WO2012149463A1 - Molécules de facteur vii chimériques à demi-vie augmentée et procédés d'utilisation - Google Patents

Molécules de facteur vii chimériques à demi-vie augmentée et procédés d'utilisation Download PDF

Info

Publication number
WO2012149463A1
WO2012149463A1 PCT/US2012/035642 US2012035642W WO2012149463A1 WO 2012149463 A1 WO2012149463 A1 WO 2012149463A1 US 2012035642 W US2012035642 W US 2012035642W WO 2012149463 A1 WO2012149463 A1 WO 2012149463A1
Authority
WO
WIPO (PCT)
Prior art keywords
domain
factor
amino acid
egf
chimeric
Prior art date
Application number
PCT/US2012/035642
Other languages
English (en)
Inventor
Darrel W. Stafford
Dengmin Feng
David M. Mann
Original Assignee
The University Of North Carolina At Chapel Hill
Inspiration Biopharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US13/097,609 external-priority patent/US20120064075A1/en
Application filed by The University Of North Carolina At Chapel Hill, Inspiration Biopharmaceuticals, Inc. filed Critical The University Of North Carolina At Chapel Hill
Publication of WO2012149463A1 publication Critical patent/WO2012149463A1/fr

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424Serine endopeptidases (3.4.21)
    • C12N9/644Coagulation factor IXa (3.4.21.22)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46Hydrolases (3)
    • A61K38/48Hydrolases (3) acting on peptide bonds (3.4)
    • A61K38/482Serine endopeptidases (3.4.21)
    • A61K38/4846Factor VII (3.4.21.21); Factor IX (3.4.21.22); Factor Xa (3.4.21.6); Factor XI (3.4.21.27); Factor XII (3.4.21.38)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424Serine endopeptidases (3.4.21)
    • C12N9/6437Coagulation factor VIIa (3.4.21.21)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y304/00Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21Serine endopeptidases (3.4.21)
    • C12Y304/21021Coagulation factor VIIa (3.4.21.21)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y304/00Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21Serine endopeptidases (3.4.21)
    • C12Y304/21022Coagulation factor IXa (3.4.21.22)

Definitions

  • the present invention relates to methods of treatment using chimeric human coagulation Factor VII (FVII) polypeptides having a prolonged hemostatic protective effect, or extended half-life and delayed clearance from the body as compared with available Factor VII polypeptides, as well as polynucleotide constructs encoding such polypeptides, and vectors and host cells comprising and expressing the polynucleotides.
  • FVII human coagulation Factor VII
  • the present invention relates to methods of clearing proteins present in the extravascular space more slowly and increasing the functional half-life by reducing the interaction of Factor Vila with anti-thrombin III or other inhibitors such as alpha 2 macro globulin or tissue factor pathway inhibitor (TFPI).
  • TFPI tissue factor pathway inhibitor
  • the present invention also relates to methods of clearing proteins such as Factor IX present in the extravascular space more quickly.
  • the present invention also relates to methods of targeting proteins such as chimeric FVII polypeptides to the extravascular tissue where they may have an
  • Blood coagulation is a process consisting of a complex interaction of various blood components (or factors) that eventually gives rise to a fibrin clot.
  • the blood components which participate in what has been referred to as the coagulation "cascade,” are enzymatically inactive proteins (proenzymes or zymogens) that are converted to proteolytic enzymes by the action of an activator (which itself is an activated clotting factor).
  • Coagulation factors that have undergone such a conversion are generally referred to as "active factors,” and are designated by the addition of the letter "a" to the name of the coagulation factor (e.g., activated Factor VII is designated as Factor Vila or FVIIa).
  • thrombin feeds back and activates more FIX, which further sustains thrombin generation to allow a clot to form.
  • This process includes generation of Factor Xa (FXa) by Factor IXa (FIXa) (in complex with Factor Villa) and occurs on the surface of activated platelets.
  • FIXa Factor IXa
  • Thrombin finally converts fibrinogen to fibrin, resulting in formation of a fibrin clot.
  • Factor VII and tissue factor have been found to be the main initiators of blood coagulation.
  • the pharmacological use of Factor Vila has rapidly expanded and it is often used off-label in trauma.
  • FVIIa is rapidly removed from the circulatory system, maintaining it in the circulatory system or extravascular spaces, especially around blood vessels, may be valuable. Thus, the lifetime of FVII and/or FVIIa may be a complex question because it is cleared rapidly from circulation but may be present outside of the circulatory system as well.
  • Factor VII is a plasma glycoprotein that is known to circulate in blood as a single-chain zymogen. The zymogen has marginal catalytic activity. Single-chain Factor VII may be converted to two-chain Factor Vila by Factor Xa, Factor Xlla, Factor IXa, Factor Vila or thrombin in vitro.
  • Factor Xa is believed to be the major physiological activator of Factor VII, although other proteases may also be able to cleave FVII into FVIIa.
  • Factor VII is dependent on Vitamin K for its activity, which is required for the gamma-carboxylation of multiple glutamic acid residues that are clustered in the amino terminal domain of the protein, the so-called "Gla-domain.” These gamma-carboxylated glutamic acids are required for the efficient secretion of FVII and its metal ion-induced interaction with phospholipids.
  • zymogen Factor VII The conversion of zymogen Factor VII into the activated two-chain molecule occurs by cleavage of an internal Arg 1 5 2-Ile[ 5 3 peptide bond. Additionally, it is well known that high concentrations of Factor VII lead to autoactivation in vitro; which is also true of the chimeric proteins of this invention. In the presence of tissue factor, phospholipids and calcium ions, the two-chain Factor Vila rapidly activates Factor X or Factor IX by limited proteolysis.
  • hFVII human FVII
  • FVII The gene organization and protein structure of FVII are similar to those of other vitamin K-dependent procoagulant proteins, with exons la and lb encoding signal sequence; exon 2 the propeptide and GLA domain; exon 3 a short hydrophobic region; exons 4 and 5 the epidermal growth factor-like domains; and exon 6 through 8 the serine protease catalytic domain (Yoshitake et al. Biochemistry 1985; 24: 3736- 3750).
  • Factor IX Greek factor
  • GLA ⁇ -carboxyglutamic acid
  • EGF epidermal growth factor-like
  • the vitamin K dependent coagulation plasma proteins contain a GLA domain that functions as the site of protein attachment to phospholipids or certain cell membranes and the GLA domain is highly conserved among the various coagulation proteins. Despite their similarity, the GLA domains exhibit a wide range of affinities for phospholipid, with the GLA domain of Protein S having the highest affinity for phospholipids. (Ellison et al. Biochemistry 1998; 37:7997-8003; McDonald et al. Biochemistry 1997; 36:5120-27).
  • Factor Vila has been used to control bleeding disorders that have several causes such as clotting factor deficiencies (e.g., hemophilia A and B or deficiency of coagulation Factors XI or VII) or clotting factor inhibitors.
  • Factor Vila has also been used to control excessive bleeding occurring in subjects with a normally functioning blood clotting cascade (no clotting factor deficiencies or inhibitors against any of the coagulation factors). Such bleeding may, for example, be caused by a defective platelet function, thrombocytopenia or von Willebrand's disease.
  • Warnings relating to treatment with Factor VII have been proposed for products seeking regulatory approval.
  • the European Medicines Agency, Human Medicines Evaluation Unit recommends that current Factor VII therapies carry a warning of the risk of thrombosis and disseminated intravascular coagulation, particularly in situations where the Factor VII is to be administered to patients with a history of coronary heart disease or liver disease, post-operative patients, neonates and those at risk from thrombosis and disseminated intravascular coagulation. See, e.g., Core SPC for Human Plasma Derived Coagulation Factor VII Products (CPMP/BPWG/2048/01), July, 2004.
  • rFVIIa human recombinant FVIIa
  • NovoSeven ® Commercial preparations of human recombinant FVIIa (rFVIIa), NovoSeven ® and NovoSeven ® RT, are indicated for the treatment of bleeding episodes in hemophilia A or B patients and are the only rFVIIa preparations for treatment of bleeding episodes available on the market.
  • NovoSeven® may bind to rehydrated lyophilized platelets, which could be administered in combination to localize the Factor VII to a site of injury (Fischer et al. Platelets 2008; 19: 182-91).
  • a higher specific activity analogue of NovoSeven ® has been shown to have a shorter plasma half-life than NovoSeven ® because of in vivo interaction with antithrombin.
  • both NovoSeven ® and this analogue will be considerably shortened by in vivo inhibition with antithrombin compared to the chimeric molecules described in this invention.
  • the functional half-life of both NovoSeven and this analogue may also be shortened because of binding with alpha 2 macroglobulin and/or tissue factor pathway inhibitor (TFPI), whereas the functional half-life of the chimeric molecules of this invention may not.
  • TFPI tissue factor pathway inhibitor
  • selective PEGylation of Factor VII may increase plasma half-life, (Stennicke et al. Thromb.
  • glycosylation are expected to function in a similar manner in the chimeric Factor Vila molecules of the present invention, i.e., the properties imparted to a protein by the covalent attachment of a non-polypeptide moiety are expected to be imparted to the chimeric Factor VII a molecules.
  • the present invention provides a method of treating a bleeding disorder in a subject in need thereof, comprising administering to the subject an effective amount of a chimeric Factor Vila polypeptide with a prolonged functional lifespan in vivo or prolonged functional half life in vivo as compared with a non-chimeric Factor Vila polypeptide.
  • a method of treating a bleeding disorder in a subject in need thereof comprising administering to the subject an effective amount of a chimeric Factor Vila polypeptide with a prolonged protective effect against bleeding due to the bleeding disorder or trauma, as compared with a non-chimeric Factor Vila polypeptide.
  • Also provided herein is a method of treating a bleeding disorder in a subject in need thereof, comprising administering to the subject an effective amount of a modified Factor Vila polypeptide that has a reduced affinity for tissue factor as compared with a non-modified Factor Vila polypeptide.
  • the present invention further provides a method of treating a bleeding disorder in a subject in need thereof, comprising administering to the subject an effective amount of a modified Factor Vila polypeptide that has an increased binding affinity for a basement membrane component and/or increased ability to mediate binding of a protein to a structural molecule of the extravascular tissue such as a basement membrane component as compared with a non-modified Factor Vila polypeptide.
  • Also provided herein is a method of targeting or sequestering a modified Factor Vila polypeptide to extravascular tissue in a subject in need of treatment for a bleeding disorder, comprising administering to a subject an effective amount of a modified Factor Vila polypeptide that has increased targeting or sequestering to extravascular tissue as compared with a non-modified Factor Vila polypeptide.
  • a method of treating a bleeding disorder in a subject in need thereof comprising administering to the subject an effective amount of a modified Factor Vila polypeptide that has a reduced clearance rate from the body of the subject or reduced binding to Factor Vila protease inhibitors that inactivate FVIIa protease activity or facilitate the clearance of bound FVIIa in the body of the subject as compared with a non-modified Factor Vila polypeptide.
  • the present invention also provides a method of treating a bleeding disorder in a subject in need thereof, comprising administering to the subject an effective amount of a chimeric FVIIa polypeptide less frequently during bleeding incidences or in between bleeding incidences, with longer intermittent duration during a bleeding incidence, at lower doses during or before bleeding incidences and /or with longer duration prior to a bleeding incidence (e.g. as a prophylactic treatment), as compared with a non-chimeric Factor Vila polypeptide.
  • a chimeric Factor Vila polypeptide in the methods of this invention, can be employed, wherein the chimeric Factor Vila polypeptide, comprises a catalytic domain of Factor VII and/or an EGF-2 domain of Factor VII.
  • Such a chimeric Factor Vila polypeptide can further comprise a domain that mediates binding of a protein to a structural molecule of the extravascular tissue such as a basement membrane component.
  • a domain include a) a single chain antibody Fab fragment or single chain variable fragment (scFv) that specifically binds a structural molecule of the extravascular tissue such as a basement membrane component; b) a laminin binding domain of a laminin binding receptor; c) a laminin binding domain of a proteoglycan; d) a laminin binding domain of a bacterial adhesin protein; e) a nidogen/entactin binding domain; f) a collagen type 4 binding domain; and g)any combination of (a)-(f) above.
  • the chimeric Factor Vila polypeptide of this invention can comprise, in addition to a FVII catalytic domain and a FVII EGF-2 domain, a domain that mediates binding of a protein to a structural molecule of the extravascular tissue such as a basement membrane component, and/or a GLA domain of a vitamin K dependent coagulation protein, including but not limited to Factor IX GLA domain or Protein S GLA domain.
  • the chimeric Factor Vila polypeptide described above can further comprise an
  • EGF-1 domain of a vitamin K dependent coagulation protein e.g., that binds more poorly to tissue factor than non-chimeric Factor Vila
  • a vitamin K dependent coagulation protein e.g., that binds more poorly to tissue factor than non-chimeric Factor Vila
  • the chimeric Factor Vila polypeptide can comprises an EGF- 1 domain of Factor IX or an EGF-1 domain of Protein S or an EGF-1 domain of Factor X.
  • the GLA domain can be a Factor IX Gla domain. In some embodiments of the chimeric Factor Vila polypeptide of this invention, the GLA domain can be a Factor IX GLA domain comprising a substitution of lysine at residue 51 in the amino acid sequence of SEQ ID NO: 19 by arginine.
  • the GLA domain is a Factor IX GLA domain comprising a substitution of lysine at residue 51 in the amino acid sequence of SEQ ID NO: 19 by alanine and/or a substitution of valine at residue 56 in the amino acid sequence of SEQ ID NO: 19 with another amino acid (e.g., lysine, leucine, isoleucine and methionine as non-limiting examples)
  • An exemplary embodiment is a chimeric Factor Vila polypeptide comprising a Factor IX EGF-1 domain and a Factor IX GLA domain, wherein the FIX GLA domain comprises a substitution of lysine at residue 51 in the amino acid sequence of SEQ ID NO: 19 by alanine.
  • This mutation in the FIX GLA domain reduces the affinity for collagen Type IV.
  • Lowering the affinity of the FVIIa chimera for basement membrane collagen (Type IV) is expected to yield an advantage over other FVIIa molecules. For example, if some FVIIa chimeras described herein turn out to be hypercoagulable, then using a chimeric FVIIa that binds less tightly will result in less FVIIa protein bound to the basement membrane (collagen Type IV) and thereby reduce the thrombotic risk
  • the EGF-1 domain can be a Factor VII EGF-1 domain comprising a substitution of isoleucine at residue 129 in the amino acid sequence of SEQ ID NO: 18 by alanine
  • the EGF-1 domain can be a Factor VII EGF-1 domain comprising a substitution of arginine at residue 139 in the amino acid sequence of SEQ ID NO: 18 by alanine
  • the catalytic domain of Factor VII can comprise a substitution of methionine at residue 366 of the amino acid sequence of SEQ ID NO: 18 with alanine, valine or isoleucine
  • the catalytic domain of Factor VII can comprise a substitution of valine at residue 218 of the amino acid sequence of SEQ ID NO: 18 with aspartate
  • the catalytic domain of Factor VII can comprise a substitution of glutamate at residue 356 of the amino acid sequence of SEQ ID NO: 18 with valine
  • a bleeding disorder can be but is not limited to, a clotting factor deficiency; defective platelet function; thrombocytopenia; von Willebrand's disease; inhibition of clotting factors; bleeding induced by surgery; bleeding induced by trauma and any combination thereof.
  • the bleeding disorder is a deficiency of a clotting factor or its clotting function, which can be hemophilia.
  • the present invention further provides a method of treating a bleeding disorder in a subject in need thereof, comprising administering to the subject an effective amount of a nucleic acid molecule comprising a nucleotide sequence encoding the chimeric Factor Vila polypeptide.
  • FIG. 1 shows a diagrammatic representation of chimeric FVIIa molecules useful in the present invention.
  • FVII Factor VII
  • FIX Factor IX
  • Pro S Protein S.
  • FIG. 2 shows the thrombin generation (nM) in normal conditions and hemophilic conditions (removal of Factor IX or Factor VIII) in a cell based model system of hemophilia for varying concentrations of wild-type Factor Vila.
  • FIG, 3 shows the thrombin generation (nM) in normal conditions and hemophilic conditions (removal of Factor IX or Factor VIII) in a cell based model system of hemophilia with administration of 50nM wild-type Factor Vila, or ⁇ chimeric Factor Vila.
  • 1063 Factor Vila chimera with GLA domain and EGF-1 domain of Factor IX
  • CT54 Factor Vila chimera with GLA domain of Protein S and EGF-1 domain of Factor IX.
  • FIG. 4 shows the peak thrombin, relative to the control value, produced in a cell based model system of hemophilia following administration of 50nM wild-type Factor Vila, or ⁇ chimeric Factor Vila.
  • 1063 Factor Vila chimera with GLA domain and EGF-1 domain of Factor IX
  • CT54 Factor Vila chimera with GLA domain of Protein S and EGF-1 domain of Factor IX.
  • FIG. 5 shows the disruption hemostasis time in a clotting assay for a hemophilia B mouse with no treatment, a hemophilia B mouse administered with 2 mg/kg of NovoSeven®, a hemophilia B mouse administered with 2 mg/kg of a chimeric FVIIa molecule and a wild-type mouse with no treatment.
  • 1063 Factor Vila chimera with GLA domain and EGF-1 domain of Factor IX.
  • FIG. 6 shows the amino acid sequence of an exemplary chimeric Factor VII of the present invention, comprising the signal, pro peptide, GLA and EGFl domains of Factor IX (underlined) (SEQ ID NO: l).
  • FIG. 7 shows the amino acid sequence of an exemplary chimeric Factor VII of the present invention, comprising the signal, pro peptide, and EGFl domains of Factor IX (underlined), and the GLA domain of Protein S (bold) (SEQ ID NO:2).
  • the present invention provides methods of extending the lifetime of FVIIa in the body and of extending the effective treatment of a bleeding disorder in a subject having the bleeding disorder by administering one or more of the chimeric FVIIa polypeptides described herein.
  • the method of treating the bleeding disorder may include a method of administering to the subject a nucleic acid molecule comprising a nucleotide sequence encoding a chimeric Factor Vila polypeptide and/or a method of administering to the subject the chimeric Factor Vila protein that the nucleotide sequence encodes, as described herein.
  • the methods of the current invention use chimeric FVIIa molecules, and in particular embodiments, employ chimeric hFVIIa molecules comprising hFVIIa domains and domains from one or more proteins of the coagulation system, providing one or more desired benefits. While not wishing to be constrained by the inventors' present theory of activity, it is believed that by locating the chimeric FVII or FVIIa molecules extravascularly or on a basement membrane component such as type IV collagen, they will be exposed when the endothelium lining the blood vessel is breached and will accumulate in the vicinity of other coagulation proteins and activated platelets such that a response to a bleeding episode is more effective and a number of benefits are achieved as described below.
  • the chimeric FVIIa and FVII molecules of the present invention therefore, have one or more improved properties as compared to commercially available rFVIIa or rFVII or other non-chimeric FVII polypeptides, including having a prolonged, or extended functional half-life and a reduced clearance rate from the body. Consequently, medical treatment with a FVIIa chimera of the invention offers advantages over the currently available rFVIIa compound, such as requiring potentially lower doses and/or providing extended duration of protection against further bleeding episodes between intermittent doses and/or following the end of treatment. Other advantages include accumulating the chimeric Factor Vila molecules in the vicinity of other coagulation proteins and activated platelets such that a response to a bleeding episode is quicker and/or more effective.
  • the present invention provides a method of treating a bleeding disorder in a subject (e.g., a subject in need thereof), comprising administering to the subject an effective amount of a chimeric Factor Vila polypeptide with a prolonged functional lifespan in vivo or a prolonged functional half life in vivo (e.g., prolonged by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%), 90%), 95%), 100%) or more) as compared with a non-chimeric Factor Vila polypeptide.
  • the present invention provides a method of treating a bleeding disorder in a subject (e.g., a subject in need thereof), comprising administering to the subject an effective amount of a modified Factor Vila polypeptide that has an increased binding affinity for a structural molecule of the extravascular tissue such as a basement membrane component (e.g., increased by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 90%, 95%, or 100%) as compared with a non-modified Factor Vila polypeptide.
  • the determination of binding affinity for a structural molecule of the extravascular tissue such as a basement membrane component of the polypeptides
  • Also provided herein is a method of treating a bleeding disorder in a subject (e.g., a subject in need thereof), comprising administering to the subject an effective amount of a modified Factor Vila polypeptide that has a reduced clearance rate from the body of the subject and/or reduced binding to Factor Vila protease inhibitors that inactivate FVIIa protease activity or facilitate the clearance of bound FVIIa in the body of the subject (e.g., prolonged by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 90%, 95%, or 100%) as compared with a non-modified Factor Vila polypeptide.
  • the determination of the clearance rate or reduced binding to Factor Vila protease inhibitors that inactivate FVIIa protease activity or facilitate the clearance of bound FVIIa of the polypeptides of this invention can be made by carrying out protocols as described herein and as are known in the art.
  • Representative chimeric FVIIa polypeptides useful in the methods of the invention include a chimeric FVIIa polypeptide comprising the EGF-2 and catalytic domains of FVII and the GLA domain of a vitamin K-dependent coagulation protein and the EGF-1 domain of a vitamin K-dependent coagulation protein (e.g., an EGF-1 domain that binds more poorly to tissue factor than a non-chimeric Factor Vila polypeptide).
  • Other representative chimeric FVIIa polypeptides useful in the methods of the invention include a chimeric FVIIa comprising the EGF-1, EGF-2 and catalytic domains of FVII and the GLA domain of a vitamin K-dependent coagulation protein.
  • chimeric FVIIa polypeptides useful in the methods of the invention include 1) a chimeric FVIIa comprising the GLA and EGF-1 domains of FIX and the EGF-2 and catalytic domains of FVII; 2) a chimeric FVIIa comprising the EGF-1 domain of FIX and the GLA, EGF-2 and catalytic domains of FVII; 3) a chimeric FVIIA comprising the GLA domain of Protein S, the EGF-1 domain of FIX and the EGF-2 and catalytic domains of FVII; 4) a chimeric FVIIa comprising the GLA and EGF-1 domains of Protein S and the EGF-2 and catalytic domains of FVII; 5) a chimeric FVIIa comprising the EGF-1 domain of Protein S and the GLA, EGF-2 and catalytic domains of FVII; 6) a chimeric FVIIa comprising the EGF-1 domain of Protein S and the GLA, E
  • a chimeric FVIIa comprising the EGF- 1 domain of Protein S, the GLA domain of FIX and the EGF-2 and catalytic domains of FVII, where the lysine at residue 51 in the FIX GLA domain (i.e., at residue 51 in the amino acid sequence of SEQ ID NO: 19) has been substituted with an arginine.
  • Additional embodiments of this invention include a chimeric FVIIa comprising the GLA and EGF-1 domains of FIX and the EGF-2 and catalytic domains of FVII, where the lysine at residue 51 in the FIX GLA domain (i.e., at residue 51 in the amino acid sequence of SEQ ID NO: 19) has been substituted with an alanine and/or the valine at residue 56 of the amino acid sequence of SEQ ID NO: 19 has been substituted with another amino acid (e.g., lysine, leucine, isoleucine, methionine).
  • lysine at residue 51 in the FIX GLA domain i.e., at residue 51 in the amino acid sequence of SEQ ID NO: 19
  • another amino acid e.g., lysine, leucine, isoleucine, methionine
  • a further embodiment of this invention includes a chimeric FVIIa comprising the EGF- 1 domain of Protein S, the GLA domain of FIX and the EGF-2 and catalytic domains of FVII, where the lysine at residue 51 in the FIX GLA domain (i.e., at residue 51 in the amino acid sequence of SEQ ID NO: 19) has been substituted with an alanine and/or the valine at residue 56 of the amino acid sequence of SEQ ID NO: 19 has been substituted with another amino acid (e.g., lysine, leucine, isoleucine, methionine).
  • this invention also contemplates chimeric forms of FVII in the aforementioned embodiments also.
  • FVIIa polypeptides useful in the methods of the invention also may include wild-type FVIIa or any of the above described chimeric FVIIa polypeptides, which have amino acid substitutions in the FVII EGF-1 domain or the FVII GLA domain.
  • the substitutions can be conservative substitutions and/or non- conservative substitutions.
  • Such substitutions may include the substitution of the isoleucine at residue 129 by alanine and/or a substitution of the arginine at residue 139 by alanine in the amino acid sequence of the FVII EGF-1 domain shown as SEQ ID NO: 18.
  • Additional substitutions may include, in a FVIIa chimera comprising a FIX GLA domain, the substitution of the lysine at residue 51 by arginine in the amino acid sequence of the FIX GLA domain as shown in SEQ ID NO: 19, which causes the GLA domain to have a higher binding affinity for collagen type IV but does not appear to affect platelet binding (Gui et al. Blood 2002; 100:153-8; Cheung et al. J Biol Chem 1992; 267:20529-31 ; Melton et al. Blood Coagulation and Fibrinolysis 2001 ; 12:237-43 ).
  • substitutions in such a chimera comprising a FIX GLA domain include a substitution of the lysine at residue 51 by alanine in the amino acid sequence of the FIX GLA domain as shown in SEQ ID NO: 19 and/or a substitution of the valine at residue 56 of the GLA domain as shown in SEQ ID NO: 19 with another amino acid (e.g., lysine, leucine, isoleucine, methionine, etc.).
  • another amino acid e.g., lysine, leucine, isoleucine, methionine, etc.
  • the FVII molecules of this invention can comprise a substitution of the methionine at residue 366 in the amino acid sequence of the FVII catalytic domain shown as SEQ ID NO: 18 by another amino acid, which in some embodiments can be a conservative amino acid substitution, which can be, for example alanine, valine, leucine or isoleucine, which further reduces the affinity for tissue factor; and, the substitution of the valine at residue 218 in the amino acid sequence of the FVII catalytic domain as shown in SEQ ID NO: 18 by aspartate, the substitution of the glutamate at residue 356 in the amino acid sequence of the FVII catalytic domain shown as SEQ ID NO: 18 by valine and/or the substitution of the methionine at residue 358 in the amino acid sequence of the FVII catalytic domain shown as SEQ ID NO: 18 by glutamine, which result in a Factor Vila with higher specific activity.
  • a conservative amino acid substitution which can be, for example alanine, valine, leucine
  • the invention provides a method of treating a bleeding disorder in a subject having the bleeding disorder by administering a modified FVII polypeptide or modified FVIIa polypeptide, wherein the modified polypeptide is targeted to and/or accumulates in the extravascular space, thereby shielding the modified polypeptide from the clearance mechanisms in a subject's body that act on a non-modified FVIIa or FVII polypeptide (e.g., the currently available Factor VII or Factor Vila polypeptides) or protecting the modified polypeptide from inactivation regardless of whether it is cleared from the body.
  • a non-modified FVIIa or FVII polypeptide e.g., the currently available Factor VII or Factor Vila polypeptides
  • modified polypeptides are FVIIa polypeptides comprising a GLA domain of any coagulation protein that binds collagen type IV in the basement membrane (or another basement membrane component), or the phospholipid membrane of cells.
  • GLA domains include the GLA domain of FIX and the GLA domain of protein S, which can further comprise substitutions and/or other modifications as described herein that enhance binding to basement membrane components such as collagen type IV.
  • Nonlimiting examples of a modified polypeptide of this invention include a recombinant protein comprising a GLA domain of FIX or a GLA domain of Protein S, a chimeric protein comprising a GLA domain of FIX or a GLA domain of Protein S and/or a chimeric FVIIa polypeptide of this invention comprising a GLA domain of FIX or a GLA domain of Protein S.
  • the present invention provides a method of treating a subject having a bleeding disorder by administering a chimeric Factor Vila polypeptide of the invention that comprises a catalytic domain derived from a Factor VII polypeptide and a domain that mediates binding of a protein to a structural molecule of the extravascular tissue such as a basement membrane component.
  • a chimeric Factor Vila polypeptide of the invention that comprises a catalytic domain derived from a Factor VII polypeptide and a domain that mediates binding of a protein to a structural molecule of the extravascular tissue such as a basement membrane component.
  • a domain can be, for example, a collagen type IV targeting domain.
  • Such collagen type IV targeting domains include domains from proteins that interact with or bind to collagen type IV (see for example, UniProt Accession Nos. P02462, P08572, Q01955, P53420, P29400, QPY5P4 and Q14031).
  • Nonlimiting examples of such domains include a single chain antibody Fab fragment or single chain variable fragment (scFv) (See, e.g., Colcher et al. "Pharmacokinetics and biodistribution of genetically engineered antibodies" Q J Nucl Med 1998; 42(4):225- 241) that specifically binds a structural molecule of the extravascular tissue such as a basement membrane component.
  • domains that bind basement membrane components include the laminin binding domain or laminin- binding protein sequences, such as from laminin-binding receptors ( see, for example, UniProt Accession No. P08865) or the laminin binding proteoglycan, agrin (see, e.g., (UniProt Accession No. 000468; Kroger & Schroder "Agrin in the developing CNS: New roles for a synapse organizer" News Physical Sci 2002; 17:207-212; Mascarenhas et al.
  • laminin binding domain or laminin- binding protein sequences such as from laminin-binding receptors ( see, for example, UniProt Accession No. P08865) or the laminin binding proteoglycan, agrin (see, e.g., (UniProt Accession No. 000468; Kroger & Schroder "Agrin in the developing CNS: New roles for a synapse organizer" News Physical Sci 2002; 17:
  • a domain that mediates binding of a protein to a structural molecule of the extravascular tissue such as a basement membrane component can be present in the chimeric Factor Vila polypeptide of this invention at the carboxy terminus, in between the GLA and EGF-1 domains, as a substitution for the GLA domain and any combination thereof.
  • basement membrane component includes protein molecules present in the thin layer of connective tissue that typically underlies endothelial cells, including those that form the wall of a blood or lymphatic vessel of any type, or an epithelial surface or boundary.
  • Nonlimiting examples of basement membrane components include proteins such as laminin, nidogen, entactin, collagens of several types, including Type IV and Type XVIII, proteoglycans (such as Perlecan) and glycosaminoglycans (such as heperan sulfate).
  • a "domain that mediates binding of a protein to a basement membrane component” or a domain “that mediates binding of a protein to a structural molecule of the extravascular tissue such as a basement membrane component” is a part (e.g., fragment or subsection) of a protein that can fold, function, and exist independently of the rest of the protein sequence or structure.
  • a protein domain may (but does not necessarily have to) comprise the entire sequence or structure of a protein.
  • a basement membrane binding domain is defined as a protein domain that can bind to, or mediate binding of the protein to, molecular components in the basement membrane or subendothelial matrix.
  • Such targeting of coagulation proteins to the extravascular space using a domain that binds to a basement membrane component or mediates binding of a protein to a structural molecule of the extravascular tissue such as a basement membrane component and has reduced affinity for tissue factor has the additional, but unexpected benefit of protecting the chimeric FVIIa polypeptides from the normal circulatory clearance mechanisms present in a subject's body while prolonging the functional half-life of the chimeric Factor Vila polypeptides.
  • This approach can also be used to target other therapeutically useful polypeptides or other molecules to extravascular storage sites.
  • Such therapeutically useful molecules may include other coagulation cascade proteins and the like as are known in the art.
  • Such targeting of coagulation proteins to the extravascular space using a domain that binds to a basement membrane component and has reduced affinity for tissue factor has the additional, but unexpected benefit of protecting the chimeric FVIIa polypeptides from the normal circulatory clearance mechanisms present in a subject's body while prolonging the functional half-life of the chimeric Factor Vila polypeptides.
  • This approach can also be used to target other therapeutically useful polypeptides or other molecules to extravascular storage sites.
  • therapeutically useful molecules may include other coagulation cascade proteins and the like as are known in the art.
  • the present invention further provides a method of treating a bleeding disorder in a subject having the bleeding disorder by administering to the subject a modified polypeptide (e.g., a modified FVII or FVIIa polypeptide) with reduced binding affinity for tissue factor (e.g., reduced at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 90%, 95%, or 100%) as compared with the binding affinity for tissue factor of a non-modified polypeptide (e.g., a non-modified Factor VII or Factor Vila polypeptide).
  • a non-modified polypeptide e.g., a non-modified Factor VII or Factor Vila polypeptide
  • a modified polypeptide with reduced binding affinity for tissue factor as compared with a non-modified polypeptide can be, for example, a chimeric Factor VII polypeptide of this invention or active fragment thereof.
  • Nonlimiting examples of such polypeptides include a chimeric FVIIa polypeptide comprising the GLA and EGF-1 domains of FIX and the EGF-2 and catalytic domains of FVII; and a chimeric FVIIa polypeptide comprising the GLA domain of Protein S, the EGF-1 domain of FIX and the EGF-2 and catalytic domains of FVII.
  • the reduction or elimination of binding to tissue factor by the chimeric FVIIa polypeptide should also extend the useful half-life of the chimeric FVIIa polypeptide because the interaction with anti-thrombin III should be much reduced (Rao et al. Blood 1993 81(10):2600- 2607; Broze et al. Blood 1993 82(5): 1679-1681).
  • chimeric polypeptide or “chimeric Factor VII polypeptide” or “chimeric Factor Vila polypeptide” refer to a polypeptide comprising the EGF-2 and catalytix domains from Factor VII in combination with one or more domains from another protein.
  • non-chimeric polypeptide or “non- chimeric Factor VII polypeptide” or” non-chimeric Factor Vila polypeptide” thus refer to a Factor VII protein whose domains are Factor VII derived and not derived from other proteins.
  • modified Factor VII polypeptide or modified
  • Factor Vila polypeptide can include a Factor VII polypeptide or Factor Vila polypeptide that has been modified (e.g., by substitution, deletion, insertion, etc., of one or more amino acids), resulting in a Factor VII polypeptide or Factor FVIIa polypeptide that has altered properties (e.g., enhanced or diminished binding affinity, enhanced or diminished activity, etc.) as compared with a non-modified Factor VII polypeptide or Factor Vila polypeptide, which is understood to be a native or wild type Factor VII or Factor Vila, which can include naturally or non-naturally occurring variants that may differ in amino acid sequence from "wild type" Factor VII or Factor Vila but do not have the particular altered properties as described herein.
  • activity means the ability of a Factor VII polypeptide to convert its substrate Factor X to the active Factor Xa or Factor IX to Factor IXa with or without the ability to bind tissue factor, or any other function of Factor VII.
  • FVIIa includes a product consisting of the two-chain form of FVII, FVIIa may also indicate the active protease form of a FVII polypeptide.
  • inherent activity includes the ability to generate thrombin on the surface of activated platelets in the absence of tissue factor.
  • Ga domain or "N-terminal GLA-domain” includes the amino acid sequence from about amino acid residue 61 to about amino acid residue 105 of the amino acid sequence of SEQ ID NO: 18 (Factor VII precursor sequence, see, e.g., UniProt Accession No. P08709), the amino acid sequence from about amino acid residue 47 to about amino acid residue 92 of the amino acid sequence of SEQ ID NO: 19 (Factor IX precursor sequence, see, e.g., UniProt Accession No. P00740), the amino acid sequence from about amino acid residue 41 to about amino acid residue 85 of the amino acid sequence of SEQ ID NO:22 (Factor X precursor sequence, see, e.g., UniProt Accession No.
  • amino acid sequence from about amino acid 43 to about amino acid 88 of SEQ ID NO:23 (Protein C precursor sequence, see, e.g., UniProt Accession No. P04070), the amino acid sequence from about amino acid 53 to about amino acid 94 of SEQ ID NO:24 (Growth arrest-specific protein 6 (GAS6 or Gas 6) precursor sequence, see e.g., UniProt Accession No.
  • any post- translational modifications to the identified amino acid sequences any conservative amino acid substitutions in the identified amino acid sequences, addition of amino acid residues to the identified amino acid sequences, deletions of amino acid residues from the identified amino acid sequences, or any other amino acid sequence from a coagulation cascade protein that binds to phospholipid membranes.
  • EGF-l describes a region of 30-40 amino acids having structural homology to epidermal growth factor (EGF) and typically containing six cysteines found originally in EGF (epidermal growth factor) and also in a range of proteins involved in cell signaling and in coagulation proteins, with nearly all known EGF-like domains containing disulfide bonds 1-3, 2-4 and 5-6.
  • EGF-l domain of Factor VII is from about amino acid residue 106 to about amino acid residue 142 of the amino acid sequence of SEQ ID NO: 18.
  • the EGF-l domain of Factor IX is from about amino acid residue 93 to about amino acid residue 129 of the amino acid sequence of SEQ ID NO:19.
  • the EGF-l domain of Protein S is from about amino acid residue 1 17 to about amino acid residue 155 of the amino acid sequence of SEQ ID NO:20.
  • the EGF-l domain of Factor X is from about amino acid residue 86 to about amino acid residue 122 of the amino acid sequence of SEQ ID NO:22.
  • the EGF-l domain from Protein C is from about amino acid residue 97 to about amino acid 132 of the amino acid sequence of SEQ ID NO:23.
  • the EGF-l domain from GAS6 is from about amino acid residue 116 to about amino acid 154 of the amino acid sequence of SEQ ID NO:24.
  • EGF-2 means the second EGF-like domain in a series (of two or more EGF-like domains).
  • the EGF-2 domain of Factor VII is from about amino acid residue 147 to about amino acid residue 188 in the amino acid sequence of SEQ ID NO: 18.
  • the EGF-2 domain of Factor IX is from about amino acid residue 130 to about amino acid residue 171 in the amino acid sequence of SEQ ID NO: 19.
  • the EGF-2 domain of Protein S is from about amino acid residue 157 to about amino acid residue 200 in the amino acid sequence of SEQ ID NO:20.
  • the EGF-2 domain of Factor X is from about amino acid residue 125 to about amino acid residue 165 in the amino acid sequence of SEQ ID NO:22.
  • the EGF-2 domain from Protein C is from about amino acid residue 136 to about amino acid 176 of the amino acid sequence of SEQ ID NO:23.
  • the EGF-2 domain from GAS6 is from about amino acid residue 156 to about amino acid 196 of the amino acid sequence of SEQ ID NO:24.
  • catalytic domain means a domain in a protein that may mediate cleavage of peptide bonds.
  • the catalytic domain of Factor VII is from about amino acid residue 213 to about amino acid residue 452 in the amino acid sequence of SEQ ID NO: 18.
  • the catalytic domain of Factor IX is from about amino acid residue 227 to about amino acid residue 459 in the amino acid sequence of SEQ ID NO: 19.
  • the catalytic domain of Factor X is from about amino acid residue 235 to about amino acid residue 467 in the amino acid sequence of SEQ ID NO:22,
  • the catalytic domain from Protein C is from about amino acid residue 212 to about amino acid 450 of the amino acid sequence of SEQ ID NO:23.
  • amino acid sequences described herein can include any post-translational modifications to the identified amino acid sequences, any conservative amino acid substitutions in the identified amino acid sequences, any addition of amino acid residues to the identified amino acid sequences and/or any deletions of amino acid residues from the identified amino acid sequences.
  • GLA 4-carboxyglutamic acid
  • protealytic domain means a domain in a protein that may mediate cleavage of peptide bonds, generally considered to be from about amino acid residue 213 to the carboxy terminal amino acid residue of the amino acid sequence of SEQ ID NO: 18. (the heavy-chain of Factor Vila). Generally speaking, the terms “catalytic domain” and “protease domain” are recognized as the same and are interchangeable.
  • Vector VII polypeptide as used herein means any protein comprising the amino acid sequence encompassing residues 61-466 of native human Factor VII (SEQ ID NO: 18) or variants or fragments thereof. This includes but is not limited to human Factor VII, human Factor Vila and variants thereof.
  • Fractor VII as used herein is intended to comprise the inactive one- chain zymogen Factor VII molecule as well as the activated two-chain Factor VII molecule (Factor Vila). This includes proteins that have the amino acid sequence encompassing residues 61-466 (SEQ ID NO: 18) of native human Factor VII or Factor Vila.
  • the definition also encompasses proteins and peptides with a slightly modified amino acid sequence, for instance, a modified N-terminal end including N-terminal amino acid deletions or additions so long as those proteins substantially retain the activity of Factor Vila (e.g., retain about 50%, 60%, 70%, 80%, 90%, 95%, 100%, etc. of the activity of native Factor Vila).
  • Factor Vila or “FVIIa” as used herein means a product consisting of the activated form (Factor Vila).
  • Fractor VII or “Factor Vila” within the above definition also includes natural allelic variations that may exist and occur from one individual to another. Also, degree, specific monosaccharide composition and location of glycosylation or other post-translation modifications may vary depending on the chosen host cells, tissue, or animal species of expression and the nature of the host cellular, or tissue environment.
  • domain as used herein is intended to encompass a part of a protein sequence and structure that can evolve, function, and exist independently of the rest of the protein chain.
  • a domain is capable of forming a compact three-dimensional structure and often can be independently stable and cooperatively folded.
  • One domain may appear in a variety of evolutionarily related proteins. Domains can vary in length from between about 25 amino acids up to about 500 amino acids in length.
  • a "domain” can also encompass a domain from a wild-type protein that has had an amino acid residue, or residues, replaced by conservative substitution. Because they are independently and cooperatively folded and self-stable in a protein milieu, domains can be "swapped" by genetic engineering between one protein and another to make chimeric proteins.
  • variant or “variants,” as used herein, is intended to designate Factor VII having the amino acid sequence encompassing residues 61-466 (SEQ ID NO: 18) of native human Factor VII or Factor Vila, wherein one or more amino acids of the parent protein have been substituted by another amino acid and/or wherein one or more amino acids of the parent protein have been deleted and/or wherein one or more amino acids have been inserted in the protein and/or wherein one or more amino acids have been added to the parent Such addition can take place either at the N- terminal end or at the C-terminal end of the parent protein or both, as well as internally.
  • the "variant” or “variants” within this definition still have FVII activity in their activated form.
  • the EGF-1 domain of FVII has 65.7% identity with the EGF-1 domain of FIX and the GLA domain of FVII has 58.6% identity with the GLA domain of FIX and 51% identity with the GLA domain of Protein S.
  • a variant is at least, 40%, 50%, 60%. 70%, 80%,
  • a variant is at least 80% identical with the amino acid sequence encompassing residues 61-466 (SEQ ID NO: 18) of native human Factor VII or Factor Vila. In another embodiment a variant is at least 90% identical with the amino acid sequence encompassing residues 61-466 (SEQ ID NO: 18) of native human Factor VII or Factor Vila. In a further embodiment a variant is at least 95% identical with the amino acid sequence encompassing residues 61-466 (SEQ ID NO: 18) of native human Factor VII or Factor Vila.
  • any other amino acid means one amino acid that is different from that amino acid naturally present at that position. This includes but is not limited to amino acids that can be encoded by a polynucleotide. Preferably the different amino acid is in natural L-form and can be encoded by a polynucleotide. A specific example is L-cysteine (Cys). This also includes non-naturally occuring amino acids, such as synthetic or modified amino acids, as are well known in the art.
  • operably linked refers to the covalent joining of two or more nucleotide sequences, by means of enzymatic ligation or otherwise, in a configuration relative to one another such that the normal function of the sequences can be performed.
  • the nucleotide sequence encoding a presequence or secretory leader is operably linked to a nucleotide sequence coding for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide: a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence of interest; a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation into the protein or peptide of interest.
  • "operably linked" means that the nucleotide sequences being linked are contiguous and in the case of a secretory leader, contiguous and in reading phase.
  • vector means any nucleic acid entity capable of amplification in a host cell.
  • the vector may be an autonomously replicating vector, i.e., a vector, which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid.
  • the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome(s) into which it has been integrated.
  • Vectors include, but are not limited to plasmid vectors, phage vectors, viruses or cosmid vectors.
  • Vectors usually contain a replication origin and at least one selectable gene, i.e. , a gene which encodes a product which is readily detectable or the presence of which is essential for cell growth.
  • host cell represents any cell, including hybrid cells, in which heterologous DNA can be expressed.
  • Typical host cells include, but are not limited to insect cells, yeast cells, mammalian cells, including human cells, such as BHK, CHO, HEK, and COS cells.
  • the host cells being cultivated are preferably mammalian cells, more preferably an established mammalian cell line, including, without limitation, CHO (e.g., ATCC CCL 61), COS-1 (e.g., ATCC CRL 1650), baby hamster kidney (BHK) and HEK293 (e.g., ATCC CRL 1573; Graham et al, J Gen. Virol.
  • a suitable BHK cell line is the tk " tsl3 BHK cell line (Waechter and Baserga, Proc. Natl. Acad. Sci. USA 79: 1 106-11 10, 1982), hereinafter referred to as BHK 570 cells.
  • the BHK 570 cell line is available from the American Type Culture Collection, 10801 University, Boulevard, Manassas, Va. 20110, under ATCC accession number CRL 10314.
  • a tk- tsl 3 BHK cell line is also available from the ATCC under accession number CRL 1632.
  • Suitable cell lines include, without limitation, Rat Hep I (Rat hepatoma; ATCC CRL 1600), Rat Hep II (Rat hepatoma; ATCC CRL 1548), TCMK (ATCC CCL 139), Human lung (ATCC HB 8065), NCTC 1469 (ATCC CCL 9.1) and DUKX cells (Urlaub and Chasin, Proc. Natl Acad. Sci. USA 77:4216-4220, 1980). Also useful are 3T3 cells, Namalwa cells, myelomas and fusions of myelomas with other cells.
  • the term "appropriate growth medium” means a medium containing nutrients and other components required for the growth of cells and the expression of the nucleic acid sequence encoding the Factor VII polypeptide of the invention.
  • conjugate (or interchangeably “conjugated polypeptide”) is intended to indicate a heterogeneous (in the sense of composite or chimeric) molecule formed by the covalent attachment of one or more polypeptide(s) to one or more non- polypeptide moieties such as polymer molecules, lipophilic compounds, sugar moieties or organic derivatizing agents.
  • the conjugate is soluble at relevant concentrations and conditions, i.e., soluble in physiological fluids such as blood.
  • conjugated polypeptides of the invention include glycosylated and/or PEGylated polypeptides.
  • covalent attachment means that the polypeptide and the non- polypeptide moiety are either directly covalently joined to one another, or else are indirectly covalently joined to one another through an intervening moiety or moieties, such as a bridge, spacer, or linkage moiety or moieties.
  • non-conjugated polypeptide can be used to refer to the polypeptide part of the conjugate.
  • non-polypeptide moiety means a molecule that is capable of conjugating to an attachment group of the polypeptide of the invention. Suitable examples of such molecules include polymer molecules, sugar moieties, lipophilic compounds, or organic derivatizing agents.
  • the non-polypeptide moiety is linked to the polypeptide part of the conjugate through an attachment group of the polypeptide.
  • the non-polypeptide moiety can be directly covalently joined to the attachment group or it can be indirectly covalently joined to the attachment group through an intervening moiety or moieties, such as a bridge, spacer, or linkage moiety or moieties.
  • polymer molecule is a molecule formed by covalent linkage of two or more monomers, wherein none of the monomers is an amino acid residue, except where the polymer is human albumin or another abundant plasma protein.
  • polymer can be used interchangeably with the term “polymer molecule.”
  • the term is intended to encompass carbohydrate molecules attached by in vitro glycosylation, i.e., a synthetic glycosylation performed in vitro normally involving covalently linking a carbohydrate molecule to an attachment group of the polypeptide, optionally using a cross-linking agent.
  • a carbohydrate molecule attached by in vivo glycosylation, such as N- or O- glycosylation (as further described below) is referred to herein as a "sugar moiety.”
  • a non-polypeptide moiety contained in a conjugate or otherwise used in the present invention shall be a reference to one or more non-polypeptide moieties, such as polymer molecule(s) or sugar moieties.
  • attachment group is intended to indicate a functional group of the polypeptide, in particular of an amino acid residue thereof or a carbohydrate moiety, capable of attaching a non-polypeptide moiety such as a polymer molecule, a lipophilic molecule, a sugar moiety or an organic derivatizing agent.
  • attachment group is used in an unconventional way to indicate the amino acid residues constituting a N-glycosylation site (with the sequence N-X-S/T/C, wherein X is any amino acid residue except proline, N is asparagine and S/T/C is either serine, threonine or cysteine, preferably serine or threonine, and most preferably threonine).
  • N is asparagine
  • S/T/C is either serine, threonine or cysteine, preferably serine or threonine, and most preferably threonine.
  • amino acid residue comprising an attachment group for the non-polypeptide moiety as used in connection with alterations of the amino acid sequence of the polypeptide of interest is to be understood as meaning that one or more amino acid residues constituting an N-glycosylation site are to be altered in such a manner that either a functional N- glycosylation site is introduced into the amino acid sequence or removed from said sequence.
  • the term “treat” or “treatment” is meant to include both control and/or prevention of an expected or unexpected bleeding, such as in surgery, and regulation of an already occurring bleeding, such as in trauma or in on demand treatment for hemophilia patients, with the purpose of inhibiting or minimizing the bleeding.
  • Prophylactic administration of the chimeric or modified Factor Vila polypeptide according to the invention is thus included in the term "treatment.”
  • Bleeding episode is meant to include uncontrolled and/or excessive bleeding. Bleeding episodes may be a problem or complication both in connection with surgery and other forms of tissue damage. Uncontrolled and/or excessive bleeding may occur in subjects having a normal coagulation system and subjects having coagulation or bleeding disorders.
  • Half-life customarily means when 1 ⁇ 2 of the currently present material has been removed from circulation.
  • the amount of molecule in circulation is not of exclusive importance, rather, it is the activity present in the amounts localized in the extravascular space, bound to cell surfaces, bound to the basement membrane or present in the extravascular fluid.
  • the clearance process is complex and does not follow a typical profile of removal of a molecule in circulation by the kidneys or liver or other cellular uptake mechanisms. Protection from bleeding or other aspects of the FVII battery of functions is what is meant by half-life irrespective of the level or amount in circulation.
  • bleeding disorder includes any defect, congenital, acquired or induced, of cellular, physiological, or molecular origin that is manifested in bleeding or bleedings.
  • clotting factor deficiencies e.g., hemophilia A and B or deficiency of coagulation Factors XI or VII
  • clotting factor inhibitors e.g., defective platelet function, thrombocytopenia, von Willebrand's disease, or bleeding induced by surgery or trauma.
  • This term is also intended to encompass a situation where the patient has normal levels of a clotting factor protein, but this protein is not functional due, for example, to neutralization by circulating antibodies (e.g., Factor VIII inhibitor antibodies) or because the patient may have been administered an overdose of warfarin (which could cause the endogenous clotting factor to be synthesized in a non-functional form), or cases where the person has normal levels of FVII in the blood but it has a genetic mutation that renders it dysfunctional.
  • a person bleeds because of a deficiency in the function of some clotting factor in the blood but not necessarily a deficiency in the amount of the actual dysfunctional clotting factor.
  • Excessive bleeding also occurs in subjects with a normally functioning blood clotting cascade (no clotting factor deficiencies or inhibitors against any of the coagulation factors) and may be caused by a defective platelet function, thrombocytopenia or von Willebrand's disease.
  • the bleedings may be likened to those bleedings caused by hemophilia because the haemostatic system, as in hemophilia, lacks or has abnormal essential clotting "compounds" (such as platelets or von Willebrand factor protein), causing major bleedings.
  • the normal haemostatic mechanism may be overwhelmed by the demand of immediate hemostasis and they may develop bleeding in spite of a normal haemostatic mechanism.
  • Achieving satisfactory hemostasis also is a problem when bleedings occur in organs such as the brain, inner ear region and eyes, with limited possibility for surgical hemostasis.
  • organs such as the brain, inner ear region and eyes
  • the same problem may arise in the process of taking biopsies from various organs (liver, lung, tumor tissue, gastrointestinal tract) as well as in laparoscopic surgery. Common for all these situations is the difficulty to provide hemostasis by surgical techniques (sutures, clips, etc.), which also is the case when bleeding is diffuse (hemorrhagic gastritis and profuse uterine bleeding).
  • Acute and profuse bleedings may also occur in subjects on anticoagulant therapy in whom a defective hemostasis has been induced by the therapy given. Such subjects may need surgical interventions in case the anticoagulant effect has to be counteracted rapidly.
  • Radical retropubic prostatectomy is a commonly performed procedure for subjects with localized prostate cancer.
  • the operation is frequently complicated by significant and sometimes massive blood loss.
  • the considerable blood loss during prostatectomy is mainly related to the complicated anatomical situation, with various densely vascularized sites that are not easily accessible for surgical hemostasis, and which may result in diffuse bleeding from a large area.
  • intracerebral hemorrhage is the least treatable form of stroke and is associated with high mortality and hematoma growth in the first few hours following intracerebral hemorrhage. Treatment with rFVIIa can limit the growth of the hematoma, reduce mortality, and improve functional outcomes at 90 days.
  • chimeric Factor VII molecules of the present invention can overcome this problem in stroke therapy.
  • Another situation that may cause problems in the case of unsatisfactory hemostasis is when subjects with a normal haemostatic mechanism are given anticoagulant therapy to prevent thromboembolic disease.
  • anticoagulant therapy may include heparin, other forms of proteoglycans, warfarin or other forms of vitamin K- antagonists as well as aspirin and other platelet aggregation inhibitors.
  • the bleeding is associated with hemophilia. In another embodiment, the bleeding is associated with hemophilia with acquired inhibitors. In another embodiment, the bleeding is associated with thrombocytopenia. In another embodiment, the bleeding is associated with von Willebrand's disease. In another embodiment, the bleeding is associated with severe tissue damage. In another embodiment, the bleeding is associated with severe trauma. In another embodiment, the bleeding is associated with surgery. In another embodiment, the bleeding is associated with laparoscopic surgery. In another embodiment, the bleeding is associated with hemorrhagic gastritis. In another embodiment, the bleeding is profuse uterine bleeding. In another embodiment, the bleeding is occurring in organs with a limited possibility for mechanical hemostasis. In another embodiment, the bleeding is occurring in the brain, inner ear region or eyes. In another embodiment, the bleeding is associated with the process of taking biopsies. In another embodiment, the bleeding is associated with anticoagulant therapy.
  • subject as used herein is intended to mean any animal, in particular mammals, such as humans, and may, where appropriate, be used interchangeably with the term “patient.”
  • a subject "in need thereof is a subject for whom the administration of the chimeric FVII or FVIIa polypeptides and/or modified Factor VII or Factor Vila polypeptides and/or nucleic acid molecules encoding the chimeric FVII or FVIIa polypeptides and/or modified Factor VII or Factor Vila polypeptides of this invention is beneficial, i.e., imparts a beneficial or therapeutic effect.
  • Such a subject in need thereof can be a subject having a bleeding disorder, a subject suspected of having a bleeding disorder or a subject not having a bleeding disorder.
  • the term "enhancement of the normal haemostatic system” means an improvement of the ability to generate thrombin or to generate a functional clot.
  • prolonged protective hemostatic effect means an increase in the time a molecule remains in the body of a subject, even if not in the circulation, and remains functional in protecting against bleeding, including preventing new bleeds.
  • the term can also mean that a molecule that is functionally different in protecting against bleeding—including diminishing the number or extent of new bleeding episodes—can be administered in lower doses, the dosing regimen can be less frequent, there is an increased interval between doses and/or bleeding can be prevented for a longer period of time following cessation of pharmacological administration.
  • the term “functional lifetime” or “functional lifespan” means the length of time that a protein is functionally active in the body (i.e., in vivo), regardless of where the protein is located.
  • Examples of the functionality of the protein may include protease activity, the ability to protect against bleeds, prevent new bleeds, and/or bind to cell surfaces, and/or protease activity for a longer period than presently available FVIIa preparations.
  • the term "functional half-life” means the amount of time that is required for the loss of half of the function of the protein in vivo or in vitro.
  • the term "clearance rate” means the rate at which a coagulation protein active or otherwise, is removed from the body, including from the extravascular space or the rate at which the activity of a coagulation protein is lost from the body, including the extravascular space.
  • gene therapy refers to a method of changing the expression of an endogenous gene by exogenous administration of a gene.
  • gene therapy also refers to the replacement of a defective gene encoding a defective protein, or replacement of a missing gene, by introducing a functional gene corresponding to the defective or missing gene into somatic or stem cells of an individual in need.
  • Gene therapy can be accomplished by ex vivo methods, in which differentiated or somatic stem cells are removed from the individual's body followed by the introduction of a normal copy of the defective gene into the explanted cells using, e.g., a viral vector as the gene delivery vehicle.
  • gene therapy also refers to the replacement of a defective gene encoding a defective protein by introducing a polynucleotide that functions substantially the same as the defective gene or protein should function if it were not defective into somatic or stem cells of an individual in need.
  • gene therapy may be employed in the context of administering to a subject a nucleic acid molecule comprising a nucleotide sequence encoding a chimeric FVII of this invention.
  • the present invention can utilize an isolated nucleic acid molecule comprising a nucleotide sequence encoding a chimeric FVII protein of this invention.
  • a nucleic acid molecule can be present in a nucleic acid construct (e.g., a vector or plasmid).
  • a nucleic acid construct can be present in a cell.
  • a method of delivering a chimeric FVII protein of this invention to a cell comprising introducing into the cell a nucleic acid molecule comprising a nucleotide sequence encoding the chimeric FVII protein under conditions whereby the nucleotide sequence is expressed to produce the chimeric FVII protein in the cell.
  • the cell can be a cell that is introduced into a subject and/or the cell can be a cell already present in the subject.
  • the chimeric Factor VII polypeptides described herein may be produced by means of recombinant nucleic acid techniques.
  • a cloned wild-type Factor VII nucleic acid sequence is modified to encode the desired protein.
  • This modified sequence is then inserted into an expression vector, which is in turn transformed or transfected into host cells.
  • Higher eukaryotic cells in particular cultured mammalian cells, are suitable as host cells.
  • P08709-1) and the amino acid sequence of the precursor form is provided herein as SEQ ID NO: 18.
  • the bovine Factor VII sequence is described in Takeya et al., J. Biol. Chem. 263:14868-14872 (1988)).
  • the complete nucleotide and amino acid sequences for Factor IX are known (see Davie et al , Proc. Natl. Acad. Sci. U.S.A 1982; 79:6461-6464; Jaye et al, Nucleic Acids Res. 1983; 11 :2325-2335; and, McGraw et al., Proc. Natl. Acad. Sci. U.S.A.
  • SEQ ID NO.T9 amino acid sequence of the precursor form
  • SEQ ID NO.T9 amino acid sequence of Protein S
  • SEQ ID NO: 20 amino acid sequence of the precursor form is provided herein as SEQ ID NO: 20.
  • the complete nucleotide and amino acid sequences for other coagulation proteins are also known and can be viewed using SwissProt or at the NCBI web page.
  • the amino acid sequence alterations may be accomplished by a variety of techniques. Modification of the nucleic acid sequence may be by site-specific mutagenesis. Techniques for site-specific mutagenesis are well known in the art and are described in, for example, Zoller and Smith ⁇ DNA 3:479-488, 1984) or Horton et al. ("Splicing by extension overlap" Gene 77:61-68, 1989). Thus, using the nucleotide and amino acid sequences of Factor VII, one may introduce the alteration(s) of choice. Likewise, procedures for preparing a DNA construct using polymerase chain reaction using specific primers are well known to persons skilled in the art (see, PCR Protocols, 1990, Academic Press, San Diego, Calif., USA).
  • the chimeric Factor VII polypeptides useful in the methods of the present invention may be prepared by introducing unique restriction sites into the nucleotide sequences encoding the various polypeptides, which can be used to isolate fragments of nucleotide sequences that encode entire domains of various polypeptides.
  • the chimeric Factor VII polypeptides useful in the methods of the present invention may be made by constructing a complete nucleotide sequence to encode the entire chimeric polypeptide based on the known nucleotide sequences of the domains of various polypeptides. Such complete nucleotide sequences can be optimized for expression in a system of choice and are available from companies such as Blue Heron Biotechnology, Bothell, Washington. Subsequently, these various nucleotide sequences can be recombined to produce the various chimeric Factor VII polypeptides useful in the methods of the present invention.
  • unique restriction sites may be introduced into the nucleotide sequences encoding various coagulation proteins so that the GLA, EGF-1, EGF-2 and catalytic domains may be freely interchanged between the various coagulation proteins.
  • the EGF-1 domain can rotate freely around the EGF-2 domain, (Pike et al. Proc Natl. Acad. Sci. 1999; 96:8925-8930) whereas, the GLA and EGF-1 domains may not rotate freely around each other when calcium is present (Sunnerhagen et al. Nature Structural Biology 1995; 2:504-509).
  • the GLA and EGF- 1 domains may be from the same coagulation protein, but from a different protein than the EGF-2 and catalytic domains.
  • the chimeric Factor Vila polypeptides useful in the methods of the present invention may therefore, comprise domains from any of the coagulation proteins, provided at least 50% of one domain is a Factor VII domain.
  • the chimeric Factor Vila polypeptides of the present invention may include GLA and EGF-1 domains from the same protein, or from different proteins.
  • the nucleic acid construct encoding the chimeric Factor VII polypeptides useful in the methods of the invention may suitably be of genomic or cDNA origin, for instance obtained by preparing a genomic or cDNA library and screening for DNA sequences coding for all or part of the various polypeptides by hybridization using synthetic oligonucleotide probes in accordance with standard techniques (see, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd. Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989).
  • the nucleic acid construct encoding the chimeric Factor VII polypeptides may also be prepared synthetically by established standard methods, e.g. the phosphoamidite method described by Beaucage and Caruthers, Tetrahedron Letters 22 (1981), 1859-1869, or the method described by Matthes et al, EMBO Journal 3 (1984), 801-805.
  • phosphoamidite method oligonucleotides are synthesized, e.g. T in an automatic DNA synthesizer, purified, annealed, ligated and cloned in suitable vectors.
  • nucleic acid construct may be of mixed synthetic and genomic, mixed synthetic and cDNA or mixed genomic and cDNA origin prepared by ligating fragments of synthetic, genomic or cDNA origin (as appropriate), the fragments corresponding to various parts of the entire nucleic acid construct, in accordance with standard techniques.
  • DNA sequences for use in producing chimeric Factor VII polypeptides useful in the methods of the present invention will typically encode a pre-pro polypeptide at the amino -terminus of Factor VII to obtain proper posttranslational processing (e.g., gamma-carboxylation of glutamic acid residues) and secretion from the host cell.
  • the pre-pro polypeptide may be that of Factor VII or another vitamin K-dependent plasma protein, such as Factor IX, Factor X, prothrombin, protein C or protein S.
  • additional modifications can be made in the amino acid sequence of the chimeric Factor VII polypeptides where those modifications do not significantly impair the ability of the protein to act as a coagulant.
  • Expression vectors for use in expressing Factor Vila variants will comprise a promoter capable of directing the transcription of a cloned gene or cDNA.
  • Suitable promoters for use in cultured mammalian cells include viral promoters and cellular promoters.
  • Viral promoters include the SV40 promoter (Subramani et al., Mol Cell. Biol 1 :854-864, 1981) and the CMV promoter (Boshart et al., Cell 41 :521-530, 1985).
  • a particularly suitable viral promoter is the major late promoter from adenovirus 2 (Kaufman and Sharp, Mol. Cell. Biol. 2: 1304-1319, 1982).
  • Another particularly preferable promoter is the Chinese Hamster elongation factor- 1 -alpha (CHEF1) promoter.
  • Cellular promoters include the mouse kappa gene promoter (Bergman et al. Proc. Natl. Acad. Sci. USA 81 :7041-7045, 1983) and the mouse V H promoter (Loh et al. Cell 33:85-93, 1983).
  • a particularly suitable cellular promoter is the mouse metallothionein-I promoter (Palmiter et al. Science 222:809-814, 1983).
  • Expression vectors may also contain a set of RNA splice sites located downstream from the promoter and upstream from the insertion site for the chimeric Factor VII sequence itself.
  • RNA splice sites may be obtained from adenovirus and/or immunoglobulin genes.
  • a polyadenylation signal located downstream of the insertion site.
  • Particularly suitable polyadenylation signals include the early or late polyadenylation signal from SV40 (Kaufman and Sharp), the polyadenylation signal from the adenovirus 5 Elb region, the human growth hormone gene terminator (DeNoto et al. Nucl. Acids Res. 9:3719-3730, 1981) or the polyadenylation signal from the human Factor VII gene or the bovine Factor VII gene.
  • the expression vectors may also include a noncoding viral leader sequence, such as the adenovirus 2 tripartite leader, located between the promoter and the RNA splice sites; and enhancer sequences, such as the SV40 enhancer.
  • Cloned DNA sequences are introduced into cultured mammalian cells by, for example, calcium phosphate-mediated transfection (Wigler et al., Cell 14:725-732, 1978; Corsaro and Pearson, Somatic Cell Genetics 7:603-616, 1981; Graham and Van der Eb, Virology 52d:456-467, 1973) or electroporation (Neumann et al., EMBO J. 1 :841-845, 1982).
  • a gene that confers a selectable phenotype is generally introduced into cells along with the gene or cDNA of interest.
  • Suitable selectable markers include genes that confer resistance to drugs such as neomycin, hygromycin, and methotrexate,
  • the selectable marker may be an amplifiable selectable marker.
  • a suitable amplifiable selectable marker is a dihydrofolate reductase (DHFR) sequence.
  • Another suitable selectable marker is histidinol. Selectable markers are reviewed by Thilly (Mammalian Cell Technology, Butterworth Publishers, Stoneham, Mass., incorporated herein by reference). The person skilled in the art will easily be able to choose suitable selectable markers.
  • Selectable markers may be introduced into the cell on a separate plasmid at the same time as the gene of interest, or they may be introduced on the same plasmid. If on the same plasmid, the selectable marker and the gene of interest may be under the control of different promoters or the same promoter, the latter arrangement producing a dicistronic message. Constructs of this type are known in the art (for example, Levinson and Simonsen, U.S. Pat. No. 4,713,339). It may also be advantageous to add additional DNA, known as "carrier DNA,” to the mixture that is introduced into the cells,
  • the medium used to culture the cells may be any conventional medium suitable for growing the host cells, such as minimal or complex media containing appropriate supplements. Suitable media are available from commercial suppliers or may be prepared according to published recipes (e.g., in catalogues of the American Type Culture Collection). The media are prepared using procedures known in the art (see, e.g., references for bacteria and yeast; Bennett, J. W. and LaSure, L., editors, More Gene Manipulations in Fungi, Academic Press, CA, 1991). Growth media generally include a carbon source, a nitrogen source, essential amino acids, essential sugars, vitamins, salts, phospholipids, proteins and growth factors.
  • the medium will contain vitamin K, preferably at a concentration of about 0.05 ng/ml to about 100 ⁇ g/ml, which can vary dependent upon the uptake or sequestering of vitamin K by the cells.
  • Drug selection is then applied to select for the growth of cells that are expressing the selectable marker in a stable fashion.
  • the drug concentration may be increased to select for an increased copy number of the cloned sequences, thereby increasing expression levels. Clones of stably transfected cells are then screened for expression of the desired chimeric Factor VII polypeptide.
  • Suitable mammalian cell lines include the CHO (ATCC CCL 61), COS-1 (ATCC CRL 1650), baby hamster kidney (BHK) and 293 (ATCC CRL 1573; Graham et al., J. Gen. Virol. 36:59-72, 1977) cell lines or derivative cell lines thereof.
  • a suitable BHK cell line is the tk.sup.-tsl3 BHK cell line (Waechter and Baserga, Proc. Natl. Acad. Sci. USA 79: 1106-1110, 1982), hereinafter referred to as BHK 570 cells.
  • the BHK 570 cell line is available from the American Type Culture Collection, 12301 Parklawn Dr., Manassas, Va.
  • a tk "ts13 BHK cell line is also available from the ATCC under accession number CRL 1632.
  • a number of other cell lines may be used, including Rat Hep I (Rat hepatoma; ATCC CRL 1600), Rat Hep II (Rat hepatoma; ATCC CRL 1548), TCMK (ATCC CCL 139), Human lung (ATCC HB 8065), NCTC 1469 (ATCC CCL 9.1) and DUKX cells (Urlaub and Chasin, Proc. Natl. Acad. Sci. USA 77:4216-4220, 1980).
  • the chimeric Factor VII polypeptides useful in the methods of the invention may be conjugated to prolong the half-life of the polypeptide in vivo. Such conjugation may decrease renal clearance and increase the amount of Factor VII present in vivo, while decreasing the frequency of administration of the chimeric Factor VII polypeptides.
  • Suitable conjugates and methods of preparing conjugated Factor VII polypeptides are described in U.S. Pat. No. 7,442,524, which is hereby incorporated by reference in its entirety.
  • Transgenic animal technology may be employed to produce the chimeric Factor VII polypeptides useful in the methods of the invention. It is preferred to produce the proteins within the mammary glands of a host female mammal. Expression in the mammary gland and subsequent secretion of the protein of interest into the milk overcomes many difficulties encountered in isolating proteins from other sources. Milk is readily collected, available in large quantities, and biochemically well characterized. Furthermore, the major milk proteins are present in milk at high concentrations (typically from about 1 to 15 g/1).
  • the chimeric Factor VII polypeptides useful in the methods of the present invention may also be produced in the urine of a host animal, which has the advantage over production in milk in that both male and female animals produce urine and that there are less proteins in urine than in milk for isolation purposes.
  • Milk protein genes include those genes encoding caseins (see U.S. Pat. No. 5,304,489), beta-lactoglobulin, a-lactalbumin, and whey acidic protein.
  • the beta-lactoglobulin (BLG) promoter is suitable.
  • a region of at least the proximal 406 bp of 5' flanking sequence of the gene will generally be used, although larger portions of the 5' flanking sequence, up to about 5 kbp, are suitable, such as about 4.25 kbp DNA segment encompassing the 5' flanking promoter and non-coding portion of the beta- lactoglobulin gene (see Whitelaw et al., Biochem. J. 286: 31-39 (1992)). Similar fragments of promoter DNA from other species are also suitable.
  • a urothelium-specific promoter is used.
  • a promoter that drives expression of uroplakin-related genes can be used. (See, e.g., U.S. Patent No. 6,001,646, which is incorporated by reference herein in its entirety).
  • beta-lactoglobulin gene may also be incorporated in constructs, as may genomic regions of the gene to be expressed. It is generally accepted in the art that constructs lacking introns, for example, express poorly in comparison with those that contain such DNA sequences (see Brinster et al., Proc. Natl. Acad Sci. USA 85: 836-840 (1988); Palmiter et al., Proc. Natl. Acad. Sci USA 88: 478-482 (1991); Whitelaw et al., Transgenic Res. 1 : 3-13 (1991); PCT Publication No. WO 89/01343; and PCT Publication No. WO 91/02318, each of which is incorporated herein by reference).
  • genomic sequences containing all or some of the native introns of a gene encoding the protein or polypeptide of interest thus the further inclusion of at least some introns from, e.g., the beta-lactoglobulin gene, is preferred.
  • One such region is a DNA segment that provides for intron splicing and RNA polyadenylation from the 3' non-coding region of the ovine beta-lactoglobulin gene. When substituted for the natural 3' non-coding sequences of a gene, this ovine beta-lactoglobulin segment can both enhance and stabilize expression levels of the protein or polypeptide of interest.
  • the region surrounding the initiation ATG of the chimeric Factor VII sequence is replaced with corresponding sequences from a milk specific protein gene.
  • Such replacement provides a putative tissue-specific initiation environment to enhance expression. It is convenient to replace the entire chimeric Factor VII pre-pro and 5' non-coding sequences with those of, for example, the BLG gene, although smaller regions may be replaced.
  • a DNA segment encoding chimeric Factor Vila is operably linked to additional DNA segments required for its expression to produce expression units.
  • additional segments include the above-mentioned promoter, as well as sequences that provide for termination of transcription and polyadenylation of mRNA.
  • the expression units will further include a DNA segment encoding a secretory signal sequence operably linked to the segment encoding the chimeric Factor Vila.
  • the secretory signal sequence may be a native Factor VII secretory signal sequence or may be that of another protein, such as a milk protein (see, for example, von Heijne, Nucl. Acids Res. 14: 4683-4690 (1986); and Meade et al, U.S. Pat. No. 4,873,316, which are incorporated herein by reference).
  • Construction of expression units for use in transgenic animals is conveniently carried out by inserting a chimeric Factor VII sequence into a plasmid or phage vector containing the additional DNA segments, although the expression unit may be constructed by essentially any sequence of ligations. It is particularly convenient to provide a vector containing a DNA segment encoding a milk protein and to replace the coding sequence for the milk protein with that of a chimeric Factor VII polypeptide; thereby creating a gene fusion that includes the expression control sequences of the milk protein gene. In any event, cloning of the expression units in plasmids or other vectors facilitates the amplification of the chimeric Factor VII sequence. Amplification is conveniently carried out in bacterial (e.g. , E.
  • the vectors will typically include an origin of replication and a selectable marker functional in bacterial host cells.
  • the expression unit is then introduced into fertilized eggs (including early-stage embryos) of the chosen host species.
  • Introduction of heterologous DNA can be accomplished by one of several routes, including microinjection ⁇ e.g. , U.S. Pat. No. 4,873,191), retroviral infection (Jaenisch, Science 240: 1468-1474 (1988)) or site-directed integration using embryonic stem (ES) cells (reviewed by Bradley et al., Bio/Technology 10: 534-539 (1992)).
  • the eggs are then implanted into the oviducts or uteri of pseudopregnant females and allowed to develop to term.
  • Production in transgenic plants may also be employed.
  • Expression may be generalized or directed to a particular organ, such as a tuber (see, Hiatt, Nature 344:469-479 (1990); Edelbaum et al., J Interferon Res. 12:449-453 (1992); Sijmons et al., Bio/Technology 8:217-221 (1990); and EP 0 255 378).
  • Production of the chimeric Factor VII polypeptides useful in the methods of the present invention may also be achieved through in vitro translation, such as for example by rabbit reticulocyte lysate, wheat germ extract and E. coli cell free systems.
  • the in vitro translation may also be linked or coupled.
  • Linked in vitro translation is based on transcription with a bacteriophage polymerase followed by translation in the rabbit reticulocyte lysate or wheat germ lysate systems. Coupled in vitro translation is based upon the E. coli cell free system.
  • the chimeric Factor VII polypeptides useful in the methods of the invention are recovered from cell culture medium or the milk, urine and/or plasma of a transgenic animal.
  • the chimeric Factor VII polypeptides useful in the methods of the present invention may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, pseudo- affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g. , preparative isoelectric focusing (IEF), differential solubility (e.g., ammonium sulfate precipitation), or extraction (see, e.g., Protein Purification, J.-C.
  • chromatography e.g., ion exchange, affinity, pseudo- affinity, hydrophobic, chromatofocusing, and size exclusion
  • electrophoretic procedures e.g. , preparative isoelectric focusing (IEF), differential solubility (e.g., ammonium sul
  • Additional purification may be achieved by conventional chemical purification means, such as high performance liquid chromatography.
  • Other methods of purification including precipitation by barium salts, are known in the art, and may be applied to the purification of the chimeric Factor VII polypeptides described herein (see, for example, Scopes, R., Protein Purification, Springer- Verlag, N.Y., 1982).
  • the chimeric Factor VII polypeptides of the invention are substantially pure.
  • the Factor VII variants of the invention are purified to at least about 90 to 95% purity, preferably to at least about 98% purity. Purity may be assessed by e.g., gel electrophoresis, amino-terminal amino acid sequencing and reverse-phase HPLC.
  • the chimeric Factor VII polypeptide is cleaved at its activation site in order to convert it to its two-chain form. Activation may be carried out according to procedures known in the art, such as those disclosed by Osterud, et al., Biochemistry 1 1 :2853-2857 (1972); Thomas, U.S. Pat. No. 4,456,591 ; Hedner and Kisiel, J. Clin, Invest. 71 :1836-1841 (1983); or Kisiel and Fujikawa, Behring Inst. Mitt. 73:29-42 (1983).
  • the chimeric Factor VII polypeptide may be activated by concentrating the chimeric Factor VII polypeptide and contacting a positively charged surface or resin, for example, as described by Bjoern et al. (Research Disclosure, 269 September 1986, pp. 564-565), Factor VII may be activated by passing it through an ion-exchange chromatography column, such as Mono Q® (Pharmacia fine Chemicals) or the like.
  • the chimeric Factor VII polypeptide may also be activated in solution by obtaining a solution comprising a substantially purified preparation of the chimeric Factor VII polypeptide; adding to the solution an amine compound, Ca to a final concentration of about 5mM to about 50mM (such as about lOmM to about 30mM), and adjusting the final pH of the solution to about 7.2 to 8.6 (such as about 7.6 to about 8.2); incubating the resulting activation mixture at between about 2°C and about 25°C for an amount of time sufficient to convert at least 90% of the chimeric FVII polypeptide to chimeric FVIIa polypeptide; and, optionally, isolating the FVIIa from the activation mixture.
  • the chimeric Factor VII polypeptide may also be activated by increasing the concentration of Factor VII in solution so that the Factor VII autoactivates. This typically occurs at concentrations greater than 5 mg/ml. Alternatively it can be activated in the cell while being synthesized. The resulting activated chimeric Factor VII polypeptide may then be formulated and administered as described below. Alternatively, the Factor VII polypeptide can be administered in the inactive form by gene therapy vectors and become activated intracellulary. Such intracellular activation may be accomplished by including an RKRRKR cleavage motif at the activation site, as disclosed in (Margaritis et al. J Clin.
  • the material can be activated by any known method including poly amines, polycations, high concentrations of the molecule, concentrations on a cell or tissue surface, or through gene therapy.
  • the chimeric Factor VII polypeptides useful in the methods of the invention may also be used in methods of treating bleeding disorders by way of gene therapy.
  • the chimeric Factor VII polypeptides useful in the methods of the invention are encoded by nucleic acid molecules that may be introduced into cells of the subject by ex vivo transfer or by in vivo transfer.
  • Vectors suitable for gene therapy include viruses, such as adenoviruses, adeno-associated virus (AAV), vaccinia, herpesviruses, baculoviruses and retroviruses, parvovirus, lenti virus, bacteriophages, cosmids, plasmids, fungal vectors and other recombination vehicles typically used in the art which have been described for expression in a variety of eukaryotic and prokaryotic hosts, and may be used for gene therapy as well as for simple protein expression.
  • viruses such as adenoviruses, adeno-associated virus (AAV), vaccinia, herpesviruses, baculoviruses and retroviruses, parvovirus, lenti virus, bacteriophages, cosmids, plasmids, fungal vectors and other recombination vehicles typically used in the art which have been described for expression in a variety of eukaryotic and prokaryotic hosts, and may be
  • the vector is a viral vector.
  • Viral vectors, especially adenoviral vectors can be complexed with a cationic amphiphile, such as a cationic lipid, polyL-lysine (PLL), and diethylaminoethyldextran (DELAE-dextran), which provide increased efficiency of viral infection of target cells (See, e.g., PCT Publication No. PCT/US97/21496 filed Nov. 20, 1997, incorporated herein by reference).
  • Suitable viral vectors for use in the present invention include vectors derived from vaccinia, herpesvirus, AAV and retroviruses.
  • a vector is used in which the coding sequences and any other desired sequences are flanked by regions that promote homologous recombination at a desired site in the genome, thus providing for expression of the construct from a nucleic acid molecule that has integrated into the genome (Koller and Smithies, Proc. Natl. Acad. Sci. USA 1989, 86:8932-8935; Zijlstra et al., Nature 1989, 342:435-438; U.S. Pat. No. 6,244,113 to Zarling et al.; and U.S. Pat. No. 6,200,812 to Pati et al., each of which is incorporated herein in its entirety by reference).
  • Delivery of the vector into a patient may be either direct, in which case the patient is directly exposed to the vector or a delivery complex, or indirect, in which case, cells are first transformed with the vector in vitro, and then transplanted into the patient. These two approaches are Icnown, respectively, as in vivo and ex vivo gene therapy.
  • the vector is directly administered in vivo, where it enters the cells of the subject and mediates expression of the gene.
  • This can be accomplished by any of numerous methods Icnown in the art and discussed above, e.g. , by constructing it as part of an appropriate expression vector and administering it so that it becomes intracellular, e.g., by infection using a defective or attenuated retroviral or other viral vector (see, U.S. Pat. No.
  • a nucleic acid-ligand complex can be formed in which the ligand comprises a fusogenic viral peptide to disrupt endosomes, allowing the nucleic acid to avoid lysosomal degradation, or cationic 12-mer peptides, e.g., derived from antennapedia, that can be used to transfer therapeutic DNA into cells (Mi et al., Mol. Therapy 2000 2:339-47).
  • the nucleic acid can be targeted in vivo for cell specific uptake and expression, by targeting a specific receptor (see, e.g., PCT Publication Nos. WO 92/06180, WO 92/22635, WO 92/20316 and WO 93/14188).
  • magnetofection may be used to deliver vectors to mammals. This technique associates the vectors with superparamagnetic nanoparticles for delivery under the influence of magnetic fields. This application reduces the delivery time and enhances vector efficacy (Scherer et al., Gene Therapy 2002 9: 102-9).
  • the nucleic acid can be administered using a lipid carrier.
  • Lipid carriers can be associated with naked nucleic acids (e.g., plasmid DNA) to facilitate passage through cellular membranes.
  • Cationic, anionic, or neutral lipids can be used for this purpose.
  • cationic lipids are suitable because they have been shown to associate better with DNA which, generally, has a negative charge.
  • Cationic lipids have also been shown to mediate intracellular delivery of plasmid DNA (Feigner and Ringold, Nature 1989; 337:387). Intravenous injection of cationic lipid- plasmid complexes into mice has been shown to result in expression of the DNA in lung (Brigham et al., Am. J. Med.
  • cationic lipids include those disclosed, for example, in U.S. Pat. No. 5,283,185; and e.g., U.S. Pat. No. 5,767,099, the disclosures of which are incorporated herein by reference.
  • the cationic lipid is N 4 - spermine cholesteryl carbamate (GL-67) disclosed in U.S. Pat. No. 5,767,099.
  • Additional suitable lipids include N 4 -spermidine cholestryl carbamate (GL-53) and 1- (N 4 -spermine)-2,3-dilaurylglycerol carbamate (GL-89).
  • an appropriate immunosuppressive treatment can be employed in conjunction with the viral vector, e.g., adenovirus vector, to avoid immuno-deactivation of the viral vector and transfected cells.
  • the viral vector e.g., adenovirus vector
  • immunosuppressive cytokines such as interleukin-12 (IL-12), interferon- gamma (IFN-gamma), or anti-CD4 antibody
  • IL-12 interleukin-12
  • IFN-gamma interferon- gamma
  • anti-CD4 antibody can be administered to block humoral or cellular immune responses to the viral vectors.
  • IL-12 interleukin-12
  • IFN-gamma interferon- gamma
  • anti-CD4 antibody can be administered to block humoral or cellular immune responses to the viral vectors.
  • Somatic cells may be engineered ex vivo with a construct encoding a chimeric Factor VII polypeptide of the invention using any of the methods described above, and re-implanted into an individual. This method is described generally in PCT Publication No. WO 93/09222 to Selden et al. In addition, this technology is used in Cell Based Delivery's proprietary ImPACT technology, described in Payumo et al., Clin. Orthopaed. and Related Res. 2002; 403S: S228-S242.
  • somatic cells e.g., fibroblasts, hepatocytes, or endothelial cells
  • primary cells derived from an individual or tissue and engineered prior to passaging
  • secondary cells passedaged in vitro prior to introduction in vivo
  • immortalized cell lines known in the art.
  • Somatic cells useful for the methods of the present invention include but are not limited to somatic cells, such as fibroblasts, keratinocytes, epithelial cells, endothelial cells, hepatocytes, formed elements of the blood, muscle cells, other somatic cells that can be cultured, and somatic cell precursors.
  • the cells are hepatocytes.
  • Constructs that include the polynucleotide encoding the chimeric FVIIa polypeptides useful in the methods of the invention and, optionally, nucleic acids encoding a selectable marker, along with additional sequences necessary for expression of the chimeric FVIIa in recipient primary or secondary cells, are used to transfect primary or secondary cells in which the encoded product is to be produced.
  • Such constructs include but are not limited to infectious vectors, such as retroviral, herpes, adenovirus, adeno-associated virus, mumps and poliovirus vectors, can be used for this purpose.
  • Transdermal delivery is especially suited for indirect transfer using cell types of the epidermis including keratinocytes, melanocytes, and dendritic cells (Pfutzner et al., Expert Opin. Investig. Drugs 2000; 9:2069-83).
  • the vector for gene therapy is a single-stranded self complementary adeno-associated virus.
  • this self complementary adeno-associated virus may contain the small transhyretin promoter-enhancer, introns from the mouse minute virus and the polyadenylation signal from bovine growth hormone.
  • the vector may also contain the RKRRKR sequence described by Margaritis et al. that causes the Factor VII to be secreted in the active form, i.e. , Factor Vila. (Margaritis et al., J. Clin. Invest., 2004; 113: 1025-31).
  • the chimeric Factor VII polypeptides useful in the methods of the present invention may be used to control bleeding disorders which have several causes such as clotting factor deficiencies ⁇ e.g., hemophilia A and B or deficiency of coagulation factors XI or VII) or clotting factor inhibitors, or they may be used to control excessive bleeding occurring in subjects with a normally functioning blood clotting cascade (no clotting factor deficiencies or inhibitors against any of the coagulation factors).
  • the bleedings may be caused by a defective platelet function, thrombocytopenia or von Willebrand's disease. They may also be seen in subjects in whom an increased fibrinolytic activity has been induced by various stimuli.
  • the haemostatic mechanism may be overwhelmed by the demand of immediate hemostasis and they may develop bleedings in spite of a normal haemostatic mechanism. Achieving satisfactory hemostasis is also a problem when bleedings occur in organs such as the brain, inner ear region and eyes and may also be a problem in cases of diffuse bleedings (hemorrhagic gastritis and profuse uterine bleeding) when it is difficult to identify the source. The same problem may arise in the process of taking biopsies from various organs (liver, lung, tumor tissue, gastrointestinal tract) as well as in laparoscopic surgery. These situations share the difficulty of providing hemostasis by surgical techniques (sutures, clips, etc.).
  • Acute and profuse bleedings may also occur in subjects on anticoagulant therapy in whom a defective hemostasis has been induced by the therapy given. Such subjects may need surgical interventions in case the anticoagulant effect has to be counteracted rapidly. Another situation that may cause problems in the case of unsatisfactory hemostasis is when subjects with a normal haemostatic mechanism are given anticoagulant therapy to prevent thromboembolic disease.
  • anticoagulant therapy may include heparin, other forms of proteoglycans, warfarin or other forms of vitamin K-antagonists as well as aspirin and other platelet aggregation inhibitors.
  • VII polypeptides useful in the methods of the invention will typically be administered up to about 3 days or within about 24 hours prior to performing the intervention, and for periods of about 3, 7, or 14 days or more thereafter.
  • Administration as a coagulant can be by a variety of routes as described herein.
  • the dose of the chimeric Factor VII or Factor Vila polypeptides ranges from about 0.05 mg/day to about 500 mg/day, preferably from about 1 mg/day to about 200 mg/day, and more preferably from about 10 mg/day to about 175 mg/day for a 70 kg subject as loading and maintenance doses, depending on the weight of the subject and the severity of the condition. Alternatively this could be calculated as 90 ⁇ g/kilogram to 270 ⁇ g/kilogram of the patient.
  • a dosage range for the administration to a subject of a nucleic acid molecule comprising a nucleotide sequence encoding a chimeric Factor Vila polypeptide, chimeric Factor VII polypeptide, modified Factor Vila polypeptide or modified Factor VII polypeptide in the form of a viral vector can be, for example, from about 5 X 10 12 viral genomes per kg to about 5 X 10 15 viral genomes per kg.
  • One of skill in the art would be able to determine the optimal dose for a given subject and a given condition.
  • the pharmaceutical compositions are primarily intended for parenteral administration for prophylactic and/or therapeutic treatment.
  • the pharmaceutical compositions are administered parenterally, i.e., intravenously, subcutaneously, or intramuscularly, or it may be administered by continuous or pulsatile infusion.
  • the pharmaceutical compositions may be formulated for administration in various ways, including, but not limited to, orally, subcutaneously, intravenously, intracerebrally, intranasally, transdermally, intraperitoneally, intramuscularly, intrapulmonary, vaginally, rectally, intraocularly, or in any other acceptable manner.
  • compositions for parenteral administration comprise the chimeric Factor VII polypeptide useful in the methods of the invention in combination with, preferably dissolved in, a pharmaceutically acceptable carrier, preferably an aqueous carrier.
  • a pharmaceutically acceptable carrier preferably an aqueous carrier.
  • aqueous carriers such as water, buffered water, 0.4% saline, 0.3% glycine and the like.
  • the chimeric Factor VII polypeptides useful in the methods of the invention may also be formulated with compositions that prolong stability and storage, such as methionine and sucrose.
  • the chimeric Factor VII polypeptides useful in the methods of the invention can also be formulated into liposome preparations for delivery or targeting to the sites of injury. Liposome preparations are generally described in, e.g., U.S.
  • compositions may be sterilized by conventional, well-known sterilization techniques.
  • the resulting aqueous solutions may be packaged for use or filtered under aseptic conditions and lyophilized, the lyophilized preparation being combined with a sterile aqueous solution prior to administration.
  • the compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents and the like, for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, etc.
  • the compositions may also contain preservatives, isotonifiers, non-ionic surfactants or detergents, antioxidants and/or other miscellaneous additives.
  • chimeric Factor VII polypeptide concentration in these formulations can vary widely, i.e., from less than about 0.5% by weight, usually at or at least about 1% by weight to as much as about 15 or 20% by weight and will be selected primarily by fluid volumes, viscosities, etc., in accordance with the particular mode of administration selected.
  • a typical pharmaceutical composition for intravenous infusion could be made up to contain 250 ml of sterile Ringer's solution and 10 mg of the chimeric Factor VII polypeptide.
  • Actual methods for preparing parenterally administrable compositions will be known or apparent to those skilled in the art and are described in more detail in, for example, Remington's Pharmaceutical Sciences, 18th ed., Mack Publishing Company, Easton, Pa. (1990).
  • compositions containing the chimeric Factor VII polypeptides useful in the methods of the present invention can be administered for prophylactic and/or therapeutic treatments.
  • compositions are administered to a subject in need of the methods of this invention, as described above, in an amount sufficient to cure, alleviate or partially arrest the disorder and its complications.
  • An amount adequate to accomplish this is defined as a "therapeutically effective amount” or “effective amount.”
  • amounts effective for this purpose will depend on the severity of the disease or injury as well as the weight and general state of the subject.
  • the effective amount will range from about 0.05 mg up to about 500 mg of the chimeric Factor VII polypeptide per day for a 70 kg subject, with dosages of from about 1.0 mg to about 200 mg of the chimeric Factor VII polypeptide per day being more commonly used.
  • the materials of the present invention may generally be employed in serious disease or injury states, that is, life threatening or potentially life threatening situations. In such cases, in view of the minimization of extraneous substances and general lack of immunogenicity of human Factor VII in humans, it is possible and may be felt desirable by the treating physician to administer a substantial excess of these chimeric Factor VII polypeptide compositions.
  • compositions containing the chimeric Factor VII polypeptide useful in the methods of the invention are administered to a subject susceptible to or otherwise at risk of a disease state or injury to enhance the subject's own coagulative capability.
  • a subject susceptible to or otherwise at risk of a disease state or injury to enhance the subject's own coagulative capability.
  • Such an amount is defined to be a "prophylactically effective dose.”
  • the precise amounts once again depend on the subject's state of health and weight, but the dose generally ranges from about 0.05 mg to about 500 mg per day for a 70-kilogram subject, more commonly from about 1.0 mg to about 200 mg per day for a 70-kilogram subject.
  • compositions can be carried out with dose levels and patterns being selected by the treating physician.
  • the chimeric Factor VII polypeptides may be administered by continuous infusion using e.g., a portable pump system.
  • the chimeric Factor VII polypeptides useful in the methods of the present invention may also be formulated in sustained, or extended release formulations.
  • sustained, or extended release compositions include, but are not limited to, semi-permeable matrices of solid hydrophobic particles containing the polypeptide.
  • Local delivery of the chimeric Factor Vila polypeptides useful in the methods of the present invention, such as, for example, topical application may be carried out, for example, by means of a spray, perfusion, double balloon catheters, stent, incorporated into vascular grafts or stents, hydrogels used to coat balloon catheters, or other well established methods.
  • the pharmaceutical compositions should provide a quantity of Factor VII variant sufficient to effectively treat the subject.
  • Sacl site is at the junction of the EGF-1 and EGF-2 domains (residues 82-83 of Factor VII; residues 83-84 of Factor IX);
  • Notl site is at the 3' end of the EGF-2 domain (residues 135-137 of Factor VII; residues 132-134 of Factor IX.
  • the amino acid sequence of the resulting chimeras are set forth in SEQ ID NO: l (Factor IX signal, propeptide, GLA and EGFl domains, with Factor VII EGF2 and catalytic domains) and SEQ ID NO:2 (Factor IX signal and propeptide domains, Protein S GLA domain, Factor IX EGFl domain, with Factor VII EGF2 and catalytic domains).
  • SEQ ID NO: l Vector IX signal, propeptide, GLA and EGFl domains, with Factor VII EGF2 and catalytic domains
  • SEQ ID NO:2 Vector IX signal and propeptide domains, Protein S GLA domain, Factor IX EGFl domain, with Factor VII EGF2 and catalytic domains.
  • the thrombin generation of Factor Vila was determined using an in vitro model of hemophilia. Monocytes were used as a source of tissue factor and combined with unactivated platelets and synthetic plasma containing plasma concentrations of Factors V, VII, IX, VIII, and XI, and plasma concentrations of antithrombin and TFPI. Hemophilic conditions were created by omitting factors VIII and IX.
  • Monocytes were prepared by drawing 4ml of blood from a healthy individual and placing in a sodium citrate tube. The blood was carefully layered on top of 3ml of Accu-PrepTM Lymphocyte separation medium (Accurate Chemicals, NY, USA) in a 15ml conical tube and centrifuged at 1500 rpm for 30 minutes. The mononuclear layer was then removed and added to an equal volume of Versene (Lineberger Tissue Culture) at 4°C and centrifuged at 800 rpm for 10 minutes. The resulting pellet was resuspended in 5ml of Versene at 4°C and centrifuged at 800 rpm for 10 minutes.
  • Versene Lineberger Tissue Culture
  • the resulting pellet was resuspended in 4ml of macrophage SFM media (Life Technologies, CA, USA), supplemented with 500ng/ml of lipopolysaccharide (LPS) (Sigma-Aldrich, MO, USA) and cells were plated at 200 ⁇ 1 ⁇ 11 of a 96-well plate. The plate was incubated at 37°C, 5% C0 2 for two hours and then washed three times with macrophage SFM media and then incubated overnight.
  • LPS lipopolysaccharide
  • Platelets were prepared by drawing 4ml of blood from a healthy individual and placing in a sodium citrate tube. The blood was carefully layered on top of 5ml of Accu-PrepTM Lymphocyte separation medium (Accurate Chemicals, NY, USA) in a 15ml conical tube and centrifuged at 1500 rpm for 30 minutes. The platelet layer was then removed and added to an equal volume of citrate-glucose-saline with 10 ⁇ g/ml of prostaglandin Ei (PGE1) (Sigma-Aldrich, MO, USA) and centrifuged at 800 rpm for 10 minutes. The resulting pellet was discarded and the platelets were isolated from plasma proteins by Sepharose gel filtration in calcium free Tyrodes buffer supplemented with lmg/ml ovalbumin, The recovered platelets were stored at 37°C.
  • Accu-PrepTM Lymphocyte separation medium Accept Chemicals, NY, USA
  • PGE1 prostaglandin Ei
  • Synthetic plasma for the in vitro assay that mimics hemophilia was generated by using Factor XI C-l -esterase inhibitor at a concentration of 5 ⁇ g/ml with the addition after 1 hour incubation with the previously prepared monocytes of 200 ⁇ g/ml antithrombin, 0.07 ⁇ g/ml of TFPI, lOOmg/ml of prothrombin, 8 ⁇ g/ml of Factor X and 0.5 ⁇ g/ml of Factor VII. Following an overnight incubation, Factor V was added at a concentration of 7 ⁇ g/ml. For normal conditions, Factor IX was added after the 1 hour incubation at a concentration of 4 ⁇ g ml and following the overnight incubation, Factor VIII was added at lU/ml.
  • thrombin assay buffer containing ImM EDTA and 0.5mM Gly-Pro-Arg-pNA (Centerchem Inc., CT, USA). 100 ⁇ of 50% acetic acid was added to stop synthetic substrate cleavage and the OD was measured at 405nm. Thrombin concentration was determined using the following formula:
  • [thrombin] dilution x ((A405-background)/(stop-start))/(conversion factor) wherein the conversion factor is InM thrombin gives a rate of 0.0117 OD/min at 405nm.
  • Thrombin generation in normal conditions shows peak thrombin production with a short lag phase (FIG. 2).
  • Increasing concentrations of wild-type Factor Vila improved thrombin production in the hemophilic condition. (FIG. 2).
  • Example II The thrombin generation of the chimeric proteins produced in Example I was determined using an in vitro model of hemophilia described in Example II.
  • the clotting activity of the chimeric Factor Vila polypeptides was assessed in vivo, in a clotting assay, as described by Buyue, Y., et al. 2008 Blood 112:3234-3241. Briefly, Factor VII was administered to a hemophilia B mouse (2 mg/kg of NovoSeven®, 2 mg/kg of a chimeric Factor Vila containing the GLA and EGF-1 domains of Factor IX and the EGF-2 and catalytic domains of Factor Vila, or 1.4 mg/kg of a chimeric Factor Vila containing the GLA domain of Protein S, the EGF-1 domain of Factor IX and the EGF-2 and catalytic domains of Factor Vila), through a catheter inserted into a vein in the leg.
  • mice were anesthetized and the saphenous vein of the other leg was transected by pushing a small gauge needle through it. The distal portion is then cut by inserting the tip of a pair of scissors into the vein and snipping to create a small cup. A clot is formed and the time until bleeding stops was recorded. The clot was then removed using a 30 gauge needle and the time until bleeding stops was again recorded. This process was repeated for 30 minutes. The number of clots was recorded as the number of disruptions. The times recorded were averaged and recorded as an average time.
  • the experiment was conducted on one mouse for the wild-type mouse and the chimeric FactorVlIa containing the GLA domain of Protein S, the EGF-1 domain of Factor IX and the EGF-2 and catalytic domains of Factor Vila.
  • the experiment was conducted on two hemophilia B mice with the same results.
  • the hemophilia B mouse that was not administered any Factor VII, the 0.25 disruptions recorded in Table 1 below indicate that only one out of four mice did not bleed out with the initial injury.
  • the experiment was repeated with one hemophilia B mouse with no treatment, one hemophilia B mouse administered 2mg/kg of NovoSeven®, one hemophilia B mouse administered 2mg/kg of a chimeric Factor Vila containing the GLA and EGF- 1 domains of Factor IX and the EGF-2 and catalytic domains of Factor Vila and one wild-type mouse with no treatment.
  • the hemophilia B mouse administered the 2mg/kg of chimeric Factor Vila containing the GLA and EGF- 1 domains of Factor IX and the EGF-2 and catalytic domains of Factor Vila had a shorter average time to cessation of bleeding than the hemophilia B mouse administered 2mg/kg of NovoSeven® and the wild-type mouse. (FIG. 5).
  • Thrombogenicity of the chimeric Factor Vila polypeptides of the invention can be tested in a mouse model that expresses high levels of these proteins. Recently, it has been shown that 50% of mice expressing greater than 2 ⁇ g/ml recombinant wild type mouse factor Vila died from thromboses within 16 months. When backcrossing into the C57BL/6J mouse strain to generate Hemophilia B mice expressing similar levels of factor Vila , these mice had the same mortality rates and thromboses occurred much earlier ( ⁇ 4 months). (Aljamali MN, et al. J Clin Invest.
  • a hemophilia B mouse (strain C57BL/6J) expressing 2-10 ⁇ g or more of the chimeric FVIIa polypeptides has been produced. If expression of the chimeric Factor Vila polypeptides would have caused thromboses in these mice similar to that observed in mice expressing wild type FVIIa, then it would have been expected that these chimeric expressing mice would have died from thrombosis early on ( ⁇ 4 months). However the chimeric FVIIa-expressing mice have remained healthy throughout the observation period of ⁇ 6 months, and show no bleeding events..
  • the mouse strain can be developed by using a new self complementary adeno associated vector (AAV) developed by Dr. Paul Monahan of the Gene Therapy Center at UNC. (Wu Z, et al. Mol Ther. 2008;16:280-289).
  • AAV self complementary adeno associated vector
  • This vector contains the small transhyretin promoter-enhancer (TTR promoter), introns from the minute virus of mouse, the MVM and the bovine growth hormone pA signal. It has been shown that injection of 1 x 10 11 vector genomes, based on this vector, into the portal vein resulted in sustained expression of Factor IX of 7 ⁇ g per ml within 8 weeks of infection. (Wu Z, et al. Mol Ther. 2008;16:280-289).
  • the cDNA of both mouse and human factor Vila, as well as the chimeric Factor VII polypeptides of the invention may be used to assess thrombogenicity.
  • the RKRRKR (SEQ ID NO:21) sequence described by Margaritis et al. that causes the Factor VII to be secreted in the active form, i.e., Factor Vila. (Margaritis et al., J. Clin. Invest., 2004; 113: 1025-31) can also be used.
  • mouse polypeptides can be generated for injection into mice. It has been reported that mouse tissue factor does not react well with human Factor VII, so mouse polypeptides (both wild type and chimeric Factor Vila) are used when utilizing a murine model to demonstrate the thrombogenicity of the chimeric versus wild-type FVIIa polypeptides. It is thought that the hemostatic function of FVIIa when used pharmacologically is independent of tissue factor; but, based upon observations that thrombosis occurs in tissues rich in tissue factor, it is likely that the thrombotic events are tissue factor dependent..
  • the mouse polypeptides that can be used to test this hypothesis include a wild-type mouse Factor VII (SEQ ID NO:3), a wild-type mouse Factor VII with an RKRRKR sequence to cause the polypeptide to be secreted in the two-chain, active form (FVIIa) (SEQ ID NO: 4), a mouse Factor IX signal, propeptide, GLA and EGFl domains, with Factor VII EGF2 and catalytic domains and an RKRRKR sequence (SEQ ID NO: 5) and a mouse Factor IX signal and propeptide domains, Protein S GLA domain, Factor IX EGFl domain, with Factor VII EGF2 and catalytic domains and an RKRRKR sequence (SEQ ID NO:6).
  • the chimeric mouse Factor VII polypeptides (SEQ ID NOS:5 and 6) will have a reduced affinity for tissue factor (perhaps by as much as 100 fold lower when compared to the wild-type FVII molecule) and this should be sufficient to prevent unwanted thromboses.
  • the chimeric Factor VII polypeptides may also be additionally modified to further reduce the affinity for tissue factor.
  • An example of such a mutation is to change the methionine at residue 366 in the amino acid sequence of SEQ ID NO: 18 to alanine.
  • Other modifications of the chimeric Factor VII polypeptides may be included that result in a higher specific activity of Factor Vila. Examples of such modifications include the following equivalent to residues 218, 356 and 358 of the human sequence (SEQ ID NO: 18): V218D, E356V and M358Q.
  • the wild-type and chimeric mouse Factor VII polypeptides described above can be constructed by using mouse Factor VII cDNA as a template and using oligonucleotide primers to amplify the various domains and then inserting the constructs into a pSC-TTR-mvm vector, the construction of which is described in Wu et al., Molecular Therapy 2008 16:280-289.
  • the wild-type mouse Factor VII can be amplified from mouse Factor VII cDNA using the following primers: 5'- TGAGGATCCCCACCATGGTTCCACAGGCGCATGGGCT -3' (SEQ ID NO:7) and 5'-TTCCCCAGCATGCCTACAGTAGTGGGAGTCGGAAAAC-3' (SEQ ID NO:8).
  • the amplified fragment can then be digested with BamHI/SphI and inserted into the pSC-TTR-mvm vector between the Bglll/SphI sites. Subsequently, the BGH polyadenylation sequence can be inserted into the resulting vector at the Sphl site.
  • the wild-type mouse Factor VII construct with the RKRRKR sequence can be constructed in a similar fashion. Specifically, the wild-type mouse Factor VII with the RKRRKR sequence can be amplified from mouse Factor VII cDNA using the following primers:
  • the resulting amplified fragment can then be digested with BamHI/SphI and inserted into the pSC-TTR-mvm vector between the Bglll/SphI sites.
  • the BGH polyadenylation sequence can be inserted into the resulting vector at the Sphl site.
  • the construct containing the mouse Factor IX signal, propeptide, GLA and EGF-1 domains, with Factor VII EGF-2 and catalytic domains and an RKRRKR sequence (SEQ ID NO: 5) is similarly constructed. Specifically, a first fragment is generated using mouse FactorIX cDNA as a template and the following primers:
  • a second fragment is generated using mouse Factor VII as a template and the following primers:
  • a third fragment can be generated using mouse Factor VII as a template and the following primers:
  • the BGH polyadenylation sequence is inserted into the resulting vector at the Sphl site.
  • a similar process can be used to generate the construct containing the mouse Factor IX signal and propeptide domains, Protein S GLA domain, Factor IX EGF1 domain, with Factor VII EGF2 and catalytic domains and an RKRRKR sequence (SEQ ID NO: 6).
  • a first fragment can be generated using mouse Factor IX cDNA and the following primers:
  • a second fragment can be generated using mouse Protein S as a template and the following primers:
  • a third fragment can be generated using the vector with the mouse Factor IX signal, propeptide, GLA and EGFl domains, with Factor VII EGF2 and catalytic domains and an RKRRKR sequence as a template and the following primers:
  • the resulting amplified fragment is then digested with BamHI/SphI and inserted into the pSC-TTR-mvm vector between the Bglll/Sphl sites.
  • the BGH polyadenylation sequence can be inserted into the resulting vector at the Sphl site.
  • the wild-type mouse Factor VII (SEQ ID NO:3) and wild-type mouse Factor VII with the RKRRKR sequence (SEQ ID NO:4) vector constructs were each injected into two male hemophilia B mice of matched age (5X10 11 vector genomes per mouse).
  • mice The mouse Factor IX signal, propeptide, GLA and EGFl domains, with Factor VII EGF2 and catalytic domains and an RKRRKR sequence (SEQ ID NO: 5) and mouse Factor IX signal and propeptide domains, Protein S GLA domain, Factor IX EGFl domain, with Factor VII EGF2 and catalytic domains and an RKRRKR sequence (SEQ ID NO:6) vector constructs were each injected into three male hemophilia B mice of matched age (5X10 11 vector genomes per mouse). Approximately three weeks post-injection, all mice injected with either wild-type mouse Factor VII (SEQ ID NO:3) or wild-type mouse Factor VII with the RKRRKR sequence (SEQ ID NO:4) died.
  • SEQ ID NO:3 wild-type mouse Factor VII
  • RKRRKR sequence SEQ ID NO:4
  • mice injected with either mouse Factor IX signal, propeptide, GLA and EGFl domains, with Factor VII EGF2 and catalytic domains and an RKRRKR sequence (SEQ ID NO: 5), or mouse Factor IX signal and propeptide domains, Protein S GLA domain, Factor IX EGF1 domain, ' with Factor VII EGF2 and catalytic domains and an RKRRKR sequence (SEQ ID NO: 6) were alive and showed no adverse symptoms approximately five weeks post-injection. Blood is collected once a week from the mice and after six to eight weeks following injection the level of mouse Factor VII polypeptide can be measured.
  • antigen levels to the mouse Factor VII polypeptides can be determined indirectly by measuring the clotting activity in vitro from blood samples of the injected mice (Margaritas et al, Gene Therapy 2009; 113:3682-3689).
  • Example VI Binding of collagen and accumulation of chimeric Factor Vila polypeptides in the basement membrane
  • Binding of collagen type IV by the chimeric Factor Vila polypeptides and accumulation of the chimeric Factor Vila polypeptides can be shown by injecting the polypeptides into mice and subsequently taking tissue samples from the mice and staining with antibodies labeled for collagen type IV and the chimeric polypeptides.
  • 2 mg/kg of the chimeric Factor Vila polypeptides can be administered through a catheter inserted into a vein in the leg of a hemophelia B mouse strain.
  • the animals can be sacrificed at predetermined time intervals and tissue sections can be taken and preserved by placing in OCT embedding compound, snap-freezing in liquid nitrogen cooled isopentane and transferred to liquid nitrogen.
  • the cyrosections of the tissue can then be fixed for 15 minutes in 3% paraformaldehyde in PBS, pH 7.4, rinsed in PBS for 5 minutes, incubated in methanol for 10 minutes, rinsed three times in PBS and then blocked in 3% BSA/PBS for 1 hour. Following this, the tissue sections can be incubated overnight with an affinity purified antibody directed to the chimeric Factor Vila polypeptides and then a secondary antibody directed to the primary antibody, which is labeled with a flurochrome, such as FITC.
  • a flurochrome such as FITC
  • Another antibody directed to collagen type IV can also be used during the incubation step and a further antibody directed to the collagen type IV-antibody complex can be labeled with another flurochrome such as rhodamine.
  • the stained tissue sections can be viewed on a fluorescence microscope, such as a Nikon FXA. Binding of the chimeric Factor Vila polypeptides can then be visualized and detected with the presence of a green signal in the interstitial spaces, collagen type IV can be visualized and detected with the presence of a red signal, and the colocalization of the chimeric Factor Vila polypeptides with collagen type IV and the accumulation of the polypeptides in the extravascular space can be visualized and detected with the presence of a yellow signal in the interstitial spaces.
  • a fluorescence microscope such as a Nikon FXA
  • Example VII Affinity of chimeric Factor Vila polypeptides for tissue factor Tissue Factor at various concentrations (0-400nM) can be distributed into 96 well plates.
  • Factor Vila or chimeric Factor Vila polypeptides of the invention can be added to the wells at a final concentration of lOnM.
  • varying concentrations of Factor Vila or the chimeric Factor Vila polypeptides of the invention (0-128nM) can be added to a fixed concentration of Tissue Factor (lOnM).
  • Reaction buffer Tris-HCl 20mM, pH7.4, NaCl lOOmM, and PEG 0.16% can be added to the wells and incubated for 1 hour at room temperature.
  • Synthetic substrate S- 2288 can be added to the reaction mix at a concentration of 2mM.
  • the absorbance at 405nm can be measured on a microplate reader for 30 minutes and the initial rate of hydrolysis of the synthetic substrate can be used for analysis.
  • the data collected can be analyzed by a quadratic solution to the equilibrium equation and the affinity of the chimeric FVIIa polypeptides for Tissue Factor, relative to wild type FVIIa, can be estimated.
  • the functional half-life and clearance rate of the chimeric Factor Vila polypeptides, compared to wild-type Factor VII can be determined by taking blood samples from subjects at specific time periods following administration of the polypeptides and assaying for the total Factor VII, the active Factor VII, and the Factor VII associated with antithrombin.
  • each participant can have a peripheral line inserted and receive, for example, 90 ⁇ g/kg body weight of NovoSeven ® or the chimeric Factor Vila polypeptides intravenously.
  • Blood specimens can be collected at baseline and at 0.5, 1.0, 2.0, 4.0 and 6.0 h post-dose in 3,2% sodium citrate evacuated containers to document Factor VII coagulant activity, total Factor VII concentration and Factor Vll-antithrombin complex concentration at each time point.
  • FactorVlIa Because the interaction between FactorVlIa and anti-thi mbin III is essentially irreversible, just measuring total FactorVlIa antigen is not sufficient to measure active circulating FactorVlIa, it is also necessary to measure the amount of FactorVIIa-anti-thrombin III complex.
  • Total Factor VII concentration and Factor Vll-antithrombin complex concentration can be measured by Enzyme Immunosorbent Assay.
  • Factor VII coagulant activity can be analyzed using the Staclot ® VIIa-rTF assay (Diagnostica Stago).
  • the inability of the chimeric Factor Vila polypeptides to bind tissue factor should be demonstrated by a decrease in the Factor VII- antithrombin complex concentration at each time point compared to NovoSeven ® . This should translate into a reduced clearance rate for the chimeric Factor Vila polypeptides and an increase in the functional half-life of the chimeric Factor Vila polypeptides when compared to NovoSeven ® , EXAMPLE IX. Studies to demonstrate that both human and mouse versions of FIXcia-EgfiFVIIaand ProSciaFIX Egfl FVIIa chimeras can stop bleeding in hem B mice.
  • results are based upon a tail bleeding model and a bleeding model 1 in which the saphenous vein is severed and the time to clot formation is measured. The clot is then removed and again the time to cessation of bleeding is measured.
  • Two parameters are produced: 1) the number of times that bleeding stops in a 30 minute period, and 2) the average time until bleeding stops after clot removal.
  • the average bleeding time is the 1800 second limit of the observational period.
  • FIX FIX
  • Mononine FIX
  • the response curve is similar to that expected from a hemophilic patient: 0.1 U/mL gives similar values as seen in wt mice, 0.01 U/mL gives similar values as seen in hemophilic animals, and 0.02 and 0.05 U/mL give dose-dependent movement toward the wt values.
  • the sharp dose dependence of this assay allows for assessment of effects of molecules with enhanced (or reduced) clotting activity.
  • Murine wt and chimeric FVIIa protein will be produced for infusion into hemophilic mice and the hemostasis model involving transection of the saphenous vein will be used to characterize hemostasis.
  • Gene therapy technologies will also be used to produce mice expressing wtFVIIa and FVIIa chimeras and hemostasis will be measured in these mice.
  • Pilot data show mean ⁇ SD TTH of 71 ⁇ 12 s for rFVIIa versus 51 ⁇ 8 s for FIXoia- EGF iFVIIa.
  • a two sample t-test will detect a mean difference of 20 with SD of 90 between wtFVIIa and FVIIa chimera at a level of 0.005 with 90% power with 9 mice/group.
  • hemostasis in mice infused with chimeras that have higher affinity for phospholipids (ProSoi a FIX Egf iFVIIa) or lower affinity for platelets (FIX G i a vi o -E g fi FVIIa and FVIIoi a FIXEg f i FVIIa) will be compared with normal and hemophilic mice, and mice infused with wtFVIIa. It is anticipated that the chimera with reduced affinity for platelets will require higher doses to support hemostasis, whereas the chimera with increased phospholipid binding will support hemostasis similar to FVIIa, or will support hemostasis at lower levels.
  • the infusion experiments will allow measurements after plasma levels have dropped below one percent FlXoia- K5 R-EGF l FVIIa may exhibit higher hemostatic activity for a given plasma level than FIXoia-K5A-EGFiFVIIa, by virtue of its increased affinity to collagen IV and localization to the site of injury.
  • TAT circulating thrombin- antithrombin
  • TTO time to vessel occlusion
  • FeCl 3 ferric chloride
  • TAT prothrombotic biomarkers
  • fibrin formation in hemophilic mice expressing FVIIa and FVIIa chimeras having different TF-, phospholipid- and collagen IV-binding properties. It is well accepted in human clinical medicine that elevated levels of TAT and D-dimer are correlated with thrombosis, and that both these markers and thrombotic risk increase with age. In mice, elevated levels of TAT have been associated with early death due to fibrin deposition in animals expressing high levels of FVIIa. 5 Blood will be drawn from chimeric mice after 1, 2, and 4 weeks, and then monthly. TAT and D-dimer levels will be measured by ELISA.
  • Baseline TAT in wt mice is 17.4 ⁇ 2.3 ng/mL (mean ⁇ SD). A 2- to 5-fold increase in TAT would be biologically meaningful. Assuming means of 17.5 and 35 and SD of 7.5, a two sample t-test at level 0.005 has at least 90% power with 9 mice/group. Baseline D-dimer in wt mice is 94.1 ⁇ 43.9 ng/mL, and D-dimer levels in hypercoagulable mice are 236.7 ⁇ 72 ng/mL. An increase of even 10-20% above baseline would be considered biologically significant. A two sample t-test can detect a mean difference of 100 ng/mL with standard deviation 50 ng/mL between wtFVIIa and FVIIa chimera at a level of 0.005 with 90% power with 9 mice/group.
  • FVIIa chimeric molecules in hemophilic mice.
  • Mice expressing FVIIa will be expected to have increased TAT and D-dimers relative to hemophilic mice and TAT levels will be expected to positively correlate with expression of FVIIa (wild type or chimeric).
  • TAT and D- dimer measurements in mice expressing chimeric FVIIa will be compared to FVIIa. If the thrombogenic potential of FVIIa is related to its TF-binding properties, it is anticipated that TAT and D-dimer levels will be lower in mice expressing FVIIa chimeras that do not bind TF than in mice expressing wtFVIIa.
  • mice expressing FIX G i a- E g fi 5RFVIIa chimera with reduced TF binding but increased collagen IV binding will show similar or lower TAT and D-dimer levels than similar chimeras without collagen IV binding.
  • TAT circulating prothrombotic biomarkers
  • D-dimer circulating prothrombotic biomarkers
  • Wt mice will be infused with different levels of wt or FVIIa chimera as described above, and development of circulating TAT and D-dimer will be measured in blood samples (5, 15, and 30 min, l, 2, 4 hours) by ELISA.
  • thrombogenic potential of FVIIa chimeras using murine models of intravascular thrombosis and thrombolysis. Resistance to fibrinolysis has been associated with increased thrombotic risk and worse outcomes in patients with deep vein thrombosis. 6 Therefore, in addition to monitoring thrombus formation in response to injury, a model of thrombolysis will be used to assess clot structure in response to FVIIa or FVIIa chimeras.
  • thrombosis and thrombolysis models in transgenic chimera-expressing hem A mice and in wt mice infused with wtFVIIa or FVIIa chimeras will be used.
  • This protocol has been optimized for the FeCl 3 thrombosis model in wt C57BL/6, but the FeCl 3 concentration and/or time of injury can be altered to maximize differences between wt and hemophilic mice.
  • Circulating plasma antigen total FVIIa and chimera-AT complexes
  • activity will be measured by quantitative western blotting and calibrated automated thrombography (CAT), respectively, and extravascular sequestration of FVIIa chimeras will be identified by immunohistochemistry.
  • CAT automated thrombography
  • mice expressing FIXoi a -EGFi FVIIa show normal hemostasis in the bleeding model but no plasma procoagulant activity or antigen, it would be expected to observe significant chimera bound in the extravascular space.
  • CAT will be used to measure plasma thrombin generation.
  • CAT assays will be performed by diluting platelet-rich plasmas (PRP) from chimeric mice 1 :3 16 and triggering clotting with TF. 17 Recombinant murine TF will be used for these assays. Readouts (lag time, peak thrombin generated, and endogenous thrombin potential) will be compared to wt plasma, hem B plasma, and hem B plasma spiked to normal (100%) levels of FIX. Fibrinolysis assays will be performed similarly, but in the presence of tPa. 18 The readouts, time to peak turbidity and peak turbidity indicate the procoagulant potential and the peak amount of fibrin produced during the reaction, respectively 19 , and will be compared to wt and hem B plasmas, as described above.
  • pilot data show the mean ⁇ SD for peak thrombin in normal plasma is 146 ⁇ 59nM, and with 50nM wtFVIIa in hemophilic plasma is 37 ⁇ 1 nM.
  • a two sample t-test can detect a mean difference of 110 with standard deviation of 40 at a level of 0.005 with at least 90% power with 9 mice/group.
  • pilot data show mean ⁇ SD for peak turbidity in normal plasma is 800 ⁇ 300 sec, and with 2nM wtFVIIa in hemophilic plasma is 1700 ⁇ 900 sec.
  • a two sample t-test can detect a mean difference of 900 with standard deviation 450 sec at a level of 0.005 with 90%) power with 9 mice/group.
  • FVIIa TF binding will be determined by comparing PRP from mice whose chimeras lack TF binding ability FVII G i a FIX Egf iFVIIa and FIX G i a -E gf i FVIIa with PRP from normal, hemophilic, and FVIIa chimeric mice. It is anticipated that the non-TF- binding chimeras will support similar thrombin generation and fibrinolytic stability as wt plasma and FVIIa.
  • Plasma from FIXoiaVioK- E g f iFVIIa mice will show reduced thrombin generation and clot stability. It is anticipated that FLX G ia- E g f iFVIIa, FLXGiaKSA- EgfiFVIIa, and FIX G i aK 5R- E g f iFVIIa will have similar plasma activity because neither CAT nor the fibrinolysis assay is sensitive to collagen IV binding.
  • Assay conditions and a standard curve will be established by adding preformed mouse FVIIa-AT complexes (FVIla expressed as described herein and mouse AT from Enzyme Research Labs) to mouse plasma. Background levels of FVIIa-AT will be measured in wt mice, and statistical analysis will be performed as described herein.
  • mice expressing FVIIa molecules that cannot bind to TF would be expected to have lower circulating FVIIa-AT complexes than mice expressing wtFVIIa, and may approach the background seen in mice that do not express FVIla. It is similarly anticipated that mice infused with FIXoia- EGF iFVIIa will have reduced circulating FVIIa-AT complexes. If FVIIa-AT levels are not reduced in these mice, it can be determined that FVIIa-AT formation in vivo is mediated by a TF-independent mechanism.
  • Plasma will be collected at 5, 15, and 30 min, and 1, 2, 3, 4, 6, 8, 12, and 24 hours after dosing and analyzed for FVIIa activity, antigen, and FVIIa-AT complexes.
  • 24,26 Plasma FVIIa activity-, total antigen-, and FVIIa-AT complex -time data will be analyzed by noncompartmental methods to recover robust estimates of standard PK outcomes, including maximum concentration, area under the curve, systemic clearance (CI), volume of distribution at steady state, and terminal Ti/ 2 .
  • PK/PD compartmental models will be developed using data collected from these studies to understand the plasma FVIIa exposure-response relationship 27 These analyses will employ Phoenix WinNonlin (Pharsight, Cary, NC) as the primary modeling software.
  • Comparison of hemostatic activity of wt and chimeric FVIIa in a dog model of hem A In vivo methods will be used to compare hemostatic efficacy and ex vivo methods will be used to monitor safety of the FVIIa chimeras versus wtFVIIa.
  • Biomarkers of procoagulant activity from whole blood and plasma will be measured.
  • the biomarkers include a complete blood count (leukocytes, platelets, hematocrit), chemistry panel, aPTT, prothrombin time, fibrinogen levels, TAT, CAT,D-dimer, and fibrin stability studies, and screening inhibitor assessments.
  • FVIIa chimeras with decreased TF binding or enhanced collagen IV binding properties will exhibit hemostatic activity in vivo, even when their levels cannot be detected in plasma.
  • This expectation would be supported by finding that the ARFI endpoint of the TTH (min) is significantly shortened in treated dogs compared to naive hem A dogs, even at the plasma nadir.
  • the secondary endpoints of area (mm 2 ) and rate (mm 2 /sec) of hemorrhage at this time point will also be measured and it is similarly expected that these parameters will be reduced in treated compared to na ' ive hem A dogs.
  • Vascular smooth muscle-derived tissue factor is critical for arterial thrombosis after ferric chloride-induced injury.
  • Blood 2009 113(3):705-713 Gui T, Reheman A, Ni H, et al. Abnormal hemostasis in a knock-in mouse carrying a variant of factor IX with impaired binding to collagen type IV. J Thromb Haemost 2009 7(11): 1843-1851

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Molecular Biology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Microbiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Hematology (AREA)
  • Diabetes (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne de nouvelles protéines et de nouveaux procédés d'utilisation de facteurs VIIa polypeptidiques chimériques.
PCT/US2012/035642 2011-04-29 2012-04-27 Molécules de facteur vii chimériques à demi-vie augmentée et procédés d'utilisation WO2012149463A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US13/097,609 US20120064075A1 (en) 2009-06-25 2011-04-29 Chimeric factor vii molecules with enhanced half life and methods of use
US13/097,609 2011-04-29

Publications (1)

Publication Number Publication Date
WO2012149463A1 true WO2012149463A1 (fr) 2012-11-01

Family

ID=47072796

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2012/035642 WO2012149463A1 (fr) 2011-04-29 2012-04-27 Molécules de facteur vii chimériques à demi-vie augmentée et procédés d'utilisation

Country Status (1)

Country Link
WO (1) WO2012149463A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3830273A4 (fr) * 2018-08-03 2022-05-18 Duke University Chimères de facteur vii de protéine c

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007149406A2 (fr) * 2006-06-19 2007-12-27 Nautilus Technology Llc Polypeptides facteurs ix de la coagulation modifiés et leur utilisation thérapeutique
WO2008127702A2 (fr) * 2007-04-13 2008-10-23 Catalyst Biosciences, Inc. Polypeptides du facteur vii modifiés et leurs utilisations
WO2009126307A2 (fr) * 2008-04-11 2009-10-15 Catalyst Biosciences, Inc. Polypeptides facteur vii modifiés et leurs utilisations
US20100330059A1 (en) * 2009-06-25 2010-12-30 The University Of North Carolina At Chapel Hill Chimeric factor vii molecules

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007149406A2 (fr) * 2006-06-19 2007-12-27 Nautilus Technology Llc Polypeptides facteurs ix de la coagulation modifiés et leur utilisation thérapeutique
WO2008127702A2 (fr) * 2007-04-13 2008-10-23 Catalyst Biosciences, Inc. Polypeptides du facteur vii modifiés et leurs utilisations
WO2009126307A2 (fr) * 2008-04-11 2009-10-15 Catalyst Biosciences, Inc. Polypeptides facteur vii modifiés et leurs utilisations
US20100330059A1 (en) * 2009-06-25 2010-12-30 The University Of North Carolina At Chapel Hill Chimeric factor vii molecules
US20120064075A1 (en) * 2009-06-25 2012-03-15 Inspiration Biopharmaceuticals, Inc. Chimeric factor vii molecules with enhanced half life and methods of use

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3830273A4 (fr) * 2018-08-03 2022-05-18 Duke University Chimères de facteur vii de protéine c
US11560556B2 (en) 2018-08-03 2023-01-24 Duke University Protein C-factor VII chimeras

Similar Documents

Publication Publication Date Title
US20120064075A1 (en) Chimeric factor vii molecules with enhanced half life and methods of use
JP4361728B2 (ja) ヒト凝固因子vii変異型
US6905683B2 (en) Human coagulation factor VII variants
EP1282693B1 (fr) Variants du facteur vii humain de coagulation
US7695935B2 (en) Nucleic acids encoding human coagulation FVII polypeptides
AU2001287550A1 (en) Human coagulation factor VII variants
AU2008261165A1 (en) Human coagulation factor VII variants
WO2012149463A1 (fr) Molécules de facteur vii chimériques à demi-vie augmentée et procédés d'utilisation
WO2008117179A2 (fr) Nouveaux polynucléotides et polypeptides du gène du facteur vii humain

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12776096

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12776096

Country of ref document: EP

Kind code of ref document: A1