WO2012167588A1

WO2012167588A1 - Amino acid sequence of affinity peptide of bone marrow mesenchymal stem cells, screening methods and the use thereof.

Info

Publication number: WO2012167588A1
Application number: PCT/CN2011/084339
Authority: WO
Inventors: 敖英芳; 邵振兴; 皮彦斌; 张辛; 周春燕
Original assignee: 北京大学第三医院
Priority date: 2011-06-09
Filing date: 2011-12-21
Publication date: 2012-12-13
Also published as: CN102229646B; CN102229646A

Abstract

The present invention provides a heptad peptide screened by phage display technology, with its amino acid sequence shown as SEQ ID NO: 1, and the said polypeptide has specific affinity for bone marrow mesenchymal stem cells. The present invention also provides methods for screening said affinity peptide and the use thereof, which can improve the affinity of biological material for bone marrow mesenchymal stem cells, and can be used for cartilage repairing in tissue engineering.

Description

Amino acid sequence, screening method and application of bone marrow mesenchymal stem cell affinity polypeptide

The invention belongs to the field of biomedicine, and particularly relates to an amino acid sequence, screening method and application of a bone marrow mesenchymal stem cell affinity polypeptide. Background technology

After nearly 20 years of development, Tissue Engineering (TE) has been widely used in various clinical fields, including bone tissue, cartilage, nerves, blood vessels, skin, and regeneration and repair of the gastrointestinal and genitourinary systems.

Book

In the development of tissue engineering, continuous improvement and renewal of the various organizations' supports is key, including material renewal, improvement of production methods and continuous innovation of construction concepts. Another recent obvious change in the concept of tissue engineering is to "make it simple", that is, to simulate the composition of normal tissues as much as possible by various complicated means and techniques in vitro, and then implant In the body, it is better to provide a self-repairing stent for the human body, so that the natural "bioreactor" of the human body is attached to the stent for self-repair. Because the human body environment is very complicated, it will lead to a lot of experimental ideas and results, and the complexity of the stent implantation step will limit its clinical promotion and application. However, such scaffolds require specific modifications as needed to induce adhesion, proliferation and differentiation of specific cells.

In normal tissues, the matrix surrounding the cells plays an important role in the biological function of the cells. The functional domains of the proteins or polypeptide molecules in the matrix bind to the cell surface receptors, activate the complex signaling pathways in the cells, and express the genes of the cells. Biological functions such as adhesion, migration, proliferation, and differentiation are regulated, and these domains may be only a few amino acid fragments in length. This regulation method provides us with a theoretical basis for constructing active polypeptide sequences and surface modification of tissue engineering scaffolds to simulate the regulation function of the surrounding cells on the cells themselves. Modification of the scaffold with different types of polypeptides also confers different biological functions to the scaffold. Studies have shown that surface modification of artificial scaffolds with pericellular matrix proteins can increase the rate of cell attachment to scaffolds and proliferation rates. Further studies have found that fibronectin is promoted in matrix proteins surrounding these cells. The main component of cell attachment and migration. In fact, what really affects the function of cell biology is only the functional domain composed of several amino acid fragments in fibronectin. For example, modification of the scaffold with the RGD peptide can increase the adhesion rate of the muscle cells to the scaffold and also increase the cell proliferation efficiency, indicating that only a domain of three amino acid fragment lengths can have a significant effect on cell function. Duan and other 4 people have similar findings, using the cornea The modification of the scaffold by the cell-specific affinity polypeptide sequence can increase the adhesion rate of the corneal epithelial cells to the scaffold, and induce the stratification of the corneal cells on the scaffold, and the tissue structure similar to the physiological condition appears. At the same time, the modification of the scaffold by the polypeptide can also regulate the aggregation of the protein molecule on the tissue engineering scaffold. Ryadnov et al. use a small molecular protein constructed by a plurality of polypeptide fragments to modify the scaffold, and use the polypeptide to exhibit a pro-specific molecular molecule. Sexuality, confers the function of capturing these protein molecules to the scaffold, enriches the protein molecules around the scaffold, and regulates the biological functions of the cells in the scaffold. Shah et al. used a highly affinity polypeptide sequence of TGF-β to modify the polypeptide-binding molecular nano-scaffold (PA), which greatly improved the repair effect of the scaffold on cartilage defects, and the ability of the scaffold to induce stem cells to differentiate into cartilage. It is greatly enhanced, and the expression level of mucopolysaccharide is also significantly improved. The polypeptide-modified scaffold can be loaded, protected, and released slowly. This sustained release is closely related to the degradation time of the scaffold and the degree of modification of the scaffold by the affinity polypeptide. When the degree of modification is 5% -10% At the 4th week after implantation, the stent still exerts an excellent sustained release function of growth factors. And most importantly, there was no significant difference in the final repair of cartilage defects between the explants of exogenous TGF-β and the scaffolds that were not transfected with exogenous TGF-β, suggesting that the TGF-β affinity peptide modified scaffold, In the absence of exogenous growth factors, endogenous TGF-β growth factor can be enriched in a large amount, and the microenvironment in the scaffold can be improved to achieve the function of inducing differentiation of stem cells into cartilage.

Bone marrow mesenchymal stem cells (BMSCs), a kind of stem cells with multi-directional differentiation potential in bone marrow tissue, were proposed by Friedenstein et al in the 1960s, and their cytological properties have been studied. A large number of related research results have been published, especially in the past two decades. With the rapid development of tissue engineering and regenerative medicine, the demand for seed cells has led to a deeper research on various stem cells. At present, the multi-directional differentiation potential of bone marrow mesenchymal stem cells has been confirmed by a large number of studies, and because of its strong proliferative activity and multi-directional differentiation characteristics, it has been widely used in myocardium, nerve, liver, pancreas, Bone tissue and cartilage regeneration in all areas of tissue engineering.

In the process of implementing the present invention, the inventors have found that at least the following problems exist in the prior art: There is no bone marrow mesenchymal stem cell progeny capable of improving the specific affinity of biological materials for bone marrow mesenchymal stem cells in the prior art. And screening methods for peptides. Summary of the invention

The object of the present invention is to provide a screening method for a bone marrow mesenchymal stem cell affinity polypeptide capable of improving the specific affinity of a biological material for bone marrow mesenchymal stem cells in view of the above-mentioned drawbacks of the prior art.

Another object of the invention is to provide an amino acid sequence of a bone marrow mesenchymal stem cell affinity polypeptide.

A further object of the invention is to provide the use of a bone marrow mesenchymal stem cell affinity polypeptide.

The technical solution adopted by the present invention in order to achieve the above object is:

A screening using improved phage display technology can enhance the specificity of biological materials for bone marrow mesenchymal stem cells And a method for the ability of a bone marrow mesenchymal stem cell affinity polypeptide comprising the following steps:

(1) Primary culture of human bone marrow mesenchymal stem cells and human fibroblasts: Primary cultured cells were obtained by primary culture of human bone marrow mesenchymal stem cells and passaged one generation; primary cultured and propagated by human fibroblasts Above generation, obtain negative screening cells;

(2) Negative screening: a phage library is added to the negative screening cells to remove the polypeptide fragment bound to the P10 generation ACL fibroblasts in the phage library;

(3) Positive screening: The phage polypeptide library obtained after the negative screening in step (2) is added to the positive screening cells to obtain the positively-selected bone marrow mesenchymal stem cells, which are combined with the specificity of the phage library. Binding affinity polypeptide fragment;

(4) Phage amplification: The bone marrow mesenchymal stem cells obtained in the step 3 are extracted, and a cell lysate is prepared, and the phage titer in the cell is amplified;

(5) measuring the titer of the amplified phage extract, and storing at 4 ° C;

The above steps (1) to (5) are repeated for 4 rounds, and the first round of screening is added to the phage library stock solution, and then the phage extract after the previous round of cell lysate amplification is added in each round;

(6) Extracting the phage DNA fragments specific for each round and obtained from the bone marrow mesenchymal stem cells, and sequencing them to select a polypeptide sequence with high affinity for bone marrow mesenchymal stem cells: SEQ in the sequence listing ID NO. 1 EPLQLKM , whose DNA sequence is shown as SEQ ID NO. 2 in the Sequence Listing: GAGCCGCTGCAGCTGAAGATG. Another technical solution of the present invention is an application of a bone marrow mesenchymal stem cell affinity polypeptide modified to a human scaffold and a modification method thereof, comprising the following steps: 3' C-end of the selected bone marrow mesenchymal stem cell affinity polypeptide , a cysteine (C) is attached, and the cysteine (C) residue is covalently coupled with the surface of the polyhexanolide (PCL) electrospinning membrane by the ammoniated surface -NH _{2 to} make PCL The nanofiber membrane scaffold has the property of specifically enriching bone marrow mesenchymal stem cells.

Specifically, the following steps are included:

1) The PCL nanofiber membrane was placed in 10% w/v 1,6-hexanediamine in an isopropyl alcohol configuration at 37 ° C for 1 h;

2) by cross-linking U (4-(N-maleimidomethyl) cyclohexane-l-carboxylate (sulfo-SMCC) ) 4- [N-maleimidomethyl]cyclohexane-1-carboxysulfoaluminate The imide binds the amino group on the surface of the PCL nanofiber membrane to the affinity polypeptide.

More specific steps are:

1) Trim the PCL nanofiber membrane into a circle equal to the pore area of the 24-well plate, and then place it into the well of the 24-well plate, and add 500 μl of 10% w/v of 1, 6 - per well. Hexanediamine / isopropanol solution, 37 ° C, placed lh;

2) Rinse with deionized water for 3 to 5 times, rinse with double distilled water for 3 to 5 times, PBS (phosphate buffer, 0. 01M, pH 7. 4) Rinse 3 times;

3) Add 400 μl of crosslinker 4-(Ν-maleimidomethyl)cyclohexane-1-carboxylic acid-3-sulfosuccinimide ester (1 mg/ml SMCC, per well). Thermo company), placed at room temperature for lh;

4) Rinse 3 times with EDTA (ethylenediaminetetraacetic acid) buffer (500ml 0. 01Μ/ρΗ 7.4 PBS + 18.612g EDTA, pH 7. 2~7· 5 )

5) Add 0. lmg / ml peptide solution (configured with the above EDTA-containing buffer), 400 μl per well at 4 ° C overnight;

6) Rinse with deionized water for 3 times, pre-freeze at -20 °C, and store at 4 °C after lyophilization in vacuum.

The beneficial effects brought by the technical solutions provided by the embodiments of the present invention are:

1. Bone marrow mesenchymal stem cell-specific affinity polypeptide fragments are obtained by phage display technology, so that they can be highly targeted to bone marrow mesenchymal stem cells.

2. The surface of the PCL nanofiber membrane is modified by covalently coupling the affinity polypeptide fragment with the PCL electrospinning membrane to specifically enrich the bone marrow mesenchymal stem cells, so that the material is used as a scaffold When the cartilage regeneration is repaired in the body, the bone marrow mesenchymal stem cells can be continuously adhered and a normal extracellular matrix (ECM) is produced, thereby achieving a better repair effect.

3. In the process of species-specific identification of the polypeptide, the polypeptide has no obvious species specificity, so the affinity polypeptide sequence can be widely used in various cytological experiments and animal experiments as a The affinity vector for screening bone marrow mesenchymal stem cells can screen and purify bone marrow mesenchymal stem cells more efficiently. DRAWINGS

1 is a diagram showing the results of primary culture of human bone marrow mesenchymal stem cells provided in Example 1 of the present invention;

2a, 2b, and 2c are the results of the phage blue spot assay provided in the phage titer assay of Example 1 of the present invention; 10 μl of the phage diluted 10 μ 1 was added to 200 μl of Escherichia coli to incubate 1 After 5 minutes, the top medium was added and rapidly mixed, and the tetracycline-resistant LB-tet plate was plated at 37 ° C, 5% CO ₂ overnight to calculate the number of phage blue spots on the plate. This number is then multiplied by the dilution factor to obtain the plaque forming unit (pfu) titer per 10 μ phage. A single blue spot was picked up and amplified in LB/E. coli culture medium, and phage DNA sequencing was performed. Figure 2a: The number of blue spots is 10°; Figure 2b, the number of blue spots is 10 ¹ ; Figure 2c: The number of blue spots is 10 ² .

Figure 3 is a graph showing the recovery rate of four rounds of screened phage provided in the screening of phage affinity polypeptides of Example 1 of the present invention; Figure 4a is a graph showing the results of flow cytometry of human MSC affinity polypeptides provided in Example 2 of the present invention;

Figure 4b is a graph showing the results of quantitative analysis of the fluorescence intensity of Figure 4a;

See Figure 4a and Figure 4b, InM's FITC (fluorescein isothiocyanate, fluorescein isothiocyanate) Light-labeled BMSC-affinity peptide sequence and Scramble peptide were incubated with bone marrow mesenchymal stem cells for 1 hour, respectively, for flow cytometry; Figure 4b shows FITC Labeled mismatched peptides were incubated with bone marrow mesenchymal stem cells with an average fluorescence intensity of 6; FITC-labeled affinity peptides were incubated with bone marrow mesenchymal stem cells, with an average fluorescence intensity of 189, and the fluorescence intensity of the affinity peptide group (189) ) far higher than the fluorescence intensity of the mismatched peptide group (6); suggesting that the affinity of the bone marrow mesenchymal stem cell affinity polypeptide to bone marrow mesenchymal stem cells is much higher than that of the mismatched polypeptide to bone marrow mesenchymal stem cells .

Figure 5a is a graph showing the results of flow cytometry of a rat MSC affinity polypeptide provided in Example 2 of the present invention; Figure 5b is a graph showing the results of quantitative analysis of the fluorescence intensity of Figure 5a;

Figure 5c is a graph showing the results of flow cytometry of the MSC affinity polypeptide of rabbits provided in Example 2 of the present invention; Figure 5d is a graph showing the results of quantitative analysis of the fluorescence intensity of Figure 5c;

Referring to Figure 5a and Figure 5b, rat (Rat): FITC-labeled mismatched polypeptide was incubated with rat bone marrow mesenchymal stem cells with an average fluorescence intensity of 5; FITC-labeled affinity polypeptide and rat bone marrow mesenchymal stem cells Co-incubation with an average fluorescence intensity of 65. The fluorescence intensity of the affinity peptide group (65) is much higher than that of the mismatched peptide group (5);

See Figure 5c and Figure 5d, rabbit (Rabbit): FITC-labeled mismatched peptides were incubated with rabbit bone marrow mesenchymal stem cells, with an average fluorescence intensity of 4; FITC-labeled affinity peptides and rabbit bone marrow mesenchymal stem cells Co-incubation with an average fluorescence intensity of 74. The fluorescence intensity of the affinity peptide group (74) is much higher than that of the mismatched peptide group (4);

In Figures 4a, 5a and 5c, the left peak represents the mismatched polypeptide and the right peak represents the affinity polypeptide. Counts is the quantity.

The average fluorescence intensity in Figure 4b, Figure 5b, and Figure 5d is the average fluorescence intensity.

Figure 6 is a result of laser confocal microscopy observation provided by Example 2 of the present invention; the affinity polypeptide and mismatch polypeptide labeled with FITC are separately incubated with bone marrow mesenchymal stem cells for lh, phalloidin counterstained cytoskeleton, hochest counterstaining The nucleus and laser confocal microscopy were used to observe the binding of cells to peptides. The results showed that the affinity polypeptide sequence (EPLQLKM) had significantly higher affinity for bone marrow mesenchymal stem cells than the mismatched polypeptide (MLKPLEQ);

Figure 7 is a schematic view showing the attachment of an affinity polypeptide fragment to the surface of a polycaprolactone (PCL) nanoelectrospun fiber membrane by covalent bonding according to Example 3 of the present invention;

8 is a polypeptide linkage observed by a confocal microscope under the laser confocal microscope of a bone marrow mesenchymal stem cell-specific polypeptide modified PCL nanoelectrospun fiber membrane provided by Example 3 of the present invention;

The figure shows: Polycaprolactone (PCL) nanofibers with FITC-labeled affinity peptide fragment (EPLQLKM), showing high green fluorescence intensity, suggesting higher connection efficiency;

9a and 9b are the bone marrow mesenchymal stem cell-specific polypeptide-modified PCL nano-electrospins provided in Example 3 of the present invention. The effect of the silk scaffold; Figure 9a is a fragment of the affinity peptide of the bone marrow mesenchymal stem cell; Figure 9b is a fragment of the mismatched polypeptide;

Polycaprolactone (PCL) nanofiber membranes linked with bone marrow mesenchymal stem cell affinity peptide fragment (EPLQLKM) and mismatched polypeptide fragment (MLKPLEQ) were placed in bone marrow mesenchymal stem cell suspension and co-cultured. It is shown that the PCL nanofiber membrane to which the affinity polypeptide is linked is more favorable for the adhesion and growth of the bone marrow mesenchymal stem cells than the PCL nanofiber membrane to which the mismatched polypeptide is linked. (blue 1 : hochest - nucleus; green 2: PCL nanofiber membrane linked to peptide; red 3: ghost pen loop peptide-cytoskeleton). detailed description

In order to make the objects, the technical solutions and the advantages of the present invention more apparent, the embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.

Example 1

Screening of Bone Marrow Mesenchymal Stem Cell Affinity Polypeptide Sequences by Phage Display Technology:

(1) Human bone marrow mesenchymal stem cells and primary culture of human fibroblasts:

a. Primary culture and passage of human bone marrow mesenchymal stem cells

Human bone marrow tissue was obtained from patients undergoing total knee arthroplasty (TKA), placed in a blood collection tube containing K2 EDTA anticoagulation (BD company), and washed with PBS (0.01 M, pH 7. 4). 2 times, the bone marrow tissue was evenly spread on the bottom of the culture dish, and added to DMEM (LG) complete medium containing 10% FBS, observed for 24 to 48 hours. After seeing the adherent cells, change the medium and continue the culture, then 2~3 Change the liquid once a day and pass it on for generations. As a positive screening cell (see Figure 1). Among them, DMEM is a medium containing various amino acids and glucose.

b. Primary culture and passage of human fibroblasts

Human anterior cruciate ligament tissue was harvested from patients undergoing total knee arthroplasty (TKA), PBS (0.01 M, pH 7.4), membranous tissue and blood clots were removed, and cut with ophthalmic scissors. Broken, trypsin for 30 min at 37 °C to remove impurities, add complete medium to stop digestion, wash twice with PBS (0.01 M, pH 7.4), then add 0.2% of type I collagenase (formulated in DMEM) Digested at 37 ° C for 2-3 hours, shaken at 37 ° C per hour for 5 min, until most of the tissue blocks were visible to the naked eye. Under the inverted microscope, most of the cells were separated, and the elbow was light. Lightly blow, add an equal volume of complete medium to neutralize collagenase, centrifuge the digested cell suspension, discard the supernatant, resuspend in complete medium, plate, and pass for more than ten generations. As a negative screening cell.

(2) Negative screening (removal of polypeptide fragments that bind to P10 generation ACL fibroblasts):

a. Take a dish of P10 ACL cells, wash it with trypsin, PBS (0.01M, PH 7.4) 2~3 times; add blocking Buffer (blocking buffer, 0. 1M NaC0 ₃ (pH 8.6), 5 mg/ml BSA, 0.02% NaN ₃ ) was resuspended in 1 ml EP tube and blocked for 1 h at 4 ° C to reduce non-specific binding;

b. Centrifuge (1500 rpm, 5min), discard the supernatant, add 0. 5ml of serum-free DMEM (HG), cell count ( 2 X 10 ⁶ );

c. Add Ι μ ΐ phage library (Ph. D. -7TM Phage Display Library, NEB) (IX 10 ¹¹ PFU /10 μ phage stock solution, 100 μ 1 ), and let stand for 30 min at room temperature;

d. Centrifuge (lOOOOrpm, 5min), aspirate the supernatant, and obtain the negatively screened phage polypeptide library bacterial solution, and transfer to a new EP tube for use;

(3) Positive screening:

Take a dish of PI generation source SC (medullary mesenchymal stem cells), trypsinize, wash PBS (0. 01M, pH 7. 4) 2~3 times; add blocking buffer to resuspend in lml EP tube The cell was counted (2 X 10 ⁶ ); the cell was counted (2×10 ⁶ );

c adding step (2) to obtain the negatively screened phage polypeptide library bacterial solution, and leave it at room temperature for 30 min;

d. Centrifuge (10, OOO rpm, 5 min), discard the supernatant, wash PBS (0.11 M, pH 7.4) for 2 to 3 times to obtain positively screened cells;

(4) Phage amplification (see Ph. D. -7TM Phage Display Peptide Library Kit): a. Prepare the cell lysate from the positively screened cells obtained in step (3), and expand the phage titer in the cell. 5小时; The cell lysate was added to a solution of the ER2738 (in the early-log), shaking at 37 ° C, incubated for 4.5 hours;

b. The culture solution in step 1) is added to a centrifuge tube, centrifuged at 10, OOO rpm for 10 minutes at 4 ° C, the supernatant is transferred to a new tube, and centrifuged again (10, OOO rpm, lOmin);

c. Extract 80% of the supernatant, transfer to a new centrifuge tube, add 1 / 6 volume of PEG / NaCl, and let the phage precipitate at 4 ° C overnight;

d. The next day, 10, OOO rpm, 4 ° C, the phage bacterial solution was centrifuged, 15 minutes, the supernatant was discarded, centrifuged again (10, OOO rpm, lOmin), and the supernatant was discarded;

e. Resuspend the phage pellet with lml TBS (50 mM Tris-HC1 (ρΗ7·5), 150 mM NaCl) and centrifuge at 5 °C for 5 minutes.

f. Move the supernatant to a new centrifuge tube and reprecipitate with 1/6 volume of PEG/NaCl. Incubate on ice for 60 minutes. Centrifuge at 4 ° C, 10, OOO rpm for 10 minutes, discard the supernatant, re-centrifugate briefly, and discard the supernatant again.

g. Resuspend the pellet with 200 μl of TBS (ρΗ7.5, containing 0.02% NaN ₃ ), centrifuge for 1 minute, and move the supernatant to new In the centrifuge tube. This is the amplified phage extract.

(5) Phage titer determination (see Ph. D. -7TM Phage Display Peptide Library Kit): a. Inoculate ER2738 single colony in 5_10 ml LB medium, incubate at 37 ° C, shaker at 250 rpm to mid-log phase (0D ₆ . . . ~ 0. 5).

b. The upper layer of agar is heated and melted in a microwave oven and divided into 3 ml/part into a sterile test tube, one tube of each dilution of the phage. Store at 45 ° C for later use.

c Pre-warm LB/IPTG/Xgal plates at 37 °C, one plate for each phage dilution gradient.

d. The phage was diluted 10 fold in LB medium. Recommended dilution range: Amplified phage culture supernatant: 10 ⁸ -10 ^u ; Unamplified panning eluate: ΙΟ^ΙΟ^ For each dilution, replace with a fresh tip. It is recommended to use a filter tip. Avoid cross contamination.

e. When the E. coli broth is in the middle of the logarithm, divide it into 200 μΐ/aliquot in a microcentrifuge tube and use one tube for each phage dilution.

f. Add 10 μM phage of different dilutions to E. coli in each tube, mix well by shaking, and incubate for 1-5 min at room temperature.

g. The phage-infected E. coli broth was added to a 45 °C pre-warmed top agar culture tube, mixed one time at a time, and immediately poured onto a pre-warmed LB/IPTG/Xgal plate at 37 °C. Properly tilt the plate to spread the upper agar evenly.

h. After the plate was cooled for 5 min, it was placed in a 37 ° C incubator and cultured overnight.

i. Check the plate and count the number of spots on the plate with ~10 ² plaques (see Figure 2a, Figure 2b and Figure 2c). Then, multiply this number by the dilution factor to obtain the plaque forming unit (pfu) titer per 10 μ phage.

The above (1) to (5) steps were repeated for 4 rounds, and then each round of the phage extract was sequenced.

(6) Sequencing of phage polypeptide fragments (see Ph. D. -7TM Phage Display Peptide Library Kit Operation Manual):

a. Plaque amplification: Escherichia coli amplified bacterial solution (0D: 0.5) was diluted 1:100 with LB medium, and each plaque clone to be sequenced was dispensed into a tube, 1 ml/tube. ;

b. Using a sterilized toothpick or tip, pick a monoclonal blue plaque in a plate with a plaque between 10 and 100, and place it in the above 1 ml culture tube. A total of 20 monoclonals were picked.

c 37 ° C, shaker at 250 rpm, incubate 4. 5-5 h;

d. After incubation, the phage bacterial solution was transferred to a centrifuge tube and centrifuged for 30 seconds. The supernatant is transferred to a new tube and centrifuged. Pipette 80% of the supernatant into a new centrifuge tube. This is a solution for amplifying the phage. It can be stored at 4 °C for several weeks without much effect on the titer. Long-term storage application of sterile glycerol 1: 1 dilution, storage at -20 ° C; e. From the above amplified monoclonal phage liquid, absorb 500 μΐ into a new centrifuge tube;

f. Add 200 μ 1 PEG/NaCl, mix by inversion, and let stand for 10 min at room temperature;

g. Centrifuge for 10 min, discard the supernatant, and briefly centrifuge (lOOOO rpm, 30 sec) to remove the residual supernatant; h. Resuspend the phage pellet in 100 μl of iodide buffer and add 250 μl of ethanol. Incubate for 10 min at room temperature i. Centrifuge for 10 min and discard the supernatant. The precipitate was washed with 70% ethanol and dried under vacuum for a short time;

g. The pellet is resuspended in 20 μΐ double distilled water, which is a phage template DNA solution;

k. Sequencing, after four rounds of screening, a set of polypeptide sequences with high affinity for bone marrow mesenchymal stem cells were obtained. Experimental results of the embodiments of the present invention:

a. Phage affinity peptide screening: Using a phage display library (Ph.D. -7TM Phage Display Peptide Library Kit; New England Biolabs), a total of 4 rounds of screening were performed. After each screening, the phage titer was obtained and multiplied by The total volume of the bacterial liquid is the total amount of phage recovered after screening, and the selected phage is amplified, and the amplified phage is used for the next round of screening. The first round of screening: Add phage stock solution (titer: 1 X10 ¹³ PFU/10 1), after lysing the cells, extract the phage titer to 1X10 ³ PFU /10μ1, and after the extracted phage is amplified, the phage titer is 1X10 ^U PFU/I0 1; The second round of screening: Adding the amplified phage 10 μ 1 , after screening, the recovered phage titer is 4.1×10 ⁴ PFU /10μ 1, and the titer after amplification is 1×10 ^U PFU/I0 1 The third round of screening: After screening, the recovered phage titer is 5.6×10 ⁶ PFU /10μ 1, and the titer after amplification is 1 X 10 ^U PFU/10 μ 1; The fourth round of screening: After screening, the phage titer is recovered. It is 3.0X10 ⁵ PFU /10μ 1.

Table 1: Phage recovery: Adding phage (pfu) Recovery of phage (pfu) Recovery rate first round 1.0E+12 1.0E+3 1.0E-9 Second round 1.0E+11 4.1E+4 4.1E-7 Three rounds 1.0E+11 5.6E+5 5.6E-6 Fourth round 1.0E+11 3.0E+5 3.0E-6 Affinity multiple 5.6E-6/1.0E-9 = 5600 See Figure 3, after four rounds After screening, the bone marrow mesenchymal stem cell affinity phage (EPLQLKM was calculated, and the phage recovery rate was calculated and compared with the phage stock solution. The phage recovery rate of the affinity-containing polypeptide: 5.60E-06; the recovery rate of the phage stock solution: 1.00E-09 Compared with the phage primitive phase, the obtained bone marrow mesenchymal stem cell affinity phage increased the affinity for bone marrow mesenchymal stem cells by 5600 times (5.60E-06/1.00E_09). b, peptide sequence screening results:

After each round of screening, the titer was determined by screening the obtained phage bacterial liquid, and 20 colonies were randomly picked from xgal culture plates with the number of blue spots between 10 and 100, and each was amplified in 1 ml of E. coli bacteria, and extracted. Phage DNA was sequenced. After four rounds of screening, a set of polypeptide sequences with high affinity for bone marrow mesenchymal stem cells were obtained: EPLQLKM (Table 2).

Table 2: Screening results of peptide sequences

VVGTANT

GTTGTTGGGACGGCTAATACT

MYASSSK

ATGTATGCGTCTTCTTCTAAG

EPALYVT

GAGCCGGCGCTGTATGTGACT

From the sequencing results in the above table, among the 20 phage clones determined in the second round, the polypeptide sequence of 3 clones is: EPLQLKM; of the 20 phage clones determined in the third round, the polypeptide sequence of 7 clones is : EPLQLKM; of the 20 phage clones determined in the fourth round, the polypeptide sequence of 10 clones was: EPLQLKM. The first round of screening results lacked specificity, so the polypeptide fragments carried by the phage in the eluate were not detected. Therefore, after four rounds of screening, a polypeptide sequence with high affinity for bone marrow mesenchymal stem cells was obtained: EPLQLKM.

Example 2

Affinity Identification of Bone Marrow Mesenchymal Stem Cell Affinity Peptide for Human and Rat and Rabbit-derived Bone Marrow Mesenchymal Stem Cells Cell-Level Affinity Identification:

(1) Flow cytometry

Method: Take a BMSC, and digest it with 0.05% EDTA for 0 minutes until the cells are completely detached. Collect the suspension, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, and again The cells were suspended in PBS (0.01 M, pH 7.4), repeated 3 times, and the cells were filtered through a 400 mesh filter, and then centrifuged again (2000 rpm, 5 min), 0. lml PBS (0.01 M, pH 7. 4) was resuspended. After the cells, InM's SMSC affinity polypeptide (FITC-EPLQLKMC) and mismatched polypeptide (FITC-MLKPLEQC) were added, incubated for 1 h at room temperature, centrifuged (2000 rpm, 5 min), and washed 3 times with PBS (0.1 M, pH 7.4). 0. 5ml PBS (0. 01M, pH 7. 4) The cells were resuspended and transferred into a flow tube for flow cytometry analysis.

RESULTS: Human-derived mesenchymal stem cells were primary cultured on 60 mm plates. When the cell fusion rate was greater than 90%, they were combined with InM FITC-labeled bone marrow mesenchymal stem cell affinity peptide (FITC-EPLQLKMC) and mismatched polypeptide (FITC). -

MLKPLEQC) After 1 hour of incubation, flow cytometry was performed. The mismatched polypeptide was used as a blank control group with an average fluorescence intensity of 6; the primary bone marrow mesenchymal stem cells incubated with the bone marrow mesenchymal stem cell affinity polypeptide had an average fluorescence intensity of 189. The fluorescence intensity of the bone marrow mesenchymal stem cell affinity polypeptide group was 31.5 times that of the mismatched polypeptide, indicating that the bone marrow mesenchymal stem cell affinity polypeptide has significant affinity for human-derived mesenchymal stem cell cells (see Figure 4a). And Figure 4b).

Similarly, flow cytometric analysis was performed using rat and rabbit-derived mesenchymal stem cells, in rats and rabbits. The experimental results show that the obtained affinity polypeptide sequence has no species specificity, and has affinity for human-derived mesenchymal stem cells, and also shows high density of bone marrow mesenchymal stem cells derived from rats and rabbits. Affinity (see Figures 5a, 5b, 5c and 5d).

(2) Observation by laser confocal microscopy

METHODS: Bone marrow mesenchymal stem cells were cultured, and fixed in 4% paraformaldehyde for 10 min, washed with PBS (0.11 M, pH 7.4) for 3 times. FITC-binding affinity peptides and mismatched peptides were separately incubated with cells. Incubate for 1 h, phalloidin complex counterstained cytoskeleton 37 ° C lh, hochest counterstained nuclei, room temperature for 10 min, laser confocal microscopy to observe the binding of cells and peptides. (See Figure 6)

RESULTS: Cell slides were prepared from human-derived mesenchymal stem cells, fixed in 4% paraformaldehyde for 10 min, washed three times with PBS, and FITC-affinity affinity peptides and mismatched peptides were incubated with cell slides for 1 h at 37 °C. , phalloidin peptide counterstained cytoskeleton lh, room temperature, hochest counterstained nuclei for 10min, observed the binding of cells and peptides by laser confocal microscopy, observed the distribution of FITC green fluorescence in bone marrow mesenchymal stem cells, visible Bone marrow mesenchymal stem cell affinity polypeptides can accumulate in large amounts around and inside bone marrow mesenchymal stem cells, while only a very small number of mismatched random polypeptides are randomly endocytosed by bone marrow mesenchymal stem cells. This indicates that the bone marrow mesenchymal stem cell affinity polypeptide has a high affinity for human-derived mesenchymal stem cells (see Figure 6).

Example 3

Bone marrow mesenchymal stem cell-specific polypeptide modification PCL nano-electrospun fiber membrane:

(1) Peptide synthesis: The bone marrow mesenchymal stem cell affinity polypeptide EPLQLKM and the mismatched peptide MLKPLEQC (control) (Scilight-peptide Inc, China) were separately synthesized and screened, and the peptide was labeled with FITC fluorescent dye, and for the material The surface is covalently modified to link a cysteine residue (C) at the 3' of the polypeptide to facilitate covalent attachment to the imino (_NH ₂ ) of each material;

(2) Trim the PCL nano-electrospun fiber membrane into a circle equal to the hole area of the 24-well plate, and then place it into the hole of the 24-well plate, adding 500 μl of 10% w/v to each well. 1, 6 - hexamethylene diamine / isopropanol solution, 37 ° C, placed lh;

(3) Rinse with deionized water 3~5 times, rinse with double distilled water 3~5 times, rinse 3 times with PBS (0. 01M, pH 7. 4);

(4) Add 400 ul of crosslinker 4- (N-maleimidomethyl)cyclohexane-1-carboxylic acid-3-sulfosuccinimide ester per well (1 mg/ml SMCC, Thermo Company), placed at room temperature for lh;

(5) Rinse 3 times with EDTA-containing buffer (500ml 0. 01Μ/ρΗ 7.4 PBS + 18.612g EDTA, pH 7. 2~7· 5);

(6) Add 0. lmg/ml polypeptide solution (configured with the above EDTA-containing buffer), 400 μl per well at 4 ° C overnight;

(7) Rinse with deionized water for 3 times, pre-freeze at -20 °C, and store at 4 °C after lyophilization in vacuum. (8) Observe the peptide linkage under a laser confocal microscope (see Figure 8).

Bone marrow mesenchymal stem cell-specific peptide modification PCL nano-electrospinning stent test results:

The affinity peptide fragment EPLQLKM and the mismatched polypeptide fragment MLKPLEQ were ligated to the surface of the polycaprolactone (PCL) nano-electrospinning scaffold by covalent binding (see Figure 7) and placed in a bone marrow mesenchymal stem cell suspension. Co-cultivation. The results showed that the PCL nanofiber membrane to which the affinity polypeptide was linked was more favorable for the adhesion and growth of bone marrow mesenchymal stem cells than the PCL nanofiber membrane to which the mismatched polypeptide was ligated. (See Figure 9a and Figure 9b)

The above is only the preferred embodiment of the present invention, and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., which are within the spirit and scope of the present invention, should be included in the protection of the present invention. Within the scope.

Preface 歹 iJ table

< 110> Peking University Third Hospital

<120> Amino acid sequence, screening method and application of bone marrow mesenchymal stem cell affinity polypeptide

<130> 11SG1F0319

<160> 2

< 170> Patentln version 3. 4

<210> 1

<211> 7

<212> PRT

<213> Phage (M13 Phage)

<400> 1

EPLQLKM 7

<210> 2

<211> 21

<212> DNA

<213> phage (M13 Phage)

<400> 2

GAGCCGCTGC AGCTGAAGAT G 21

Claims

Claim

An amino acid sequence of a bone marrow mesenchymal stem cell affinity polypeptide, characterized in that the amino acid sequence is SEQ ID NO. 1 in the sequence listing.

A method for screening an amino acid sequence of a bone marrow mesenchymal stem cell affinity polypeptide according to claim 1, which comprises the steps of:

Negative screening of human fibroblasts and positive screening of bone marrow mesenchymal stem cells were performed by phage display technology. After screening, bone marrow mesenchymal stem cells were extracted, cells were lysed, and phage which were specific for bone marrow mesenchymal stem cells were extracted. The DNA fragment is sequenced to obtain a polypeptide amino acid sequence having high affinity for bone marrow mesenchymal stem cells.

The method for screening a bone marrow mesenchymal stem cell affinity polypeptide according to claim 2, which comprises the following steps:

(1) Primary culture of human bone marrow mesenchymal stem cells and human fibroblasts: Primary cultured cells were obtained by primary culture of human bone marrow mesenchymal stem cells and passed through one generation; primary cultured and propagated by human fibroblasts Above generation, obtain negative screening cells;

(2) Negative screening: A phage library is added to the negative screening cells to remove the polypeptide fragments bound to the P10 generation ACL cells in the phage library;

(3) Positive screening: The phage polypeptide library obtained after the negative screening in step (2) is added to the positive screening cells to obtain the positively screened bone marrow mesenchymal stem cells, which bind to the specific binding of the phage library. Affinity polypeptide fragment;

(4) Phage amplification: extraction step (3) obtained bone marrow mesenchymal stem cells, preparing cell lysate, and amplifying the phage titer therein;

(5) measuring the titer of the amplified phage extract, and storing at 4 ° C;

(6) Extracting the phage DNA fragments specific for each round and obtained from bone marrow mesenchymal stem cells, and sequencing them to select a polypeptide sequence having high affinity for bone marrow mesenchymal stem cells: EPLQLKM.

4. A bone marrow mesenchymal stem cell affinity polypeptide according to claim 1 for use in modifying an implanted human scaffold.

5. A method of modifying a bone marrow mesenchymal stem cell affinity polypeptide according to claim 1 for implantation into a human scaffold, The method comprises the steps of: connecting the 3' C-terminus of the selected bone marrow mesenchymal stem cell affinity polypeptide to a cysteine (C), and utilizing the cysteine (C) residue and poly The lactone (PCL) electrospun membrane is covalently coupled to the surface-NH ₂ after ammoniation, so that the PCL nanofiber membrane scaffold has the property of specifically enriching bone marrow mesenchymal stem cells.

6. A method according to claim 5, comprising the steps of:

2) The amino group and the affinity polypeptide on the surface of the PCL nanofiber membrane were cross-linked by 4-(N-maleimidomethyl)cyclohexane-1-carboxylic acid-3-sulfosuccinimide ester. connection.

7. A method according to claim 5, comprising the steps of:

2) Rinse with deionized water 3~5 times, rinse with double distilled water 3~5 times, rinse 3 times with PBS;

3) 400 μl of cross-linking agent 4-(Ν-maleimidomethyl)cyclohexane-1-carboxylic acid-3-sulfosuccinimide ester was added to each well, and allowed to stand at room temperature for 1 h;

4) Rinse 3 times with PBS;

5) Add 0. lmg / ml of the peptide solution, 400 μl per well, overnight at 4 ° C;