WO2013023763A1

WO2013023763A1 - Bitransgenic bovine

Info

Publication number: WO2013023763A1
Application number: PCT/EP2012/003400
Authority: WO
Inventors: Germán Gustavo KAISER; Nicolas Crescendo MUCCI; Adrián Angel MUTTO
Original assignee: Instituto Nacional De Tecnologia Agropecuaria (Inta); Universidad Nacional De San Martín
Priority date: 2011-08-16
Filing date: 2012-08-09
Publication date: 2013-02-21
Also published as: AR087557A1

Abstract

Bitransgenic mammal animal capable of producing humanized milk, expression vector and methods for obtaining it. The bitransgenic non-human animal comprises, inserted in its genome, at least one nucleic acid molecule encoding a heterologous lysozyme and a heterologous lactoferrin operably linked to an expression promoter. Expression of the lysozyme and the lactoferrin is bicystronic, and the lysozyme and the lactoferrin are expressed in the mammary tissue of said non-human mammal. The heterologous lysozyme may be a human lysozyme, for example having an amino acid sequence as set forth in SEQ ID No. 1; and the heterologous lactoferrin may be a human lactoferrin, for example having an amino acid sequence as set forth in SEQ ID No. 2. The milk from the bitransgenic animal comprises human proteins.

Description

BITRANSGENIC BOVINE

DESCRIPTION

The present invention refers to a bitransgenic mammal animal that produces humanized milk, and to related transformation vectors and methods for obtaining it. More specifically, the invention refers to a bitransgenic non-human animal, comprising at least one nucleic acid molecule encoding a heterologous lysozyme and a heterologous lactoferrin operably linked to an expression promoter inserted into its genome. Expression of lysozyme and lactoferrin is bicystronic, and they are expressed in the mammary tissue of said non-human mammal. The heterologous lysozyme may be a human lysozyme, for example having an amino acid sequence as set forth in SEQ ID No. 1 ; and the heterologous lactoferrin may be a human lactoferrin, for example having an amino acid sequence as set forth in SEQ ID No. 2. Milk from the bitransgenic animal of the invention may comprise at least lOug/ml lysozyme, more specifically from 10 to 70ug/ml lysozyme. Further, milk from the bitransgenic animal may comprise at least 30ug/ml lactoferrin, more specifically from 30 to 70ug/ml lactoferrin.

BACKGROUND

Production of transgenic animals may be intended for various applications, which include generation of animals with increased performance (rapid growth), as study models for human diseases, as a source of organs for xenotransplants, to investigate genetic expression, promoter regulation and codifying sequences as well as aimed at the generation of animals for the production of proteins of interest. The production of pharmacologically useful proteins in a mammary gland system originated the term "gene-pharming" or "gene-pharm" (Keefer, C.L., Anim Reprod Sci 82-83, 5- 12, 2004). For several years, numerous research groups have successfully produced transgenic rabbits, sheep, goats, cows, and pigs expressing heterologous proteins.

One way to clone transgenic animals is by transformation of somatic cells and subsequent nuclear transfer (NT). The generation of individual transgenics by NT involves transfection of donor cells and their transfer to enucleated oocytes for reconstruction (cloning). Unlike pronuclear microinjection, where only up to 3-5% of animals born are transgenic, using the NT technique ensures that 100% of animals born are transgenic.

Cow milk lacks some important components of human milk, and such is the case of two proteins: lactoferrin and lisozyme A. The possibility of introducing human lactoferrin and lysozyme A genes into cow milk is thus of great significance for human health. Both human proteins are essential for proper development of human newborns

Advances in molecular biology technology applied to animal reproduction, together with new targeting methods for introducing genes into the genome of farm animals, have made it technically possible to obtain proteins having good expression rates in transgenics. However, there still remains a need for a simple and efficient method for producing multitransgenic animals for medical and veterinary applications. Different strategies have been used, for example crossing transgenic animals expressing different proteins. This kind of protocols is very costly as they involve long periods of time before any results are obtained (Niemann, H., Kues, W.A., 2003. Animal reproduction Science 79, 291 -317). In addition, the most frequently used techniques for obtaining transgenic animals (pronuclear injection, viral vectors, sperm-mediated transgenesis, somatic cell nuclear transfer) have very low efficiency. Although this would seem to be possible using viral vectors, the necessary use of resistance genes and multiple viral sequences for each transgenic event implies a questionable addition of non-physiological DNA to genetically modified organisms and a release of antibiotic resistance into the environment. Furthermore, the use of more than one vector for obtaining multitransgenics also involves the presence of more than one heterologous promoter, which might cause one of them to affect functionality of the other.

IRES (internal ribosome entry site) sequences were described for the first time in 1988 in polio and encephalomyocarditis viruses (Jang et al., 1988 J. Virol. 62 (8): 2636-43). These sequences provide an internal ribosome recognition site, allowing for translational initiation in the middle of a messenger RNA, as a part of the protein synthesis process. When an IRES segment is located between two open reading frames in an eukaryotic mRNA molecule (a bicystronic mRNA), it may lead to translation of a downstream protein codifying region regardless its mRNA structure. The most frequently used IRES are those from poliovirus and encephalomyocarditis virus (EMCV) (Dirks et al., 1993, Gene; 128(2): 247-9).

Regarding vector construction with an IRES fragment, translational initiation of the second cystron would successfully occur when the intercystronic region contains about 80 nucleotides, not being effective when this region contains from 300 to 400 nucleotides. However, introduction of an IRES fragment into the coding region of the first cystron stops its translation but initiates translation of the second cystron. Hennecke et al {Nucleic Acids Res., 15; 29(16): 3327-34, 2001) found that bicystronic reading frame compositions of a mRNA and the order in which they are located define cystron expression strength. Although cellular environment and nature of IRES fragments affect translation strength, the main determinants would be cystron location in mRNA and cystron sequence and/or structure.

US Patent 6, 1 18,045 discloses non-human mammals producing lysosomal proteins such as a-glycosidases. Patent document WO 1995/5024494 discloses transgenic non-human mammals expressing a human enzyme having catalytic activity producing oligosaccharides and glycoconjugates.

Patent document US 7,045,677 discloses expression of human lysozyme in mammal milk, where the lysozyme is present as a fusion protein, the second sequence or fused peptide may be calcitonin, parathyroid hormone, glucagon, glucagon-like peptide 1 , magainin, histatin, protegrin, or clavanin. Patent document US 7,045,677 discloses expression of a fusion protein in milk of transgenic mammals. The fusion protein comprises lactoferrin and another peptide selected from calcitonin, parathyroid hormone, glucagon, glucagon-like peptide 1, magainin, histatin, or clavanin.

SUMMARY OF THE INVENTION

A bitransgenic non-human mammal animal is provided, comprising at least one nucleic acid molecule encoding a heterologous lysozyme and a heterologous lactoferrin operably linked to an expression promoter inserted in its genome. Expression of lysozyme and lactoferrin is bicystronic, and they are both expressed in the mammary tissue of said non-human mammal. The promoter may be a mammary gland-specific promoter, for example a β-casein, a-casein, β-lactoglobulin promoter. The animal may be any mammal, for example mammals whose milk is used for human consumption and is capable of being humanized using the vector and process described herein, for example animals such as cattle, goats, pigs, sheep, or camelids. The heterologous lysozyme may be a human lysozyme, for example having an amino acid sequence as set forth in SEQ ID No. 1 ; and the heterologous lactoferrin may be a human lactoferrin, for example having an amino acid sequence as set forth in SEQ ID No. 2. Further, milk from the bitransgenic animal may comprise at least lOug/ml lysozyme, more specifically from 10 to 70ug/ml lysozyme. Further, milk from the bitransgenic animal may comprise at least 30ug/ml lactoferrin, more specifically from 30 to 70ug/ml lactoferrin. The invention also provides milk from a bitransgenic non-human mammal, comprising human lysozyme and human lactoferrin. Said milk comprises at least lOug/ml of human lysozyme and at least 30ug/ml of human lactoferrin.

Further, an expression vector is provided, comprising at least one mammary- tissue expression promoter operabiy linked to a DNA sequence encoding a human lactoferrin, an IRES sequence and a DNA sequence encoding a human lysozyme. The vector may contain other known regulatory sequences, for example introns, or enhancers.

The invention also provides a method for producing a non-human bitransgenic mammal, comprising: a) introducing into the genome of a somatic cell from a non- human mammal an insert comprising a mammary-tissue expression promoter operabiy linked to a DNA sequence encoding a human lactoferrin, an IRES sequence, and a DNA sequence encoding a human lysozyme, b) enucleating oocytes of a non-human mammal, c) fusing the transgenic somatic cell of step a) with the enucleated oocyte, d) activating the fused cells to form embryos, e) implanting said embryos into the uterus of a female from the same species. The process of introducing the insert may be any known process, for example lipotransfection, or electrotransfection. Preferably, the cloning process is a nuclear transfer, however, any person skilled in the art would know that it is possible to use other known processes such as, for example, pronuclear microinjection, gamete-mediated transgenesis, or virus-mediated transgenesis.

DESCRIPTION OF THE DRAWINGS

Figure 1 : Figure 1 shows the bicystronic vector (pIRES2/LF/liso) construction ;

Figure 2: Figure 2 shows the results of two Western blots for expression of human lactoferrin and lysozymes, LI and L2: transgenic lines for lactoferrin, L3 and L4: transgenic lines for lysozyme, non-functional cekNMumG, functional cel+:NMumG, C+: human milk, c-: fresh medium.

Figure 3: Figure 3 shows the results of a bitransgenic bovine filiation test, in a) Sequencing image of STR (short tandem repeat) and b) table indicating shared STR.

Figure 4: Figure 4 is an image of a calf kariotype showing insertion of the vector into the bitransgenic bovine genome.

Figure 5: Figure 5 shows Western blot results for detection of human lysozyme in milk, lane 1 : Lambda Hindlll EcoRI markers, 2: lOul of total RNA from bicystronic cow, 37ul of total RNA bicystronic cow, 4: 3ul of total RNA from bicystronic cow, 5: lOul of total RNA from cow milk, 6: 3ul of total RNA from cow milk, 7: vector bearing human lysozyme cDNA, 8: 5ul of total RNA from human milk and 9: water.

Figure 6: Figure 6 shows Western blot results for detecting human lactoferrin in milk, lane 1 : Lambda Hindlll EcoRJ markers, 2: 5ul of total RNA from bicystronic cow, 3: 2.5ul of total RNA from bicystronic cow, 4: 5ul of total RNA from cow milk, 5: 2.5ul of total RNA from cow milk, 6: 3ul of total RNA from bicystronic cow; 7: human milk, 8: vector bearing human lactoferrin cDNA and 9: water.

Figure 7: Figure 7 shows Western blot results verifying the presence of human lactoferrin in milk from a bitransgenic animal; ISA: milk from a bitransgenic animal; cow: bovine milk as negative control; Hum: human milk and 1/5: 1/5 diluted human milk.

Figure 8: Figure 8 shows Western blot results verifying the presence of human lysozyme in milk from a bitransgenic animal; I: milk from a bitransgenic animal; v: bovine milk as negative control; H: human milk.

DETAILED DESCRIPTION OF THE INVENTION

Two human genes can be introduced into the genome of a cell culture from a non-human mammal, for example a bovine, by means of a single transfection event and using a bicystronic expression vector. Using a nuclear transfer technique with somatic cells, embryos, pregnancies and birth of a double transgenic individual may be obtained, expressing the corresponding proteins at mammary gland level.

A vector capable of introducing two human genes (for example lactoferrin and lysozyme) into the genome of a bovine mammary cell line under the control of a single promoter is described. In another aspect the invention describes the use of the transformed cell line and the cloning technique by nuclear transfer to obtain embryos, pregnancies, gestations and finally a bitransgenic animal expressing both corresponding proteins at mammary gland level.

The vector optimizes the selection processes of cell lines and reduces the number of resistances to antibiotics needed to select cells transfected with more than two genes.

For example, a pIRES2-EGFP vector (Clontech Inc, USA) was used, in which the CMV promoter had been removed and a caprine β-casein promoter had been added as well as human lysozyme and lactoferrin genes. Preliminary studies were carried out involving transfection of murine mammary cells with said expression vector. Both proteins were found in the cell cultures after inducing expression using hormonal methods. It is obvious that other expression promoters may be used in mammary tissue, for example β-lactoglobulin, oc-casein , oc-lactoalbumin. In a preferred embodiment the nucleotide sequence of lysozyme in the vector is that of SEQ ID No. 3 which encodes the amino acid sequence of SEQ ID No. 1. However it is known that other human lysozyme sequences may be used, as described in National Center of Biotechnology Information (www.ncbi.nlm.nih.gov) under Access Nos.: NM 000230.2; XM 002823504.1. In a preferred embodiment the nucleotide sequence of lactoferrin in the vector is that of SEQ ID No. 4 which encodes the amino acid sequence of SEQ ID No. 2; however it is known that other human lactoferrin sequences may be used, as described in National Center of Biotechnology Information (www.ncbi.nlm.nih.gov) under Access Nos.: NP_002343.3; XM_516417.3

When the bitransgenic animal was one year and one month old, lactation was artificially induced and the presence in its milk of both proteins, human lysozyme and lactoferrin, was confirmed. As a result of these experiments it was demonstrated that the vector is functional (in vitro and in vivo) and that it is capable of introducing into the bovine genome both human genes, which are conserved throughout embryonic development, gestation and birth of the bitransgenic animal.

The present Patent Application describes the construction of a bicystronic vector. The vector is shown as a preferred embodiment in Figure 1. Any person skilled in the art knows that regulatory elements, expression elements, and other vector sequences may be modified without altering the spirit of the present invention. All obvious modifications which may be made when constructing a bicystronic vector fall within the scope of the present invention. For example, one or more copies of an insulator sequence may be included in a site immediately previous to the caprine β casein promoter. An example of insulator sequences is the 5^' region of a chicken β globin gene.

For the purpose of verifying functionality of the constructed vector, rat mammary gland epithelial cells (NMumG), a commonly used cell line in expression studies involving human breast cancer, were transfected (Wu et al, 2003, Reprod Fertil Dev 15, 231-239). Cells were grown in contact with an extracellular matrix for 5 days. During this period the cells grew as a monolayer and lost contact inhibition forming three-dimensional spherical nuclei, similar to mammary alveoli. After 10 days of culture without changing the medium, the culture was aliquoted and detection of the proteins produced by the cell line was carried out by Western blot (Figure 2). As may be observed in Figure 2, clones of transfected NMumG expressed human lactoferrin and lysozyme in functional mammals.

Subsequently, and as described in the examples, nuclear transfer was carried out using transgenic bovine fibroblasts. After 7 days of culture, 8 transferable embryos resulting from 54 fused oocyte-cell complexes (14.8% embryonic production) were obtained.

Embryo transfer was carried out in 6 previously synchronized receptor females, two underwent double transfers (two embryos per receptor female) and 4 transfers were simple. After 30 days of transfer, 2 pregnant receptor females were detected, one double and the other single, which represented 33.3 % of pregnancy (2/6) considering all transferred female receptors and 37.5 % (3/8) considering all transferred embryos. Double pregnancy was lost between the 8th and 9th months of gestation.

Delivery in bitransgenic animals was induced 5 days before the expected date by administration of 30 mg im dexamethasone and 25 mg im prostaglandin. Thirty six hours after induction, obstetric manoeuvres were carried out to determine fetal position and viability. A cesarean-section (C-section) was performed on the standing animal, by the left flank approach of the uterus. Immediately after delivery, the calf was administered 25 mg of doxapram (Viviram Holliday), and antimicrobials as a preventive rational empiric therapy. Then, weighing (45 Kg) and hygiene of upper airways were performed.

During a period of 80 days after delivery the bitransgenic animal was kept in confinement at the nursery, where it received all kind of therapies intended to diagnose and reverse each of the 26 pathological conditions observed (of a total of 69 described as the most frequently documented in bovine clones). On day 81, the calf was discharged and placed under normal life conditions according to an artificial breeding regime.

Filiation tests and FISH were performed in order to determine the phylogeny of the bitransgenic animal of the invention. Figure 3 shows the results of sequencing specific markers indicating that the bitransgenic animal is a clone from the founder Jersey cow which provided the fibroblasts. In situ fluorescent hybridization studies (FISH) were carried out to verify the presence of the vector (pIRES2/LF/liso of the invention), the number of insertions and the amount of chromosomes bearing said vector in calf genome. In Figure 4 it may be seen that the inserted vector is present as a single copy.

RT-PCR tests were performed in order to determine the presence of human lysozyme and lactoferrin transcripts in cells present in the bitransgenic animal milk. The tests are described in the examples. Figures 5 and 6 show results which clearly indicate the presence of transcripts corresponding to human lysozyme and lactoferrin. Figure 5 shows the presence of lysozyme transcripts in lane four (3μ1 of total RNA, optimal concentration) in the calf milk, whereas no lysozyme transcripts were demonstrated in the bovine milk control . Figure 6 shows the presence of lactoferrin transcripts (for example 3μ1 of total RNA, optimal concentration) in the calf milk, whereas no lactoferrin transcripts were observed in the bovine milk control.

To verify the presence of human proteins in the milk of bitransgenic calves, Western blot experiments were performed in milk. As may be seen in figures 7 and 8, by using monoclonal antibodies specific for human lysozyme and lactoferrin it was possible to detect the presence of both proteins in the milk produced by the bitransgenic animal, whereas no signal at all was detected in the milk from a bovine animal used as negative control. Bitransgenic animals produce an amount of milk from lOug/ml to 70ug/ml of human lysozyme and an amount from 30 to 70ug/ml of human lactoferrin. Human proteins found in the milk of the bitransgenic animal may be purified from said milk using for example standard procedures such as precipitation, ionic exchange, molecular exclusion or affinity chromatography (see for example Protein Purification, Springer-Verlag, N.Y., 1982)

The bitransgenic animal thus obtained and described herein provides milk comprising, for example, two human proteins with significant properties useful for the prevention of digestive tract and iron absorption disorders in infants. In other words, the bitransgenic animal provides humanized milk. This will result in an improved life quality for infants that have no access to human breast milk. Furthermore, the production of recombinant eukaryotic proteins in transgenic animals provides advantages such as the possibility of performing post-translational modifications where bacterial or yeast expression systems are deficient or absent, thus making products nonfunctional. In addition, the cost of these modified animals is extremely lower when compared to production systems in eukaryotic cell cultures. Additionally, when using this technology as a production platform, it is possible to meet high protein needs for medicinal as well as nutraceutical use, using a small number of animals. For all of the above reasons, this bitransgenic calf obtained by a cloning technique provides a safe and efficient system for producing milk with high nutritional value for humans.

This invention is better illustrated by the following examples, which should not be construed as limiting its scope. On the contrary, it should be clearly understood that other embodiments, modifications and equivalents thereof may be devised after reading the present description, by a person skilled in the art without departing from the spirit of the present invention and/or the scope of the appended claims.

Examples:

All reagents used herein, except for those specifically indicated, were obtained from Sigma Chemical Company (St. Louis, MO).

Example 1: Construction of the expression vector

A copy DNA (cDNA) of 1960 base pairs (SEQ ID No. 4, Gen Bank No.:

NM 002343) containing the human lactoferrin gene was obtained from ATCC (American Type Culture Collection). The gene was amplified from the original vector by PCR using specific oligonucleotides for human lactoferrin and subsequently cloned into the vector pGEM-T easy (Promega, MO, USA), where the oligonucleotides contained terminal recognition sequences for the enzyme Xhol (New England Biolabs, cat rO 1465).

SEQ ID No. 5: Reverse LTF: 5 ^'CTCGAGTTACTTCCTGAGGAATTC 3^'

SEQ ID No. 6: Forward LTF: 5 ^' CTCGAGATGAAACTTGTCTTCCTC 3 ^'

In addition, a cDNA from human lysozyme was obtained by RT-PCR using messenger RNA from an in vitro culture of macrophages obtained from peripheral blood as a template. Blood was obtained by venous puncture and different cell types were separated by centrifugation in Lynphoprep medium (Invitrogen, Ca, USA) at 5000rpm for 15 minutes at room temperature. Once leukocytes were collected, they were washed in culture medium (DMEM, 10% foetal calf serum, 50ug/ml gentamycin) and then grown in the same medium for a period of 5 days until morphological differentiation into macrophages was observed under the microscope (Current protocols). Then extraction of total RNA from the cells was carried out using the TRiZol protocol, according to the manufacturer's instructions. A retro-transcription reaction with the RNA was accomplished using Superscript III (Invitrogen) at 42 degrees for an hour. Then a PCR was performed with TAQ platinum (Invitrogen) and using the DNA copy previously generated as a template with specific primers for

Human lysozyme.

Primer sequences:

SEQ ID No. 7: Forward Lysozyme: 5 ^'CTCGAGATGAAGGCTCTCATTGTT3 ^'

SEQ D No. 8: Reverse Lysozyme: 5 ^'CTCGAGAGTTACTACACTCCACAACCT3 ^'

Thus a fragment of 436 base pairs was obtained corresponding to the complete coding sequence of the human lysozyme gene (SEQ ID No. 3), which was cloned into the pGEM-T vector and, as in the first case, two restriction sequences, a Mscl forward restriction sequence and a Eagl reverse restriction sequence (NEB, cat: r05345 and r05055) were added to the primers.

The construction for expression in mammary gland was accomplished using the pIRES2-EGFP vector (Clontech inc, USA), from which the CMV promoter was removed and a caprine β-casein promoter obtained from the Milk vector expression system of Invitrogen Corp by PCR with Platinum TAQ DNApol (Gibco), using primers containing an Asel forward restriction sequence and a Nhel reverse restriction sequence

(NEB, cat r05265 and r01315, respectively) .

Primer sequences for b casein

SEQ ID No. 9: Forward B-casein: 5 ^' ATTATTGTCAGTGAGGATGGGGCTGGA3 ^'

SEQ ID No. 10: Reverse B-casein: 5 ^' GCTAGCAATGATCTGATTTAGTGGCTG 3 ^'

Since in most cases, ribosomal recognition of mRNA is mediated through a consensus sequence (Kozak sequences), the latter was added to an oligonucleotide used for amplifying one of the genes of interest and thus achieving the correct expression of the genes of interest. Figure 1 shows the final construction used with the inserted genes

(plRES2/LF/liso). The nucleotide sequence of SEQ ID No. 1 1 corresponds to the complete sequence of the pIRES2 LF/liso vector of the invention

The presence of the insert and its correct orientation in the constructs were verified by PCR with vector oligonucleotides and by automated sequencing with the same primers as previously mentioned used for orientation of SEQ ID No. 5, SEQ ID

No. 6, SEQ ID No. 7, and SEQ ID No. 8. The vector was propagated and kept in E. coli

Top Ten (Invitrogen, Ca, USA).

Example 2: In vitro expression of the expression vector Normal epithelial cells from mammary gland of rat, NMumG at American Type Culture Collection (ATCC) No.: CRL-1636, were obtained. These cells were grown in DMEM (Gibco, Invitrogen, Ca, USA) with 10% SFB (HyClone, UT, USA) and 50μg/ml gentamycin sulphate at 37°C and 99% humidity. The cells were transfected in culture with Lipofectamine 2000 (Invitrogen, Ca, USA) according to the manufacturer's specifications. For this purpose, 5 μg of DNA and 2 μΐ, of Lipofectamine 2000 were mixed in 100 μΐ of OptiMEM without antibiotics, and incubated for 4 hours at 38.5°C. After this, transfection complexes were removed by changing the medium on the culture plate. Culture plate wells were covered with 50mg/cm² of Matrigel™ Basement Membrane Matrix (Becton Dickinson, Franklin Lakes, NJ, USA), which is a extracellular matrix protein extract from mouse sarcoma. Transfected cells were seeded at a concentration of lxlO⁶ cells/ml on 6-well plates covered with Matrigel, and 10μg/ml Prolactin, 10μg/ml Insulin and ^g/ml dexamethasone were added to the culture medium.

Western blot (in vitro cells). Expression vector in vitro functionality assay

Cells transfected with the construction containing lactoferrin and lysozyme genes were grown in differentiation medium (DMEM, 10% SFB, 50μg/ml gentamycin, 10μg/ml Prolactin, 10μg/ml Insulin, and ^g/ml dexamethasone) for 10 days with no change of medium. Protein detection was carried out with 100 μΐ of culture medium from different plates, which were mixed with a seeding solution for proteins. Membranes were incubated with primary rabbit anti-human lactoferrin and rabbit anti- human lysozyme antibodies (Dako, Cytomation, USA) at a dilution of 1/3000 in TBS solution with 5% milk for 2 hours, then they were washed three times in TBS Tween 20 solution (TBS, 0,05% Tween 20). An anti-rabbit antibody produced in goat was used as a secondary antibody. Detection was accomplished using the Supersignal West Pico Chemiluminiscent kit (Pierce, USA), and development on Kodak radiographic film (Kodak, Japan).

Example 3: Transgenesis

Preparation of a primary culture of bovine cells

A biopsy taken from the ear of a Jersey cow was introduced into high glucose

DMEM medium (Gibco), 5 % SFB and 50ug/ml Gentamycin, 25ug/ml Fungizone, 0.01 % Polyvinil alcohol) at 20 °C. Primary cultures were obtained by mechanical tissue disgregation as described in Current Protocols in Cell Biology {Current Protocols in Cell Biology (1998) 2.1.1 -2.1.12) and Baldassarre et al., Reproduction, fertility, and development 16, 465-470, with some modifications. Each tissue fragment was placed in a 100mm Petri dish (Nunc), and covered with a coverslip, followed by the addition of 10 ml of complete growth medium (DMEM, 15 % SFB (Hyclone, New Zealand), 2x Antibiotics (Pen-Strep lOOx, Gibco, Ca, USA), and \0 i%lm\ Nystatin (Gibco)). The plate containing the explants were grown during 10 days at 38.5°C, 5% C0₂ and 99% humidity, with change of culture medium every four days. Once optimum confluence was reached, they were washed with fresh medium and a 0.5% solution of Trypsin (Gibco) was added, and further incubated at room temperature for 10 minutes. After treatment with trypsin, the cells were washed with growth medium and resuspended in 90% SFB and 10% DMSO and kept in liquid nitrogen until use.

Transfection of bovine cells

The bovine cells thus obtained were cultured in growth medium (DMEM, 15% SFB (Hyclone), 50μg/ml gentamycin). When 70% confluence was reached, the growth medium was replaced by OptiMem (Gibco) and after 4 hours cells were transfected in culture with Lipofectamine 2000 (Invitrogen, Ca, USA) following the manufacturer's specifications. To this end, 5 μg of DNA and 2 μΐ,, of Lipofectamine 2000 were mixed in 100 μί, of OptiMEM without antibiotics, and incubated for 4 hours at 38.5°C.

Somatic cell nuclear transfer (cloning)

Collection of enucleated bovine oocytes

Bovine oocytes were obtained by follicular puncture of slaughterhouse ovaries. Ovaries were transported to the laboratory in a thermos containing sterile physiological solution at 20 °C, washed in PBS with antibiotics and their follicles were punctured with a 21 G needle to collect the follicular liquor. Oocytes were recovered from the follicular liquid under a stereoscopic magnifier, classified and introduced in maturation medium (TCM-199 with addition of 10% foetal calf serum and rh-FSH) in a C02 oven (38.5°C, 5% C02 in air and saturation humidity, Sanyo MCO 17 Al, Japan). After 16 hours of maturation, oocytes were denuded from their cumulus oophurus cell coverage by physico-enzymatic methods (vortexing and hyaluronidase) and enucleation was performed on those oocytes showing an appropriate nuclear maturation (oocytes with polar bodies) according to the method described by Keefer et al., (2000) Biology of Reproduction 64: 849-856, using a Nikon Eclipse TE-300 inverted microscope and Nikon-Narishige NT 88 V3 micromanipulators (Nikon, Japan). Nuclear transfer and fusion

One transfected cell (recombinant fibroblast from a Jersey cow) was transferred into each enucleated oocyte using the technique of somatic cell nuclear transfer (Wilmut et al., Nature 385: 810-3, 1997). Then oocyte membranes were fused with membranes from the transfected cells (fibroblasts) by a pulse of 2kV/cm for 20 microseconds (BTX EC 830, Harvard Apparatus, USA). Fusion was assessed after one hour, and the procedure was repeated in non-fused oocytes-cells.

Activation, culture and transfer to recipient animals

After fusion of oocytes, they are activated using ionomycin (5μΜ; 4 minutes) and 6-dimethylaminopurine (6-DMAP, Sigma) (2mM, 4 hours), according to the Melican method (2005). Embryos were grown in a C02 oven at 38.5° C, 5% C02, 5% 02 and 90% N and saturation humidity (Sanyo MCO 175M, Japan) during 7 days in SOF (synthetic oviductal fluid) medium. Embryos obtained by the 7^th day of culture were transferred to previously synchronized female receptors.

Synchronization of female recipients, embryo transfer and pregnancy determination

Muciparous Aberdeen Angus cows were used as embryo recipients of transgenic clones, and kept at the experimental field of ΕΕΑ-ΓΝΤΑ Balcarce. Estrus synchronization was accomplished by double injection, 11 days apart, of 2 ml IM prostaglandin F2a. Embryo transfer was performed on day 7 post-estrus detection, previous determination of the presence of a corpus luteum. Ultrasonographic pregnancy determination was performed within 30 days after embryo transfer using an Aloka 500 apparatus (Japan). After confirming pregnancies by ultrasound, monthly evaluations to determine foetal size and viability, and early detection of frequently reported problems in pregnancies of clones (hydroallantois, placental oedema, etc.) were performed.

Birth and neonatal monitoring

A Neonatology Unit was mounted at EEA-INTA Balcarce, considering that production and subsequent transfer of embryos produced in vitro by nuclear transfer generate high-risk pregnancies, births and calves, which was equipped with the necessary items to meet the needs of such animals. Further, considering that they were genetically modified animals, the above-mentioned infrastructure was designed and equipped as provided under resolution 240 of the Ministry of Agriculture, Livestock and Fishery [Ministerio de Agricultura, Ganaderia y Pesca de la Nacion], prior approval by the National Commission of Agricultural Biotechnology [Comision National de Biotecnologia Agropecuaria] (CONABIA).

Filiation test

In order to confirm that the animal descended from the transfected cells, a bovine paternity test was performed using the StockMarks® for Cattle Bovine Genotyping Kit (Applied Biosystem, Ca, USA) based on detection of 1 1 microsatellites using an AB1 Prism 3730 automated sequencer (Applied Biosystem, Ca, USA). The markers used in this test are authorized by the l.S.A.G. (International Society of Animal Genetics).

Genomic DNA extraction was carried out using extraction columns according to the manufacturer's protocol (Qiamp mini Kit, Qiagen, Germany), with a peripheral blood sample collected with a Vacutainer® (BD, USA). One hundred ng of genomic DNA were taken and two multiplex PCRs were carried out with the purpose of amplifying the corresponding markers for each animal.

Markers used for filiation of the clones (Stork Marks, Applied Biosystem) and PCR cycle used for amplification of the markers.

The amplification products were purified and analyzed with an automated sequencer; then the results were processed using the Data Collection and Gene Mapper v 0.4 software (Applied Biosystems, Ca, USA). In situ Fluorescent Hybridization (FISH) to confirm the expression vector in the animals

An in situ hybridization test using the expression vector as a probe was perfomed to confirm the integration site and number of insertions. This was done by digestion of l(^g of the expression vector with the DNase I enzyme and a replication reaction of fragments (nick translation) with polymerase I from E. coli was carried out using nucleotides labeled with Rhodamine fluorophore (dCTP-Rhodamine). The cell treatment was the same as that used for karyotyping. Cell lines of fibroblasts were grown in the presence of 50 g/ml colchicine (Colcemid, Gibco) for 4 hours, after which they were resuspended and washed with hypotonic solution (KC1 0.05M). Then, hey were mounted on slides and washed by direct dripping; Carnoy solution was used for fixation (3: 1 methanokacetic acid). Hybridization of probes was carried out on cell smears fixed on slides. Visualization was performed with an Eclipse 2000s microscope (Nikon, TK, Japan) using filters for Rhodamine and DAPI.

Artificial Induction of Lactation

To determine the presence of the human proteins in milk, lactation was artificially induced when the calf was one year and one month old. The protocol used to this end is described below:

manual milking

Day 22 Start manual milking

Day 23 Mechani cal milking

Day 24 Mechani cal milking

Milking was performed by hand twice a day (morning and afternoon) during 60 days, taking test samples on day 57. Subsequently, lactation was discontinued and each quarter was sealed using a commercial product (bovigam®-lactation BAYER) to prevent possible infections by milk overload.

RT-PCR confirming the presence of lysozyme and lactoferrin transcripts in of bitransgenic animal milk cells

One hundred ml of milk from the bitransgenic animal and 100 ml of bovine milk were centrifuged to obtain a pellet consisting of desquamated epithelial cells. After obtaining the pellet, it was resuspended in 2 ml of TriZol buffer (Invitrogen), following the manufacturer's protocol, and total RNA was extracted. Subsequently, 400ul of chloroform was added, it was centrifuged for 15 min at 4°C. Then, the supernatant was collected and 0.7 volumes of isopropanol were added. This was followed by centrifugation at 12000 rpm for 15 min at 4°C. The pellet thus obtained was hydrated with 75% ethanol and centrifuged for 5 min at 12000 rpm. After this, the pellet was dried and resuspended in R Aase-free milliQ water.

Retro-transcription and amplification reactions were performed in one step using the One Step RT-PCR kit (Invitrogen) with platinum TAQpol. Samples were treated following the manufacturer's instructions and two cycles were performed for each messenger RNA to be detected. Firstly, specific primers for human proteins were used for lactoferrin, the same for lactoferrin and lysozyme (SEQ ID Nos. 5, 6, 7, and 8) and thermocycling and reaction mixtures were: Reagents Mixture

RNA 5ul

2X reaction mixture 25ul

Forward primer (lOmM) lul

Reverse primer (lOmM) lul

TAQ 2ul

Water 16ul

lactoferrin

55°— 30min

94°..

94°.... 1 sec

¹ 40 ciclos

58°—^■ 30sec

68°- — 2min

68°— 5min

68°— lmin

68°— 5min

Amplification fragments were separated on 1 .5% agarose gel in TBE buffer (Tris borate EDTA) and detected using ethidium bromide (lmg/ml).

Western blot in milk. Assessment of human proteins in milk from the bitransgenic animal

After obtaining milk from the bitransgenic animal a Western blot test was carried out using anti lactoferrin human (ABcam, cat ab 109000) and anti human lysozyme (ABcam cat 91653) monoclonal antibodies, both generated in rabbit anti- human proteins of interest. Milk samples, from the calf of interest as well as controls (bovine milk) were separated using polyacrylamide gel, SDS page 12% in running buffer (5X: glycine 72g, Tris 15g, SDS 5g in 1 liter of water) at 90 volts for 2 hours. Then, proteins were transferred from the gel to a nitrocellulose membrane (Millipore, USA), using Mini sub cell vessel (Biorad, USA) by electrotransfer at a 25mA current in a transfer medium (3X: Tris 9.09g, Glycine 43.2 g, Methanol 600 ml, 3 Lts water) for 2 hours. The membrane was rinsed several times and then it was blocked using TBS (50mM Tris-HCl pH 7.6 and 150mM NaCl) with 5% Fish Gelatin and 2% normal horse serum during 1 hour under agitation. Then it was incubated with primary anti human lactoferrin and lysozyme monoclonal antibodies in TBS 3% Fish Gelatin for 1 hour, and thereafter incubation was performed with a secondary of goat anti rabbit antibody labeled with horseradish peroxidase (Sigma) in TBS 3% fish gelatin, for a period of one hour. After washing with TBS 0, 1 % Tween 20, detection was accomplished using the Supersignal West Pico Chemiluminiscent kit (Pierce, USA), and finally development on Kodak radiographic film (Kodak, Japan).

Claims

27 CLAIMS

1. A bitransgenic non-human mammal animal, comprising at least one nucleic acid molecule encoding a heterologous lysozyme and a nucleic acid molecule encoding a heterologous lactoferrin operably linked to an expression promoter inserted in its genome, wherein expression of the lysozyme and the lactoferrin is bicystronic, and said lysozyme and said lactoferrin are expressed in the mammary tissue of said non- human mammal.

2. The animal according to claim 1 , wherein the promoter is a mammary gland-specific promoter.

3. The animal according to claim 2, wherein the promoter is a β-casein promoter.

4. The animal according to claim 1, wherein said animal is selected from the group consisting of cattle, goats, pigs, sheep and camelids.

5. The animal according to claim 1, wherein the lysozyme is human lysozyme.

6. The animal according to claim 5, wherein the lysozyme comprises an amino acid sequence as set forth in SEQ ID No. 1.

7. The animal according to claim 1, wherein the lactoferrin is human lactoferrin.

8. The animal according to claim 7, wherein the lactoferrin comprises an amino acid sequence as set forth in SEQ ID No. 2.

9. The animal according to claim 1, wherein the nucleic acid molecule encoding the heterologous lysozyme comprises SEQ ID No. 3.

10. The animal according to claim 1, wherein the nucleic acid molecule encoding the heterologous lactoferrin comprises SEQ ID No. 4

1 1. The animal according to claim 1, wherein lysozyme concentration in milk from the non-human mammal is of at least lOug/ml.

12. The animal according to claim 1, wherein lactoferrin concentration in milk from the non-human mammal is of at least 30ug/ml.

13. Milk of a bitransgenic non-human mammal, comprising human lysozyme and human lactoferrin. 28

14. The milk according to claim 13, comprising at least l Oug/ml of human lysozyme.

15. The milk according to claim 13, comprising at least 30ug/ml of human lactoferrin.

16. An expression vector, comprising at least one mammary tissue expression promoter operably linked to a DNA sequence encoding a human lactoferrin, an IRES sequence, and a DNA sequence encoding a human lysozyme.

17. The vector according to claim 16, wherein the promoter is a β-casein promoter.

18. The vector according to claim 16, wherein the DNA sequence encoding a human lactoferrin is SEQ ID No. 4 and the DNA sequence encoding a human lysozyme is SEQ ID No. 3.

19. A method for producing a bitransgenic non-human mammal, comprising: a) introducing into the genome of a somatic cell from a non-human mammal an insert comprising a mammary-tissue expression promoter operably linked to a DNA sequence encoding a human lactoferrin, an IRES sequence, and a DNA sequence encoding a human lysozyme, b) enucleating oocytes of a non-human mammal, c) fusing the transgenic somatic cell of step a) with the enucleated oocyte, d) activating the fused cells to form embryos, e) implanting said embryos into the uterus of a female from the same species.

20. The method according to claim 19, wherein the DNA sequence encoding a human lactoferrin encodes the amino acid sequence of SEQ ID No. 2 and the DNA sequence encoding a human lysozyme encodes the amino acid sequence of SEQ ID No. 1.