WO2012131673A2 - Ccat-1 silencing nucleic acid agents for treating cancer - Google Patents

Ccat-1 silencing nucleic acid agents for treating cancer Download PDF

Info

Publication number
WO2012131673A2
WO2012131673A2 PCT/IL2012/000136 IL2012000136W WO2012131673A2 WO 2012131673 A2 WO2012131673 A2 WO 2012131673A2 IL 2012000136 W IL2012000136 W IL 2012000136W WO 2012131673 A2 WO2012131673 A2 WO 2012131673A2
Authority
WO
WIPO (PCT)
Prior art keywords
ccat
cancer
nucleic acid
rna
molecule
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IL2012/000136
Other languages
French (fr)
Other versions
WO2012131673A3 (en
Inventor
Aviram Nissan
David Halle
Ali OSMAY GURE
Victoria TSIVIN
Vera PAVLOV
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hadasit Medical Research Services and Development Co
Mor Research Applications Ltd
Original Assignee
Hadasit Medical Research Services and Development Co
Mor Research Applications Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hadasit Medical Research Services and Development Co, Mor Research Applications Ltd filed Critical Hadasit Medical Research Services and Development Co
Publication of WO2012131673A2 publication Critical patent/WO2012131673A2/en
Publication of WO2012131673A3 publication Critical patent/WO2012131673A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]

Definitions

  • the present invention is directed to the field of cancer therapy.
  • the invention is directed to compositions and methods for inhibiting colon cancer associated transcript- 1 (CCAT-1) expression, such as by using small interfering RNA (siRNA) or short hairpin RNA (shRNA), thereby treating cancer in a subject.
  • CCAT-1 colon cancer associated transcript- 1
  • siRNA small interfering RNA
  • shRNA short hairpin RNA
  • Colorectal cancer is a common disease which accounts for an estimated 153,000 cases and 52,000 deaths in the US annually and over a million new cases worldwide.
  • adenocarcinoma of the colon and rectum accounts for more new cases of cancer per year than any anatomic site except the lung.
  • the etiology is unknown, however, the pathogenesis of a malignant adenocarcinoma from normal colomc mucosa, a process that lasts an average of 10 years, is well characterized both phenotypically and at the molecular level.
  • Colon cancer Associated Transcript- 1 (CCAT-1) gene is 2528 base pairs long, and is located on chromosome 8q 24.21.
  • CCAT-1 is a non-coding RNA transcript highly expressed in CRC but not in normal colonic tissue.
  • CCAT-1 expression was high in human tissues of CRC in various stages. Compared to normal colonic tissue, normal colomc mucosa in the vicinity of the tumor site showed higher expression. High expression was observed in adenomatous polyps studied and tissues obtained from primary adenocaricnoma of the colon. High CCAT1 expression was seen in lymph node, liver, and peritoneal metastasis of CRC origin.
  • CCAT-1 upregulation was seen in cell lines derived from non-small cell lung cancer (NSCLC), squamous cell caricnoma of the uterine cervix, gastric cancer, hepatocellular carcinoma, cholangiocarcinoma, and pancreatic cancer, but not in cell lines derived form breast or ovarian cancer.
  • CCAT-1 expression was validated in human tissues, e.g., NSCLC, pancreatic, and gastric cancer. However, undetectable or minimal CCAT-1 expression was demonstrated in various normal human tissues. Nevertheless, the role of CCAT-1 in tumorigenesis has yet to be defined.
  • CCAT-1 was also identified by amplification using quantitative PCR (qPCR) from blood samples (plasma) and stool samples of patients with colon cancer and not in samples from patients without colon cancer.
  • qPCR quantitative PCR
  • RNA interference is a method of post-transcriptional inhibition of gene expression that is conserved among many eukaryotic organisms. RNAi is induced by short (i.e., ⁇ 30 nucleotide) double stranded RNA (dsRNA) molecules present in the cell. These short dsRNA molecules, called “short interfering RNA” or “siRNA”, induce degradation of messenger RNAs (mRNAs) that share sequence homology with the siRNA to within one nucleotide resolution. It is believed that the siRNA and the targeted mRNA bind to an "RNA- induced silencing complex" or "RISC,” which cleaves the targeted mRNA.
  • RISC messenger RNAs
  • siRNA is apparently recycled much like a multiple-turnover enzyme, with 1 siRNA molecule capable of inducing cleavage of approximately 1000 mRNA molecules.
  • siRNA-mediated RNAi degradation of mRNA is therefore more effective than currently available technologies for inhibiting expression of a target gene.
  • Small hairpin RNA (shRNA) or short hairpin RNA is an additional form of a double stranded RNA molecule effective in RNA interference.
  • siRNA gene-silencing in oncology is to identify loss-of-function phenotypes in genes that will result in decreased proliferation or death of cancer cells.
  • silencing or down-regulation of CCAT-1 gene expression particularly using nucleic acid agents, including but not limited to siRNA or shRNA, may be applied effectively as anti-cancer therapy.
  • compositions and methods useful for inhibiting or preventing cancer comprising nucleic acid agents capable of silencing or reducing the expression of the CCAT-1 gene for the treatment of cancer.
  • siRNA small interfering RNA
  • shRNA short hairpin RNA
  • siRNA and shRNA indicate double-stranded RNA capable of inducing RNA interference (RNAi) by cleavage of a target gene RNA transcript and are composed of a sense RNA strand having highly homologous sequence to a fragment of the target gene RNA and an antisense RNA strand having the complementary sequence to the target gene.
  • the shRNA molecule contains a sense strand and an antisense strand, and a loop sequence between the sense and antisense strands.
  • the present invention provides compositions and methods for treating cancer and/or preventing the progression of cancer, utilizing CCAT-1 silencing oligonucleotides or recombinant constructs encoding them, as detailed herein.
  • the CCAT- 1 silencing oligonucleotides of the invention are selected from the group consisting of: antisense molecules, RNA interference (RNAi) molecules (e.g. small interfering RNAs denoted siRNAs and short hairpin RNAs) and enzymatic nucleic acid molecules (e.g. ribozymes and DNAzymes).
  • RNAi RNA interference
  • siRNAs small interfering RNAs denoted siRNAs and short hairpin RNAs
  • enzymatic nucleic acid molecules e.g. ribozymes and DNAzymes.
  • CCAT-1 silencing oligonucleotides that may be used in the methods of the invention are those having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-10, and analogs, fragments or derivatives thereof, as detailed herein below.
  • the invention provides a double stranded RNA (dsRNA) molecule directed to CCAT- 1.
  • the dsRNA molecule comprises a sense RNA strand and an antisense RNA strand wherein the sense and the antisense RNA strands form an RNA duplex, wherein one strand of said dsRNA molecule comprises a nucleotide sequence specifically hybridizable with a target sequence of about 10 to about 30 contiguous nucleotides in CCAT-1 RNA transcript.
  • the target sequence is of 20 to 30 contiguous nucleotides in CCAT-1 RNA transcript.
  • the dsRNA molecule is selected from small interfering RNA (siRNA) and short hairpin RNA (shRNA).
  • the dsRNA is siRNA.
  • the dsRNA is shRNA.
  • each strand of the dsRNA molecule is no more than 30 nucleotides in length, and is preferably about 25-28 nucleotides in length.
  • the dsRNA molecules may further comprise 3' nucleotide overhangs on either or both strands, i.e. terminal portions of the nucleotide sequence that are not base paired between the two strands of the double stranded RNA molecule.
  • the overhang is about 1-5 nucleotides in length, e.g. 2 nucleotides in length.
  • dsRNA molecule of the invention comprises a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1- 5, and analogs and derivatives thereof, as follows:
  • the dsRNA molecule comprises a sense nucleic acid sequence as set forth in any one of SEQ ID NOS : 1 -5.
  • At least one strand comprises at least two 3' deoxyribonucleotides.
  • the sense strand comprises at least two 3' deoxyribonucleotides.
  • Exemplary CCAT-1 specific siRNA are those set forth in any one of SEQ ID NOs: 6 -10, as detailed hereinbelow.
  • CCAT-1 is known in the art as a non-coding RNA transcript.
  • the full length CCAT-1 cDNA was initially cloned from a HT29 (human colorectal adenocarcinoma cell line) cDNA library.
  • the CCAT-1 cDNA has the nucleic acid sequence as set forth in SEQ ID NO: 16.
  • the one strand of said dsRNA molecule comprises a nucleotide sequence specifically hybridizable with a fragment of CCAT-1.
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a CCAT-1 silencing oligonucleotide, and a pharmaceutically acceptable carrier, excipient or diluent.
  • the CCAT-1 silencing oligonucleotide is selected from the dsRNA molecules of the invention.
  • the dsRNA molecule comprises a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1- 10, and analogs and derivatives thereof.
  • the methods of the invention are effected by administering to or expressing in cells of the subject a therapeutically effective amount of at least one CCAT-1 silencing oligonucleotide of the invention, as detailed herein.
  • the present invention provides a method for treating or preventing the symptoms of a disorder associated with increased or aberrant CCAT-1 expression in a subject in need thereof, comprising expressing in cells of the subject a CCAT- 1 silencing oligonucleotide, thereby treating or preventing the symptoms of the disorder in said subject.
  • the method comprises administering to said subject a therapeutically effective amount of a dsRNA molecule of the invention, including but not limited to siRNA and shRNA.
  • the molecule comprises a sense strand having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-10.
  • the molecule comprises a sense strand having a nucleic acid sequence as set forth in SEQ ID NO: 6.
  • the disorder is a neoplastic disorder.
  • said method is for treating cancer or inhibiting tumor progression in said subject.
  • said subject has a tumor characterized by expression of CCAT-1 RNA in at least a portion of the cells of the tumor.
  • said tumor is a solid tumor.
  • said tumor is selected from colorectal cancer, non-small cell lung cancer (NSCLC), squamous cell carcinoma of the uterine cervix, gastric cancer, hepatocellular carcinoma, cholangiocarcinoma and pancreatic cancer.
  • NSCLC non-small cell lung cancer
  • squamous cell carcinoma of the uterine cervix gastric cancer
  • hepatocellular carcinoma cholangiocarcinoma and pancreatic cancer.
  • said tumor is colorectal cancer.
  • the present invention provides a method for treating cancer or inhibiting tumor progression in a subject in need thereof, comprising the step of administering to said subject a therapeutically effective amount of a CCAT-1 silencing oligonucleotide, thereby treating cancer or inhibiting tumor progression in said subject.
  • said subject has a tumor characterized by expression of CCAT- 1 RNA in at least a portion of the cells of the tumor.
  • expressing the CCAT-1 silencing oligonucleotide of the invention reduces the levels of CCAT-1 RNA in said cells, thereby treating cancer or inhibiting tumor progression in said subject.
  • the present invention provides a CCAT-1 silencing oligonucleotide for use in treating cancer or inhibiting tumor progression in a subject in need thereof.
  • the CCAT-1 silencing oligonucleotide is a siRNA molecule.
  • the siRNA molecule comprises a sense strand having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-10, or an analog, derivative or fragment thereof.
  • the present invention provides use of a CCAT-1 silencing oligonucleotide for the preparation of a medicament for treating cancer or inhibiting tumor progression in a subject in need thereof.
  • the CCAT-1 silencing oligonucleotide is an siRNA molecule.
  • the siRNA molecule comprises a sense strand having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-10, or an analog, derivative or fragment thereof.
  • the present invention provides a method for treating or preventing the symptoms of a disorder associated with increased or aberrant CCAT-1 expression in a subject in need thereof, comprising administering to a subject a therapeutically effective amount of a vector comprising a transcription regulating sequence (e.g., CCAT-1 specific promoter) and a cytotoxic gene.
  • a transcription regulating sequence e.g., CCAT-1 specific promoter
  • Figure 1 shows qPCR results of CCAT-I silencing by CCAT-1 siRNA (siRNA #13) in HT-29 colon cancer cell lines, compared to untreated cells, cells treated with lipofectamine and cells treated with scrambled siRNA.
  • Figure 2 is a graph depicting CCAT-1 silencing by CCAT1 siRNA on colon cancer cell proliferation.
  • Figure 3 depicts the impact of CCAT-1 silencing on colon cancer cell migration.
  • Figure 4 is a graph illustrating the impact of CCAT-1 silencing by shRNA on cell proliferation measured by the MTT incorporation assay compared to a control scrambled shRNA plasmid.
  • the present invention provides compositions and methods for treating or preventing the symptoms of a disorder associated with increased or aberrant CCAT-1 expression, particularly for treating cancer or inhibiting tumor progression in a subject.
  • the present invention is based, in part, on the unexpected discovery that silencing CCAT-1, e.g., using siRNA or shRNA techniques, inhibited CCAT-1 cell proliferation in HT- 29 colon cancer cell lines. Further, siRNA and shRNA specifically targeting CCAT-1 , unexpectedly reduced colon cancer cell migration.
  • the present invention provides CCAT-1 silencing oligonucleotides including but not limited to siRNA and shRNA, and recombinant constructs encoding them for treating cancer and/or preventing the cancer progression.
  • the RNA-interfering oligonucleotide or CCAT-1 silencing oligonucleotides of the present invention is selected from the group consisting of: an antisense molecule, a RNA interference (RNAi) molecule (including but not limited to small interfering RNAs (siRNAs) and hairpin RNAs) and an enzymatic nucleic acid molecule (e.g. ribozymes and DNAzymes), as detailed herein below.
  • RNAi RNA interference
  • siRNAs small interfering RNAs
  • DNAzymes e.g. ribozymes and DNAzymes
  • RNA interference or "RNAi” is a term initially applied to a phenomenon observed in plants and worms where double-stranded RNA (dsRNA) blocks gene expression in a specific and post-transcriptional manner.
  • RNA interference is a two-step process. It is believed that during the first step, which is termed the initiation step, input dsRNA is digested into 21-23 nucleotide (nt) small interfering RNAs (siRNA) by the enzyme Dicer, a member of the RNase III family of dsRNA-specific ribonucleases, which cleaves dsRNA (introduced directly or via an expressing vector, cassette or virus) in an ATP-dependent manner.
  • nt nucleotide
  • siRNA small interfering RNAs
  • RNA-induced silencing complex An ATP-dependent unwinding of the siRNA duplex is believed to be required for activation of the RISC.
  • the active RISC targets the homologous transcript by base pairing interactions and cleaves the mRNA into 12 nucleotide fragments from the 3' terminus of the siRNA.
  • RNAi RNAi RNAi RNAi amplification step within the RNAi pathway has been suggested to explain the remarkable potency of RNAi. Amplification could occur by copying of the input dsRNAs, which would generate more siRNAs, or by replication of the siRNAs formed. Alternatively or additionally, amplification could be effected by multiple turnover events of the RISC.
  • siRNA molecules of the present invention preferably comprise sense and antisense strands having nucleic acid sequence complementarity, wherein each strand is typically about 18-30 nucleotides in length.
  • each strand of the double stranded region may be e.g. 19-30, 22-28, 24-27, or 25-27 nucleotides in length.
  • RNA duplexes in the 27 base length may have significantly increased potency compared to 21- mer siRNAs designed to hybridize at the same location.
  • the superior activity of longer siRNAs can probably be attributed to the importance of Dicer- mediated cleavage and loading of effector molecules into the RISC.
  • the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 1. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 1. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 2. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 2. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 3. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 3. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 4.
  • nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 4. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 5. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 5.
  • the sense and antisense strands of the present siRNA comprise two complementary, single-stranded RNA molecules or comprise a single molecule in which two complementary portions are base-paired and are covalently linked by a single-stranded "hairpin" area (e.g. a shRNA molecule).
  • a hairpin area e.g. a shRNA molecule
  • Dicer or its equivalent
  • one or both strands of the siRNA of the invention also comprise a 3' overhang.
  • the siRNA of the invention comprises at least one 3' overhang of from 1 to about 6 nucleotides (which includes ribonucleotides or deoxynucleotides) in length, from 1 to about 5 nucleotides in length, from 1 to about 4 nucleotides in length, or from about 2 to about 4 nucleotides in length.
  • the at least one 3' overhang is 1 nucleotides in length. In another embodiment, the at least one 3' overhang is 2 nucleotides in length.
  • the at least one 3' overhang is 3 nucleotides in length. In another embodiment, the at least one 3' overhang is 4 nucleotides in length. In another embodiment, the at least one 3' overhang is 5 nucleotides in length. In another embodiment, the at least one 3' overhang is 6 nucleotides in length.
  • each strand of the siRNA of the invention can comprise 3' overhangs of dithymidylic acid ("dTdT”) or diuridylic acid (“dUdU").
  • dTdT dithymidylic acid
  • dUdU diuridylic acid
  • siRNA oligonucleotides of the invention are targeted to (hybridizable with) specific areas of the CCAT-1 transcript, and substantially comprise a sense nucleic acid sequence as set forth in any one of SEQ ID NOS: 6-10.
  • the siRNA oligonucleotides comprise a sense nucleic acid sequence as set forth in any one of SEQ ID NOS: 6-10, and an antisense nucleic acid sequence as set forth in any one of SEQ ID NOS: 11-15.
  • the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 6. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 6. In another embodiment, the antisense strand has a nucleic acid sequence as set forth in SEQ ID NO: 11. In another embodiment, the nucleic acid sequence of the antisense strand is as set forth in SEQ ID NO: 11. Each possibility represents a separate embodiment of the present invention.
  • the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 7. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 7. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 12. In another embodiment, the nucleic acid sequence of the antisense strand is as set forth in SEQ ID NO: 12. Each possibility represents a separate embodiment of the present invention.
  • the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 8. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 8. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 13. In another embodiment, the nucleic acid sequence of the antisense strand is as set forth in SEQ ID NO: 13. Each possibility represents a separate embodiment of the present invention. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 9. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 9.
  • the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 14.
  • the nucleic acid sequence of the antisense strand is as set forth in SEQ ID NO: 14.
  • the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 10. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 10. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 15. In another embodiment, the nucleic acid sequence of the antisense strand is as set forth in SEQ ID NO: 15. Each possibility represents a separate embodiment of the present invention.
  • RNAi including siRNA and shR A molecules suitable for use with the present invention are known in the art and can be carried out for example, without limitation, as follows.
  • the nucleic acid sequence of the target gene e.g., CCAT-1
  • CCAT-1 CCAT-1
  • Each AA and the 3' adjacent 19 nucleotides is recorded as a potential siRNA target site.
  • potential target sites are compared to an appropriate genomic database (e.g., human, mouse, rat etc.) using any sequence alignment software, such as the BLAST software available from the NCBI server (www.ncbi.nlm.nih.gov BLAST/). Putative target sites that exhibit significant homology to other coding sequences are filtered out.
  • an appropriate genomic database e.g., human, mouse, rat etc.
  • sequence alignment software such as the BLAST software available from the NCBI server (www.ncbi.nlm.nih.gov BLAST/).
  • Qualifying target sequences are selected as template for siRNA synthesis.
  • Preferred sequences are those including low G/C content as these have proven to be more effective in mediating gene silencing as compared to those with G/C content higher than 55 %.
  • Several target sites are preferably selected along the length of the target gene for evaluation.
  • a negative control is preferably used in conjunction.
  • Negative control siRNA preferably include the same nucleotide composition as the siRNAs but lack significant homology to the genome.
  • a scrambled nucleotide sequence of the siRNA is preferably used, provided it does not display any significant homology to any other gene.
  • An encoded siRNA agent of the present invention are of at least 10, at least 15, at least 17, at least 18, at least 19 or at least 20 bases specifically hybridizable with CCAT-1 RNA, but excluding the full length CCAT-1 RNA transcript or known variants thereof.
  • the CCAT- 1 silencing oligonucleotides of the invention are preferably no more than about 1000 bases in length, more preferably no more than about 100 bases in length. In other preferable embodiments, the oligonucleotides are no more than 40, no more than 35, preferably no more than 30 nucleotides (or base pairs) in length.
  • CCAT-1 mRNA refers to a transcriptional product of the CCAT-1 gene.
  • CCAT- 1 RNA refers to a transcriptional product of CCAT-1 as set for the in SEQ ID NO: 16.
  • oligonucleotide and “oligonucleic acid” are used interchangeably and refer to an oligomer or polymer of ribonucleic acid (ribo-oligonucleotide or ribo- oligonucleoside) or deoxyribonucleic acid. These terms include nucleic acid strands composed of naturally occurring nucleobases, sugars and covalent intersugar linkages as well as oligonucleotides having non-naturally occurring portions which function similarly. Such modified or substituted oligonucleotides may be preferred over native forms because of the valuable characteristics including, for example, increased stability in the presence of plasma nucleases and enhanced cellular uptake.
  • CCAT-1 -silencing oligonucleotide denotes an oligonucleic acid capable of specifically reducing the level or expression of the gene product, i.e. the level of CCAT-1 RNA, below the level that is observed in the absence of the oligonucleic acid.
  • gene expression is down-regulated by at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90%.
  • RNA interfering molecules as detailed herein.
  • a nucleic acid sequence specifically hybridizable with CCAT-1 RNA has a preference for hybridizing (in cells, under physiological conditions) with CCAT-1 RNA as opposed to a non-related RNA molecule (e.g. GAPDH).
  • said sequence has at least a 5-fold or at least 10-fold preference for hybridizing with CCAT-1 RNA as opposed to a non- related RNA molecule.
  • a siRNA or shRNA specifically hybridizable with CCAT-1 RNA has sufficient complementarity to an RNA product of the CCAT-1 gene for the siRNA or shRNA molecule to direct cleavage of said RNA via RNA interference.
  • variant refers to substantially similar sequences possessing common qualitative biological activities.
  • An oligonucleotide variant includes a pharmaceutically acceptable salt, homolog, analog, extension or fragment of a nucleotide sequence useful for the invention.
  • variant are chemically modified natural and synthetic nucleotide molecules (derivatives).
  • variant also encompassed within the term “variant” are substitutions (conservative or non-conservative), additions or deletions within the nucleotide sequence of the molecule, as long as the required function of silencing CCAT-1 transcripts is sufficiently maintained.
  • Oligonucleotide and polynucleotides variants may share at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity (homology).
  • homolog may refer e.g. to any degree of homology disclosed herein.
  • a sense RNA strand having highly homologous sequence to a fragment of the target gene RNA refers to a sense RNA strand having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity of the target gene RNA, e.g., to a fragment of CCAT-1 transcript.
  • a fragment of CCAT-1 transcript is about 20 to about 30 nucleotides in length.
  • the fragment of CCAT-1 transcript is no more than 30, no more than 29, no more than 28, no more than 27, no more than 26 or no more than 25 nucleotides in length.
  • the siRNA molecule comprises a nucleic acid sequence as set forth in any one of SEQ ID NOs: 1-10, wherein each possibility represents a separate embodiment of the present invention.
  • said siRNA molecule comprises a homolog, variant, fragment or variant of a fragment of SEQ ID NOs: 1-10, as detailed herein, wherein each possibility represents a separate embodiment of the present invention.
  • the siRNA molecule consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-10.
  • inhibitory RNA e.g. siRNA
  • Inhibitory RNA has been used, for example, in treating Hepatitis B Virus in animal models (Morrissey D et al, Nature Biotechnology, 23(8), 1002-1007, 2005; Morrissey D et al, Hepatology 41 (6): 1349-56, 2005).
  • DNAzyme molecule capable of specifically cleaving its encoding polynucleotides.
  • DNAzymes are single- stranded nucleic acid agents that are capable of cleaving both single and double stranded target sequences.
  • a general model (the "10-23" model) for the DNAzyme has been proposed.
  • "10- 23" DNAzymes have a catalytic domain of 1 deoxyribonucleotides, flanked by two substrate- recognition domains of seven to nine deoxyribonucleotides each. This type of DNAzyme can effectively cleave its substrate RNA at purine:pyrimidine junctions (for a review of DNAzymes see Khachigian, 2002).
  • Ribozyme molecule capable of specifically cleaving its encoding polynucleotides. Ribozymes are being increasingly used for the sequence-specific inhibition of gene expression by the cleavage of mRNAs encoding proteins of interest (Welch et al., 1998). The possibility of designing ribozymes to cleave any specific target RNA has rendered them valuable tools in both basic research and therapeutic applications. In the therapeutics area, ribozymes have been exploited to target viral RNAs in infectious diseases, dominant oncogenes in cancers and specific somatic mutations in genetic disorders.
  • ribozyme gene therapy protocols for HIV-1, cancer, and other diseases are already in clinical or pre-clinical trials. More recently, ribozymes have been used for transgenic animal research, gene target validation and pathway elucidation. Several ribozymes are in various stages of clinical trials.
  • TFOs triplex forming oligonucleotides
  • oligonucleotides Modification of the oligonucleotides, such as the introduction of intercalators and backbone substitutions, and optimization of binding conditions (pH and cation concentration) have aided in overcoming inherent obstacles to TFO activity such as charge repulsion and instability, and it was recently shown that synthetic oligonucleotides can be targeted to specific sequences (for a recent review see Seidman and Glazer, 2003).
  • nucleic acid agents designed according to the teachings of the present invention can be generated according to any nucleic acid synthesis method known in the art, including both enzymatic syntheses or solid-phase syntheses, as well as using recombinant methods well known in the art.
  • nucleic acid agents of the present invention can be also generated using an expression vector as is further described hereinbelow.
  • nucleic acid agents of the present invention are modified.
  • Nucleic acid agents can be modified using various methods known in the art.
  • nucleic acid agents are modified either in backbone, internucleoside linkages, or bases, as is described hereinunder.
  • nucleic acid agents useful according to this aspect of the present invention include oligonucleotides or polynucleotides containing modified backbones or non- natural internueleoside linkages.
  • oligonucleotides or polynucleotides having modified backbones include those that retain a phosphorus atom in the backbone, as disclosed in U.S. Pat.
  • modified oligonucleotide backbones include, for example: phosphorothioates; chiral phosphorothioates; phosphorodithioates; phosphotriesters; aminoalkyl phosphotriesters; methyl and other alkyl phosphonates, including 3'-alkylene phosphonates and chiral phosphonates; phosphinates; phosphoramidates, including 3'-amino phosphoramidate and aminoalkylphosphoramidates; thionophosphoramidates; thionoalkylphosphonates; thionoalkylphosphotriesters; and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogues of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5 -3' or 2'-5' to 5'-2'.
  • Various salts, mixed salts, and free acid forms of the above modifications can also be used.
  • modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short-chain alkyl or cycloalkyl internueleoside linkages, mixed heteroatom and alkyl or cycloalkyl internueleoside linkages, or one or more short-chain heteroatomic or heterocyclic internueleoside linkages.
  • morpholino linkages formed in part from the sugar portion of a nucleoside
  • siloxane backbones sulfide, sulfoxide, and sulfone backbones
  • formacetyl and thioformacetyl backbones methylene formacetyl and thioformacetyl backbones
  • alkene- containing backbones sulfamate backbones
  • sulfonate and sulfonamide backbones amide backbones
  • others having mixed N, O, S and CH 2 component parts, as disclosed in U.S. Pat.
  • nucleic acid agents which may be used according to the present invention are those modified in both sugar and the internueleoside linkage, i.e., the backbone of the nucleotide units is replaced with novel groups.
  • the base units are maintained for complementation with the appropriate polynucleotide target.
  • An example of such an oligonucleotide mimetic includes a peptide nucleic acid (PNA).
  • PNA oligonucleotide refers to an oligonucleotide where the sugar-backbone is replaced with an amide-containing backbone, in particular an aminoethylglycine backbone.
  • the bases are retained and are bound directly or indirectly to aza-nitrogen atoms of the amide portion of the backbone.
  • the methods of the invention include the use of antisense therapy.
  • Antisense therapy refers to the process of inactivating target DNA or mRNA sequences through the use of complementary DNA or RNA oligonucleic acids, thereby inhibiting gene transcription or translation.
  • An antisense molecule can be single stranded, double stranded or triple helix.
  • An antisense compound is specifically hybridizable when binding of the compound to the target nucleic acid interferes with the normal function of the target nucleic acid to cause a loss of activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in Vivo assays or therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays.
  • stringent hybridization conditions or “stringent conditions” refers to conditions under which the siRNa agent of the invention will hybridize to its target sequence, but to a minimal number of other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Stringent conditions under which oligomeric compounds hybridize to a target sequence are determined by the nature and composition of the oligomeric compounds and the assays in which they are being investigated.
  • oligonucleotide and the further DNA, RNA, or oligonucleotide molecule are complementary to each other when a sufficient number of complementary positions in each molecule are occupied by nucleobases which can hydrogen bond with each other.
  • “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of precise pairing or complementarity over a sufficient number of nucleobases such that stable and specific binding occurs between the oligonucleotide and a target nucleic acid.
  • Nucleic acid agents of the present invention may also include base modifications or substitutions.
  • "unmodified” or “natural” bases include the purine bases adenine (A) and guanine (G) and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).
  • Modified bases include but are not limited to other synthetic and natural bases, such as: 5-methylcytosine (5-me-C); 5-hydroxymethyl cytosine; xanthine; hypoxanthine; 2- aminoadenine; 6-methyl and other alkyl derivatives of adenine and guanine; 2-propyl and other alkyl derivatives of adenine and guanine; 2-thiouracil, 2-thiothymine, and 2- thiocytosine; 5-halouracil and cytosine; 5-propynyl uracil and cytosine; 6-azo uracil, cytosine, and thymine; 5-uracil (pseudouracil); 4-thiouracil; 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8- hydroxyl, and other 8-substituted adenines and guanines; 5-halo, particularly 5-bromo, 5- trifiuoromethyl, 5-
  • modified bases include those disclosed in; U.S. Pat. No. 3,687,808; Kroschwitz, J. I., ed. (1990), pages 858-859; Englisch et al. (1991); and Sanghvi (1993).
  • modified bases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6- azapyrimidines, and N-2, N-6, and O-6-substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine.
  • 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi et al, 1993, pages 276-278), and are presently preferred base substitutions, even more particularly when combined with 2'-0- methoxyethyl sugar modifications.
  • the nucleic acid agents of the present invention can be expressed in cells. It will be appreciated that the agents of the present invention may be expressed directly in the subject (i.e. in vivo gene therapy) or may be expressed ex vivo in a cell system (autologous or non-autologous) and then administered to the subject.
  • construct includes a nucleic acid sequence encoding silencing oligonucleic acid according to the present invention, the nucleic acid sequence operably linked to a promoter and optionally other transcription regulation sequences.
  • a nucleic acid sequence encoding the agents of the present invention is preferably ligated into a nucleic acid construct suitable for mammalian cell expression.
  • a nucleic acid construct includes a promoter sequence for directing transcription of the polynucleotide sequence in the cell in a constitutive or inducible manner.
  • constructs of the present invention may be produced using standard recombinant and synthetic methods well known in the art.
  • An isolated nucleic acid sequence can be obtained from its natural source, either as an entire (i.e., complete) gene or a portion thereof.
  • a nucleic acid molecule can also be produced using recombinant DNA technology (e.g., polymerase chain reaction (PCR) amplification, cloning) or chemical synthesis (see e.g. Sambrook et ah, 2001 ; Ausubel, et ah, 1989, Chapters 2 and 4).
  • PCR polymerase chain reaction
  • Nucleic acid sequences include natural nucleic acid sequences and homologs thereof, including, but not limited to, natural allelic variants and modified nucleic acid sequences in which nucleotides have been inserted, deleted, substituted, and/or inverted in such a manner that such modifications do not substantially interfere with the nucleic acid molecule's ability to encode a functional oligonucleotide of the invention.
  • a nucleic acid molecule homolog can be produced using a number of methods known to those skilled in the art (see, for example, Sambrook et ah, 2001).
  • nucleic acid molecules can be modified using a variety of techniques including, but not limited to, classic mutagenesis techniques and recombinant DNA techniques, such as site-directed mutagenesis, chemical treatment of a nucleic acid molecule to induce mutations, restriction enzyme cleavage of a nucleic acid fragment, ligation of nucleic acid fragments, polymerase chain reaction (PCR) amplification arid/or mutagenesis of selected regions of a nucleic acid sequence, synthesis of oligonucleotide mixtures and ligation of mixture groups to "build" a mixture of nucleic acid molecules and combinations thereof.
  • classic mutagenesis techniques and recombinant DNA techniques such as site-directed mutagenesis
  • chemical treatment of a nucleic acid molecule to induce mutations
  • nucleic acid molecule homologs can be selected from a mixture of modified nucleic acids by screening for the function of the oligonucleic acid encoded by the nucleic acid with respect to cell proliferation, migration, , for example by the methods described herein.
  • operably linked refers to linking a nucleic acid sequence to a transcription control sequence in a manner such that the molecule is able to be expressed when transfected (i.e., transformed, transduced, infected or transfected) into a host cell.
  • Transcription control sequences are sequences, which control me initiation, elongation, and termination of transcription. Particularly important transcription control sequences are those that control transcription initiation, such as promoter, enhancer, operator and repressor sequences. Suitable transcription control sequences include any transcription control sequence that can function in at least one of the recombinant cells of the present invention, A variety of such transcription control sequences are known to those skilled in the art.
  • Suitable transcription control sequences include those that function in animal, bacteria, helminth, yeast and insect cells.
  • the constructs of the invention comprise mammalian transcription control sequences, more preferably human regulatory sequences, and, optionally and additionally, other regulatory sequences.
  • Constitutive promoters suitable for use with the present invention are promoter sequences that are active under most environmental conditions and most types of cells such as the cytomegalovirus (CMV) and Rous sarcoma virus (RSV). Inducible promoters are induced in particular cell types or under certain conditions.
  • CMV cytomegalovirus
  • RSV Rous sarcoma virus
  • a vector comprising at least one recombinant construct comprising at least one nucleic acid sequence encoding a CCAT-1 silencing oligonucleotide (including but not limited to small interfering RNA (siRNA) molecule directed to CCAT-1), the nucleic acid sequence being operably linked to at least one transcription- regulating sequence.
  • the transcription-regulating sequence is a promoter.
  • the transcription-regulating sequence is another type of transcription-regulating sequence.
  • the transcription-regulating sequence is a CCAT-1 -specific promoter.
  • the transcription-regulating sequence is a tissue-specific promoter.
  • the CCAT-1 -specific promoter is followed by a gene encoding cytotoxic agents such as but not limited to chlorotoxin.
  • the term "vector” refers to a construct comprising a regulatory sequence operatively linked to a heterologous polynucleotide that is administered to target cells.
  • the vector can be a viral expression vector, a plasmid or a construct of naked D A, and, optionally, can include additional sequences required for construction, selection, stability, penetration, etc.
  • the nucleic acid construct (also referred to herein as an "expression vector") of the present invention include, in another embodiment, additional sequences, which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors).
  • additional sequences which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors).
  • typical cloning vectors may also contain a transcription and translation initiation sequence, a transcription and translation terminator, and/or a polyadenylation signal.
  • Eukaryotic promoters typically contain two types of recognition sequences, the TATA box and upstream promoter elements.
  • the TATA box located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis.
  • the other upstream promoter elements determine the rate at which transcription is initiated.
  • the promoter utilized by the nucleic acid construct of the present invention is active in the specific target cell population.
  • Enhancer elements can stimulate transcription up to 1,000-fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer/promoter combinations that are suitable for the present invention include those derived from polyoma virus, human or murine cytomegalovirus (CMV), the long term repeat from various retroviruses such as murine leukemia virus, murine or Rous sarcoma virus and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 1983, which is incorporated herein by reference.
  • CMV cytomegalovirus
  • the promoter is preferably positioned approximately the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function:
  • Polyadenylation sequences can also be added to the expression vector in order to increase RNA stability. Two distinct sequence elements are required for accurate and efficient polyadenylation: GU or U rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides, AAUAAA, located 11-30 nucleotides upstream. Exemplary termination and polyadenylation signals that are suitable for the present invention include those derived from SV40.
  • the expression vector of the present invention may typically contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA.
  • a number of animal viruses contain DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell.
  • the vector may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid.
  • RNAi expression vectors are replicable nucleic acid constructs used to express (transcribe) RNA which produces siRNA moieties in the cell in which the construct is expressed.
  • Such vectors include a transcriptional unit comprising an assembly of (1) genetic element(s) having a regulatory role in gene expression, for example, promoters, operators, or enhancers, operatively linked to (2) a "coding" sequence which is transcribed to produce a double- stranded RNA (two RNA moieties that anneal in the cell to form an siRNA, or a single hairpin RNA which can be processed to an siRNA), and (3) appropriate transcription initiation and termination sequences.
  • a transcriptional unit comprising an assembly of (1) genetic element(s) having a regulatory role in gene expression, for example, promoters, operators, or enhancers, operatively linked to (2) a "coding" sequence which is transcribed to produce a double- stranded RNA (two RNA moieties that anneal in the cell to form an siRNA, or a single hairpin RNA which can be processed to an siRNA), and (3) appropriate transcription initiation and termination sequences.
  • siRNAs small hairpin RNAs
  • Another type of siRNA expression vector encodes the sense and antisense siRNA strands under control of separate pol III promoters.
  • the siRNA strands from this vector like the shRNAs of the other vectors, may haVe 3' thymidine termination signals. Silencing efficacy by both types of expression vectors was comparable to that induced by transiently transfecting siRNA.
  • Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can be also used.
  • RNA molecules such as siRNAs
  • vectors for delivering and expressing silencing RNA molecules include for example plasmid vectors, inducible vectors, adenoviral vectors, retroviral vectors and lentiviral vectors and CMV-based vectors.
  • viruses are very specialized infectious agents that have evolved, in many cases, to elude host defense mechanisms.
  • viruses infect and propagate in specific cell types.
  • the targeting specificity of viral vectors utilizes its natural specificity to specifically target predetermined cell types and thereby introduce a recombinant gene into the infected cell.
  • the type of vector used by the present invention will depend on the cell type transformed. The ability to select suitable vectors according to the cell type transformed is well within the capabilities of the ordinary skilled artisan and as such no general description of selection consideration is provided herein.
  • nucleic acids by viral infection offers several advantages over other methods such as lipofection and electroporation, since higher transfection efficiency can be obtained due to the infectious nature of viruses.
  • the expression construct of the present invention can also include sequences engineered to enhance stability, production, purification, yield or toxicity of the expressed RNA.
  • the vector is constructed so as to enable stable expression of the CCAT-1 silencing oligonucleotide (e.g., the siRNA agent) in the target cell.
  • the vector may be integrated to the genome of the target cell using viral vectors (e.g. lentiviral vectors) or specific recombination (e.g. by the Cre/lox site-specific recombination system known in the art may be conveniently used which employs the bacteriophage PI protein Cre recombinase and its recognition sequence ioxP).
  • the vector can be transfected into bacteria such as, but not limited to, Escherichia Coli (E. Coli) to be delivered orally to a given human subject.
  • the invention provides an isolated host cell comprising at least one recombinant construct comprising at least one nucleic acid sequence encoding a CCAT-1 silencing oligonucleotide including but not limited to a small interfering RNA (siRNA) molecule directed to CCAT-1.
  • a CCAT-1 silencing oligonucleotide including but not limited to a small interfering RNA (siRNA) molecule directed to CCAT-1.
  • siRNA small interfering RNA
  • lipids for lipid-mediated transfer of the gene are, for example, DOTMA, DOPE, and DC-Choi (Tonkinson et al., 1996).
  • Other vectors can be used, such as cationic lipids, polylysine, and dendrimers.
  • the expression construct of the present invention can also include sequences engineered to enhance stability, production, purification, yield or toxicity of the expressed RNA.
  • agents of the present invention can be administered to a subject per se, or in a pharmaceutical composition where they are mixed with suitable carriers or excipientsr.
  • the composition comprises as an active agent a CCAT-1 silencing oligonucleotide of the invention.
  • CCAT-1 silencing agents e.g. siRNA or shRNA
  • CCAT-1 silencing oligonucleotides e.g. siRNA having a nucleic acid sequence as set forth in any one of SEQ ID NOs: 1-10, including variants, analogs and derivatives thereof, may be used.
  • sequences in which a deoxythymidine (dT) residue has been substituted for a uracil residue or is absent may be used (for example, when expressing an siRNA molecule from a nucleic acid construct of the invention).
  • dT deoxythymidine
  • pharmaceutical composition refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients.
  • the purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.
  • active ingredient refers to the agent accountable for the inhibition or reduction of cancer cell proliferation and/or migration (CCAT-1 silencing agent).
  • physiologically acceptable carrier and “pharmaceutically acceptable carrier” which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound.
  • excipient refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient.
  • excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
  • nucleic acid molecules Methods for the delivery of nucleic acid molecules is described in Akhtar et al., 1992, Trends Cell Biol., 2, 139; and Delivery Strategies for Antisense Oligonucleotide Therapeutics, ed. Akhtar, 1995 which are both incorporated herein by reference.
  • Sullivan et al., WO 94/02595 further describes the general methods for delivery of enzymatic RNA molecules. These protocols can be utilized for the delivery of virtually any nucleic acid molecule.
  • Nucleic acid molecules can be administered to cells by a variety of methods known to those familiar to the art, including, but not restricted to, encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles, such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres.
  • nucleic acid molecules can be directly delivered ex vivo to cells or tissues with or without the aforementioned vehicles.
  • the nucleic acid/vehicle combination is locally delivered by direct injection or by use of a catheter, infusion pump or stent.
  • routes of delivery include, but are not limited to, intravascular, intramuscular, subcutaneous or joint injection, aerosol inhalation, oral (tablet or pill form), topical, systemic, ocular, intraperitoneal and/or intrathecal delivery. More detailed descriptions of nucleic acid delivery and administration are provided in Sullivan et al., WO 94/02595 and Draper et al., WO 93/23569 which have been incorporated by reference herein.
  • the molecules of the instant invention can be used as pharmaceutical agents.
  • Pharmaceutical agents prevent, inhibit the occurrence, or treat (alleviate a symptom to some extent, preferably all of the symptoms) of the disease state in a patient.
  • the nucleic acid is locally delivered in a sustained or extended release manner in particular by means of a drug-eluting stent.
  • administering is carried out by injecting the nucleic acid agent from an injection balloon catheter directly into the vascular injury site, under pressure, through injectors contained on the surface of the catheter balloon.
  • compositions for use in accordance with the present invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations that can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
  • the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer.
  • physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer.
  • penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art.
  • Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient.
  • Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores.
  • Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP).
  • disintegrating agents may be added, such as cross- linked polyvinyl pyrrolidone, agar, Or alginic acid or a salt thereof such as sodium alginate.
  • Dragee cores are provided with suitable coatings.
  • suitable coatings For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
  • Pharmaceutical compositions which can be used orally include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
  • the push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers.
  • filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers.
  • the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
  • stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.
  • compositions may take the form of tablets or lozenges formulated in conventional manner.
  • the active ingredients for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide.
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
  • compositions described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion.
  • Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative.
  • the compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form.
  • suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions.
  • Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes.
  • Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran.
  • the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.
  • the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use.
  • compositions of the present invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.
  • compositions suitable for use in context of the present invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (nucleic acid agent) effective to prevent, alleviate or ameliorate symptoms of a disorder or prolong the survival of the subject being treated.
  • the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays.
  • a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.
  • Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals.
  • the data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human.
  • the dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition, (See e.g., Fingl, et al, 1975).
  • Dosage amount and interval may be adjusted individually to provide plasma or tissue levels of the active ingredient are sufficient to induce or suppress the biological effect (minimal effective concentration or "MEC").
  • MEC minimum effective concentration
  • the MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.
  • dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.
  • compositions to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.
  • compositions of the present invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient.
  • the pack may, for example, comprise metal or plastic foil, such as a blister pack.
  • the pack or dispenser device may be accompanied by instructions for administration.
  • the pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert.
  • Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated Condition, as if further detailed above.
  • the present invention provides a method for treating or preventing the symptoms of a disorder associated with increased or aberrant CCAT-1 expression in a subject in need thereof, comprising expressing in cells of the subject at least one CCAT-1 silencing oligonucleotide that reduces the level of CCAT-1 R A in the cells, thereby treating or preventing the symptoms of the disorder in said subject.
  • the CCAT-1 silencing oligonucleotide is an siR A molecule.
  • the CCAT-1 silencing oligonucleotide is an shR A molecule.
  • the present invention provides a method for treating or preventing the symptoms of a neoplastic disorder in a subject in need thereof, comprising expressing in cells of the subject at least one CCAT-1 silencing oligonucleotide that reduces the level of CCAT-1 RNA in the cells, thereby treating or preventing the symptoms of the neoplastic disorder in said subject.
  • the neoplastic disorder is associated with increased or aberrant CCAT-1 expression.
  • Increased CCAT-1 expression has been recently reported in human tissues of colorectal cancer (CRC) in various stages, as well as in adenomatous polyps. High CCAT-1 expression was also seen in lymph node, liver, and peritoneal metastasis of CRC origin.
  • CCAT-1 upregulation was seen in cell lines derived from non ⁇ small cell lung cancer (NSCLC), squamous cell carcinoma of the uterine cervix, gastric cancer, hepatocellular carcinoma, cholangiocarcinoma, and pancreatic cancer.
  • NSCLC non ⁇ small cell lung cancer
  • squamous cell carcinoma of the uterine cervix gastric cancer
  • hepatocellular carcinoma cholangiocarcinoma
  • pancreatic cancer pancreatic cancer
  • cancer as used herein should be understood to encompass any neoplastic disease which is characterized by abnormal and uncontrolled cell division causing malignant growth or tumor.
  • Non-limiting examples of cancer which may be treated according to at least some embodiments of the present invention are solid tumors, sarcomas, hematological malignancies, including but not limited to breast cancer (e.g. breast carcinoma), cervical cancer, ovary cancer (ovary carcinoma), endometrial cancer, melanoma, bladder cancer (bladder carcinoma), lung cancer (e.g. adenocarcinoma and non-small cell lung cancer), pancreatic cancer (e.g. pancreatic carcinoma such as exocrine pancreatic carcinoma), colon cancer (e.g.
  • colorectal carcinoma such as colon adenocarcinoma and colon adenoma
  • gastric cancer urothelial cell carcinomas
  • prostate cancer including the advanced disease, hematopoietic tumors of lymphoid lineage (e.g.
  • leukemia acute lymphocytic leukemia, chronic lymphocytic leukemia, B-cell lymphoma, Burkitt's lymphoma, multiple myeloma, Hodgkin's lymphoma, Non-Hodgkin's lymphoma), myeloid leukemia (for example, acute myelogenous leukemia (AML), chronic myelogenous leukemia), thyroid cancer, thyroid follicular cancer, myelodysplastic syndrome (MDS), tumors of mesenchymal origin (e.g.
  • fibrosarcomas and rhabdomyosarcomas melanoma, uveal melanoma, teratocarcinoma, neuroblastoma, glioma, glioblastoma, benign tumor of the skin (e.g.
  • keratoacanthomas renal cancer, anaplastic large-cell lymphoma, esophageal squamous cells carcinoma, hepatocellular carcinoma, follicular dendritic cell carcinoma, intestinal cancer, muscle-invasive cancer, seminal vesicle tumor, epidermal carcinoma, spleen cancer, head and neck cancer, stomach cancer, liver cancer, bone cancer, brain cancer, cancer of the retina, biliary cancer, small bowel cancer, salivary gland cancer, cancer of uterus, cancer of testicles, cancer of connective tissue, prostatic hypertrophy, myelodysplasia, Waldenstrom's macro globinaemia, nasopharyngeal, neuroendocrine cancer, myelodysplastic syndrome, mesothelioma, angiosarcoma, Kaposi's sarcoma, carcinoid, oesophagogastric, fallopian tube cancer, peritoneal cancer, papillary serous mullerian cancer
  • the cancer is selected from the group consisting of: colon cancer, rectal cancer, lung cancer, gastric cancer, esophageal cancer, liver cancer (e.g., hepatocellularlar caricnoma or cholangiocarcinoma), pancreatic cancer or squamous cell caricnoma of the uterine cervix.
  • the cancer is colorectal cancer.
  • the cancer is colon cancer.
  • the methods of the invention are useful for treating precancerous lesions such as adenomatous polyp.
  • the cancer is invasive. In another embodiment, the cancer is noninvasive. In one embodiment, the cancer is non metastatic. In another embodiment, the cancer is metastatic. In another embodiment, the cancer is a metastasis of colorectal cancer or lung cancer. It is to be explicitly understood that each of the cancer types is a separate embodiment of the invention.
  • the disease is selected from the group including but not limited to primary and metastatic cancer of the colon, including colon adenocarcinoma.
  • the precancerous lesion is an adenomatous polyp.
  • the cancer is lung cancer.
  • the disease is selected from the group consisting of but not limited to squamous cell lung carcinoma, lung adenocarcinoma, carcinoid, small cell lung cancer or non-small cell lung cancer.
  • the cancer is gastric cancer. In another embodiment, the cancer is liver cancer. In some embodiments, the liver cancer is selected from the group consisting of but not limited to heaptocellular carcinoma or cholangiocarcinoma. In another embodiment, the cancer is pancreatic cancer. In another embodiment, the cancer is esophageal cancer. In another embodiment, the cancer is carcinoma of the uterine cervix. Each possibility represents a separate embodiment of the invention.
  • the subject is a mammal, particularly a human.
  • the methods of the invention comprises introducing into the cells ex vivo a therapeutically effective amount of a CCAT-1 silencing oligonucleotide.
  • the pharmaceutical compositions of the present invention can be used to treat cancer alone or in combination with other established or experimental therapeutic regimens against cancer.
  • Therapeutic methods for treatment of cancer suitable for combination with the present invention include, but are not limited to, chemotherapy, biological therapy, hormonal therapy, radiotherapy, phototherapy and photodynamic therapy, surgery, nutritional therapy, ablative therapy, combined radiotherapy and chemotherapy, brachitherapy, proton beam therapy, immunotherapy, cellular therapy, and photon beam radiosurgical therapy.
  • the human colon cancer cell lines were obtained from the American Tissue Culture Collection (ATCC) (HTB-38, Manassas, VA) .
  • ATCC American Tissue Culture Collection
  • HTB-38 Manassas, VA
  • the cancer cells were cultured in RPMi 1640 medium (with L-glutamine and phenol red) supplemented with 10% Fetal Bovine Serum (FBS), 1% hepes, 1% penicillin streptomycin and 1% sodium pyruvate (Biological Industries Beit-Haemek Ltd., Beit Haemek, Israel). Cell cultures were maintained at 37°C with 5% C0 2 .
  • BLAST Basic Local Alignment Search Tool
  • thermodynamic stability of the dsRNA ends is important.
  • the 5' end of the strand having the less stable thermodynamics is preferentially incorporated into RISC. Therefore, a sense strand of RNAi duplex was designed wherein the terminal two 3' nucleotides are deoxyribonucleotides.
  • the target site of the dsRNA was extended by 4 bases to the 3' end of the sense strand and 6 bases to the 5' end of the antisense strand.
  • siRNAs were studied:
  • CCAT-1 siRNA #1 5' CUGUUAUUGUCAAGCACCCUCCUGCCU 3' (SEQ ID NO: 12) 3' dGdACAAUAACAGUUCGUGGGAGGACG 5' (SEQ ID NO: 7)
  • the double strand siRNA oligonucleotide targeting CCAT-1 was designed and synthesized by IDT Research (Coralville, IA). Twenty four hours before transfection, 80* 10 5 HT-29 cells per well were plated until 40-60% were confluent at the time of transfection. Cells were suspended in a 500 ⁇ ⁇ medium of RPMi 1640 containing 10% FBS and 1% L-glutamine (Biological Industries Beit-Haemek Ltd., Beit Haemek, Israel). At day of transfection, growth medium was changed and 500 ⁇ fresh medium were added to the wells.
  • HT-29 cells Twenty four hours before transfection, 1.5*10 5 HT-29 cells per well were plated in a manner that 40-60% of the cells were confluent at the time of transfection. The cells were suspended in a 2 mL medium of PMi 1640 containing 10% FBS and 1% L-glutamine (Biological Industries Beit-Haemek Ltd., Beit Haemek, Israel). At day of transfection, culture medium was replaced and 2 mL fresh medium was added to each well.
  • HT-29 cells were transfected using the following protocol.
  • HT-29 cells Twenty four hours before transfection, 1.5* 10 5 HT-29 cells per well were plated in a manner that 40-60% of the cells were confluent at the time of transfection.
  • the cells were suspended in a 2 mL medium of RPMI 1640 containing 10% FBS and 1% L-glutamine (Biological Industries Beit-Haemek Ltd., Beit Haemek, Israel).
  • culture medium was replaced and 2 mL fresh medium was added to each well.
  • 4 ⁇ , of plasmid (CCAT-1 shRNA) were used with ⁇ .
  • LIPOFECTAMINE 2000 Invitrogen, Carlsbad, CA
  • Reagent was diluted by 250 ⁇ L ⁇ OPTI- MEM I medium.
  • RNA was prepared 24 and 48 hours after transfection using the RNeasy Plus Mini kit (QIAGEN, Valencia, CA) including the DNA removal step, according to the manufacturer's instructions.
  • cDNA was synthesized using Super Script II reverse transcriptase kit (Invitrogen, Carlsbad, CA) with random primer.
  • RNA-containing PCR mix were used for reverse transcription. All experiments were performed in duplicates. PCR was performed according to the following protocol: 40 cycles including (denaturation: 95"C, 15 sec; annealing/extension: 60°C, 1 min).
  • Custom designed primers were used for CCAT-1 amplification (Applied Biosystems Inc., Foster City, CA, USA).
  • CCAT-1 forward primer 5 '-TC ACTGAC AAC ATCGACTTTGAAG (SEQ ID NO:
  • CCAT-1 reverse primer 5 1 - GGAG A AAAC GCTTAGCC AT AC AG (SEQ ID NO: 18); CCAT-1 probe: 6Fam-CTGGCCAGCCCTGCCACTTACCA-Tamra (SEQ ID NO:
  • GAPDH Human GAPD (GAPDH) Endogenous Control (VIC / MGB Probe, Primer Limited, 4326317E, (Applied Biosystems Inc., Foster City, CA, USA).
  • Absolute quantification was done according to the manufacturers instructions. Each sample was normalized according to its GAPDH content and also against a calibrator (HT-29).
  • MTT incorporation assay Five mgs MTT (3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) (Invitrogen, Carlsbad, CA) were dissolved in 1 mL PBS buffer. Twenty four hours and 48 h after transfection MTT stock solution was added to the cell culture to obtain a final concentration of 0.5 mg/mL MTT in the RPMi 1640 medium without phenol red, supplemented with 10% Fetal Bovine Serum (FBS) and 1% L-glutamine (Biological Industries Beit-Haemek Ltd., Beit Haemek, Israel). Fifty ⁇ L MTT solution was added to each well containing transfected cells, and to the control wells containing culture medium only. The plate was incubated for 4 hours at 37°C with 5% C0 2 .
  • MTT 3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide
  • MTT was converted to an insoluble formazan.
  • the culture medium was aspirated and 150 ⁇ DMSO was added to each well and was incubated for 10 min at 37°C with 5% C0 2 to dissolve formazan crystals. Absorbance readings were obtained at 550nm by a Nanodrop® Spectrophotometer (ND-100, NanoDrop Technologies, Wilmington, DE).
  • Cell migration assay was performed using Boyden chambers and 8 ⁇ pore size polyethylene terephthalate pores.
  • the chambers were washed with 500 ⁇ 0.1% BSA medium, and with 700 ⁇ , collagen type I 30 ⁇ g/mL for 1 h incubation at 37°C with 5% C0 2 .
  • cells were trypsinized by the addition of 500 ⁇ , Trypsin EDTA to a 6 wells plate. Cells were counted using a hemocytometer, then re-suspended to a concentration of 5*10 5 cells/mL with 0.1% BSA medium without serum. Suspended cells were incubated at 37°C for 30 min. Collagen was washed with 0.1% BSA medium and 700 ⁇ , 0.1% BSA medium without serum were added to the lower fraction. Subsequently, 200 ⁇ . of cell suspension were added to the top fraction and incubated for 30 min at 37°C with 5% C0 2.
  • Fetal Bovine serum FBS
  • FBS Fetal Bovine serum
  • the non- invading cells were removed from the upper surface of the inserts by "scrubbing" with wet cotton- tipped swabs.
  • the inserts were washed with PBS with Mg +2 and Ca +2 .
  • 500 ⁇ , of formaldehyde 4% were added to each well, incubated for 60 minutes at room temperature. After incubation, inserts were transformed to a clean well containing 500 ⁇ L ⁇ crystal violet and incubated for 30 minutes at room temperature.
  • siRNA # 1 The CCAT-1 silencing efficiency of siRNA # 1, siRNA # 10, siRNA # 12, siRNA # 13 and siRNA # 13 was studied 24h and 48h after transfection.
  • RNA was extracted from HT-29 cells transfected with CCAT-l_siRNA #13 (SEQ ID NO:6 and SEQ ID NO: 1 1). Real-time quantitative (q)PCR was performed as described above and was repeated in several cell samples. As seen in Table 3 and Figure 1, siRNA directed to CCAT-1 (e.g., CCAT-l siRNA #13) remarkably reduced CCAT-1 expression, compared to controls (lipofectamine only or scrambled Neg siRNA). The reference calibrator of HT-29 cells is RQ 1.
  • CCAT- 1 siRNA #13 comprising SEQ ID NO: 6 and 1 1
  • Table 3 and figure 1 show that an exemplary CCAT-1 siRNA molecule (CCAT- 1 siRNA #13 ; comprising SEQ ID NO: 6 and 1 1) remarkably reduced CCAT-1 expression compared to controls.
  • CCAT-1 specific siRNA reduced the number of viable HT-29 cells when compared with the controls: untransfected HT-29 cells, Lipofectamine only, scrambled Neg siRNA and CCAT-l_siRNA.
  • Proliferation of HT-29 colon cancer cell line was measured by the MTT incorporation assay (at 0, 24 and 48 hours) as described above. Experiments were repeated in several cell samples. Results are expressed in OD (performed at a wavelength of 550) and outlined in Table 4 and Figure 2. As seen, siRNA directed to CCAT-1 reduces colon cancer cell proliferation.
  • Table 4 and Figure 2 show reduction of colon cancer cell proliferation using an exemplary CCAT-1 siRNA agent (CCAT1 siRNA #13).
  • HT-29 colon cancer cell line was measured by the Transwell assay as described above. OD readings were performed at a wavelength of 570 nm. Experiments were repeated in several cell samples, fetal bovine serum was used as a chemo-attractant. Results are expressed in OD measured after 24 hours of incubation and outlined in Table 6 and Figure 3. As seen, siRNA directed to CCAT-1 reduces colon cancer cell migration.
  • Table 6 and Figure 3 show reduction of colon cancer eel migration using an exemplary CC AT- 1 siRNA agent (CC AT 1 siRNA #13).
  • CCAT-1 specific shRNA plasmid reduced the number of viable HT-29 cells when compared to HT-29 cells transfected by scrambled shRNA-containing plasmid.
  • the relative quantity (RQ) of CCATl as measured by qPCR was significantly lower (84%) in the HT29 cells transfected by the CCAT-1 shRNA containing plasmid (p ⁇ 0.00001).
  • Table 9 The impact of CCATl silencing by shRNA on cell proliferation measured by the MTT incorporation assay.
  • CCAT-l_shR A plasmid 72 12 0.655 ⁇ 0.160* As seen in table 9, CCAT-1 silencing with shRNA had a significant (p ⁇ 0.001) impact on cell proliferation as measured by the MTT incorporation assay. A significant difference in the proliferation was seen in cells transfected by CCAT-1 shRNA vs scrambled plasmid ( Figure 4).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention provides compositions and methods for inhibiting colon cancer associated transcript- 1 (CCAT-1) expression. In particular, the present invention provides small interfering RNA (siRNA) and short hairpin RNA (shRNA) molecules for treating cancer in a subject.

Description

CCAT-1 SILENCING NUCLEIC ACID AGENTS FOR TREATING CANCER
FIELD OF THE INVENTION
The present invention is directed to the field of cancer therapy. In particular, the invention is directed to compositions and methods for inhibiting colon cancer associated transcript- 1 (CCAT-1) expression, such as by using small interfering RNA (siRNA) or short hairpin RNA (shRNA), thereby treating cancer in a subject.
BACKGROUND OF THE INVENTION
Colorectal cancer (CRC) is a common disease which accounts for an estimated 153,000 cases and 52,000 deaths in the US annually and over a million new cases worldwide. In Western countries, adenocarcinoma of the colon and rectum accounts for more new cases of cancer per year than any anatomic site except the lung. The etiology is unknown, however, the pathogenesis of a malignant adenocarcinoma from normal colomc mucosa, a process that lasts an average of 10 years, is well characterized both phenotypically and at the molecular level.
Colon cancer Associated Transcript- 1 (CCAT-1) gene is 2528 base pairs long, and is located on chromosome 8q 24.21. CCAT-1 is a non-coding RNA transcript highly expressed in CRC but not in normal colonic tissue. CCAT-1 expression was high in human tissues of CRC in various stages. Compared to normal colonic tissue, normal colomc mucosa in the vicinity of the tumor site showed higher expression. High expression was observed in adenomatous polyps studied and tissues obtained from primary adenocaricnoma of the colon. High CCAT1 expression was seen in lymph node, liver, and peritoneal metastasis of CRC origin.
CCAT-1 upregulation was seen in cell lines derived from non-small cell lung cancer (NSCLC), squamous cell caricnoma of the uterine cervix, gastric cancer, hepatocellular carcinoma, cholangiocarcinoma, and pancreatic cancer, but not in cell lines derived form breast or ovarian cancer. CCAT-1 expression was validated in human tissues, e.g., NSCLC, pancreatic, and gastric cancer. However, undetectable or minimal CCAT-1 expression was demonstrated in various normal human tissues. Nevertheless, the role of CCAT-1 in tumorigenesis has yet to be defined. CCAT-1 was also identified by amplification using quantitative PCR (qPCR) from blood samples (plasma) and stool samples of patients with colon cancer and not in samples from patients without colon cancer.
International Patent Application No. WO 09/101620, to some of the inventors of the present invention and others, relates to CCAT-1 as a nucleic acid transcript specifically expressed in cancer cells, particularly colon, rectal and lung cancer. The Ί63 publication provides methods for diagnosing cancer by detecting the expression of CCAT-1 as well as isolated polynucleotides, compositions and kits for use in said diagnostic methods. The contents of that disclosure are incorporated herein as if set forth in their entirety.
RNAi
RNA interference (RNAi) is a method of post-transcriptional inhibition of gene expression that is conserved among many eukaryotic organisms. RNAi is induced by short (i.e., <30 nucleotide) double stranded RNA (dsRNA) molecules present in the cell. These short dsRNA molecules, called "short interfering RNA" or "siRNA", induce degradation of messenger RNAs (mRNAs) that share sequence homology with the siRNA to within one nucleotide resolution. It is believed that the siRNA and the targeted mRNA bind to an "RNA- induced silencing complex" or "RISC," which cleaves the targeted mRNA. The siRNA is apparently recycled much like a multiple-turnover enzyme, with 1 siRNA molecule capable of inducing cleavage of approximately 1000 mRNA molecules. siRNA-mediated RNAi degradation of mRNA is therefore more effective than currently available technologies for inhibiting expression of a target gene. Small hairpin RNA (shRNA) or short hairpin RNA is an additional form of a double stranded RNA molecule effective in RNA interference.
Recent advances in the design and delivery of targeting siRNA molecules allows efficient and highly specific gene silencing in mammalian systems. The most common application of siRNA gene-silencing in oncology is to identify loss-of-function phenotypes in genes that will result in decreased proliferation or death of cancer cells.
Nowhere in the art is it disclosed that silencing or down-regulation of CCAT-1 gene expression, particularly using nucleic acid agents, including but not limited to siRNA or shRNA, may be applied effectively as anti-cancer therapy.
There remains an unmet need for, and it would be highly advantageous to have specific compositions and methods for treating cancer or inhibiting tumor progression, particularly of colorectal and/or lung cancer.
SUMMARY OF THE INVENTION
The invention provides compositions and methods useful for inhibiting or preventing cancer, comprising nucleic acid agents capable of silencing or reducing the expression of the CCAT-1 gene for the treatment of cancer.
The present invention discloses for the first time that small interfering RNA (siRNA) agents directed to CCAT-1 can exert a beneficial effect in anti-cancer therapy. In particular, small interfering RNA (siR A) and short hairpin RNA (shRNA) targeting CCAT-1 inhibited cancer cell proliferation and reduced cancer cell migration. The terms siRNA and shRNA indicate double-stranded RNA capable of inducing RNA interference (RNAi) by cleavage of a target gene RNA transcript and are composed of a sense RNA strand having highly homologous sequence to a fragment of the target gene RNA and an antisense RNA strand having the complementary sequence to the target gene. The shRNA molecule contains a sense strand and an antisense strand, and a loop sequence between the sense and antisense strands.
Thus, the present invention provides compositions and methods for treating cancer and/or preventing the progression of cancer, utilizing CCAT-1 silencing oligonucleotides or recombinant constructs encoding them, as detailed herein. In certain embodiments, the CCAT- 1 silencing oligonucleotides of the invention are selected from the group consisting of: antisense molecules, RNA interference (RNAi) molecules (e.g. small interfering RNAs denoted siRNAs and short hairpin RNAs) and enzymatic nucleic acid molecules (e.g. ribozymes and DNAzymes). According to exemplary embodiments, CCAT-1 silencing oligonucleotides that may be used in the methods of the invention are those having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-10, and analogs, fragments or derivatives thereof, as detailed herein below.
According to a first aspect, the invention provides a double stranded RNA (dsRNA) molecule directed to CCAT- 1. In some embodiments, the dsRNA molecule comprises a sense RNA strand and an antisense RNA strand wherein the sense and the antisense RNA strands form an RNA duplex, wherein one strand of said dsRNA molecule comprises a nucleotide sequence specifically hybridizable with a target sequence of about 10 to about 30 contiguous nucleotides in CCAT-1 RNA transcript. In some embodiments the target sequence is of 20 to 30 contiguous nucleotides in CCAT-1 RNA transcript.
In some embodiments the dsRNA molecule is selected from small interfering RNA (siRNA) and short hairpin RNA (shRNA). In one embodiment, the dsRNA is siRNA. In one embodiment, the dsRNA is shRNA. Typically, each strand of the dsRNA molecule is no more than 30 nucleotides in length, and is preferably about 25-28 nucleotides in length. The dsRNA molecules may further comprise 3' nucleotide overhangs on either or both strands, i.e. terminal portions of the nucleotide sequence that are not base paired between the two strands of the double stranded RNA molecule. Preferably, the overhang is about 1-5 nucleotides in length, e.g. 2 nucleotides in length.
According to some embodiments, dsRNA molecule of the invention comprises a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1- 5, and analogs and derivatives thereof, as follows:
5'- CACAUAGUAGCUAAUGCCUACUCCC -3' (SEQ ID NO: 1);
5'- GCAGGAGGGUGCUUGACAAUAACAG -3' (SEQ ID NO: 2);
5'- GUUCCAUAUUCUACUGUGUAUCUUA -3' (SEQ ID NO: 3);
5'- GAAACACAGUGCACAACAAAUGUAA -3' (SEQ ID NO: 4); and
5'- GCAGGAGAAUCCCUUGAACCUGGAA -3' (SEQ ID NO: 5.
In certain embodiments, the dsRNA molecule comprises a sense nucleic acid sequence as set forth in any one of SEQ ID NOS : 1 -5.
In additional embodiments, at least one strand comprises at least two 3' deoxyribonucleotides. In particular embodiments, the sense strand comprises at least two 3' deoxyribonucleotides. Exemplary CCAT-1 specific siRNA are those set forth in any one of SEQ ID NOs: 6 -10, as detailed hereinbelow.
5'- CACAUAGUAGCUAAUGCCUACUCdCdC -3' (SEQ ID NO: 6);
5'- GCAGGAGGGUGCUUGACAAUAACdAdG -3' (SEQ ID NO: 7);
5'- GUUCCAUAUUCUACUGUGUAUCUdTdA -3' (SEQ ID NO: 8);
5'- GAAACACAGUGCACAACAAAUGUdAdA -3' (SEQ ID NO: 9); and
5'- GC AGG AG A AUC C CUUGA ACCUGGd Ad A -3' (SEQ ID NO: 10). CCAT-1 is known in the art as a non-coding RNA transcript. The full length CCAT-1 cDNA was initially cloned from a HT29 (human colorectal adenocarcinoma cell line) cDNA library. In a specific embodiment, the CCAT-1 cDNA has the nucleic acid sequence as set forth in SEQ ID NO: 16. In another embodiment, the one strand of said dsRNA molecule comprises a nucleotide sequence specifically hybridizable with a fragment of CCAT-1.
In another aspect, the present invention provides a pharmaceutical composition comprising a CCAT-1 silencing oligonucleotide, and a pharmaceutically acceptable carrier, excipient or diluent. In some embodiments, the CCAT-1 silencing oligonucleotide is selected from the dsRNA molecules of the invention. In particular embodiments, the dsRNA molecule comprises a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1- 10, and analogs and derivatives thereof.
The methods of the invention are effected by administering to or expressing in cells of the subject a therapeutically effective amount of at least one CCAT-1 silencing oligonucleotide of the invention, as detailed herein.
According to another aspect, the present invention provides a method for treating or preventing the symptoms of a disorder associated with increased or aberrant CCAT-1 expression in a subject in need thereof, comprising expressing in cells of the subject a CCAT- 1 silencing oligonucleotide, thereby treating or preventing the symptoms of the disorder in said subject. In some embodiments, the method comprises administering to said subject a therapeutically effective amount of a dsRNA molecule of the invention, including but not limited to siRNA and shRNA. According to some embodiments, the molecule comprises a sense strand having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-10. According to a particular embodiment the molecule comprises a sense strand having a nucleic acid sequence as set forth in SEQ ID NO: 6.
According to another embodiment, the disorder is a neoplastic disorder. According to another embodiment, said method is for treating cancer or inhibiting tumor progression in said subject. In a particular embodiment, said subject has a tumor characterized by expression of CCAT-1 RNA in at least a portion of the cells of the tumor.
In some embodiments, said tumor is a solid tumor. In particular embodiments, said tumor is selected from colorectal cancer, non-small cell lung cancer (NSCLC), squamous cell carcinoma of the uterine cervix, gastric cancer, hepatocellular carcinoma, cholangiocarcinoma and pancreatic cancer. Each possibility represents a separate embodiment of the present invention. In a particular embodiment, said tumor is colorectal cancer. According to another aspect, the present invention provides a method for treating cancer or inhibiting tumor progression in a subject in need thereof, comprising the step of administering to said subject a therapeutically effective amount of a CCAT-1 silencing oligonucleotide, thereby treating cancer or inhibiting tumor progression in said subject.
In some embodiments, said subject has a tumor characterized by expression of CCAT- 1 RNA in at least a portion of the cells of the tumor. In additional embodiments, expressing the CCAT-1 silencing oligonucleotide of the invention reduces the levels of CCAT-1 RNA in said cells, thereby treating cancer or inhibiting tumor progression in said subject.
In another aspect, the present invention provides a CCAT-1 silencing oligonucleotide for use in treating cancer or inhibiting tumor progression in a subject in need thereof. In some embodiments, the CCAT-1 silencing oligonucleotide is a siRNA molecule. In another embodiment, the siRNA molecule comprises a sense strand having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-10, or an analog, derivative or fragment thereof.
In another aspect, the present invention provides use of a CCAT-1 silencing oligonucleotide for the preparation of a medicament for treating cancer or inhibiting tumor progression in a subject in need thereof. In some embodiments, the CCAT-1 silencing oligonucleotide is an siRNA molecule. In another embodiment, the siRNA molecule comprises a sense strand having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-10, or an analog, derivative or fragment thereof.
In another aspect, the present invention provides a method for treating or preventing the symptoms of a disorder associated with increased or aberrant CCAT-1 expression in a subject in need thereof, comprising administering to a subject a therapeutically effective amount of a vector comprising a transcription regulating sequence (e.g., CCAT-1 specific promoter) and a cytotoxic gene.
Other objects, features and advantages of the present invention will become clear from the following description and drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows qPCR results of CCAT-I silencing by CCAT-1 siRNA (siRNA #13) in HT-29 colon cancer cell lines, compared to untreated cells, cells treated with lipofectamine and cells treated with scrambled siRNA. Figure 2 is a graph depicting CCAT-1 silencing by CCAT1 siRNA on colon cancer cell proliferation.
Figure 3 depicts the impact of CCAT-1 silencing on colon cancer cell migration.
Figure 4 is a graph illustrating the impact of CCAT-1 silencing by shRNA on cell proliferation measured by the MTT incorporation assay compared to a control scrambled shRNA plasmid.
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides compositions and methods for treating or preventing the symptoms of a disorder associated with increased or aberrant CCAT-1 expression, particularly for treating cancer or inhibiting tumor progression in a subject.
The present invention is based, in part, on the unexpected discovery that silencing CCAT-1, e.g., using siRNA or shRNA techniques, inhibited CCAT-1 cell proliferation in HT- 29 colon cancer cell lines. Further, siRNA and shRNA specifically targeting CCAT-1 , unexpectedly reduced colon cancer cell migration.
Thus, the present invention provides CCAT-1 silencing oligonucleotides including but not limited to siRNA and shRNA, and recombinant constructs encoding them for treating cancer and/or preventing the cancer progression.
In certain embodiments, the RNA-interfering oligonucleotide or CCAT-1 silencing oligonucleotides of the present invention is selected from the group consisting of: an antisense molecule, a RNA interference (RNAi) molecule (including but not limited to small interfering RNAs (siRNAs) and hairpin RNAs) and an enzymatic nucleic acid molecule (e.g. ribozymes and DNAzymes), as detailed herein below. In a preferable embodiment, the oligonucleotide is a siRNA molecule. In one embodiment, the constructs of the invention direct expression in cells of the subject of an siRNA molecule that inhibits or reduces CCAT-1 RNA levels via RNA interference.
"RNA interference" or "RNAi" is a term initially applied to a phenomenon observed in plants and worms where double-stranded RNA (dsRNA) blocks gene expression in a specific and post-transcriptional manner. RNA interference is a two-step process. It is believed that during the first step, which is termed the initiation step, input dsRNA is digested into 21-23 nucleotide (nt) small interfering RNAs (siRNA) by the enzyme Dicer, a member of the RNase III family of dsRNA-specific ribonucleases, which cleaves dsRNA (introduced directly or via an expressing vector, cassette or virus) in an ATP-dependent manner. Successive cleavage events degrade the RNA to 19-21 bp siRNA duplexes, each strand with 2-nucleotide 3' overhangs. In the effector step, the siRNA duplexes bind to a nuclease complex to form the RNA-induced silencing complex (RISC). An ATP-dependent unwinding of the siRNA duplex is believed to be required for activation of the RISC. The active RISC then targets the homologous transcript by base pairing interactions and cleaves the mRNA into 12 nucleotide fragments from the 3' terminus of the siRNA. Although the mechanism of cleavage is still to be elucidated, research indicates that each RISC contains a single siRNA and an RNase. It is possible to eliminate the "initiation step" by providing siRNA a priori. An amplification step within the RNAi pathway has been suggested to explain the remarkable potency of RNAi. Amplification could occur by copying of the input dsRNAs, which would generate more siRNAs, or by replication of the siRNAs formed. Alternatively or additionally, amplification could be effected by multiple turnover events of the RISC.
The siRNA molecules of the present invention preferably comprise sense and antisense strands having nucleic acid sequence complementarity, wherein each strand is typically about 18-30 nucleotides in length. For example, each strand of the double stranded region may be e.g. 19-30, 22-28, 24-27, or 25-27 nucleotides in length.
Recent reports indicate that chemically synthesized RNA duplexes in the 27 base length may have significantly increased potency compared to 21- mer siRNAs designed to hybridize at the same location. The superior activity of longer siRNAs can probably be attributed to the importance of Dicer- mediated cleavage and loading of effector molecules into the RISC.
In one embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 1. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 1. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 2. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 2. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 3. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 3. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 4. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 4. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 5. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 5. Each possibility represents a separate embodiment of the present invention.
In some embodiments, the sense and antisense strands of the present siRNA comprise two complementary, single-stranded RNA molecules or comprise a single molecule in which two complementary portions are base-paired and are covalently linked by a single-stranded "hairpin" area (e.g. a shRNA molecule). Without wishing to be bound by any theory, it is believed that the hairpin area of the latter type of siRNA molecule is cleaved xntracellularly by Dicer (or its equivalent) to form a siRNA of two individual base-paired RNA molecules. Preferably, one or both strands of the siRNA of the invention also comprise a 3' overhang.
As used herein, "3' overhang" refers to at least one unpaired nucleotide extending from the 3 '-end of an RNA strand. Thus in one embodiment, the siRNA of the invention comprises at least one 3' overhang of from 1 to about 6 nucleotides (which includes ribonucleotides or deoxynucleotides) in length, from 1 to about 5 nucleotides in length, from 1 to about 4 nucleotides in length, or from about 2 to about 4 nucleotides in length. In some embodiments, the at least one 3' overhang is 1 nucleotides in length. In another embodiment, the at least one 3' overhang is 2 nucleotides in length. In another embodiment, the at least one 3' overhang is 3 nucleotides in length. In another embodiment, the at least one 3' overhang is 4 nucleotides in length. In another embodiment, the at least one 3' overhang is 5 nucleotides in length. In another embodiment, the at least one 3' overhang is 6 nucleotides in length.
In the embodiment in which both strands of the siRNA molecule comprise a 3' overhang, the length of the overhangs can be the same or different for each strand. In some embodiments, the 3' overhang is present on both strands of the siRNA, and is 2 nucleotides in length. For example, each strand of the siRNA of the invention can comprise 3' overhangs of dithymidylic acid ("dTdT") or diuridylic acid ("dUdU").
As illustrated in Table 1 hereinbelow, preferable silencing oligonucleotides of the invention are targeted to (hybridizable with) specific areas of the CCAT-1 transcript, and substantially comprise a sense nucleic acid sequence as set forth in any one of SEQ ID NOS: 6-10. In certain embodiments, the siRNA oligonucleotides comprise a sense nucleic acid sequence as set forth in any one of SEQ ID NOS: 6-10, and an antisense nucleic acid sequence as set forth in any one of SEQ ID NOS: 11-15. - exemplary CCAT-1 down regulating sequences
Figure imgf000011_0001
In one embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 6. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 6. In another embodiment, the antisense strand has a nucleic acid sequence as set forth in SEQ ID NO: 11. In another embodiment, the nucleic acid sequence of the antisense strand is as set forth in SEQ ID NO: 11. Each possibility represents a separate embodiment of the present invention.
In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 7. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 7. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 12. In another embodiment, the nucleic acid sequence of the antisense strand is as set forth in SEQ ID NO: 12. Each possibility represents a separate embodiment of the present invention.
In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 8. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 8. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 13. In another embodiment, the nucleic acid sequence of the antisense strand is as set forth in SEQ ID NO: 13. Each possibility represents a separate embodiment of the present invention. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 9. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 9. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 14. In another embodiment, the nucleic acid sequence of the antisense strand is as set forth in SEQ ID NO: 14. Each possibility represents a separate embodiment of the present invention.
In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 10. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 10. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 15. In another embodiment, the nucleic acid sequence of the antisense strand is as set forth in SEQ ID NO: 15. Each possibility represents a separate embodiment of the present invention.
Synthesis RNAi including siRNA and shR A molecules suitable for use with the present invention are known in the art and can be carried out for example, without limitation, as follows. First, the nucleic acid sequence of the target gene (e.g., CCAT-1) is optionally scanned downstream for AA di-nucleotide sequences. Each AA and the 3' adjacent 19 nucleotides is recorded as a potential siRNA target site.
Second, potential target sites are compared to an appropriate genomic database (e.g., human, mouse, rat etc.) using any sequence alignment software, such as the BLAST software available from the NCBI server (www.ncbi.nlm.nih.gov BLAST/). Putative target sites that exhibit significant homology to other coding sequences are filtered out.
Qualifying target sequences are selected as template for siRNA synthesis. Preferred sequences are those including low G/C content as these have proven to be more effective in mediating gene silencing as compared to those with G/C content higher than 55 %. Several target sites are preferably selected along the length of the target gene for evaluation. For better evaluation of the selected siRNAs, a negative control is preferably used in conjunction. Negative control siRNA preferably include the same nucleotide composition as the siRNAs but lack significant homology to the genome. Thus, a scrambled nucleotide sequence of the siRNA is preferably used, provided it does not display any significant homology to any other gene.
An encoded siRNA agent of the present invention are of at least 10, at least 15, at least 17, at least 18, at least 19 or at least 20 bases specifically hybridizable with CCAT-1 RNA, but excluding the full length CCAT-1 RNA transcript or known variants thereof. The CCAT- 1 silencing oligonucleotides of the invention are preferably no more than about 1000 bases in length, more preferably no more than about 100 bases in length. In other preferable embodiments, the oligonucleotides are no more than 40, no more than 35, preferably no more than 30 nucleotides (or base pairs) in length.
As used herein the phrase "CCAT-1 mRNA", "CCAT-1 transcript" or "CCAT-1 RNA" refers to a transcriptional product of the CCAT-1 gene. In some embodiments, CCAT- 1 RNA refers to a transcriptional product of CCAT-1 as set for the in SEQ ID NO: 16.
The terms "oligonucleotide" and "oligonucleic acid" are used interchangeably and refer to an oligomer or polymer of ribonucleic acid (ribo-oligonucleotide or ribo- oligonucleoside) or deoxyribonucleic acid. These terms include nucleic acid strands composed of naturally occurring nucleobases, sugars and covalent intersugar linkages as well as oligonucleotides having non-naturally occurring portions which function similarly. Such modified or substituted oligonucleotides may be preferred over native forms because of the valuable characteristics including, for example, increased stability in the presence of plasma nucleases and enhanced cellular uptake.
The terms "CCAT-1 -silencing oligonucleotide", "CCAT-1 -silencing oligonucleic acid", "CCAT-1 expression-inhibiting oligonucleic acid", "CCAT-1 expression-inhibiting oligonucleotide" or "oligonucleic acid that inhibits or reduces CCAT-1 expression," as used herein, denote an oligonucleic acid capable of specifically reducing the level or expression of the gene product, i.e. the level of CCAT-1 RNA, below the level that is observed in the absence of the oligonucleic acid. In some embodiments gene expression is down-regulated by at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90%.
Expression-inhibiting (down-regulating or silencing) oligonucleic acids include, for example, RNA interfering molecules (RNAi) as detailed herein.
The phrase "specifically hybridizable" as used herein indicates a sufficient degree of complementarity such that stable and specific binding occurs between the target and the oligonucleotide. A nucleic acid sequence specifically hybridizable with CCAT-1 RNA has a preference for hybridizing (in cells, under physiological conditions) with CCAT-1 RNA as opposed to a non-related RNA molecule (e.g. GAPDH). Preferably, said sequence has at least a 5-fold or at least 10-fold preference for hybridizing with CCAT-1 RNA as opposed to a non- related RNA molecule. Thus, a siRNA or shRNA specifically hybridizable with CCAT-1 RNA has sufficient complementarity to an RNA product of the CCAT-1 gene for the siRNA or shRNA molecule to direct cleavage of said RNA via RNA interference.
As used herein, the term "variant" refers to substantially similar sequences possessing common qualitative biological activities. An oligonucleotide variant includes a pharmaceutically acceptable salt, homolog, analog, extension or fragment of a nucleotide sequence useful for the invention. Encompassed within the term "variant" are chemically modified natural and synthetic nucleotide molecules (derivatives). Also encompassed within the term "variant" are substitutions (conservative or non-conservative), additions or deletions within the nucleotide sequence of the molecule, as long as the required function of silencing CCAT-1 transcripts is sufficiently maintained. Oligonucleotide and polynucleotides variants may share at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity (homology). In different embodiments, "homolog" may refer e.g. to any degree of homology disclosed herein.
As used herein, the term "a sense RNA strand having highly homologous sequence to a fragment of the target gene RNA" refers to a sense RNA strand having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity of the target gene RNA, e.g., to a fragment of CCAT-1 transcript. In some embodiments of the methods and compositions of the invention, a fragment of CCAT-1 transcript is about 20 to about 30 nucleotides in length. In another embodiment, the fragment of CCAT-1 transcript is no more than 30, no more than 29, no more than 28, no more than 27, no more than 26 or no more than 25 nucleotides in length.
As used herein the term "about" refers to ±10%. It is required that any numeric value in the application will be referred to as if it is preceded by the term "about".
In another embodiment, the siRNA molecule comprises a nucleic acid sequence as set forth in any one of SEQ ID NOs: 1-10, wherein each possibility represents a separate embodiment of the present invention. In other embodiments, said siRNA molecule comprises a homolog, variant, fragment or variant of a fragment of SEQ ID NOs: 1-10, as detailed herein, wherein each possibility represents a separate embodiment of the present invention. In another embodiment, the siRNA molecule consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-10.
While a preferable embodiment of the invention is directed to double-stranded siRNA molecules such as illustrated in Table 1, it is to be understood that other modifications are within the scope of the present invention. Thus, the use of analogs, variants and derivatives of the sequences set forth in any one of SEQ ID NOS: 1-10 is contemplated, as long as the inhibitory activity of the CCAT-1 downregulating oligonucleotide is retained.
Therapeutic methods for use of inhibitory RNA (e.g. siRNA) are well known in the art. Inhibitory RNA has been used, for example, in treating Hepatitis B Virus in animal models (Morrissey D et al, Nature Biotechnology, 23(8), 1002-1007, 2005; Morrissey D et al, Hepatology 41 (6): 1349-56, 2005).
Another agent capable of silencing the expression of a CCAT-1 RNA is a DNAzyme molecule capable of specifically cleaving its encoding polynucleotides. DNAzymes are single- stranded nucleic acid agents that are capable of cleaving both single and double stranded target sequences. A general model (the "10-23" model) for the DNAzyme has been proposed. "10- 23" DNAzymes have a catalytic domain of 1 deoxyribonucleotides, flanked by two substrate- recognition domains of seven to nine deoxyribonucleotides each. This type of DNAzyme can effectively cleave its substrate RNA at purine:pyrimidine junctions (for a review of DNAzymes see Khachigian, 2002).
Examples of construction and amplification of synthetic, engineered DNAzymes recognizing single and double-stranded target cleavage sites have been disclosed in U.S. Pat. No. 6,326,174 to Joyce et al.
Another agent capable of silencing CCAT-1 is a ribozyme molecule capable of specifically cleaving its encoding polynucleotides. Ribozymes are being increasingly used for the sequence-specific inhibition of gene expression by the cleavage of mRNAs encoding proteins of interest (Welch et al., 1998). The possibility of designing ribozymes to cleave any specific target RNA has rendered them valuable tools in both basic research and therapeutic applications. In the therapeutics area, ribozymes have been exploited to target viral RNAs in infectious diseases, dominant oncogenes in cancers and specific somatic mutations in genetic disorders. Most notably, several ribozyme gene therapy protocols for HIV-1, cancer, and other diseases are already in clinical or pre-clinical trials. More recently, ribozymes have been used for transgenic animal research, gene target validation and pathway elucidation. Several ribozymes are in various stages of clinical trials.
An additional method of silencing CCAT-1 is via triplex forming oligonucleotides (TFOs). In the last decade, studies have shown that TFOs can be designed which can recognize and bind to polypurine/polypirimidine regions in double-stranded helical DNA in a sequence-specific manner. Thus the DNA sequence encoding the CCAT-1 RNA of the present invention can be targeted thereby down-regulating the RNA molecule. The recognition rules governing TFQs are outlined e.g. by EP Publication 375408. Modification of the oligonucleotides, such as the introduction of intercalators and backbone substitutions, and optimization of binding conditions (pH and cation concentration) have aided in overcoming inherent obstacles to TFO activity such as charge repulsion and instability, and it was recently shown that synthetic oligonucleotides can be targeted to specific sequences (for a recent review see Seidman and Glazer, 2003).
Nucleic acid synthesis
The nucleic acid agents designed according to the teachings of the present invention can be generated according to any nucleic acid synthesis method known in the art, including both enzymatic syntheses or solid-phase syntheses, as well as using recombinant methods well known in the art.
Equipment and reagents for executing solid-phase synthesis are commercially available from, for example, IDT Research (Coralville, IA). Any other means for such synthesis may also be employed; the actual synthesis of the nucleic acid agents is well within the capabilities of one skilled in the art and can be accomplished via established methodologies as detailed in, for example: Sambrook, J. and Russell, D. W. (2001), "Molecular Cloning: A Laboratory Manual"; Ausubel, R. M. et al„ eds. (1994, 1989), "Current Protocols in Molecular Biology," Volumes I-III, John Wiley & Sons, Baltimore, Maryland; Perbal, B. (1 88), "A Practical Guide to Molecular Cloning," John Wiley & Sons, New York; utilizing solid-phase chemistry, e.g. cyanoethyl phosphoramidite followed by deprotection, desalting, and purification by, for example, an automated trityl-on method or HPLC.
It will be appreciated that nucleic acid agents of the present invention can be also generated using an expression vector as is further described hereinbelow.
Optionally and preferably, the nucleic acid agents of the present invention are modified. Nucleic acid agents can be modified using various methods known in the art.
In certain embodiments, nucleic acid agents are modified either in backbone, internucleoside linkages, or bases, as is described hereinunder.
Specific examples of nucleic acid agents useful according to this aspect of the present invention include oligonucleotides or polynucleotides containing modified backbones or non- natural internueleoside linkages. Examples of oligonucleotides or polynucleotides having modified backbones include those that retain a phosphorus atom in the backbone, as disclosed in U.S. Pat. Nos.: 4,469,863; 4,476,301 ; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050.
Other modified oligonucleotide backbones include, for example: phosphorothioates; chiral phosphorothioates; phosphorodithioates; phosphotriesters; aminoalkyl phosphotriesters; methyl and other alkyl phosphonates, including 3'-alkylene phosphonates and chiral phosphonates; phosphinates; phosphoramidates, including 3'-amino phosphoramidate and aminoalkylphosphoramidates; thionophosphoramidates; thionoalkylphosphonates; thionoalkylphosphotriesters; and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogues of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5 -3' or 2'-5' to 5'-2'. Various salts, mixed salts, and free acid forms of the above modifications can also be used.
Alternatively, modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short-chain alkyl or cycloalkyl internueleoside linkages, mixed heteroatom and alkyl or cycloalkyl internueleoside linkages, or one or more short-chain heteroatomic or heterocyclic internueleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide, and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene- containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts, as disclosed in U.S. Pat. Nos.: 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141 ; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439.
Other nucleic acid agents which may be used according to the present invention are those modified in both sugar and the internueleoside linkage, i.e., the backbone of the nucleotide units is replaced with novel groups. The base units are maintained for complementation with the appropriate polynucleotide target. An example of such an oligonucleotide mimetic includes a peptide nucleic acid (PNA). A PNA oligonucleotide refers to an oligonucleotide where the sugar-backbone is replaced with an amide-containing backbone, in particular an aminoethylglycine backbone. The bases are retained and are bound directly or indirectly to aza-nitrogen atoms of the amide portion of the backbone. United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262; each of which is herein incorporated by reference. Other backbone modifications which may be used in the present invention are disclosed in U.S. Pat. No. 6,303,374.
In some embodiments the methods of the invention include the use of antisense therapy. Antisense therapy refers to the process of inactivating target DNA or mRNA sequences through the use of complementary DNA or RNA oligonucleic acids, thereby inhibiting gene transcription or translation. An antisense molecule can be single stranded, double stranded or triple helix. An antisense compound is specifically hybridizable when binding of the compound to the target nucleic acid interferes with the normal function of the target nucleic acid to cause a loss of activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in Vivo assays or therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays.
In the present invention the phrase "stringent hybridization conditions" or "stringent conditions" refers to conditions under which the siRNa agent of the invention will hybridize to its target sequence, but to a minimal number of other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Stringent conditions under which oligomeric compounds hybridize to a target sequence are determined by the nature and composition of the oligomeric compounds and the assays in which they are being investigated.
"Complementary" as used herein, refers to the capacity for precise pairing between one nucleobase of an oligomeric compound to its target nucleic acid. For example, if a nucleobase at a certain position of an oligonucleotide or polynucleotide (an oligomeric compound), is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, said target nucleic acid being a DNA, RNA, or oligonucleotide molecule, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be a complementary position. The oligonucleotide and the further DNA, RNA, or oligonucleotide molecule are complementary to each other when a sufficient number of complementary positions in each molecule are occupied by nucleobases which can hydrogen bond with each other. Thus, "specifically hybridizable" and "complementary" are terms which are used to indicate a sufficient degree of precise pairing or complementarity over a sufficient number of nucleobases such that stable and specific binding occurs between the oligonucleotide and a target nucleic acid.
Nucleic acid agents of the present invention may also include base modifications or substitutions. As used herein, "unmodified" or "natural" bases include the purine bases adenine (A) and guanine (G) and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). "Modified" bases include but are not limited to other synthetic and natural bases, such as: 5-methylcytosine (5-me-C); 5-hydroxymethyl cytosine; xanthine; hypoxanthine; 2- aminoadenine; 6-methyl and other alkyl derivatives of adenine and guanine; 2-propyl and other alkyl derivatives of adenine and guanine; 2-thiouracil, 2-thiothymine, and 2- thiocytosine; 5-halouracil and cytosine; 5-propynyl uracil and cytosine; 6-azo uracil, cytosine, and thymine; 5-uracil (pseudouracil); 4-thiouracil; 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8- hydroxyl, and other 8-substituted adenines and guanines; 5-halo, particularly 5-bromo, 5- trifiuoromethyl, and other 5-substituted uracils and cytosines; 7-methylguanine and 7- methyladenine; 8-azaguanine and 8-azaadenine; 7-deazaguanine and 7-deazaadenine; and 3- deazaguanine and 3 -deazaadenine. Additional modified bases include those disclosed in; U.S. Pat. No. 3,687,808; Kroschwitz, J. I., ed. (1990), pages 858-859; Englisch et al. (1991); and Sanghvi (1993). Such modified bases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6- azapyrimidines, and N-2, N-6, and O-6-substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi et al, 1993, pages 276-278), and are presently preferred base substitutions, even more particularly when combined with 2'-0- methoxyethyl sugar modifications.
Recombinant constructs, vectors and host cells
As mentioned hereinabove, the nucleic acid agents of the present invention (e.g., an siRNA molecule such as those set forth by any one of SEQ ID NOs: 1-10) can be expressed in cells. It will be appreciated that the agents of the present invention may be expressed directly in the subject (i.e. in vivo gene therapy) or may be expressed ex vivo in a cell system (autologous or non-autologous) and then administered to the subject.
The term "construct" as used herein includes a nucleic acid sequence encoding silencing oligonucleic acid according to the present invention, the nucleic acid sequence operably linked to a promoter and optionally other transcription regulation sequences.
To express such an agent (i.e., to produce an RNA molecule) in mammalian cells, a nucleic acid sequence encoding the agents of the present invention is preferably ligated into a nucleic acid construct suitable for mammalian cell expression. Such a nucleic acid construct includes a promoter sequence for directing transcription of the polynucleotide sequence in the cell in a constitutive or inducible manner.
The constructs of the present invention may be produced using standard recombinant and synthetic methods well known in the art. An isolated nucleic acid sequence can be obtained from its natural source, either as an entire (i.e., complete) gene or a portion thereof. A nucleic acid molecule can also be produced using recombinant DNA technology (e.g., polymerase chain reaction (PCR) amplification, cloning) or chemical synthesis (see e.g. Sambrook et ah, 2001 ; Ausubel, et ah, 1989, Chapters 2 and 4). Nucleic acid sequences include natural nucleic acid sequences and homologs thereof, including, but not limited to, natural allelic variants and modified nucleic acid sequences in which nucleotides have been inserted, deleted, substituted, and/or inverted in such a manner that such modifications do not substantially interfere with the nucleic acid molecule's ability to encode a functional oligonucleotide of the invention.
A nucleic acid molecule homolog can be produced using a number of methods known to those skilled in the art (see, for example, Sambrook et ah, 2001). For example, nucleic acid molecules can be modified using a variety of techniques including, but not limited to, classic mutagenesis techniques and recombinant DNA techniques, such as site-directed mutagenesis, chemical treatment of a nucleic acid molecule to induce mutations, restriction enzyme cleavage of a nucleic acid fragment, ligation of nucleic acid fragments, polymerase chain reaction (PCR) amplification arid/or mutagenesis of selected regions of a nucleic acid sequence, synthesis of oligonucleotide mixtures and ligation of mixture groups to "build" a mixture of nucleic acid molecules and combinations thereof. For example, nucleic acid molecule homologs can be selected from a mixture of modified nucleic acids by screening for the function of the oligonucleic acid encoded by the nucleic acid with respect to cell proliferation, migration, , for example by the methods described herein.
The phrase "operably linked" refers to linking a nucleic acid sequence to a transcription control sequence in a manner such that the molecule is able to be expressed when transfected (i.e., transformed, transduced, infected or transfected) into a host cell. Transcription control sequences are sequences, which control me initiation, elongation, and termination of transcription. Particularly important transcription control sequences are those that control transcription initiation, such as promoter, enhancer, operator and repressor sequences. Suitable transcription control sequences include any transcription control sequence that can function in at least one of the recombinant cells of the present invention, A variety of such transcription control sequences are known to those skilled in the art. Exemplary suitable transcription control sequences include those that function in animal, bacteria, helminth, yeast and insect cells. Preferably, the constructs of the invention comprise mammalian transcription control sequences, more preferably human regulatory sequences, and, optionally and additionally, other regulatory sequences.
Constitutive promoters suitable for use with the present invention are promoter sequences that are active under most environmental conditions and most types of cells such as the cytomegalovirus (CMV) and Rous sarcoma virus (RSV). Inducible promoters are induced in particular cell types or under certain conditions.
In another aspect, there is provided a vector comprising at least one recombinant construct comprising at least one nucleic acid sequence encoding a CCAT-1 silencing oligonucleotide (including but not limited to small interfering RNA (siRNA) molecule directed to CCAT-1), the nucleic acid sequence being operably linked to at least one transcription- regulating sequence. In another embodiment, the transcription-regulating sequence is a promoter. In another embodiment, the transcription-regulating sequence is another type of transcription-regulating sequence. In another embodiment, the transcription-regulating sequence is a CCAT-1 -specific promoter. In another embodiment, the transcription-regulating sequence is a tissue-specific promoter. In another embodiment, the CCAT-1 -specific promoter is followed by a gene encoding cytotoxic agents such as but not limited to chlorotoxin.
As used herein, the term "vector" refers to a construct comprising a regulatory sequence operatively linked to a heterologous polynucleotide that is administered to target cells. The vector can be a viral expression vector, a plasmid or a construct of naked D A, and, optionally, can include additional sequences required for construction, selection, stability, penetration, etc.
The nucleic acid construct (also referred to herein as an "expression vector") of the present invention include, in another embodiment, additional sequences, which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors). In addition, typical cloning vectors may also contain a transcription and translation initiation sequence, a transcription and translation terminator, and/or a polyadenylation signal.
Eukaryotic promoters typically contain two types of recognition sequences, the TATA box and upstream promoter elements. The TATA box, located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis. The other upstream promoter elements determine the rate at which transcription is initiated. Preferably, the promoter utilized by the nucleic acid construct of the present invention is active in the specific target cell population.
Enhancer elements can stimulate transcription up to 1,000-fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer/promoter combinations that are suitable for the present invention include those derived from polyoma virus, human or murine cytomegalovirus (CMV), the long term repeat from various retroviruses such as murine leukemia virus, murine or Rous sarcoma virus and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 1983, which is incorporated herein by reference.
In the construction of the expression vector, the promoter is preferably positioned approximately the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function:
Polyadenylation sequences can also be added to the expression vector in order to increase RNA stability. Two distinct sequence elements are required for accurate and efficient polyadenylation: GU or U rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides, AAUAAA, located 11-30 nucleotides upstream. Exemplary termination and polyadenylation signals that are suitable for the present invention include those derived from SV40.
In addition to the elements already described, the expression vector of the present invention may typically contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA. For example, a number of animal viruses contain DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell.
The vector may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid.
The type of vector may be selected e.g. for producing single-stranded or double- stranded RNA or DNA. Suitable vectors for producing various silencing oligonucleic acids are known in the art. For example, RNAi expression vectors (also referred to as a dsRNA- encoding plasmid) are replicable nucleic acid constructs used to express (transcribe) RNA which produces siRNA moieties in the cell in which the construct is expressed. Such vectors include a transcriptional unit comprising an assembly of (1) genetic element(s) having a regulatory role in gene expression, for example, promoters, operators, or enhancers, operatively linked to (2) a "coding" sequence which is transcribed to produce a double- stranded RNA (two RNA moieties that anneal in the cell to form an siRNA, or a single hairpin RNA which can be processed to an siRNA), and (3) appropriate transcription initiation and termination sequences.
Some of these vectors have been engineered to express small hairpin RNAs (shRNAs), which are processed in vivo into siRNA-like molecules capable of carrying out gene-specific silencing. Another type of siRNA expression vector encodes the sense and antisense siRNA strands under control of separate pol III promoters. The siRNA strands from this vector, like the shRNAs of the other vectors, may haVe 3' thymidine termination signals. Silencing efficacy by both types of expression vectors was comparable to that induced by transiently transfecting siRNA. Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can be also used.
Various vectors for delivering and expressing silencing RNA molecules such as siRNAs are known in the art, and include for example plasmid vectors, inducible vectors, adenoviral vectors, retroviral vectors and lentiviral vectors and CMV-based vectors.
As described above, viruses are very specialized infectious agents that have evolved, in many cases, to elude host defense mechanisms. Typically, viruses infect and propagate in specific cell types. The targeting specificity of viral vectors utilizes its natural specificity to specifically target predetermined cell types and thereby introduce a recombinant gene into the infected cell. Thus, the type of vector used by the present invention will depend on the cell type transformed. The ability to select suitable vectors according to the cell type transformed is well within the capabilities of the ordinary skilled artisan and as such no general description of selection consideration is provided herein.
Various methods can be used to introduce the expression vector of the present invention into cells. Such methods are generally described in Sambrook et al, (1989, 1992), in Ausubel et at., (1989), Chang et al., (1995), Vega et al., (1995), and Gilboa et at. (1986), and include, for example, stable or transient transfection, lipofection, electroporation and infection with recombinant viral vectors. In addition, see U.S. Pat. Nos. 5,464,764 and 5,487,992 for positive-negative selection methods.
Introduction of nucleic acids by viral infection offers several advantages over other methods such as lipofection and electroporation, since higher transfection efficiency can be obtained due to the infectious nature of viruses.
Other than containing the necessary elements for the transcription of the inserted coding sequence, the expression construct of the present invention can also include sequences engineered to enhance stability, production, purification, yield or toxicity of the expressed RNA.
In certain embodiments, the vector is constructed so as to enable stable expression of the CCAT-1 silencing oligonucleotide (e.g., the siRNA agent) in the target cell. For example, the vector may be integrated to the genome of the target cell using viral vectors (e.g. lentiviral vectors) or specific recombination (e.g. by the Cre/lox site-specific recombination system known in the art may be conveniently used which employs the bacteriophage PI protein Cre recombinase and its recognition sequence ioxP). In certain embodiments, the vector can be transfected into bacteria such as, but not limited to, Escherichia Coli (E. Coli) to be delivered orally to a given human subject.
In another aspect, the invention provides an isolated host cell comprising at least one recombinant construct comprising at least one nucleic acid sequence encoding a CCAT-1 silencing oligonucleotide including but not limited to a small interfering RNA (siRNA) molecule directed to CCAT-1.
Useful lipids for lipid-mediated transfer of the gene are, for example, DOTMA, DOPE, and DC-Choi (Tonkinson et al., 1996). Other vectors can be used, such as cationic lipids, polylysine, and dendrimers.
Other than containing the necessary elements for the transcription of the inserted coding sequence, the expression construct of the present invention can also include sequences engineered to enhance stability, production, purification, yield or toxicity of the expressed RNA.
Pharmaceutical compositions
The agents of the present invention can be administered to a subject per se, or in a pharmaceutical composition where they are mixed with suitable carriers or excipientsr.
In various embodiments, the composition comprises as an active agent a CCAT-1 silencing oligonucleotide of the invention. It should further be noted, that CCAT-1 silencing agents (e.g. siRNA or shRNA) used in the compositions and methods of the present invention may contain a nucleic acid sequence as denoted herein, including analogs, variants and derivatives thereof as detailed herein, with or without a 3' overhang. In certain embodiments, CCAT-1 silencing oligonucleotides (e.g. siRNA) having a nucleic acid sequence as set forth in any one of SEQ ID NOs: 1-10, including variants, analogs and derivatives thereof, may be used. Thus, for example, sequences in which a deoxythymidine (dT) residue has been substituted for a uracil residue or is absent may be used (for example, when expressing an siRNA molecule from a nucleic acid construct of the invention).
As used herein, "pharmaceutical composition" refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.
Herein the term "active ingredient" refers to the agent accountable for the inhibition or reduction of cancer cell proliferation and/or migration (CCAT-1 silencing agent). Hereinafter, the phrases "physiologically acceptable carrier" and "pharmaceutically acceptable carrier" which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound.
Herein the term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
Techniques for formulation and administration of drugs may be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, PA, latest edition, which is incorporated herein by reference.
Methods for the delivery of nucleic acid molecules is described in Akhtar et al., 1992, Trends Cell Biol., 2, 139; and Delivery Strategies for Antisense Oligonucleotide Therapeutics, ed. Akhtar, 1995 which are both incorporated herein by reference. Sullivan et al., WO 94/02595, further describes the general methods for delivery of enzymatic RNA molecules. These protocols can be utilized for the delivery of virtually any nucleic acid molecule. Nucleic acid molecules can be administered to cells by a variety of methods known to those familiar to the art, including, but not restricted to, encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles, such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres. For some indications, nucleic acid molecules can be directly delivered ex vivo to cells or tissues with or without the aforementioned vehicles. Alternatively, the nucleic acid/vehicle combination is locally delivered by direct injection or by use of a catheter, infusion pump or stent. Other routes of delivery include, but are not limited to, intravascular, intramuscular, subcutaneous or joint injection, aerosol inhalation, oral (tablet or pill form), topical, systemic, ocular, intraperitoneal and/or intrathecal delivery. More detailed descriptions of nucleic acid delivery and administration are provided in Sullivan et al., WO 94/02595 and Draper et al., WO 93/23569 which have been incorporated by reference herein.
The molecules of the instant invention can be used as pharmaceutical agents. Pharmaceutical agents prevent, inhibit the occurrence, or treat (alleviate a symptom to some extent, preferably all of the symptoms) of the disease state in a patient.
Alternately, one may administer the pharmaceutical composition in a local rather than systemic manner, for example by direct injection or by means of a catheter, infusion pump or stent. Alternatively, the nucleic acid is locally delivered in a sustained or extended release manner in particular by means of a drug-eluting stent. In another particular embodiment, administering is carried out by injecting the nucleic acid agent from an injection balloon catheter directly into the vascular injury site, under pressure, through injectors contained on the surface of the catheter balloon.
Pharmaceutical compositions for use in accordance with the present invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations that can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
For oral administration, the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient. Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as cross- linked polyvinyl pyrrolidone, agar, Or alginic acid or a salt thereof such as sodium alginate.
Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses. Pharmaceutical compositions which can be used orally, include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.
For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.
For administration by nasal inhalation, the active ingredients for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
The pharmaceutical composition described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative. The compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
Pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions. Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use.
The pharmaceutical composition of the present invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.
Pharmaceutical compositions suitable for use in context of the present invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (nucleic acid agent) effective to prevent, alleviate or ameliorate symptoms of a disorder or prolong the survival of the subject being treated.
Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.
For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays. For example, a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.
Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition, (See e.g., Fingl, et al, 1975).
Dosage amount and interval may be adjusted individually to provide plasma or tissue levels of the active ingredient are sufficient to induce or suppress the biological effect (minimal effective concentration or "MEC"). The MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.
Depending on the severity and responsiveness of the condition to be treated, dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.
The amount of a composition to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.
Compositions of the present invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert. Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated Condition, as if further detailed above.
Therapeutic use
In some embodiments, the present invention provides a method for treating or preventing the symptoms of a disorder associated with increased or aberrant CCAT-1 expression in a subject in need thereof, comprising expressing in cells of the subject at least one CCAT-1 silencing oligonucleotide that reduces the level of CCAT-1 R A in the cells, thereby treating or preventing the symptoms of the disorder in said subject. In an exemplary embodiment, the CCAT-1 silencing oligonucleotide is an siR A molecule. In another exemplary embodiment, the CCAT-1 silencing oligonucleotide is an shR A molecule.
In some embodiments, the present invention provides a method for treating or preventing the symptoms of a neoplastic disorder in a subject in need thereof, comprising expressing in cells of the subject at least one CCAT-1 silencing oligonucleotide that reduces the level of CCAT-1 RNA in the cells, thereby treating or preventing the symptoms of the neoplastic disorder in said subject. In some embodiments, the neoplastic disorder is associated with increased or aberrant CCAT-1 expression. Increased CCAT-1 expression has been recently reported in human tissues of colorectal cancer (CRC) in various stages, as well as in adenomatous polyps. High CCAT-1 expression was also seen in lymph node, liver, and peritoneal metastasis of CRC origin. CCAT-1 upregulation was seen in cell lines derived from non^small cell lung cancer (NSCLC), squamous cell carcinoma of the uterine cervix, gastric cancer, hepatocellular carcinoma, cholangiocarcinoma, and pancreatic cancer.
The term "cancer" as used herein should be understood to encompass any neoplastic disease which is characterized by abnormal and uncontrolled cell division causing malignant growth or tumor. Non-limiting examples of cancer which may be treated according to at least some embodiments of the present invention are solid tumors, sarcomas, hematological malignancies, including but not limited to breast cancer (e.g. breast carcinoma), cervical cancer, ovary cancer (ovary carcinoma), endometrial cancer, melanoma, bladder cancer (bladder carcinoma), lung cancer (e.g. adenocarcinoma and non-small cell lung cancer), pancreatic cancer (e.g. pancreatic carcinoma such as exocrine pancreatic carcinoma), colon cancer (e.g. colorectal carcinoma, such as colon adenocarcinoma and colon adenoma), gastric cancer, urothelial cell carcinomas, prostate cancer including the advanced disease, hematopoietic tumors of lymphoid lineage (e.g. leukemia, acute lymphocytic leukemia, chronic lymphocytic leukemia, B-cell lymphoma, Burkitt's lymphoma, multiple myeloma, Hodgkin's lymphoma, Non-Hodgkin's lymphoma), myeloid leukemia (for example, acute myelogenous leukemia (AML), chronic myelogenous leukemia), thyroid cancer, thyroid follicular cancer, myelodysplastic syndrome (MDS), tumors of mesenchymal origin (e.g. fibrosarcomas and rhabdomyosarcomas), melanoma, uveal melanoma, teratocarcinoma, neuroblastoma, glioma, glioblastoma, benign tumor of the skin (e.g. keratoacanthomas), renal cancer, anaplastic large-cell lymphoma, esophageal squamous cells carcinoma, hepatocellular carcinoma, follicular dendritic cell carcinoma, intestinal cancer, muscle-invasive cancer, seminal vesicle tumor, epidermal carcinoma, spleen cancer, head and neck cancer, stomach cancer, liver cancer, bone cancer, brain cancer, cancer of the retina, biliary cancer, small bowel cancer, salivary gland cancer, cancer of uterus, cancer of testicles, cancer of connective tissue, prostatic hypertrophy, myelodysplasia, Waldenstrom's macro globinaemia, nasopharyngeal, neuroendocrine cancer, myelodysplastic syndrome, mesothelioma, angiosarcoma, Kaposi's sarcoma, carcinoid, oesophagogastric, fallopian tube cancer, peritoneal cancer, papillary serous mullerian cancer, malignant ascites, gastrointestinal stromal tumor (GIST), and a hereditary cancer syndrome such as Li-Fraumeni syndrome and Von Hippel-Lindau syndrome (VHL), wherein said cancer exhibits high or aberrant levels of CCAT-1 RNA.
According to certain embodiments of the methods of the present invention, the cancer is selected from the group consisting of: colon cancer, rectal cancer, lung cancer, gastric cancer, esophageal cancer, liver cancer (e.g., hepatocelullar caricnoma or cholangiocarcinoma), pancreatic cancer or squamous cell caricnoma of the uterine cervix. In one embodiment, the cancer is colorectal cancer. In another embodiment, the cancer is colon cancer. In another embodiment, the methods of the invention are useful for treating precancerous lesions such as adenomatous polyp.
In one embodiment, the cancer is invasive. In another embodiment, the cancer is noninvasive. In one embodiment, the cancer is non metastatic. In another embodiment, the cancer is metastatic. In another embodiment, the cancer is a metastasis of colorectal cancer or lung cancer. It is to be explicitly understood that each of the cancer types is a separate embodiment of the invention.
With regard to colon cancer, the disease is selected from the group including but not limited to primary and metastatic cancer of the colon, including colon adenocarcinoma. In one embodiment, the precancerous lesion is an adenomatous polyp.
In another embodiment, the cancer is lung cancer. With regard to lung cancer, the disease is selected from the group consisting of but not limited to squamous cell lung carcinoma, lung adenocarcinoma, carcinoid, small cell lung cancer or non-small cell lung cancer.
In another embodiment, the cancer is gastric cancer. In another embodiment, the cancer is liver cancer. In some embodiments, the liver cancer is selected from the group consisting of but not limited to heaptocellular carcinoma or cholangiocarcinoma. In another embodiment, the cancer is pancreatic cancer. In another embodiment, the cancer is esophageal cancer. In another embodiment, the cancer is carcinoma of the uterine cervix. Each possibility represents a separate embodiment of the invention.
In one embodiment, the subject is a mammal, particularly a human.
In some embodiments the methods of the invention comprises introducing into the cells ex vivo a therapeutically effective amount of a CCAT-1 silencing oligonucleotide.
In certain embodiments, the pharmaceutical compositions of the present invention can be used to treat cancer alone or in combination with other established or experimental therapeutic regimens against cancer. Therapeutic methods for treatment of cancer suitable for combination with the present invention include, but are not limited to, chemotherapy, biological therapy, hormonal therapy, radiotherapy, phototherapy and photodynamic therapy, surgery, nutritional therapy, ablative therapy, combined radiotherapy and chemotherapy, brachitherapy, proton beam therapy, immunotherapy, cellular therapy, and photon beam radiosurgical therapy.
The following examples are presented in order to more fully illustrate some embodiments of the invention. They should, in no way be construed, however, as limiting the broad scope of the invention.
EXAMPLES
Materials and methods
Human colon cancer cell lines
The human colon cancer cell lines were obtained from the American Tissue Culture Collection (ATCC) (HTB-38, Manassas, VA) .The cancer cells were cultured in RPMi 1640 medium (with L-glutamine and phenol red) supplemented with 10% Fetal Bovine Serum (FBS), 1% hepes, 1% penicillin streptomycin and 1% sodium pyruvate (Biological Industries Beit-Haemek Ltd., Beit Haemek, Israel). Cell cultures were maintained at 37°C with 5% C02.
Selection of siRNA for targeting of CCAT-1
First, using Basic Local Alignment Search Tool (BLAST), 19 DNA nucleotide-long sequences were selected. The selected sequences were two complementary 21-mer RNA sequences, each with a two base 3' overhang, and 30-70% GC content for the internal stability of the siRNA.
The thermodynamic stability of the dsRNA ends is important. The 5' end of the strand having the less stable thermodynamics is preferentially incorporated into RISC. Therefore, a sense strand of RNAi duplex was designed wherein the terminal two 3' nucleotides are deoxyribonucleotides. In order to create a Dicer substrate RNAi from the standard 21-mer RNAi sequence, the target site of the dsRNA was extended by 4 bases to the 3' end of the sense strand and 6 bases to the 5' end of the antisense strand.
The following siRNAs were studied:
CCAT-1 siRNA #1 : 5' CUGUUAUUGUCAAGCACCCUCCUGCCU 3' (SEQ ID NO: 12) 3' dGdACAAUAACAGUUCGUGGGAGGACG 5' (SEQ ID NO: 7)
CCAT-1 siRNA # 10:
5' UAAGAUACACAGUAGAAUAUGGAACUA 3' (SEQ ID NO: 13) 3' dAdTUCUAUGUGUCAUCUUAUACCUUG 5' (SEQ ID NO: 8)
CCAT-1 siRNA # 12:
5 ' UU AC AUUUGUUGUGC ACUGUGUUUCU A 3 ' (SEQ ID NO : 14) 3' dAdAUGUAAACAACACGUGACACAAAG 5' (SEQ ID NO: 9)
CCAT-1 siRNA # I5:
5' UUCCAGGUUCAAGGGAUUCUCCUGCCU 3' (SEQ ID NO: 15)
3' dAdAGGUCCAAGUUCCCUAAGAGGACG 5' (SEQ ID NO: 10)
CCAT-1 siRNA # 13:
5' GGGAGUAGGCAUUAGCUACUAUGUGAG 3' (SEQ ID NO: 1 1)
3' dCdCCUCAUCCGUAAUCGAUGAUACAC 5' (SEQ ID NO: 6)
siRNA transfection in a 24 well plate
The double strand siRNA oligonucleotide targeting CCAT-1 was designed and synthesized by IDT Research (Coralville, IA). Twenty four hours before transfection, 80* 105 HT-29 cells per well were plated until 40-60% were confluent at the time of transfection. Cells were suspended in a 500 μΐ^ medium of RPMi 1640 containing 10% FBS and 1% L-glutamine (Biological Industries Beit-Haemek Ltd., Beit Haemek, Israel). At day of transfection, growth medium was changed and 500 μΙ fresh medium were added to the wells.
For each well of transfected cells, 50 pmol CCAT-1 siRNA was added to 50 of OPTI- MEM I Reduced Serum medium without serum (Invitrogen, Carlsbad, CA). In a different tube, 0.5 jiL LIPOFECTAMINE 2000 (Invitrogen, Carlsbad, CA) reagent was added to 50 μΐ, OPTI- MEM I medium. Incubation time was 5 minutes at room temperature. The contents of both tubes were mixed for 20 minutes at room temperature to allow siRNA- LIPOFECTAMINE 2000 reagent complexes to form. After incubation, the siRNA- LIPOFECT AMINE 2000 complexes (100 μΐ,) were transferred to transfection wells and were mixed gently. Untreated HT-29 cells served as control. Additional controls contained HT-29 cells with LIPOFECTAMINE 2000 only and with Scrambled (non-specific) siRNA. Growth medium was replaced 6 h after transfection.
siRNA transfection in a 6 well plate
Twenty four hours before transfection, 1.5*105 HT-29 cells per well were plated in a manner that 40-60% of the cells were confluent at the time of transfection. The cells were suspended in a 2 mL medium of PMi 1640 containing 10% FBS and 1% L-glutamine (Biological Industries Beit-Haemek Ltd., Beit Haemek, Israel). At day of transfection, culture medium was replaced and 2 mL fresh medium was added to each well.
For each well transfected, 250 pmol CCAT-1 siRNA were diluted with 250 μL· of OPTI- MEM I Reduced Serum medium (Invitrogen, Carlsbad, CA). In addition, 2.5 LIPOFECTAMINE 2000 (Invitrogen, Carlsbad, CA) Reagent was diluted by 250 \xL OPTI- MEM I medium. Incubation time was 5 minutes at room temperature. Then, both tubes were combined and incubated for 20 minutes at room temperature to allow siRNA- LIPOFECTAMINE 2000 reagent complexes to form. After incubation, siRNA- LIPOFECTAMINE 2000 complexes (500 μί) were added directly to each well and were mixed gently. Untreated HT-29 cells served as control. Additional controls contained HT-29 cells with LIPOFECTAMINE 2000 only and with Scrambled (non-specific) siRNA. Growth medium was replaced 6 h after transfection.
In order to study the reproducibility of the transfection process, all transfections were repeated 5 times or more. All cells were harvested and the following assays were performed.
Stable transfection of HT-29 with shRNA
For stable transfection of HT-29 with shRNA a GFP containing plasmid MISSION® Custom Vector (PLKO.1 -puro-CMV-tGFP) also containing a gene conferring Furomycin resistance was used. The specific insert (siRNA #13; comprising SEQ ID NO: 11 and SEQ ID NO: 6) was inserted into the plasmid according to the manufacturer (Sigma, St Louis, USA) instructions. HT-29 cells were transfected using the following protocol.
Twenty four hours before transfection, 1.5* 105 HT-29 cells per well were plated in a manner that 40-60% of the cells were confluent at the time of transfection. The cells were suspended in a 2 mL medium of RPMI 1640 containing 10% FBS and 1% L-glutamine (Biological Industries Beit-Haemek Ltd., Beit Haemek, Israel). At day of transfection, culture medium was replaced and 2 mL fresh medium was added to each well. For each well transfected, 4 μί, of plasmid (CCAT-1 shRNA) were used with ΙΟμΙ. LIPOFECTAMINE 2000 (Invitrogen, Carlsbad, CA) Reagent was diluted by 250 μL· OPTI- MEM I medium. Incubation time was 5 minutes at room temperature. RNA was extracted and the CCATl RNA quantity was compared between cells transfected with CCAT-1 shRNA and scrambled shRNA using qPCR. In order to eliminate all untransfected cells, 2 g of Furamycin were added to the medium resulting in killing of all untransfected cells.
In order to study the reproducibility of the transfection process, all transfections were repeated 5 times or more. All cells were harvested and the following assays were performed.
The high yield of transfection was confirmed by observation after the fluorescence of GFP molecule in HT-29 cells which were transfected by CCAT-1 shRNA plasmid.
RNA extraction
RNA was prepared 24 and 48 hours after transfection using the RNeasy Plus Mini kit (QIAGEN, Valencia, CA) including the DNA removal step, according to the manufacturer's instructions.
cDNA synthesis
The synthesis of cDNA was performed using Super Script II reverse transcriptase kit (Invitrogen, Carlsbad, CA) with random primer.
RT-PCR analysis
One g of total RNA was used for reverse transcription in a total of 20μ1 reaction mix. 2μ1 of the RNA-containing PCR mix were used for PCR. All experiments were performed in duplicates. PCR was performed according to the following protocol: 40 cycles including (denaturation: 95"C, 15 sec; annealing/extension: 60°C, 1 min).
Custom designed primers were used for CCAT-1 amplification (Applied Biosystems Inc., Foster City, CA, USA).
CCAT-1 forward primer: 5 '-TC ACTGAC AAC ATCGACTTTGAAG (SEQ ID NO:
17);
CCAT-1 reverse primer: 51 - GGAG A AAAC GCTTAGCC AT AC AG (SEQ ID NO: 18); CCAT-1 probe: 6Fam-CTGGCCAGCCCTGCCACTTACCA-Tamra (SEQ ID NO:
19). GAPDH (Human GAPD (GAPDH) Endogenous Control (VIC / MGB Probe, Primer Limited, 4326317E, (Applied Biosystems Inc., Foster City, CA, USA).
Absolute quantification was done according to the manufacturers instructions. Each sample was normalized according to its GAPDH content and also against a calibrator (HT-29).
MTT assay
Cell proliferation was studied by MTT incorporation assay. Five mgs MTT (3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) (Invitrogen, Carlsbad, CA) were dissolved in 1 mL PBS buffer. Twenty four hours and 48 h after transfection MTT stock solution was added to the cell culture to obtain a final concentration of 0.5 mg/mL MTT in the RPMi 1640 medium without phenol red, supplemented with 10% Fetal Bovine Serum (FBS) and 1% L-glutamine (Biological Industries Beit-Haemek Ltd., Beit Haemek, Israel). Fifty μL MTT solution was added to each well containing transfected cells, and to the control wells containing culture medium only. The plate was incubated for 4 hours at 37°C with 5% C02.
After incubation, MTT was converted to an insoluble formazan. The culture medium was aspirated and 150 μΤ DMSO was added to each well and was incubated for 10 min at 37°C with 5% C02 to dissolve formazan crystals. Absorbance readings were obtained at 550nm by a Nanodrop® Spectrophotometer (ND-100, NanoDrop Technologies, Wilmington, DE).
Migration assa
Cell migration assay was performed using Boyden chambers and 8 μπι pore size polyethylene terephthalate pores.
After transfection for 48 h, the chambers were washed with 500 μΐ^ 0.1% BSA medium, and with 700 μΐ, collagen type I 30 μg/mL for 1 h incubation at 37°C with 5% C02. During incubation cells were trypsinized by the addition of 500 μΐ, Trypsin EDTA to a 6 wells plate. Cells were counted using a hemocytometer, then re-suspended to a concentration of 5*105 cells/mL with 0.1% BSA medium without serum. Suspended cells were incubated at 37°C for 30 min. Collagen was washed with 0.1% BSA medium and 700 ΐ, 0.1% BSA medium without serum were added to the lower fraction. Subsequently, 200 μΐ. of cell suspension were added to the top fraction and incubated for 30 min at 37°C with 5% C02.
Then, 90 μ^ of Fetal Bovine serum (FBS) were added to 10% of the whole sample volume as a chemoattractant and incubated for 24 h at -37°C with 5% C02. After 24 hours of incubation, the non- invading cells were removed from the upper surface of the inserts by "scrubbing" with wet cotton- tipped swabs. Before fixing the invaded cells, the inserts were washed with PBS with Mg+2 and Ca+2. Then, 500 ΐ, of formaldehyde 4% were added to each well, incubated for 60 minutes at room temperature. After incubation, inserts were transformed to a clean well containing 500 μL· crystal violet and incubated for 30 minutes at room temperature. Following this second incubation, stained inserts were washed for several times in and allowed to air dry. Finally each insert was transferred to a new well, adding 200 ΐ, of methanol, then incubated for 15 minutes on an orbital shaker. Absorbance readings were obtained at 570nm by a Nanodrop® Spectrophotometer (ND-100, NanoDrop Technologies, Wilmington, DE).
Example 1
siR A selection for CCAT-1 knock-down
The CCAT-1 silencing efficiency of siRNA # 1, siRNA # 10, siRNA # 12, siRNA # 13 and siRNA # 13 was studied 24h and 48h after transfection.
Table 2 - siRNA silencing efficiency of CCAT-1
Figure imgf000038_0001
As seen in Table 2, all examined siRNA molecule were efficient in silencing CCAT-1. CCAT-1 siRNA # 13 had the best silencing effect, reproducible over a wide range of experimental conditions and therefore was selected to be used in the current study. Example 2
Transfection efficiency of siRNA directed to CCAT-1 reduces CCAT-1 expression
RNA was extracted from HT-29 cells transfected with CCAT-l_siRNA #13 (SEQ ID NO:6 and SEQ ID NO: 1 1). Real-time quantitative (q)PCR was performed as described above and was repeated in several cell samples. As seen in Table 3 and Figure 1, siRNA directed to CCAT-1 (e.g., CCAT-l siRNA #13) remarkably reduced CCAT-1 expression, compared to controls (lipofectamine only or scrambled Neg siRNA). The reference calibrator of HT-29 cells is RQ=1.
Table 3: qPCR results of CCAT-1 silencing by CCAT1 siRNA
Figure imgf000039_0001
Independent Samples T test: *24 h: Between Scrambled Neg siRNA and CCAT- 1 siRNA # 13: P value=0.003. **48 h: Between Scrambled Neg siRNA and CCAT-l_siRNA # 13 : P value<0.00001.
Table 3 and figure 1 show that an exemplary CCAT-1 siRNA molecule (CCAT- 1 siRNA #13 ; comprising SEQ ID NO: 6 and 1 1) remarkably reduced CCAT-1 expression compared to controls. Example 3
The impact of CCAT-1 siRNA on HT-29 colon cancer cell line proliferation
CCAT-1 specific siRNA reduced the number of viable HT-29 cells when compared with the controls: untransfected HT-29 cells, Lipofectamine only, scrambled Neg siRNA and CCAT-l_siRNA. Proliferation of HT-29 colon cancer cell line was measured by the MTT incorporation assay (at 0, 24 and 48 hours) as described above. Experiments were repeated in several cell samples. Results are expressed in OD (performed at a wavelength of 550) and outlined in Table 4 and Figure 2. As seen, siRNA directed to CCAT-1 reduces colon cancer cell proliferation.
Table 4: The impact of CCAT-1 silencing on cell proliferation
Figure imgf000040_0001
Independent Samples T test: *24 h: Between Scrambled Neg siRNA and CCAT- 1 siRNA # 13: P <0.00001. **48 h: Between Scrambled Neg siRNA and CCAT-l_siRNA # 13: P=0.002. Table 5: ANOVA test:
Figure imgf000041_0001
Table 4 and Figure 2 show reduction of colon cancer cell proliferation using an exemplary CCAT-1 siRNA agent (CCAT1 siRNA #13).
Example 4
The impact of CCAT-1 siRNA on colon cancer cell migration
Migration of HT-29 colon cancer cell line was measured by the Transwell assay as described above. OD readings were performed at a wavelength of 570 nm. Experiments were repeated in several cell samples, fetal bovine serum was used as a chemo-attractant. Results are expressed in OD measured after 24 hours of incubation and outlined in Table 6 and Figure 3. As seen, siRNA directed to CCAT-1 reduces colon cancer cell migration.
Table 6: The impact of CCAT-1 silencing by CCAT1 siRNA on cell migration
Figure imgf000041_0002
Independent Samples T test: *48 h: Between Scrambled Neg siRNA and CCAT- 1 siRNA # 13: P=0.01 Table 7: ANOVA test:
Figure imgf000042_0001
Table 6 and Figure 3 show reduction of colon cancer eel migration using an exemplary CC AT- 1 siRNA agent (CC AT 1 siRNA #13).
Example 5
The impact of CCAT-1 shRNA on HT-29 colon cancer cell line proliferation
CCAT-1 specific shRNA plasmid reduced the number of viable HT-29 cells when compared to HT-29 cells transfected by scrambled shRNA-containing plasmid. As seen in table 8, the relative quantity (RQ) of CCATl as measured by qPCR was significantly lower (84%) in the HT29 cells transfected by the CCAT-1 shRNA containing plasmid (p<0.00001).
Table 8: Relative Quantity of CCATl RNA in HT29 cells transfected by shRNA
Figure imgf000042_0002
Table 9: The impact of CCATl silencing by shRNA on cell proliferation measured by the MTT incorporation assay.
Sample Time after plating the n MeaniSD- OD cells (hours)
Scrambled shRNA plasmid 24 12 0.237±0.032
Scrambled shRNA plasmid 48 12 0.623±0.113
Scrambled shRNA plasmid 72 12 1.439±0.140
CCAT-l_shRNA plasmid 24 12 0.197±0.043*
CCAT-l_shRNA plasmid 48 12 0.282±0.044*
CCAT-l_shR A plasmid 72 12 0.655±0.160* As seen in table 9, CCAT-1 silencing with shRNA had a significant (p<0.001) impact on cell proliferation as measured by the MTT incorporation assay. A significant difference in the proliferation was seen in cells transfected by CCAT-1 shRNA vs scrambled plasmid (Figure 4).
Table 10: The impact of CCAT1 silencing by shRNA on cell migration
Figure imgf000043_0001
Migration of HT-29 cells transfected by CCAT1 or scrambled shRNA was measured by the transwell migration assay.
As seen in table 10, a significant {p~0.006) reduction in the migration of HT-29 cells transfected by CCAT1 ShRNA was observed.
The foregoing description of the specific embodiments will so fully reveal the general nature of the mvention that others can, by applying current knowledge, readily modify and/or adapt for various applications such specific embodiments without undue experimentation and without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. The means, materials, and steps for carrying out various disclosed functions may take a variety of alternative forms without departing from the invention.

Claims

1. A double stranded RNA (dsRNA) molecule directed to colon cancer associated transcript- 1 (CCAT-1), the dsRNA molecule comprises a sense RNA strand and an antisense RNA strand wherein the sense and the antisense RNA strands form an RNA duplex, wherein one strand of said dsRNA molecule comprises a nucleotide sequence specifically hybridizable with a target sequence of about 20 to about 30 contiguous nucleotides in CCAT-1 RNA.
2. The dsRNA molecule of claim 1, wherein the strands are each no more than about 30 nucleotides in length.
3. The dsRNA molecule of claim 1 selected from small interfering RNA (siRNA) and short hairpin RNA (shRNA).
4. The dsRNA molecule of claim 1 , wherein the sense strand of said dsRNA molecule has a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-5.
5. The dsRNA molecule of claim 1, wherein the sense strand of said dsRNA molecule has a nucleic acid sequence as set forth in SEQ ID NO: 1.
6. The dsRNA molecule of claim 1, wherein at least one strand comprises at least two 3' deoxyribonucleotides.
7. The dsRNA molecule of claim 6, wherein the sense strand of said dsRNA molecule has a nucleic acid sequence as set forth in any one of SEQ ID NOS: 6-10.
8. The dsRNA molecule of claim 6 wherein the sense strand of said dsRNA molecule has a nucleic acid sequence as set forth in SEQ ID NO: 6.
9. The dsRNA molecule of claim 1, wherein at least one strand comprises a 3' overhang.
10. The dsRNA molecule of claim 9, wherein the overhang is about 1-5 nucleotides in length.
11. The dsRNA molecule of claim 9, wherein the overhang is 2 nucleotides in length.
12. A pharmaceutical composition comprising the dsRNA molecule according to any one of claims 1-1 1 and a pharmaceutically acceptable carrier, excipient or diluent.
13. A method for treating or preventing the symptoms of a disorder associated with increased or aberrant CCAT-1 expression in a subject in need thereof, comprising expressing in cells of the subject an dsRNA molecule that reduces the level of CCAT-1 RNA in the cells, thereby treating or. preventing the symptoms of the disorder in said subject.
14. The method of claim 13, comprising administering to said subject a therapeutically effective amount of a dsR A molecule according to claim 1.
15. The method of claim 13, wherein the disorder is a neoplastic disorder.
16. The method of claim 13 for treating cancer or inhibiting tumor progression in said subject, wherein said subject has a tumor characterized by expression of CCAT-1 R A in at least a portion of the cells of the tumor.
17. The method of claim 16, wherein the tumor is a solid tumor.
18. The method of claim 17, the tumor is selected from lung carcinoma, colon carcinoma or adenoma, rectal cancer, lung cancer, gastric cancer, esophageal cancer, liver cancer, pancreatic cancer or squamous cell caricnoma of the uterine cervix.
19. The method of claim 16, wherein the cancer is colorectal cancer.
20. The method of claim 13, wherein the dsRNA comprises a sense strand having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-10.
21. The method of claim 20, wherein said sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 6.
22. A method for treating cancer or inhibiting tumor progression in a subject in need thereof, comprising the step of administering to said subject a therapeutically effective amount of a CCAT-1 silencing oligonucleotide, thereby treating cancer or inhibiting tumor progression in said subject.
23. The method of claim 22, wherein said CCAT-1 silencing oligonucleotide is selected from the group consisting of: a RNA interference (RJSfAi) molecule, an antisense molecule and an enzymatic nucleic acid molecule.
24. The method of claim 23, wherein said CCAT-1 silencing oligonucleotide is a siRNA molecule.
25. The method of claim 23, wherein said CCAT-1 silencing oligonucleotide is a shRNA molecule.
26. The method of claim 23, wherein said siRNA molecule comprises a sense strand selected from the group consisting of SEQ ID NOS: 1-10.
27. The method of claim 26, wherein said sense strand has a nucleic acid sequence as set forth in SEQ ID NO : 6.
28. The method of claim 23 for treating cancer or inhibiting tumor progression in said subject, wherein said subject has a tumor characterized by expression of CCAT-1 RNA in at least a portion of the cells of the tumor.
29. The method of claim 28, wherein the tumor is selected from lung carcinoma, colon carcinoma or adenoma, rectal cancer, lung cancer, gastric cancer, esophageal cancer, liver cancer, pancreatic cancer or squamous cell caricnoma of the uterine cervix.
30. The method of claim 22, wherein the cancer is colorectal cancer.
PCT/IL2012/000136 2011-03-31 2012-03-29 Ccat-1 silencing nucleic acid agents for treating cancer Ceased WO2012131673A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161469849P 2011-03-31 2011-03-31
IL61/469,849 2011-03-31

Publications (2)

Publication Number Publication Date
WO2012131673A2 true WO2012131673A2 (en) 2012-10-04
WO2012131673A3 WO2012131673A3 (en) 2012-11-22

Family

ID=46932013

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2012/000136 Ceased WO2012131673A2 (en) 2011-03-31 2012-03-29 Ccat-1 silencing nucleic acid agents for treating cancer

Country Status (1)

Country Link
WO (1) WO2012131673A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107365838A (en) * 2017-07-06 2017-11-21 郑州大学 With the method for BstUI surveyor's LINCRNA CCAT1 gene rs6470502 polymorphisms

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2502649A1 (en) * 2002-10-18 2004-04-29 Nucleonics Inc. Double-stranded rna structures and constructs, and methods for generating and using the same
US7306916B2 (en) * 2004-05-04 2007-12-11 Dako Denmark A/S Methods for detecting chromosome aberrations
US7842466B1 (en) * 2005-09-16 2010-11-30 Celera Corporation Colon disease targets and uses thereof
WO2008035692A1 (en) * 2006-09-19 2008-03-27 Jcr Pharmaceuticals Co., Ltd. Cancer cell identification marker and cancer cell proliferation inhibitor
EP2247754A1 (en) * 2008-02-11 2010-11-10 Hadasit Medical Research Services & Development Limited Colon cancer associated transcript 1 (ccat1) as a cancer marker

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107365838A (en) * 2017-07-06 2017-11-21 郑州大学 With the method for BstUI surveyor's LINCRNA CCAT1 gene rs6470502 polymorphisms

Also Published As

Publication number Publication date
WO2012131673A3 (en) 2012-11-22

Similar Documents

Publication Publication Date Title
US8513401B2 (en) Double stranded nucleic acid targeting low copy promoter-specific RNA
CN102341498B (en) Natural antisense transcripton by suppressing VEGF (VEGF) treats the related diseases of VEGF
JP5886757B2 (en) Treatment of interferon regulatory factor 8 (IRF8) related diseases by inhibition of natural antisense transcripts against interferon regulatory factor 8 (IRF8)
EP2111449B1 (en) H19 silencing nucleic acid agents for treating rheumatoid arthritis
JP2013165733A (en) Nucleic acid agent for downregulating h19, and method for using the same
US20190300882A1 (en) Methods of treating neuroblastoma and reagents therefor
JP2022031642A (en) Antisense oligonucleotides
JP2025023131A (en) SiRNA sequences targeting the expression of the human genes JAK1 or JAK3 for therapeutic use
US20100055783A1 (en) Nucleic acid compounds for inhibiting ras gene expression and uses thereof
WO2016149618A1 (en) Method for regulation of telomere-length
JP4467559B2 (en) Compositions and methods for inhibiting cell proliferation
WO2008099396A1 (en) Use of h19-silencing nucleic acid agents for treating restenosis
Shen et al. Silencing of human c-myc oncogene expression by poly-DNP-RNA
JP2007530431A (en) Compositions and methods for treating pancreatic cancer
Prins et al. Antisense of oligonucleotides and the inhibition of oncogene expression
CN107709561B (en) Modified siRNA and pharmaceutical composition containing the modified siRNA
US7902167B2 (en) Compounds and methods for down-regulating Wrap53 protein by RNA interference
CA2576576A1 (en) Gastrin-specific interfering rna
WO2020014566A2 (en) Compositions and methods for treating endometriosis
US20220259596A1 (en) Inhibitors of microRNA 451a for Treatment of Endometriosis
US9115167B2 (en) Multi-targets interfering RNA molecules and their applications
KR101985067B1 (en) Composition for preventing or treating cancer comprising miR-BART1-3p inhibitor as active ingredient
US20060122140A1 (en) In Vitro and in vivo silencing of human c-myc oncogene expression by poly-DNP-RNA
JP2004350607A (en) Telomerase inhibitor
Devlin Studies of catalytic nucleic acids targeted against the transcript of the PTEN tumor suppressor

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12765833

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12765833

Country of ref document: EP

Kind code of ref document: A2