WO2012148297A1 - Method for determining skin sensitisation potential - Google Patents

Abstract

The present invention provides an in vitro method for predicting the in vivo skin sensitization potential of chemical compounds using a combination of mammalian cell models with multiple endpoints analysis. The method comprises the steps of: 1- selection of the chemicals concentrations to be tested using cell viability assays 2-detection of expression levels of genes implicated in skin sensitization 3-detection of the activation status of intracellular signaling pathways 4- outputs from points 2 and 3 are assessed for a group of chemical compounds comprising known sensitizers and irritants (training compounds) and used to build a statistical classification model trained and optimized to classify unknown chemicals compounds (test compounds) as either sensitizers or non-sensitizers.

Description

DESCRIPTION

"METHOD FOR DETERMINING SKIN SENSITISATION POTENTIAL"

FIELD OF THE INVENTION

The invention relates to an in vitro cell-based method for evaluating the probability of a chemical to operate as a skin sensitizer in vivo

BACKGROUND OF THE INVENTION

Allergic contact dermatitis (ACD) is one of the most common occupational diseases iri developed countries arid 19.5% of the general population is sensitive to at least one allergen (Thyssen et al., 2007). ACD is the clinical condition caused by an allergic immune response following skin exposure to a large subset of small reactive chemicals (haptens) that can be found in the environment and in many household products. A large number of these chemicals are electrophilic molecules (with the exception of metals and thiols) that have the ability to bind skin proteins and form sensitising complexes (Figure 2) . Several in vivo methods have been proven accurate in predicting chemicals that possess skin sensitising properties, such as the local lymph node assay (Basketter et al., 2002). However, the skin sensitization potential is an endpoiht that needs to be assessed within the framework of existing and forthcoming legislation, namely the 7th Amendment to the Cosmetic Directive (Directive 2003/15/EC) (EU 2003) and more recently the new European Cosmetic Regulation (on November, 2009) (EC 2009) that seek to gradually eliminate animal experiments from the safety and toxicity testing of cosmetic ingredients and other chemical substances. The final cut-off date is March 2013, when cosmetic products containing an ingredient whose safety was tested in animals will not be allowed for sale in Europe, irrespective of the availability of alternative non-animal tests. Therefore, the rapid development and validation of in vitro testing strategies is a prerequisite to maintain Europe's competitiveness in the cosmetic industry. Progress in understanding the mechanisms of skin sensitisation and its effects on the production of cytokines/chemokines by different skin cell types provides the opportunity to develop in vitro tests as an alternative to in vivo sensitisation testing. Currently, the most promising alternative in vitro approaches are based on Langerhans (LC) /dendritic cells (DC) systems, given the pivotal role played by these cells in ACD (Ryan et al . , 2007; dos Santos et al., 2009) . The argument subjacent to the development of in vitro dendritic cell (DC) -based assays is that sensitiser-induced changes in the DC phenotype can be differentiated from those induced by irritants. This assumption is derived from the unique capacity of DC to convert environmental signals encountered at the skin into a receptor expression pattern (MHC class II molecules, co-stimulatory molecules, chemokine receptors) and a soluble mediator release profile that will stimulate T lymphocytes. Since signal transduction cascades precede changes in surface marker expression and cytokine/chemokine secretion, these phenotypic modifications are a consequence of a signal transduction profile that is specifically triggered by sensitisers and not by irritants (Figure 3) . Indeed, all DC modifications triggered by skin sensitisers, both at the genomic and proteomic level, result from the coordination of different intracellular signalling pathways that are specifically triggered by skin sensitisers and not by irritants. Previous results demonstrated that contact sensitisers activate the mitogen-activated protein kinases (MAPKs), mainly the p38 MAP (Arrighi et al., 2001; Boileve et al., 2004; Boisleve et al., 2005; Matos et al., 2005a; Matos et al., 2005b; Koeper et al., 2007; Trompezinski et al., 2008; Mitjans et al . , 2008; Mitjans et al., 2010). Further downstream signals elicited by skin sensitizers include the activation of the transcription factors nuclear factor kappa-B (NF-kB) and activating protein-1 (AP-.1) (Cruz et al., 2002; Cruz et al., 2004; Ade et al., 2007; Antonios et al., 2009). Since LC are a relatively minor population in the epidermis (2 to 5%), several cell culture protocols have been developed to derive LC-like dendritic cells, namely, DC derived from CD34+ progenitors from cord blood, DC derived from blood monocytes and monocytic cell lines with the capacity to develop into DC, such as THP-1, U- 937 and MUTZ-3. In the studies that use these DC-cell models, the activation of endocytosis, the increase in phosphotyrosine levels, the up- regulation of cell surface markers, the increase in cytokine and chemokine production, oxidation of cell surface thiols and the up- regulation of detoxifying genes were analysed as markers for the sensitisation capacity (Neves et al., 2008; Nukada et al., 2008; Suzuki et al., 2009; Ade et al., 2009; Hirota et al,, 2009; Kagatani et al., 2010; Natsch, 2010). In this context, our work has been performed using a mouse skin-derived dendritic cell line, FSDC, that is a model of immature DC, with morphological, phenotypical and functional characteristics of Langerhans cells (Girolomoni et al., 1995). In contrast to other DC lines used for studying skin sensitisation hazards, FSDC have the advantage of being cultured in the absence of exogenous recombinant growth factors .

It is widely recognised that alternatives to animal testing cannot be accomplished with a single biomarker and/or approach, but rather will require the integration of results obtained from different assays. The present invention provides a novel non-animal test for skin sensitization that may be extended to other types of hypersensitivity diseases (e.g. respiratory allergy) . OBJECT OF THE INVENTION

The object of the present invention is to provide a fast, inexpensive and (high throughput) in vitro cell-based method for skin sensitization evaluation.

SUMMARY OF THE INVENTION

The invention provides methods for predicting the in vivo skin sensitizing potential of a test compound.

In a first main embodiment, the invention provides a method for predicting the in vivo skin sensitizing potential of a test compound, comprising: a) culturing mammalian cells presenting dendritic characteristics ;

b) applying selected concentrations of known sensitizers and irritants (training compounds) during a predetermined period of time to the cells of step (a) based on the results obtained from viability assays; c) measuring the expression level of one or more predictor genes in the cells of step (b) ;

d) measuring the activation status of predictor intracellular signaling pathways in the cells of step (b) ;

e) conducting a computational discriminant analysis where the expression level (s) measured in step (c) and the signaling pathways measured i step (d)were used to build a statistical classification model trained and optimized to classify chemical compounds as either sensitizers or non- sensitizers;

f) applying selected concentrations of a test compound during a predetermined period of time to the cells of step (a) based on the results obtained from viability assays;

g) measuring the expression level of one or more predictor genes in the cells of step (f) ;

h) measuring the activation status of predictor intracellular signaling pathways in the cells of step (f) ;

i) classifying the test compound through the classification model from step (e) as belonging either to sensitizer or non-sensitizer class.

The mammalian cells are selected from the group consisting of: human keratinocytes (HaCat and NCTC2455 cells), human monocyte Thp-1 and U937 cell lines and the mouse fetal skin-derived dendritic cell line (FSDC) .

Cells are exposed to varying dosage amounts of the test compound, in accordance with the results obtained for viability assays that measure mitochondrial function membrane integrity, and ATP release for a period, between 0,5 and 24h. The selected concentrations obtained from the viability assays are those that induce between 10-50% toxicity.

The predictor gene(s) are selected from the group consisting of: FABP4, IL-17F, CXCL10, thioredoxin, thioredoxin reductase, heme oxygenase (decycling) 1 (HMOX1) and NAD ( P) H

The predictor intracellular signaling pathways are selected from the group consisting of: p38 MAPK, JNK, ERK, PKC, PKA/AMPc, calcium release, AKT/PI3K, Nrf-2, AP-1, CREB, NF-kB, JAK/STAT.

For the establishment of the discriminator classification model, nine chemical compounds were tested (training compounds), 6 of which are known sensitizers of different strength. The selected sensitizers reflect the variety of physicochemical and reaction mechanisms involved in the sensitization process. Also^ three irritants were included in the study. The expression of predictor genes and the activation of predictor intracellular signaling pathways were determined for these nine compounds and the results obtained were used as training data in the development of a statistical classification model. This model was trained and optimized to classify chemical compounds as either sensitizers or non-sensitizers

The expression of the predictor genes and the activation of the predictor intracellular signaling pathways triggered by the test compound were used both as inputs in the statistical classification model. Through said model, the test compound will be included into the class of sensitizers or into the class of non-sensitizers.

The selected predictor genes are: TRXR, HMOXl, NQ01 and the predictor intracellular signaling pathways are p38MAPK and JNK.

DEFINITIONS

AMPc: Cyclic adenosine monophosphate

ATP: Adenosine Triphosphate

JNK: c-Jun N-terminal kinase

MAPK: Mitogen Activated Protein Kinases

ERK1/2: extracellular signal-regulated kinases 1/2

NF-kB: transcription factors nuclear factor kappa-B

AP-1: activating protein-1

IL-17F: Interleucin 17F

FABP4 : Fatty acid-binding protein 4

TRXR: thioredoxin reductase

HMOX-1: heme oxygenase (decycling) 1

NQOl: NAD(P)H dehydrogenase quinone 1 PI3K/AKT: phosphatidylinositol 3-kinase

CXCLl-0: chemokine CXCL10

FSDC: foetal mouse skin derived dendritic cell line

Nr£2: transcription factor nuclear factor-erythroid 2-related factor 2

JAK/STAT: Janus kinase and signal transducer and activator of transcription

PKC: Protein kinase C PKA: protein kinase A DMSO:

dimetylsulfoxide

PBS: phosphate buffer saline

The term "sensitizer" refers to any chemical compound, of synthetic or natural origin, able to induce a sensitization reaction in an individual. it is meant by "irritants" a particular type of non- sensitizers . Contrary to sensitizers, irritants do not induce an immune response . They react in a non-specific way. irritants are useful as npn-sensitizers in the development of a test because they are difficult to distinguish from sensitizers.

It should be understood that the present invention relates to a method for determining the sensitizing potential of a specific (single) chemical compound.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows a schematic representation of the workflow for the in vitro cell-based test for skin sensitization prediction of a chemical compound.

Figure 2 shows the effect of sin sensitizers on the activation of intracellular signaling pathways.

Figure 3 shows the effects of different DNFB and SDS concentrations on the cell viability (determined by the MTT assay) , The optimal concentrations were chose based on a required cytotoxicity up to 30% (70% of cell viability) . Figure 4 shows the effect of the training compounds on the expression of the selected predictor genes (TRXR, HMOX1, NQOl) .

Figures 5 shows the effect ofthe training compounds DNFB and SDS on the activation of the predictor intracellular signaling pathways (p38MAPK and JNK)

DETAILED DESCRIPTION OF THE INVENTION

Before explaining at least one embodiment of the invention in detail by way of exemplary drawings, experimentation, results, and laboratory procedures, it is to be understood that the invention is not limited in its application to the details of construction and the arrangement of the components set forth in the following description or illustrated in the drawings, experimentation and/or results. The invention is capable of other embodiments or of being practiced or carried out in various ways. As such, the language used herein is intended to be given the broadest possible scope and meaning; and the embodiments are meant to be exemplary and not exhaustive. Also, it is to be understood that the phraseology and terminology employed herein is for the purpose of description and should not be regarded as limiting.

Unless otherwise defined herein, scientific and technical terms used in connection with the present invention shall have the meanings that are commonly understood by those of ordinary skill in the art. Generally, nomenclatures utilized in connection with, and techniques of, cell and tissue culture, molecular biology, and protein and oligo- or polynucleotide chemistry described herein are those well known and commonly used in the art. Standard techniques are used for recombinant DNA, oligonucleotide synthesis, and cell culture. Enzymatic reactions and purification techniques are performed according to manufacturer's specifications or as commonly accomplished in the art or as described herein. The foregoing techniques and procedures are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification.

The present invention provides methods for predicting the in vivo skin sensitizing potential of chemical compounds using a combination of mammalian cell models with multiple endpoint analysis. In particular, the present invention involve assays to measure the expression of key genes associated with skin sensitization in multiple mammalian cell models, coupled with the activation of intracellular signaling pathways triggered during inflammatory processes, such as skin sensitization . These methods can provide a means of predicting the potential of a chemical to act as a skin sensitizer. The genes associated with skin sensitization include, but are not limited, to TRXR, HMOX, and NQ01. The signaling pathways associated with an inflammatory event include, but are not limited, to p38MAPK and JNK. The use of some of these genes as markers for skin sensitization is not novel and has been reported in the literature. However, the use of these markers in multiple mammalian cell models and the evaluation of the intracellular signaling pathways integrated in a computational analysis to provide a model that is trained and optimized to classify chemical compounds as either sensitizers or non- sensitizers have not been reported.

Training chemicals and Statistical classification model used to classify chemicals compounds as either sensitizers or non-sensitizers .

Nine chemical compounds (training compounds) were tested, 6 of which are known sensitizers of different strength, reflecting the variety of physicochemical and reaction mechanisms involved in the sensitization process. Also, three irritants were included in the study. The expression of predictor gehes and the activation of predictor intracellular signaling pathways were determined for these nine compounds and the results obtained are used as training data in the development of a statistical classification model. This model was trained and optimized to classify chemical compounds as either sensitizers or non-sensitizers .

Below, some more information On the training chemical compounds used.

A.Allergens

A.l. Nickel sulphate (Ni)

Nickel is a heavy metal that is quite abundant in the environment because of the high consumption of nickel- containing products. Nickel is classified as a moderate sensitizer.

A.2. 4-ethoxymethylene-oxazol-5-one (Oxazolone; Oxa)

Not much information on the applications of oxazolone can be found in the literature, it is however classified as a strong sensitizer. In terms of reactivity it is an acyl transfer agent

A.3. 1-fluoro-2, 4-dinitrobenzene (DNFB)

DNFB is an organic compound that has been used for many years as an experimental human strong sensitizer. In terms of reactivity it is a SN2Ar electrophile. A. .p-Phenylenediamine (PPD)

PPD is the most important hair-dye allergen. It is classified as a pro-hapten as it requires a physicochemical reaction to be transformed into a reactive species. In terms of reactivity it is probably/possibly a pro-Michael acceptor.

A.5. Cinnamal (Cin)

Cinnamal is a common additive in perfume and cosmetic industry as aroma substance. In terms of reactivity it is a Michael acceptor and/or a Schiff's base former.

A.6. Glyoxal (Glx)

Glyoxal is an organic compound used in large amounts by the textile industry as a crosslinker for starch-based formulations and as a starting material with ureas for wrinkle- resistant chemical treatments. In terms of reactivity it is a Schiff's base former

B. Irritants

B.l. Sodium dodecyl sulfate (also known as sodium lauryl sulfate, SDS) :

SDS is an ionic detergent that is used in household products such as toothpastes, shampoos, shaving foams and bubble baths for its thickening effect and its ability to create lather. It is a typical irritating compound.

B.2. Benzalkonium chloride (BC)

BC is an organic compound that is used as an antiseptic and spermicide. It is used in eyewashes, hand and face washes, mouthwashes, spermicidal creams, and in various other cleaners, sanitizers, and disinfectants.

B.3. Salicylic acid (SA)

SA is a colorless crystalline organic acid widely used in organic synthesis. SA is a key ingredient in many skin- care products for the treatment of acne, psoriasis, calluses, corns, keratosis pilaris, and warts.

Gene expression and intracellular signaling pathways activation in FSDC exposed to the training chemical allergens and irritants

Culture of FSDC

The mouse fetal skin-derived dendritic cell line is a skin dendritic cell precursor with antigen presenting capacity (Girolomoni et al., 1995). This cell line was previously characterized by a surface phenotype consistent with a Langerhans cell progenitor (H-2d.b+, I- Ad.b+, CD54+, MHCII+, MHCI+, CDllc+, CDllb+, B7.2+, CD44+, B220-, CD3-) this phenotype was confirmed in our lab for the most important of these surface markers. Cells were cultured in endotoxin-free Iscove's Modified Dulbecco's Medium (IMDM), supplemented with 10% (v/v) fetal bovine serum, 1% (w/v) glutamine, 3.02 g/1 sodium bicarbonate, 100 μg/ml streptomycin and 100 U/ml penicillin, in a humidified incubator with 5% C02/95% air, at 37 °C. The FSDC did not require exogenous growth factors for their continued proliferation whe cultured in serum-containing medium, having a doubling time of about 48 h. The cells were used after reaching 70-80% confluence. After 45 passages the cells were discarded. Chemical exposure of the cells

FSDC cells from 3 independent passages were exposed to the training compounds or to the solvent (PBS, ethanol or DMS0> control) for 0.5, 1, 3, 6, 12 and 24 hours.

The following concentrations and solvents were used:

MTT assay

FSDC were exposed, for 24 h, to chemical sensitizing model compounds, in a dose response experiment and analyzed for viability by the reduction of the tetrazolium bromide salt, 3- ( 4 , 5-dimethylthiazol-2-yl ) -2 , 5-diphenyl tetrazolium bromide (MTT) (Mosmann, 1983). FSDC were plated at 0.2x106 cells/well in 48-well plates in a final IMD volume of 400μ1 and stock solutions of chemical sensitizing model compounds were added, to obtain the different final in-well concentrations studied. After 23 h exposure, 40 μΐ of MTT solution (5mg/ml) was added to each well and cells were further incubated at 37 °C for 1 h. Finally, the supernatants were discarded and 300 μΐ of acidic isopropanol were added to the cells. Formazan quantification was performed using an automatic plate reader (SLT, Austria) at 570 nm, with a reference wavelength of 620 nm. The concentrations of the chemical sensitizing model compounds used on the next approaches were those that induce 70% of cell viability.

Cell lysate preparation and Western blot analysis

For assessment of phosphorylated proteins, FSDC were plated at 1x106 cells/well in 12-well microplates in a final IMDM volume of 2 ml artd incubated with chemical sensitizing model compounds. To obtain the lysates, cells were washed in ice-cold PBS and harvested in RIPA lysis buffer (50 mM Tris-HCl (pH 8.0), 1% Nonidet P-40, 150 mM NaCl, 0.5% sodium deoxycholate, 0.1% SDS, 2 mM EDTA and lmM DTT) freshly supplemented with protease and phosphatase inhibitor cocktails. The nuclei and the insoluble cell debris were removed by centrifugation at 4°C, at 12, 000g for 10 min. The postnuclear extracts were collected and used as total cell lysates. Protein concentration was determined using the bicinchortinic acid method and the cell lysates were denatured at 95°C, for 5 min, in sample buffer (0.125 mM Tris pH 6.8; 2% w/v SDS; 100 mM DTT; 10% glycerol and bromophenol blue) for its use in western blot analysis .

Western blot was performed to evaluate the levels of phospho-p38 MAPK and phospho-SAPK/JNK. 50 g of protein were electrophoretically separated on a 12% (v/v) sodium dodecyl sulfate-polyacrylamide gel, and transferred to a polyvinylidene difuoride (PVDF) membrane. The membranes were blocked with 5% (w/v) fat-free dry milk in Tris- buffered saline containing 0.1% (v/v) Tween 20 (TBS-T), for 1 h, at room temperature. Blots were then incubated overnight at 4°C with the primary antibodies against the different proteins to be studied: phospho-p38 MAPK (1:1000); phospho-JNK (1:1000). The membranes were then washed for 25 min with TBS-T, and incubated, for 1 h, at room temperature, with an alkaline phosphatase-conjugated anti-rabbit antibody (1:20,000). The immune complexes were detected by membrane exposure to the ECF reagent, during 5 min, followed by scanning for blue excited fluorescence on the Storm 860 (GE Healthcare) . The generated signals were analyzed using the ImageQuant TL software. To test whether similar amounts of protein for each sample were loaded, the membranes were stripped and reprobed with antibodies to total SAPK/JNK and p38 MAPK and blots were developed with alkaline phosphatase- conjugated secondary antibodies and visualized by enhanced chemifluorescence .

RNA extraction

Cells were plated at 2x106 cells/well in 6-well microplates in a final volume of 4 ml and treated with chemical sensitizing model compounds. Total RNA was isolated from cells with the TRIzol® reagent according to the manufacturer's instructions. Briefly, cells were washed with ice-cold PBS harvested and homogenized in 1 ml of Trizol by pipetting vigorously. After addition of 200 μΐ of chloroform the samples were vortexed, incubated for 2 min at room temperature and centrifuged at 12,000*g, for 15 min, at 4°C. The aqueous phase containing RNA was transferred to a new tube and RNA precipitated with 500 μΐ of isopropanol for at least 10 min at room temperature. Following a 10 min centrifugation at 12,000g, the pellet was washed with 1 ml 75% ethanol and resuspended in 100 μΐ 60°C heated RNase free water. The RNA concentration was determined by OD260 measurement using a Nanodrop spectrophotometer (Wilmington, DE, USA) and quality was inspected for absence of degradation or genomic DNA contamination, using the Experion RNA StdSens Chips in the ExperionTM automated microfluidic electrophoresis system (BioRad Hercules, CA, USA) . RNA was stored in RNA Storage Solution (Ambion, Foster City, CA, USA) at -80°C. Real-time RT-PCR

One microgram of total RNA was reverse transcribed using the iScript Select cDNA Synthesis Kit. Briefly, 2 μΐ of random primers and the necessary volume of RNase-free water to complete 15μ1, were added to each RNA sample. The samples were heated at 65°C, for 5 mim, and snap- chilled on ice for 1 min. After this, 5μ1 of a Master Mix containing 1 μΐ of iScript reverse transcriptase and 4 μΐ of 5x Reaction Buffer were added to each sample. A protocol for cDNA synthesis was run on all samples (5 min at 25°C, 30 min at 42°C, 5 min at 85°C and then put on hold at 4°C) . After the cDNA synthesis, the samples were diluted with RNase-free water up to a volume of 100 μΐ. Realtime PCR was performed in a 20 μΐ volume containing 5 μΐ cDNA (50 ng) , 10 μΐ 2x Syber Green Supermix, 2 μΐ of each primer (250 nM) and 1 μΐ H20 PCR grade. Samples were denatured at 95°C during 3 min. Subsequently, 40 cycles were run for 10 sec at 95°C for denaturation, 30 sec at the appropriate annealing temperature and 30 sec at 72°C for elongation. Real-time RT-PCR reactions were run in duplicate for each sample on a Bio-Rad My Cycler iQ5. Primers were designed using Beacon Designer® Software v7.2, from Primier Biosoft International and thoroughly tested. Primer sequences are given in Table 1. Gn each real-time PCR plate there was a non-template control present for each pair of primers analyzed. For determination of primer-pair specific efficiencies, a 4 points dilution series of control sample for each pair of primers was run on each experiment (Rasmussen, 2001) . Amplification reactions were monitored using a SYBR-Green assay. After amplification, a threshold was set for each gene and Ct-values were calculated for all samples. Gene expression changes were analyzed using the built-in iQ5 Optical system software v2. The software enables analyzing the results with the Pfaffl method (Pfaffl, 2001), a variation of AACT method corrected for gene-specific efficiencies, and to report gene expression changes as relative fold changes compared to control samples. The results were normalized Using a reference gene, HPRT-1, determined with Genex® software (MultiD Analyses AB) as the most stable for the treatment conditions used.

Statistical classification model used to classify chemical compounds as either sensitizers or non- sensitizers

For the establishment of the classification model, the expression of predictor genes and the activation of predictor intracellular signaling pathways were determined for nine representative compounds (training compounds) . The results obtained were used as training data in the development of a statistical classification model. This model was trained and optimized to classify chemical compounds as either sensitizers or non- sensitizers.

Training data was obtained as fold change relatively to untreated cells (control) and was in a first step converted to a logarithmic scale. Following transformation, training data was subjected to linear discriminant analysis. From this analysis were extracted the variables that better differentiate sensitizers form non-sensitizers (predictor variables) . The predictor variables were used to create a discriminant function. From this function were extracted the classification function coefficients that were subsequently used to create a classification algorithm. This classification algorithm was able to classify an unknown chemical compound (test compound) as either sensitizer or non- sensitizer. The classification algorithm could be presented as small piece of software with a user-friendly interface. The classification of an unknown chemical compound (test compound) consists of:

1 - Determination of the concentration of the compound that causes up to 30% cytotoxicity.

2 - Determination of the effects of the test compound on the predictor variables (predictor genes and predictor signaling pathways) . The results were obtained as fold changes induced by the treatment with the test compound when compared to untreated cells (control) .

3- Testing the results obtained for the test compound on the classification algorithm.

4 - The result is expressed as the test compound belonging either to sensitizer or to non-sensitizer group.

Example 1: Blind assay for the classification of 8 test compounds using the developed prediction model.

Using the prediction model built on the data from 9 training compounds relatively to 3 predictor genes and 2 predictor signaling pathways, a blind assay was performed in order to classify 8 test compounds. At the beginning of the assay the operator occulted the identity of the compounds by attributing a letter to each one. All the parameters (effect on the cell viability, effects on the expression of predictor genes and predictor signaling pathways and classification) were subsequently determined unknowing the identity of the compounds. The results are summarized in Table 1.

In this blind assay, using the developed prediction model, we are able to correctly classify 7 of the 8 test compounds, corresponding to an accuracy of 87,5%. Considering that the 9 training compounds were correctly classified when tested individually in our model, we were able to correctly classify 16 compounds over a total of 17, corresponding to an accuracy of 94%

Table 1 Classification of 8 test compounds using the developed prediction model

Table 2 Primer sequences for targeted cDNAs

5 ' -3 ' sequence RefSeq ID

Target cDNA F: forward; R; reverse

HPRT1 F: GTTGAAGATATAATTGACACTG NM_013556

R: GGCATATCCAACAACAAAC

TRXR F: GGCGACAAATAACAAAGGTAAAG NM_001042523

R: ACATTCCAAGGCGACATAGG

HMOX F: CCAGTTCTACCAGAGTAA NM_010442

R: ACAGAAGTTAGAGACCAA

NQOl F: CCTCTATGCTATGAACTT NM_008706

R: GTCCTTCCTTATATGCTA REFERENCES

Ade, N., Antonios, D., Kerdine-Romer, S., Boisieve, F. , Rousset, F. , and Pallardy, M. , 2007. NF-kappaB plays a major role in the maturation of human dendritic cells induced by NiSO(4) but not by DNCB. Toxicol Sci 99, 488-501.

Ade, . , Leon, F., Pallardy, . , Peiffer, J. L. , Kerdine-Romer, S., Tissier, M. H . , Bonnet, P. A., Fabre, I., and Ourlin, J. C, 2009. HMOX1 and NQOl genes are upregulated in response to contact sensitizers in dendritic cells and THP-1 cell line: role of the Keapl/Nrf2 pathway. Toxicol Sci 107, 451-460.

Antonios, D., Ade, N., Kerdine-Romer, S., Assaf- Vandecasteele, H . , Larange, A., Azouri, H., and Pallardy, M, , 2009. Metallic haptens induce differential phenotype of human dendritic cells through activation of mitogen-activated protein kinase and NF- kappaB pathways. Toxicol In Vitro 23, 227-234.

Arrighi, J. F_^, Rebsamen, M.> Rousset, F., Kindler, V., and Hauser, C, 2001. A critical role for p38 mitogen-activated protein kinase in the maturation of human blood-derived dendritic cells induced by lipopolysaccharide, TNF-alpha, and contact sensitizers. J Immunol 166, 3837-3845.

Basketter, D. A., Evans, P., Fielder, R. J., Gerberick, G. F. , Dearman, R. J., and Kimber, I., 2002. Local lymph node assay - validation, conduct and use in practice. Food Chem Toxicol 40, 593-598.

Boisieve, F. , Kerdine-Romer, S. , and Pallardy, M. , 2005. Implication of the MAPK pathways in the maturation of human dendritic cells induced by nickel and TNF-alpha. Toxicology 206, 233-244.

Boisieve, F., Kerdine-Romer, S., Rougier-Larzat, N., and Pallardy, M. , 2004. Nickel and DNCB induce CCR7 expression on human dendritic cells through different signalling pathways: role of TNF-alpha and MAPK. J Invest Dermatol 123, 494-502.

Cruz, M. T,, Duarte, C. B . , Goncalo, M. , Figueiredo, A., Carvalho, A. P., and Lopes, M. C, 2002. Differential activation of nuclear factor kappa B subunits in a skin dendritic cell line in response to the strong sensitizer 2, -dinitrofluo.robenze.ne . Arch Dermatol Res 294, 419-425.

Cruz, M. T., Goncalo, M., Figueiredo, Ά. , Carvalho, A. P., Duarte, C. B., and Lopes, M. C, 2004. Contact sensitizer nickel sulfate activates the transcription factors NF-kB and AP-1 and increases the expression of nitric oxide synthase in a skin dendritic cell line. Exp Dermatol 13, 18-26.

dos Santos, G. G., Reinders, J., Ouwehand, K., Rustemeyer, T., Scheper, R. J., and Gibbs, S., 2009. Progress on the development of human in vitro dendritic cell based assays for assessment of the sensitizing potential of a compound. Toxicol Appl Pharmacol 236, 372-382.

EC (2009) . REGULATION No 1223/2009 OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL of 30 November 2009 on cosmetic products. Official Journal of the European Union, L 342/59 .

EU (2003) . DIRECTIVE 2003/15/EC OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL of 27 February 2003 amending Council Directive 76/768 /EEC on the approximation of the laws of the Member States relating to cosmetic products. Official Journal of the European Union, L66, 26-35.

Girolomoni, G., Lutz, M. B., Pastore, S., Assmann, C. U., Cavani, A., and Ricciardi-Castagnoli, P., 1995. Establishment of a cell line with features of early dendritic cell precursors from fetal mouse skin. Eur J Immunol 25, 2163-2169.

Hirota, M., Suzuki, M. , Hagino, S. , Kagatani, S., Sasaki, Y., Aiba, S., and Itagaki, H., 2009. Modification of cell-surface thiols elicits activation of human monocytic cell line THP-1: possible involvement in effect of haptens 2,4- dinitrochlorobenzene and nickel sulfate. J Toxicol Sci 34, 139- 150.

Iijima, N., Yanagawa, Y., and Onoe, K., 2003. Role of early- or late-phase activation of p38 mitogen- activated protein kinase induced by tumour necrosis factor-alpha or 2,4- dinitrochlorobenzene during maturation of murine dendritic cells. Immunology 110, 322-328.

Kagatani, S., Sasaki, Y., Hirota, M. , Mizuashi, M. , Suzuki, M. , Ohtani, T., Itagaki, H., and Aiba, S., 2010. Oxidation of cell surface thiol groups by contact sensitizers triggers the maturation of dendritic cells. J Invest Dermatol 130, 175-183. Koeper, L. M. , Schulz, A., Ahr, H. J., and Vohr, H. ., 2007. In vitro differentiation of skin sensitizers by cell signaling pathways. Toxicology 242, 144-152.

Matos, T. J., Duarte, C. B., Goncalo, M., and Lopes, M. C, 2005a. DNFB activates MAPKs and upregulates CD40 in skin-derived dendritic cells. J Dermatol Sci 39, 113-123.

Matos, T. J., Duarte, C. B., Goncalo, M. , and Lopes, M. C, 2005b. Role of oxidative stress in ERK and p38 MAPK activation induced by the chemical sensitizer DNFB in a fetal skin dendritic cell line. Immunol Cell Biol 83, 607-614.

Mitjans, M. , Galbiati, V., Lucchi, L., Viviani, B., Marinovich, M., Galli, C. L., and Gorsini, E., 2010. Use of IL-8 release and p38 MAPK activation in THP-1 cells to identify allergens and to assess their potency in vitro. Toxicol In Vitro.

Mitjans, M. , Viviani, B., Lucchi, L., Galli, C. L, Marinovich, M. , and Corsini, E, , 2008. Role of p38 MAPK in the selective release of IL-8 induced by chemical allergen in naive THp-1 cells. Toxicol In Vitro 22, 386-395.

Natsch, A., 2010. The Nrf2-Keapl-ARE toxicity pathway as a cellular sensor for skin sensitizers-functional relevance and a hypothesis on innate reactions to skin sensitizers. Toxicol Sci 113, 284-292.

Neves, B. M., Cruz, M. T., Francisco, V., Goncalo, M., Figueiredo, A., Duarte, C. B., and Lopes, M. C, 2008. Differential modulation of CXCR4 and CD40 protein levels by skin sensitizers and irritants in the FSDC cell line. Toxicol Lett 177, 74-82.

Nukada, Y., Miyazawa, M., Kosaka, N., Ito, Y., Sakaguchi, H., and Nishiyama, . , 2008. Production of IL-8 in THP-1 cells following contact allergen stimulation via mitogen-activated protein kinase activation or tumor necrosis factor-alpha production. J Toxicol Sci 33, 175-185.

Ryan, C. A., Kimber, I., Basketter, D. A., Pallardy, M., Gilde.a, L. A., and Gerberick, G. F. , 2007. Dendritic cells and skin sensitization: biological roles and uses in hazard identification. Toxicol Appl Pharmacol 221, 384-394.

Suzuki, , , Hirota, M. , Hagino, S., Itagaki, H., and Aiba, S., 2009. Evaluation of changes of cell- surface thiols as a new biomarker for in vitro sensitization test. Toxicol In Vitro 23, 687-696.

Thyssen, J. P., Linneberg, A., Menne, T. and Johansen, J.D., 2007. The epidemiology of contact allergy in the general population—prevalence and main findings. Contact Dermatitis 57, 287-299.

Trompezinski, S., Migdal, C, Tailhardat, M., Le Varlet, B., Courtellemont , P., Haftek, M. , and Serres, M . , 2008. Characterization of early events involved in human dendritic cell maturation induced by sensitizers: cross talk between MAPK signalling pathways. Toxicol Appl Pharmacol 230, 397-406.

Claims

1. Method for determining skin sensitisation potential which comprises the analysis of the expression level of a gene group and on the activation status of a set of intracellular signalling pathways involved in immunization response events, for cell models with dendritic cell characteristics, comprising the steps:

(a) culturing a suitable type of mammalian cells

(b) applying selected concentrations of known sensitizers and irritants (training compounds) during a predetermined period of time to the cells of step (a) based on the results obtained from viability assays;

(c) measuring the expression level of one or more predictor genes in the cells exposed to training compounds of step (b) ;

(d) measuring the activation status of predictor intracellular signaling pathways in the cells exposed to training compounds of step;

(e) Conducting a computational discriminant analysis where the expression level (s) measured in step (c) and the signaling pathways measured in step (d)were used to build a statistical classification model trained and optimized to classify chemical compounds as either sensitizers or non-sensitizers ;

(f) applying selected concentrations of a test compound during a predetermined period of time to the cells of step (a) based on the results obtained from viability assays;

(g) measuring the expression level of one or more predictor genes in the cells exposed to test compound of step (f) ;

(h) measuring the activation status of predictor intracellular signaling pathways in the cells exposed to test compound of step .(f) ;

(i) classifying the test compound through the classification model from step (e) as belonging either to sensitizer or non-sensitizer class.

2. The method according to claim 1 which comprises the analysis of the expression of key gene markers associated with skin sensitization, which include but are not limited to FABP4, IL-17F, CXCL10, thioredoxin, thioredoxin reductase, heme oxygenase (decycling) 1 (HM^'OXl) and NAD ( P) H dehydrogenase quinone 1 (NQOl) .

3. The method according to claim 1 which comprises the analysis of the activation status of a set of intracellular signalling pathways involved in immunization response events such as skin inflammation or allergic events, which include but are not limited to p38 MAPK, JNK, ERK, PKA/AMPc, calcium release, PKC, AKT/PI3K, Nrf-2, AP-1, CREB, NF-kB and JAK/STAT.

4. The method according to any of the preceding claims, wherein the suitable cell culture is a mammalian cell model with dendritic characteristics such as M.UTZ-3 cell line, THP-1 cell line, U937 cell line, keratinocytes cell lines or combinatory cultures including keratinocytes and dendritic cells .

5. The method according to any of the preceding claims, wherein the cell treatment time is comprised between 5 minutes and 48 hours.

6. The method according to any of the preceding claims wherein the concentrations of chemical compounds were chosen based on induced cell mortality between 10-50% up to 30% cell .

7. The method according to any of the preceding laims, wherein the statistical classification model is built based on the simultaneous analysis of the expression level of one or more predictor genes and on the activation of one or more predictor intracellular signalling pathways.

8. The method according to the claim 7 where the number of predictor genes analysed is at least 1, preferably is at least 3.

9. The method according to the claim 8 where the preferential predictor genes are thioredoxin reductase, heme oxygenase 1 (HM0X1) and NAD ( P) H dehydrogenase quinone 1 (NQOl) .

10. The method according to the claim 7 where the number of predictor signalling pathways analysed is at least 1, preferably is at least 2.

11. The method according to the claim 10 where the preferential predictor signalling pathways analysed

are p38 MAPK and JNK.

12. The method according to the claim 11 where JNK signalling pathway is used to discriminate sensitizers from non- sensitizers .

13- The method according to any of the preceding claims wherein the tested chemical could be a synthetic chemical, a natural occurring chemical, a botanically fragrance or a drug.