WO2012168399A1 - Methods for predicting, treating and modelling hormone resistance - Google Patents

Methods for predicting, treating and modelling hormone resistance Download PDF

Info

Publication number
WO2012168399A1
WO2012168399A1 PCT/EP2012/060849 EP2012060849W WO2012168399A1 WO 2012168399 A1 WO2012168399 A1 WO 2012168399A1 EP 2012060849 W EP2012060849 W EP 2012060849W WO 2012168399 A1 WO2012168399 A1 WO 2012168399A1
Authority
WO
WIPO (PCT)
Prior art keywords
mutation
prkaria
hormone
camp
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2012/060849
Other languages
French (fr)
Inventor
Caroline SILVE
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institut National de la Sante et de la Recherche Medicale INSERM
Original Assignee
Institut National de la Sante et de la Recherche Medicale INSERM
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institut National de la Sante et de la Recherche Medicale INSERM filed Critical Institut National de la Sante et de la Recherche Medicale INSERM
Publication of WO2012168399A1 publication Critical patent/WO2012168399A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/573Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90Enzymes; Proenzymes
    • G01N2333/91Transferases (2.)
    • G01N2333/912Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • G01N2333/91205Phosphotransferases in general
    • G01N2333/9121Phosphotransferases in general with an alcohol group as acceptor (2.7.1), e.g. general tyrosine, serine or threonine kinases
    • G01N2333/91215Phosphotransferases in general with an alcohol group as acceptor (2.7.1), e.g. general tyrosine, serine or threonine kinases with a definite EC number (2.7.1.-)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/02Screening involving studying the effect of compounds C on the interaction between interacting molecules A and B (e.g. A = enzyme and B = substrate for A, or A = receptor and B = ligand for the receptor)

Definitions

  • the present invention provides novel mutations in the gene encoding for the regulatory subunit type 1A of cyclic adenosine 5'-monophosphate-dependent protein kinase (PRKAR1A) that are responsible for hormone resistance. Accordingly, the present invention relates to methods for predicting, treating and modelling hormone resistance.
  • PRKAR1A cyclic adenosine 5'-monophosphate-dependent protein kinase
  • GPCR G-protein coupled receptors
  • cAMP activates PKA, resulting in the phosphorylation of specific proteins that mediate the physiological effects of these hormones (Spaulding SW.
  • mutations in the gene encoding the a subunit of the G protein-coupling receptors to stimulation of adenylyl cyclase cause developmental abnormalities of bone, as well as hormone resistance (pseudohypoparathyroidism caused by loss-of-function mutations) and hormone hypersecretion (McCune-Albright syndrome caused by gain-of- function mutations).
  • the present invention provides novel mutations in the gene encoding for the regulatory subunit type 1A of cyclic adenosine 5'-monophosphate-dependent protein kinase (PRKARl A) that are responsible for hormone resistance. Accordingly, the present invention relates to methods for predicting, treating and modelling hormone resistance.
  • PRKARl A cyclic adenosine 5'-monophosphate-dependent protein kinase
  • the inventors report a germline mutation in the gene for PRKARl A, the cAMP-dependent regulatory subunit of protein kinase A (PKA), in three unrelated patients with aero dysostosis and multiple hormone resistance.
  • the mutated subunit impairs the PKA response to stimulation by cAMP, and therefore explains the hormone resistance seen in these patients and the similarities of their skeletal abnormalities with those observed in pseudohypoparathyroidism type la.
  • PRKARIA cyclic adenosine 5'-monophosphate-dependent protein kinase
  • PRKARIA cyclic adenosine 5'-monophosphate-dependent protein kinase
  • the term refer to the PRKARIA gene of any species, especially human, but also other mammals or vertebrates to which the invention can apply.
  • Homo sapiens PRKARIA gene is localized on chromosome 17 (location 17q23-q24), the sequence of which is deposited in Genebank under accession number NC 000017.10. Three PRKARIA transcript variants have been described.
  • the first mRNA variant is deposited in GeneBank under accession number NM 002734.3
  • the corresponding amino acid sequence is deposited in GenPept database under accession number NP 002725.1.
  • the second mRNA variant deposited in GeneBank under accession number NM 212471.1 .
  • the corresponding amino acid sequence is deposited in GenPept database under accession number NP 997636.1.
  • the third mRNA variant deposited in GeneBank under accession number NM 212472.1.
  • the corresponding amino acid sequence is deposited in GenPept database under accession number NP 997637.1.
  • the cAMP-binding domain B corresponds to the region ranging from position 262 to position 381 in the amino acid sequence of PRKARl A ( Figure 1C).
  • mutants mean any detectable change in genetic material, e.g. DNA, RNA, cDNA, or any process, mechanism, or result of such a change.
  • Mutations include deletion, insertion or substitution of one or more nucleotides.
  • the mutation may occur in the coding region of a gene (i.e. in exons), in introns, or in the regulatory regions (e.g. enhancers, response elements, suppressors, signal sequences, polyadenylation sequences, promoters) of the gene.
  • a mutation is identified in a subject by comparing the sequence of a nucleic acid or polypeptide expressed by said subject with the corresponding nucleic acid or polypeptide expressed in a control population.
  • the mutation may be a "missense” mutation, where it replaces one amino acid with another in the gene product, or a "non sense” mutation, where it replaces an amino acid codon with a stop codon.
  • a mutation may also occur in a splicing site where it creates or destroys signals for exon-intron splicing and thereby lead to a gene product of altered structure.
  • a mutation in the genetic material may also be "silent", i.e. the mutation does not result in an alteration of the amino acid sequence of the expression product.
  • a "subject" in the context of the present invention is preferably a mammal.
  • the mammal can be a human, non-human primate, mouse, rat, dog, cat, horse, or cow, but are not limited to these examples. Mammals other than humans can be advantageously used as subjects that represent animal models of hormone resistance.
  • a subject can be male or female.
  • a subject can also be one who has not been previously diagnosed as having hormone resistance. For example, a subject can be one who exhibits one or more risk factors for hormone resistance, or a subject who does not exhibit hormone resistance risk factors, or a subject who is asymptomatic for hormone resistance.
  • a subject can also be one who is at risk of developing hormone resistance.
  • “Risk” in the context of the present invention relates to the probability that an event will occur over a specific time period, as in the conversion to hormone resistance, and can mean a subject's "absolute” risk or “relative” risk.
  • Absolute risk can be measured with reference to either actual observation post-measurement for the relevant time cohort, or with reference to index values developed from statistically valid cohorts that have been followed for the relevant time period.
  • Relative risk refers to the ratio of absolute risks of a subject compared either to the absolute risks of low risk cohorts or an average population risk, which can vary by how clinical risk factors are assessed.
  • Odds ratios the proportion of positive events to negative events for a given test result, are also commonly used (odds are according to the formula p/(l-p) where p is the probability of event and (1- p) is the probability of no event) to no- conversion.
  • Alternative continuous measures which may be assessed in the context of the present invention include time to hormone resistance conversion and therapeutic hormone resistance conversion risk reduction ratios.
  • hormone resistance refers to any condition mimicking a hormone deficiency. More particularly, said hormone resistance results from a loss of function in the cAMP signalling pathway. Accordingly the present invention pertains to any hormone that mediates its effect through the cAMP signalling pathway. Said hormone may be easily identified by the skilled man in the art.
  • said hormones include but are not limited to thyroid stimulating hormone (TSH), luteinizing hormone (LH), follicle-stimulating hormone (FSH), parathyroid hormone (PTH), thyrotropin, parathyroid hormone-related protein (PTHrP), gonadotropin, gonadotropin releasing hormone(GnRH), calcitonin, C5a anaphylatoxin, neurokinin, thyrotropin-releasing hormone (TRH), oxytocin, glucagon, , Growth hormone-releasing hormone (GHRH), Corticotropin Releasing Hormone, melanocyte stimulating hormone, adrenocorticotropic hormone, melanocortin hormone, and adrenocortico trophic hormone (ACTH).
  • TSH thyroid stimulating hormone
  • LH luteinizing hormone
  • FSH parathyroid hormone
  • PTH parathyroid hormone
  • PTHrP parathyroid hormone-related protein
  • gonadotropin gonadotropin releasing hormone(G
  • the inventors identified a mutation in the PRKA l A gene.
  • a nucleic acid comprising a PRKARIA nucleotide sequence, or a fragment thereof, carrying a mutation such as defined above is part of the invention. Accordingly, the invention relates to an isolated nucleic acid encoding the PRKARl A, which nucleic acid comprises or consists in a PRKARl A gene sequence that contains the non sense mutation c.1101 C>T. The invention further relates to the polypeptide encoded by said nucleic acid.
  • the present invention also relates to cell transformed with a nucleic acid according to the invention. Diagnostic methods of the invention:
  • a further aspect of the invention relates to a method for predicting whether a subject is at risk for having or developing a hormone resistance comprising the step consisting of detecting in a sample a mutation in PRKARl A gene wherein the presence of said mutation is indicative of a risk of having or developing a hormone resistance.
  • hormone disorders comprise growth disorders, acrodysostosis, acromegaly, Addison disease, adrenal gland diseases, Cushing syndrome, obesity, diabetes mellitus-type 2, gonadal disorders, hypogonadism, hypopituitarism, hypothyroidism, Kallmann syndrome, parathyroid diseases, pituitary diseases, puberty, delayed, puberty, precocious, renal osteodystrophy.
  • the present invention also relates to a method for diagnosing hormone resistance in a subject comprising the step consisting of detecting in a sample a mutation in PRKARl A gene according to the invention wherein the presence of said mutation is indicative that said subject has a hormone resistance.
  • the present invention also provides a molecular diagnosis for a hormone disorder.
  • the present invention also relates to a method for diagnosing hormone resistance in a subject comprising the step consisting of detecting in a sample a mutation in PRKARl A gene wherein the presence of said mutation is indicative that said subject has a hormone disorder.
  • the present invention also provides a molecular diagnosis for aero dysostosis.
  • the present invention also relates to a method for diagnosing aero dysostosis in a subject comprising the step consisting of detecting in a sample a mutation in PRKARIA gene wherein the presence of said mutation is indicative that said subject has aero dysostosis.
  • the present invention also relates to a method for estimating a probability that a subject will achieve a response to a treatment with a hormone, comprising detecting in a sample a mutation in PRKARIA gene wherein the presence of said mutation is indicative that said subject has a high risk not to achieve a response with said treatment.
  • said hormone may be selected from the group consisting of thyroid stimulating hormone (TSH), luteinizing hormone (LH), follicle-stimulating hormone (FSH), parathyroid hormone (PTH), thyrotropin, parathyroid hormone-related protein (PTHrP), gonadotropin, gonadotropin releasing hormone(GnRH), calcitonin, C5a anaphylatoxin, neurokinin, thyrotropin-releasing hormone (TRH), oxytocin, glucagon, Growth hormone- releasing hormone (GHRH), Corticotropin Releasing Hormone, melanocyte stimulating hormone, adrenocorticotropic hormone, melanocortin hormone, and adrenocorticotrophic hormone (ACTH).
  • TSH thyroid stimulating hormone
  • LH luteinizing hormone
  • FSH parathyroid hormone
  • PTH parathyroid hormone
  • PTHrP parathyroid hormone-related protein
  • gonadotropin gonadotropin releasing hormone(G
  • Said method is particularly useful in the management of disorders associated with for example a hormone deficiency, the treatment of which signals through the said domain of said PKA subunit, since the effects of the treatment may be modulated at this level (pharmacogenomics).
  • the PRKARIA mutation according to the invention is found in the region encoding for cAMP -binding-domain B of the protein. More preferably, the mutation of PRKARIA according to the invention is located in the exon 1 1. In some embodiments the mutation is a non sense mutation causing the truncation of cAMP -binding-domain B of the protein. Preferably the mutation induces the truncation of the region comprising arginine at position 368 (R368) and tyrosine a position 373 (Y373). More preferably the mutation is c. l 101 C>T changing the codon specifying the conserved arginine 368 in cAMP binding domain B to a stop codon (p. R368X).
  • said mutation may be detected by analyzing a PRKARIA nucleic acid molecule.
  • PRKARIA nucleic acid molecules include mRNA, genomic DNA and cDNA derived from mRNA. DNA or RNA can be single stranded or double stranded. These may be utilized for detection by amplification and/or hybridization with a probe, for instance.
  • the nucleic acid sample may be obtained from any cell source or tissue biopsy.
  • cell sources include without limitation blood cells, buccal cells, epithelial cells, fibroblasts, or any cells present in a tissue obtained by biopsy.
  • Cells may also be obtained from body fluids, such as blood, plasma, serum, lymph, etc.
  • DNA may be extracted using any methods known in the art, such as described in Sambrook et al, 1989.
  • RNA may also be isolated, for instance from tissue biopsy, using standard methods well known to the one skilled in the art such as guanidium thiocyanate-phenol-chloroform extraction.
  • PRKAR1A mutations may be detected in a RNA or DNA sample, preferably after amplification.
  • the isolated RNA may be subjected to coupled reverse transcription and amplification, such as reverse transcription and amplification by polymerase chain reaction (RT-PCR), using specific oligonucleotide primers that are specific for a mutated site or that enable amplification of a region containing the mutated site.
  • RT-PCR polymerase chain reaction
  • conditions for primer annealing may be chosen to ensure specific reverse transcription (where appropriate) and amplification; so that the appearance of an amplification product be a diagnostic of the presence of a particular PRKARl A mutation.
  • RNA may be reverse-transcribed and amplified, or DNA may be amplified, after which a mutated site may be detected in the amplified sequence by hybridization with a suitable probe or by direct sequencing, or any other appropriate method known in the art.
  • a cDNA obtained from RNA may be cloned and sequenced to identify a mutation in PRKARl A sequence.
  • nucleic acid molecule may be tested for the presence or absence of a restriction site.
  • a base substitution mutation creates or abolishes the recognition site of a restriction enzyme, this allows a simple direct PCR test for the mutation.
  • RNA sequencing includes, but are not limited to, direct sequencing, restriction fragment length polymorphism (RFLP) analysis; hybridization with allele-specific oligonucleotides (ASO) that are short synthetic probes which hybridize only to a perfectly matched sequence under suitably stringent hybridization conditions; allele-specific PCR; PCR using mutagenic primers; ligase-PCR, HOT cleavage; denaturing gradient gel electrophoresis (DGGE), temperature denaturing gradient gel electrophoresis (TGGE), single-stranded conformational polymorphism (SSCP) and denaturing high performance liquid chromatography (Kuklin et al, 1997).
  • DGGE denaturing gradient gel electrophoresis
  • TGGE temperature denaturing gradient gel electrophoresis
  • SSCP single-stranded conformational polymorphism
  • Direct sequencing may be accomplished by any method, including without limitation chemical sequencing, using the Maxam-Gilbert method ; by enzymatic sequencing, using the Sanger method ; mass spectrometry sequencing ; sequencing using a chip-based technology; and real-time quantitative PCR.
  • DNA from a subject is first subjected to amplification by polymerase chain reaction (PCR) using specific amplification primers.
  • PCR polymerase chain reaction
  • RCA rolling circle amplification
  • InvaderTMassay or oligonucleotide ligation assay (OLA).
  • OLA may be used for revealing base substitution mutations.
  • two oligonucleotides are constructed that hybridize to adjacent sequences in the target nucleic acid, with the join sited at the position of the mutation.
  • DNA ligase will covalently join the two oligonucleotides only if they are perfectly hybridized.
  • useful nucleic acid molecules in particular oligonucleotide probes or primers, according to the present invention include those which specifically hybridize the regions where the mutations are located.
  • Oligonucleotide probes or primers may contain at least 10, 15, 20 or 30 nucleotides. Their length may be shorter than 400, 300, 200 or 100 nucleotides. According to a second embodiment said mutation in the PRKARIA gene may be detected at the protein level.
  • Said mutation may be detected according to any appropriate method known in the art.
  • a sample such as a tissue biopsy, obtained from a subject may be contacted with antibodies specific of the mutated form of PRKARIA, i.e. antibodies that are capable of distinguishing between a mutated form of PRKARIA and the wild-type protein (or any other protein), to determine the presence or absence of a PRKARIA specified by the antibody.
  • Antibodies that specifically recognize a mutated PRKARIA also make part of the invention.
  • the antibodies are specific of mutated PRKARIA, that is to say they do not cross- react with the wild-type PRKARIA.
  • the antibodies of the present invention may be monoclonal or polyclonal antibodies, single chain or double chain, chimeric antibodies, humanized antibodies, or portions of an immunoglobulin molecule, including those portions known in the art as antigen binding fragments Fab, Fab', F(ab')2 and F(v). They can also be immuno conjugated, e.g. with a toxin, or labelled antibodies. Whereas polyclonal antibodies may be used, monoclonal antibodies are preferred for they are more reproducible in the long run.
  • Polyclonal antibodies can be obtained from serum of an animal immunized against the appropriate antigen, which may be produced by genetic engineering for example according to standard methods well-known by one skilled in the art. Typically, such antibodies can be raised by administering mutated PRKAR1A subcutaneously to New Zealand white rabbits which have first been bled to obtain pre-immune serum.
  • the antigens can be injected at a total volume of 100 ⁇ per site at six different sites. Each injected material may contain adjuvants with or without pulverized acrylamide gel containing the protein or polypeptide after SDS- polyacrylamide gel electrophoresis.
  • the rabbits are then bled two weeks after the first injection and periodically boosted with the same antigen three times every six weeks.
  • a sample of serum is then collected 10 days after each boost.
  • Polyclonal antibodies are then recovered from the serum by affinity chromatography using the corresponding antigen to capture the antibody. This and other procedures for raising polyclonal antibodies are disclosed by Harlow et al. (1988) which is hereby incorporated in the references.
  • a “monoclonal antibody” in its various grammatical forms refers to a population of antibody molecules that contains only one species of antibody combining site capable of immunoreacting with a particular epitope.
  • a monoclonal antibody thus typically displays a single binding affinity for any epitope with which it immunoreacts.
  • a monoclonal antibody may therefore contain an antibody molecule having a plurality of antibody combining sites, each immunospecific for a different epitope, e.g. a bispecific monoclonal antibody.
  • a monoclonal antibody was produced by immortalization of a clonally pure immunoglobulin secreting cell line, a monoclonally pure population of antibody molecules can also be prepared by the methods of the present invention.
  • Monoclonal antibodies may be prepared by immunizing purified mutated PRKAR1A into a mammal, e.g. a mouse, rat, human and the like mammals.
  • the antibody-producing cells in the immunized mammal are isolated and fused with myeloma or heteromyeloma cells to produce hybrid cells (hybridoma).
  • the hybridoma cells producing the monoclonal antibodies are utilized as a source of the desired monoclonal antibody. This standard method of hybridoma culture is described in Kohler and Milstein (1975).
  • mAbs can be produced by hybridoma culture the invention is not to be so limited. Also contemplated is the use of mAbs produced by an expressing nucleic acid cloned from a hybridoma of this invention. That is, the nucleic acid expressing the molecules secreted by a hybridoma of this invention can be transferred into another cell line to produce a transformant.
  • the transformant is genotypically distinct from the original hybridoma but is also capable of producing antibody molecules of this invention, including immunologically active fragments of whole antibody molecules, corresponding to those secreted by the hybridoma. See, for example, U.S. Pat. No. 4,642,334 to Reading; PCT Publication No.; European Patent Publications No. 0239400 to Winter et al. and No. 0125023 to Cabilly et al.
  • Antibody generation techniques not involving immunisation are also contemplated such as for example using phage display technology to examine naive libraries (from non- immunised animals); see Barbas et al. (1992), and Waterhouse et al. (1993).
  • Antibodies raised against mutated PRKAR1A may be cross reactive with wild-type PRKAPvlA. Accordingly a selection of antibodies specific for mutated PRKAR1A is required. This may be achieved by depleting the pool of antibodies from those that are reactive with the wild-type PRKARl A, for instance by submitting the raised antibodies to an affinity chromatography against wild-type PRKARl A.
  • binding agents other than antibodies may be used for the purpose of the invention.
  • binding agents may be for instance aptamers, which are a class of molecule that represents an alternative to antibodies in term of molecular recognition.
  • Aptamers are oligonucleotide or oligopeptide sequences with the capacity to recognize virtually any class of target molecules with high affinity and specificity.
  • ligands may be isolated through Systematic Evolution of Ligands by Exponential enrichment (SELEX) of a random sequence library, as described in Tuerk C. and Gold L., 1990.
  • the random sequence library is obtainable by combinatorial chemical synthesis of DNA. In this library, each member is a linear oligomer, eventually chemically modified, of a unique sequence.
  • Peptide aptamers consists of a conformationally constrained antibody variable region displayed by a platform protein, such as E. coli Thioredoxin A that are selected from combinatorial libraries by two hybrid methods (Colas et al, 1996).
  • Probe, primers, aptamers or antibodies of the invention may be labelled with a detectable molecule or substance, such as a fluorescent molecule, a radioactive molecule or any others labels known in the art. Labels are known in the art that generally provide (either directly or indirectly) a signal.
  • labelled with regard to the probe, primers, aptamers or antibodies of the invention, is intended to encompass direct labelling of the the probe, primers, aptamers or antibodies of the invention by coupling (i.e., physically linking) a detectable substance to the the probe, primers, aptamers or antibodies of the invention, as well as indirect labeling of the probe, primers, aptamers or antibodies of the invention by reactivity with another reagent that is directly labeled.
  • detectable substances include but are not limited to radioactive agents or a fluorophore (e.g. fluorescein isothiocyanate (FITC) or phycoerythrin (PE) or Indocyanine (Cy5)).
  • indirect labeling examples include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling of a DNA probe with biotin such that it can be detected with fluorescently labeled streptavidin.
  • An antibody or aptamer of the invention may be labelled with a radioactive molecule by any method known in the art.
  • radioactive molecules include but are not limited radioactive atom for scintigraphic studies such as 1123, 1124, Inl 11, Rel86, Rel88.
  • Kits of the invention are provided:
  • the PRKAR1 A mutation is detected by contacting the DNA of the subject with a nucleic acid probe, which is optionally labeled.
  • Primers may also be useful to amplify or sequence the portion of the PRKARl A gene containing the mutated positions of interest.
  • Such probes or primers are nucleic acids that are capable of specifically hybridizing with a portion of the PRKARl A gene sequence containing the mutated positions of interest. That means that they are sequences that hybridize with the portion mutated PRKAR1A nucleic acid sequence to which they relate under conditions of high stringency.
  • the present invention further provides kits suitable for determining at least one of the mutations of the PRKARl A gene.
  • kits may include the following components:
  • a probe usually made of DNA, and that may be pre-labelled.
  • the probe may be unlabelled and the ingredients for labelling may be included in the kit in separate containers ; and
  • hybridization reagents the kit may also contain other suitably packaged reagents and materials needed for the particular hybridization protocol, including solid-phase matrices, if applicable, and standards.
  • kits may include :
  • sequencing primers may be pre-labelled or may contain an affinity purification or attachment moiety ;
  • the kit may also contain other suitably packaged reagents and materials needed for the particular sequencing amplification protocol.
  • the kit comprises a panel of sequencing or amplification primers, whose sequences correspond to sequences adjacent to at least one of the polymorphic positions, as well as a means for detecting the presence of each polymorphic sequence.
  • kits which comprises a pair of nucleotide primers specific for amplifying all or part of the PRKARl A gene comprising at least one of mutations that are identified herein, especially at position 1101.
  • the kit of the invention may comprise a labelled compound or agent capable of detecting the mutated polypeptide of the invention (e.g., an antibody or aptamers as described above which binds the polypeptide).
  • the kit may comprise (1) a first antibody (e.g., attached to a solid support) which binds to a polypeptide comprising a mutation of the invention; and, optionally, (2) a second, different antibody which binds to either the polypeptide or the first antibody and is conjugated to a detectable agent.
  • the kit can also comprise, e.g., a buffering agent, a preservative, or a protein stabilizing agent.
  • the kit can also comprise components necessary for detecting the detectable agent (e.g., an enzyme or a substrate).
  • the kit can also contain a control sample or a series of control samples which can be assayed and compared to the test sample contained.
  • Each component of the kit is usually enclosed within an individual container and all of the various containers are within a single package along with instructions for observing whether the tested subject is suffering from or is at risk of developing a bone mineral density related disease.
  • the present invention also relates to an agent that is able to raise the expression of the nucleic acid of the invention for use in the treatment of hormone resistance, or even for the treatment of hormone disorders as above described.
  • an increase in the expression of the nucleic acid according to the invention could compensate the loss of function induced by the mutated protein and thus could restore sensitivity to hormones.
  • the present invention also relates to an agent that is able to restore the functionality of the polypeptide encoded by the nucleic acid of the invention for use in the treatment of hormone resistance.
  • the agent improves the dissociation between the catalytic subunit of protein kinase A with the mutated PRKAR1A polypeptide according to the invention.
  • the present invention also relates to a method for screening a drug for the treatment of hormone resistance comprising the steps consisting of testing a plurality of candidate compounds for their ability to improve the dissociation between the catalytic subunit of protein kinase A with the mutated PRKAR1A polypeptide according to the invention and selecting those that improves said dissociation.
  • said screening method is performed with a cell transformed with a nucleic acid according to the invention and a bio luminescence resonance energy assay is be used.
  • fusion protein constructs are prepared: a luciferase reporter may be inserted at the C-terminus of the mutated PRKAR1A and the YFP reporter at the N-terminus of the catalytic subunit of protein kinase A. Cells were then cotransfected with the constructs as prepared. The cells are then lysed. For BRET experiments, cell lysates are contacted with varying concentrations of 8 AHA-AMPc, cAMP analogue that specifically binds to cAMP binding domain B of PRKARIA.
  • Luminescence and fluorescence are measured simultaneously at 485nm and 530nm using a Mithras LB940 plate reader (Berthold Technologies).
  • the BRET ratios may then calculated and expressed in mBRET as previously described (Achour L, Scott MG, Shirvani H, et al. CD4-CCR5 interaction in intracellular compartments contributes to receptor expression at the cell surface. Blood 2009;! 13: 1938- 47.).
  • the results are the mean ⁇ SEM of 4 independent experiments with independent cotransfections.
  • the screening method comprises the steps consisting of:
  • a first fusion protein consisting of a luciferase reporter fused at the C- terminus of the mutated PRKAR1A according to the invention and a second fusion protein consisting of a YFP reporter fused at the N-terminus of the catalytic subunit of protein kinase A
  • step iv) comparing the curve response obtained in step iii) with a curve response obtained with a first fusion protein comprising the wild type PRKARl A
  • the screening method of the invention may comprise a step consisting of determining whether said candidate compound is able to restore the high affinity of mutated PRKARl A for cAMP.
  • the candidate compound of may be selected from a library of compounds previously synthesised, or a library of compounds for which the structure is determined in a database, or from a library of compounds that have been synthesised de novo.
  • the candidate compound may be selected from the group of (a) proteins or peptides, (b) nucleic acids and (c) organic or chemical compounds.
  • a further aspect of the invention relates to a non human animal model for hormone resistance and more specifically for multiple hormone resistance whose genome comprises a nucleic acid according to the invention (i.e. a nucleic acid comprising a PRKARl A nucleotide sequence comprising a distinct non sense mutation c. l 101C>T) linked to a promoter.
  • a nucleic acid according to the invention i.e. a nucleic acid comprising a PRKARl A nucleotide sequence comprising a distinct non sense mutation c. l 101C>T
  • Any of various methods can be used to introduce a nucleic acid sequence into animals to produce transgenic animals expressing said nucleic acid. Such techniques are well-known in the art and include, but are not limited to, pronuclear microinjection and transformation of embryonic stem cells. Methods for generating transgenic animals that can be used include, but are not limited to, those described in J. P. Sundberg and T.
  • a transgenic non- human animal expressing a nucleic acid according to the invention can be achieved by methods such as DNA injection of an expression construct into a preimplantation embryo or by use of stem cells, such as embryonic stem (ES) cells or induced pluripotent stem (iPS) cells.
  • stem cells such as embryonic stem (ES) cells or induced pluripotent stem (iPS) cells.
  • expression construct and "expression cassette” are used herein to refer to a double-stranded recombinant DNA molecule containing the desired nucleic acid sequence and containing one or more regulatory elements necessary or desirable for the expression of the operably linked coding sequence.
  • regulatory element refers to a nucleotide sequence which controls some aspect of the expression of nucleic acid sequences.
  • Exemplary regulatory elements illustratively include an enhancer, an internal ribosome entry site (IRES), an intron; an origin of replication, a polyadenylation signal (pA), a promoter, a transcription termination sequence, and an upstream regulatory domain, which contribute to the replication, transcription, post-transcriptional processing of a nucleic acid sequence.
  • IVS internal ribosome entry site
  • pA polyadenylation signal
  • promoter a transcription termination sequence
  • upstream regulatory domain which contribute to the replication, transcription, post-transcriptional processing of a nucleic acid sequence.
  • operably linked refers to a nucleic acid in functional relationship with a second nucleic acid.
  • a regulatory element is included in an expression cassette is a promoter in particular embodiments.
  • promoter refers to a DNA sequence operably linked to a nucleic acid sequence to be transcribed such as a nucleic acid sequence encoding a desired molecule.
  • a promoter is generally positioned upstream of a nucleic acid sequence to be transcribed and provides a site for specific binding by RNA polymerase and other transcription factors.
  • a promoter is generally positioned upstream of the nucleic acid sequence transcribed to produce the desired molecule, and provides a site for specific binding by RNA polymerase and other transcription factors.
  • An included promoter can be a constitutive promoter or can provide inducible expression; and can provide ubiquitous, tissue-specific or cell-type specific expression.
  • Ubiquitous promoters include, but are not limited to, a 3-phosphoglycerate kinase (PGK-1) promoter, a beta-actin promoter, a ROSA26 promoter, a heat shock protein 70 (Hsp70) promoter, an EF-1 alpha gene encoding elongation factor 1 alpha (EF1) promoter, an eukaryotic initiation factor 4A (eIF-4Al) promoter, a chloramphenicol acetyltransferase (CAT) promoter and a CMV (cytomegalovirus) promoter.
  • PGK-1 3-phosphoglycerate kinase
  • beta-actin beta-actin promoter
  • ROSA26 promoter
  • Hsp70 heat shock protein 70
  • Hsp70 heat shock protein 70
  • EF-1 alpha gene encoding elongation factor 1 alpha (EF1) promoter an eukaryotic initiation factor 4A (eIF-4Al) promoter
  • Tissue-specific promoters that may be used include, but are not limited to, a promoter of a gene expressed in the tissue where the hormone resistance shall be installed. The skilled man in the art may easily identified the relevant promoter.
  • one or more enhancer sequences may be included such as, but not limited to, cytomegalovirus (CMV) early enhancer element and an SV40 enhancer element.
  • CMV cytomegalovirus
  • An expression construct may include sequences necessary for amplification in bacterial cells, such as a selection marker (e.g. kanamycin or ampicillin resistance gene) and a replicon.
  • a selection marker e.g. kanamycin or ampicillin resistance gene
  • the expression construct is linearized before injection into non-human preimplantation embryos.
  • the expression construct is injected into fertilized oocytes. Fertilized oocytes are collected from superovulated females the day after mating (0.5 dpc) and injected with the expression construct. The injected oocytes are either cultured overnight or transferred directly into oviducts of 0.5-day p.c. pseudopregnant females.
  • the expression construct may be transfected into stem cells (ES cells or iPS cells) using well-known methods, such as electroporation, calcium-phosphate precipitation and lipofection.
  • the cells are screened for transgene integration by DNA analysis, such as PCR, Southern blot or sequencing. Cells with the correct integration can be functionally tested.
  • ES cells are grown in media optimized for the particular line.
  • ES media contains 15% fetal bovine serum (FBS) or synthetic or semi-synthetic equivalents, 2 mM glutamine, 1 mM Na Pyruvate, 0.1 mM non-essential amino acids, 50 U/ml penicillin and streptomycin, 0.1 mM 2-mercaptoethanol and 1000 U/ml LIF (plus, for some cell lines chemical inhibitors of differentiation) in Dulbecco's Modified Eagle Media (DMEM).
  • FBS fetal bovine serum
  • glutamine 1 mM Na Pyruvate
  • 0.1 mM non-essential amino acids 50 U/ml penicillin and streptomycin
  • 2-mercaptoethanol 0.1 mM 2-mercaptoethanol
  • 1000 U/ml LIF plus, for some cell lines chemical inhibitors of differentiation
  • DMEM Dulbecco's Modified Eagle Media
  • Selected cells incorporating the expression construct can be inj ected into preimplantation embryos.
  • ES or iPS cell are rendered to single cells using a mixture of trypsin and EDTA, followed by resuspension in ES media.
  • Groups of single cells are selected using a finely drawn-out glass needle (20-25 micrometer inside diameter) and introduced through the embryo's zona pellucida and into the blastocysts cavity (blastocoel) using an inverted microscope fitted with micromanipulators.
  • stem cells can be injected into early stage embryos (e.g. 2-cell, 4-cell, 8-cell, premorula or morula).
  • Injection may be assisted with a laser or piezo pulses drilled opening the zona pellucida.
  • Approximately 9-10 selected stem cells (ES or iPS cells) are injected per blastocysts, or 8-cell stage embryo, 6-9 stem cells per 4-cell stage embryo, and about 6 stem cells per 2-cell stage embryo.
  • embryos are allowed to recover for a few hours at 37[deg.] C. in 5% C02, 5% 02 in nitrogen or cultured overnight before transfer into pseudopregnant recipient females.
  • stem cells can be aggregated with morula stage embryos. All these methods are well established and can be used to produce stem cell chimeras.
  • Pseudopregnant embryo recipients are prepared using methods known in the art. Briefly, fertile female mice between 6-8 weeks of age are mated with vasectomized or sterile males to induce a hormonal state conductive to supporting surgically introduced embryos. At 2.5 days post coitum (dpc) up to 15 of the stem cell containing blastocysts are introduced into the uterine horn very near to the uterus-oviduct junction. For early stage embryos and morula, such embryos are either cultured in vitro into blastocysts or implanted into 0.5 dpc or 1.5 dpc pseudopregnant females according to the embryo stage into the oviduct.
  • dpc coitum
  • Chimeric pups from the implanted embryos are born 16-20 days after the transfer depending on the embryo age at implantation. Chimeric males are selected for breeding.
  • Offspring can be analyzed for transmission of the ES cell genome by coat color and genetic analysis, such as PCR, Southern blot or sequencing. Further the expression of the nucleic acid of the invention can be analyzed by protein analysis (Western blot, ELISA) or other functional assays. Offspring expressing the transgene are intercrossed to create non-human animals homozygous for the transgene.
  • the transgene is targeted into a specific locus of the stem cell genome which is known to result in reliable expression, such as the Hprt or the Rosa26 locus.
  • a targeting construct is made using recombinant DNA techniques and includes 5' and 3' sequences which are homologous to the stem cell endogenous gene.
  • the targeting construct further includes a selectable marker such as neomycin phosphotransferase, hygromycin or puromycin, a nucleic acid according to the invention and a polyadenylation signal.
  • the nucleic acid according to the invention is either in frame with the endogenous gene locus, or a splice acceptor site and internal ribosome entry site (IRES) sequences are included.
  • IRS internal ribosome entry site
  • Such a targeting construct is transfected into stem cells and the stem cells are screened to detect the homologous recombination event using PCR, Southern blot or sequencing analysis. Cells with the correct homologous recombination event can be further analyzed for transgene expression by protein analysis, such as ELISA or Western blot analysis. If desired, the selectable marker can be removed by treating the stem cells with Cre recombinase.
  • Offspring After Cre recombinase treatment the cells are analyzed for the presence of the nucleic acid according to the invention. Cells with the correct genomic event will be selected and injected into preimplantation embryos as described above. Chimeric males are selected for breeding.
  • Offspring can be analyzed for transmission of the ES cell genome by coat color and genetic analysis, such as PCR, Southern blot or sequencing and can be tested for SCF protein expression such as by protein analysis (Western blot, ELISA) or other functional assays. Offspring expressing the by protein analysis (Western blot, ELISA) or other functional assays are intercrossed to create non-human animals homozygous for the transgene.
  • transgenic animals include a nucleic acid according to the invention in substantially all of their cells, as well as transgenic animals that include a nucleic acid of the invention in some, but not all their cells.
  • One or multiple copies (such as concatamers) of the nucleic acid of the invention may be integrated into the genome of the cells of the transgenic animals.
  • Transgenic animals of the present invention are preferably non- human mammals, particularly rodents, such as mice, rats or guinea pigs. More preferably, the animal is a mouse. Said mouse may be selected from the groups consisting of C57BL/6, BALB/c, DBA/2, CBA/ and SV129 strains.
  • Such animal model may be useful for screening drugs useful for treating hormone resistance, or even for treating hormone disorders as above described. More particularly, the animal model according to the invention may be suitable for screening drugs for treating a hormone resistance, studying the physiopathology of said hormone resistance, and for endeavouring diagnostic or prognostic markers of said hormone resistance.
  • a further aspect of the invention relates to a method for screening a drug for treating hormone resistance, said method comprising the step consisting of: i) providing a non human animal model according to the invention
  • the candidate compound of may be selected from a library of compounds previously synthesised, or a library of compounds for which the structure is determined in a database, or from a library of compounds that have been synthesised de novo.
  • the candidate compound may be selected from the group of (a) proteins or peptides, (b) nucleic acids and (c) organic or chemical compounds.
  • FIGURES are a diagrammatic representation of FIGURES.
  • FIG. 1 Identification of a nonsense mutation causing R368X in patients with acrodysostosis.
  • A Family pedigrees. Patients, filled symbols; unaffected, open symbols; males, squares; females, circles.
  • B A portion of the nucleotide sequence of exon 1 1 of the PRKARIA gene from index cases and unaffected parents is shown. The heterozygous substitution of cytosine at position 1 101 (c. l 101C>T) leads to the replacement of the Arg at position 368 by a stop codon (p.Arg368X).
  • the deleted region comprises the Tyr at position 373.
  • PRKARIA protein expression in untransfected cells (UnT) or cells transiently transfected with pCDNA3.1 constructs encoding WT-PRKARIA, R368X-PRKAR 1 A , Y373A- PRKARIA or the empty vector was analyzed by Western blotting.
  • Supplementary Figure 1 Brachydactyly in a patient with acrodysostosis and hormonal resistance. Shown are a photograph (A) and radiograph (B) of one hand of patient 2 obtained when the patient was 10 years old. The patient presents a shortening of metacarpals, metatarsals and phalanges, characterizing brachydactyly type E (BDE). Note the shortening of all bones, and the bulky and stocky aspect of the affected bones.
  • Urinary cAMP expressed as ⁇ / ⁇ creatinine, was measured at the indicated times in the three patients (solid symbols) and in 6 control subjects (open symbols). Urinary cAMP under baseline conditions was elevated in the three patients (patients, 23.4 ⁇ 2.2; controls, 13.9 ⁇ 2.1 ⁇ cAMP/ mmol creatinine; p ⁇ 0.048). The three patients showed a brisk rise in urinary cAMP following PTH infusion.
  • FECa was measured 4 h after PTH administration in the three patients and five controls. A decrease in FECa was observed in 2 of 3 patients and all controls. The decrease in FECa in the three patients at 4 h after PTH infusion was significantly less than that observed in controls (% decrease in FECa: patients, 25 ⁇ 12%; controls, 76 ⁇ 13%; p ⁇ 0.036).
  • EXAMPLE 1 A RECURRENT MUTATION IN PRKAR1A AND ACRODYSOSTOSIS WITH HORMONE RESISTANCE Results:
  • Mild gonadotropin resistance was indicated by the presence of bilateral cryptorchidism in the 2 male patients; decreased testosterone levels in the adult male patient; increased basal FSH levels in the female patient; and "high normal" peak levels of serum FSH and LH in patient 1 in response to GnRH, measured on two occasions (FSH/LH: 5.9/26.8 and 5.9/19.0 UI/L).
  • R368X causes a truncation of PRKARIA domain B, including two residues, Arg368 and Tyr373, shown to be determinant for the binding of cAMP to domain B. 14
  • the mutation that results in Y373A has been shown previously in vitro to render PKA less sensitive to cAMP activation. 14
  • the Release of the Catalytic Subunits is Impaired in Cells Transfected with R368X and Y373A PRKARIA: Bio luminescence Resonance Energy Transfer (BRET) analysis of the interaction between the catalytic subunit (PRKACA) and WT and R368X and Y373A PRKARIA was performed to examine the underlying mechanism of hormonal resistance.
  • BRET Bio luminescence Resonance Energy Transfer
  • the presence of a molecular interaction between PRKACA and both the WT or abnormal (R368X and Y373A) PRKARIA subunits was demonstrated by the presence of a strong and saturable BRET signal obtained when increasing amounts of the YFP-PRKACA acceptor were cotransfected with a fixed amount of the PRKARlA-luc donor subunits.
  • the 8-AHA-cAMP analog In cells transfected with the WT PRKARIA, the 8-AHA-cAMP analog induced a dose- dependent reduction of the BRET signal, reflecting the dissociation between the 2 subunits (Fig. 2D). In cells transfected with the R368X and Y373A PRKARIA, 8-AHA-cAMP also induced a dose-dependent reduction of the BRET signal, but the dose-response curve was significantly shifted to the right for both mutants (EC50: WT PRKARIA, 1.0 ⁇ 0.3 10 ⁇ 9 M; R368X PRKARIA, 7.1 ⁇ 0.7 10 ⁇ 9 M; R373A PRKARIA, 1.2 ⁇ 0.2 10 ⁇ 8 M; p ⁇ 0.05 and ⁇ 0.01 respectively, comparing R368X and R373A to WT).
  • Dicussion These three unrelated patients have aero dysostosis and resistance to several hormones carrying the same heterozygous de novo mutation that results in an amino acid substitution of R368X in PRKARIA.
  • This mutation introduces a premature stop codon in the C-terminal portion of PRKARIA, thereby disrupting the cAMP -binding domain B.
  • the alteration of cAMP binding to domain B is known to disrupt the ordered and cooperative activation of PKA by cAMP, 14 ' 19 as reported here.
  • the abnormal PRKARIA protein was present at higher levels than the wild type protein in cells from the patients, consistent with a faster rate of degradation of WT than abnormal PRKARIA subunits due to the preferential release of WT PRKARIA from PKA tetramers.
  • tissue-specific imprinting of Gsa and tissue-specific expression of alternative PKA isoforms may contribute to the phenotypic differences observed comparing acrodysostosis and PHPla.
  • this work identifies a novel genetic abnormality within the cAMP- signaling pathway that results in the resistance of PKA to cAMP stimulation, thereby causing congenital bone dysplasia associated with resistance to several hormones. Whether or not other clinically distinct forms acrodysostosis are also due to genetic or epigenetic defects at the PRKAR1A locus, or in other genes of the pathway, remains to be determined.
  • Tasken K Skalhegg BS, Tasken KA, et al. Structure, function, and regulation of human cAMP-dependent protein kinases. Adv Second Messenger Phosphoprotein Res
  • Wilson LC Oude Luttikhuis ME, Baraitser M, guitarist HM, Trembath RC. Normal erythrocyte membrane Gs alpha bioactivity in two unrelated patients with acrodysostosis. J Med Genet 1997;34: 133-6.
  • PKA cyclic AMP-dependent protein kinase A
  • PRKARIA cyclic AMP-dependent protein kinase A regulatory subunit 1 A
  • PPNAD primary pigmented nodular adrenocortical disease
  • PTH infusion test Informed consent was obtained from patients and controls for all studies. The PTH infusion test was performed on the 3 patients (age 40, 19, and 13 years respectively for patient 1, 2, and 3) and 6 healthy volunteers (3 men, 3 women, mean age 35 + 6 years) using techniques similar to those described by Chase et al. 1 . Briefly, subjects received an intravenous injection of 40 ⁇ g/kg human recombinant PTH 1"34 (teriparatide, Lilly, France). Urine samples were collected during a period of diuresis maintained by oral intake of water (200 ml/h). Urine was discarded at time -60 min, and collected at times 0, 30, 60, 120, 240 and 300 minutes. Blood samples were collected at 0 and 240 minutes. The samples for determination of plasma cAMP were collected in chilled EDTA tubes and centrifuged for 10 min before freezing; urine samples were immediately frozen.
  • Fractional calcium excretion was calculated as (UCa/UCr) x (SCr/SCa).
  • TmP/GFR was derived from the fractional reabsorption of filtered inorganic phosphate [1- (UP/UCr) x (SCr/SP)] and plasma concentration of inorganic phosphate using the nomogram constructed by Walton and Bijvoet 2 .
  • Biochemical analysis All biochemical measurements were performed using standard clinical laboratory procedures for electrolyte and hormone concentrations in blood and urine.
  • Genomic DNA and R A were extracted from peripheral blood mononuclear cells and EBV immortalized B-lymphocytes using standard procedures. Intronic, and when required, exonic primers were used to amplify the exons and intron-exon junctions for the PRKAR1A (12 exons) and GNAS (Gsa exons 1-13) genes as previously described 3"5 .
  • PCR products were analyzed by direct nucleotide sequence analysis. Methylation patterns at the four differentialy methylated regions (NESP, AS, XL, AB) of the GNAS locus were evaluated by digestion of PCR-amplified DNA following bisulfite treatment using previously described techniques 5 .
  • Epstein-Barr virus (EBV) immortalized B-lymphocytes were established from two controls and two patients affected with aero dysostosis (patients 1 and 2). The presence of the wild-type (WT) and mutant PRKARIA mRNA in immortalized B-lymphocytes was determined by sequencing RT-PCR products.
  • the 3 '-end of the reverse primer designed as described 6 , is complementary to the mutated sequence, but contains an intentional mismatch at the -2 position. Thus, two of the three bases at the 3 '-end of the reverse primer are mismatched with the WT allele, precluding its amplification. PCR products were analyzed by direct nucleotide sequencing.
  • PRKARIA expression plasmids and site-directed mutagenesis Full-length WT cDNA encoding human PRKARIA was amplified by RT-PCR from HEK293 cells and inserted into the pCDNA3.1 plasmid (Invitrogen). After complete sequencing of the cDNA insert, the p.R368X mutation identified in the patients and the Y373A mutation were introduced into the WT-PRKARIA cDNA construct using the Quick Change site-directed mutagenesis kit (Stratagene), and confirmed by complete sequencing of cDNA inserts.
  • COS-7 cells and HEK293 cells were cultured as described in DMEM containing 10% fetal bovine serum, 100 U/ml penicillin G and 100 ⁇ g/ml streptomycin 7"8 .
  • COS-7 cells in 24-well plates were transfected using Fugene HD (Roche) with either 250 ng DNA/cm 2 (PKA activity) or 125 ng/cm 2 pCDNA3.1 construct encoding either WT-, R368X-, or Y373A-PRKAR1A and 125 ng/cm 2 pCDNA3.1 construct encoding the empty vector (cAMP production). All studies were performed 48 h after transfection.
  • EBV immortalized B-lymphocytes were cultured in RPMI-1640 medium containing 10% fetal bovine serum, 100 U/ml penicillin G and 100 ⁇ g/ml streptomycin.
  • COS-7 cells were cotransfected with: i) 225 ng pCDNA3.1 construct encoding either WT-, R368X-, Y373A-PRKAR1 A or the empty vector; ii) 250 ng pCRE-Luc plasmid, containing a firefly luciferase reporter gene under the control of a CRE-responsive element (Stratagene); and iii) 25 ng pRL-TK plasmid (Promega), containing a constitutively expressed Renilla luciferase reporter gene that was used as an internal control for transfection efficiency.
  • Cells were either untreated (to measure basal transcriptional PKA activities), or treated with 0.3 , 1 and 1 0 ⁇ of forskolin (Sigma- Aldrich) or 0.3 and 30 ⁇ o f the 8- aminohexylamino cAMP analog (8-AHA-cAMP, Sigma- Aldrich) in the presence of 1 mM 3- isobutyl-l-methylxanthine (IBMX, Sigma- Aldrich).
  • the PKA inhibitor H89 Sigma- Aldrich, 10 ⁇
  • Luciferase activities were determined 6 h after forskolin addition as described previously 9 using a Centra LB 960 luminometer (Berthold).
  • Stimulation of cAMP production Stimulation of cAMP production by isoproterenol and cholera toxin was performed as described previously 7 ' 10 .
  • the cAMP content in cells extracts was measured using the cAMP Biotrak Enzyme immunoassay (EIA) System (Amersham). Results are expressed as picomoles/well.
  • PRKAR1A protein expression Western blotting was performed using cell lysates obtained from EBV immortalized lymphocytes (two controls and patients 1 and 2), and from COS cells that were either untransfected or that had been transfected with pCDNA3.1 constructs encoding WT-, R368X-, Y371A-PRKAR1A , or the empty vector. Cells were lysed with IX Cell Lysis Buffer (Cell Signaling) containing ImM PMSF. Ten micrograms of total protein from each sample were separated by 12% one-dimensional SDS-PAGE, and the proteins were transferred to Immobilon-P membranes (Millipore). The membranes were incubated sequentially using the SNAP i.d.
  • EBV immortalized B-lymphocytes were incubated at 37°C in Hank's buffered salt solution containing 10 mM Hepes (lxlO 6 cells/200 ⁇ ) with either buffer or forskolin (10 ⁇ ) in the presence of 1 mM IBMX for 30 min. The reactions were terminated by adding 50 ⁇ of 5X Laemmli sample buffer as described 11 . Samples were boiled for 5 min and frozen at -80°C until Western blotting. Lysates (10-20 ⁇ ) from each sample were separated by 15% one- dimensional SDS-PAGE, and the proteins were transferred to Immobilon-P membranes (Millipore).
  • the membranes were incubated sequentially as described above with a 1/1000 dilution of a rabbit monoclonal antibody recognizing CREB phosphorylated at Ser 133 (Cell Signaling Technology), a 1/500 dilution of a goat anti-rabbit immunoglobulin antibody conjugated to horseradish peroxidase (Promega), and SuperSignal West Femto Chemiluminescent Substrate (Pierce, Thermo Scientific).
  • the membranes were reprobed using similar techniques with a rabbit monoclonal antibody recognizing total CREB protein (Cell Signaling Technology). Bands present on film exposed to the blots were quantified using ImageJ software (Rasband, W.S., ImageJ, U. S.
  • BRET Measurement Molecular interactions between regulatory and catalytic subunits of PKA were investigated using bio luminescence resonance energy transfer (BRET) according to Prinz et al. 12 . Briefly, the human WT and R368X and Y373A mutant cDNAs of PRKARIA and the mouse PRKACA cDNA were amplified by PCR using appropriate primers. PRKARIA variants were inserted in frame into the Bam l site of pRlucN2(h) (Biosignal, PerkinElmer Life Sciences) and PRKACA was inserted into the HmdIII and Apal sites of PEYFP-C3 (Clontech/BD Biosciences).
  • the luciferase reporter is at the C-terminus of PRKARIA constructs and the YFP reporter at the N-terminus of PRKACA.
  • HEK293 cells were cotransfected in 25cm 2 flasks with 2 to 4 ng of PRKARIA constructs and 5 to 60 ng of PRKACA constructs using Effectene according to the manufacturer's instructions (Qiagen). The cells were lysed two-days after transfection in 2 ml Passive lysis buffer (Promega) containing ImM IBMX and frozen.
  • Modelling of human PRKAR1A The 3D cristallography X-ray structure of the bovine and mouse PRKAR1A (PDB: 1RGS) (PDB: 2QCS) 14"15 were used to model the human PRKARIA by homology. Models were developed for wild-type (WT) and mutants (R368X and Y373A) of PRKARIA. Based on the alignment between bovine, mouse and human PRKARIA sequences (clustalW and Fasta algorithms), one hundred homology models were built using Modeller v9.7 (http://www.salilab.org/modeller/) and an objective function was calculated for each model in order to select the best score.
  • Ligand rmsd and binding pocket surface were estimated and compared to the values obtained for the WT subunit. Analysis and representation of ligand conformation in the binding pocket (domain B) of PRKARIA was performed using PyMol software (http://www.pymol.org/).
  • the domain B cAMP binding pocket has a surface of 290 A 2 (supplementary Fig. 4).
  • the ribose ring of cAMP interacts directly with E326 and R335 residues in the binding pocket, and the adenine ring of cAMP interacts with domain B through hydrophobic and stacking interactions with the Y373 and S375 residues 15 (supplementary Fig. 4C).
  • a constitutive interaction between Y373 and E326 participates in a network of contacts (hydrogen bonds and hydrophobic stacking) that induces a strong orientation of the dipole moment of the adenine ring, thereby creating strong constraints for the positioning of cAMP in the binding pocket 15 .
  • the R368X mutation results in several important structural changes. First, the surface of the R368X mutant binding pocket was reduced to 27 A 2 (Supplementary Fig. 4B), limiting it, essentially, to a single ribose-binding pocket. Furthermore, the ability of residues localized in the binding pocket of PRKARl A to form an interaction network is seriously affected by the deletion of Y373 residue (supplementary Fig. 4C).
  • the Y373A substitution induces an increase m the surface of the binding pocket (Y373A, 515 A 2 ; WT, 290 A 2 ). These differences can be explained by the deletion of Y373 side chain, which closes the binding pocket in WT but not in Y373A mutant PRKARl A (supplementary Fig. 4C).
  • cAMP production in cells expressing the WT or mutant PRKARIA Isoproterenol and cholera toxin induced a dose-dependent stimulation of cAMP production in COS cells that was of similar magnitude in cells expressing the WT and mutant PRKARI A (supplementary Fig. 4). Maximal stimulation was approximately 5-fold and 35-fold over baseline, respectively, for isoproterenol and cholera toxin. Basal cAMP production was similar in cells expressing WT and mutant PRKARIA. Allele-specific PCR: To evaluate whether the de novo R386X mutation in PRKARIA occurred on the same allele in the three patients, SNPs present in proximity to the c. l 101C>T mutation were evaluated.
  • Two of the patients were heterozygous (T/A), and one was homozygous (T/T) for the SNP rs2302233 in intron 10 located 230 bp upstream of the c. l l01C>T mutation.
  • a region encompassing SNP rs2302233 and the c. l l01C>T mutation was amplified in the three patients and two controls as described in the methods using a reverse primer allowing the specific amplification of the mutated allele. As expected, no PCR products were obtained following amplification of DNA from controls.
  • HDAC4 AD 600430 syndromic Williams SR, et al. Haploinsufficiency of HDAC4 causes brachydactyly mental retardation syndrome, with brachydactyly type E, developmental delays, and behavioral problems. Am J Hum Genet. 2010 Aug 13;87(2):219-28.
  • a cis-regulatory site downregulates PTHLH in translocation t(8;12)(q13;p11.2) and leads to Brachydactyly Type E.
  • HOXD13 AD 142989 isolated Johnson D, et al. Missense mutations in the homeodomain of HOXD13 are associated with brachydactyly types D and E. Am J Hum Genet. 2003 Apr;72(4):984-97.
  • Table 1 Microsatellite analysis at 16 loci using the PowerPlex 16 System in the three patients and their parents*. For each patient, the allele inherited from the mother and the father are in blue and red respectively.
  • BDE ⁇ Brachydactyly Type E
  • PKA cyclic AMP-dependent protein kinase A
  • PRKARl A regulatory subunit 1 A
  • PPNAD primary pigmented nodular adrenocortical disease

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Hematology (AREA)
  • Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Urology & Nephrology (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention provides novel mutations in the gene encoding for the regulatory subunit type 1A of cyclic adenosine 5'-monophosphate-dependent protein kinase (PRKAR1A) that are responsible for hormone resistance. Accordingly, the present invention relates to methods for predicting, treating and modelling hormone resistance. In particular, the present invention relates to a method for predicting whether a subject is at risk for having or developing a hormone resistance comprising the step consisting of detecting in a sample a mutation in PRKAR1A gene wherein the presence of said mutation is indicative of a risk of having or developing a hormone resistance.

Description

METHODS FOR PREDICTING, TREATING AND MODELLING HORMONE
RESISTANCE
FIELD OF THE INVENTION:
The present invention provides novel mutations in the gene encoding for the regulatory subunit type 1A of cyclic adenosine 5'-monophosphate-dependent protein kinase (PRKAR1A) that are responsible for hormone resistance. Accordingly, the present invention relates to methods for predicting, treating and modelling hormone resistance.
BACKGROUND OF THE INVENTION:
Numerous hormones activate heterotrimeric G-protein coupled receptors (GPCR), which couple G protein to adenylyl cyclase, generating intracellular cAMP (Spiegel AM, Weinstein LS. Inherited diseases involving g proteins and g protein-coupled receptors. Annu Rev Med 2004;55:27-39.) In turn, cAMP activates PKA, resulting in the phosphorylation of specific proteins that mediate the physiological effects of these hormones (Spaulding SW. The ways in which hormones change cyclic adenosine 3',5'-monophosphate-dependent protein kinase subunits, and how such changes affect cell behavior. Endocr Rev 1993;14:632- 50.; Tasken K, Skalhegg BS, Tasken KA, et al. Structure, function, and regulation of human cAMP-dependent protein kinases. Adv Second Messenger Phosphoprotein Res 1997;31 : 191- 204.; Taylor SS, Buechler JA, Yonemoto W. cAMP-dependent protein kinase: framework for a diverse family of regulatory enzymes. Annu Rev Biochem 1990;59:971-1005.). Loss-of- function mutations in the proteins implicated in this way may cause hormone resistance that is the source of many hormone disorders. For example, mutations in the gene encoding the a subunit of the G protein-coupling receptors to stimulation of adenylyl cyclase cause developmental abnormalities of bone, as well as hormone resistance (pseudohypoparathyroidism caused by loss-of-function mutations) and hormone hypersecretion (McCune-Albright syndrome caused by gain-of- function mutations).
Accordingly, identifying novel mutations causing loss of function in the cAMP signalling pathway represents a particular interest for physicians and scientists for predicting treating, and modelling hormone resistance. SUMMARY OF THE INVENTION:
The present invention provides novel mutations in the gene encoding for the regulatory subunit type 1A of cyclic adenosine 5'-monophosphate-dependent protein kinase (PRKARl A) that are responsible for hormone resistance. Accordingly, the present invention relates to methods for predicting, treating and modelling hormone resistance.
DETAILED DESCRIPTION OF THE INVENTION:
The inventors report a germline mutation in the gene for PRKARl A, the cAMP- dependent regulatory subunit of protein kinase A (PKA), in three unrelated patients with aero dysostosis and multiple hormone resistance. The mutated subunit impairs the PKA response to stimulation by cAMP, and therefore explains the hormone resistance seen in these patients and the similarities of their skeletal abnormalities with those observed in pseudohypoparathyroidism type la.
Definitions:
As used herein, the term "PRKARl A gene" denotes the gene coding for the regulatory subunit type 1A of cyclic adenosine 5'-monophosphate-dependent protein kinase (PRKARIA). The term refer to the PRKARIA gene of any species, especially human, but also other mammals or vertebrates to which the invention can apply. Homo sapiens PRKARIA gene is localized on chromosome 17 (location 17q23-q24), the sequence of which is deposited in Genebank under accession number NC 000017.10. Three PRKARIA transcript variants have been described. The first mRNA variant is deposited in GeneBank under accession number NM 002734.3 The corresponding amino acid sequence is deposited in GenPept database under accession number NP 002725.1. The second mRNA variant deposited in GeneBank under accession number NM 212471.1 . The corresponding amino acid sequence is deposited in GenPept database under accession number NP 997636.1. The third mRNA variant deposited in GeneBank under accession number NM 212472.1. The corresponding amino acid sequence is deposited in GenPept database under accession number NP 997637.1. The cAMP-binding domain B corresponds to the region ranging from position 262 to position 381 in the amino acid sequence of PRKARl A (Figure 1C). The terms "mutation" mean any detectable change in genetic material, e.g. DNA, RNA, cDNA, or any process, mechanism, or result of such a change. This includes gene mutations, in which the structure (e.g. DNA sequence) of a gene is altered, any gene or DNA arising from any mutation process, and any expression product (e.g. protein or enzyme) expressed by a modified gene or DNA sequence. Mutations include deletion, insertion or substitution of one or more nucleotides. The mutation may occur in the coding region of a gene (i.e. in exons), in introns, or in the regulatory regions (e.g. enhancers, response elements, suppressors, signal sequences, polyadenylation sequences, promoters) of the gene. Generally a mutation is identified in a subject by comparing the sequence of a nucleic acid or polypeptide expressed by said subject with the corresponding nucleic acid or polypeptide expressed in a control population. Where the mutation is within the gene coding sequence, the mutation may be a "missense" mutation, where it replaces one amino acid with another in the gene product, or a "non sense" mutation, where it replaces an amino acid codon with a stop codon. A mutation may also occur in a splicing site where it creates or destroys signals for exon-intron splicing and thereby lead to a gene product of altered structure. A mutation in the genetic material may also be "silent", i.e. the mutation does not result in an alteration of the amino acid sequence of the expression product.
A "subject" in the context of the present invention is preferably a mammal. The mammal can be a human, non-human primate, mouse, rat, dog, cat, horse, or cow, but are not limited to these examples. Mammals other than humans can be advantageously used as subjects that represent animal models of hormone resistance. A subject can be male or female. A subject can also be one who has not been previously diagnosed as having hormone resistance. For example, a subject can be one who exhibits one or more risk factors for hormone resistance, or a subject who does not exhibit hormone resistance risk factors, or a subject who is asymptomatic for hormone resistance. A subject can also be one who is at risk of developing hormone resistance.
"Risk" in the context of the present invention, relates to the probability that an event will occur over a specific time period, as in the conversion to hormone resistance, and can mean a subject's "absolute" risk or "relative" risk. Absolute risk can be measured with reference to either actual observation post-measurement for the relevant time cohort, or with reference to index values developed from statistically valid cohorts that have been followed for the relevant time period. Relative risk refers to the ratio of absolute risks of a subject compared either to the absolute risks of low risk cohorts or an average population risk, which can vary by how clinical risk factors are assessed. Odds ratios, the proportion of positive events to negative events for a given test result, are also commonly used (odds are according to the formula p/(l-p) where p is the probability of event and (1- p) is the probability of no event) to no- conversion. Alternative continuous measures which may be assessed in the context of the present invention include time to hormone resistance conversion and therapeutic hormone resistance conversion risk reduction ratios.
As used herein the term "hormone resistance" refers to any condition mimicking a hormone deficiency. More particularly, said hormone resistance results from a loss of function in the cAMP signalling pathway. Accordingly the present invention pertains to any hormone that mediates its effect through the cAMP signalling pathway. Said hormone may be easily identified by the skilled man in the art. Typically said hormones include but are not limited to thyroid stimulating hormone (TSH), luteinizing hormone (LH), follicle-stimulating hormone (FSH), parathyroid hormone (PTH), thyrotropin, parathyroid hormone-related protein (PTHrP), gonadotropin, gonadotropin releasing hormone(GnRH), calcitonin, C5a anaphylatoxin, neurokinin, thyrotropin-releasing hormone (TRH), oxytocin, glucagon, , Growth hormone-releasing hormone (GHRH), Corticotropin Releasing Hormone, melanocyte stimulating hormone, adrenocorticotropic hormone, melanocortin hormone, and adrenocortico trophic hormone (ACTH).
Mutation of the invention:
The inventors identified a mutation in the PRKA l A gene.
As shown in example, direct sequencing of the PRKARIA gene has led to the detection of a distinct non sense mutation c. H01C>T changing the codon specifying the conserved arginine 368 in cAMP binding domain B to a stop codon (p. R368X). A nucleic acid comprising a PRKARIA nucleotide sequence, or a fragment thereof, carrying a mutation such as defined above is part of the invention. Accordingly, the invention relates to an isolated nucleic acid encoding the PRKARl A, which nucleic acid comprises or consists in a PRKARl A gene sequence that contains the non sense mutation c.1101 C>T. The invention further relates to the polypeptide encoded by said nucleic acid.
The present invention also relates to cell transformed with a nucleic acid according to the invention. Diagnostic methods of the invention:
A further aspect of the invention relates to a method for predicting whether a subject is at risk for having or developing a hormone resistance comprising the step consisting of detecting in a sample a mutation in PRKARl A gene wherein the presence of said mutation is indicative of a risk of having or developing a hormone resistance.
In fine the method of the presentation invention is particularly suitable for identifying subjects at risk for having or developing a hormone disorder. In some embodiments, hormone disorders comprise growth disorders, acrodysostosis, acromegaly, Addison disease, adrenal gland diseases, Cushing syndrome, obesity, diabetes mellitus-type 2, gonadal disorders, hypogonadism, hypopituitarism, hypothyroidism, Kallmann syndrome, parathyroid diseases, pituitary diseases, puberty, delayed, puberty, precocious, renal osteodystrophy.
The present invention also relates to a method for diagnosing hormone resistance in a subject comprising the step consisting of detecting in a sample a mutation in PRKARl A gene according to the invention wherein the presence of said mutation is indicative that said subject has a hormone resistance.
The present invention also provides a molecular diagnosis for a hormone disorder. Thus the present invention also relates to a method for diagnosing hormone resistance in a subject comprising the step consisting of detecting in a sample a mutation in PRKARl A gene wherein the presence of said mutation is indicative that said subject has a hormone disorder. The present invention also provides a molecular diagnosis for aero dysostosis. Thus the present invention also relates to a method for diagnosing aero dysostosis in a subject comprising the step consisting of detecting in a sample a mutation in PRKARIA gene wherein the presence of said mutation is indicative that said subject has aero dysostosis.
The present invention also relates to a method for estimating a probability that a subject will achieve a response to a treatment with a hormone, comprising detecting in a sample a mutation in PRKARIA gene wherein the presence of said mutation is indicative that said subject has a high risk not to achieve a response with said treatment.
Typically, said hormone may be selected from the group consisting of thyroid stimulating hormone (TSH), luteinizing hormone (LH), follicle-stimulating hormone (FSH), parathyroid hormone (PTH), thyrotropin, parathyroid hormone-related protein (PTHrP), gonadotropin, gonadotropin releasing hormone(GnRH), calcitonin, C5a anaphylatoxin, neurokinin, thyrotropin-releasing hormone (TRH), oxytocin, glucagon, Growth hormone- releasing hormone (GHRH), Corticotropin Releasing Hormone, melanocyte stimulating hormone, adrenocorticotropic hormone, melanocortin hormone, and adrenocorticotrophic hormone (ACTH).
Said method is particularly useful in the management of disorders associated with for example a hormone deficiency, the treatment of which signals through the said domain of said PKA subunit, since the effects of the treatment may be modulated at this level (pharmacogenomics).
Preferably, the PRKARIA mutation according to the invention is found in the region encoding for cAMP -binding-domain B of the protein. More preferably, the mutation of PRKARIA according to the invention is located in the exon 1 1. In some embodiments the mutation is a non sense mutation causing the truncation of cAMP -binding-domain B of the protein. Preferably the mutation induces the truncation of the region comprising arginine at position 368 (R368) and tyrosine a position 373 (Y373). More preferably the mutation is c. l 101 C>T changing the codon specifying the conserved arginine 368 in cAMP binding domain B to a stop codon (p. R368X).
According to a first embodiment, said mutation may be detected by analyzing a PRKARIA nucleic acid molecule. In the context of the invention, PRKARIA nucleic acid molecules include mRNA, genomic DNA and cDNA derived from mRNA. DNA or RNA can be single stranded or double stranded. These may be utilized for detection by amplification and/or hybridization with a probe, for instance.
The nucleic acid sample may be obtained from any cell source or tissue biopsy. Non- limiting examples of cell sources available include without limitation blood cells, buccal cells, epithelial cells, fibroblasts, or any cells present in a tissue obtained by biopsy. Cells may also be obtained from body fluids, such as blood, plasma, serum, lymph, etc. DNA may be extracted using any methods known in the art, such as described in Sambrook et al, 1989. RNA may also be isolated, for instance from tissue biopsy, using standard methods well known to the one skilled in the art such as guanidium thiocyanate-phenol-chloroform extraction.
PRKAR1A mutations may be detected in a RNA or DNA sample, preferably after amplification. For instance, the isolated RNA may be subjected to coupled reverse transcription and amplification, such as reverse transcription and amplification by polymerase chain reaction (RT-PCR), using specific oligonucleotide primers that are specific for a mutated site or that enable amplification of a region containing the mutated site. According to a first alternative, conditions for primer annealing may be chosen to ensure specific reverse transcription (where appropriate) and amplification; so that the appearance of an amplification product be a diagnostic of the presence of a particular PRKARl A mutation. Otherwise, RNA may be reverse-transcribed and amplified, or DNA may be amplified, after which a mutated site may be detected in the amplified sequence by hybridization with a suitable probe or by direct sequencing, or any other appropriate method known in the art. For instance, a cDNA obtained from RNA may be cloned and sequenced to identify a mutation in PRKARl A sequence.
Actually numerous strategies for genotype analysis are available (Antonarakis et al.,
1989 ; Cooper et al, 1991 ; Grompe, 1993). Briefly, the nucleic acid molecule may be tested for the presence or absence of a restriction site. When a base substitution mutation creates or abolishes the recognition site of a restriction enzyme, this allows a simple direct PCR test for the mutation. Further strategies include, but are not limited to, direct sequencing, restriction fragment length polymorphism (RFLP) analysis; hybridization with allele-specific oligonucleotides (ASO) that are short synthetic probes which hybridize only to a perfectly matched sequence under suitably stringent hybridization conditions; allele-specific PCR; PCR using mutagenic primers; ligase-PCR, HOT cleavage; denaturing gradient gel electrophoresis (DGGE), temperature denaturing gradient gel electrophoresis (TGGE), single-stranded conformational polymorphism (SSCP) and denaturing high performance liquid chromatography (Kuklin et al, 1997). Direct sequencing may be accomplished by any method, including without limitation chemical sequencing, using the Maxam-Gilbert method ; by enzymatic sequencing, using the Sanger method ; mass spectrometry sequencing ; sequencing using a chip-based technology; and real-time quantitative PCR. Preferably, DNA from a subject is first subjected to amplification by polymerase chain reaction (PCR) using specific amplification primers. However several other methods are available, allowing DNA to be studied independently of PCR, such as the rolling circle amplification (RCA), the InvaderTMassay, or oligonucleotide ligation assay (OLA). OLA may be used for revealing base substitution mutations. According to this method, two oligonucleotides are constructed that hybridize to adjacent sequences in the target nucleic acid, with the join sited at the position of the mutation. DNA ligase will covalently join the two oligonucleotides only if they are perfectly hybridized.
Therefore, useful nucleic acid molecules, in particular oligonucleotide probes or primers, according to the present invention include those which specifically hybridize the regions where the mutations are located.
Oligonucleotide probes or primers may contain at least 10, 15, 20 or 30 nucleotides. Their length may be shorter than 400, 300, 200 or 100 nucleotides. According to a second embodiment said mutation in the PRKARIA gene may be detected at the protein level.
Said mutation may be detected according to any appropriate method known in the art. In particular a sample, such as a tissue biopsy, obtained from a subject may be contacted with antibodies specific of the mutated form of PRKARIA, i.e. antibodies that are capable of distinguishing between a mutated form of PRKARIA and the wild-type protein (or any other protein), to determine the presence or absence of a PRKARIA specified by the antibody.
Antibodies that specifically recognize a mutated PRKARIA also make part of the invention. The antibodies are specific of mutated PRKARIA, that is to say they do not cross- react with the wild-type PRKARIA.
The antibodies of the present invention may be monoclonal or polyclonal antibodies, single chain or double chain, chimeric antibodies, humanized antibodies, or portions of an immunoglobulin molecule, including those portions known in the art as antigen binding fragments Fab, Fab', F(ab')2 and F(v). They can also be immuno conjugated, e.g. with a toxin, or labelled antibodies. Whereas polyclonal antibodies may be used, monoclonal antibodies are preferred for they are more reproducible in the long run.
Procedures for raising "polyclonal antibodies" are also well known. Polyclonal antibodies can be obtained from serum of an animal immunized against the appropriate antigen, which may be produced by genetic engineering for example according to standard methods well-known by one skilled in the art. Typically, such antibodies can be raised by administering mutated PRKAR1A subcutaneously to New Zealand white rabbits which have first been bled to obtain pre-immune serum. The antigens can be injected at a total volume of 100 μΐ per site at six different sites. Each injected material may contain adjuvants with or without pulverized acrylamide gel containing the protein or polypeptide after SDS- polyacrylamide gel electrophoresis. The rabbits are then bled two weeks after the first injection and periodically boosted with the same antigen three times every six weeks. A sample of serum is then collected 10 days after each boost. Polyclonal antibodies are then recovered from the serum by affinity chromatography using the corresponding antigen to capture the antibody. This and other procedures for raising polyclonal antibodies are disclosed by Harlow et al. (1988) which is hereby incorporated in the references.
A "monoclonal antibody" in its various grammatical forms refers to a population of antibody molecules that contains only one species of antibody combining site capable of immunoreacting with a particular epitope. A monoclonal antibody thus typically displays a single binding affinity for any epitope with which it immunoreacts. A monoclonal antibody may therefore contain an antibody molecule having a plurality of antibody combining sites, each immunospecific for a different epitope, e.g. a bispecific monoclonal antibody. Although historically a monoclonal antibody was produced by immortalization of a clonally pure immunoglobulin secreting cell line, a monoclonally pure population of antibody molecules can also be prepared by the methods of the present invention.
Laboratory methods for preparing monoclonal antibodies are well known in the art (see, for example, Harlow et al, 1988). Monoclonal antibodies (mAbs) may be prepared by immunizing purified mutated PRKAR1A into a mammal, e.g. a mouse, rat, human and the like mammals. The antibody-producing cells in the immunized mammal are isolated and fused with myeloma or heteromyeloma cells to produce hybrid cells (hybridoma). The hybridoma cells producing the monoclonal antibodies are utilized as a source of the desired monoclonal antibody. This standard method of hybridoma culture is described in Kohler and Milstein (1975). While mAbs can be produced by hybridoma culture the invention is not to be so limited. Also contemplated is the use of mAbs produced by an expressing nucleic acid cloned from a hybridoma of this invention. That is, the nucleic acid expressing the molecules secreted by a hybridoma of this invention can be transferred into another cell line to produce a transformant. The transformant is genotypically distinct from the original hybridoma but is also capable of producing antibody molecules of this invention, including immunologically active fragments of whole antibody molecules, corresponding to those secreted by the hybridoma. See, for example, U.S. Pat. No. 4,642,334 to Reading; PCT Publication No.; European Patent Publications No. 0239400 to Winter et al. and No. 0125023 to Cabilly et al.
Antibody generation techniques not involving immunisation are also contemplated such as for example using phage display technology to examine naive libraries (from non- immunised animals); see Barbas et al. (1992), and Waterhouse et al. (1993).
Antibodies raised against mutated PRKAR1A may be cross reactive with wild-type PRKAPvlA. Accordingly a selection of antibodies specific for mutated PRKAR1A is required. This may be achieved by depleting the pool of antibodies from those that are reactive with the wild-type PRKARl A, for instance by submitting the raised antibodies to an affinity chromatography against wild-type PRKARl A.
Alternatively, binding agents other than antibodies may be used for the purpose of the invention. These may be for instance aptamers, which are a class of molecule that represents an alternative to antibodies in term of molecular recognition. Aptamers are oligonucleotide or oligopeptide sequences with the capacity to recognize virtually any class of target molecules with high affinity and specificity. Such ligands may be isolated through Systematic Evolution of Ligands by Exponential enrichment (SELEX) of a random sequence library, as described in Tuerk C. and Gold L., 1990. The random sequence library is obtainable by combinatorial chemical synthesis of DNA. In this library, each member is a linear oligomer, eventually chemically modified, of a unique sequence. Possible modifications, uses and advantages of this class of molecules have been reviewed in Jayasena S.D., 1999. Peptide aptamers consists of a conformationally constrained antibody variable region displayed by a platform protein, such as E. coli Thioredoxin A that are selected from combinatorial libraries by two hybrid methods (Colas et al, 1996).
Probe, primers, aptamers or antibodies of the invention may be labelled with a detectable molecule or substance, such as a fluorescent molecule, a radioactive molecule or any others labels known in the art. Labels are known in the art that generally provide (either directly or indirectly) a signal.
The term "labelled", with regard to the probe, primers, aptamers or antibodies of the invention, is intended to encompass direct labelling of the the probe, primers, aptamers or antibodies of the invention by coupling (i.e., physically linking) a detectable substance to the the probe, primers, aptamers or antibodies of the invention, as well as indirect labeling of the probe, primers, aptamers or antibodies of the invention by reactivity with another reagent that is directly labeled. Other examples of detectable substances include but are not limited to radioactive agents or a fluorophore (e.g. fluorescein isothiocyanate (FITC) or phycoerythrin (PE) or Indocyanine (Cy5)). Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling of a DNA probe with biotin such that it can be detected with fluorescently labeled streptavidin. An antibody or aptamer of the invention may be labelled with a radioactive molecule by any method known in the art. For example radioactive molecules include but are not limited radioactive atom for scintigraphic studies such as 1123, 1124, Inl 11, Rel86, Rel88.
Kits of the invention:
According to another aspect of the invention, the PRKAR1 A mutation is detected by contacting the DNA of the subject with a nucleic acid probe, which is optionally labeled.
Primers may also be useful to amplify or sequence the portion of the PRKARl A gene containing the mutated positions of interest.
Such probes or primers are nucleic acids that are capable of specifically hybridizing with a portion of the PRKARl A gene sequence containing the mutated positions of interest. That means that they are sequences that hybridize with the portion mutated PRKAR1A nucleic acid sequence to which they relate under conditions of high stringency.
The present invention further provides kits suitable for determining at least one of the mutations of the PRKARl A gene.
The kits may include the following components:
(i) a probe, usually made of DNA, and that may be pre-labelled. Alternatively, the probe may be unlabelled and the ingredients for labelling may be included in the kit in separate containers ; and (ii) hybridization reagents: the kit may also contain other suitably packaged reagents and materials needed for the particular hybridization protocol, including solid-phase matrices, if applicable, and standards.
In another embodiment, the kits may include :
(i) sequence determination or amplification primers : sequencing primers may be pre-labelled or may contain an affinity purification or attachment moiety ; and
(ii) sequence determination or amplification reagents : the kit may also contain other suitably packaged reagents and materials needed for the particular sequencing amplification protocol. In one preferred embodiment, the kit comprises a panel of sequencing or amplification primers, whose sequences correspond to sequences adjacent to at least one of the polymorphic positions, as well as a means for detecting the presence of each polymorphic sequence.
In a particular embodiment, it is provided a kit which comprises a pair of nucleotide primers specific for amplifying all or part of the PRKARl A gene comprising at least one of mutations that are identified herein, especially at position 1101.
Alternatively, the kit of the invention may comprise a labelled compound or agent capable of detecting the mutated polypeptide of the invention (e.g., an antibody or aptamers as described above which binds the polypeptide). For example, the kit may comprise (1) a first antibody (e.g., attached to a solid support) which binds to a polypeptide comprising a mutation of the invention; and, optionally, (2) a second, different antibody which binds to either the polypeptide or the first antibody and is conjugated to a detectable agent.
The kit can also comprise, e.g., a buffering agent, a preservative, or a protein stabilizing agent. The kit can also comprise components necessary for detecting the detectable agent (e.g., an enzyme or a substrate). The kit can also contain a control sample or a series of control samples which can be assayed and compared to the test sample contained. Each component of the kit is usually enclosed within an individual container and all of the various containers are within a single package along with instructions for observing whether the tested subject is suffering from or is at risk of developing a bone mineral density related disease.
Therapeutic methods of the invention: The present invention also relates to an agent that is able to raise the expression of the nucleic acid of the invention for use in the treatment of hormone resistance, or even for the treatment of hormone disorders as above described. Without wishing to be bound by theory the inventors believe that an increase in the expression of the nucleic acid according to the invention could compensate the loss of function induced by the mutated protein and thus could restore sensitivity to hormones.
The present invention also relates to an agent that is able to restore the functionality of the polypeptide encoded by the nucleic acid of the invention for use in the treatment of hormone resistance.
In a particular embodiment, the agent improves the dissociation between the catalytic subunit of protein kinase A with the mutated PRKAR1A polypeptide according to the invention.
The present invention also relates to a method for screening a drug for the treatment of hormone resistance comprising the steps consisting of testing a plurality of candidate compounds for their ability to improve the dissociation between the catalytic subunit of protein kinase A with the mutated PRKAR1A polypeptide according to the invention and selecting those that improves said dissociation.
In some embodiment, said screening method is performed with a cell transformed with a nucleic acid according to the invention and a bio luminescence resonance energy assay is be used. Briefly, fusion protein constructs are prepared: a luciferase reporter may be inserted at the C-terminus of the mutated PRKAR1A and the YFP reporter at the N-terminus of the catalytic subunit of protein kinase A. Cells were then cotransfected with the constructs as prepared. The cells are then lysed. For BRET experiments, cell lysates are contacted with varying concentrations of 8 AHA-AMPc, cAMP analogue that specifically binds to cAMP binding domain B of PRKARIA. Luminescence and fluorescence are measured simultaneously at 485nm and 530nm using a Mithras LB940 plate reader (Berthold Technologies). The BRET ratios may then calculated and expressed in mBRET as previously described (Achour L, Scott MG, Shirvani H, et al. CD4-CCR5 interaction in intracellular compartments contributes to receptor expression at the cell surface. Blood 2009;! 13: 1938- 47.). The results are the mean ± SEM of 4 independent experiments with independent cotransfections.
In some embodiments, the screening method comprises the steps consisting of:
i) providing a first fusion protein consisting of a luciferase reporter fused at the C- terminus of the mutated PRKAR1A according to the invention and a second fusion protein consisting of a YFP reporter fused at the N-terminus of the catalytic subunit of protein kinase A
ii) contacting said fusion proteins with an amount of a candidate compound
iii) determining the curve response in BRET signal reduction obtained in the presence of varying amounts of 8 AHA-AMPc
iv) comparing the curve response obtained in step iii) with a curve response obtained with a first fusion protein comprising the wild type PRKARl A
v) and selecting the candidate compound that are able to a get curve response similar to the one obtained with a first fusion protein comprising the wild type PRKARl A.
In some embodiments, the screening method of the invention may comprise a step consisting of determining whether said candidate compound is able to restore the high affinity of mutated PRKARl A for cAMP.
According to a one embodiment of the invention, the candidate compound of may be selected from a library of compounds previously synthesised, or a library of compounds for which the structure is determined in a database, or from a library of compounds that have been synthesised de novo. The candidate compound may be selected from the group of (a) proteins or peptides, (b) nucleic acids and (c) organic or chemical compounds.
Animal models of the invention:
A further aspect of the invention relates to a non human animal model for hormone resistance and more specifically for multiple hormone resistance whose genome comprises a nucleic acid according to the invention (i.e. a nucleic acid comprising a PRKARl A nucleotide sequence comprising a distinct non sense mutation c. l 101C>T) linked to a promoter. Any of various methods can be used to introduce a nucleic acid sequence into animals to produce transgenic animals expressing said nucleic acid. Such techniques are well-known in the art and include, but are not limited to, pronuclear microinjection and transformation of embryonic stem cells. Methods for generating transgenic animals that can be used include, but are not limited to, those described in J. P. Sundberg and T. Ichiki, Eds., Genetically Engineered Mice Handbook, CRC Press; 2006; M. H. Hofker and J. van Deursen, Eds., Transgenic Mouse Methods and Protocols, Humana Press, 2002; A. L. Joyner, Gene Targeting: A Practical Approach, Oxford University Press, 2000; Manipulating the Mouse Embryo: A Laboratory Manual, 3<rd >edition, Cold Spring Harbor Laboratory Press; Dec. 15, 2002, ISBN-10: 0879695919; Kursad Turksen (Ed.), Embryonic stem cells: methods and protocols in Methods Mol Biol. 2002; 185, Humana Press; Current Protocols in Stem Cell Biology, ISBN: 978047015180; Meyer et al. PNAS USA, vol. 107 (34), 15022-15026.
Generation of a transgenic non- human animal expressing a nucleic acid according to the invention can be achieved by methods such as DNA injection of an expression construct into a preimplantation embryo or by use of stem cells, such as embryonic stem (ES) cells or induced pluripotent stem (iPS) cells.
The terms "expression construct" and "expression cassette" are used herein to refer to a double-stranded recombinant DNA molecule containing the desired nucleic acid sequence and containing one or more regulatory elements necessary or desirable for the expression of the operably linked coding sequence. The term "regulatory element" as used herein refers to a nucleotide sequence which controls some aspect of the expression of nucleic acid sequences. Exemplary regulatory elements illustratively include an enhancer, an internal ribosome entry site (IRES), an intron; an origin of replication, a polyadenylation signal (pA), a promoter, a transcription termination sequence, and an upstream regulatory domain, which contribute to the replication, transcription, post-transcriptional processing of a nucleic acid sequence. Those of ordinary skill in the art are capable of selecting and using these and other regulatory elements in an expression construct with no more than routine experimentation. Expression constructs can be generated recombinantly or synthetically using well-known methodology.
The term "operably linked" as used herein refers to a nucleic acid in functional relationship with a second nucleic acid. A regulatory element is included in an expression cassette is a promoter in particular embodiments. The term "promoter" as used herein refers to a DNA sequence operably linked to a nucleic acid sequence to be transcribed such as a nucleic acid sequence encoding a desired molecule. A promoter is generally positioned upstream of a nucleic acid sequence to be transcribed and provides a site for specific binding by RNA polymerase and other transcription factors. In specific embodiments, a promoter is generally positioned upstream of the nucleic acid sequence transcribed to produce the desired molecule, and provides a site for specific binding by RNA polymerase and other transcription factors. An included promoter can be a constitutive promoter or can provide inducible expression; and can provide ubiquitous, tissue-specific or cell-type specific expression.
Ubiquitous promoters include, but are not limited to, a 3-phosphoglycerate kinase (PGK-1) promoter, a beta-actin promoter, a ROSA26 promoter, a heat shock protein 70 (Hsp70) promoter, an EF-1 alpha gene encoding elongation factor 1 alpha (EF1) promoter, an eukaryotic initiation factor 4A (eIF-4Al) promoter, a chloramphenicol acetyltransferase (CAT) promoter and a CMV (cytomegalovirus) promoter.
Tissue-specific promoters that may be used include, but are not limited to, a promoter of a gene expressed in the tissue where the hormone resistance shall be installed. The skilled man in the art may easily identified the relevant promoter.
In addition to a promoter, one or more enhancer sequences may be included such as, but not limited to, cytomegalovirus (CMV) early enhancer element and an SV40 enhancer element.
An expression construct may include sequences necessary for amplification in bacterial cells, such as a selection marker (e.g. kanamycin or ampicillin resistance gene) and a replicon. For methods of DNA injection of an expression construct into a preimplantation embryo, the expression construct is linearized before injection into non-human preimplantation embryos. Preferably the expression construct is injected into fertilized oocytes. Fertilized oocytes are collected from superovulated females the day after mating (0.5 dpc) and injected with the expression construct. The injected oocytes are either cultured overnight or transferred directly into oviducts of 0.5-day p.c. pseudopregnant females. Methods for superovulation, harvesting of oocytes, expression construct injection and embryo transfer are known in the art and described in Manipulating the Mouse Embryo: A Laboratory Manual, 3rd edition, Cold Spring Harbor Laboratory Press; Dec. 15, 2002, ISBN-10: 0879695919. Offspring can be tested for the presence of the transgene by DNA analysis, such as PCR, Southern blot or sequencing. Mice which are carrying the transgene can be tested for protein expression such as by using ELISA or Western blot analysis.
Alternatively the expression construct may be transfected into stem cells (ES cells or iPS cells) using well-known methods, such as electroporation, calcium-phosphate precipitation and lipofection. The cells are screened for transgene integration by DNA analysis, such as PCR, Southern blot or sequencing. Cells with the correct integration can be functionally tested.
Mouse ES cells are grown in media optimized for the particular line. Typically ES media contains 15% fetal bovine serum (FBS) or synthetic or semi-synthetic equivalents, 2 mM glutamine, 1 mM Na Pyruvate, 0.1 mM non-essential amino acids, 50 U/ml penicillin and streptomycin, 0.1 mM 2-mercaptoethanol and 1000 U/ml LIF (plus, for some cell lines chemical inhibitors of differentiation) in Dulbecco's Modified Eagle Media (DMEM). A detailed description is known in the art (Tremml et al., 2008, Current Protocols in Stem Cell Biology, Chapter l :Unit 1C.4. For review of inhibitors of ES cell differentiation, see Buehr, M., et al. (2003). Genesis of embryonic stem cells. Philosophical Transactions of the Royal Society B: Biological Sciences 358, 1397-1402.
Selected cells incorporating the expression construct can be inj ected into preimplantation embryos. For microinjection, ES or iPS cell are rendered to single cells using a mixture of trypsin and EDTA, followed by resuspension in ES media. Groups of single cells are selected using a finely drawn-out glass needle (20-25 micrometer inside diameter) and introduced through the embryo's zona pellucida and into the blastocysts cavity (blastocoel) using an inverted microscope fitted with micromanipulators. Alternatively to blastocyst injection, stem cells can be injected into early stage embryos (e.g. 2-cell, 4-cell, 8-cell, premorula or morula). Injection may be assisted with a laser or piezo pulses drilled opening the zona pellucida. Approximately 9-10 selected stem cells (ES or iPS cells) are injected per blastocysts, or 8-cell stage embryo, 6-9 stem cells per 4-cell stage embryo, and about 6 stem cells per 2-cell stage embryo. Following stem cell introduction, embryos are allowed to recover for a few hours at 37[deg.] C. in 5% C02, 5% 02 in nitrogen or cultured overnight before transfer into pseudopregnant recipient females. In a further alternative to stem cell injection, stem cells can be aggregated with morula stage embryos. All these methods are well established and can be used to produce stem cell chimeras. For a more detailed description see Manipulating the Mouse Embryo : A Laboratory Manual, 3rd edition (A. Nagy, M. Gertsenstein, K. Vintersten, R. Behringer, Cold Spring Harbor Laboratory Press; Dec. 15, 2002, ISBN-10: 0879695919, Nagy et al, 1990, Development 110, 815-821; U.S. Pat. No. 7,576,259: Method for making genetic modifications, U.S. Pat. No. 7,659,442, U.S. Pat. No. 7,294,754, Kraus et al. 2010, Genesis 48, 394-399).
Pseudopregnant embryo recipients are prepared using methods known in the art. Briefly, fertile female mice between 6-8 weeks of age are mated with vasectomized or sterile males to induce a hormonal state conductive to supporting surgically introduced embryos. At 2.5 days post coitum (dpc) up to 15 of the stem cell containing blastocysts are introduced into the uterine horn very near to the uterus-oviduct junction. For early stage embryos and morula, such embryos are either cultured in vitro into blastocysts or implanted into 0.5 dpc or 1.5 dpc pseudopregnant females according to the embryo stage into the oviduct. Chimeric pups from the implanted embryos are born 16-20 days after the transfer depending on the embryo age at implantation. Chimeric males are selected for breeding. Offspring can be analyzed for transmission of the ES cell genome by coat color and genetic analysis, such as PCR, Southern blot or sequencing. Further the expression of the nucleic acid of the invention can be analyzed by protein analysis (Western blot, ELISA) or other functional assays. Offspring expressing the transgene are intercrossed to create non-human animals homozygous for the transgene.
Alternatively the transgene is targeted into a specific locus of the stem cell genome which is known to result in reliable expression, such as the Hprt or the Rosa26 locus. For targeted transgenics, a targeting construct is made using recombinant DNA techniques and includes 5' and 3' sequences which are homologous to the stem cell endogenous gene. The targeting construct further includes a selectable marker such as neomycin phosphotransferase, hygromycin or puromycin, a nucleic acid according to the invention and a polyadenylation signal. To insure correct transcription and translation of the nucleic acid according to the invention, the nucleic acid according to the invention is either in frame with the endogenous gene locus, or a splice acceptor site and internal ribosome entry site (IRES) sequences are included. For example see FIG. 5C. Such a targeting construct is transfected into stem cells and the stem cells are screened to detect the homologous recombination event using PCR, Southern blot or sequencing analysis. Cells with the correct homologous recombination event can be further analyzed for transgene expression by protein analysis, such as ELISA or Western blot analysis. If desired, the selectable marker can be removed by treating the stem cells with Cre recombinase. After Cre recombinase treatment the cells are analyzed for the presence of the nucleic acid according to the invention. Cells with the correct genomic event will be selected and injected into preimplantation embryos as described above. Chimeric males are selected for breeding. Offspring can be analyzed for transmission of the ES cell genome by coat color and genetic analysis, such as PCR, Southern blot or sequencing and can be tested for SCF protein expression such as by protein analysis (Western blot, ELISA) or other functional assays. Offspring expressing the by protein analysis (Western blot, ELISA) or other functional assays are intercrossed to create non-human animals homozygous for the transgene.
In some embodiments transgenic animals include a nucleic acid according to the invention in substantially all of their cells, as well as transgenic animals that include a nucleic acid of the invention in some, but not all their cells. One or multiple copies (such as concatamers) of the nucleic acid of the invention may be integrated into the genome of the cells of the transgenic animals.
Transgenic animals of the present invention are preferably non- human mammals, particularly rodents, such as mice, rats or guinea pigs. More preferably, the animal is a mouse. Said mouse may be selected from the groups consisting of C57BL/6, BALB/c, DBA/2, CBA/ and SV129 strains.
Such animal model may be useful for screening drugs useful for treating hormone resistance, or even for treating hormone disorders as above described. More particularly, the animal model according to the invention may be suitable for screening drugs for treating a hormone resistance, studying the physiopathology of said hormone resistance, and for endeavouring diagnostic or prognostic markers of said hormone resistance.
A further aspect of the invention relates to a method for screening a drug for treating hormone resistance, said method comprising the step consisting of: i) providing a non human animal model according to the invention
ii) administering to said animal a candidate compound
iii) measuring the effect of said compound on the hormone sensitivity.
iv) selecting the candidate compound capable of the hormone sensitivity.
According to a one embodiment of the invention, the candidate compound of may be selected from a library of compounds previously synthesised, or a library of compounds for which the structure is determined in a database, or from a library of compounds that have been synthesised de novo. The candidate compound may be selected from the group of (a) proteins or peptides, (b) nucleic acids and (c) organic or chemical compounds.
The invention will be further illustrated by the following figures and examples. However, these examples and figures should not be interpreted in any way as limiting the scope of the present invention.
FIGURES:
Figure 1. Identification of a nonsense mutation causing R368X in patients with acrodysostosis. (A) Family pedigrees. Patients, filled symbols; unaffected, open symbols; males, squares; females, circles. (B) A portion of the nucleotide sequence of exon 1 1 of the PRKARIA gene from index cases and unaffected parents is shown. The heterozygous substitution of cytosine at position 1 101 (c. l 101C>T) leads to the replacement of the Arg at position 368 by a stop codon (p.Arg368X). ( Schematic representation of PRKARIA. The deleted region (grey) comprises the Tyr at position 373. (DD : dimerization domain; IS : inhibitory site; cA-A and cA-B: cAMP-binding domains A and B). Numbers indicate the residues at the domain boundaries.14 (D) PRKARIA protein expression in EBV-immortalized B-lymphocytes from controls (Ctrl 1 , Ctrl 2) and patients with acrodysostosis (Pt 1 , Pt 2) was analyzed by Western blotting as described in the Supplementary Appendix. The ratio of truncated (47 kDa) to wild-type protein (49 kDa) was 3.2+0.2 and 6.9+0.8 (mean+SEM, n=3), respectively, for Pt 1 and Pt 2.
Figure 2. PKA activity in cells expressing R368X and Y373A PRKARIA. (A)
PRKARIA protein expression in untransfected cells (UnT) or cells transiently transfected with pCDNA3.1 constructs encoding WT-PRKARIA, R368X-PRKAR 1 A , Y373A- PRKARIA or the empty vector was analyzed by Western blotting. (B) PKA transcriptional activity was measured in cells stimulated with the indicated concentrations of forskolin in the presence of 1 mM IBMX using the CRE-luciferase reporter assay described in the Supplementary Appendix. Results are expressed relative to values obtained for unstimulated cells transfected with the empty vector (mean±SEM, n=3). (†) <0.001 comparing cells transfected with R368X and Y373A-PRKAR1 A to cells transfected with the empty vector and those transfected with WT-PRKARIA and stimulated with the same forskolin concentration, (t) <0.001 comparing cells transfected with WT-PRKARIA to cells transfected with the empty vector and stimulated by the same forskolin concentration. (*) <0.001 comparing cells transfected with WT, R368X and Y373A-PRKAR1 A to cells transfected with the empty vector and stimulated by 10 μΜ forskolin. (C) Cells were stimulated with the indicated concentrations of the B-site selective 8-aminohexylamino-cAMP analog in the presence of 1 mM IBMX. 8-AHA-cAMP induced significant stimulation of CRE-luciferase activity in cells transfected with either the WT-PRKARIA or the empty vector († p<0.05;†† p<0.01), but not in cells transfected with the R368X or Y373A-PRKAR1A mutants. (D) Lysates from cells cotransfected with YFP-PRKACA and either WT, R368X or Y373A-PRKAR1A-Iuc constructs were incubated in the presence of the indicated concentrations of 8-AHA-cAMP, and BRET ratios were determined as described in the Supplementary Appendix. Results (mean±SEM; n=4) are expressed as % of values measured in the absence of 8-AHA-cAMP.
Supplementary Figure 1. Brachydactyly in a patient with acrodysostosis and hormonal resistance. Shown are a photograph (A) and radiograph (B) of one hand of patient 2 obtained when the patient was 10 years old. The patient presents a shortening of metacarpals, metatarsals and phalanges, characterizing brachydactyly type E (BDE). Note the shortening of all bones, and the bulky and stocky aspect of the affected bones.
Supplementary Figure 2. Response to PTH infusion of patients with acrodysostosis and hormonal resistance and control subjects. Subjects received a bolus intravenous injection of 40 μg/kg recombinant hPTHl-34. (A) Urinary cAMP, expressed as μηιοΐ/ιηιηοΐ creatinine, was measured at the indicated times in the three patients (solid symbols) and in 6 control subjects (open symbols). Urinary cAMP under baseline conditions was elevated in the three patients (patients, 23.4 ± 2.2; controls, 13.9 ± 2.1 μιηοΐ cAMP/ mmol creatinine; p < 0.048). The three patients showed a brisk rise in urinary cAMP following PTH infusion. Although peak values were, on average, lower than those observed in controls, this difference did not reach statistical significance. (B) FECa was measured 4 h after PTH administration in the three patients and five controls. A decrease in FECa was observed in 2 of 3 patients and all controls. The decrease in FECa in the three patients at 4 h after PTH infusion was significantly less than that observed in controls (% decrease in FECa: patients, 25 ± 12%; controls, 76 ± 13%; p < 0.036).
Supplementary Figure 3. Western blot analysis of CREB phosphorylation in lymphocytes from 2 controls and patients 1 and 2. Lymphocytic cell lines from patients (Pt) 1 and 2 and two controls (Ctrl) were stimulated or not for 30 min with 10 μΜ Forskolin in the presence of IBMX, lysed and processed for Western blotting using antibodies against S133-phospho-CREB (PCREB) and CREB as described in the methods section. The intensity of each band was determined using ImageJ software, and the PCREB/CREB ratio was calculated for each sample (raw data). The results from each experiment were normalized to the mean of the values obtained for forskolin- stimulated control cells (normalized). (A) Blots and results obtained from a single experiment. (B) Results (mean ± SEM of normalized ratios) for 4 experiments, except for patient 1 (n=3). ** p<0.001, compared to results obtained for cells from both controls.
Supplementary Figure 4. Structural analysis of 3D models of WT and mutant forms of human PRKAR1A. (A) Ribbon representation of WT PRKAR1 A (left, red) and PRKARl A carrying the R368X mutation (right, light blue). (B) Surface representation of the PRKAR1 A domain B binding pocket. Both the WT (left, red) and R368X mutant (right, light blue) are shown. A stick diagram (yellow) of a cAMP molecule docked into the binding pocket is also shown. (C) stick representation of cAMP docking into the binding pocket of the WT (left, purple), R368X mutant (middle, yellow) and the Y373A mutant (right, orange) forms of the domain B binding pocket of PRKARl A. Dashed lines represent ionic interactions; arrows indicate the turn of adenine ring within the binding pocket. All images were generated with PyMol software (http://www.pymol.org/).
Supplementary Figure 5. Stimulation of cAMP production in response to isoproterenol and cholera toxin is not different comparing COS cells transfected with wild-type and mutant PRKARIA. COS cells were transfected with plasmids resulting in the expression of WT PRKAR1A or PRKAR1A carrying the R386X or Y373A mutations. Forty- eight h after transfection, the cells were stimulated in triplicate with the indicated amounts of isoproterenol (A) or cholera toxin (B) as described in the Subjects and Methods section of the Supplementary Appendix. Two independent experiments were performed. Shown are the mean ± SEM from one representative experiment.
EXAMPLE 1: A RECURRENT MUTATION IN PRKAR1A AND ACRODYSOSTOSIS WITH HORMONE RESISTANCE Results:
Patients: The three patients we studied were small for gestational age at birth and developed typical clinical and radiological features of aero dysostosis (Table 1 and Fig. 1, Supplementary Appendix). Two of the patients were West Europeans (WE). One patient (patient 2) was of mixed WE (3/4) and West African (WA) (1/4) descent. Resistance to PTH was present on the basis of increased circulating PTH levels in the presence of low or normal serum calcium and normal or increased serum phosphate. Plasma cAMP was increased in two patients, and at the upper limit of the normal range in the third. Urinary calcium excretion was normal in all patients, and TmP/GFR was increased in two. Urinary cAMP excretion, a marker of PTH bioactivity in the kidney, was elevated under baseline conditions in all patients (patients, 23.4±2.2; controls, 13.9±2.1 μιηοΐ cAMP / mmol creatinine, p=0.048; Supplementary Fig. 2), consistent with PTH resistance resulting from an abnormality downstream of adenylyl cyclase. All patients showed a brisk rise in urinary cAMP following PTH infusion (Supplementary Fig. 2A); peak values trended lower than those in controls (p= NS). No phosphaturic response was observed in the patients over the first hour following PTH infusion. However, as increased phosphate excretion was observed in only 2/6 controls, there was no significant difference between the two groups (data not shown). The decrease in fractional calcium excretion (FEca), calculated as [UCa/UCr x SCr/SCa] in the three patients four hours after PTH infusion was significantly smaller than that observed in controls (% decrease in FECa, 25±12% and 76±13% respectively, p=0.036; Supplementary Fig. 2B).
All patients had normal or low T4 associated with increased TSH levels, indicating resistance to TSH (Table 1). As was observed for PTH and TSH, increased serum calcitonin levels, measured in two patients, were consistent with resistance to calcitonin, as is also seen in patients affected with PHP la and mutation in Gsa.10-11 Impaired GH secretory responses after GHRH challenge indicated resistance to GHRH in the two patients in whom it was studied (Table 1). Mild gonadotropin resistance was indicated by the presence of bilateral cryptorchidism in the 2 male patients; decreased testosterone levels in the adult male patient; increased basal FSH levels in the female patient; and "high normal" peak levels of serum FSH and LH in patient 1 in response to GnRH, measured on two occasions (FSH/LH: 5.9/26.8 and 5.9/19.0 UI/L).
There were no other affected people in the patients' families (Fig. lA). Karyotyping was performed in each patient at during the initial clinical investigation, and revealed no abnormalities. Analysis of the GNAS locus, including sequencing of Gsa exons 1-13 and evaluation of methylation at the four differentially methylated regions, revealed no abnormalities. Informed written consent was obtained from patients, parents and controls, in agreement with the French Ethical Committee recommendations.
Identification of the Mutation in the PRKARIA Gene: Since the patients with aero dysostosis displayed resistance to hormones signalling through the GPCR-cAMP- activated pathway, we hypothesized that a mutation in PRKARIA, resulting in an impairment of the responsiveness of PKA to cAMP, could be involved. Indeed, in the three unrelated patients, the same heterozygous cytosine - thymidine mutation was identified in exon 11 of the PRKARIA gene (c. l l01C>T; Fig. IB). This transversion changed the codon specifying the conserved Arg368 in the cAMP -binding protein domain B to a stop codon (p.Arg368X), resulting in the truncation of the last 14 amino-acids of the protein (Fig. 1C). This mutation was not found in the public databases or in the 200 ancestrally-matched control persons (100 WE, 100 WA).12 Paternity was confirmed in the three patients using micro satellite analysis at 16 loci (PowerPlex 16 System, Promega; Supplementary Appendix, Table 1). The mutation was not present in the patients' parents or in the one sibling studied, indicating that the same mutation had occurred de novo in each patient (Fig. IB). Expression of the mutant mRNA in patients 1 and 2 was demonstrated by sequencing amplification products obtained by RT-PCR from patient RNA extracted from lymphoblastic cell lines. Western blot analysis of protein extracts from EBV-transformed lymphocytes showed heterozygous expression of a shortened PRKARIA protein (MW -47 kD) consistent with the lack of the last 14 C-terminal amino- acids (Fig. ID). Functional studies of PKA activation, performed by measuring the phosphorylation of CREB at SI 33 in forskolin- stimulated lymphocytic cell lines, demonstrated that CREB phosphorylation was significantly reduced in cells from patients compared to that observed in cells from controls (Supplementary Fig. 3). R368X Impairs cAMP-induced PKA Activity: In the absence of cAMP, PKA exists as a tetramer with two regulatory (R) subunits locking the two catalytic (C) subunits in an inactive state.3"4' 13 Activation of the enzyme requires the release of the catalytic subunits, which is triggered by the sequential binding of cAMP molecules first to domain B, then to domain A of the R subunit. Because domain A is relatively inaccessible to cAMP binding until cAMP binds to domain B, domain B has been designated the "gatekeeper" for PKA activation. The identified mutation that results in R368X causes a truncation of PRKARIA domain B, including two residues, Arg368 and Tyr373, shown to be determinant for the binding of cAMP to domain B.14 The mutation that results in Y373A has been shown previously in vitro to render PKA less sensitive to cAMP activation.14 These observations indicate that R368X should cause a functional defect in PRKARIA comparable to that caused by Y373A, and result in the formation of PKA tetramers whose activation by cAMP is impaired.
To demonstrate this point at a molecular level, we compared cAMP-stimulated PKA activity in cells transfected with vectors expressing each of the mutant cDNAs that give rise to PRKARIA R386X and Y373A, the wild-type (WT) PRKARIA or an empty control vector. Cells were co-transfected with a CRE-luciferase construct to assess PKA activity using CRE-mediated gene transcription.15"16 WT and abnormal PRKARIA proteins were expressed at similar levels in these cells, and were present in excess over the endogenous PRKARIA protein levels (Fig. 2A).
As expected, forskolin induced a concentration-dependent increase in CRE-luciferase activity in cells transfected with the empty vector (endogenous PKA activity) and in cells transfected with the WT PRKARIA cDNA (Fig. 2B). At all concentrations tested, forskolin induced a lower stimulation of PKA in cells overexpressing the WT PRKARIA compared to that seen in cells transfected with the empty vector, as previously described,17 reflecting the inhibitory effect of PRKARIA subunit overexpression on PKA activity. H89, a selective PKA inhibitor acting on the catalytic subunit, abolished completely the ability of forskolin to increase CRE-luciferase activity. In cells expressing R386X or Y373A PRKARIA proteins, forskolin induced a concentration-dependent increase in CRE-luciferase activity, but with a marked shift to the right in the dose-response curve, indicating that the responsiveness of PKA to cAMP was substantially reduced (Fig. 2B). PKA activity in response to the 8-AHA-cAMP analog is impaired in cells transfected with R368X and Y373A PRKARIA: We reasoned that since the 8- aminohexylamino-cAMP analog (8-AHA-cAMP) binds preferentially to domain B of PRKARIA, but not to domain A, PKA- induced transcriptional activity in cells expressing PRKARIA mutants lacking a functional domain B should be impaired in response to this analog.18 As expected, 8-AHA-cAMP induced a dose-dependent increase in CRE-luciferase activity in untransfected cells or cells overexpressing WT PRKARIA (Fig. 2C). In contrast, 8-AHA-cAMP did not significantly stimulate CRE-luciferase activity in cells expressing R368X or Y373A PRKARIA, even at high concentration (30 μΜ).
The Release of the Catalytic Subunits is Impaired in Cells Transfected with R368X and Y373A PRKARIA: Bio luminescence Resonance Energy Transfer (BRET) analysis of the interaction between the catalytic subunit (PRKACA) and WT and R368X and Y373A PRKARIA was performed to examine the underlying mechanism of hormonal resistance. The presence of a molecular interaction between PRKACA and both the WT or abnormal (R368X and Y373A) PRKARIA subunits was demonstrated by the presence of a strong and saturable BRET signal obtained when increasing amounts of the YFP-PRKACA acceptor were cotransfected with a fixed amount of the PRKARlA-luc donor subunits. In cells transfected with the WT PRKARIA, the 8-AHA-cAMP analog induced a dose- dependent reduction of the BRET signal, reflecting the dissociation between the 2 subunits (Fig. 2D). In cells transfected with the R368X and Y373A PRKARIA, 8-AHA-cAMP also induced a dose-dependent reduction of the BRET signal, but the dose-response curve was significantly shifted to the right for both mutants (EC50: WT PRKARIA, 1.0±0.3 10~9 M; R368X PRKARIA, 7.1±0.7 10~9 M; R373A PRKARIA, 1.2±0.2 10~8 M; p<0.05 and <0.01 respectively, comparing R368X and R373A to WT). Thus, these results confirm that the mutation that leads to R368X PRKARIA results in the expression of regulatory subunits that are able to bind PKA catalytic subunits, but whose dissociation from catalytic subunits is less sensitive to cAMP. An analysis performed using 3D-models based on published crystallographic structures of bovine and mouse PKA12 indicated that the mutations that result in both R386X and Y373A lead to abnormalities in the domain B pocket that preclude high-affinity binding of cAMP (Supplementary Appendix, results and Fig. 4).
Dicussion: These three unrelated patients have aero dysostosis and resistance to several hormones carrying the same heterozygous de novo mutation that results in an amino acid substitution of R368X in PRKARIA. This mutation introduces a premature stop codon in the C-terminal portion of PRKARIA, thereby disrupting the cAMP -binding domain B. The alteration of cAMP binding to domain B is known to disrupt the ordered and cooperative activation of PKA by cAMP,14' 19 as reported here. The abnormal PRKARIA protein was present at higher levels than the wild type protein in cells from the patients, consistent with a faster rate of degradation of WT than abnormal PRKARIA subunits due to the preferential release of WT PRKARIA from PKA tetramers.2' 20 The presence of tetramers preferentially formed with the mutated protein is likely to accentuate the cAMP resistance, and to explain the dominant effect of this heterozygous PKRAR1A mutation. It is noteworthy, however, that the mutation leads to an impairment, not a total absence of PKA activity. In addition, several iso forms of both R and C subunits of PKA have been identified, each the product of distinct genes, and a variety of PKA isoenzymes have been described that use different combinations of these subunits.2"4 Thus, although the most abundant isoenzyme (Type l a), formed by the combination of catalytic subunit a and PRKARIA, appears to be expressed constitutive ly in most cells, the deleterious effects of the R368X abnormality may be more or less pronounced depending on the cell-specific expression of alternative PKA isoforms. These considerations may explain the variation in the extent of resistance for different hormones that signal through cAMP.
It is interesting that genetic and biochemical abnormalities in the same cAMP- signaling pathway are associated with both aero dysostosis with hormonal resistance and PHPla. While aero dysostosis and PHPla share several typical clinical features (e.g., metacarpal abnormalities, obesity, cryptorchidism, and resistance to hormones that depend upon the generation of cAMP), other manifestations differ. Although impaired PTHrP- mediated actions likely contribute to the skeletal phenotype in both diseases, the skeletal dysplasia is more severe in acrodysostosis, with prenatal onset and marked brachydactyly (Supplementary Fig. 1). In contrast, PTH resistance is less marked in acrodysostosis, as indicated by the absence of hypocalcemia during follow-up periods ranging from 10 to 24 years. The tissue-specific imprinting of Gsa and tissue-specific expression of alternative PKA isoforms may contribute to the phenotypic differences observed comparing acrodysostosis and PHPla.
Because the mutation that leads to R368X results in PKRARIA regulatory subunits that are impaired in their ability to dissociate from catalytic subunits in response to cAMP, it is, in this sense, a "gain-of- function" mutation of PRKAR1A that decreases PKA sensitivity to cAMP. In contrast, germline "loss-of- function" mutations of PRKAR1A that result in constitutive activation of PKA induce a disease called the Carney Complex (CNC), in which patients can manifest various combinations of lentigines, cardiac myxoma and primary pigmented nodular adrenocortical disease.21"23 Osteochondromyxomas have been observed in CNC and mouse models associated with increased cAMP-dependent PKA activity. 24-25
In conclusion, this work identifies a novel genetic abnormality within the cAMP- signaling pathway that results in the resistance of PKA to cAMP stimulation, thereby causing congenital bone dysplasia associated with resistance to several hormones. Whether or not other clinically distinct forms acrodysostosis are also due to genetic or epigenetic defects at the PRKAR1A locus, or in other genes of the pathway, remains to be determined.
References: 1. Spiegel AM, Weinstein LS. Inherited diseases involving g proteins and g protein-coupled receptors. Annu Rev Med 2004;55 :27-39.
2. Spaulding SW. The ways in which hormones change cyclic adenosine 3 ',5'- monophosphate-dependent protein kinase subunits, and how such changes affect cell behavior. Endocr Rev 1993;14:632-50.
3. Tasken K, Skalhegg BS, Tasken KA, et al. Structure, function, and regulation of human cAMP-dependent protein kinases. Adv Second Messenger Phosphoprotein Res
1997;31 : 191-204.
4. Taylor SS, Buechler J A, Yonemoto W. cAMP-dependent protein kinase: framework for a diverse family of regulatory enzymes. Annu Rev Biochem 1990;59:971- 1005.
5. Bastepe M, Juppner H. GNAS locus and pseudohypoparathyroidism. Horm Res 2005;63:65-74.
6. Maroteaux PLM, M. Les Maladies Osseuses de l'Enfant. 4 ed. Paris: Medecine- Sciences Flammarion; 2002.
7. Ablow RC , Hsia YE , Brandt IK. Acrodysostosis coinciding with pseudohypoparathyroidism and pseudo-pseudo hypoparathyroidism. AJR Am J Roentgenol 1977;128:95-9. 8. Graham JM, Jr., Krakow D, Tolo VT, Smith AK, Lachman RS. Radiographic findings and Gs-alpha bioactivity studies and mutation screening in acrodysostosis indicate a different etiology from pseudohypoparathyroidism. Pediatr Radiol 2001;31 :2-9.
9. Wilson LC, Oude Luttikhuis ME, Baraitser M, Kingston HM, Trembath RC. Normal erythrocyte membrane Gs alpha bioactivity in two unrelated patients with acrodysostosis. J Med Genet 1997;34: 133-6.
10. Vlaeminck-Guillem V, D'Herbomez M, Pigny P, et al. Pseudohypoparathyroidism la and hypercalcitoninemia. J Clin Endocrinol Metab 2001;86:3091-6.
1 1 . W a g a r G , L e h t i v u o r i J , S a l v e n I , B a c k m a n R , S i vu l a A . Pseudohypoparathyroidism associated with hypercalcitoninaemia. Acta Endocrinol (Copenh)
1980;93:43-8.
12. Bertherat J, Horvath A, Groussin L, et al. Mutations in regulatory subunit type 1 A of cyclic adenosine 5'-monophosphate-dependent protein kinase (PRKARIA): phenotype analysis in 353 patients and 80 different genotypes. J Clin Endocrinol Metab 2009;94:2085- 91.
13. Kim C, Xuong NH, Taylor SS. Crystal structure of a complex between the catalytic and regulatory (RIalpha) subunits of PKA. Science 2005;307:690-6.
14. Kim C, Cheng CY, Saldanha SA, Taylor SS. PKA-I holoenzyme structure reveals a mechanism for cAMP-dependent activation. Cell 2007;130: 1032-43.
15. Montminy MR, Gonzalez GA, Yamamoto KK. Regulation of cAMP-inducible genes by CREB. Trends Neurosci 1990;13: 184-8.
16. Groussin L, Kirschner LS, Vincent-Dejean C, et al. Molecular analysis of the cyclic AMP-dependent protein kinase A (PKA) regulatory subunit 1 A (PRKARIA) gene in patients with Carney complex and primary pigmented nodular adrenocortical disease (PPNAD) reveals novel mutations and clues for pathophysiology: augmented PKA signaling is associated with adrenal tumorigenesis in PPNAD. Am J Hum Genet 2002;71 : 1433-42.
17. Kopperud R, Krakstad C, Selheim F, Doskeland SO. cAMP effector mechanisms. Novel twists for an Old' signaling system. FEBS Lett 2003;546: 121-6.
18. Skalhegg BS, Landmark BF, Doskeland SO, Hansson V, Lea T, Jahnsen T. Cyclic AMP-dependent protein kinase type I mediates the inhibitory effects of 3',5'-cyclic adenosine monophosphate on cell replication in human T lymphocytes. J Biol Chem 1992;267: 15707- 14.
19. Su Y, Dostmann WR, Herberg FW, et al. Regulatory subunit of protein kinase A: structure of deletion mutant with cAMP binding domains. Science 1995;269:807-13. 20. van Daalen Wetters T, Coffino P. Reversion of an S49 cell cyclic AMP-dependent protein kinase structural gene mutant occurs primarily by functional elimination of mutant gene expression. Mol Cell Biol 1983;3:250-6.
21. Horvath A, Stratakis CA. Clinical and molecular genetics of acromegaly: MEN1 , Carney complex, McCune-Albright syndrome, familial acromegaly and genetic defects in sporadic tumors. Rev Endocr Metab Disord 2008;9: 1-11.
22. Bertherat J, Groussin L, Sandrini F, et al. Molecular and functional analysis of PRKARIA and its locus (17q22-24) in sporadic adrenocortical tumors: 17q losses, somatic mutations, and protein kinase A expression and activity. Cancer Res 2003;63:5308-19.
23. Kirschner LS, Carney JA, Pack SD, et al. Mutations of the gene encoding the protein kinase A type I-alpha regulatory subunit in patients with the Carney complex. Nat Genet 2000;26:89-92.
24. Carney JA, Boccon-Gibod L, Jarka DE, et al. Osteochondromyxoma of bone: a congenital tumor associated with lentigines and other unusual disorders. Am J Surg Pathol 2001;25: 164-76.
25. Tsang KM, Starost MF, Nesterova M, et al. Alternate protein kinase A activity identifies a unique population of stromal cells in adult bone. Proc Natl Acad Sci U S A 2010;107:8683-8.
Figure imgf000032_0001
TABLE 1. Clinical and biochemical features of the three patients with acrodysostosis and hormone resistance SGA : small for gestational age;†SD: standard deviation relative to the normal population; Patients are affected with brachydactyly type E (BDE), characterized by shortening of metacarpals and metatarsals and/or phalanges.6 The severity of the BDE in patients with acrodysostosis is exemplified by a general shortening of all metacarpals, metatarsals and phalanges, and the bulky and stocky aspect of the affected bones
(Supplementary Fig. 1). Other genetic diseases associated with this form of brachydactyly are listed in Supplementary Appendix, Table 2. JThese studies were performed at age 40, 19, and
13 years respectively for patient 1, 2, and 3. §NA: not available EXAMPLE 2: SUPPLEMENTARY APPENDIX
Subjects and Methods:
Responses to PTH infusion: Informed consent was obtained from patients and controls for all studies. The PTH infusion test was performed on the 3 patients (age 40, 19, and 13 years respectively for patient 1, 2, and 3) and 6 healthy volunteers (3 men, 3 women, mean age 35 + 6 years) using techniques similar to those described by Chase et al.1. Briefly, subjects received an intravenous injection of 40 μg/kg human recombinant PTH1"34 (teriparatide, Lilly, France). Urine samples were collected during a period of diuresis maintained by oral intake of water (200 ml/h). Urine was discarded at time -60 min, and collected at times 0, 30, 60, 120, 240 and 300 minutes. Blood samples were collected at 0 and 240 minutes. The samples for determination of plasma cAMP were collected in chilled EDTA tubes and centrifuged for 10 min before freezing; urine samples were immediately frozen.
Fractional calcium excretion (FECa) was calculated as (UCa/UCr) x (SCr/SCa). TmP/GFR was derived from the fractional reabsorption of filtered inorganic phosphate [1- (UP/UCr) x (SCr/SP)] and plasma concentration of inorganic phosphate using the nomogram constructed by Walton and Bijvoet2.
Biochemical analysis: All biochemical measurements were performed using standard clinical laboratory procedures for electrolyte and hormone concentrations in blood and urine.
Sequence and mRNA expression analysis: Genomic DNA and R A were extracted from peripheral blood mononuclear cells and EBV immortalized B-lymphocytes using standard procedures. Intronic, and when required, exonic primers were used to amplify the exons and intron-exon junctions for the PRKAR1A (12 exons) and GNAS (Gsa exons 1-13) genes as previously described3"5. PCR products were analyzed by direct nucleotide sequence analysis. Methylation patterns at the four differentialy methylated regions (NESP, AS, XL, AB) of the GNAS locus were evaluated by digestion of PCR-amplified DNA following bisulfite treatment using previously described techniques5.
Epstein-Barr virus (EBV) immortalized B-lymphocytes were established from two controls and two patients affected with aero dysostosis (patients 1 and 2). The presence of the wild-type (WT) and mutant PRKARIA mRNA in immortalized B-lymphocytes was determined by sequencing RT-PCR products.
Allele-specific PCR and sequence analysis: To specifically amplify a segment of the PRKARIA gene containing portions of intron 10 and exon 11, and derived uniquely from the allele that was mutated in each patient, the following primers were used to amplify DNA isolated from b l o o d m o n o n u c l e a r c e l l s : f o r w a r d , 5 '- AGAGGGAAGGTGTGAGATTTTGATC ( S E Q I D N O : 1 ); reverse 5'- AAACTGTTGTACTGCTGGATGTTACA (SEQ ID NO :2). The 3 '-end of the reverse primer, designed as described6, is complementary to the mutated sequence, but contains an intentional mismatch at the -2 position. Thus, two of the three bases at the 3 '-end of the reverse primer are mismatched with the WT allele, precluding its amplification. PCR products were analyzed by direct nucleotide sequencing.
PRKARIA expression plasmids and site-directed mutagenesis: Full-length WT cDNA encoding human PRKARIA was amplified by RT-PCR from HEK293 cells and inserted into the pCDNA3.1 plasmid (Invitrogen). After complete sequencing of the cDNA insert, the p.R368X mutation identified in the patients and the Y373A mutation were introduced into the WT-PRKARIA cDNA construct using the Quick Change site-directed mutagenesis kit (Stratagene), and confirmed by complete sequencing of cDNA inserts.
Cell culture and transient transfection: COS-7 cells and HEK293 cells were cultured as described in DMEM containing 10% fetal bovine serum, 100 U/ml penicillin G and 100 μg/ml streptomycin7"8. COS-7 cells in 24-well plates were transfected using Fugene HD (Roche) with either 250 ng DNA/cm2 (PKA activity) or 125 ng/cm2 pCDNA3.1 construct encoding either WT-, R368X-, or Y373A-PRKAR1A and 125 ng/cm2 pCDNA3.1 construct encoding the empty vector (cAMP production). All studies were performed 48 h after transfection. EBV immortalized B-lymphocytes were cultured in RPMI-1640 medium containing 10% fetal bovine serum, 100 U/ml penicillin G and 100 μg/ml streptomycin.
Transcriptional PKA activity: COS-7 cells were cotransfected with: i) 225 ng pCDNA3.1 construct encoding either WT-, R368X-, Y373A-PRKAR1 A or the empty vector; ii) 250 ng pCRE-Luc plasmid, containing a firefly luciferase reporter gene under the control of a CRE-responsive element (Stratagene); and iii) 25 ng pRL-TK plasmid (Promega), containing a constitutively expressed Renilla luciferase reporter gene that was used as an internal control for transfection efficiency.
Cells were either untreated (to measure basal transcriptional PKA activities), or treated with 0.3 , 1 and 1 0 μΜ of forskolin (Sigma- Aldrich) or 0.3 and 30 μΜ o f the 8- aminohexylamino cAMP analog (8-AHA-cAMP, Sigma- Aldrich) in the presence of 1 mM 3- isobutyl-l-methylxanthine (IBMX, Sigma- Aldrich). In some experiments, the PKA inhibitor H89 (Sigma- Aldrich, 10 μΜ) was added at the same time as forskolin. Luciferase activities were determined 6 h after forskolin addition as described previously9 using a Centra LB 960 luminometer (Berthold). For each well, the ratio of firefly luciferase activity to Renilla luciferase activity was calculated to correct for transfection efficiency. All luciferase activity ratios were then normalized to the ratio measured in the unstimulated samples transfected with the empty pCDNA3.1 vector. Results are the mean ± SEM for three independent experiments performed in triplicate, using two different plasmid preparations.
Stimulation of cAMP production: Stimulation of cAMP production by isoproterenol and cholera toxin was performed as described previously7' 10. The cAMP content in cells extracts was measured using the cAMP Biotrak Enzyme immunoassay (EIA) System (Amersham). Results are expressed as picomoles/well.
PRKAR1A protein expression: Western blotting was performed using cell lysates obtained from EBV immortalized lymphocytes (two controls and patients 1 and 2), and from COS cells that were either untransfected or that had been transfected with pCDNA3.1 constructs encoding WT-, R368X-, Y371A-PRKAR1A , or the empty vector. Cells were lysed with IX Cell Lysis Buffer (Cell Signaling) containing ImM PMSF. Ten micrograms of total protein from each sample were separated by 12% one-dimensional SDS-PAGE, and the proteins were transferred to Immobilon-P membranes (Millipore). The membranes were incubated sequentially using the SNAP i.d. system (Millipore) with a 1/100 dilution of mouse monoclonal antibody recognizing the conserved carboxyl terminus of PRKARIA (PKA[RI] AB; BD Transduction Laboratories), a 1/5000 dilution of a goat anti-mouse immunoglobulin antibody conjugated to horseradish peroxidase (Promega), and SuperSignal West Pico Chemiluminescent Substrate according to the manufacturer's instructions (Pierce). Blots shown are representative of at least three individual experiments.
Measurement of CREB phosphorylation at Serl33 in lymphocytic cell lines: EBV immortalized B-lymphocytes were incubated at 37°C in Hank's buffered salt solution containing 10 mM Hepes (lxlO6 cells/200 μΐ) with either buffer or forskolin (10 μΜ) in the presence of 1 mM IBMX for 30 min. The reactions were terminated by adding 50 μΐ of 5X Laemmli sample buffer as described11. Samples were boiled for 5 min and frozen at -80°C until Western blotting. Lysates (10-20 μί) from each sample were separated by 15% one- dimensional SDS-PAGE, and the proteins were transferred to Immobilon-P membranes (Millipore). The membranes were incubated sequentially as described above with a 1/1000 dilution of a rabbit monoclonal antibody recognizing CREB phosphorylated at Ser 133 (Cell Signaling Technology), a 1/500 dilution of a goat anti-rabbit immunoglobulin antibody conjugated to horseradish peroxidase (Promega), and SuperSignal West Femto Chemiluminescent Substrate (Pierce, Thermo Scientific). The membranes were reprobed using similar techniques with a rabbit monoclonal antibody recognizing total CREB protein (Cell Signaling Technology). Bands present on film exposed to the blots were quantified using ImageJ software (Rasband, W.S., ImageJ, U. S. National Institutes of Health, Bethesda, Maryland, USA, http://rsb.info.nih.gov/ij/, 1997-2009). Within a given experiment, the ratio of the phospho-CREB to CREB band intensities for each sample was calculated, and results were normalized to the average ratio obtained for forskolin-stimulated control cells.
BRET Measurement: Molecular interactions between regulatory and catalytic subunits of PKA were investigated using bio luminescence resonance energy transfer (BRET) according to Prinz et al.12. Briefly, the human WT and R368X and Y373A mutant cDNAs of PRKARIA and the mouse PRKACA cDNA were amplified by PCR using appropriate primers. PRKARIA variants were inserted in frame into the Bam l site of pRlucN2(h) (Biosignal, PerkinElmer Life Sciences) and PRKACA was inserted into the HmdIII and Apal sites of PEYFP-C3 (Clontech/BD Biosciences). In these constructions, the luciferase reporter is at the C-terminus of PRKARIA constructs and the YFP reporter at the N-terminus of PRKACA. HEK293 cells were cotransfected in 25cm2 flasks with 2 to 4 ng of PRKARIA constructs and 5 to 60 ng of PRKACA constructs using Effectene according to the manufacturer's instructions (Qiagen). The cells were lysed two-days after transfection in 2 ml Passive lysis buffer (Promega) containing ImM IBMX and frozen. For BRET experiments, cell lysates were mixed with Hank's buffered salt solution containing ImM IBMX and 50μΜ coelenterazine in the presence or absence of varying concentrations of 8 AHA-AMPc. Luminescence and fluorescence were measured simultaneously at 485nm and 530nm using a Mithras LB940 plate reader (Berthold Technologies). The BRET ratios were calculated and expressed in mBRET as previously described13. The results are the mean ± SEM of 4 independent experiments with independent cotransfections.
Modelling of human PRKAR1A: The 3D cristallography X-ray structure of the bovine and mouse PRKAR1A (PDB: 1RGS) (PDB: 2QCS)14"15 were used to model the human PRKARIA by homology. Models were developed for wild-type (WT) and mutants (R368X and Y373A) of PRKARIA. Based on the alignment between bovine, mouse and human PRKARIA sequences (clustalW and Fasta algorithms), one hundred homology models were built using Modeller v9.7 (http://www.salilab.org/modeller/) and an objective function was calculated for each model in order to select the best score. Selected models were refined by energy minimization (AMBER forcefield) using VEGAZZ software (http://www.vegazz.net/). For the selected models (see results), the local root mean square distance (rmsd) between human (h) and bovine (b) or mouse (m) PRKARIA structure is -0.27 A. These low rmsd values indicated that the spatial arrangement of PRKARIA was similar in the three species. Modelling of hPRKARlA mutants (R368X and Y373A) was performed using the same strategy and revealed that models adopt the same structure as described for human WT PRKARIA (rmsd -0.2 A).
Docking of cAMP molecule into the binding pocket of domain B of human PRKARIA: In order to establish the positioning of cAMP in the binding pocket of domain B of human PRKARIA mutants (R368X and Y373A), cAMP was first manually docked into human WT PRKARIA domain B using VEGAZZ software based on the structural data for bovine PRKARIA15. The positioning was refined by calculation using Autodock 4.0 software (http://autodock.scripps.edu/), and energy minimization was performed using MMFF94 force field. The positioning of cAMP into domain B of human PRKARIA mutants (R368X and Y373A) was performed using the same procedure. Ligand rmsd and binding pocket surface were estimated and compared to the values obtained for the WT subunit. Analysis and representation of ligand conformation in the binding pocket (domain B) of PRKARIA was performed using PyMol software (http://www.pymol.org/).
Statistical analysis: Unless otherwise stated, values are expressed as means ± SEM. Quantitative variables between patients and controls were compared using the Mann- Whitney non parametric rank-sum test. For CRE-luciferase activity, BRET measurements, and evaluation of phospho-CREB to CREB ratios, statistical analyses were performed using oneway ANOVA and post test comparisons between individual groups were made using Bonferroni's multiple comparison test; P values <0 5 were considered as significant.
Results and Discussion:
Structural analysis of cAMP binding to WT and mutated PRKARIA: To define the structural impact of mutations R368X and Y373A on the cAMP binding pocket of domain B of PRKARIA, homology 3D-models were developed based on previously reported X-ray structures of bovine and mouse PRKARIA14"15. These models indicated that the spatial arrangements of human WT and mutant (R368X and Y373A) PRKARIA were very similar, and close to that determined for PRKARIA from other species14"15, as indicated by the low estimated rmsd values. Similarly, the low rmsd values obtained for cAMP docking in the domain B binding pocket indicated that the calculated cAMP binding position is very similar to that determined by X-ray crystallography15. These results indicated that these models can be used to define the structural impact of mutations (R368X and Y373A) on cAMP binding to domain B.
In the WT PRKARIA the domain B cAMP binding pocket has a surface of 290 A2 (supplementary Fig. 4). The ribose ring of cAMP interacts directly with E326 and R335 residues in the binding pocket, and the adenine ring of cAMP interacts with domain B through hydrophobic and stacking interactions with the Y373 and S375 residues15 (supplementary Fig. 4C). These observations were supported by the results of affinity labelling studies using 8-N3- cAMP, which revealed that the photoaffmity probe physically interacts with the tyrosine residue equivalent to Y373 in human PRKARIA16. In addition, a constitutive interaction between Y373 and E326 participates in a network of contacts (hydrogen bonds and hydrophobic stacking) that induces a strong orientation of the dipole moment of the adenine ring, thereby creating strong constraints for the positioning of cAMP in the binding pocket15. The R368X mutation results in several important structural changes. First, the surface of the R368X mutant binding pocket was reduced to 27 A2 (Supplementary Fig. 4B), limiting it, essentially, to a single ribose-binding pocket. Furthermore, the ability of residues localized in the binding pocket of PRKARl A to form an interaction network is seriously affected by the deletion of Y373 residue (supplementary Fig. 4C). The absence of this interaction network results in a decrease in affinity for cAMP due to the absence of the stacking interaction, and may allow the adenine ring to freely turn inside the binding pocket, as shown in the docking simulation experiment where the position of adenine ring was modified as compared to its position in the WT pocket (supplementary Fig. 4C, arrow). Moreover, the deletion of S375 in the R368X mutant also removes the hydrophobic interaction between this residue and the adenine ring of cAMP (supplementary Fig. 4C). Taken together these results indicate that the R368X mutation strongly impairs the binding of cAMP in the domain B binding pocket of PRKARl A.
Analysis of the structural 3D-model of the Y373A mutant and docking simulation experiments revealed that the deletion of the side chain of Y373 also induced a loss in the interaction network between cAMP and the binding pocket (supplementary Fig. 4C). The docking measurement revealed that the ligand rmsd of the Y373A mutant (2.10 A) is considerably greater than that of WT PRKARl A ( 0.28 A), indicating a different positioning of the ligand, mainly due to a half-turn in the orientation of the adenine ring (supplementary Fig. 4C, arrow). In contrast to findings for the R368X mutant, the Y373A substitution induces an increase m the surface of the binding pocket (Y373A, 515 A2; WT, 290 A2). These differences can be explained by the deletion of Y373 side chain, which closes the binding pocket in WT but not in Y373A mutant PRKARl A (supplementary Fig. 4C).
As previously shown17, analysis of PKA activation by two molecules of cAMP revealed a molecular mechanism in five major steps: 1) Initial binding of cAMP to PRKARl A domain B; 2) Recruitment of a network of hydrophobic and hydrogen bonds involving Y373, which stabilizes the binding; 3) A large conformational change of PRKARl A due mainly to the disruption of ionic bond between E261 and R366; 4) Binding of cAMP to PRKARIA domain A; 5) Finally, dissociation of catalytic subunit from the inhibitory site of PRKARIA, resulting in PKA activation. The deletion or modification of the Y373 residue in mutants (R368X and Y373A) prevents the hydrophobic and ionic interactions between cAMP and the binding pocket, resulting in the impairment of steps 1 to 3 of PKA activation17. In conclusion, structural analysis of the PRKAR1A R368X mutant demonstrates that the R368-V381 deletion has two major effects that impair the ability of PRKARIA to undergo conformational changes necessary for the activation of PKA17: i) the surface of the domain B binding pocket is reduced in size to that of a ribose-binding site; ii) the disruption of the network of hydrophobic and hydrogen bond interactions within the domain B binding pocket leads to a drastic reduction in its affinity for cAMP. cAMP production in cells expressing the WT or mutant PRKARIA: Isoproterenol and cholera toxin induced a dose-dependent stimulation of cAMP production in COS cells that was of similar magnitude in cells expressing the WT and mutant PRKARI A (supplementary Fig. 4). Maximal stimulation was approximately 5-fold and 35-fold over baseline, respectively, for isoproterenol and cholera toxin. Basal cAMP production was similar in cells expressing WT and mutant PRKARIA. Allele-specific PCR: To evaluate whether the de novo R386X mutation in PRKARIA occurred on the same allele in the three patients, SNPs present in proximity to the c. l 101C>T mutation were evaluated. Two of the patients were heterozygous (T/A), and one was homozygous (T/T) for the SNP rs2302233 in intron 10 located 230 bp upstream of the c. l l01C>T mutation. A region encompassing SNP rs2302233 and the c. l l01C>T mutation was amplified in the three patients and two controls as described in the methods using a reverse primer allowing the specific amplification of the mutated allele. As expected, no PCR products were obtained following amplification of DNA from controls. Sequencing of PCR products obtained from the three patients demonstrated that the cl 101C>T mutation occurred on an allele carrying the A haplotype for SNP rs2302233 in patients 2 and 3, but on an allele carrying the T haplotype for patient 1. Thus, the mutation did not arise on the same allele in these three patients.
Figure imgf000041_0001
Gene Transmission OMIM Reference
HDAC4 AD 600430 syndromic Williams SR, et al. Haploinsufficiency of HDAC4 causes brachydactyly mental retardation syndrome, with brachydactyly type E, developmental delays, and behavioral problems. Am J Hum Genet. 2010 Aug 13;87(2):219-28.
GNAS AD 139320 syndromic Bastepe M, Jiippner H. GNAS locus and pseudohypoparathyroidism. Horm Res. 2005;63(2):65- 74.
PTHLH AD 613382 syndromic Maass PG, et al. A cis-regulatory site downregulates PTHLH in translocation t(8;12)(q13;p11.2) and leads to Brachydactyly Type E. Hum Mol Genet. 2010 Mar 1 ;19(5):848-60. Klopocki E, et al. Deletion and point mutations of PTHLH cause brachydactyly type E. Am J Hum Genet. 2010 Mar 12;86(3):434-9.
μ_] Unknown AD 112410 syndromic Toka, H. R., et al. Families with autosomal dominant brachydactyly type E, short stature, and
§- severe hypertension. Ann. Intern. Med. 129: 204-208, 1998.
cT (Chromosome 12?)
HOXD13 AD 142989 isolated Johnson D, et al. Missense mutations in the homeodomain of HOXD13 are associated with brachydactyly types D and E. Am J Hum Genet. 2003 Apr;72(4):984-97.
Table 1. Microsatellite analysis at 16 loci using the PowerPlex 16 System in the three patients and their parents*. For each patient, the allele inherited from the mother and the father are in blue and red respectively.
Table 2. Genetic diseases associated with brachydactyly type E† (OMIM 113300):
^Brachydactyly Type E (BDE) is characterized by a general shortening of metacarpals and metatarsals and/or phalanges18"20. It is a frequent feature of several genetic syndromes, including Turner syndrome. However, the genetic cause of the majority of BDE cases remains unexplained. Within families, the phenotype is variable, and can range from a moderate shortening of individual bones to a shortening of all bones in the hands and feet, as observed in aero dysostosis. BDE is rarely observed as an isolated anomaly.
References: 1. Chase LR, Melson GL, Aurbach GD. Pseudohypoparathyroidism: defective excretion of 3',5'-AMP in response to parathyroid hormone. J Clin Invest 1969;48: 1832-44.
2. Walton RJ, Bijvoet OL. Nomogram for derivation of renal threshold phosphate concentration. Lancet 1975;2:309-10.
3. Bertherat J, Horvath A, Groussin L, et al. Mutations in regulatory subunit type 1 A of cyclic adenosine 5'-monophosphate-dependent protein kinase (PRKARl A): phenotype analysis in 353 patients and 80 different genotypes. J Clin Endocrinol Metab 2009;94:2085- 91.
4. Groussin L, Kirschner LS, Vincent-Dejean C, et al. Molecular analysis of the cyclic AMP-dependent protein kinase A (PKA) regulatory subunit 1 A (PRKARl A) gene in patients with Carney complex and primary pigmented nodular adrenocortical disease (PPNAD) reveals novel mutations and clues for pathophysiology: augmented PKA signaling is associated with adrenal tumorigenesis in PPNAD. Am J Hum Genet 2002;71 : 1433-42.
5. Mariot V, Maupetit-Mehouas S, Sinding C, Kottler ML, Linglart A. A maternal epimutation of GNAS leads to Albright osteodystrophy and parathyroid hormone resistance. J Clin Endocrinol Metab 2008;93:661-5.
6. Hance AJ, Lemiale V, Izopet J, et al. Changes in human immunodeficiency virus type 1 populations after treatment interruption in patients failing antiretroviral therapy. J Virol 2001;75:6410-7. 7. Couvineau A, Wouters V, Bertrand G, et al. PTHR1 mutations associated with Oilier disease result in receptor loss of function. Hum Mol Genet 2008;17:2766-75.
8. Jobert AS, Leroy C, Butlen D, Silve C. Parathyroid hormone-induced calcium release from intracellular stores in a human kidney cell line in the absence of stimulation of cyclic adenosine 3',5'-monophosphate production. Endocrinology 1997;138:5282-92.
9. Dos Santos C, Bougneres P, Fradin D. A single-nucleotide polymorphism in a methylatable Foxa2 binding site of the G6PC2 promoter is associated with insulin secretion in vivo and increased promoter activity in vitro. Diabetes 2009;58:489-92.
10. Linglart A, Mahon MJ, Kerachian MA, et al. Coding GNAS mutations leading to hormone resistance impair in vitro agonist- and cholera toxin- induced adenosine cyclic
3',5'-monophosphate formation mediated by human XLalphas. Endocrinology 2006;147:2253-62.
11. El-Benna J, Dang PM. Analysis of protein phosphorylation in human neutrophils. Methods Mol Biol 2007;412:85-96.
12. Prinz A, Diskar M, Erlbruch A, Herberg FW. Novel, isotype-specific sensors for protein kinase A subunit interaction based on bio luminescence resonance energy transfer
(BRET). Cell Signal 2006;18: 1616-25.
13. Achour L, Scott MG, Shirvani H, et al. CD4-CCR5 interaction in intracellular compartments contributes to receptor expression at the cell surface. Blood 2009;113: 1938-47.
14. Kim C, Xuong NH, Taylor SS. Crystal structure of a complex between the catalytic and regulatory (RIalpha) subunits of PKA. Science 2005;307:690-6.
15. Su Y, Dostmann WR, Herberg FW, et al. Regulatory subunit of protein kinase A: structure of deletion mutant with cAMP binding domains. Science 1995;269:807-13.
16. Kerlavage AR, Taylor SS. Covalent modification of an adenosine 3' :5'- monophosphate binding site of the regulatory subunit of cAMP-dependent protein kinase II with 8-azidoadenosine 3':5'-monophosphate. Identification of a single modified tyrosine residue. J Biol Chem 1980;255:8483-8.
17. Kim C, Cheng CY, Saldanha SA, Taylor SS. PKA-I holoenzyme structure reveals a mechanism for cAMP-dependent activation. Cell 2007;130: 1032-43.
18. Hertzog KP. Brachydactyly and pseudo-pseudohypoparathyroidism. Acta
Genet Med Gemellol (Roma) 1968;17:428-38.
19. Maroteaux PLM, M. Les Maladies Osseuses de l'Enfant. 4 ed. Paris: Medecine- Sciences Flammarion; 2002.
20. Temtamy SA, Aglan MS. Brachydactyly. Orphanet J Rare Dis 2008;3: 15. REFERENCES:
Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure.

Claims

CLAIMS:
1. A nucleic acid comprising a PRKARIA nucleotide sequence, or a fragment thereof, carrying the non sense mutation c. l 101C>T.
2. A polypeptide encoded by the nucleic acid according to claim 1.
3. A method for predicting whether a subject is at risk for having or developing a hormone resistance comprising the step consisting of detecting in a sample a mutation in PRKARIA gene wherein the presence of said mutation is indicative of a risk of having or developing a hormone resistance.
4. A method for identifying subjects at risk for having or developing a hormone disorder comprising the step consisting of detecting in a sample a mutation in PRKARIA gene wherein the presence of said mutation is indicative of a risk of having or developing a hormone disorder.
5. The method according to claim 4 wherein said hormone disorder is selected from the group consisting of growth disorders, acrodysostosis, acromegaly, Addison disease, adrenal gland diseases, Cushing syndrome, obesity, diabetes mellitus-type 2, gonadal disorders, hypogonadism, hypopituitarism, hypothyroidism, Kallmann syndrome, parathyroid diseases, pituitary diseases, puberty, delayed, puberty, precocious, renal osteodystrophy.
6. A method for diagnosing hormone resistance in a subject comprising the step consisting of detecting in a sample a mutation in PRKARIA gene according to the invention wherein the presence of said mutation is indicative that said subject has a hormone resistance.
7. A method for diagnosing acrodysostosis in a subject comprising the step consisting of detecting in a sample a mutation in PRKARIA gene wherein the presence of said mutation is indicative that said subject has acrodysostosis.
8. A method for estimating a probability that a subject will achieve a response to a treatment with a hormone, comprising detecting in a sample a mutation in PRKARIA gene wherein the presence of said mutation is indicative that said subject has a high risk not to achieve a response with said treatment
9. The method according to any of claims 1 to 8 wherein said mutation is c. l 101 C>T changing the codon specifying the conserved arginine 368 in cAMP binding domain B to a stop codon (p. R368X).
10. A method for screening a drug for the treatment of hormone resistance comprising the steps consisting of testing a plurality of candidate compounds for their ability to improve the dissociation between the catalytic subunit of protein kinase A with the mutated PRKARIA polypeptide according to claim 2 and selecting those that improves said dissociation.
11. A non human animal model for hormone resistance whose genome comprises a nucleic acid according to claim 1 linked to a promoter.
PCT/EP2012/060849 2011-06-08 2012-06-08 Methods for predicting, treating and modelling hormone resistance Ceased WO2012168399A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP11305710.3 2011-06-08
EP11305710 2011-06-08

Publications (1)

Publication Number Publication Date
WO2012168399A1 true WO2012168399A1 (en) 2012-12-13

Family

ID=44675358

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2012/060849 Ceased WO2012168399A1 (en) 2011-06-08 2012-06-08 Methods for predicting, treating and modelling hormone resistance

Country Status (1)

Country Link
WO (1) WO2012168399A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109897891A (en) * 2017-12-08 2019-06-18 中国科学院大连化学物理研究所 A kind of kit of myxoma of heart early diagnosis

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0125023A1 (en) 1983-04-08 1984-11-14 Genentech, Inc. Recombinant immunoglobulin preparations, methods for their preparation, DNA sequences, expression vectors and recombinant host cells therefor
US4642334A (en) 1982-03-15 1987-02-10 Dnax Research Institute Of Molecular And Cellular Biology, Inc. Hybrid DNA prepared binding composition
EP0239400A2 (en) 1986-03-27 1987-09-30 Medical Research Council Recombinant antibodies and methods for their production
US7294754B2 (en) 2004-10-19 2007-11-13 Regeneron Pharmaceuticals, Inc. Method for generating an animal homozygous for a genetic modification

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4642334A (en) 1982-03-15 1987-02-10 Dnax Research Institute Of Molecular And Cellular Biology, Inc. Hybrid DNA prepared binding composition
EP0125023A1 (en) 1983-04-08 1984-11-14 Genentech, Inc. Recombinant immunoglobulin preparations, methods for their preparation, DNA sequences, expression vectors and recombinant host cells therefor
EP0239400A2 (en) 1986-03-27 1987-09-30 Medical Research Council Recombinant antibodies and methods for their production
US7294754B2 (en) 2004-10-19 2007-11-13 Regeneron Pharmaceuticals, Inc. Method for generating an animal homozygous for a genetic modification
US7576259B2 (en) 2004-10-19 2009-08-18 Regeneron Pharmaceuticals, Inc. Method for making genetic modifications
US7659442B2 (en) 2004-10-19 2010-02-09 Regeneron Pharmaceuticals, Inc. Method for making homozygous genetic modifications

Non-Patent Citations (60)

* Cited by examiner, † Cited by third party
Title
"Manipulating the Mouse Embryo: A Laboratory Manual, 3<rd >edition,", 15 December 2002, COLD SPRING HARBOR LABORATORY PRESS
A. L. JOYNER: "Gene Targeting: A Practical Approach", 2000, OXFORD UNIVERSITY PRESS
A. NAGESH SHETTY ROY ET AL: "Familial Recurrent Atrial Myxoma: Carney's Complex", CLINICAL CARDIOLOGY, vol. 34, no. 2, 1 February 2011 (2011-02-01), pages 83 - 86, XP055008925, ISSN: 0160-9289, DOI: 10.1002/clc.20845 *
A. NAGY, M. GERTSENSTEIN; K. VINTERSTEN; R. BEHRINGER: "Manipulating the Mouse Embryo: A Laboratory Manual,3rd edition", 15 December 2002, COLD SPRING HARBOR LABORATORY PRESS
ABLOW RC; HSIA YE; BRANDT IK: "Acrodysostosis coinciding with pseudohypoparathyroidism and pseudo-pseudohypoparathyroidism", AJR AM J ROENTGENOL, vol. 128, 1977, pages 95 - 9
ACHOUR L; SCOTT MG; SHIRVANI H ET AL.: "CD4-CCRS interaction in intracellular compartments contributes to receptor expression at the cell surface", BLOOD, vol. 113, 2009, pages 1938 - 47
ACHOUR L; SCOTT MG; SHIRVANI H ET AL.: "CD4-CCRS interaction in intracellular compartments contributes to receptor expression at the cell surface", BLOOD, vol. 113, no. 193, 2009, pages 8 - 47
AGNÈS LINGLART ET AL: "Recurrent PRKAR1A Mutation in Acrodysostosis with Hormone Resistance", NEW ENGLAND JOURNAL OF MEDICINE, vol. 364, no. 23, 9 June 2011 (2011-06-09), pages 2218 - 2226, XP055008609, ISSN: 0028-4793, DOI: 10.1056/NEJMoa1012717 *
BASTEPE M; JUPPNER H.: "GNAS locus and pseudohypoparathyroidism", HORM RES, vol. 63, 2005, pages 65 - 74
BERTHERAT J; GROUSSIN L; SANDRINI F ET AL.: "Molecular and functional analysis of PRKAR1A and its locus (17q22-24) in sporadic adrenocortical tumors: 17q losses, somatic mutations, and protein kinase A expression and activity", CANCER RES, vol. 63, 2003, pages 5308 - 19
BERTHERAT J; HORVATH A; GROUSSIN L ET AL.: "Mutations in regulatory subunit type 1A of cyclic adenosine 5'-monophosphate-dependent protein kinase (PRKAR1A): phenotype analysis in 353 patients and 80 different genotypes", J CLIN ENDOCRINOL METAB, vol. 94, 2009, pages 2085 - 91
BUEHR, M. ET AL.: "Genesis of embryonic stem cells", PHILOSOPHICAL TRANSACTIONS OF THE ROYAL SOCIETY B: BIOLOGICAL SCIENCES, vol. 358, 2003, pages 1397 - 1402
CARNEY JA; BOCCON-GIBOD L; JARKA DE ET AL.: "Osteochondromyxoma of bone: a congenital tumor associated with lentigines and other unusual disorders", AM J SURG PATHOL, vol. 25, 2001, pages 164 - 76
CHASE LR; MELSON GL; AURBACH GD: "Pseudohypoparathyroidism: defective excretion of 3',5'-AMP in response to parathyroid hormone", J CLIN INVEST, vol. 48, 1969, pages 1832 - 44
CHOEL KIM ET AL: "PKA-I Holoenzyme Structure Reveals a Mechanism for cAMP-Dependent Activation", CELL, vol. 130, no. 6, 1 September 2007 (2007-09-01), pages 1032 - 1043, XP055008679, ISSN: 0092-8674, DOI: 10.1016/j.cell.2007.07.018 *
COUVINEAU A; WOUTERS V; BERTRAND G ET AL.: "PTHR1 mutations associated with Ollier disease result in receptor loss of function", HUM MOL GENET, vol. 17, 2008, pages 2766 - 75
CURRENT PROTOCOLS IN STEM CELL BIOLOGY
DOS SANTOS C; BOUGNERES P; FRADIN D: "A single-nucleotide polymorphism in a methylatable Foxa2 binding site of the G6PC2 promoter is associated with insulin secretion in vivo and increased promoter activity in vitro", DIABETES, vol. 58, 2009, pages 489 - 92
EL-BENNA J; DANG PM: "Analysis of protein phosphorylation in human neutrophils", METHODS MOL BIOL, vol. 412, 2007, pages 85 - 96
GRAHAM JM, JR.; KRAKOW D; TOLO VT; SMITH AK; LACHMAN RS: "Radiographic findings and Gs-alpha bioactivity studies and mutation screening in acrodysostosis indicate a different etiology from pseudohypoparathyroidism", PEDIATR RADIOL, vol. 31, 2001, pages 2 - 9
GROUSSIN L; KIRSCHNER LS; VINCENT-DEJEAN C ET AL.: "Molecular analysis of the cyclic AMP-dependent protein kinase A (PKA) regulatory subunit 1A (PRKAR1A) gene in patients with Carney complex and primary pigmented nodular adrenocortical disease (PPNAD) reveals novel mutations and clues for pathophysiology: augmented PKA signaling is associated with ad", AM J HUM GENET, vol. 71, 2002, pages 1433 - 42
HANCE AJ; LEMIALE V; IZOPET J ET AL.: "Changes in human immunodeficiency virus type 1 populations after treatment interruption in patients failing antiretroviral therapy", J VIROL, vol. 75, 2001, pages 6410 - 7
HERRICK G ET AL: "Mobile elements bounded by C4A4 telomeric repeats in oxytricha fallax", CELL, CELL PRESS, US, vol. 43, no. 3, 1 December 1985 (1985-12-01), pages 759 - 768, XP023910800, ISSN: 0092-8674, [retrieved on 19851201], DOI: 10.1016/0092-8674(85)90249-1 *
HERTZOG KP: "Brachydactyly and pseudo-pseudohypoparathyroidism", ACTA GENET MED GEMELLOL (ROMA, vol. 17, 1968, pages 428 - 38
HORVATH A; STRATAKIS CA.: "Clinical and molecular genetics of acromegaly: MEN1, Carney complex, McCune-Albright syndrome, familial acromegaly and genetic defects in sporadic tumors", REV ENDOCR METAB DISORD, vol. 9, 2008, pages 1 - 11, XP019580353
I. BOSSIS: "Minireview: PRKAR1A: Normal and Abnormal Functions", ENDOCRINOLOGY, vol. 145, no. 12, 1 January 2004 (2004-01-01), pages 5452 - 5458, XP055008973, ISSN: 0013-7227, DOI: 10.1210/en.2004-0900 *
J. P. SUNDBERG AND T. ICHIKI,: "Genetically Engineered Mice Handbook", 2006, CRC PRESS
JOBERT AS; LEROY C; BUTLEN D; SILVE C: "Parathyroid hormone-induced calcium release from intracellular stores in a human kidney cell line in the absence of stimulation of cyclic adenosine 3',5'-monophosphate production", ENDOCRINOLOGY, vol. 138, 1997, pages 5282 - 92
KERLAVAGE AR; TAYLOR SS: "Covalent modification of an adenosine 3':5'- monophosphate binding site of the regulatory subunit of cAMP-dependent protein kinase II with 8-azidoadenosine 3':5'-monophosphate. Identification of a single modified tyrosine residue", J BIOL CHEM, vol. 255, 1980, pages 8483 - 8
KIM C; CHENG CY; SALDANHA SA: "Taylor SS. PKA-I holoenzyme structure reveals a mechanism for cAMP-dependent activation", CELL, vol. 130, 2007, pages 1032 - 43, XP055008679, DOI: doi:10.1016/j.cell.2007.07.018
KIM C; CHENG CY; SALDANHA SA; TAYLOR SS: "PKA-I holoenzyme structure reveals a mechanism for cAMP-dependent activation", CELL, vol. 130, 2007, pages 1032 - 43, XP055008679, DOI: doi:10.1016/j.cell.2007.07.018
KIM C; XUONG NH; TAYLOR SS: "Crystal structure of a complex between the catalytic and regulatory (RIalpha) subunits of PKA", SCIENCE, vol. 307, 2005, pages 690 - 6
KIM C; XUONG NH; TAYLOR SS: "Crystal structure of a complex between the catalytic and regulatory (RIalpha) subunits ofPKA", SCIENCE, vol. 307, 2005, pages 690 - 6
KIRSCHNER LS; CARNEY JA; PACK SD ET AL.: "Mutations of the gene encoding the protein kinase A type I-alpha regulatory subunit in patients with the Carney complex", NAT GENET, vol. 26, 2000, pages 89 - 92
KOPPERUD R; KRAKSTAD C; SELHEIM F; DOSKELAND SO: "cAMP effector mechanisms. Novel twists for an 'old' signaling system", FEBS LETT, vol. 546, 2003, pages 121 - 6, XP004433630, DOI: doi:10.1016/S0014-5793(03)00563-5
KRAUS ET AL., GENESIS, vol. 48, 2010, pages 394 - 399
KURSAD TURKSEN: "Embryonic stem cells: methods and protocols in Methods Mol Biol.", vol. 185, 2002, HUMANA PRESS
LINGLART A; MAHON MJ; KERACHIAN MA ET AL.: "Coding GNAS mutations leading to hormone resistance impair in vitro agonist- and cholera toxin-induced adenosine cyclic 3',5'-monophosphate formation mediated by human XLalphas", ENDOCRINOLOGY, vol. 147, 2006, pages 2253 - 62
M. H. HOFKER AND J. VAN DEURSEN: "Transgenic Mouse Methods and Protocols", 2002, HUMANA PRESS
MARIOT V; MAUPETIT-MEHOUAS S; SINDING C; KOTTLER ML; LINGLART A: "A maternal epimutation of GNAS leads to Albright osteodystrophy and parathyroid hormone resistance", J CLIN ENDOCRINOL METAB, vol. 93, 2008, pages 661 - 5
MAROTEAUX PLM, M.: "Les Maladies Osseuses de l'Enfant. 4 ed.", 2002, MEDECINE-SCIENCES FLAMMARION
MEYER ET AL., PNAS USA, vol. 107, no. 34, pages 15022 - 15026
MONTMINY MR; GONZALEZ GA; YAMAMOTO KK: "Regulation of cAMP-inducible genes by CREB", TRENDS NEUROSCI, vol. 13, 1990, pages 184 - 8, XP024531374, DOI: doi:10.1016/0166-2236(90)90045-C
NAGY ET AL., DEVELOPMENT, vol. 110, 1990, pages 815 - 821
PRINZ A; DISKAR M; ERLBRUCH A; HERBERG FW: "Novel, isotype-specific sensors for protein kinase A subunit interaction based on bioluminescence resonance energy transfer (BRET", CELL SIGNAL, vol. 18, 2006, pages 1616 - 25, XP024910693, DOI: doi:10.1016/j.cellsig.2006.01.013
SKALHEGG BS; LANDMARK BF; DOSKELAND SO; HANSSON V; LEA T; JAHNSEN T: "Cyclic AMP-dependent protein kinase type I mediates the inhibitory effects of 3',5'-cyclic adenosine monophosphate on cell replication in human T lymphocytes", J BIOL CHEM, vol. 267, 1992, pages 15707 - 14
SPAULDING SW.: "The ways in which hormones change cyclic adenosine 3',5'-monophosphate-dependent protein kinase subunits, and how such changes affect cell behavior", ENDOCR REV, vol. 14, 1993, pages 632 - 50
SPAULDING SW: "The ways in which hormones change cyclic adenosine 3',5'- monophosphate-dependent protein kinase subunits, and how such changes affect cell behavior", ENDOCR REV, vol. 14, 1993, pages 632 - 50
SPIEGEL AM; WEINSTEIN LS: "Inherited diseases involving g proteins and g protein-coupled receptors", ANNU REV MED, vol. 55, 2004, pages 27 - 39
SU Y; DOSTMANN WR; HERBERG FW ET AL.: "Regulatory subunit of protein kinase A: structure of deletion mutant with cAMP binding domains", SCIENCE, vol. 269, 1995, pages 807 - 13
TASKEN K; SKALHEGG BS; TASKEN KA ET AL.: "Structure, function, and regulation of human cAMP-dependent protein kinases", ADV SECOND MESSENGER PHOSPHOPROTEIN RES, vol. 31, 1997, pages 191 - 204, XP002939888
TAYLOR SS; BUECHLER JA; YONEMOTO W.: "cAMP-dependent protein kinase: framework for a diverse family of regulatory enzymes", ANNU REV BIOCHEM, vol. 59, 1990, pages 971 - 1005
TEMTAMY SA; AGLAN MS, BRACHYDACTYLY. ORPHANET J RARE DIS, vol. 3, no. 15, 2008
TREMML ET AL.: "Current Protocols in Stem Cell Biology", 2008, article "For review of inhibitors of ES cell differentiation"
TSANG KM; STAROST MF; NESTEROVA M ET AL.: "Alternate protein kinase A activity identifies a unique population of stromal cells in adult bone", PROC NATL ACAD SCI USA, vol. 107, 2010, pages 8683 - 8
VAN DAALEN WETTERS T; COFFINO P.: "Reversion of an S49 cell cyclic AMP-dependent protein kinase structural gene mutant occurs primarily by functional elimination of mutant gene expression", MOL CELL BIOL, vol. 3, 1983, pages 250 - 6
VLAEMINCK-GUILLEM V; D'HERBOMEZ M; PIGNY P ET AL.: "Pseudohypoparathyroidism Ia and hypercalcitoninemia", J CLIN ENDOCRINOL METAB, vol. 86, 2001, pages 3091 - 6
WAGAR G; LEHTIVUORI J; SALVEN I; BACKMAN R; SIVULA A: "Pseudohypoparathyroidism associated with hypercalcitoninaemia", ACTA ENDOCRINOL (COPENH, vol. 93, 1980, pages 43 - 8
WALTON RJ; BIJVOET OL: "Nomogram for derivation of renal threshold phosphate concentration", LANCET, vol. 2, 1975, pages 309 - 10
WILSON LC; OUDE LUTTIKHUIS ME; BARAITSER M; KINGSTON HM; TREMBATH RC: "Normal erythrocyte membrane Gs alpha bioactivity in two unrelated patients with acrodysostosis", J MED GENET, vol. 34, 1997, pages 133 - 6

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109897891A (en) * 2017-12-08 2019-06-18 中国科学院大连化学物理研究所 A kind of kit of myxoma of heart early diagnosis

Similar Documents

Publication Publication Date Title
US7510835B2 (en) Methods for identifying risk of breast cancer and treatments thereof
JP5817038B2 (en) Uric acid transporter, uric acid transport-related disease predisposition and inflammation-related disease predisposition evaluation method and evaluation kit, test body and medicine
US20050170500A1 (en) Methods for identifying risk of melanoma and treatments thereof
US8236933B2 (en) Modified animal lacking functional PYY gene, monoclonal antibodies that bind PYY isoforms and uses therefor
US20050014158A1 (en) Therapeutic methods for reducing fat deposition and treating associated conditions
US20050277118A1 (en) Methods for identifying subjects at risk of melanoma and treatments thereof
WO2005007687A1 (en) Compositions and methods for modulating ovarian follicular initiation
US20080199480A1 (en) Methods for Identifying Risk of Type II Diabetes and Treatments Thereof
US10429384B2 (en) Compositions, kits, and methods for identification, assessment, prevention, and therapy of metabolic disorders
US20040018533A1 (en) Diagnosing predisposition to fat deposition and therapeutic methods for reducing fat deposition and treatment of associated conditions
JP2012507713A (en) How to protect against heart failure
Casarini et al. Gonadotropin receptors
KR20050085855A (en) Methods for predicting therapeutic response to agents acting on the growth hormone receptor
WO2006022619A2 (en) Methods for identifying risk of type ii diabetes and treatments thereof
Rezgui et al. Structure and function of the human Gly1619Arg polymorphism of M6P/IGF2R domain 11 implicated in IGF2 dependent growth
WO2002064771A1 (en) Novel cell adhesion molecule specific to activated leukocyte
WO2012168399A1 (en) Methods for predicting, treating and modelling hormone resistance
JP2013039065A (en) Gene associated with self-inflammatory disease or autoimmune disease, and use thereof
KR100971270B1 (en) IFF Receptor Essays, Compounds and Therapeutic Compositions
WO2006001981A2 (en) Methods for treating disease by modulating an osmotic stress pathway
US20080319176A1 (en) Glycerol as a predictor of glucose tolerance
Bak The secret life of IGSF1: from consternation to revelation
WO2016042137A1 (en) Method for diagnosing myeloproliferative chronic myelomonocytic leukemia or unclassified myeloproliferative myelodysplastic neoplasm
WO2001031344A2 (en) Glycerol as a predictor of glucose tolerance

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12726127

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12726127

Country of ref document: EP

Kind code of ref document: A1