WO2012168743A2 - Bacteria - Google Patents

Bacteria Download PDF

Info

Publication number
WO2012168743A2
WO2012168743A2 PCT/GB2012/051319 GB2012051319W WO2012168743A2 WO 2012168743 A2 WO2012168743 A2 WO 2012168743A2 GB 2012051319 W GB2012051319 W GB 2012051319W WO 2012168743 A2 WO2012168743 A2 WO 2012168743A2
Authority
WO
WIPO (PCT)
Prior art keywords
cell
electrogenic
micro
organism
host cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2012/051319
Other languages
French (fr)
Other versions
WO2012168743A3 (en
Inventor
Stephen R.P. JAFFÉ
Gregory J.S. FOWLER
Ana G. PEREIRA-MEDRANO
Phillip C. WRIGHT
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Sheffield
Original Assignee
University of Sheffield
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Sheffield filed Critical University of Sheffield
Publication of WO2012168743A2 publication Critical patent/WO2012168743A2/en
Publication of WO2012168743A3 publication Critical patent/WO2012168743A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • HELECTRICITY
    • H01ELECTRIC ELEMENTS
    • H01MPROCESSES OR MEANS, e.g. BATTERIES, FOR THE DIRECT CONVERSION OF CHEMICAL ENERGY INTO ELECTRICAL ENERGY
    • H01M8/00Fuel cells; Manufacture thereof
    • H01M8/16Biochemical fuel cells, i.e. cells in which microorganisms function as catalysts
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02EREDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E60/00Enabling technologies; Technologies with a potential or indirect contribution to GHG emissions mitigation
    • Y02E60/30Hydrogen technology
    • Y02E60/50Fuel cells

Definitions

  • the invention relates to improved electrogenic bacteria and microbial fuel cells comprising these bacteria which have improved power densities. Methods of obtaining such bacteria are also disclosed.
  • Microbial Fuel Cells are devices in which electrogenic micro-organisms such as bacteria grow on an anode and export electrons (reducing equivalents) to it, while oxidising organic substrates such as acetate to carbon dioxide.
  • a reduction typically of oxygen to water
  • Protons flow between the two electrodes, normally through a proton exchange membrane or a phase boundary.
  • Figure 1 shows such an arrangement.
  • the membrane also serves to keep oxygen out of the anode chamber, as the presence of oxygen here would inhibit the anode reactions.
  • the anode and cathode are connected by a wire containing a load (a device being powered or, in the laboratory setting, a resistor).
  • the current produced by the MFC can be calculated by monitoring the voltage drop across the resistor.
  • the power output of a MFC is usually stated as power density according to the surface area of the anode (W/m 2 or A m 2 ), so that different devices can be compared.
  • MFCs have the potential to address two markets: energy generation and waste water/effluent treatment/bioremediation.
  • Waste water treatment plants use a significant amount of electrical power, mainly for aeration and pumping - from 400kW up to 2,500kW per m 3 /s. It has been calculated that the energy content of the waste water for one plant was nine times the power required to run it (Logan (2008) Chapter 9 "Microbial Fuel Cells", Pub. Wiley, ISBN: 978-047023948-3). There is, therefore, a significant incentive for power recovery from water treatment plants (including black and grey water systems). MFCs offer a viable option to achieve this with high Coulombic efficiency. Furthermore, MFCs can offset the cost of some of the stages of treatment that are currently necessary before streams can be discharged into the environment, due to the breakdown of waste organic compounds (perhaps in combination with an anaerobic digestion system).
  • MFCs have several advantages over anaerobic digesters for some applications, notably the fact that the energy is recovered directly as electricity rather than in the form of biogas that needs to be separated and, if electricity is desired, burned in a heat engine.
  • a MFC can produce 3kWh for every kilogram of organic matter compared to the 1 kWh of electricity and 2 kWh of heat produced during biomethanation (Aelterman et al. (2006) Water Sci. Technol. 54 9-15).
  • high Coulombic efficiencies have been achieved previously from MFCs but only under very carefully optimised conditions.
  • MFCs have been studied for many years but are only just beginning to achieve commercialisation in quite limited fields; the most significant reason for this is low power densities, especially with practical, mixed substrates such as are likely to be found in real applications, rather than a single laboratory feedstock.
  • Metabolically versatile organisms allow for a wide range of organic substances to be completely oxidised to C0 2 under a diverse variety of conditions and, potentially very importantly, under a wide range of temperature conditions. This is unlike anaerobic digesters, which must operate under defined conditions and are greatly impeded by variations in temperature. However, it may be effective to run MFCs and digesters together as a combined treatment plant.
  • DMRB Dissimilatory metal reducing bacteria
  • a culture of species such as these forms a biofilm on the anode. Understanding the mechanisms by which the DMRB transfer their electrons to the anode provides us with the ability to increase their electrogenic activity. Electron transfer from the metabolic centres of the cell, via the outer membrane cytochromes and any surface organelles to an external electrode (or other electron acceptor) is complex, and numerous proteins are implicated in the chain. There are currently three known ways by which this electron transfer occurs:
  • Exogenous mediators cells use exported mediators that allow them to transfer their electrons to an intermediate molecule which then diffuses to the anode. This has not been as thoroughly documented as the other methods of electron transfer, but several Shewanella species have recently been recognised as secreting electron shuttles in the form of flavin mononucleotide that can then reduce Fe (III). This may provide a route for electron transport to the anode.
  • the present inventors have developed a suite of genes which, when transferred from a naturally electrogenic organism to a naive host (i.e., an organism lacking or largely lacking the relevant electrogenic functions), achieved a significant improvement in current in a microbial fuel cell.
  • a naive host i.e., an organism lacking or largely lacking the relevant electrogenic functions
  • This provides a combination of benefits, all of which are important for microbial fuel cells, for example, higher power density, greater range of substrates, good growth rate and robustness of culture.
  • an electrogenic micro- organism host cell comprising, preferably transformed or transfected with, at least one heterologous electrogenic pathway gene.
  • heterologous electrogenic pathway gene indicates a gene which is an exogenous gene, i.e., not native to the micro-organism host cell of the invention, the gene encoding for a protein involved in electron transfer within a naturally occurring electrogenic micro-organism which is different to the host cell, or encoding for a protein involved in electron transfer from such a naturally occurring micro-organism to an external body such as another cell or, particularly, an electrode in a MFC or half-cell.
  • the gene may also encode a portion of such a protein, for example where several genes are utilised to form a whole active protein.
  • the gene is a gene for which reducing or knocking out its activity in the naturally occurring electrogenic micro-organism would result in the reduction or elimination of electrogenic activity of the naturally occurring electrogenic micro-organism. Therefore, the invention represents the result of introducing at least one heterologous (i.e., exogenous) gene to a host cell, the gene(s) conferring electrogenic properties to a non-electrogenic cell and/or conferring improved electrogenic properties (i.e., increased power density when the cell is used in a MFC) to a cell having existing electrogenic capabilities.
  • the invention provides an electrogenic micro-organism host cell in which an electrogenic pathway gene is overexpressed, i.e. overexpressed compared to a naturally occurring host cell.
  • the electrogenic pathway gene encodes a nucleic acid molecule or polypeptide endogenous to the cell.
  • naturally-occurring refers to a polypeptide sequence that occurs in nature or to a nucleic acid molecule, e.g. a RNA or DNA molecule having a nucleotide sequence that occurs in nature (e.g., encodes a natural protein).
  • Said nucleic acid molecules include an open reading frame encoding protein, and can further include non-coding regulatory sequences and introns.
  • said overexpression is achieved by providing the cell with at least one further copy of an electrogenic pathway gene.
  • electroactive micro-organism indicates a micro-organism which is capable of transferring electrons to the surface of an anode in a microbial fuel cell. Therefore, when the micro-organism is grown under anaerobic conditions in the anode chamber of a MFC, a current will be measurable in the MFC from which a power density can be calculated.
  • a suitable anode may be a carbon anode (e.g., carbon fibre, brush or graphite, with or without lacing with platinum), or an anode formed from a precious metal or a metal oxide (e.g., Indium Tin Oxide).
  • “Host cell” as used herein refers to the particular subject cell and also to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
  • the micro-organism host cell may be, for example, a bacterium or a yeast.
  • the micro-organism is a gram-negative bacterium, for example (but not limited to) a bacterium from the genera Geobacter, Shewanella or is an Escherichia coli strain.
  • the bacterium comprises a Type II secretion pathway to enable the correct localisation of electrogenic pathway proteins (such as the gene OmcA and homologues, orthologues and paralogues thereof (e.g., NapC in E. coli) on the outer membrane of the bacterium.
  • heterologous refers to a polypeptide or nucleic acid sequence which is not present or naturally occurring within a host cell.
  • heterologous polynucleotide or polypeptide may comprise a nucleic acid sequence which is identical or partially homologous to an endogenous nucleic acid or amino acid sequence of sequence of the cell.
  • endogenous refers to any polypeptide or nucleic acid sequence which is present and/or naturally occurring in a host cell.
  • the host cell for use in the expression system of the present invention may be an aerobic cell or alternatively a facultative anaerobic cell.
  • the cell is a bacterial cell.
  • the cell may be a yeast cell (e.g. Saccharomyces, Pichia), an algae cell, an insect cell, or a plant cell.
  • Bacterial host cells include Gram-positive and Gram- negative bacteria. Suitable bacterial host cells include, but are not limited to the Gram-negative bacteria, for example a bacterium of the family Enterobacteria, most preferably Escherichia coli. E. coli is the most preferred bacterial host cells for the present invention. Expression in £ coli offers numerous advantages over other expression systems, particularly low development costs and high production yields.
  • Cells suitable for high protein expression include, for example, E.coli W31 10, the B strains of E.coli. E.coli BL21 , BL21 (DE3), and BL21 (DE3) pLysS, pLysE, DH1 , DH4I, DH5, DH5I, DH5IF', DH5IMCR, DH10B, DHIOB/p3, DH1 IS, C600, HB101 , JM101 , JM105, JM109, JM1 10, K38, RR1 , Y1088, Y1089, CSH18, ER1451 , ER1647 are particularly suitable for expression.
  • £ coli K12 strains are also preferred as such strains are standard laboratory strains, which are non-pathogenic, and include NovaBlue, JM109 and DH5a (Novogen®), £ coli K12 RV308, £. coli K12 C600, £ coli HB101 , see, for example, Brown, Molecular Biology Labfax (Academic Press (1991 )).
  • the host cell is a bacterium of the family Proteobacteria, most preferably Geobacter.
  • the host cell is a bacterium of the family Shewanellaceae, most preferably Shewanella.
  • the micro-organism may comprise at least one cytochrome maturation gene, for example a heterologous or endogenous gene selected from at least one of the Shewanella oneidensis MR-1 genes Mtr-A, MtrB, MtrC, MtrD, MtrE, MtrF or OmcA and/or at least one of the Geobacter sulferreducens genes OmcS (UniProt accession no. D7AKN5) and/or OmcZ (UniProt accession no. D7AL56).
  • a heterologous or endogenous gene selected from at least one of the Shewanella oneidensis MR-1 genes Mtr-A, MtrB, MtrC, MtrD, MtrE, MtrF or OmcA and/or at least one of the Geobacter sulferreducens genes OmcS (UniProt accession no. D7AKN5) and/or OmcZ (UniProt accession
  • the electrogenic pathway gene as mentioned above may be selected from any of these S. oneidensis MR-1 and G. sulferreducens genes.
  • the micro-organism is transformed or transfected with a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:1 or portions or fragments thereof.
  • the micro-organism is transformed or transfected with a nucleic acid sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of the nucleotide sequence shown in SEQ ID NO:1 or portions or fragments thereof.
  • the micro-organism is transformed or transfected with a nucleic acid molecule that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of the nucleotide sequence shown in SEQ ID NO:1 or portions or fragments thereof, and at least one nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of a nucleotide sequence of SEQ ID NO: 2, 3, 4, 5, 6 or 7 or portions or fragments thereof.
  • the micro-organism is transformed or transfected with a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:2 or portions or fragments thereof.
  • the micro-organism is transformed or transfected with a nucleic acid sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of the nucleotide sequence shown in SEQ ID NO:2 or portions or fragments thereof.
  • the micro-organism is transformed or transfected with a nucleic acid molecule that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of the nucleotide sequence shown in SEQ ID NO:2 or portions or fragments thereof, and at least one nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of a nucleotide sequence of SEQ ID NO: 1 , 3, 4, 5, 6 or 7 or portions or fragments thereof.
  • the micro-organism is transformed or transfected with a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:3 or portions or fragments thereof.
  • the micro-organism is transformed or transfected with a nucleic acid molecule comprising a nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, identical to the entire length of the nucleotide sequence of SEQ ID NO:3 or portions or fragments thereof.
  • the micro-organism is transformed or transfected with a nucleic acid molecule that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of the nucleotide sequence shown in SEQ ID NO:3 or portions or fragments thereof, and at least one nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of a nucleotide sequence of SEQ ID NO: 1 , 2, 4, 5, 6 or 7 or portions or fragments thereof.
  • the micro-organism is transformed or transfected with a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:4 or portions or fragments thereof.
  • the micro-organism is transformed or transfected with a nucleic acid molecule comprising a nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, identical to the entire length of the nucleotide sequence of SEQ ID NO:4 or portions or fragments thereof.
  • the micro-organism is transformed or transfected with a nucleic acid molecule that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of the nucleotide sequence shown in SEQ ID NO:4 or portions or fragments thereof, and at least one nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of a nucleotide sequence of SEQ ID NO: 1 , 2, 3, 5, 6 or 7 or portions or fragments thereof.
  • the micro-organism is transformed or transfected with a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:5 or portions or fragments thereof.
  • the micro-organism is transformed or transfected with a nucleic acid molecule comprising a nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, identical to the entire length of the nucleotide sequence of SEQ ID NO:5 or portions or fragments thereof.
  • the micro-organism is transformed or transfected with a nucleic acid molecule that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of the nucleotide sequence shown in SEQ ID NO:5 or portions or fragments thereof, and at least one nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of a nucleotide sequence of SEQ ID NO: 1 , 2, 3, 4, 6 or 7 or portions or fragments thereof.
  • the micro-organism is transformed or transfected with a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:6 or portions or fragments thereof.
  • the micro-organism is transformed or transfected with a nucleic acid molecule comprising a nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, identical to the entire length of the nucleotide sequence of SEQ ID NO:6 or portions or fragments thereof.
  • the micro-organism is transformed or transfected with a nucleic acid molecule that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of the nucleotide sequence shown in SEQ ID NO:6 or portions or fragments thereof, and at least one nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of a nucleotide sequence of SEQ ID NO: 1 , 2, 3, 4, 5 or 7 or portions or fragments thereof.
  • the micro-organism is transformed or transfected with a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:7 or portions or fragments thereof.
  • the micro-organism is transformed or transfected with a nucleic acid molecule comprising a nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, identical to the entire length of the nucleotide sequence of SEQ ID NO:7 or portions or fragments thereof.
  • the micro-organism is transformed or transfected with a nucleic acid molecule that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of the nucleotide sequence shown in SEQ ID NO:7 or portions or fragments thereof, and at least one nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of a nucleotide sequence of SEQ ID NO: 1 , 2, 3, 4, 5 or 6 portions or fragments thereof.
  • the S. oneidensis MR-1 gene MtrA may also be expressed in the micro-organism.
  • the recombinant micro-organisms as herein before described may comprise, i.e. be transformed or transfected with, a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:9 or portions or fragments thereof.
  • the micro-organism comprises a nucleic acid molecule comprising a nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, identical to the entire length of the nucleotide sequence of SEQ ID NO:9 or portions or fragments thereof.
  • micro-organism may also be transformed or transfected with the Goebacter OmcS gene. Accordingly, the recombinant micro-organisms as herein before described may further comprise, i.e. be transformed or transfected with, a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:16 or portions or fragments thereof.
  • the micro-organism comprises a nucleic acid molecule comprising a nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, identical to the entire length of the nucleotide sequence of SEQ ID NO: 16 or portions or fragments thereof.
  • the micro-organism comprises a nucleic acid molecule that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of the nucleotide sequence shown in SEQ ID NO:16 or portions or fragments thereof, and at least one nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of a nucleotide sequence of SEQ ID NO: 1 , 2, 3, 4, 5, 6, 7 or 9 portions or fragments thereof.
  • micro-organism may also be transformed or transfected with the Goebacter OmcZ gene. Accordingly, the recombinant micro-organisms as herein before described may further comprise, i.e. be transformed or transfected with, a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:17 or portions or fragments thereof.
  • the micro-organism comprises a nucleic acid molecule comprising a nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, identical to the entire length of the nucleotide sequence of SEQ ID NO: 17 or portions or fragments thereof.
  • the micro-organism comprises a nucleic acid molecule that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of the nucleotide sequence shown in SEQ ID NO:17 or portions or fragments thereof, and at least one nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of a nucleotide sequence of SEQ ID NO: 1 , 2, 3, 4, 5, 6, 7 or 9 portions or fragments thereof.
  • sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes).
  • the length of a reference sequence aligned for comparison purposes is at least 30%, preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, and even more preferably at least 70%, 75%, 80%, 82%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the length of the reference sequence.
  • the amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared.
  • amino acid or nucleic acid “identity” is equivalent to amino acid or nucleic acid "homology”).
  • the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
  • the comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm.
  • the percent identity between two amino acid sequences is determined using the Needleman et al. (1970) J. Mol. Biol. 48:444-453) algorithm which has been incorporated into the GAP program in the GCG software package (available at http://www.gcg.com), using either a BLOSUM 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1 , 2, 3, 4, 5, or 6.
  • the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (available at http://www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1 , 2, 3, 4, 5, or 6.
  • a particularly preferred set of parameters are a BLOSUM 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.
  • the percent identity between two amino acid or nucleotide sequences can be determined using the algorithm of Meyers et al. (1989) CABIOS 4:1 1 -17) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
  • Specific combinations may comprise: all of MtrA-F (for example, arranged in the order D, E, F, C, A, B; SEQ ID NO:10); all of MtrA-F and OmcA (together known as MR-1 , SEQ ID NO:9); MtrDEF (SEQ ID NO:8); MtrDEF and OmcA; MtrFCAB (SEQ ID NO:14); MtrABC (for example, arranged in the order C, A, B; SEQ ID NO:15); OmcA and MtrCAB (SEQ ID NO: 18).
  • the micro-organism may also comprise cytochrome maturation genes, either naturally or within an exogenous expression vector such as, for example, pEC86 and/or pRGK333.
  • pEC86 comprises the ccmABCDEFGH cytochrome maturation genes, and is not IPTG inducible (see Arslan et al, 1998, Biochemical and Biophysical Research Communications 747:744- 747).
  • pRGK333 also comprises the ccmABCDEFGH cytochrome maturation genes, and is IPTG-inducible (see Feissner R et al, 2006, Mol. Microbiol. 60:563-577).
  • the electrogenic micro-organism according to the invention may be characterised in that, when in use in a microbial fuel cell, a greater power density is obtainable or obtained from the microbial fuel cell compared to the power density obtainable from a microbial fuel cell comprising an equivalent host cell which does not comprise the heterologous electrogenic pathway protein.
  • the term "equivalent host cell” means the strain of micro-organism in the form prior to the introduction of the at least one heterologous electrogenic pathway gene. Therefore, the electrogenic micro-organism according to the invention provides a means for improving the power density of microbial fuel cells, since the micro-organisms are more readily able to transfer electrons to an anode in a MFC than an equivalent cell before the addition of the electrogenic pathway gene.
  • power density refers to the amount of power (time rate of energy transfer) per unit volume.
  • a microbial fuel cell comprising an electrogenic micro-organism according to the first aspect of the invention.
  • this provides improvements on the microbial fuel cells of the prior art, since improved power outputs can be provided in cells utilising microorganisms which are not naturally occurring.
  • micro-organisms can be used which are relatively easy to grow in culture compared to naturally electrogenic cells and/or which are better understood by the skilled person for use industrially and/or in the laboratory.
  • E. coli strain cells may be particularly useful, for example.
  • the electrogenic activities of naturally occurring bacterial strains such as Shewanella or Geobacter strains may be improved by the introduction of one or more additional heterologous electrogenic pathway genes.
  • the term "fuel cell” refers to an electrochemical unit that converts chemical energy into an electrical current.
  • the electric current is generated through chemical reactions using a substrate, which is oxidized in the presence of an electron producing catalyst.
  • the oxidation typically occurs at an anode.
  • the electrons cannot pass through the electrolyte medium, and thus, are shunted through an electrical circuit.
  • an electrical current is generated by the transfer of electrons from an anode to a cathode.
  • the reaction products are formed at the cathode.
  • microbial fuel cell “MFC”, ⁇ ” and “microMFC” are used inetrchangably to refer to a bio-electrochemical system that drives a current by mimicking bacterial interactions found in nature.
  • Micro-organisms catabolize substrates, such as glucose, acetate, butyrate or wastewater and thereby generate electrons.
  • the electrons gained from this oxidation are transferred to an anode, where they are shunted through an electrical circuit to the cathode. Here they are transferred to a high potential electron acceptor such as oxygen.
  • a high potential electron acceptor such as oxygen.
  • the microbial fuel cell may be characterised in that, in use, the power density is greater than the power density obtained in an equivalent microbial fuel cell comprising a host cell equivalent to the micro-organism according to the first aspect of the invention but not comprising the heterologous electrogenic pathway gene or protein.
  • the improvement in power density may be at least about 30% or more compared to the power density from a MFC comprising the micro-organism not comprising the heterologous electrogenic pathway gene or protein, preferably at least about 50%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 750%, 1000%, 1500%, 2000%, 2500%, or at least about 3000% or more.
  • an expression vector comprising one or more of the polynucleotide sequences of the expression constructs pACYCOmcA (SEQ ID NO:1 1 ), pACYCMtrDEF (SEQ ID NO: 12), pACYCMR-1 (SEQ ID NO: 13) and/or pACYCOmcA-MtrCAB (SEQ ID NO: 18), or an electrogenic protein encoding variant thereof.
  • pACYCMR- 1 is used to describe the pACYC Duet-1 plasmid with the MtrA-F and OmcA polynucleotide sequences inserted.
  • the specific order of the genes within pACYCMR-1 is MtrDEF, OmcA, MtrCAB.
  • electrogenic protein encoding variant thereof encompasses fragments of these expression vectors which represent at least one electrogenic pathway gene as defined above, i.e., a gene encoding for a protein involved in electron transfer within a naturally occurring electrogenic bacterium, or involved in electron transfer from such an electrogenic bacterium to an external body such as an electrode.
  • the expression vector comprises a nucleotide sequence of SEQ ID NO:1 1 or portions or fragments thereof.
  • the micro-organism comprises a nucleic acid molecule comprising a nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, identical to the entire length of the nucleotide sequence of SEQ ID NO:1 1 or portions or fragments thereof.
  • the expression vector comprises a nucleotide sequence of SEQ ID NO:12 or portions or fragments thereof.
  • the micro-organism comprises a nucleic acid molecule comprising a nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, identical to the entire length of the nucleotide sequence of SEQ ID NO:12 or portions or fragments thereof.
  • the expression vector comprises a nucleotide sequence of SEQ ID NO:13 or portions or fragments thereof.
  • the micro-organism comprises a nucleic acid molecule comprising a nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, identical to the entire length of the nucleotide sequence of SEQ ID NO: 13 or portions or fragments thereof.
  • the term "vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • the vector can be capable of autonomous replication or it can integrate into a host DNA.
  • the vector may include restriction enzyme sites for insertion of recombinant DNA and may include one or more selectable markers.
  • the vector can be a nucleic acid in the form of a plasmid, a bacteriophage or a cosmid.
  • the vector is suitable for bacterial expression, e.g. for expression in E. coli.
  • the vector is capable of propagation in the bacterial cell and is stably transmitted to future generations.
  • the design of the expression vector depends on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, and the like.
  • the expression vectors of the invention can be introduced into host cells to thereby produce proteins or polypeptides, including fusion proteins or polypeptides, encoded by nucleic acids as described herein (e.g., the Shewanella oneidensis MR-1 genes, MtrA, MtrB, MtrC, MtrD, MtrE, MtrF and OmcA).
  • the vector comprises those genetic elements which are necessary for expression of the specified nucleic acid molecules in a bacterial cell.
  • the elements required for transcription and translation in the bacterial cell include a promoter, a coding region for the specified nucleic acid molecules, and a transcriptional terminator.
  • genes described in this aspect of the invention may also encode a portion of such a protein, for example where several genes are utilised to form a whole active protein.
  • variant polynucleotide sequences comprising any substitution of, variation of, modification of, replacement of, deletion of, or addition of one or more nucleic acid(s) from or to a polynucleotide sequence described herein, providing the resultant polypeptide sequence encoded by the polynucleotide is unchanged, for example because of the degeneracy of the genetic code.
  • the variants also encompass genes which are homologues, orthologues or paralogues to those specifically described herein, for example, genes from other genera or strains or bacteria.
  • Variant polynucleotide sequences include, therefore, allelic variants and also include a polynucleotide (a "probe sequence") which substantially hybridises to an electrogenic pathway gene as used in the invention and/or to one of the expression constructs listed above, for example, because the "probe" sequence is complementary to the electrogenic pathway gene sequence. Such hybridisation may occur at or between low and high stringency conditions.
  • low stringency conditions can be defined as hybridisation in which the washing step takes place in a 0.330-0.825 M NaCI buffer solution at a temperature of about 40-48°C below the calculated or actual melting temperature (T m ) of the probe sequence (for example, about ambient laboratory temperature to about 55°C), while high stringency conditions involve a wash in a 0.0165-0.0330 M NaCI buffer solution at a temperature of about 5-10°C below the calculated or actual T m of the probe sequence (for example, about 65°C).
  • the buffer solution may, for example, be SSC buffer (0.15M NaCI and 0.015M tri-sodium citrate), with the low stringency wash taking place in 3 x SSC buffer and the high stringency wash taking place in 0.1 x SSC buffer. Steps involved in hybridisation of nucleic acid sequences have been described for example in Sambrook et al. (2001 ).
  • an electrogenic micro-organism comprising expressing in a host cell at least one of the Shewanella oneidensis MR-1 genes MtrB, MtrC, MtrD, MtrE, MtrF or OmcA and/or at least one of the Geobacter sulferreducens genes OmcS and/or OmcZ or variants thereof as hereinbefore described.
  • the expressing may comprise transforming the host cell with a nucleic acid comprising a polynucleotide sequence of at least one of the genes MtrB, MtrC, MtrD, MtrE, MtrF, OmcA, OmcS and/or OmcZ.
  • the method may comprise transforming the host cell with the expression vector pOmcA and/or pACYCOmcA and/or pACYCMtrDEF as hereinbefore described.
  • the method may further comprise transforming the host cell with a nucleic acid comprising a polynucleotide sequence of the gene MtrA as hereinbefore described.
  • the method may comprise transforming the host cell with at least one expression vector according to the third aspect of the invention.
  • the method may comprise transforming the host cell with one or more of the expression constructs pOmcA, pACYCOmcA, pACYCMtrDEF, pACYCMR-1 and/or pACYCOmcA- MtrCAB as hereinbefore described.
  • pOmcA as used throughout this specification, relates to a constitutive expression plasmid of OmcA, where OmcA is the Shewanella oneidensis MR-1 OmcA outer membrane cytochrome. OmcA localises to the outer membrane upon heterologous expression in E. coli BL21 and can reduce Fe (III) to Fe (II) outside the cell (Donald et al., 2008).
  • the method may additionally comprise transforming the host cell with a polynucleotide comprising one or more cytochrome maturation genes, e.g. the MR-1 genes Mtr-A, MtrB, MtrC, MtrD, MtrE, MtrF or OmcA, or OmcS and/or OmcZ as herein before described, for example in expression vectors pEC86 and/or pRGK333.
  • suitable genes may be present in the host cell genome or in one or more other expression vectors.
  • the method may further comprise the step of confirming that the host cell is an electrogenic micro-organism (or is a more electrogenic micro-organism) after expressing the one or more genes in said cell, by using the host cell in a microbial fuel cell and determining that the power density obtainable in the microbial fuel cell is greater than the power density obtainable in an equivalent microbial fuel cell comprising an equivalent host cell not comprising the one or more genes.
  • the host cell may be a yeast or bacterium, for example a bacterium of the genera Geobacter or Shewanella, or wherein the host cell is an Escherichia coli cell.
  • a suitable Escherichia coli strain may be BL21 and derivatives, such as strains carrying a DE3 region.
  • the singular encompasses the plural unless the context otherwise requires.
  • the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise. Preferred features of each aspect of the invention may be as described in connection with any of the other aspects.
  • Figure 1 is a diagram of a Microbial Fuel Cell showing electrogenic micro-organisms growing on the anode, with air bubbled into the cathode chamber to provide dissolved oxygen for reactions at the cathode;
  • Figure 2 is a diagram of a Half Cell which has been used in the experiments described herein;
  • Figure 3 shows the predicted metal reducing c-type cytochromes in S. oneidensis MR-1 ;
  • Figure 4 shows the map for plasmid pACYCDuet-1 (Novagen).
  • Figure 5 compares the power density in MFCs comprising £ coli BL21 DE3 pEC86 pOmcA cells or £ coli BL21 DE3;
  • Figure 6 compares the current density in MFCs comprising £ coli BL21 DE3 cells, K12 pEC86 pMtrA cells, BL21 DE3 pEC86 pOmcA cells or S. oneidensis MR-1 cells;
  • Figure 7 compares the power density in MFCs comprising £. coli BL21 DE3 cells comprising various plasmids and constructs, or S. oneidensis MR-1 cells;
  • Figure 8 shows the power density in a half cell comprising £ coli BL21 DE3 pACYCMR-1 cells, compared to that in a half cell comprising £ coli BL21 DE3 pACYCDuet-1 cells;
  • Figure 9 shows an SDS-PAGE gel of proteins from BL21 (DE3) cells and BL21 (DE3) cells comprising pOmcA, with lane 1 showing size standards, lane 2 the proteins in supernatant from a BL21 DE3 cell culture, lane 3 the proteins in supernatant from a BL21 DE3 pEC86 pOmcA cell culture, lane 4 the soluble protein fraction of BL21 DE3 cells, lane 5 the soluble protein fraction of BL21 DE3 pEC86 pOmcA cells, lane 6 the insoluble protein fraction of BL21 DE3 cells and lane 7 the insoluble protein fraction of BL21 DE3 pEC86 pOmcA cells;
  • Figure 10 shows: (A) Two of the plasmids used herein; pRGK333, an IPTG inducible £ coli cytochrome maturation protein over-expression plasmid (Feissner et al. 2006) and the Shewanella cytochrome expression plasmid pACYCOmcA-MtrCAB (S) Heterologously-synthesised decaheme cytochromes (MtrA-C and OmcA from Shewanella oneidensis MR-1 ) potentially involved in the transfer of electrons for the novel £. coli strains. (C refers to cytoplasm, P to periplasm, and ES to extracellular space).
  • Figure 1 1 provides schematic diagrams and photographs of the electrogenic activity testing devices used herein.
  • A Schematic representation of the microfluidic microbial fuel cell.
  • S Photograph of the MFC.
  • C Schematic diagram of the sedimentary half cell. The circular anodes are arranged at the base of the cell to allow potentially electrogenic bacteria to form a layer or a biofilm.
  • D Photograph of the sedimentary half cell containing a dense bacterial culture.
  • Figure 12 shows the maximum power density (mW/m 2 ) attained within the microbial fuel cell.
  • (1 ) Growth medium only - LB + lactate + 0.5mM IPTG.
  • Figure 13 shows Western blots using polyclonal antibodies for MtrC, MtrA, and OmcA to detect cytochromes proteins present within the sample supernatants.
  • Fig 14 provides picologger readings from the M9 minimal media half cell test of BL21 DE3 pRGK333 pACYCOMCA and BL21 DE3 pRGK333 pACYCOMCA-MtrCAB
  • Fig 15 provides a continuation of picologger readings from Figure 14 the M9 minimal media half cell test of BL21 DE3 pRGK333 pACYCOMCA and BL21 DE3 pRGK333 pACYCOMCA-MtrCAB
  • Fig 16 shows activity of BL21 DE3 pRGK333 pACYCOmcA and BL21 DE3 pRGK333 pACYCOmcA-MtrCAB within half cells following roughly 8 days (1 1700 mins total incubation time, shown as 8500 in Fig.
  • Figure 17 provides power densities of S. oneidensis MR-1 strains grown in LB media compared to LB media alone. Peak average power density were measured in microMFCs (see text) for (a) LB medium; (b) Empty plasmid pBBRI MCS in S. oneidensis; and (c ) pBBR1 MCS:OmcA in S. oneidensis
  • Figure 18 shows SEQ ID NO:1
  • FIG. 19 shows SEQ ID NO:2
  • Figure 20 shows SEQ ID NO:3
  • Figure 21 shows SEQ ID NO:4
  • Figure 22 shows SEQ ID NO:5
  • Figure 23 shows SEQ ID NO:6
  • Figure 24 shows SEQ ID NO:7
  • Figure 25 shows SEQ ID NO:8
  • Figure 26 shows SEQ ID NO:9
  • Figure 27 shows SEQ ID NO:10
  • Figure 28 shows SEQ ID NO:1 1
  • Figure 29 shows SEQ ID NO:12
  • Figure 30 shows SEQ ID NO:13
  • Figure 31 shows SEQ ID NO:14
  • Figure 32 shows SEQ ID NO:15
  • Figure 33 shows SEQ ID NO:16
  • Figure 34 shows SEQ ID NO:17
  • Figure 35 shows SEQ ID NO:18
  • the decahaem outer membrane c-type cytochrome OmcA gene (SEQ ID NO:1 ) from
  • S. oneidensis MR-1 was inserted into a pUNI-PROM vector (Donald et al. (2008) J. Bacteriol. 190 5127-5131 ) that allowed for constitutive expression from a tat promoter, to form the construct pOmcA.
  • the cytochrome maturation genes were considered essential for the expression of the cytochrome and so the plasmid pEC86 (Thony-Meyer et al. (1995) J. Bacteriol. 177 4321 -4326) was used, carrying genes that encode for cytochrome c maturation (Ccm) proteins.
  • the constructs were transformed into BL21 (DE3) E. coli cells.
  • the cells were taken from a selective antibiotic agar plate and transferred to a 100 mL liquid culture of Luria Bertani (LB) media. This was done with a final concentration of 20 ⁇ g mL Chloramphenicol (Cm) and 40 ⁇ g mL Ampicillin (Amp). This was left for 16 hours at 37°C, with agitation at a rate of 180 rpm. 1 mL of the dense culture was then used to inoculate a fresh 100 mL of LB with Cm and Amp at the same concentrations. This culture was held at 37°C, 180 rpm for 16 hours and 30 mL of this culture was tested in MFCs as outlined below.
  • LB Luria Bertani
  • the sites chosen for the insertion of the gene fragments into pACYCDuet-1 were the Ascl and Notl sites present within MCS1 .
  • the genes were cloned into the plasmid using T4 DNA ligase from Promega (Southampton, UK) and transformed into E. coli DH5oc cells from Invitrogen (Paisley, UK). The cells were plated out onto 20 ⁇ g ml Cm LB agar plates.
  • the DNA collected from the positive colonies was transformed into BL21 DE3 to allow for expression of the proteins within an IPTG inducible strain.
  • Single colonies were picked off the plates and transferred into 100 ml LB media with 20 ⁇ g ml Cm and left at 37°C, 180 rpm for 16 hours.
  • 1 ml of the developed culture was taken and used to inoculate 100 ml of LB media, again with the same antibiotics and left at 37°C, 180 rpm until it reached an OD 6 oo of 0.4.
  • the S. oneidensis gene expression vectors were transformed into cells along with the plasmid pRGK333 instead of pEC86.
  • pRGK333 carries the genes for cytochrome c maturation, with the difference that pRGK333 is an inducible plasmid, so that the timing of the "switching on" of gene expression can be controlled.
  • Microbial Fuel Cells comprising transformed cell cultures
  • Protocol 1 A single colony of the transformed BL21 DE3 strain was taken and added to 10 ml LB plus 20 ⁇ g ml Chloramphenicol and 40 ⁇ g ml Ampicillin in a 50 ml falcon tube. This was put in a shaking incubator at 37°C, 180 rpm for 16 hours. 1 ml of this culture was taken and added to a fresh 10 ml of LB with the same concentration of antibiotics and allowed to grow for 16 hours under the same conditions as the starter culture.
  • IPTG IPTG was used for unduction, 1 ml of the first culture was taken and added to a fresh 100 ml of LB with the same concentration of antibiotics and allowed to grow until an OD 6 oo of 0.5 was achieved under the same conditions as the starter culture. At this point, IPTG was added to the culture to give a final concentration of 0.5mM and the flask was moved to 25°C, 150rpm overnight. Next day, the OD 6 oo of all cultures was noted, using LB as a blank and the culture was spun down at 2800 rpm for 10 min. The supernatant was removed and the culture was gently resuspended in fresh LB to an OD 6 oo of 5. The volume of liquid required for the correct OD was obtained using the following calculations:
  • the answer from the second calculation provides the number of ml of fresh LB that the pellet needs to be resuspended in to give an OD 6 oo of 5.
  • Protocol 2 (referred to as the "2nd setup" in Figure 7): A single colony of the transformed BL21 DE3 strain was taken and added to 10 ml LB plus 20 ⁇ g/ml Chloramphenicol and 100 ⁇ g/ml Ampicillin in a 50 ml Falcon tube. This was put in a shaking incubator at 37°C, 180 rpm for 16 hours. 1 ml of this culture was taken and added to a fresh 100 ml of LB with the same concentration of antibiotics and allowed to grow until an OD 6 oo of 0.5 was achieved under the same conditions as the starter culture. At this point, IPTG was added to the culture to give a final concentration of 0.5mM and the flask was moved to 37°C, 150rpm overnight.
  • a suitable MFC device was constructed from using pure carbon fibre veil (PRF Composite Materials, Poole, U.K.) cut into 2 x 10 mm oblongs with the total surface area being 200 mm 2 .
  • the PEM was a made to order Nafion membrane with a carbon and platinum cathode side (Ion Power Inc, Delaware, USA). Both the anode and cathode sections had a 1 mm x 2 mm section of copper tape attached to provide a conductive appendage for attachment to an interface and resistance box and then data acquisition device.
  • 200 ⁇ of the OD 6 oo 5 culture was then extracted using a 1 ml syringe and injected into the MFC device and into the anode chamber.
  • the device was then connected to the resistance box by attaching crocodile clips to the conductive copper tape of each compartment.
  • the data acquisition began as soon as the clips were attached with the resistance set at 33 ⁇ until the samples had stabilised.
  • the resistance of the samples was then decreased every 500 seconds in the following increments with readings noted before each change: 33 ⁇ , 15 ⁇ , 5 ⁇ , 2 ⁇ , 1 ⁇ , 470 ⁇ , 200 ⁇ and 100 ⁇ .
  • a single colony of cells transformed with pACYCMR-1 were picked from a transformation plate, transferred into 100 ml of LB with 20 mg/ml Cm and grown at 37°C for 16 hours at 180 rpm. 1 ml of this starter culture was used to inoculate a fresh 100 ml of LB along with 20 mg/ml Cm. This was again grown at 37°C for 16 hours at 180 rpm until an OD 6 oo of 0.4 was reached. The expression of the proteins was then induced using 1 mM IPTG and cells were grown under the same conditions for the remainder of their 16 hour growth.
  • the OD 6 oo of the culture was checked after 16 hours of incubation and the cells were split into two 50 ml Falcon tube containers and spun down in a centrifuge at 2800 rpm for 10 mins. The supernatant from this was expelled and the remaining cell pellet was resuspended in the volume of LB required in order to make the final OD of the culture to 5.0. 10 ml of this culture was then added to a half cell as shown in Figure 2, containing 200 ml LB. The total volume of the half cell was made up to 250 ml using a volume of IPTG providing a 1 mM final concentration, 20 mg/ml Cm and the remainder was made up using LB.
  • a red rod Ag/AgCI reference electrode (Radiometer analytical) was then inserted into each half cell and sealed using silicone sealant to provide a micro aerobic environment.
  • the half cells were then connected to the same data connectors as the MFC device described above and stored in a water bath at 37°C. Data was collected using the same software.
  • Figure 8 shows the results for a culture of cells transformed with pACYCMR-1 compared to cells transformed with the empty plasmid pACYCDuet-1 .
  • the Figure demonstrates that cells comprising the MR-1 gene cluster have an increased negative potential value.
  • the wet weight of a cell pellet from a 15ml culture of the target strain was measured, and the same weight of glass beads (425-600microns) was added, plus 0.5ml of wash buffer (150mM NaCI, 100mM Tris-HCI and 1 mM EDTA, pH8.0). This was vortexed in a bead beater for three sessions of 1 minute, being placed on ice between beatings. The lysate was obtained by centrifugation (13,000rpm for 15min) and contained the soluble proteins, and was stored at -20°C.
  • the remaining cell pellet contained the insoluble proteins, and was resuspended in 150 ⁇ of a buffer made up of 6M urea, 150mM NaCI, 100mM Tris-HCI and 1 mM EDTA, incubated on ice for 1 hour and then centrifuged (13,000rpm for 30min). The second supernatant containing the insoluble proteins was removed and stored at -20°C.
  • the protein bands obtained after 1 -D gel electrophoresis were cut out and the proteins embedded in the gel matrix were digested using trypsin as described by Gan et al., (Proteomics (2005) 5 2468-2478). Briefly, the Instant Blue stain was washed away using distilled water. The proteins were reduced and alkylated using dithiothreitol and alkylated using iodoacetamide (IAA). The proteins in the gel matrix were subject to trypsin digestion overnight in the presence of ammonium bicarbonate and acetonitrile. The peptides were eluted from the gel matrix using repeated washing with formic acid, ammonium bicarbonate and acetonitrile. The peptides were dried using a vacuum concentrator ((Concentrator 5301 , Eppendorf, UK) and stored at -20°C.
  • a vacuum concentrator (Concentrator 5301 , Eppendorf, UK) and stored at -20°C.
  • the peptides were separated on a PepMap C-18 RP capillary column (LC Packings) with a constant flow rate of 0.3 ⁇ _/ ⁇ " ⁇ with a linear gradient elution using buffer A (3% acetonitrile and 0.1 % formic acid) and buffer B (97% acetonitrile and 0.1 % formic acid); starting with 3% buffer A up to 35% buffer B over 45 min.
  • Data acquisition was set in the positive ion mode with a mass range of 300- 2,000m/z. Tandem mass spectrometry was performed on peptides with +2, +3 and +4 charge states. Identifications were made using the complete protein database of
  • Shewanella oneidensis MR-1 genes used were amplified using PCR, from genomic DNA obtained from the organism. The genes were ligated into pACYCDuet- 1 (Novagen) or pRSFDuet-1 (Novagen); for the full list of primers, plasmids and strains constructed see Tables S1 -3.
  • plasmids were simultaneously transformed into BL21 (DE3) (Invitrogen) alongside pRGK333 (a plasmid coding for inducible cytochrome maturation genes).
  • the extraction of the protein fractions was carried out using a metalloprotein extraction procedure modified from Novagen's Strep « Tactin® Purification Kit User Protocol. Briefly, glass beads (acid washed Sigma 0.5mm) were added to the bacterial cell pellet in 0.5-1.5ml extraction buffer (150mM NaCL, l OOmM Tris-Hcl, 1 mM EDTA, pH8.0, with added Roche 'Complete' EDTA-minus antiprotease solution). For the insoluble protein samples, urea was added to a final concentration of 6M. Samples were put in a bead beater for 3 x 1 min, keeping the samples cold by occasional immersion in ice, and then spun at 13K at 4°C for 10-30min. The soluble and insoluble cell fractions were both obtained from the same cell pellet via repeated glass bead cracking.
  • Selected peptides for analysis by pseudo-selective reaction monitoring (Pandhal et al., 201 1 , Biotechnol. Bioeng. 108, 902-12) for insoluble and soluble fractions ) were chosen from previous MS/MS protein identifications of S. oneidensis MR-1 protein extracts, via an Agilent Ultimate 3000 HPLC system) coupled with an HCT Ultra PTM Discovery ESI-lon Trap MS/MS (Bruker Daltonic, Coventry, UK).
  • pSRM pseudo-selective reaction monitoring
  • a polarization curve was carried out to determine the maximum power density of the engineered strains by applying an external resistance which was decreased every 300 s.
  • the initial starting resistance was 1 1 1 kQ, gradually decreasing to 1.1 1 kQ over 16 steps. Data obtained was then analyzed using Microsoft Excel.
  • the Ni/Ti wire was fed through a small hole of the lid and the end of the reference electrode came through a similar hole.
  • Aquarium Silicone Sealant was used to seal any gaps left in the lid (Aquatics Online Ltd, Bridgend, UK) after it was tightly screwed.
  • the completed half cell was then transferred to a 37°C water bath and connected up to the computer via an ADC-24 A-D converter computer interface (Pico technology Ltd., Cambridgeshire, U.K.). Readings were taken every min for 900 mins, with data being analyzed on Microsoft Excel.
  • Escherichia coli is the model prokaryotic organism for synthetic biology techniques, with a vast number of studies documenting both heterologous expression of functional proteins and the introduction of foreign pathways (Yadav and Stephanopoulos 2010, Curr. Opin. Microbiol. 13, 371 -376). This versatile organism was chosen not only for these reasons, but also because functional expression of S. oneidensis MR-1 c-type cytochromes in £ coli has been shown to be possible for reduction of Fe (III) (Donald et al., 2008, J. Bacterial. 190, 5127-31 ).
  • MtrCAB and OmcA The highly conserved metal reduction genes within a large proportion of Shewanella species are MtrCAB and OmcA (James K Fredrickson et al., 2008, Nat. Rev. Microbiol. 6, 592- 603). These four proteins provide an electron transport pathway between the periplasm and insoluble extracellular terminal electron acceptors, all coded by genes located within a single operon on the genome.
  • the inventors In order to channel electrons from the intracellular quinone pool to the periplasm, the inventors relied on the £ coli host inner membrane electron donors as previously seen (Pitts et al., J. Biol. Chem. 278, 27758-27765). The main hub of this activity was presumed to have originated from the £. coli ortholog of the S.
  • oneidensis inner membrane tetraheme cytochrome CymA namely NapC
  • Some level of plasticity has been demonstrated within this network with residual iron reduction ability of MtrA in a ANapC mutant (Jensen et al. 2010, Proc. Natl. Acad. Sci USA 107, 19213-8).
  • the new construct relies on over-expression of cytochrome maturation genes and the type II secretion pathway found in B- type strains, both of which have been shown to be vital in previous experiments in which S. oneidensis outer membrane cytochromes were expressed (Donald et al., 2008, J. Bacteriol. 190, 5127-31 )).
  • the inventors constructed 3 plasmids in which cytochrome gene expression was under the regulation of a 77 lac promoter.
  • the plasmids were pACYCOmcA ⁇ OmcA), pACYCOmcA-MtrCAB ⁇ OmcA-MtrCAB) and pRSFOmcA-MtrCAB (see Figure 10A) (Table S1.).
  • oneidensis cytochromes due to the lack of expression of the equivalent maturation genes within E. coli under aerobic growth conditions (Thony-Meyer et al. 1995, J. Bacteriol. 177, 4321 -4326).
  • cells of all redundant strains were induced using 0.5 mM IPTG once they had reached an OD 6 oo of 0.5 to allow sufficient time for full expression.
  • Cell pellets of the aerobically grown strains were collected and fractionated into soluble and insoluble fractions and resolved by SDS-PAGE. The supernatant collected from the harvested cell pellets was concentrated by acetone precipitation to allow the analysis of secreted proteins.
  • Table 1 provides an analysis of engineered E. coli strains with the portable electron transporter assembly.
  • the proteins identified are from the Mtr operon of S. oneidensis MR-1 through the use of Auto MS(n) and/or HPLC-ESI-pSRM (pseudo- selective reaction monitoring - see text) MS/MS, after resolving protein extractions via 1 D SDS-PAGE.
  • a Phenyx AC score of at least 5.0 and maximum p-value of 1 x10 ⁇ 5 were considered an unambiguous identification.
  • Brackets indicate the number of unique peptides from the total number identified.
  • MtrC, MtrA, and OmcA were used to carry out Western blots in order to detect cytochromes proteins present within the sample supernatants (Figure 13).
  • OmcA was detected in the soluble, insoluble (through pSRM) and supernatant fractions, using Western blots for pACYCOmcA, showing the truly ubiquitous nature of this protein.
  • OmcA was found in the insoluble and supernatant fractions for pACYCOmcA-MtrCAB.
  • MtrCAB were all found in the insoluble fraction for pACYCOmcA-MtrCAB through the use of pSRM, with MtrA and B also being detected in the soluble fraction.
  • a microfludic-scale MFC ⁇ MFC was chosen due to its many advantages: easy assembly, high power density per unit area, and utility for high throughput analysis of a wide number of strains (Ringeisen et al. 2006, Environ. Sci. Technol. 40, 2629-34).
  • the main disadvantage of the ⁇ MFC is that long-term growth is unfeasible.
  • the bacterial strains were each tested within the ⁇ .
  • a longer term analysis was carried out using a sedimentary fuel cell in which the negative redox potential generated by the bacterial culture was measured over 18 h (1080 min).
  • a photograph and schematic diagram of the apparatus is shown in Fig.
  • the engineered strain containing pRSFOmcA-MtrCAB was capable of generating power within the ⁇ , with a power output of ca. 17 mW m "2 .
  • This strain had a power output 6.4 mW m "2 higher than the control bearing the empty parent plasmid pACYCDuet-1 in combination with the overexpressed cytochrome maturation genes.
  • Statistical analysis of the MFC results through the use of an unpaired i-test helped to confirm validity of this result by providing a p-value of 0.0017 at a 95% confidence interval.
  • This strain also produced a power output 5 mW/m 2 higher than pACYCOmcA, showing the requirement for more than a single ubiquitously expressed cytochrome to be able to achieve a higher power output.
  • the functional interaction between a more complete electrogenic pathway in the form of OmcA-MtrCAB appears to be key to allowing £ coli to produce current more efficiently.
  • OmcA-only and OmcA-MtrCAB cluster bacterial samples showed OmcA was always present in the supernatant. It is possible that vesicle-bound OmcA proteins are involved in electron transport maybe via bound flavins (Johs et al., 2010, Biophys. J. 98, 3035-43), and that the vesicles act as some sort of transport system to the anode surface.
  • the inventors demonstrate here the introduction of electrogenic activity into a functionally redundant organism and that this effect is not device specific ( Figure 12).
  • the inventors also show that the robustness of the portable synthetic electron conduit genes is independent of the two plasmids employed in this study. Although both of these plasmids make use of the high-level expression T7 promoter, the copy number of the plasmids is significantly different, yet both engineered strains had similarly increased electrogenic capabilities.
  • the chloramphenicol resistance plasmid pACYCDuet-1 uses a p15a origin of replication yielding 15-20 copies per cell compared to the over 100 copies produced with the kanamycin resistance plasmid pRSFDuet-1 (Tolia and Joshua-Tor, 2006, Nat. Methods 3, 55-64). This is the first exemplification of the introduction of electrogenic ability into a redundant strain through the use of modern synthetic biology techniques. The presence of extracellular cytochromes indicates the possibility of some level of mediator function.
  • strains BL21 DE3 pRGK333 pACYCOmcA and BL21 DE3 pRGK333 pACYCOmcA-MtrCAB were both tested in a half cell using minimal media.
  • M9 minimal media with 0.4% carbon source which was chosen as sodium lactate, as is the standard in the field of Bioelectrochemical systems.
  • carbon source e.g. glycerol, glucose, etc.
  • Shewanella (S.) oneidensis MR-1 Wild Type (WT) was conjugated with E. coli S17 strain having the plasmid of interest in order to infect and introduce said plasmid into S. oneidensis MR-1 WT.
  • pBBRI MCS empty and pBBR1 MCS:OmcA plasmids were transformed into E. coli SM strain prior the bacterial conjugation using standard biological techniques.
  • An overnight culture of S. oneidensis MR-1 (MR-1 ) at 25 ° C and 150 rpm was prepared by selecting an individual colony from a plate of LB agar with the aid of a sterilized wire loop and inoculating it in 10 mL of LB.
  • an overnight culture of both transformed E. coli S17 strains was prepared also by selecting an individual colony from a plate of LB agar with the aid of a sterilized wire loop and inoculating it in 10 mL of LB + streptomycin + antibiotic for plasmid selection (Chloramphenicol in the case of pBBRI MCS). Next day, the cells were harvested by centrifugation (4000 rpm for 10 min) and wash the cell pellets twice with sterilised PBS to remove antibiotics. Each cell pellet was resuspended in 0.5 mL PBS and then mixed together.
  • a suitable micro-microbial fuel cell (MicroMFC) device was constructed from using pure carbon fibre veil (PRF Composite Materials, Poole, U.K.) cut into 2 x 10 mm oblongs with the total surface area being 200 mm 2 .
  • the PEM was a made to order Nafion membrane with a carbon and platinum cathode side (Ion Power Inc, Delaware, USA). Both the anode and cathode sections had a 1 mm x 2 mm section of copper tape attached to provide a conductive appendage for attachment to an interface and resistance box and then data acquisition device.
  • MicroMFC tests for MR-1 pBBRI MCS empty and MR-1 pBBR1 MCS:OmcA in LB media were carried out.
  • an overnight culture of MR-1 pBBRI MCS empty and MR-1 pBBR1 MCS:OmcA at 25 ° C and 150 rpm was prepared by selecting an individual colony from a plate of LB agar with the aid of a sterilized wire loop and inoculating it in 10 mL of LB plus Chloramphenicol (Cm). 1 mL of each overnight culture was sub-cultured in 100 mL LB plus Cm and grown overnight at 25 ° C and 150 rpm. Next day, the Optical Density (OD) at 600nm using a spectrophotometer was taken of both cultures, and then diluted with fresh LB plus antibiotics to an OD 6 oo 1 -0 plus 5 mM sodium lactate.
  • OD Optical Density
  • the culture was injected respectively into the six anodic chambers of the microMFCs and weighed accordingly to determine the rough cell weight within each of the channels.
  • 200 ⁇ - of the OD 6 oo 1 -0 cell suspension were used to inoculate each anodic chamber.
  • the anode and cathode chambers were connected to an interface box.
  • the readings from the MFCs are taken by a Picolog ADC 24 analogue to digital voltage recorder (Pico technology, Cambridgeshire, UK).
  • the computer was then set to record using Picologger software, noting the voltage in each channel every second.
  • the MFCs were left at open channel (no applied load) for 2 hours to allow the samples to settle within the chambers.
  • the polarisation curves are generated by connecting the microMFC up to a decade resistance box (Farnell, U.K.) set at a starting resistance of 100 kQ and decreasing in steps of 10 kQ down to 10 kQ. The resistance was then decreased by steps of 2 kQ down to 2 kQ and moved a single kQ down to 1 kQ. The final set of resistance changes were from 1 kQ to 200 ⁇ in 200 ⁇ decrements. The MFCs were left for at least 300 seconds between each resistance change to allow to cell voltage to level out. Recorded data was then analysed using Microsoft Excel.
  • the cell pellet was dislodged with a pipette tip and then vortexed for 30 s. Cell samples were then vortexed for 1 min at max speed, 1 min on ice, repeated 3 times. The samples were then spun down at 13,000 rpm for 15 min and the supernatant containing the soluble protein fraction carefully transferred to a fresh LoBind tube and stored at -20°C for future use. Extraction of Insoluble Protein Fractions
  • the remaining cell pellet from the soluble protein fraction extraction was then used to extract the remaining insoluble protein fraction.
  • the cell pellet was resuspended in extraction buffer (6M Urea, 150 mM NaCI, 100 mM Tris-HCI, 1 mM EDTA, pH 8.0) at a ratio of 100 ⁇ _ of buffer for every 100 mg of initial cell weight.
  • the pellet was dislodged using a pipette tip, vortex for 30 s, and then kept on ice for 1 h.
  • the samples were then vortexed and centrifuged for 30 min at 13,000 rpm.
  • the supernatant being the insoluble protein fraction was transferred to a fresh LoBind tube and stored at -20°C for further use.
  • Supernatant proteins were analysed using a procedure modified from Jiang et al (2004; Journal of chromatography A. 1023, 2.317-320). The supernatant that was obtained from spinning down 90 mL of culture was collected in a 50 mL falcon tubes. Three times supernatant volume of ice cold acetone was added to the sample, mixed well and stored at -20°C for 4 h. The 200 mL sample was then aliquoted into 4 separate 50 mL falcon tubes and spun at 14,000 rpm, 4°C for 20 min to pellet the proteins. The supernatant was poured off and the remaining pellet was resuspended in 2 mL of 6M Urea, 150 mM NaCI, 100 mM Tris-HCI, 1 mM EDTA, pH 8.0.
  • proteins were resolved in an SDS PAGE gel as described above before being electro-transferred to a PVDF membrane using an iBIot® Gel Transfer device (Invitrogen), following the manufacturer's protocol. After transfer, the membranes were incubated in 25 mL of blocking buffer (1 X TBS, 0.1 % Tween-20 with 5% w/v nonfat dry milk) for one hour at room temperature. Each membrane was then washed three times for 5 min each with 15 mL of TBS/T (1 X TBS, 0.1 % Tween-20). Membranes were incubated with the respective primary antibody (1 :10,000) in 10 mL of blocking buffer with gentle agitation overnight at 4°C.
  • blocking buffer (1 X TBS, 0.1 % Tween-20 with 5% w/v nonfat dry milk
  • the membranes were incubated with the species goat HRP-conjugated secondary antibody after washing three times for 5 min each with 15 mL of TBS/T.
  • the secondary antibody was diluted (1 :5,000) in 10 mL of blocking buffer.
  • Each membrane was then washed three times for 5 min each with 15 mL of TBS/T before incubation with 3 mL Immubilon western HRP substrate peroxide solution and 3 mL Y mix Immubilon western HRP substrate Luminol reagent (Millipore corporation, Billerica, MA, USA) for 5 min. Samples were then visualized using a CCD camera (ImageQuant-RT ECL system; GE Healthcare, Amersham, UK). Western blot images were analyzed using image analysis software (ImageQuant TL; GE Healthcare).
  • Selected and excised gel pieces were digested in-gel with modified trypsin.
  • each gel piece was destained (200 mM ammonium bicarbonate in 40% ACN for 30 min at 37°C, performed twice), reduced (10 mM DTT for 30 min at 56°C) and alkylated (55 mM iodoacetamide and 50 mM ammonium bicarbonate for 20 min in the dark at room temperature).
  • Gel pieces were completely dried in a vacuum concentrator (Eppendorf AG, Cambridge, UK) prior to adding trypsin, at a 1 :50 mass ratio (0.14 ⁇ g of trypsin). Trypsin was prepared according to the manufacturer's protocol.
  • the digested peptides were extracted. This was done by one change of 25 mM ammonium bicarbonate at room temperature for 10 min, followed by one change of 100% ACN, a change of 5% formic acid, and a final extraction with 100% ACN, incubating at 37°C for 15 min for each change. All liquid phases were combined and dried in a vacuum concentrator. Dried digests were stored at -20°C.
  • HPLC-ESI solvents contained 0.1 % FA and either 3% ACN (solvent A) or 97% ACN (solvent B).
  • the column was pre-equilibrated with solvent A. Separation of the peptides was performed on a linear gradient from 5 to 35% solvent B, in 40 min.
  • the electrospray fused silica PicoTip needle (New Objective, Inc., Woburn, MA) was operated with a voltage differential of 5.5 kV. Survey scans were acquired from 350 to 1 ,800 mlz, and MS/MS scans from 65 to 1 ,800 m/z.
  • the spectrometer sequentially conducted MS/MS on the precursor ions (+2 and +3 charge state) detected in the full scan. All analyses were performed on an HCT Ultra PTM Discovery ESI-lon Trap MS/MS system (Bruker Daltonics, Coventry UK).
  • the specific ions are peptides resulting from digestion of the total protein.
  • the m/z range of these peptides was between 400 and 800, with differentially charged variants of peptides among those chosen. A maximum of 10 individual ions were then chosen to be selected and fragmented within the MS within an isolation window of 4 m/z. Collected Trap pSRM-MS/MS, scans were analyzed using DataAnalysis v 4.0 (Bruker Daltonics, Coventry UK).
  • the electrode material used within the anode chambers was carbon fibre cloth fabric (Carbon Mods, Longton, U.K.). The carbon cloth pulled apart to defined fibres that were of 2.5 mm and were cut to 35 mm in length.
  • the MFC used is a single chamber device utilising an air cathode chamber with an internal anodic chamber volume of between 130-150 ⁇ (38) as shown in Figure 3. The two chambers are separated by a modified proton exchange membrane (PEM) (Ion Power, New Castle, DE, USA).
  • PEM modified proton exchange membrane
  • the cathode side of the PEM was carbon coated and loaded with 0.27 Pt cm "2 , whilst the anode side was pure Nafion N1 15. All PEM used had been stored in distilled water for at least 12 h before use in the fuel cell.
  • the polarisation curves are generated by connecting the ⁇ MFC up to a decade resistance box (Farnell, U.K.) set at a starting resistance of 100 kQ and decreasing in steps of 10 kQ down to 10 kQ. The resistance was then decreased by 2 kQ down to 2 kQ and moved a single kQ down to 1 kQ. The final set of resistance changes were from 1 kQ to 200 ⁇ in 200 ⁇ decrements. The ⁇ were left for at least 500 seconds between each resistance change to allow the voltage to level out. Recorded data was then analysed using Microsoft Excel. In order to be able to directly compare one strain to another the maximum power density was calculated. This provides more information than the voltage output as it allows the resistance at which the greatest power is output is achieved.
  • a decade resistance box Fernell, U.K.
  • the point of external resistance at which this occurs is equal to the internal resistance of the MFC.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Manufacturing & Machinery (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Sustainable Development (AREA)
  • Sustainable Energy (AREA)
  • Biophysics (AREA)
  • Electrochemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

There is provided an electrogenic micro-organism host cell comprising at least one heterologous electrogenic pathway gene. The electrogenic micro-organism host cell may be especially characterised in that, in use in a microbial fuel cell, a greater power density is obtainable from the microbial fuel cell compared to the power density obtainable from a microbial fuel cell comprising an equivalent host cell not comprising the heterologous electrogenic pathway protein. There is also provided microbial fuel cells comprising such an electrogenic micro-organism host cell and methods of obtaining such electrogenic micro-organism host cells.

Description

Bacteria
Field of Invention
The invention relates to improved electrogenic bacteria and microbial fuel cells comprising these bacteria which have improved power densities. Methods of obtaining such bacteria are also disclosed.
Background
Microbial Fuel Cells (MFCs) are devices in which electrogenic micro-organisms such as bacteria grow on an anode and export electrons (reducing equivalents) to it, while oxidising organic substrates such as acetate to carbon dioxide. At a cathode in the device, a reduction (typically of oxygen to water) takes place. Protons flow between the two electrodes, normally through a proton exchange membrane or a phase boundary. Figure 1 shows such an arrangement. The membrane also serves to keep oxygen out of the anode chamber, as the presence of oxygen here would inhibit the anode reactions. The anode and cathode are connected by a wire containing a load (a device being powered or, in the laboratory setting, a resistor). The current produced by the MFC can be calculated by monitoring the voltage drop across the resistor. The power output of a MFC is usually stated as power density according to the surface area of the anode (W/m2 or A m2), so that different devices can be compared.
MFCs have the potential to address two markets: energy generation and waste water/effluent treatment/bioremediation.
Waste water treatment plants use a significant amount of electrical power, mainly for aeration and pumping - from 400kW up to 2,500kW per m3/s. It has been calculated that the energy content of the waste water for one plant was nine times the power required to run it (Logan (2008) Chapter 9 "Microbial Fuel Cells", Pub. Wiley, ISBN: 978-047023948-3). There is, therefore, a significant incentive for power recovery from water treatment plants (including black and grey water systems). MFCs offer a viable option to achieve this with high Coulombic efficiency. Furthermore, MFCs can offset the cost of some of the stages of treatment that are currently necessary before streams can be discharged into the environment, due to the breakdown of waste organic compounds (perhaps in combination with an anaerobic digestion system). The use of MFCs holds several advantages over anaerobic digesters for some applications, notably the fact that the energy is recovered directly as electricity rather than in the form of biogas that needs to be separated and, if electricity is desired, burned in a heat engine. With the theoretical maximum conversion rate of 100% Coulombic efficiency, a MFC can produce 3kWh for every kilogram of organic matter compared to the 1 kWh of electricity and 2 kWh of heat produced during biomethanation (Aelterman et al. (2006) Water Sci. Technol. 54 9-15). In practice, high Coulombic efficiencies have been achieved previously from MFCs but only under very carefully optimised conditions.
MFCs have been studied for many years but are only just beginning to achieve commercialisation in quite limited fields; the most significant reason for this is low power densities, especially with practical, mixed substrates such as are likely to be found in real applications, rather than a single laboratory feedstock. Metabolically versatile organisms allow for a wide range of organic substances to be completely oxidised to C02 under a diverse variety of conditions and, potentially very importantly, under a wide range of temperature conditions. This is unlike anaerobic digesters, which must operate under defined conditions and are greatly impeded by variations in temperature. However, it may be effective to run MFCs and digesters together as a combined treatment plant.
Much effort has gone into improving the engineering of MFCs and efficiency and power density have improved as a result, but the underlying biology remains a significant contributor to the problem. Moreover, some of the species that have been used in the development of MFCs are difficult to work with industrially due to various combinations of slow growth cycles and environmental constraints (for example Geobacter, one of the best-known metal-reducing bacteria, requires anaerobic conditions for life and only metabolises a limited range of substrates). Dissimilatory metal reducing bacteria (DMRB), such as species from the genera Geobacter and Shewanella, are the organisms most studied for use in microbial fuel cells, due to their natural ability to reduce Fe(lll) by external electron transfer. In a MFC, a culture of species such as these forms a biofilm on the anode. Understanding the mechanisms by which the DMRB transfer their electrons to the anode provides us with the ability to increase their electrogenic activity. Electron transfer from the metabolic centres of the cell, via the outer membrane cytochromes and any surface organelles to an external electrode (or other electron acceptor) is complex, and numerous proteins are implicated in the chain. There are currently three known ways by which this electron transfer occurs:
1 ) Direct contact: cells adhere directly to the anode and transfer their electrons through the cell membrane and straight to the electrode using multi haem c-type cytochromes. The expression of these cytochromes in Shewanella oneidensis MR-1 is dependent on anaerobic growth where they provide a route for extracellular Fe (III) reduction. 2) Nanowire: cells use electrically conductive appendages known as nanowires or pili. These appendages allow the bacteria to transport their electrons extracellularly without having to have direct contact with the anode. This feature has been noted in both Geobacter and Shewanella where the expression of these pili is dependent on the absence of soluble electron acceptors. Once all soluble electron acceptors have been exhausted, the bacteria then synthesise the pili and also flagella to allow them to migrate towards Fe (III) oxides.
3) Exogenous mediators: cells use exported mediators that allow them to transfer their electrons to an intermediate molecule which then diffuses to the anode. This has not been as thoroughly documented as the other methods of electron transfer, but several Shewanella species have recently been recognised as secreting electron shuttles in the form of flavin mononucleotide that can then reduce Fe (III). This may provide a route for electron transport to the anode.
Summary of Invention
The present inventors have developed a suite of genes which, when transferred from a naturally electrogenic organism to a naive host (i.e., an organism lacking or largely lacking the relevant electrogenic functions), achieved a significant improvement in current in a microbial fuel cell. This provides a combination of benefits, all of which are important for microbial fuel cells, for example, higher power density, greater range of substrates, good growth rate and robustness of culture.
Unless otherwise defined herein, scientific and technical terms used herein will have the meanings that are commonly understood by the skilled person. Generally, nomenclatures used in connection with techniques of biochemistry, enzymology, molecular and cellular biology, microbiology, genetics and protein and nucleic acid chemistry and hybridisation are those well known and commonly used in the art. Conventional methods and techniques mentioned are explained in more detail, for example, in "Molecular Cloning, a laboratory manual [third edition]" (2001 ) by Sambrook et al. Pub: CSHL Press, ISBN 978-087969577-4.
According to a first aspect of the invention, there is provided an electrogenic micro- organism host cell comprising, preferably transformed or transfected with, at least one heterologous electrogenic pathway gene. The term "heterologous electrogenic pathway gene" indicates a gene which is an exogenous gene, i.e., not native to the micro-organism host cell of the invention, the gene encoding for a protein involved in electron transfer within a naturally occurring electrogenic micro-organism which is different to the host cell, or encoding for a protein involved in electron transfer from such a naturally occurring micro-organism to an external body such as another cell or, particularly, an electrode in a MFC or half-cell. The gene may also encode a portion of such a protein, for example where several genes are utilised to form a whole active protein. The gene is a gene for which reducing or knocking out its activity in the naturally occurring electrogenic micro-organism would result in the reduction or elimination of electrogenic activity of the naturally occurring electrogenic micro-organism. Therefore, the invention represents the result of introducing at least one heterologous (i.e., exogenous) gene to a host cell, the gene(s) conferring electrogenic properties to a non-electrogenic cell and/or conferring improved electrogenic properties (i.e., increased power density when the cell is used in a MFC) to a cell having existing electrogenic capabilities.
Alternatively, the invention provides an electrogenic micro-organism host cell in which an electrogenic pathway gene is overexpressed, i.e. overexpressed compared to a naturally occurring host cell. Preferably, the electrogenic pathway gene encodes a nucleic acid molecule or polypeptide endogenous to the cell. As used herein, "naturally-occurring" refers to a polypeptide sequence that occurs in nature or to a nucleic acid molecule, e.g. a RNA or DNA molecule having a nucleotide sequence that occurs in nature (e.g., encodes a natural protein). Said nucleic acid molecules include an open reading frame encoding protein, and can further include non-coding regulatory sequences and introns. Preferably, said overexpression is achieved by providing the cell with at least one further copy of an electrogenic pathway gene.
The terms "electrogenic micro-organism", "electrogenic cell" and equivalents, as used throughout this specification, indicate a micro-organism which is capable of transferring electrons to the surface of an anode in a microbial fuel cell. Therefore, when the micro-organism is grown under anaerobic conditions in the anode chamber of a MFC, a current will be measurable in the MFC from which a power density can be calculated. A suitable anode may be a carbon anode (e.g., carbon fibre, brush or graphite, with or without lacing with platinum), or an anode formed from a precious metal or a metal oxide (e.g., Indium Tin Oxide).
"Host cell" as used herein refers to the particular subject cell and also to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
The micro-organism host cell may be, for example, a bacterium or a yeast. In one embodiment, the micro-organism is a gram-negative bacterium, for example (but not limited to) a bacterium from the genera Geobacter, Shewanella or is an Escherichia coli strain. In some embodiments, the bacterium comprises a Type II secretion pathway to enable the correct localisation of electrogenic pathway proteins (such as the gene OmcA and homologues, orthologues and paralogues thereof (e.g., NapC in E. coli) on the outer membrane of the bacterium. (The Type II secretion pathway is discussed by Filloux in "Transport of Molecules Across Microbial Membranes" (1999) ISBN-10: 0521772702.) The embodiment of the invention which is an £. coli is especially advantageous, given the wealth of knowledge about this species, its rapid growth rate and the ease and safety with which it can be cultured and managed, both in the laboratory and industrially. As used herein, the term "heterologous" refers to a polypeptide or nucleic acid sequence which is not present or naturally occurring within a host cell. It should be noted that the heterologous polynucleotide or polypeptide may comprise a nucleic acid sequence which is identical or partially homologous to an endogenous nucleic acid or amino acid sequence of sequence of the cell. The term "endogenous" as used herein refers to any polypeptide or nucleic acid sequence which is present and/or naturally occurring in a host cell.
The host cell for use in the expression system of the present invention may be an aerobic cell or alternatively a facultative anaerobic cell. Preferably, the cell is a bacterial cell. Alternatively, the cell may be a yeast cell (e.g. Saccharomyces, Pichia), an algae cell, an insect cell, or a plant cell. Bacterial host cells include Gram-positive and Gram- negative bacteria. Suitable bacterial host cells include, but are not limited to the Gram-negative bacteria, for example a bacterium of the family Enterobacteria, most preferably Escherichia coli. E. coli is the most preferred bacterial host cells for the present invention. Expression in £ coli offers numerous advantages over other expression systems, particularly low development costs and high production yields. Cells suitable for high protein expression include, for example, E.coli W31 10, the B strains of E.coli. E.coli BL21 , BL21 (DE3), and BL21 (DE3) pLysS, pLysE, DH1 , DH4I, DH5, DH5I, DH5IF', DH5IMCR, DH10B, DHIOB/p3, DH1 IS, C600, HB101 , JM101 , JM105, JM109, JM1 10, K38, RR1 , Y1088, Y1089, CSH18, ER1451 , ER1647 are particularly suitable for expression. £ coli K12 strains are also preferred as such strains are standard laboratory strains, which are non-pathogenic, and include NovaBlue, JM109 and DH5a (Novogen®), £ coli K12 RV308, £. coli K12 C600, £ coli HB101 , see, for example, Brown, Molecular Biology Labfax (Academic Press (1991 )).
Alternatively, the host cell is a bacterium of the family Proteobacteria, most preferably Geobacter.
Alternatively, the host cell is a bacterium of the family Shewanellaceae, most preferably Shewanella.
In certain embodiments, the micro-organism may comprise at least one cytochrome maturation gene, for example a heterologous or endogenous gene selected from at least one of the Shewanella oneidensis MR-1 genes Mtr-A, MtrB, MtrC, MtrD, MtrE, MtrF or OmcA and/or at least one of the Geobacter sulferreducens genes OmcS (UniProt accession no. D7AKN5) and/or OmcZ (UniProt accession no. D7AL56). Surprisingly, expression of OmcA in £ coli alongside overexpressed cytochrome maturation genes is sufficient to provide this micro-organism with electrogenic capability. Expression of the genes MtrD, MtrE and MtrF in £ coli has also been found to provide electrogenic activity. By way of non-limiting example, the electrogenic pathway gene as mentioned above may be selected from any of these S. oneidensis MR-1 and G. sulferreducens genes.
In a one embodiment the micro-organism is transformed or transfected with a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:1 or portions or fragments thereof. In one embodiment, the micro-organism is transformed or transfected with a nucleic acid sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of the nucleotide sequence shown in SEQ ID NO:1 or portions or fragments thereof. In another embodiment, the micro-organism is transformed or transfected with a nucleic acid molecule that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of the nucleotide sequence shown in SEQ ID NO:1 or portions or fragments thereof, and at least one nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of a nucleotide sequence of SEQ ID NO: 2, 3, 4, 5, 6 or 7 or portions or fragments thereof.
In a one embodiment the micro-organism is transformed or transfected with a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:2 or portions or fragments thereof. In one embodiment, the micro-organism is transformed or transfected with a nucleic acid sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of the nucleotide sequence shown in SEQ ID NO:2 or portions or fragments thereof. In another embodiment, the micro-organism is transformed or transfected with a nucleic acid molecule that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of the nucleotide sequence shown in SEQ ID NO:2 or portions or fragments thereof, and at least one nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of a nucleotide sequence of SEQ ID NO: 1 , 3, 4, 5, 6 or 7 or portions or fragments thereof.
In a further embodiment the micro-organism is transformed or transfected with a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:3 or portions or fragments thereof. In another embodiment, the micro-organism is transformed or transfected with a nucleic acid molecule comprising a nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, identical to the entire length of the nucleotide sequence of SEQ ID NO:3 or portions or fragments thereof. In another embodiment, the micro-organism is transformed or transfected with a nucleic acid molecule that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of the nucleotide sequence shown in SEQ ID NO:3 or portions or fragments thereof, and at least one nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of a nucleotide sequence of SEQ ID NO: 1 , 2, 4, 5, 6 or 7 or portions or fragments thereof.
In a further embodiment the micro-organism is transformed or transfected with a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:4 or portions or fragments thereof. In another embodiment, the micro-organism is transformed or transfected with a nucleic acid molecule comprising a nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, identical to the entire length of the nucleotide sequence of SEQ ID NO:4 or portions or fragments thereof. In another embodiment, the micro-organism is transformed or transfected with a nucleic acid molecule that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of the nucleotide sequence shown in SEQ ID NO:4 or portions or fragments thereof, and at least one nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of a nucleotide sequence of SEQ ID NO: 1 , 2, 3, 5, 6 or 7 or portions or fragments thereof.
In a further embodiment the micro-organism is transformed or transfected with a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:5 or portions or fragments thereof. In another embodiment, the micro-organism is transformed or transfected with a nucleic acid molecule comprising a nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, identical to the entire length of the nucleotide sequence of SEQ ID NO:5 or portions or fragments thereof. In another embodiment, the micro-organism is transformed or transfected with a nucleic acid molecule that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of the nucleotide sequence shown in SEQ ID NO:5 or portions or fragments thereof, and at least one nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of a nucleotide sequence of SEQ ID NO: 1 , 2, 3, 4, 6 or 7 or portions or fragments thereof. In a further embodiment the micro-organism is transformed or transfected with a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:6 or portions or fragments thereof. In another embodiment, the micro-organism is transformed or transfected with a nucleic acid molecule comprising a nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, identical to the entire length of the nucleotide sequence of SEQ ID NO:6 or portions or fragments thereof. In another embodiment, the micro-organism is transformed or transfected with a nucleic acid molecule that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of the nucleotide sequence shown in SEQ ID NO:6 or portions or fragments thereof, and at least one nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of a nucleotide sequence of SEQ ID NO: 1 , 2, 3, 4, 5 or 7 or portions or fragments thereof.
In a further embodiment the micro-organism is transformed or transfected with a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:7 or portions or fragments thereof. In another embodiment, the micro-organism is transformed or transfected with a nucleic acid molecule comprising a nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, identical to the entire length of the nucleotide sequence of SEQ ID NO:7 or portions or fragments thereof. In another embodiment, the micro-organism is transformed or transfected with a nucleic acid molecule that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of the nucleotide sequence shown in SEQ ID NO:7 or portions or fragments thereof, and at least one nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of a nucleotide sequence of SEQ ID NO: 1 , 2, 3, 4, 5 or 6 portions or fragments thereof.
The S. oneidensis MR-1 gene MtrA may also be expressed in the micro-organism. Alternatively, the recombinant micro-organisms as herein before described may comprise, i.e. be transformed or transfected with, a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:9 or portions or fragments thereof. In another embodiment, the micro-organism comprises a nucleic acid molecule comprising a nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, identical to the entire length of the nucleotide sequence of SEQ ID NO:9 or portions or fragments thereof.
The micro-organism may also be transformed or transfected with the Goebacter OmcS gene. Accordingly, the recombinant micro-organisms as herein before described may further comprise, i.e. be transformed or transfected with, a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:16 or portions or fragments thereof. In another embodiment, the micro-organism comprises a nucleic acid molecule comprising a nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, identical to the entire length of the nucleotide sequence of SEQ ID NO: 16 or portions or fragments thereof. In another embodiment, the micro-organism comprises a nucleic acid molecule that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of the nucleotide sequence shown in SEQ ID NO:16 or portions or fragments thereof, and at least one nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of a nucleotide sequence of SEQ ID NO: 1 , 2, 3, 4, 5, 6, 7 or 9 portions or fragments thereof.
The micro-organism may also be transformed or transfected with the Goebacter OmcZ gene. Accordingly, the recombinant micro-organisms as herein before described may further comprise, i.e. be transformed or transfected with, a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:17 or portions or fragments thereof. In another embodiment, the micro-organism comprises a nucleic acid molecule comprising a nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, identical to the entire length of the nucleotide sequence of SEQ ID NO: 17 or portions or fragments thereof. In another embodiment, the micro-organism comprises a nucleic acid molecule that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of the nucleotide sequence shown in SEQ ID NO:17 or portions or fragments thereof, and at least one nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the entire length of a nucleotide sequence of SEQ ID NO: 1 , 2, 3, 4, 5, 6, 7 or 9 portions or fragments thereof.
Calculations of sequence homology or identity (the terms are used interchangeably herein) between sequences are performed as follows.
To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). In a preferred embodiment, the length of a reference sequence aligned for comparison purposes is at least 30%, preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, and even more preferably at least 70%, 75%, 80%, 82%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the length of the reference sequence. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein amino acid or nucleic acid "identity" is equivalent to amino acid or nucleic acid "homology"). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In a preferred embodiment, the percent identity between two amino acid sequences is determined using the Needleman et al. (1970) J. Mol. Biol. 48:444-453) algorithm which has been incorporated into the GAP program in the GCG software package (available at http://www.gcg.com), using either a BLOSUM 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1 , 2, 3, 4, 5, or 6. In yet another preferred embodiment, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (available at http://www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1 , 2, 3, 4, 5, or 6. A particularly preferred set of parameters (and the one that should be used if the practitioner is uncertain about what parameters should be applied to determine if a molecule is within a sequence identity or homology limitation of the invention) are a BLOSUM 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.
The percent identity between two amino acid or nucleotide sequences can be determined using the algorithm of Meyers et al. (1989) CABIOS 4:1 1 -17) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
Specific combinations may comprise: all of MtrA-F (for example, arranged in the order D, E, F, C, A, B; SEQ ID NO:10); all of MtrA-F and OmcA (together known as MR-1 , SEQ ID NO:9); MtrDEF (SEQ ID NO:8); MtrDEF and OmcA; MtrFCAB (SEQ ID NO:14); MtrABC (for example, arranged in the order C, A, B; SEQ ID NO:15); OmcA and MtrCAB (SEQ ID NO: 18). The micro-organism may also comprise cytochrome maturation genes, either naturally or within an exogenous expression vector such as, for example, pEC86 and/or pRGK333. pEC86 comprises the ccmABCDEFGH cytochrome maturation genes, and is not IPTG inducible (see Arslan et al, 1998, Biochemical and Biophysical Research Communications 747:744- 747). pRGK333 also comprises the ccmABCDEFGH cytochrome maturation genes, and is IPTG-inducible (see Feissner R et al, 2006, Mol. Microbiol. 60:563-577).
The electrogenic micro-organism according to the invention may be characterised in that, when in use in a microbial fuel cell, a greater power density is obtainable or obtained from the microbial fuel cell compared to the power density obtainable from a microbial fuel cell comprising an equivalent host cell which does not comprise the heterologous electrogenic pathway protein. The term "equivalent host cell" means the strain of micro-organism in the form prior to the introduction of the at least one heterologous electrogenic pathway gene. Therefore, the electrogenic micro-organism according to the invention provides a means for improving the power density of microbial fuel cells, since the micro-organisms are more readily able to transfer electrons to an anode in a MFC than an equivalent cell before the addition of the electrogenic pathway gene. The term "power density" refers to the amount of power (time rate of energy transfer) per unit volume.
According to a second aspect of the invention, there is provided a microbial fuel cell comprising an electrogenic micro-organism according to the first aspect of the invention. Advantageously, this provides improvements on the microbial fuel cells of the prior art, since improved power outputs can be provided in cells utilising microorganisms which are not naturally occurring. This then provides advantages in that micro-organisms can be used which are relatively easy to grow in culture compared to naturally electrogenic cells and/or which are better understood by the skilled person for use industrially and/or in the laboratory. E. coli strain cells may be particularly useful, for example. Alternatively, the electrogenic activities of naturally occurring bacterial strains such as Shewanella or Geobacter strains may be improved by the introduction of one or more additional heterologous electrogenic pathway genes.
As used herein the term "fuel cell" refers to an electrochemical unit that converts chemical energy into an electrical current. The electric current is generated through chemical reactions using a substrate, which is oxidized in the presence of an electron producing catalyst. The oxidation typically occurs at an anode. The electrons cannot pass through the electrolyte medium, and thus, are shunted through an electrical circuit. Hence, an electrical current is generated by the transfer of electrons from an anode to a cathode. The reaction products are formed at the cathode. As used herein "microbial fuel cell", "MFC", μΜΡΟ" and "microMFC" are used inetrchangably to refer to a bio-electrochemical system that drives a current by mimicking bacterial interactions found in nature. Micro-organisms catabolize substrates, such as glucose, acetate, butyrate or wastewater and thereby generate electrons. The electrons gained from this oxidation are transferred to an anode, where they are shunted through an electrical circuit to the cathode. Here they are transferred to a high potential electron acceptor such as oxygen. As current flows over a potential difference, power is generated directly from biofuel by the catalytic activity of bacteria. Therefore, the microbial fuel cell may be characterised in that, in use, the power density is greater than the power density obtained in an equivalent microbial fuel cell comprising a host cell equivalent to the micro-organism according to the first aspect of the invention but not comprising the heterologous electrogenic pathway gene or protein. The improvement in power density may be at least about 30% or more compared to the power density from a MFC comprising the micro-organism not comprising the heterologous electrogenic pathway gene or protein, preferably at least about 50%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 750%, 1000%, 1500%, 2000%, 2500%, or at least about 3000% or more. According to a third aspect of the invention, there is provided an expression vector comprising one or more of the polynucleotide sequences of the expression constructs pACYCOmcA (SEQ ID NO:1 1 ), pACYCMtrDEF (SEQ ID NO: 12), pACYCMR-1 (SEQ ID NO: 13) and/or pACYCOmcA-MtrCAB (SEQ ID NO: 18), or an electrogenic protein encoding variant thereof. As used herein, the term "pACYCMR- 1 " is used to describe the pACYC Duet-1 plasmid with the MtrA-F and OmcA polynucleotide sequences inserted. The specific order of the genes within pACYCMR-1 is MtrDEF, OmcA, MtrCAB.
The term "electrogenic protein encoding variant thereof" encompasses fragments of these expression vectors which represent at least one electrogenic pathway gene as defined above, i.e., a gene encoding for a protein involved in electron transfer within a naturally occurring electrogenic bacterium, or involved in electron transfer from such an electrogenic bacterium to an external body such as an electrode.
In a preferred embodiment the expression vector comprises a nucleotide sequence of SEQ ID NO:1 1 or portions or fragments thereof. In another embodiment, the micro-organism comprises a nucleic acid molecule comprising a nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, identical to the entire length of the nucleotide sequence of SEQ ID NO:1 1 or portions or fragments thereof. In a preferred embodiment the expression vector comprises a nucleotide sequence of SEQ ID NO:12 or portions or fragments thereof. In another embodiment, the micro-organism comprises a nucleic acid molecule comprising a nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, identical to the entire length of the nucleotide sequence of SEQ ID NO:12 or portions or fragments thereof.
In a preferred embodiment the expression vector comprises a nucleotide sequence of SEQ ID NO:13 or portions or fragments thereof. In another embodiment, the micro-organism comprises a nucleic acid molecule comprising a nucleotide sequence that is at least about: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, identical to the entire length of the nucleotide sequence of SEQ ID NO: 13 or portions or fragments thereof. As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. The vector can be capable of autonomous replication or it can integrate into a host DNA. The vector may include restriction enzyme sites for insertion of recombinant DNA and may include one or more selectable markers. The vector can be a nucleic acid in the form of a plasmid, a bacteriophage or a cosmid. Most preferably the vector is suitable for bacterial expression, e.g. for expression in E. coli. Preferably the vector is capable of propagation in the bacterial cell and is stably transmitted to future generations.
The design of the expression vector depends on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, and the like. The expression vectors of the invention can be introduced into host cells to thereby produce proteins or polypeptides, including fusion proteins or polypeptides, encoded by nucleic acids as described herein (e.g., the Shewanella oneidensis MR-1 genes, MtrA, MtrB, MtrC, MtrD, MtrE, MtrF and OmcA). Preferably the vector comprises those genetic elements which are necessary for expression of the specified nucleic acid molecules in a bacterial cell. The elements required for transcription and translation in the bacterial cell include a promoter, a coding region for the specified nucleic acid molecules, and a transcriptional terminator.
The genes described in this aspect of the invention (or any other aspect) may also encode a portion of such a protein, for example where several genes are utilised to form a whole active protein. Also contemplated are variant polynucleotide sequences comprising any substitution of, variation of, modification of, replacement of, deletion of, or addition of one or more nucleic acid(s) from or to a polynucleotide sequence described herein, providing the resultant polypeptide sequence encoded by the polynucleotide is unchanged, for example because of the degeneracy of the genetic code. The variants also encompass genes which are homologues, orthologues or paralogues to those specifically described herein, for example, genes from other genera or strains or bacteria. Such homologues, orthologues or paralogues are readily identifiable by the skilled person, using, for example, the BLAST software publicly available at http://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 10 June 201 1 ).
Variant polynucleotide sequences include, therefore, allelic variants and also include a polynucleotide (a "probe sequence") which substantially hybridises to an electrogenic pathway gene as used in the invention and/or to one of the expression constructs listed above, for example, because the "probe" sequence is complementary to the electrogenic pathway gene sequence. Such hybridisation may occur at or between low and high stringency conditions. In general terms, low stringency conditions can be defined as hybridisation in which the washing step takes place in a 0.330-0.825 M NaCI buffer solution at a temperature of about 40-48°C below the calculated or actual melting temperature (Tm) of the probe sequence (for example, about ambient laboratory temperature to about 55°C), while high stringency conditions involve a wash in a 0.0165-0.0330 M NaCI buffer solution at a temperature of about 5-10°C below the calculated or actual Tm of the probe sequence (for example, about 65°C). The buffer solution may, for example, be SSC buffer (0.15M NaCI and 0.015M tri-sodium citrate), with the low stringency wash taking place in 3 x SSC buffer and the high stringency wash taking place in 0.1 x SSC buffer. Steps involved in hybridisation of nucleic acid sequences have been described for example in Sambrook et al. (2001 ).
According to a fourth aspect of the invention, there is provided method of obtaining an electrogenic micro-organism according to the first aspect of the invention comprising expressing in a host cell at least one of the Shewanella oneidensis MR-1 genes MtrB, MtrC, MtrD, MtrE, MtrF or OmcA and/or at least one of the Geobacter sulferreducens genes OmcS and/or OmcZ or variants thereof as hereinbefore described. The expressing may comprise transforming the host cell with a nucleic acid comprising a polynucleotide sequence of at least one of the genes MtrB, MtrC, MtrD, MtrE, MtrF, OmcA, OmcS and/or OmcZ. Alternatively or additionally, the method may comprise transforming the host cell with the expression vector pOmcA and/or pACYCOmcA and/or pACYCMtrDEF as hereinbefore described. The method may further comprise transforming the host cell with a nucleic acid comprising a polynucleotide sequence of the gene MtrA as hereinbefore described. Alternatively or additionally, the method may comprise transforming the host cell with at least one expression vector according to the third aspect of the invention. The method may comprise transforming the host cell with one or more of the expression constructs pOmcA, pACYCOmcA, pACYCMtrDEF, pACYCMR-1 and/or pACYCOmcA- MtrCAB as hereinbefore described. The term "pOmcA", as used throughout this specification, relates to a constitutive expression plasmid of OmcA, where OmcA is the Shewanella oneidensis MR-1 OmcA outer membrane cytochrome. OmcA localises to the outer membrane upon heterologous expression in E. coli BL21 and can reduce Fe (III) to Fe (II) outside the cell (Donald et al., 2008).
The method may additionally comprise transforming the host cell with a polynucleotide comprising one or more cytochrome maturation genes, e.g. the MR-1 genes Mtr-A, MtrB, MtrC, MtrD, MtrE, MtrF or OmcA, or OmcS and/or OmcZ as herein before described, for example in expression vectors pEC86 and/or pRGK333. Alternatively, suitable genes may be present in the host cell genome or in one or more other expression vectors.
The method may further comprise the step of confirming that the host cell is an electrogenic micro-organism (or is a more electrogenic micro-organism) after expressing the one or more genes in said cell, by using the host cell in a microbial fuel cell and determining that the power density obtainable in the microbial fuel cell is greater than the power density obtainable in an equivalent microbial fuel cell comprising an equivalent host cell not comprising the one or more genes. In the method, by way of example, the host cell may be a yeast or bacterium, for example a bacterium of the genera Geobacter or Shewanella, or wherein the host cell is an Escherichia coli cell. A suitable Escherichia coli strain may be BL21 and derivatives, such as strains carrying a DE3 region. Throughout the description and claims of this specification, the words "comprise" and "contain" and variations of the words, for example "comprising" and "comprises", mean "including but not limited to" and do not exclude other moieties, additives, components, integers or steps. Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise. Preferred features of each aspect of the invention may be as described in connection with any of the other aspects. Other features of the present invention will become apparent from the following examples. Generally speaking, the invention extends to any novel one, or any novel combination, of the features disclosed in this specification (including the accompanying claims and drawings). Thus, features, integers, characteristics, compounds or chemical moieties described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein, unless incompatible therewith.
Moreover, unless stated otherwise, any feature disclosed herein may be replaced by an alternative feature serving the same or a similar purpose. Brief Description of Figures
Figure 1 is a diagram of a Microbial Fuel Cell showing electrogenic micro-organisms growing on the anode, with air bubbled into the cathode chamber to provide dissolved oxygen for reactions at the cathode; Figure 2 is a diagram of a Half Cell which has been used in the experiments described herein;
Figure 3 shows the predicted metal reducing c-type cytochromes in S. oneidensis MR-1 ;
Figure 4 shows the map for plasmid pACYCDuet-1 (Novagen).
Figure 5 compares the power density in MFCs comprising £ coli BL21 DE3 pEC86 pOmcA cells or £ coli BL21 DE3;
Figure 6 compares the current density in MFCs comprising £ coli BL21 DE3 cells, K12 pEC86 pMtrA cells, BL21 DE3 pEC86 pOmcA cells or S. oneidensis MR-1 cells;
Figure 7 compares the power density in MFCs comprising £. coli BL21 DE3 cells comprising various plasmids and constructs, or S. oneidensis MR-1 cells;
Figure 8 shows the power density in a half cell comprising £ coli BL21 DE3 pACYCMR-1 cells, compared to that in a half cell comprising £ coli BL21 DE3 pACYCDuet-1 cells;
Figure 9 shows an SDS-PAGE gel of proteins from BL21 (DE3) cells and BL21 (DE3) cells comprising pOmcA, with lane 1 showing size standards, lane 2 the proteins in supernatant from a BL21 DE3 cell culture, lane 3 the proteins in supernatant from a BL21 DE3 pEC86 pOmcA cell culture, lane 4 the soluble protein fraction of BL21 DE3 cells, lane 5 the soluble protein fraction of BL21 DE3 pEC86 pOmcA cells, lane 6 the insoluble protein fraction of BL21 DE3 cells and lane 7 the insoluble protein fraction of BL21 DE3 pEC86 pOmcA cells;
Figure 10 shows: (A) Two of the plasmids used herein; pRGK333, an IPTG inducible £ coli cytochrome maturation protein over-expression plasmid (Feissner et al. 2006) and the Shewanella cytochrome expression plasmid pACYCOmcA-MtrCAB (S) Heterologously-synthesised decaheme cytochromes (MtrA-C and OmcA from Shewanella oneidensis MR-1 ) potentially involved in the transfer of electrons for the novel £. coli strains. (C refers to cytoplasm, P to periplasm, and ES to extracellular space). Figure 1 1 provides schematic diagrams and photographs of the electrogenic activity testing devices used herein. (A) Schematic representation of the microfluidic microbial fuel cell. (S) Photograph of the MFC. (C) Schematic diagram of the sedimentary half cell. The circular anodes are arranged at the base of the cell to allow potentially electrogenic bacteria to form a layer or a biofilm. (D) Photograph of the sedimentary half cell containing a dense bacterial culture.
Figure 12 shows the maximum power density (mW/m2) attained within the microbial fuel cell. (1 ) Growth medium only - LB + lactate + 0.5mM IPTG. (2) E.coli expressing the plasmids pRGK333 and pACYCDuet-1 , (3) pRGK333 and pACYCOmcA or (4) pRGK333 and pRSFOmcA-MtrCAB, (5) pRGK333 and pCYCOmcA-MtrCAB
Figure 13 shows Western blots using polyclonal antibodies for MtrC, MtrA, and OmcA to detect cytochromes proteins present within the sample supernatants. Fig 14 provides picologger readings from the M9 minimal media half cell test of BL21 DE3 pRGK333 pACYCOMCA and BL21 DE3 pRGK333 pACYCOMCA-MtrCAB Fig 15 provides a continuation of picologger readings from Figure 14 the M9 minimal media half cell test of BL21 DE3 pRGK333 pACYCOMCA and BL21 DE3 pRGK333 pACYCOMCA-MtrCAB Fig 16 shows activity of BL21 DE3 pRGK333 pACYCOmcA and BL21 DE3 pRGK333 pACYCOmcA-MtrCAB within half cells following roughly 8 days (1 1700 mins total incubation time, shown as 8500 in Fig. 15) incubation with the carbon electrode as the sole terminal electron acceptor. Figure 17 provides power densities of S. oneidensis MR-1 strains grown in LB media compared to LB media alone. Peak average power density were measured in microMFCs (see text) for (a) LB medium; (b) Empty plasmid pBBRI MCS in S. oneidensis; and (c ) pBBR1 MCS:OmcA in S. oneidensis Figure 18 shows SEQ ID NO:1
Figure 19 shows SEQ ID NO:2
Figure 20 shows SEQ ID NO:3
Figure 21 shows SEQ ID NO:4 Figure 22 shows SEQ ID NO:5 Figure 23 shows SEQ ID NO:6 Figure 24 shows SEQ ID NO:7 Figure 25 shows SEQ ID NO:8
Figure 26 shows SEQ ID NO:9 Figure 27 shows SEQ ID NO:10 Figure 28 shows SEQ ID NO:1 1 Figure 29 shows SEQ ID NO:12 Figure 30 shows SEQ ID NO:13 Figure 31 shows SEQ ID NO:14
Figure 32 shows SEQ ID NO:15 Figure 33 shows SEQ ID NO:16 Figure 34 shows SEQ ID NO:17 Figure 35 shows SEQ ID NO:18
Examples
Examples section A:
Cloning and Expression of Shewanella oneidensis MR-1 genes
The decahaem outer membrane c-type cytochrome OmcA gene (SEQ ID NO:1 ) from
S. oneidensis MR-1 was inserted into a pUNI-PROM vector (Donald et al. (2008) J. Bacteriol. 190 5127-5131 ) that allowed for constitutive expression from a tat promoter, to form the construct pOmcA. The cytochrome maturation genes were considered essential for the expression of the cytochrome and so the plasmid pEC86 (Thony-Meyer et al. (1995) J. Bacteriol. 177 4321 -4326) was used, carrying genes that encode for cytochrome c maturation (Ccm) proteins. The constructs were transformed into BL21 (DE3) E. coli cells.
For the expression of the cytochrome maturation genes and OmcA the cells were taken from a selective antibiotic agar plate and transferred to a 100 mL liquid culture of Luria Bertani (LB) media. This was done with a final concentration of 20 μg mL Chloramphenicol (Cm) and 40 μg mL Ampicillin (Amp). This was left for 16 hours at 37°C, with agitation at a rate of 180 rpm. 1 mL of the dense culture was then used to inoculate a fresh 100 mL of LB with Cm and Amp at the same concentrations. This culture was held at 37°C, 180 rpm for 16 hours and 30 mL of this culture was tested in MFCs as outlined below. The construction of a number of different variants of the S. oneidensis MR-1 gene cluster (Figure 3) were considered ranging from the largest (MtrA-F and OmcA, in total named as MR-1 , SEQ ID NO:9) to the smallest (MtrDEF, SEQ ID NO:8). The plasmid chosen for expression was pACYCDuet-1 (Figure 4) (Novagen) since it has a T7 promoter and therefore tightly regulated expression, as well as two Multiple Cloning Sites (MCSs). The extra MCS provides the opportunity for the introduction of a further gene or gene cluster into the second site of the plasmid and co-expression without the need for further antibiotic interference.
The sites chosen for the insertion of the gene fragments into pACYCDuet-1 were the Ascl and Notl sites present within MCS1 . The genes were cloned into the plasmid using T4 DNA ligase from Promega (Southampton, UK) and transformed into E. coli DH5oc cells from Invitrogen (Paisley, UK). The cells were plated out onto 20 μg ml Cm LB agar plates.
The DNA collected from the positive colonies was transformed into BL21 DE3 to allow for expression of the proteins within an IPTG inducible strain. Single colonies were picked off the plates and transferred into 100 ml LB media with 20 μg ml Cm and left at 37°C, 180 rpm for 16 hours. 1 ml of the developed culture was taken and used to inoculate 100 ml of LB media, again with the same antibiotics and left at 37°C, 180 rpm until it reached an OD6oo of 0.4. Once the culture reached this point it was induced using 1 mM Isopropyl β-D-l -thiogalactopyranoside (IPTG) and left for a further 12 hours at 37°C, 180 rpm to allow the culture to fully develop.
In some experiments, the S. oneidensis gene expression vectors were transformed into cells along with the plasmid pRGK333 instead of pEC86. As with pEC86, pRGK333 carries the genes for cytochrome c maturation, with the difference that pRGK333 is an inducible plasmid, so that the timing of the "switching on" of gene expression can be controlled.
Microbial Fuel Cells comprising transformed cell cultures
Protocol 1: A single colony of the transformed BL21 DE3 strain was taken and added to 10 ml LB plus 20 μg ml Chloramphenicol and 40 μg ml Ampicillin in a 50 ml falcon tube. This was put in a shaking incubator at 37°C, 180 rpm for 16 hours. 1 ml of this culture was taken and added to a fresh 10 ml of LB with the same concentration of antibiotics and allowed to grow for 16 hours under the same conditions as the starter culture. Alternatively, if IPTG was used for unduction, 1 ml of the first culture was taken and added to a fresh 100 ml of LB with the same concentration of antibiotics and allowed to grow until an OD6oo of 0.5 was achieved under the same conditions as the starter culture. At this point, IPTG was added to the culture to give a final concentration of 0.5mM and the flask was moved to 25°C, 150rpm overnight. Next day, the OD6oo of all cultures was noted, using LB as a blank and the culture was spun down at 2800 rpm for 10 min. The supernatant was removed and the culture was gently resuspended in fresh LB to an OD6oo of 5. The volume of liquid required for the correct OD was obtained using the following calculations:
OD600 5/OD600 of culture (example of 1.8) = 5/1 .8 = 2.78 (2 d.p.)
Total volume of culture (10 mL) / 2.78 = 3.60 (2 d.p.)
The answer from the second calculation provides the number of ml of fresh LB that the pellet needs to be resuspended in to give an OD6oo of 5.
Protocol 2 (referred to as the "2nd setup" in Figure 7): A single colony of the transformed BL21 DE3 strain was taken and added to 10 ml LB plus 20 μg/ml Chloramphenicol and 100 μg/ml Ampicillin in a 50 ml Falcon tube. This was put in a shaking incubator at 37°C, 180 rpm for 16 hours. 1 ml of this culture was taken and added to a fresh 100 ml of LB with the same concentration of antibiotics and allowed to grow until an OD6oo of 0.5 was achieved under the same conditions as the starter culture. At this point, IPTG was added to the culture to give a final concentration of 0.5mM and the flask was moved to 37°C, 150rpm overnight. Next day, the OD6oo of the culture was noted, using LB as a blank and the culture was spun down at 2800 rpm for 10 min. The enough supernatant was removed and the culture was gently resuspended in remaining LB to an OD6oo of 5. The volume of liquid required for the correct OD6oo was obtained using the following calculations:
OD600 5/OD600 of culture (example of 1.8) = 5/1 .8 = 2.78 (2 d.p.)
Total volume of culture (10 mL) / 2.78 = 3.60 (2 d.p.)
The answer from the second calculation gives the following; 3.6 ml was subtracted from the initial 10ml culture in order to calculate how much supernatant to remove, namely 7.4ml. The pellet was resuspended in the remaining 3.6ml of supernatant to give a final OD6oo of 5.0. Glucose was added to a final concentration of 5mM.
A suitable MFC device was constructed from using pure carbon fibre veil (PRF Composite Materials, Poole, U.K.) cut into 2 x 10 mm oblongs with the total surface area being 200 mm2. The PEM was a made to order Nafion membrane with a carbon and platinum cathode side (Ion Power Inc, Delaware, USA). Both the anode and cathode sections had a 1 mm x 2 mm section of copper tape attached to provide a conductive appendage for attachment to an interface and resistance box and then data acquisition device.
200 μΙ of the OD6oo 5 culture was then extracted using a 1 ml syringe and injected into the MFC device and into the anode chamber. The device was then connected to the resistance box by attaching crocodile clips to the conductive copper tape of each compartment. The data acquisition began as soon as the clips were attached with the resistance set at 33 ΜΩ until the samples had stabilised. The resistance of the samples was then decreased every 500 seconds in the following increments with readings noted before each change: 33 ΜΩ, 15 ΜΩ, 5 ΜΩ, 2 ΜΩ, 1 ΜΩ, 470 ΚΩ, 200 ΚΩ and 100 ΚΩ.
All data recorded was then transferred to Microsoft Excel where the data could be analysed, averages and standard deviations calculated.
In order to be able to directly compare one strain to another the maximum power density was calculated. This provides more information than the voltage output as it allows the resistance at which the greatest power is output is achieved. The point of external resistance at which this occurs is equal to the internal resistance of the MFC (leropoulos et al. (2008) Int. J. Energy Res. 32 1228-1240). In order calculate the power density achieved in the MFC the current (I) firstly needed to be calculated using Ohm's law, l=V/R, where V is the measured voltage and R is the known external resistance. Power can then be calculated (W) by multiplying current by voltage, P=lxV. This then allows the power density to be determined by dividing the power by the surface area of the electrode PDensity = P/SA. The power density is presented as mW/m2.
An increase in power density in the MFC of 23% (Figure 5) or 600% (Figure 6) as compared to untransformed BL21 DE3 cells was observed, in Figure 6 achieving 23% of the power density displayed by wild type S. oneidensis MR-1 cells. Figure 7 shows that cells comprising pACYCOmcA or pACYCMR-1 (with pRGK333) achieve about 28% of the power density displayed by wild type S. oneidensis MR-1 cells. These results demonstrate that electrogenic behaviour can be engineered in a non-electrogenic cell and provides an electrogenic E. coli which can be readily studied, manipulated and used industrially.
A single colony of cells transformed with pACYCMR-1 were picked from a transformation plate, transferred into 100 ml of LB with 20 mg/ml Cm and grown at 37°C for 16 hours at 180 rpm. 1 ml of this starter culture was used to inoculate a fresh 100 ml of LB along with 20 mg/ml Cm. This was again grown at 37°C for 16 hours at 180 rpm until an OD6oo of 0.4 was reached. The expression of the proteins was then induced using 1 mM IPTG and cells were grown under the same conditions for the remainder of their 16 hour growth. The OD6oo of the culture was checked after 16 hours of incubation and the cells were split into two 50 ml Falcon tube containers and spun down in a centrifuge at 2800 rpm for 10 mins. The supernatant from this was expelled and the remaining cell pellet was resuspended in the volume of LB required in order to make the final OD of the culture to 5.0. 10 ml of this culture was then added to a half cell as shown in Figure 2, containing 200 ml LB. The total volume of the half cell was made up to 250 ml using a volume of IPTG providing a 1 mM final concentration, 20 mg/ml Cm and the remainder was made up using LB. A red rod Ag/AgCI reference electrode (Radiometer analytical) was then inserted into each half cell and sealed using silicone sealant to provide a micro aerobic environment. The half cells were then connected to the same data connectors as the MFC device described above and stored in a water bath at 37°C. Data was collected using the same software.
Figure 8 shows the results for a culture of cells transformed with pACYCMR-1 compared to cells transformed with the empty plasmid pACYCDuet-1 . The Figure demonstrates that cells comprising the MR-1 gene cluster have an increased negative potential value.
Protein extraction
The wet weight of a cell pellet from a 15ml culture of the target strain was measured, and the same weight of glass beads (425-600microns) was added, plus 0.5ml of wash buffer (150mM NaCI, 100mM Tris-HCI and 1 mM EDTA, pH8.0). This was vortexed in a bead beater for three sessions of 1 minute, being placed on ice between beatings. The lysate was obtained by centrifugation (13,000rpm for 15min) and contained the soluble proteins, and was stored at -20°C. The remaining cell pellet contained the insoluble proteins, and was resuspended in 150 μΙ of a buffer made up of 6M urea, 150mM NaCI, 100mM Tris-HCI and 1 mM EDTA, incubated on ice for 1 hour and then centrifuged (13,000rpm for 30min). The second supernatant containing the insoluble proteins was removed and stored at -20°C.
Analysis of proteins using SDS-PAGE. About 5 μΙ of each fraction (soluble and insoluble) obtained from the bacterial cells comprising the construct pOmcA was analysed on a 12% (w/v) polyacrylamide gel using the standard protocol (NuPAGE Novex Bis-Tris minigels, Invitrogen protocol). The proteins were electrophorised at 200 V until the bromophenol blue tracking dye reached the end of the gel. EZ run prestained proteins markers (NEB, UK) were used. The proteins were visualised by staining with Instant Blue (Expedeon). The result is shown in Figure 9.
Identification of proteins
The protein bands obtained after 1 -D gel electrophoresis were cut out and the proteins embedded in the gel matrix were digested using trypsin as described by Gan et al., (Proteomics (2005) 5 2468-2478). Briefly, the Instant Blue stain was washed away using distilled water. The proteins were reduced and alkylated using dithiothreitol and alkylated using iodoacetamide (IAA). The proteins in the gel matrix were subject to trypsin digestion overnight in the presence of ammonium bicarbonate and acetonitrile. The peptides were eluted from the gel matrix using repeated washing with formic acid, ammonium bicarbonate and acetonitrile. The peptides were dried using a vacuum concentrator ((Concentrator 5301 , Eppendorf, UK) and stored at -20°C.
The dried peptide samples were resuspended in a 22-μΙ Switchos buffer (3% acetonitrile and 0.1 % trifluoroacetic acid). Mass spectrometry was performed on the sample via electrospray ionisation-ion trap (HCT Ultra, Bruker Daltonics, UK) coupled with an online capillary liquid chromatography system (Famos, Switchos and Ultimate from Dionex/LC Packings, Amsterdam, The Netherlands). The peptides were separated on a PepMap C-18 RP capillary column (LC Packings) with a constant flow rate of 0.3 μΙ_/η"ΐίη with a linear gradient elution using buffer A (3% acetonitrile and 0.1 % formic acid) and buffer B (97% acetonitrile and 0.1 % formic acid); starting with 3% buffer A up to 35% buffer B over 45 min. Data acquisition was set in the positive ion mode with a mass range of 300- 2,000m/z. Tandem mass spectrometry was performed on peptides with +2, +3 and +4 charge states. Identifications were made using the complete protein database of
Escherichia_coli_BL21_Gold_DE3_pLysS_AG uid59245/ plus the protein sequence of OmcA from Shewanella_oneidensis_MR_1_uid57949/ protein database both downloaded from NCBI (www.ncbi.nlm.nih.gov, on 15th Oct, 2010). Phenyx search parameters for protein identification from acquired mass spectra were set at a mass tolerance of 1 .2 Da, MS/MS tolerance of 0.6 Da, one missed cleavage of trypsin, oxidation of methionine, and cysteine modification with IAA. OmcA was determined to be present in the insoluble fraction obtained from the bacterial cells comprising the construct pOmcA, as described above.
Examples section B: transformation of E.coli with further constructs of the invention
Materials and Methods
Additional details can be found in Section 4; supplementary information. Strains and Plasmids
All Shewanella oneidensis MR-1 genes used were amplified using PCR, from genomic DNA obtained from the organism. The genes were ligated into pACYCDuet- 1 (Novagen) or pRSFDuet-1 (Novagen); for the full list of primers, plasmids and strains constructed see Tables S1 -3.
Tabfe S1. Primers
Primer No. Sequence {5'-3'}
1 OmcA FP TGCCATAGGGCGCGCCATGATGAAACGGTTCAATTTC
2 OmcA RP TGCCATAGGCGGCCGCTTAGTTACCGTGTGCTTCCA
3 OmcA- irCAS FP TGCCATAGGGCGCGCCATGATGAAACGGI CAATTTC
4 OmcA- trCAB RP TGGC AT AGG CG GCC GCTT AGAGTTTGT AACTC ATGGT TabSe S2. Pfasmids
Plasmid Promoter Protein Coding Region Antibiotic Resistance Source pRGK333 TAG Laciq corn A-H Amp Robert Kranz pACYCDuet- 7 iac Hone Cm This paper pACYCOmeA T7 iac QmcA Cm T is paper pACYC tfABC-OmCA 17 iac Q cA-MlrCAB Gi 's Thts psper
Table S3, Strain*
Strain Cell iirte Plasmid Gene{s}
BL21
Control (DE3) pRG 333 + pACYCDuet-1 com A-H
Rj: ¾
D L ί
QmcA (DE3) pRG 333 + pACYCOmcA ccfn A-H + QmcA
MtrABC- BL21 pRG: 333 + pACYC tfASC- com A-H * OmcA-
QmcA (DE3) OmcA MtrCAB
After confirmation by DNA sequencing, the plasmids were simultaneously transformed into BL21 (DE3) (Invitrogen) alongside pRGK333 (a plasmid coding for inducible cytochrome maturation genes).
Extraction of Soluble, Insoluble and Extracellular Protein Fractions
The extraction of the protein fractions was carried out using a metalloprotein extraction procedure modified from Novagen's Strep«Tactin® Purification Kit User Protocol. Briefly, glass beads (acid washed Sigma 0.5mm) were added to the bacterial cell pellet in 0.5-1.5ml extraction buffer (150mM NaCL, l OOmM Tris-Hcl, 1 mM EDTA, pH8.0, with added Roche 'Complete' EDTA-minus antiprotease solution). For the insoluble protein samples, urea was added to a final concentration of 6M. Samples were put in a bead beater for 3 x 1 min, keeping the samples cold by occasional immersion in ice, and then spun at 13K at 4°C for 10-30min. The soluble and insoluble cell fractions were both obtained from the same cell pellet via repeated glass bead cracking.
Western Blotting of Supernatant Samples
Western blots of supernatant fractions were carried out using rabbit anti-MtrA, -MtrC, and -OmcA polyclonal antibodies. Samples were resolved in 12.5% SDS-PAGE gels before being electro-transferred to a PVDF membrane using an iBIot® Gel Transfer device (Invitrogen). A 1 :10,000 dilution of the primary antibodies was used. Following overnight agitation at 4°C, goat anti-rabbit HRP antibody was added at a 1 :5,000 dilution along with Immubilon western HRP substrate peroxide solution and Immubilon western HRP substrate Luminol reagent (Millipore Corporation, Billerica, MA, USA). Samples were then visualized using a CCD camera (ImageQuant-RT ECL system; GE Healthcare, Amersham, UK) and analyzed using image analysis software (ImageQuant TL; GE Healthcare). HPLC-ESI-pSRM MS/MS analysis
Selected peptides for analysis by pseudo-selective reaction monitoring (pSRM) (Pandhal et al., 201 1 , Biotechnol. Bioeng. 108, 902-12) for insoluble and soluble fractions ) were chosen from previous MS/MS protein identifications of S. oneidensis MR-1 protein extracts, via an Agilent Ultimate 3000 HPLC system) coupled with an HCT Ultra PTM Discovery ESI-lon Trap MS/MS (Bruker Daltonic, Coventry, UK). A total of 10 ionized peptides were selected for each protein for pSRM analysis, although if less than 10 were detected for from S. oneidensis MR-1 proteins, an in silico digest of the protein was carried out using the online tool, protein prospector (http://prospector.ucsf.ed u/prospector/cgi-bin/msform.cgi?form=msdigest).
Strain Testing in the uMFC
10 mL of dense cell cultures were diluted to a final OD6oo of 1 .0 with fresh LB, along with replenishing required antibiotics (20 μg mL"1 Cm, 100 μg mL"1 Amp) and 0.5 mM IPTG. 200 μΙ of sample was injected into the anodic chamber of the μMFC with the cathode chamber facing upwards to allow full exposure to the air. The device was then connected to the computer through the use of an interface box, ADC-24 A-D converter computer interface (Pico Technology Ltd., Cambridgeshire, U.K.) and allowed to settle for 30 mins with no external resistance applied. A polarization curve was carried out to determine the maximum power density of the engineered strains by applying an external resistance which was decreased every 300 s. The initial starting resistance was 1 1 1 kQ, gradually decreasing to 1.1 1 kQ over 16 steps. Data obtained was then analyzed using Microsoft Excel.
Strain Testing in a Sedimentary Half Cell
10 mL of a dense, uninduced culture of engineered cells was condensed down to an OD6oo of 5. Within a flow hood, 1 mL of this sample was loaded into a sterile 250 mL Duran bottle of LB alongside the relevant antibiotics (20 μg mL"1 Cm, 100 μg mL"1 Amp) and 0.5 mM IPTG. A sterile carbon paper electrode (PRF Composite Materials, Poole, U.K.), woven with Ni/Ti wire, and a Ag/AgCI red rod reference electrode (Hach Lange, Salford, UK) were inserted, ensuring the carbon electrode was flat against the bottom. The Ni/Ti wire was fed through a small hole of the lid and the end of the reference electrode came through a similar hole. Aquarium Silicone Sealant was used to seal any gaps left in the lid (Aquatics Online Ltd, Bridgend, UK) after it was tightly screwed. The completed half cell was then transferred to a 37°C water bath and connected up to the computer via an ADC-24 A-D converter computer interface (Pico technology Ltd., Cambridgeshire, U.K.). Readings were taken every min for 900 mins, with data being analyzed on Microsoft Excel.
Results and Discussion for Section B:
Design of Portable Synthetic Electron Conduits
Escherichia coli is the model prokaryotic organism for synthetic biology techniques, with a vast number of studies documenting both heterologous expression of functional proteins and the introduction of foreign pathways (Yadav and Stephanopoulos 2010, Curr. Opin. Microbiol. 13, 371 -376). This versatile organism was chosen not only for these reasons, but also because functional expression of S. oneidensis MR-1 c-type cytochromes in £ coli has been shown to be possible for reduction of Fe (III) (Donald et al., 2008, J. Bacterial. 190, 5127-31 ). The highly conserved metal reduction genes within a large proportion of Shewanella species are MtrCAB and OmcA (James K Fredrickson et al., 2008, Nat. Rev. Microbiol. 6, 592- 603). These four proteins provide an electron transport pathway between the periplasm and insoluble extracellular terminal electron acceptors, all coded by genes located within a single operon on the genome. In order to channel electrons from the intracellular quinone pool to the periplasm, the inventors relied on the £ coli host inner membrane electron donors as previously seen (Pitts et al., J. Biol. Chem. 278, 27758-27765). The main hub of this activity was presumed to have originated from the £. coli ortholog of the S. oneidensis inner membrane tetraheme cytochrome CymA, namely NapC (Gescher et al., 2008, Mol. Microbiol. 68, 706-719). Some level of plasticity has been demonstrated within this network with residual iron reduction ability of MtrA in a ANapC mutant (Jensen et al. 2010, Proc. Natl. Acad. Sci USA 107, 19213-8). The new construct relies on over-expression of cytochrome maturation genes and the type II secretion pathway found in B- type strains, both of which have been shown to be vital in previous experiments in which S. oneidensis outer membrane cytochromes were expressed (Donald et al., 2008, J. Bacteriol. 190, 5127-31 )).
Expression of S. oneidensis MR-1 Cytochromes in E. coli.
In order to try and introduce electrogenic activity into the redundant host E. coli strain, the inventors constructed 3 plasmids in which cytochrome gene expression was under the regulation of a 77 lac promoter. The plasmids were pACYCOmcA {OmcA), pACYCOmcA-MtrCAB {OmcA-MtrCAB) and pRSFOmcA-MtrCAB (see Figure 10A) (Table S1.). The use of an additional IPTG inducible plasmid, pRGK333 (Figure 10A), containing cytochrome maturation genes (ccmABCDEFGH, denoted ccm), was required in combination with the S. oneidensis cytochromes due to the lack of expression of the equivalent maturation genes within E. coli under aerobic growth conditions (Thony-Meyer et al. 1995, J. Bacteriol. 177, 4321 -4326). In order to assess the expression of the cytochromes within E. coli, cells of all redundant strains were induced using 0.5 mM IPTG once they had reached an OD6oo of 0.5 to allow sufficient time for full expression. Cell pellets of the aerobically grown strains were collected and fractionated into soluble and insoluble fractions and resolved by SDS-PAGE. The supernatant collected from the harvested cell pellets was concentrated by acetone precipitation to allow the analysis of secreted proteins. Tryptic in-gel digests were analyzed by HPLC-ESI tandem mass spectrometry combined with a pseudo-selective reaction monitoring analysis (pSRM) (Pandhal et al., 201 1 , Biotechnol. Bioeng. 108, 902-12) for insoluble and soluble fractions (Table 1 )-
Phenyx Number
Mit plasmitl wit in Expressed Fraction Coverage
AC of E. coH strain proteins identified %
score peptides pACYCOmcA OmcA Soluble 23,77 5 6 (3)
OmcA insoluble 23.26 5 8 (3) pACYCOmcA- OmcA Insoluble 1 ,47 3 3 (2) i rCAB irC Insoluble 13.75 3 3 (2)
MtrA Soluble 5,77 ■ill 1 {1 }
ΜίΐΑ Insoluble 7.36 3 ΐ t m Soluble 1 1 .23 4 2 (2)
Insoluble 8.37 3 {1 }
Table 1 provides an analysis of engineered E. coli strains with the portable electron transporter assembly. The proteins identified are from the Mtr operon of S. oneidensis MR-1 through the use of Auto MS(n) and/or HPLC-ESI-pSRM (pseudo- selective reaction monitoring - see text) MS/MS, after resolving protein extractions via 1 D SDS-PAGE. A Phenyx AC score of at least 5.0 and maximum p-value of 1 x10~5 were considered an unambiguous identification. Brackets indicate the number of unique peptides from the total number identified. Polyclonal antibodies for MtrC, MtrA, and OmcA were used to carry out Western blots in order to detect cytochromes proteins present within the sample supernatants (Figure 13). OmcA was detected in the soluble, insoluble (through pSRM) and supernatant fractions, using Western blots for pACYCOmcA, showing the truly ubiquitous nature of this protein. OmcA was found in the insoluble and supernatant fractions for pACYCOmcA-MtrCAB. MtrCAB were all found in the insoluble fraction for pACYCOmcA-MtrCAB through the use of pSRM, with MtrA and B also being detected in the soluble fraction.
Current Can Be Generated From E. coli Expressing S. oneidensis C-Type Cytochromes Within A Microfluidic MFC.
A microfludic-scale MFC ^MFC) was chosen due to its many advantages: easy assembly, high power density per unit area, and utility for high throughput analysis of a wide number of strains (Ringeisen et al. 2006, Environ. Sci. Technol. 40, 2629-34). The main disadvantage of the μMFC is that long-term growth is unfeasible. In order to determine whether the £ coli strains expressing S. oneidensis cytochromes could produce current, the bacterial strains were each tested within the μΜΡΟ. A longer term analysis was carried out using a sedimentary fuel cell in which the negative redox potential generated by the bacterial culture was measured over 18 h (1080 min). A photograph and schematic diagram of the apparatus is shown in Fig. 1 1 . All cultures were diluted to OD6oo of 1 .0. They were then replenished with a carbon source (in the form of 5 mM sodium lactate), fresh antibiotics and IPTG (0.5 mM) were added before being loaded into the anode chamber of the μΜΡΟ. A polarization curve was generated by varying the load applied to all the channels of the μΜΡΟ. Each strain had 6 replicates carried out simultaneously within the different channels of tt^MFC.
As shown in Figure 12, the engineered strain containing pRSFOmcA-MtrCAB was capable of generating power within the μΜΡΟ, with a power output of ca. 17 mW m"2. This strain had a power output 6.4 mW m"2 higher than the control bearing the empty parent plasmid pACYCDuet-1 in combination with the overexpressed cytochrome maturation genes. Statistical analysis of the MFC results through the use of an unpaired i-test helped to confirm validity of this result by providing a p-value of 0.0017 at a 95% confidence interval. This strain also produced a power output 5 mW/m2 higher than pACYCOmcA, showing the requirement for more than a single ubiquitously expressed cytochrome to be able to achieve a higher power output. The functional interaction between a more complete electrogenic pathway in the form of OmcA-MtrCAB appears to be key to allowing £ coli to produce current more efficiently.
Previous studies on Fe (III) reduction by £ coli strains revealed that expression of MtrC, A, and B cytochromes in £. coli results in an engineered strain that can reduce metal ions and solid metal oxides 8x and 4* faster, respectively, than its parental strain (Jensen et al., 2010, Proc. Natl. Acad. Sci. USA 107, 19213-8). Before the present study, it was unclear whether cytochrome-containing £ coli strains would produce current in an MFC, especially given the observation that for Pelobacter carbinolicus the capacity for Fe (III) oxide reduction does not necessarily confer an ability to transfer electrons to fuel cell anodes (Richter et al., 2007, Appl. Environ. Mircobiol. 73, 5347-53). It is also not clear how similar (a) cytochromes in situ in S. oneidensis, with or without the presence of other cytochromes, (b) isolated cytochromes tested in vitro, and (c) cytochromes expressed in £ coli, are to each other and whether it is possible to draw generic functional conclusions. Gram negative bacteria are known to respond to stress conditions by shedding membrane vesicles (Kulp and Kuehn, 2010, Annu. Rev. Microbiol. 64, 163-64) and in the case of an OmcA-only E. coli strain it has been shown that these vesicles only carry OmcA molecules (Donald et al., 2008J. Bacteriol. 190, 5127-31 ). Analysis of both the OmcA-only and OmcA-MtrCAB cluster bacterial samples showed OmcA was always present in the supernatant. It is possible that vesicle-bound OmcA proteins are involved in electron transport maybe via bound flavins (Johs et al., 2010, Biophys. J. 98, 3035-43), and that the vesicles act as some sort of transport system to the anode surface.
Negative Potential Within A Sedimentary Half Cell
To verify the results and test the capability of the electrogenic strains within different devices, the inventors employed a sedimentary half cell (Figure 1 1 ). This provided an opportunity for a longer term analysis in which the carbon (working) electrode was placed in the base of the sedimentary half cell to allow the transfer of current from planktonic cells, sedimented bacteria and/or from bacterial biofilms. In combination with an Ag/AgCI red rod reference electrode, the negative potential from the reduction of the working electrode was calculated. The results clearly show a more negative potential in strains expressing S. oneidensis c-type cytochromes following a 15h growth period within the sedimentary half cell (Figure 12). Both the pACYC and pRSF derivatives of OmcA-MtrCAB gave a higher electrogenic potential than an empty plasmid (pACYCDuet-1 ). Synthetic electron transport conduit is not specific to device or plasmid
The inventors demonstrate here the introduction of electrogenic activity into a functionally redundant organism and that this effect is not device specific (Figure 12). The inventors also show that the robustness of the portable synthetic electron conduit genes is independent of the two plasmids employed in this study. Although both of these plasmids make use of the high-level expression T7 promoter, the copy number of the plasmids is significantly different, yet both engineered strains had similarly increased electrogenic capabilities. The chloramphenicol resistance plasmid pACYCDuet-1 uses a p15a origin of replication yielding 15-20 copies per cell compared to the over 100 copies produced with the kanamycin resistance plasmid pRSFDuet-1 (Tolia and Joshua-Tor, 2006, Nat. Methods 3, 55-64). This is the first exemplification of the introduction of electrogenic ability into a redundant strain through the use of modern synthetic biology techniques. The presence of extracellular cytochromes indicates the possibility of some level of mediator function.
Half cells
Following on from the demonstrated activity of the system within a rich media (LB) the strains BL21 DE3 pRGK333 pACYCOmcA and BL21 DE3 pRGK333 pACYCOmcA-MtrCAB were both tested in a half cell using minimal media.
The specific minimal media used was M9 minimal media with 0.4% carbon source, which was chosen as sodium lactate, as is the standard in the field of Bioelectrochemical systems.
M9 salts
5X M9 salts contains:
64 g Na2HP04.7H20
15 g KH2P04
2.5 g NaCI
· 5 g NH4CI
Dissolved in deionised water to a final volume of 1 L
M9 minimal media (inc 0.4% glycerol) · 1 x M9 salts
2mM MgS04
0.1 mM CaCI2
• 0.4% carbon source (e.g. glycerol, glucose, etc.)
In sterile H20
Cell setup
250 mL of M9 minimal media (0.4% sodium lactate) was filter sterilised into an autoclaved 250 mL capped duran bottle. The media was sparged with nitrogen gas for 15 mins, all carried out within a flow hood with air filters placed between tubing. Single colonies of each of the strains were picked and grown in 10 mL of LB media in a 50 mL falcon tube alongside 20 μg mL of Chloramphenicol and 100 μg mL of Ampicillin. Cultures were grown at 200 RPM, 37 °C for 15 hours without the presence of an inducing molecule. OD6oo readings were taken following growth. Cultures were spun down in a centrifuge at 4000 RPM for 15 mins and resuspended to an OD6oo of 5.0. 1 ml_ of this culture was then added to the sparged half cells as described in our earlier method setup. Cells were setup with 20 μg mL of Chloramphenicol, 100 μg mL of Ampicillin and 0.5 mM IPTG. Once the cells had been sealed and transferred to a 37°C waterbath, they were connected to the picologger and data readings of the negative potential were taken every minute. Analysis was carried out for 8 days in order to demonstrate activity over a longer period (Figures 14 and 15). The results shown in Figures 14 to 16 clearly show a difference in activity between BL21 DE3 pRGK333 pACYCOmcA and BL21 DE3 pRGK333 pACYCOmcA-MtrCAB. The expression of MtrCAB alongside OmcA has been shown to allow for an increased export of electrons from the cell to the electrode when compared to the sole expression of OmcA. This was all shown in minimal media with defined carbon source, sparged with nitrogen to remove any dissolved oxygen and over an extended period of analysis. The presented result is further confirmatory evidence of the activity of the system. Examples section C: Microbial Fuel Cells comprising transformed Shewanella (S.) oneidensis cell cultures
Bacterial conjugation
Shewanella (S.) oneidensis MR-1 Wild Type (WT) was conjugated with E. coli S17 strain having the plasmid of interest in order to infect and introduce said plasmid into S. oneidensis MR-1 WT. In detail, pBBRI MCS empty and pBBR1 MCS:OmcA plasmids were transformed into E. coli SM strain prior the bacterial conjugation using standard biological techniques. An overnight culture of S. oneidensis MR-1 (MR-1 ) at 25°C and 150 rpm was prepared by selecting an individual colony from a plate of LB agar with the aid of a sterilized wire loop and inoculating it in 10 mL of LB. At the same time, an overnight culture of both transformed E. coli S17 strains was prepared also by selecting an individual colony from a plate of LB agar with the aid of a sterilized wire loop and inoculating it in 10 mL of LB + streptomycin + antibiotic for plasmid selection (Chloramphenicol in the case of pBBRI MCS). Next day, the cells were harvested by centrifugation (4000 rpm for 10 min) and wash the cell pellets twice with sterilised PBS to remove antibiotics. Each cell pellet was resuspended in 0.5 mL PBS and then mixed together. For the mating, 200 μ\- of the 1 mL cell suspension were spread onto LB agar plate (no antibiotics) and left at 25°C for 8 hours for the mating to happen. The cells were then scraped off the LB agar with a cell spreader and 1 ml of PBS and transferred to a clean eppendorf. Serial dilutions of 200 μ\- were plated onto LB agar with selection antibiotics (Ampicillin and Chloramphenicol) and incubated at 25°C. Successful colonies were restreaked in the same LB agar plates.
A suitable micro-microbial fuel cell (MicroMFC) device was constructed from using pure carbon fibre veil (PRF Composite Materials, Poole, U.K.) cut into 2 x 10 mm oblongs with the total surface area being 200 mm2. The PEM was a made to order Nafion membrane with a carbon and platinum cathode side (Ion Power Inc, Delaware, USA). Both the anode and cathode sections had a 1 mm x 2 mm section of copper tape attached to provide a conductive appendage for attachment to an interface and resistance box and then data acquisition device.
MicroMFC tests for MR-1 pBBRI MCS empty and MR-1 pBBR1 MCS:OmcA in LB media were carried out. In detail, an overnight culture of MR-1 pBBRI MCS empty and MR-1 pBBR1 MCS:OmcA at 25°C and 150 rpm was prepared by selecting an individual colony from a plate of LB agar with the aid of a sterilized wire loop and inoculating it in 10 mL of LB plus Chloramphenicol (Cm). 1 mL of each overnight culture was sub-cultured in 100 mL LB plus Cm and grown overnight at 25°C and 150 rpm. Next day, the Optical Density (OD) at 600nm using a spectrophotometer was taken of both cultures, and then diluted with fresh LB plus antibiotics to an OD6oo 1 -0 plus 5 mM sodium lactate.
The culture was injected respectively into the six anodic chambers of the microMFCs and weighed accordingly to determine the rough cell weight within each of the channels. In detail, 200 μ\- of the OD6oo 1 -0 cell suspension were used to inoculate each anodic chamber. After weighing, the anode and cathode chambers were connected to an interface box. The readings from the MFCs are taken by a Picolog ADC 24 analogue to digital voltage recorder (Pico technology, Cambridgeshire, UK). The computer was then set to record using Picologger software, noting the voltage in each channel every second. The MFCs were left at open channel (no applied load) for 2 hours to allow the samples to settle within the chambers. A note is made of the sample reading and the polarisation curve is then started. The polarisation curves are generated by connecting the microMFC up to a decade resistance box (Farnell, U.K.) set at a starting resistance of 100 kQ and decreasing in steps of 10 kQ down to 10 kQ. The resistance was then decreased by steps of 2 kQ down to 2 kQ and moved a single kQ down to 1 kQ. The final set of resistance changes were from 1 kQ to 200 Ω in 200 Ω decrements. The MFCs were left for at least 300 seconds between each resistance change to allow to cell voltage to level out. Recorded data was then analysed using Microsoft Excel.
In order to be able to directly compare one strain to another the maximum power density was calculated. This provides more information than the voltage output as it allows the resistance at which the greatest power is output is achieved. The point of external resistance at which this occurs is equal to the internal resistance of the MFC (leropoulos et al., 2008). In order calculate the power density achieved in the MFC the current (I) firstly needed to be calculated using Ohm's law, l=V/R, where V is the measured voltage and R is the known external resistance. Power can then be calculated (W) by multiplying current by voltage, P=lxV. This then allows the power density to be determined by dividing the power by the surface area of the electrode PDensity = P/SA. The power density is presented as mW/m2. The power density (PD) of S. oneidensis MR-1 modified strains grown in LB media were measured in MFCs with the values for peak average power density shown in Figure 17.
Empty plasmid pBBRI MCS in S. oneidensis MR-1 gave a PD of 1.85 mW/m2
OmcA-pBBR1 MCS in S. oneidensis MR-1 gave a PD of 2.78 mW/m2
Thus the over-expression of the S. oneidensis OmcA protein in S. oneidensis MR-1 leads to an increase of power output of circa 150%.
The remarkable and versatile characteristics of OmcA and S. oneindensis MR-1 has again been demonstrated in this work.
Examples section D: Supporting information
SI Materials and Methods
Strains and Plasmids Primers containing AscI and NotI restriction sites (Table S1 ) (Invitrogen, Paisley, UK) were used alongside Phusion High-Fidelity DNA polymerase (NEB, Hitchin, UK) in order to amplify the desired sequences from MR-1 genomic DNA. The fragments were extracted from a 1 % agarose gel using a QIAquick Gel Extraction Kit (Qiagen, West Sussex, UK) and subsequently digested using AscI and NotI before ligation into pACYCDuet-1 using T4 DNA ligase (NEB). The inducible ccm plasmid, pRGK333, encodes the genes ccmA-H under a tac promoter and carries an ampicillin resistance marker. Extraction of Soluble Protein Fractions
90 mL of cell culture from 100 mL cell growth was spun down at 2800 rpm, 10 min with the supernatant immediately being poured to a separate labelled container. The remaining cell pellet was transferred to LoBind microcentrifuge tubes (Eppendorf, Cambridge, UK). 700 μΙ_ of the cell pellet was taken to a separate container with the remainder being stored in the freezer for later use. The 700 μΙ_ of cell pellet was spun down at 13,000 rpm for 15 min with the supernatant being discarded and the remaining cell weight weighed. Twice the cell weight was added in glass beads cells along with wash buffer for metalloproteins (150 mM NaCI, 100 mM Tris-HCI, pH 8.0). The cell pellet was dislodged with a pipette tip and then vortexed for 30 s. Cell samples were then vortexed for 1 min at max speed, 1 min on ice, repeated 3 times. The samples were then spun down at 13,000 rpm for 15 min and the supernatant containing the soluble protein fraction carefully transferred to a fresh LoBind tube and stored at -20°C for future use. Extraction of Insoluble Protein Fractions
The remaining cell pellet from the soluble protein fraction extraction was then used to extract the remaining insoluble protein fraction. The cell pellet was resuspended in extraction buffer (6M Urea, 150 mM NaCI, 100 mM Tris-HCI, 1 mM EDTA, pH 8.0) at a ratio of 100 μΙ_ of buffer for every 100 mg of initial cell weight. The pellet was dislodged using a pipette tip, vortex for 30 s, and then kept on ice for 1 h. The samples were then vortexed and centrifuged for 30 min at 13,000 rpm. The supernatant being the insoluble protein fraction was transferred to a fresh LoBind tube and stored at -20°C for further use. Identification of Supernatant Proteins
Supernatant proteins were analysed using a procedure modified from Jiang et al (2004; Journal of chromatography A. 1023, 2.317-320). The supernatant that was obtained from spinning down 90 mL of culture was collected in a 50 mL falcon tubes. Three times supernatant volume of ice cold acetone was added to the sample, mixed well and stored at -20°C for 4 h. The 200 mL sample was then aliquoted into 4 separate 50 mL falcon tubes and spun at 14,000 rpm, 4°C for 20 min to pellet the proteins. The supernatant was poured off and the remaining pellet was resuspended in 2 mL of 6M Urea, 150 mM NaCI, 100 mM Tris-HCI, 1 mM EDTA, pH 8.0.
Western Blotting of MtrA, MtrC and OmcA
In order to carry out the Western blot samples, proteins were resolved in an SDS PAGE gel as described above before being electro-transferred to a PVDF membrane using an iBIot® Gel Transfer device (Invitrogen), following the manufacturer's protocol. After transfer, the membranes were incubated in 25 mL of blocking buffer (1 X TBS, 0.1 % Tween-20 with 5% w/v nonfat dry milk) for one hour at room temperature. Each membrane was then washed three times for 5 min each with 15 mL of TBS/T (1 X TBS, 0.1 % Tween-20). Membranes were incubated with the respective primary antibody (1 :10,000) in 10 mL of blocking buffer with gentle agitation overnight at 4°C. Next day the membranes were incubated with the species goat HRP-conjugated secondary antibody after washing three times for 5 min each with 15 mL of TBS/T. The secondary antibody was diluted (1 :5,000) in 10 mL of blocking buffer. Each membrane was then washed three times for 5 min each with 15 mL of TBS/T before incubation with 3 mL Immubilon western HRP substrate peroxide solution and 3 mL Y mix Immubilon western HRP substrate Luminol reagent (Millipore corporation, Billerica, MA, USA) for 5 min. Samples were then visualized using a CCD camera (ImageQuant-RT ECL system; GE Healthcare, Amersham, UK). Western blot images were analyzed using image analysis software (ImageQuant TL; GE Healthcare).
In Gel Digestion and MS/MS Identification
Selected and excised gel pieces were digested in-gel with modified trypsin. In brief, each gel piece was destained (200 mM ammonium bicarbonate in 40% ACN for 30 min at 37°C, performed twice), reduced (10 mM DTT for 30 min at 56°C) and alkylated (55 mM iodoacetamide and 50 mM ammonium bicarbonate for 20 min in the dark at room temperature). Gel pieces were completely dried in a vacuum concentrator (Eppendorf AG, Cambridge, UK) prior to adding trypsin, at a 1 :50 mass ratio (0.14 μg of trypsin). Trypsin was prepared according to the manufacturer's protocol. After overnight digestion at 37°C, the digested peptides were extracted. This was done by one change of 25 mM ammonium bicarbonate at room temperature for 10 min, followed by one change of 100% ACN, a change of 5% formic acid, and a final extraction with 100% ACN, incubating at 37°C for 15 min for each change. All liquid phases were combined and dried in a vacuum concentrator. Dried digests were stored at -20°C.
Sample analysis by HPLC-MS/MS
Prior to the sample analysis via HPLC-MS/MS, dried samples were reconstituted with 24 μΙ_ of 0.1 % TFA and 3% ACN solution. Peptide mixtures were separated on a C18 PepMap100 column (3 μηι, 100A, 75 μηι ID x 15 cm) using an Agilent Ultimate 3000 HPLC system (Amsterdam, The Netherlands). 10 μΙ_ of extracted peptide solution was injected by the Famos autosampler onto a 0.3 mm ID x 5 mm OD trap column (m-Precolumn™ Cartridge, PepMap C18, 5 μηη, 100 A) prior to the resolving column at a flow rate of 300 nL-min"1. HPLC-ESI solvents contained 0.1 % FA and either 3% ACN (solvent A) or 97% ACN (solvent B). The column was pre-equilibrated with solvent A. Separation of the peptides was performed on a linear gradient from 5 to 35% solvent B, in 40 min. The electrospray fused silica PicoTip needle (New Objective, Inc., Woburn, MA) was operated with a voltage differential of 5.5 kV. Survey scans were acquired from 350 to 1 ,800 mlz, and MS/MS scans from 65 to 1 ,800 m/z. The spectrometer sequentially conducted MS/MS on the precursor ions (+2 and +3 charge state) detected in the full scan. All analyses were performed on an HCT Ultra PTM Discovery ESI-lon Trap MS/MS system (Bruker Daltonics, Coventry UK).
HPLC-ESI-pSRM MS/MS analysis
If proteins were not detected through HPLC-MS/MS analysis then high sensitivity MS/MS analysis was carried out on a HCT Ultra PTM Discovery ESI-lon Trap MS/MS, using a method modified from Pandhal et al., 201 1 , Biotechnol. Bioeng. 108, 902-12) for insoluble and soluble fractions . The samples were prepared using the same method as described above. This also applies for the chromatographic separation of peptides using the Ultimate 3000 system, although this was done over a 55 min gradient of 3-35%. In order to detect proteins through the use of HPLC-ESI- pSRM MS/MS, the specific ions (mass/charge values) that were to be isolated and fragmented needed to be defined. The specific ions are peptides resulting from digestion of the total protein. The selection of the ions was done through two different methods. An in-gel digest of Shewanella was carried out as stated for other strains and analysed using HPLC-MS/MS. The peptides that were identified through this were selected for their detection. An in-silico digestion of the proteins was also carried out through the use of an online tool - protein prospector (http://prospector.ucsf.edu/prospector/cgi-bin/msform. cgi?form=msdigest). Peptides were selected that carried at least 2 charges, lacked predicted oxidation sites (and therefore tried to avoid those with Methionine residues) and if possible, carboxylated cysteine residues. The m/z range of these peptides was between 400 and 800, with differentially charged variants of peptides among those chosen. A maximum of 10 individual ions were then chosen to be selected and fragmented within the MS within an isolation window of 4 m/z. Collected Trap pSRM-MS/MS, scans were analyzed using DataAnalysis v 4.0 (Bruker Daltonics, Coventry UK).
MS/MS Data Analysis for Protein Identification
Data processing of HPLC-MS/MS samples were first parsed using proprietary vendor analysis software, HyStar v 3.2 Service Pack 1 , and processing module, Data Analysis v 4.0 Service Pack 2 (all from: Bruker Daltonik GmbH, Bremen Germany). MS/MS data recovery to MGF was processed via an embedded daMGF script. Data were then searched using a local Phenyx v2.5 (Genebio, Geneva Switzerland) processing cluster at the ChELSI Institute against the Escherichia coli BL21 - Gold(DE3)pLysS_AG protein database (downloaded from ftp://ftp.ncbi.nih.gov/genomes/Bacteria/, on May 201 1 , with 8,456 protein entries) merged with a database containing relevant Shewanella oneidensis MR-1 sequences (7 protein sequences). The search parameters were set as follows: MS tolerance was 1.2 Da and MS/MS tolerances were set at: peptide tolerance 0.6 Da, charge +2 and +3. Minimum peptide length, AC score, and maximum p-value, were 6, 6, and 1 x10~6, respectively. The enzyme mode for searching was trypsin, permitting up to two missed cleavages. Modifications were performed as follows: cys CAM (+57 Da) as fixed modification on the C residue, and oxidation of methionine (+16 Da) as variable modification on the M residue. ESI - ion trap (HCTultra) was the set instrument. These data were then searched for within the reversed merged database to estimate the false positive peptide discovery rate using the formula, false positive peptide discovery rate = 2 decoy_hits/(decoy_hits + true_hits), as detailed elsewhere (37). Processed data were exported to Excel via Phenyx local export to retrieve peptide identification data. Microfluidic MFC Setup
The electrode material used within the anode chambers was carbon fibre cloth fabric (Carbon Mods, Longton, U.K.). The carbon cloth pulled apart to defined fibres that were of 2.5 mm and were cut to 35 mm in length. The MFC used is a single chamber device utilising an air cathode chamber with an internal anodic chamber volume of between 130-150 μΙ (38) as shown in Figure 3. The two chambers are separated by a modified proton exchange membrane (PEM) (Ion Power, New Castle, DE, USA). The cathode side of the PEM was carbon coated and loaded with 0.27 Pt cm"2, whilst the anode side was pure Nafion N1 15. All PEM used had been stored in distilled water for at least 12 h before use in the fuel cell.
Strain Testing within Microfluidic MFC
Cell samples were loaded into the anode chamber of each channel using a 0.5mm x 16 mm syringe until the chamber was filled with culture. The μMFC was connected up to an interface box and the data was acquired in millivolts (mV) using an ADC-24 A-D converter computer interface (Pico technology Ltd., Cambridgeshire, U.K.). The μMFC was left at O/C for 30 min to allow the cells to settle within the chamber before a polarisation curve was taken.
The polarisation curves are generated by connecting the μMFC up to a decade resistance box (Farnell, U.K.) set at a starting resistance of 100 kQ and decreasing in steps of 10 kQ down to 10 kQ. The resistance was then decreased by 2 kQ down to 2 kQ and moved a single kQ down to 1 kQ. The final set of resistance changes were from 1 kQ to 200 Ω in 200 Ω decrements. The μΜΡΰβ were left for at least 500 seconds between each resistance change to allow the voltage to level out. Recorded data was then analysed using Microsoft Excel. In order to be able to directly compare one strain to another the maximum power density was calculated. This provides more information than the voltage output as it allows the resistance at which the greatest power is output is achieved. The point of external resistance at which this occurs is equal to the internal resistance of the MFC. In order calculate the power density achieved in the MFC the current (I) firstly needed to be calculated using Ohm's law, l=V/R, where V is the measured voltage and R is the known external resistance. Power can then be calculated (W) by multiplying current by voltage, P=lxV. This then allows the power density to be determined by dividing the power by the surface area of the electrode PDensity = P/SA. The power density is presented as mW m"2.
Strain Testing Within Sedimentary Half Cell In order to verify the results from the microbial fuel cells the electrogenic strains were also tested within a half cell. Half cells were constructed using carbon paper (PRF Composite Materials, Poole, U.K.) cut into discs measuring 7 cm in diameter (area calculated as 38.5 cm2). Four of these were required on top of each other to form a single working electrode. Ni/Ti wire was cut to 18 cm in length, pierced through the centre of the carbon paper discs and woven through 3 times towards, but not past the outer edge. This was done 4 times with 4 separate lengths of wire, leaving the disc with a metallic cross in it. The remaining lengths of the wire were twisted around each other to leave a straight column of wire. These were then autoclaved alongside 250 mL of LB in 250 mL Duran bottles, and the pierced lids.
Single colonies of engineered strains were picked from antibiotic selective plates and transferred to 50 mL falcon tubes containing 10 mL, 20 μg mL"1 Cm and 100 μg mL"1 Amp. These were left to grow at 37°C, 150-rpm O/N. Cells were concentrated to OD6oo 0.5 by spinning at 2800-rpm for 10 min and removing the desired amount of supernatant. 300 μΙ of each culture was then used to inoculate the 250 mL of LB in each half cell. Readily cleaned and calibrated Ag/AgCI red rod reference electrodes (Hach Lange, Salford, UK) were used to setup the half cells with the autoclaved working electrode and sealed with Aquarium Silicone Sealer (Aquatics Online Ltd, Bridgend, UK). Each half cell setup, containing both reference and working electrode was constructed with three replicates per strain. These were then connected an ADC-24 A-D converter computer interface to measure negative voltage (-mV) output every minute, over an18 h period. Redox potential generated by the bacterial cultures was calculated through the potential difference between the carbon cloth working electrode and the Ag/AgCI red rod reference electrode.
Sequences included in this application
SEQ ID NO: Gene/construct
1 OmcA
2 MtrA
3 MtrB
4 MtrC
5 MtrD
6 MtrE
7 MtrF
8 MtrDEF
9 MR-1
10 MtrA-F
1 1 pACYCOmcA
12 pACYC MtrDEF
13 pACYCMR-1
14 MtrFCAB
15 MtrABC

Claims

Claims
1 . An electrogenic micro-organism host cell comprising at least one heterologous electrogenic pathway gene.
2. A micro-organism according to claim 1 wherein each heterologous 5 electrogenic pathway gene encodes an electrogenic pathway protein or portion thereof.
3. A micro-organism according to claim 1 or 2 which is a bacterium.
4. A micro-organism according to claim 3 which is a bacterium from the genera Geobacter, Shewanella or which is an Escherichia coli strain.
105. A micro-organism according to any preceding comprising at least one of the
Shewanella oneidensis MR-1 genes MtrB, MtrC, MtrD, MtrE, MtrF or OmcA and/or at least one of the Geobacter genes OmcS and/or OmcZ.
6. A micro-organism according to claim 5 further comprising the Shewanella oneidensis MR-1 gene MtrA.
157. An electrogenic micro-organism according to any preceding claim characterised in that, when in use in a microbial fuel cell, a greater power density is obtainable from the microbial fuel cell compared to the power density obtainable from a microbial fuel cell comprising an equivalent host cell not comprising the heterologous electrogenic pathway protein.
208. A microbial fuel cell comprising an electrogenic micro-organism according to any of claims 1 -7.
9. A microbial fuel cell according to claim 8 characterised in that, in use, the power density is greater than the power density obtained in an equivalent microbial fuel cell comprising a host cell equivalent to the micro-organism host cell according to
25 any of claims 1 -7 which does not comprise the heterologous electrogenic pathway gene.
10. An expression vector comprising one or more of the polynucleotide sequences of pACYCOmcA, pACYCMtrDEF and/or pACYCMR-1 .
1 1 . A method of obtaining an electrogenic micro-organism according to any of 30 claims 1 -7 comprising expressing in a host cell at least one of the Shewanella oneidensis MR-1 genes MtrB, MtrC, MtrD, MtrE, MtrF or OmcA and/or at least one of the Geobacter genes OmcS and/or OmcZ.
12. A method according to claim 1 1 comprising expressing in the host cell the Shewanella oneidensis MR-1 gene MtrA.
3513. A method according to claim 1 1 or 12 wherein the expressing comprises transforming the host cell with a nucleotide comprising a polynucleotide sequence of at least one of the genes MtrB, MtrC, MtrD, MtrE, MtrF, OmcA, OmcS and/or OmcZ.
14. A method according to claim 13 comprising transforming the host cell with the expression vector pOmcA and/or pACYCOmcA and/or pACYCMtrDEF and/or pACYCMR-1 .
15. A method according to claim 13 or 14 comprising transforming the host cell 5 with at least one expression vector according to claim 10.
16. A method according to any of claims 1 1 -15 comprising the step of confirming that the host cell is an electrogenic micro-organism after expressing the one or more genes in said cell by using the host cell in a microbial fuel cell and determining that the power density obtainable in the microbial fuel cell is greater than the power
10 density obtainable in a microbial fuel cell comprising an equivalent host cell not comprising the one or more genes.
17. A method according to any of claims 1 1 -16 wherein the host cell is a strain of the genera Geobacter or Shewanella, or wherein the host cell is an Escherichia coli cell.
1518. A method according to claim 17 wherein the Escherichia coli is a BL21 strain cell.
19. A method according to claim 18 wherein the BL21 strain cell is a DE3 strain cell.
20. An electrogenic micro-organism host cell in which an electrogenic pathway 0 gene is overexpressed compared to expression of the gene in the naturally occurring host cell.
PCT/GB2012/051319 2011-06-10 2012-06-11 Bacteria Ceased WO2012168743A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB1109756.5A GB201109756D0 (en) 2011-06-10 2011-06-10 Bacteria
GB1109756.5 2011-06-10

Publications (2)

Publication Number Publication Date
WO2012168743A2 true WO2012168743A2 (en) 2012-12-13
WO2012168743A3 WO2012168743A3 (en) 2013-03-21

Family

ID=44357530

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2012/051319 Ceased WO2012168743A2 (en) 2011-06-10 2012-06-11 Bacteria

Country Status (2)

Country Link
GB (1) GB201109756D0 (en)
WO (1) WO2012168743A2 (en)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2706120A1 (en) * 2012-09-05 2014-03-12 Karlsruher Institut für Technologie Biosensor comprising a mtr-gene construct
CN104577143A (en) * 2015-01-13 2015-04-29 浙江大学 Method for preparing antibacterial air cathode
WO2016120641A1 (en) * 2015-01-30 2016-08-04 University Of The West Of England, Bristol Microbial fuel cell, method of controlling and measuring the redox potential difference of the fuel cell
WO2016187195A1 (en) * 2015-05-21 2016-11-24 University Of Georgia Research Foundation, Inc. Engineered photosynthetic organisms, photosynthetic electrodes including the engineered photosynthetic organisms, photosynthetic bioelectrochemical cells and photosynthetic fuel cells
JP2018145155A (en) * 2017-03-08 2018-09-20 東洋紡株式会社 Electron mediator
CN110628689A (en) * 2019-10-18 2019-12-31 南京工业大学 A succinic acid-producing Escherichia coli genetically engineered bacterium and its construction method and application
CN112921047A (en) * 2021-03-16 2021-06-08 天津大学 Shewanella electrogenesis strain for over-expressing cytochrome protein and construction method and application thereof
CN115976089A (en) * 2022-09-09 2023-04-18 天津大学 Method for improving electric energy output by engineering reinforced Shewanella vesicle secretion

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100279178A1 (en) * 2009-02-23 2010-11-04 Barkeloo Jason E Microbial fuel cell
US9074198B2 (en) * 2009-05-27 2015-07-07 University Of Massachusetts Geobacteraceae strains and methods
WO2012037123A1 (en) * 2010-09-13 2012-03-22 Regents Of The University Of Minnesota Microbes, methods, and devices for redox-imbalanced metabolism
JP2012190787A (en) * 2011-02-24 2012-10-04 Sony Corp Microbial fuel cell, fuel and microbe for the fuel cell, and bioreactor and biosensor

Non-Patent Citations (28)

* Cited by examiner, † Cited by third party
Title
AELTERMAN ET AL., WATER SCI. TECHNOL., vol. 54, 2006, pages 9 - 15
ARSLAN ET AL., BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 747, 1998, pages 744 - 747
BROWN: "Molecular Biology Labfax", 1991, ACADEMIC PRESS
DONALD ET AL., J. BACTERIAL., vol. 190, 2008, pages 5127 - 31
DONALD ET AL., J. BACTERIOL., vol. 190, 2008, pages 5127 - 31
DONALD ET AL., J. BACTERIOL., vol. 190, 2008, pages 5127 - 5131
FEISSNER R ET AL., MOL. MICROBIOL., vol. 60, 2006, pages 563 - 577
FILLOUX, TRANSPORT OF MOLECULES ACROSS MICROBIAL MEMBRANES, 1999
GAN ET AL., PROTEOMICS, vol. 5, 2005, pages 2468 - 2478
GESCHER ET AL., MOL. MICROBIOL., vol. 68, 2008, pages 706 - 719
JAMES K FREDRICKSON ET AL., NAT. REV. MICROBIOL., vol. 6, 2008, pages 592 - 603
JENSEN ET AL., PROC. NATL. ACAD. SCI USA, vol. 107, 2010, pages 19213 - 8
JENSEN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 107, 2010, pages 19213 - 8
JIANG ET AL., JOURNAL OF CHROMATOGRAPHY A., vol. 1023, no. 2, 2004, pages 317 - 320
JOHS ET AL., BIOPHYS. J., vol. 98, 2010, pages 3035 - 43
KULP; KUEHN, ANNU. REV. MICROBIOL., vol. 64, 2010, pages 163 - 64
LEROPOULOS ET AL., INT. J. ENERGY RES., vol. 32, 2008, pages 1228 - 1240
LOGAN: "Microbial Fuel Cells", 2008, PUB. WILEY
MEYERS ET AL., CABIOS, vol. 4, 1989, pages 11 - 17
NEEDLEMAN ET AL., J. MOL. BIOL., vol. 48, 1970, pages 444 - 453
PANDHAL ET AL., BIOTECHNOL. BIOENG., vol. 108, 2011, pages 902 - 12
PITTS ET AL., J. BIOL. CHEM., vol. 278, pages 27758 - 27765
RICHTER ET AL., APPL. ENVIRON. MIRCOBIOL., vol. 73, 2007, pages 5347 - 53
RINGEISEN ET AL., ENVIRON. SCI. TECHNOL., vol. 40, 2006, pages 2629 - 34
SAMBROOK ET AL.: "Molecular Cloning, a laboratory manual", 2001, CSHL PRESS
THONY-MEYER ET AL., J. BACTERIOL., vol. 177, 1995, pages 4321 - 4326
TOLIA; JOSHUA-TOR, NAT. METHODS, vol. 3, 2006, pages 55 - 64
YADAV; STEPHANOPOULOS, CURR. OPIN. MICROBIOL., vol. 13, 2010, pages 371 - 376

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2706120A1 (en) * 2012-09-05 2014-03-12 Karlsruher Institut für Technologie Biosensor comprising a mtr-gene construct
CN104577143A (en) * 2015-01-13 2015-04-29 浙江大学 Method for preparing antibacterial air cathode
WO2016120641A1 (en) * 2015-01-30 2016-08-04 University Of The West Of England, Bristol Microbial fuel cell, method of controlling and measuring the redox potential difference of the fuel cell
US10811718B2 (en) 2015-01-30 2020-10-20 University Of The West Of England, Bristol Microbial fuel cell, method of controlling and measuring the redox potential difference of the fuel cell
WO2016187195A1 (en) * 2015-05-21 2016-11-24 University Of Georgia Research Foundation, Inc. Engineered photosynthetic organisms, photosynthetic electrodes including the engineered photosynthetic organisms, photosynthetic bioelectrochemical cells and photosynthetic fuel cells
JP2018145155A (en) * 2017-03-08 2018-09-20 東洋紡株式会社 Electron mediator
JP7039847B2 (en) 2017-03-08 2022-03-23 東洋紡株式会社 Electronic mediator
CN110628689A (en) * 2019-10-18 2019-12-31 南京工业大学 A succinic acid-producing Escherichia coli genetically engineered bacterium and its construction method and application
CN110628689B (en) * 2019-10-18 2021-10-26 南京工业大学 Escherichia coli genetic engineering bacterium for producing succinic acid and construction method and application thereof
CN112921047A (en) * 2021-03-16 2021-06-08 天津大学 Shewanella electrogenesis strain for over-expressing cytochrome protein and construction method and application thereof
CN115976089A (en) * 2022-09-09 2023-04-18 天津大学 Method for improving electric energy output by engineering reinforced Shewanella vesicle secretion

Also Published As

Publication number Publication date
GB201109756D0 (en) 2011-07-27
WO2012168743A3 (en) 2013-03-21

Similar Documents

Publication Publication Date Title
WO2012168743A2 (en) Bacteria
Liu et al. Biological synthesis of high-conductive pili in aerobic bacterium Pseudomonas aeruginosa
Walker et al. Syntrophus conductive pili demonstrate that common hydrogen-donating syntrophs can have a direct electron transfer option
Ueki et al. An Escherichia coli chassis for production of electrically conductive protein nanowires
Wang et al. Enhancing electrical outputs of the fuel cells with Geobacter sulferreducens by overexpressing nanowire proteins
Walker et al. Electrically conductive pili from pilin genes of phylogenetically diverse microorganisms
Strycharz et al. Gene expression and deletion analysis of mechanisms for electron transfer from electrodes to Geobacter sulfurreducens
Kouzuma et al. Disruption of the putative cell surface polysaccharide biosynthesis gene SO3177 in Shewanella oneidensis MR-1 enhances adhesion to electrodes and current generation in microbial fuel cells
Joshi et al. Geobacter sulfurreducens inner membrane cytochrome CbcBA controls electron transfer and growth yield near the energetic limit of respiration
Su et al. A hybrid cyt c maturation system enhances the bioelectrical performance of engineered Escherichia coli by improving the rate-limiting step
Liu et al. Molecular evidence for the adaptive evolution of Geobacter sulfurreducens to perform dissimilatory iron reduction in natural environments
Myers et al. Engineering nanowires in bacteria to elucidate electron transport structural–functional relationships
Liu et al. Effect of temperature on the catalytic ability of electrochemically active biofilm as anode catalyst in microbial fuel cells
US20230040959A1 (en) Expression of electrically conductive protein nanowires in escherichia coli
WO2021084526A1 (en) Engineered autotrophic bacteria for co2 conversion to organic materials
Richter et al. Significance of a posttranslational modification of the PilA protein of Geobacter sulfurreducens for surface attachment, biofilm formation, and growth on insoluble extracellular electron acceptors
WO2020191281A1 (en) Microbial nanowires modified to contain peptides and methods of making
Hu et al. All roads lead to Rome: Cyclic di-GMP differentially regulates extracellular electron transfer in Geobacter biofilms
Gu et al. Rewiring the respiratory pathway of Lactococcus lactis to enhance extracellular electron transfer
Chen et al. CRISPR/dCas9-RpoD-mediated simultaneous transcriptional activation and repression in Shewanella oneidensis MR-1
Ueki et al. Generation of high current densities in Geobacter sulfurreducens lacking the putative gene for the PilB pilus assembly motor
Lin et al. Expression of filaments of the Geobacter extracellular cytochrome OmcS in Shewanella oneidensis
Shen et al. A widespread and ancient bacterial machinery assembles cytochrome OmcS nanowires essential for extracellular electron transfer
Zhao et al. Effect of Fe (III) on the performance of sediment microbial fuel cells in treating waste-activated sludge
CN108676079A (en) Conductive four type pili and its encoding gene and the carrier containing the gene and production bacterial strain and its application accordingly

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12728114

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12728114

Country of ref document: EP

Kind code of ref document: A2