WO2012129648A1 - Enhancing protein expression of adeno-associated virus vectors - Google Patents

Enhancing protein expression of adeno-associated virus vectors Download PDF

Info

Publication number
WO2012129648A1
WO2012129648A1 PCT/CA2012/000256 CA2012000256W WO2012129648A1 WO 2012129648 A1 WO2012129648 A1 WO 2012129648A1 CA 2012000256 W CA2012000256 W CA 2012000256W WO 2012129648 A1 WO2012129648 A1 WO 2012129648A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
cell
vector
cells
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CA2012/000256
Other languages
French (fr)
Inventor
Sarah WOOTTON
Darrick YU
Scott Walsh
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Guelph
Original Assignee
University of Guelph
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Guelph filed Critical University of Guelph
Publication of WO2012129648A1 publication Critical patent/WO2012129648A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/12011Betaretrovirus, e.g. mouse mammary tumour virus
    • C12N2740/12022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/15Vector systems having a special element relevant for transcription chimeric enhancer/promoter combination
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/30Vector systems having a special element relevant for transcription being an enhancer not forming part of the promoter region
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/60Vector systems having a special element relevant for transcription from viruses

Definitions

  • the present invention relates generally to the upregulation of transgene expression in cells, and more specifically to novel Enhancer elements "Ee” (nucleotide sequence) for use in a variety of viral and expression vectors and in particular an Adeno- Associated Virus vectors to increase the expression of the transgene(s) for gene therapy and industrial production of proteins.
  • Ee Enhancer elements
  • AAV Adeno-Associated Virus
  • AAV is a small, non-enveloped, replication-defective, single stranded DIMA virus from the genus Dependovirus and family Parvoviridae which can infect humans and other mammals.
  • AAV is considered nonpathogenic because it is not known to cause disease and it generates a very small immune response in its host.
  • AAV can infect both dividing and non-dividing cells and may incorporate its genome into that of the host cell or the AAV vectors can be designed and built so they do not integrate into the host cell's genome. Instead, the AAV genome fuses at its ends via the IT (inverted terminal repeats) to form circular, episomal forms, which are predicted to be the primary cause of the long term expression of the transgenes.
  • IT inverted terminal repeats
  • the research literature contains many examples of clinical trials conducted to investigate gene therapy methods using AAV vectors for diseases such as cystic fibrosis with the vector delivered to the lung via aerosol, hemophilia delivered via hepatic artery, arthritis delivered intraarticular ⁇ , muscular dystrophy delivered intramuscularly, and Alzheimer's delivered intracranial ⁇ , to name a few.
  • diseases such as cystic fibrosis with the vector delivered to the lung via aerosol, hemophilia delivered via hepatic artery, arthritis delivered intraarticular ⁇ , muscular dystrophy delivered intramuscularly, and Alzheimer's delivered intracranial ⁇ , to name a few.
  • Jaagsiekte sheep retrovirus JSRV
  • ENTV enzootic nasal tumor virus
  • GenBank publically discloses the entire nucleotide (genome) sequence for
  • JSRV (Accession No. AF105220) which contains the native sequence for Ee named herein as JE, however JE is not identified, characterized or isolated.
  • GenBank also publically discloses the nucleotide (genome) sequence for
  • ENTV-1 (Accession No. FJ744146) and ENTV-2 (Accession No. IMC_004994), which contain the native sequence for each of the Ee named herein as EE, however neither EE is not identified, characterized or isolated.
  • Enhancer elements suitable for use in a variety of viral and expression vector systems.
  • the Ee of the invention function to enhance the expression of any nucleic acid sequence/recomb ' mant DNA/transgene in a desired vector/expression system in transduced or transfected cells, tissues or mammals
  • the Ee of the invention in an embodiment are used in an AAV vector to enhance the expression of transgenes in cells transduced by the AAV vector. It has now been demonstrated that the addition of a transcriptional Enhancer element (Ee) upstream of a promoter of an AAV vector, can significantly enhance the transcription and expression of the transgene(s) contained within the AAV vector, in transduced cells.
  • the invention in aspects also is directed to a composition comprising a recombinant Adeno-Associated Virus (rAVV) vector, containing an Ee, and one or more transgenes, which together shall be termed a 'rAAVEe vector " for the purposes of describing this invention.
  • the invention encompasses novel Ee sequences, constructs comprising the
  • Ee sequences, vectors comprising the novel constructs, and compositions comprising such The invention also encompasses uses of such compositions for therapy such as gene therapy for the treatment of a variety of disorders.
  • the invention also encompasses uses of such compositions as medicaments for the treatment of disease.
  • the invention further encompasses methods of making the compositions and therapeutic methods incorporating such.
  • the invention also encompasses uses of the composition for industrial production of protein(s) in cell culture in vitro.
  • the invention also encompasses kits to verify the presence of the compositions in transduced cells and methods to verify the presence of the composition in transduced cells.
  • JS V Jaagsiekte sheep retrovirus
  • ENTV enzootic nasal tumor virus
  • JSRV and ENTV novel Ee sequences including fragments and homologous sequences thereof are used in conjunction with a promoter and transgene to form constructs within an AAV vector for transduction of cells, tissues and/or mammals.
  • another aspect of the invention is a rAAVEe vector to enhance the expression of a transgene in mammalian cell culture to increase the production yield of recombinant proteins produced in the cell culture compared to using an AAV vector without an enhancing element.
  • Utilization of a rAAVEe vector requires transducing cells with a rAAVEe vector, then growing and supporting the cells in culture medium known in the art and then harvesting the recombinant protein produced, using methods known in the art.
  • the resulting mammalian cell(s) transduced with the rAAVEe vector becomes capable of exhibiting enhanced expression of the transgene(s).
  • a rAAVEe vector is used to increase the expression of transgene(s) contained in or cloned into the rAAVEe vector, in the organs of a mammal, compared to the transgene(s) expression of an AAV vector not containing the Ee.
  • Use of the rAAVEe vector to enhance the expression of a transgene i.e. enhance the production of a protein of interest
  • a rAAVEE vector to transduce that organ.
  • systemic administration of a rAAVEE vector to enhance the expression of a transgene in several organs or the entire mammal.
  • the rAAVEe would enable the cells of an organ to increase the production of the desired proteins which may have therapeutic benefit to the mammal.
  • the resulting mammal transduced with the rAAVEe vector becomes capable of exhibiting long term enhanced expression of the transgene(s).
  • a transcriptional Enhancer element derived from Jaagsiekte sheep retrovirus (JSRV) or Enzootic nasal tumor virus (ENTV); said JSRV derived Ee comprises the sequence of SEQ ID NO: l ; said ENTV derived Ee comprises the sequence of SEQ ID NO.2.; fragments of the Ee, wherein the fragment enhances expression of a nucleic acid sequence, transgene and/or recombinant DNA (i.e.
  • the fragment can be at least 20 nucleotides in length, at least 30 nucleotides in length, at least 40 nucleotides in length, at least 50 nucleotides in length and at least 60 nucleotides in length; homologd of the Ee sequence of the invention; nucleic acid sequences that share at least 60%, at least 70%, at least 80%, at least 85%, at least 90% or at least 95% sequence identity to the Ee of the invention of SEQ ID NO.
  • nucleic acid constructs comprising the Ee of the invention; the nucleic acid constructs can further comprise a promoter and transgene; expression vectors comprising the nucleic acid constructs; mammalian expression vectors containing the constructs of the invention; Adeno-Associated Virus (AAV) vector comprising the construct (rAAVEE);
  • AAV Adeno-Associated Virus
  • the construct comprises a sequence selected from the group consisting of SEQ ID NO. SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 17, SEQ ID NO.
  • compositions comprising the vector of the invention that incorporates the Enhancer element of the invention; medicaments comprising the vectors; cells transduced/transfected with the vector; the cell is eukaryotic or prokaryotic and selected from the group consisting of human, mouse, rat, bird, cat, dog, goat, sheep, pig, bovid, horse or non-human primate cell; the cell can be selected from the group consisting of fibroblasts, neurons, retinal cells, liver cells, kidney cells, lung cells, bone marrow stem cells and hematopoietic stem cells; the cell is selected from the group consisting of HTX cells, 208 fibroblasts, HEK-293 cells and HEK-293T cells; compositions comprising a cell trans
  • FIG. 1 Schematic of AAV vector genomes containing LTRs and upstream enhancing elements derived from the JSRV or ENTV-1 genome.
  • the nucleotide sequence at the start of the enhancer (EE or JE) and LTR is shown above.
  • AJAP, AEIAP and AE2AP are AAV vectors that do not incorporate enhancer elements.
  • AEEE1AP and AJEJAP are AAV vectors (also called rAAVEe vectors) which contain enhancer elements EE and JE respectively.
  • FIG. 2 AP expression in mice following intranasal administration of AJAP
  • FIG. 3 Gross images of mouse tissues transduced intranasally with AJAP (A, F, K), AEiAP (B, G, L), AE 2 AP (C, H, M), A ]E JAP (D, I, N) and ⁇ ⁇ ⁇ ( ⁇ , J, O) and stained for AP expression. Histological sections of mouse tissues transduced intranasally with AJAP (P, U), AE ⁇ P (Q, V), AE 2 AP (R, W) A jE JAP (S, X) and A ⁇ AP (T, Y) and stained for AP expression. [0018] FIG. 3.
  • FIG. 4 AP expression in mouse tissues following intravenous and intraperitoneal administration of AJAP (A, B, C), AEiAP (D, E, F), A JE JAP (G, H, I), and AEE IAP (J, K, L). Histological sections of mouse tissues transduced intravenously and intraperitoneally with A E JAP (M, N, O) and ⁇ ⁇ ⁇ ( ⁇ , Q, R) and stained for AP expression.
  • AJAP A, B, C
  • AEiAP D, E, F
  • a JE JAP G, H, I
  • AEE IAP J, K, L
  • FIG. 5 Quantitative analysis of AP enzymatic activity in mouse tissues transduced with AAV6 vectors containing JSRV and ENTV-l LTRs with and without enhancing elements.
  • A AP expression in the lungs of mice transduced with 1 x 10 9 vg of JSRV LTR bearing vectors.
  • B AP expression in the liver of mice transduced with 2 x 10 9 vg of JSRV LTR bearing vectors.
  • C AP expression in the lungs of mice transduced with 1 x 10 10 vg of ENTV-l LTR bearing vectors.
  • D AP expression in the liver of mice transduced with 2 x 10 10 vg of ENTV-l LTR bearing vectors.
  • FIG. 6 Tumor induction in mouse lungs following intranasal administration of AAV6 vectors expressing either the ENTV or JSRV Env protein from the JSRV, ENTV-l or ENTV-2 LTR. Images are representative of tumor induction with either envelope since the frequency and magnitude of tumor induction was indistinguishable between all three LTRs. Gross images of mouse lungs transduced with AJJenv (A), AEiJenv (B) and AE 2 Jenv (C) and a marker vector expressing AP (purple staining). H&E stained histologic section of AJJenv (D), AEjJenv (E) and AE 2 Jenv (F) transduced mouse lungs. Immunohistochemical staining of AJJenv (G), AE x Jenv (H) and AE 2 Jenv (I) transduced mouse lungs with an envelope-specific monoclonal antibody.
  • FIG. 7 A schematic view of the various promoter constructs derived from the JE (JSRV Element) sequences.
  • the JSRV complete JSRV genome is shown at the top.
  • the JSRV long terminal repeat (LTR) consisting of unique 3' region (U3), repeat region (R), and unique 5' region (U5) is also shown.
  • JE328 refers to a 5' extended version of JE extending 328 bp upstream of the LTR
  • JE187 refers to a 5' extended version of JE extending 187 bp upstream of the LTR
  • JE72 refers to the original J E which extends 72 bp upstream of the LTR.
  • the chicken beta actin promoter, designated AG is also included in some constructs.
  • FIGS. 8A-E Graphs showing various constructs in 293 (A), 293T(B),
  • FIG. 9. Graph showing a comparison of four different vectors containing Ee of the invention versus control.
  • the pAAG-AP is a non-enhanced vector with a chicken beta actin promoter.
  • pAJE72-AG is an enhanced vector with chicken beta actin promoter.
  • pAJE72-U3-R-AG is an enhanced vector with the U3 region of JSRV as well as the chicken beta actin promoter.
  • pACAG-AP is a vector containing the CMV immediate enhancer and chicken beta actin promoter.
  • Novel Enhancing elements are provided derived from JSRV or ENTV. These Ee as understood by one of skill in the art can be used in a variety of viral vectors or other plasmids (expression vectors) in order to enhance expression of a desired nucleic acid sequence/recombinant DNA/transgene.
  • the novel Ee of the invention have use both in the gene therapy field as well as for the preparation of medicaments and in the industrial production of any protein peptide as desired.
  • the JSRV or ENTV derived Ee of the invention comprises the nucleotide sequence SEQ ID NO : l
  • the invention in further non-limiting aspects provides novel Enhancer elements (Ee) used in conjunction with a promoter and transgene(s) as a construct incorporated into an Adeno-Associated Virus (AAV) vector, herein referred to as rAVVEe vector.
  • the invention also in aspects provides compositions comprising the rAVVEe vector and methods of using/administrating the compositions for gene therapy and as medicaments in mammals such as humans. When these three components (Ee, AAV vector and transgene) are combined they create a novel recombinant AAV vector (rAAVEe vector).
  • a rAAVEe vector can increase the expression of a transgene gene contained in the vector in a mammalian cell which has been transduced with the vector, when compared to an AAV not containing the Ee.
  • the Enhancer elements of the invention are derived from JSRV or ENTV viruses.
  • the Ee comprises the nucleotide sequence SEQ ID NO: l (acatataaatatagatacatgttgcaataccaaaaacttatggatcttgtaaaaaaggagaggggag or SEQ ID NO: 2 (ctgcatatgaaatatagaaatatgttacagcaccaacatcttatggagcttttaaaaaataaagagaggggag), truncated subsets of these sequences or homologous sequences.
  • the Ee of the invention comprises SEQ ID NO.l or SEQ ID NO. 2 as well as sequences that are at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: l or SEQ ID NO:2 set forth herein.
  • the present invention encompasses any fragment of Ee set forth in SEQ ID NOS: 1 and 2.
  • the invention provides an isolated, synthetic or recombinant nucleic acid comprising a nucleic acid sequence having at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity to SEQ ID NO: l or 2.
  • the homologous sequences may be obtained using any of the procedures described herein or may result from the correction of a sequencing error.
  • the homology can be calculated after aligning the two sequences so that the homology is at its highest level.
  • Another way of calculating homology can be performed by published algorithms. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman and Wunsch, J. MoL Biol. 48 :443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A. 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics
  • the Ee of the invention can be used in various AAV vectors known and used in the art of gene therapy or more specifically in the AAV vectors described in Example 1 below.
  • the term "Adeno-Associated Virus vector” or "AAV vector” means a vector comprised of a viral genome based on any of the 11 known serotypes of Adeno-Associated Virus genome, and additional nucleotide sequences (functional genes, transgenes, promoters, enhancers and any other desired gene sequences) that are inserted into the vector through cloning or any other method known in the art of recombinant genetic engineering, which is capable of transducing (infecting) cells and expressing these additional nucleotide sequences in the transduced cells.
  • enhancing and “up-regulating” are used interchangeably herein and refer to expression of a gene that exceeds the endogenous level of expression, (i.e. transgene expression level achieved using an AAV vector without incorporating an Ee).
  • LTR Long Terminal Repeat
  • U3 unique region 3'
  • R region R region
  • U5 unique 5' region
  • Ee is used as a general term to describe a nucleotide sequence added to or upstream of a promoter, including a LTRof an AAV vector, which increases the expression of transgene(s) contained in the AAV vector compared to the expression of the same vector not containing the same Ee.
  • nucleotide sequences of Ee and AAV vectors incorporating such Enhancer elements are provided herein.
  • an AAV nucleic acid vector comprising an Ee of the present invention referred to as "JE" or "EE”, promoter and transgene.
  • the Ee construct may be made using well-known techniques in the art of gene construct synthesis.
  • the construct is introduced into anyvector system (in aspects the AAV vector) using recombinant technology that is well- established in the art.
  • Animals and or cells can then be transduced/transfected with a suitable vector incorporating the Ee and the desired transgene(s) using well-known techniques in the art of vector based gene therapy.
  • rAAVEe vector ' is used to describe an AAV vector which incorporates an Ee and a transgene(s) (or nucleic acid sequence or recombinant DNA molecule of interest).
  • any transgene whose expression is enhanced by the Ee when combined in an AAV vector system will demonstrate an upreguiation in the translation of the corresponding mRNA of this transgene (See e.g., Graham et al., Virol., 52 :456 (1973); Sambrook et al., Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratories, New York (1989); Davis et al., Basic Methods in Molecular Biology, Elsevier, (1986); and Chu et al., Gene 13: 197 (1981).
  • Such techniques may be used to introduce one or more exogenous DNA moieties, such as a gene transfer vector and other nucleic acid molecules, into suitable recipient cells.
  • transduction denotes the delivery of a foreign
  • stable transduction and “stably transduced” refers to the introduction and integration of foreign DNA into the genome of a foreign cell.
  • transfection refers to the uptake of foreign DNA by a cell.
  • a cell has been "transfected” when exogenous DNA has been introduced inside the cell membrane.
  • transfection techniques are generally known in the art (See e.g., Graham et al., Virol., 52:456 (1973); Sambrook et al., Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratories, New York (1989); Davis et al., Basic Methods in Molecular Biology, Elsevier, (1986); and Chu et al., Gene 13: 197 (1981).
  • Such techniques may be used to introduce one or more exogenous DNA moieties, such as a gene transfer vector and other nucleic acid molecules, into suitable recipient cells.
  • exogenous DNA moieties such as a gene transfer vector and other nucleic acid molecules
  • stable transfection and “stably transfected” refers to the introduction and integration of foreign DNA into the genome of the transfected cell.
  • stable transfectant refers to a cell, which has stably integrated foreign DNA into the genomic DNA.
  • the term “recipient cell” refers to a cell which has been transduced, or is capable of being transduced, by a nucleic acid construct or vector bearing a selected nucleotide sequence of the invention, ie. the rAVVEe of the invention.
  • the term includes the progeny of the parent cell, whether or not the progeny are identical in morphology or in genetic make-up to the original parent, so long as the selected nucleotide sequence is present.
  • the recipient cell may be the cells of a subject to which the gene therapy vector has been administered.
  • the terms “gene transfer,” “gene delivery,” and “gene transduction” refer to methods or systems for reliably inserting a particular nucleotide sequence (e.g., DNA) into targeted cells.
  • the term “gene therapy” refers to a method of treating a patient wherein polypeptides or nucleic acid sequences are transferred into cells of a patient such that activity and/or the expression of a particular molecule is restored.
  • nucleic acid sequence refers to a DNA or RNA sequence. Nucleic acids can, for example, be single or double stranded. The term includes sequences such as any of the known base analogues of DNA and RNA.
  • the term "recombinant DNA molecule” refers to a DNA molecule which is comprised of segments of DNA joined together by means of molecular biological techniques.
  • transgene means any piece of DNA which is inserted by artifice into a cell, and becomes part of the genome of the organism (i.e., either stably integrated or as a stable extrachromosomal element) which develops from that cell.
  • a transgene may include a gene which is partly or entirely heterologous (i.e., foreign) to the transgenic organism, or may represent a gene homologous to an endogenous gene of the organism. Included within this definition is a transgene created by the providing of an RNA sequence which is transcribed into DNA and then incorporated into the genome.
  • nucleic acid sequence recombinant DNA molecule or transgene
  • rAAVEe recombinant DNA molecule
  • transgene can be incorporated into the rAAVEe of the invention as is understood by one of skill in the art. Collectively, these are exogenous nucleic acid sequences.
  • a promoter for use in the rAAVEe of the present invention can be any desired promoter, selected by known considerations, such as the level of expression of a nucleic acid functionally linked to the promoter and the cell type in which the vector is to be used. That is, the promoter can be tissue/cell-specific. Promoters can be prokaryotic, eukaryotic, fungal, nuclear, mitochondrial, viral or plant promoters. Promoters can be exogenous or endogenous to the cell type being transduced by the vector. Promoters can include, for example, bacterial promoters, known strong promoters such as SV40 or the inducible metallothionein promoter, or an AAV promoter, such as an AAV p5 promoter.
  • chimeric regulatory promoters for targeted gene expression can be utilized.
  • Other promoters include promoters derived from actin genes (i.e. chicken beta actin promoter), immunoglobulin genes, cytomegalovirus (CMV), adenovirus, bovine papilloma virus, adenoviral promoters, such as the adenoviral major late promoter, an inducible heat shock promoter, respiratory syncytial virus, Rous sarcomas virus (RSV), etc.
  • the rAAVEe vector provided herein in aspects comprises an exogenous nucleic acid functionally linked to the promoter.
  • exogenous nucleic acid is meant any nucleic acid that is not normally found in wild-type AAV that can be inserted into a vector for transduction into a cell, tissue or organism.
  • the exogenous nucleic acid can be a nucleic acid not normally found in the target cell, or it can be an extra copy or copies of a nucleic acid normally found in the target cell.
  • exogenous and heterologous are used herein interchangeably.
  • the promoter can promote expression of the exogenous nucleic acid, as is known in the art, and can include the appropriate orientation of the promoter relative to the exogenous nucleic acid.
  • the exogenous nucleic acid preferably has all appropriate sequences for expression of the nucleic acid.
  • the nucleic acid can include in addition to expression control sequences, (i.e. Ee of the invention), necessary information processing sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites, and transcriptional terminator sequences.
  • the rAAVEe of the invention is useful for gene therapy, as a medicament or as a mechanism to produce large quantities of protein/peptide.
  • the exogenous nucleic acid can encode beneficial proteins or polypeptides that replace missing or defective proteins required by the cell or subject into which the vector is transferred or can encode a cytotoxic polypeptide that can be directed, e.g., to cancer cells or other cells whose death would be beneficial to the subject.
  • the exogenous nucleic acid can also encode antisense RNAs that can bind to, and thereby inactivate, mR As made by the subject that encode harmful proteins.
  • Antisense RNA and DNA see Antisense RNA and DNA, D. A.
  • Non-limiting exemplitive examples of exogenous nucleic acids which can be administered to a cell or subject as part of the present rAAVEe vector can include, but are not limited to the following : nucleic acids encoding secretory and nonsecretory proteins, nucleic acids encoding therapeutic agents, such as tumor necrosis factors (TNF), such as TNFa. ; interferons, such as interferon-a., interferon- ⁇ ., and interferon-.
  • TNF tumor necrosis factors
  • interleukins such as IL-1, IL- ⁇ ., and ILs-2 through -14; GM-CSF; adenosine deaminase; cellular growth factors, such as lymphokines; soluble CD4; Factor VIII; Factor IX; T-cell receptors; LDL receptor; ApoE; ApoC; alpha-1 antitrypsin; ornithine transcarbamylase (OTC); cystic fibrosis transmembrane receptor (CFTR); insulin; Fc receptors for antigen binding domains of antibodies, such as immunoglobulins; anti-HIV decoy tar elements; and antisense sequences which inhibit viral replication, such as antisense sequences which inhibit replication of hepatitis B or hepatitis non-A, non-B virus.
  • GM-CSF GM-CSF
  • adenosine deaminase cellular growth factors, such as lymphokines; soluble CD4; Factor VIII; Factor IX;
  • the nucleic acid is chosen considering several factors, including the cell to be transduced with the novel rAVVEe of the invention.
  • the target cell is a blood cell
  • particularly useful nucleic acids to use are those which allow the blood cells to exert a therapeutic effect, such as a gene encoding a clotting factor for use in treatment of hemophilia.
  • Another target cell is the lung airway cell, which can be used to administer nucleic acids, such as those coding for the cystic fibrosis transmembrane receptor, which could provide a gene therapeutic treatment for cystic fibrosis.
  • target cells include muscle cells where useful nucleic acids, such as those encoding cytokines and growth factors, can be transduced and the protein the nucleic acid encodes can be expressed and secreted to exert its effects on other cells, tissues and organs, such as the liver. Furthermore, the nucleic acid can encode more than one gene product.
  • suitable nucleic acids can include those that, when transduced/transfected into a primary cell, such as a blood cell, cause the transferred cell to target a site in the body where that cell's presence would be beneficial.
  • a primary cell such as a blood cell
  • blood cells such as TIL cells can be modified, such as by transfer into the cell of a Fab portion of a monoclonal antibody, to recognize a selected antigen.
  • Another example would be to introduce a nucleic acid that would target a therapeutic blood cell to tumor cells.
  • Nucleic acids useful in treating cancer cells include those encoding chemotactic factors which cause an inflammatory response at a specific site, thereby having a therapeutic effect.
  • nucleic acids particularly blood cells, muscle cells, airway epithelial cells, brain cells and endothelial cells having such nucleic acids transferred into them can be useful in a variety of diseases, syndromes and conditions.
  • suitable nucleic acids include nucleic acids encoding soluble CD4, used in the treatment of AIDS and .alpha. -antitrypsin, used in the treatment of emphysema caused by a-antitrypsin deficiency.
  • diseases, syndromes and conditions in which such cells can be useful include, for example, adenosine deaminase deficiency, sickle cell deficiency, brain disorders such as Alzheimer's disease, thalassemia, hemophilia, diabetes, phenylketonuria, growth disorders and heart diseases, such as those caused by alterations in cholesterol metabolism, and defects of the immune system.
  • Other cells in which a gene of interest can be expressed include, but are not limited to, fibroblasts, neurons, retinal cells, liver cells, kidney cells, lung cells, bone marrow stem cells and hematopoietic stem cells.
  • the cells in which the gene of interest can be expressed can be dividing cells such as MDCK cells, BHK cells, HeLa cells, 3T3 cells, CVl cells, COS7 cells, HOS cells, HTX cells and 293 cells.
  • the cells can also be embryonic stem cells of mouse, rhesus, human, bovine or sheep origin, as well as stem cells of neural, hematopoietic, muscle, cardiac, immune or other origin.
  • Non-dividing cells can also be contacted with a particle provided herein to express a gene of interest.
  • Such cells include, but are not limited to hematopoietic stem cells and embryonic stem cells that have been rendered non-dividing.
  • hepatocytes can be transduced with the present rAVVEe having useful nucleic acids/transgenes to treat liver disease.
  • a nucleic acid encoding OTC can be used to transfect hepatocytes (ex vivo and returned to the liver or in vivo) to treat congenital hyperammonemia, caused by an inherited deficiency in OTC.
  • Another example is to use a nucleic acid encoding LDL to target hepatocytes ex vivo or in vivo to treat inherited LDL receptor deficiency.
  • Such transfected hepatocytes can also be used to treat acquired infectious diseases, such as diseases resulting from a viral infection.
  • transduced hepatocyte precursors can be used to treat viral hepatitis, such as hepatitis B and non-A, non-B hepatitis, for example by transducing the hepatocyte precursor with a nucleic acid encoding an antisense RIMA that inhibits viral replication.
  • viral hepatitis such as hepatitis B and non-A, non-B hepatitis
  • transducing the hepatocyte precursor with a nucleic acid encoding an antisense RIMA that inhibits viral replication Another example includes transferring a vector provided herein having a nucleic acid encoding a protein, such as .gamma. -interferon, which can confer resistance to the hepatitis virus.
  • the invention in aspects provides rAVVEe vectors and compositions comprising such vectors described herein that are for administration to mammals, i.e. animals and humans, for gene therapy and as medicaments. Also provided is a method of delivering an exogenous nucleic acid/transgene to a subject comprising administering to a cell of or from the subject a rAVVEe vector comprising a desired nucleic acid inserted therein, and returning the cell to the subject, thereby delivering the nucleic acid to the subject.
  • cells are isolated from a subject by standard means according to the cell type and placed in appropriate culture medium, again according to cell type (see, e.g., ATCC catalog).
  • the rAVVEe are then contacted with the cells as described above, and the virus is allowed to transduce the cells.
  • Cells can then be transplanted back into the subject's body, again by means standard for the cell type and tissue (e. g., in general, U.S. Pat. No. 5,399,346; for neural cells, Dunnett, S. B. and Bjorklund, A., eds., Transplantation : Neural Transplantation-A Practical Approach, Oxford University Press, Oxford (1992)).
  • the cells can be studied for degree of transduction by the virus, by known detection means and as described herein.
  • Cells for ex vivo transduction followed by transplantation into a subject can be selected from those listed above, or can be any other selected cell.
  • a method of delivering an exogenous nucleic acid sequence (transgene) to a cell in a subject comprising administering to the subject a rAVVEe vector comprising the nucleic acid (transgene), thereby delivering the nucleic acid/transgene to a cell in the subject.
  • Administration can be an ex vivo administration directly to a cell removed from a subject, such as any of the cells listed above, followed by replacement of the cell back into the subject, or administration can be in vivo administration to a cell in the subject.
  • Modes of administration may include but are not limited to gastrointestinal or enteral (oral), epidural, intra-cerebral, intra- cerebroventricular, transdermal, intradermal, subcutaneous, nasal, intravenous, intraarterial, intramuscular, intra-cardiac, intra-osseous infusion, intra-peritoneal, intra-vesical and intra-vitreal administrations.
  • a subject is administered a rAAVEe vector, (for example JE72-U3-R-AG) in which the vector has a desired nucleic acid sequence.
  • the rAAVEe vector can be packaged with pharmaceutically suitable salts and solvates, administered to a subject.
  • Administering the rAAVEe vector with a desired gene may be conveniently administered in unit dosage form, and may be prepared by any of the methods well known in the pharmaceutical art.
  • the gene therapy agent further comprises at least one other agent of common excipients, such as sterile water or saline, polyalkylene glycols, oils of vegetable origin, hydrogenated naphtalenes, and the like.
  • the rAAVEe vectors of the invention with desired gene and at least a packaging material may be formulated into pharmaceutical compositions by admixture with pharmaceutically acceptable non-toxic excipients or carriers, such as salt and solvates.
  • pharmaceutically acceptable non-toxic excipients or carriers such as salt and solvates.
  • Such compounds and compositions may be prepared in the intravenous form, subcutaneous form, or intramuscular form for parenteral administration, particularly in the form of liquid solutions or suspensions in aqueous physiological buffer solutions; for oral administration, particularly in the form of tablets or capsules; or in inhalation form for intranasal administration, particularly in the form of powders, nasal drops, or aerosols; or on the mucosa forms of liquid solutions or suspensions for applications.
  • Sustained release compositions are also encompassed by the present invention.
  • compositions for other routes of administration may be prepared as desired using standard methods.
  • the present invention provides a method of performing gene transfer and/or gene therapy by transducing a cell using the rAAVEe vector where the vector comprises a desired transgene.
  • the present invention provides biopharmaceutical compositions including a biopharmaceutically acceptable excipient along with a therapeutically effective amount of rAAVEe.
  • Biopharmaceutically acceptable excipient means an excipient that is useful in preparing a biopharmaceutical composition that is generally safe, non-toxic, and desirable, and includes excipients that are acceptable for veterinary use as well as for human biopharmaceutical use.
  • Such excipients may be solid, liquid, semisolid, or, in the case of an aerosol composition, gaseous.
  • the biopharmaceutical compositions according to the invention may be formulated for delivery via any route of administration.
  • Route of administration may refer to any administration pathway known in the art, including but not limited to aerosol, nasal, oral, transmucosal, transdermal or parenteral.
  • Parenteral refers to a route of administration that is generally associated with injection, including intraorbital, infusion, intraarterial, intracapsular, intracardiac, intradermal, intramuscular, intraperitoneal, intrapulmonary, intraspinal, intrasternal, intrathecal, intrauterine, intravenous, subarachnoid, subcapsular, subcutaneous, transmucosal, or transtracheal.
  • the compositions may be in the form of solutions or suspensions for infusion or for injection, or as lyophilized powders.
  • the biopharmaceutical compositions according to the invention can also contain any biopharmaceutically acceptable carrier.
  • Biopharmaceutically acceptable carrier refers to a pharmaceutically acceptable material, composition, or vehicle that is involved in carrying or transporting a compound of interest from one tissue, organ, or portion of the body to another tissue, organ, or portion of the body.
  • the carrier may be a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, or a combination thereof.
  • Each component of the carrier must be “biopharmaceutically acceptable” in that it must be compatible with the other ingredients of the formulation. It must also be suitable for use in contact with any tissues or organs with which it may come in contact, meaning that it must not carry a risk of toxicity, irritation, allergic response, immunogenicity, or any other complication that excessively outweighs its therapeutic benefits.
  • biopharmaceutical compositions according to the invention can also be encapsulated, tableted or prepared in an emulsion or syrup for oral administration.
  • Biopharmaceutically acceptable solid or liquid carriers may be added to enhance or stabilize the composition, or to facilitate preparation of the composition.
  • Liquid carriers include syrup, peanut oil, olive oil, glycerin, saline, alcohols and water.
  • Solid carriers include starch, lactose, calcium sulfate, dihydrate, terra alba, magnesium stearate or stearic acid, talc, pectin, acacia, agar or gelatin.
  • the carrier may also include a sustained release material such as glyceryl monostearate or glyceryl distearate, alone or with a wax.
  • a sustained release material such as glyceryl monostearate or glyceryl distearate, alone or with a wax.
  • the biopharmaceutical preparations are made following the conventional techniques of pharmacy involving milling, mixing, granulation, and compressing, when necessary, for tablet forms; or milling, mixing and filling for hard gelatin capsule forms.
  • a liquid carrier When a liquid carrier is used, the preparation will be in the form of a syrup, elixir, emulsion or an aqueous or non-aqueous suspension.
  • Such a liquid formulation may be administered directly p.o. or filled into a soft gelatin capsule.
  • the biopharmaceutical compositions according to the invention comprising a rAAVEe may be delivered in a therapeutically effective amount.
  • the precise therapeutically effective amount is that amount of the composition that will yield the most effective results in terms of efficacy of treatment in a given subject. This amount will vary depending upon a variety of factors, including but not limited to the characteristics of the therapeutic compound (including activity, pharmacokinetics, pharmacodynamics, and bioavailability), the physiological condition of the subject (including age, sex, disease type and stage, general physical condition, responsiveness to a given dosage, and type of medication), the nature of the biopharmaceutically acceptable carrier or carriers in the formulation, and the route of administration.
  • the present invention also relates to methods for producing desired proteins and methods for expressing desired DNAs, using the Ee of the invention incorporated into any desired vector able to express the desired DNAs.
  • Production systems for proteins include in-vitro and in-vivo production systems.
  • In-vitro production systems include those using eukaryotic or prokaryotic cells.
  • desired proteins can be obtained by culturing the above-described host cells in vitro. Such a culture can be achieved according to known methods.
  • liquid culture media for animal cells include DMEM, MEM, RPM 11640, IMDM, F10 medium, and F12 medium.
  • the culture media may comprise serum supplements such as fetal calf serum (FCS), or may be serum-free culture media.
  • FCS fetal calf serum
  • a transactivator may be added to the media.
  • the culture pH is preferably about 6 to 8.
  • the cultivation is typically carried out at about 30°C to 40°C for about 15 to 200 hours; if required, the medium is changed, aerated and stirred. Since culture conditions vary depending on the cell type used, those skilled in the art can appropriately determine suitable conditions. For example, typically, CHO cells may be cultured, under an atmosphere of 0% to 40% C0 2 gas, preferably, 2% to 10%, at 30°C. to 39°., preferably, at about 37°C, for 1 to 14 days.
  • Various culture apparatuses can be used for animal cells, examples being fermentation tank-type tank culture apparatuses, airlift-type culture apparatuses, culture flask-type culture apparatuses, spinner flask-type culture apparatuses, microcarrier-type culture apparatuses, flow tank-type culture apparatuses, hollow fiber-type culture apparatuses, roller bottle-type culture apparatuses, and packed bed-type culture apparatuses.
  • In-vivo production systems for proteins include, for example, production systems using animals or plants.
  • a transgene of interest is introduced into such an animal or plant, and the polypeptide produced in the animal or plant in vivo is collected.
  • the "hosts" of the present invention includes such animals and plants.
  • Production systems using animals include systems using mammals or insects. Such mammals include goats, pigs, sheep, mice, and cattle (Vicki Glaser, SPECTRUM Biotechnology Applications, 1993).
  • Transgenic animals can also be used as the mammals.
  • DIMAs encoding desired proteins are prepared as fusion genes comprising genes encoding polypeptides such as goat ⁇ casein specifically produced into milk.
  • DNA fragments comprising the fusion genes are injected into goat embryos, and the resulting goat embryos are transplanted into female goats.
  • the desired proteins can be obtained from milk produced by transgenic goats born of the goats that have received the embryos, or their progenies. Hormones may be appropriately given to the transgenic goats to increase the amount of milk comprising the polypeptides produced by the transgenic goats (Bio/Technology, Vol. 12, p. 699-702, 1994).
  • insects such as silkworm can be used. When silkworms are used, they are infected with a baculovirus into which a DNA encoding a desired protein is inserted and the desired protein can be obtained from body fluid (Nature, Vol. 315, p. 592-594, 1985).
  • tobacco when using plants, for example, tobacco may be used.
  • a DNA encoding a desired protein is inserted into a plant expression vector, for example, pMON 530, and the vector is introduced into a bacterium such as Agrobacterium tumefaciens.
  • Tobacco for example, Nicotiana tabacum
  • the desired protein can be obtained from leaves of the resulting tobacco (Eur. J. Immunol., Vol. 24, p. 131-138, 1994).
  • the rAVVEe vectors and desired proteins obtained by the present invention can be isolated from inside or outside (medium or such) of the host cells and purified as substantially pure homogeneous proteins.
  • the proteins can be isolated and purified by conventional protein isolation/purification methods. There is no limitation on the type of methods for isolating and purifying the proteins.
  • the proteins can be isolated and purified by appropriately selecting and using in combination, a chromatography column, filter, ultrafiltration, salting out, solvent precipitation, solvent extraction, distillation, immunoprecipitation, SDS-polyacrylamide gel electrophoresis, isoelectrofocusing, dialysis, recrystallization, and such.
  • Chromatography includes, for example, affinity chromatography, ion exchange chromatography, hydrophobic chromatography, gel filtration, reverse phase chromatography, and adsorption chromatography (Strategies for Protein Purification and Characterization : A Laboratory Course Manual. Ed Daniel R. Marshak et al. , Cold Spring Harbor Laboratory Press, 1996) . These chromatographic methods can be conducted using liquid chromatography, for example, HPLC and FPLC. Any modifications or partial removal of peptides can be achieved by reacting the proteins with appropriate protein modification enzymes before or after purification. Such protein modification enzymes include, for example, trypsin, chymotrypsin, lysyl endopeptidase, protein kinase, and glucosidase.
  • the rAVVEe vectors, constructs including the Ee, or host cells of the present invention can be used to produce desired proteins, including protein fragments and peptides.
  • the desired proteins include, for example but not limited to, antibodies, cytokines, and growth factors, such as erythropoietin, colony-stimulating factor (granulocyte, macrophage, and granulocyte macrophage), interleukins 1 to 31, interferons, RANTES, lymphotoxin ⁇ , Fas ligand, flt-3 ligand, ligand (RANKL) for NF-KB receptor activation factor, TNF-related apoptosis-inducing ligand (TRAIL), CD40 ligand, 0X40 ligand, 4- lBB ligand (and other members belonging to the TNF family), thymic stroma-derived lymphopoietin, mast cell growth factor, stem cell growth factor, epidermal growth factor, growth hormone,
  • the invention also provides cells transduced with a rAVVEe of the invention.
  • the host cell may be any of the host cells familiar to those skilled in the art, including prokaryotic cells, eukaryotic cells, such as bacterial cells, fungal cells, yeast cells, mammalian cells, insect cells, or plant cells.
  • exemplary bacterial cells include any species within the genera Escherichia, Bacillus, Streptomyces, Salmonella, Pseudomonas, Lactococcus, and Staphylococcus, including, e.g., Escherichia coli, Lactococcus lactic, Bacillus subtilis, Bacillus cereus, Salmonella typhimurium, Pseudomonas fluorescens.
  • Exemplary fungal cells include any species of Aspergillus, including Aspergillus niger.
  • Exemplary yeast cells include any species of Pichia, Saccharomyces, Schizosaccharomyces, or Schwanniomyces, including Pichia pastoris, Saccharomyces cerevisiae, or Schizosaccharomyces pombe.
  • Exemplary insect cells include any species of Spodoptera or Drosophila, including Drosophila S2 and Spodoptera S/9.
  • Exemplary insect cells include Drosophila S2 and Spodoptera Sf9.
  • Exemplary yeast cells include Pichia pastoris, Saccharomyces cerevisiae or Schizosaccharomyces pombe.
  • Exemplary animal cells include CHO, COS or Bowes melanoma or any mouse or human cell line. Particularly useful cells are human, mouse, rat, bird, cat, dog, goat, sheep, pig, bovid, horse or non- human primate cell. The selection of an appropriate host is within the abilities of those skilled in the art.
  • the rAWEe vector of the invention may be introduced into the host cells using any of a variety of techniques, including transduction (viral infection), gene guns, or Ti-mediated gene transfer. Particular methods include calcium phosphate transfection, DEAE-Dextran mediated transfection, lipofection, or electroporation (Davis, L, Dibner, M., Battey, I., Basic Methods in Molecular Biology, (1986)).
  • the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the genes of the invention, Following transduction of a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter may be induced by appropriate means (e.g., temperature shift or chemical induction) and the cells may be cultured for an additional period to allow them to produce the desired polypeptide or fragment thereof.
  • Cells can be harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract is retained for further purification.
  • Microbial cells employed for expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents.
  • the expressed polypeptide or fragment thereof can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the polypeptide. If desired, high performance liquid chromatography (HPLC) can be employed for final purification steps.
  • HPLC high performance liquid chromatography
  • Various cells can be used for transduction with the rAAVEe of the invention including but not limited to COS-7 lines of monkey kidney fibroblasts, C127, 3T3, CHO, HeLa and BHK cell lines.
  • the vectors will comprise an origin of replication, a suitable promoter and the Ee of the invention, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking non-transcribed sequences.
  • DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required non- transcribed genetic elements.
  • Host cells containing the nucleotide sequence of interest can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying genes.
  • the culture conditions such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
  • the clones which are identified as having the specified enzyme activity may then be sequenced to identify the polynucleotide sequence encoding an enzyme having the enhanced activity.
  • kits comprising the compositions, e.g., nucleic acids, rAAVEe vectors, cells, polypeptides of the invention.
  • the kits also can contain instructional material teaching the methodologies and industrial uses of the invention, as described herein.
  • the Ee of the present invention is incorporated into any desired vector to express desired transgene(s).
  • the novel Ee sequences are not limited for use in the rAAVEe, but rather can be used in any appropriately constructed expression vector by techniques well known in the art (see Maniatis et al., op cit).
  • RNA polymerase a promoter recognizable by RNA polymerase, to which the polymerase binds and thus initiates the transcription process.
  • promoters There are a variety of such promoters in use, which work with different efficiencies (strong and weak promoters) and are different for prokaryotic and eukaryotic cells.
  • ribosome-binding sites such as the Shine-Dalgarno sequence (SD sequence).
  • SD sequence Shine-Dalgarno sequence
  • different transcriptional and translational regulatory sequences may be employed, depending on the nature of the host. They may be derived from viral sources, such as adenovirus, bovine papilloma virus, Simian virus, or the like, where the regulatory signals are associated with a particular gene which has a high level of expression. Examples are the TK promoter of Herpes virus, the SV40 early promoter, the yeast gal4 gene promoter, etc. Transcriptional initiation regulatory signals (i.e. Ee of the invention) may be selected which allow for repression and activation, so that expression of the genes can be modulated.
  • the Ee of the invention can be inserted into any vector which is capable of integrating the desired gene sequences into the host cell chromosome.
  • the cells which have stably integrated the introduced DNA into their chromosomes can be selected by also introducing one or more markers which allow for selection of host cells which contain the expression vector.
  • the introduced DNA molecule can be incorporated into a plasmid or viral vector (i.e. rAAVEe of the invention) capable of autonomous replication in the recipient host.
  • a plasmid or viral vector i.e. rAAVEe of the invention
  • Prokaryotic and eukaryotic plasmids are well known from the literature.
  • Factors of importance in selecting a particular plasmid or viral vector include the ease with which recipient cells that contain the vector may be recognized and selected from those recipient cells which do not contain the vector; the number of copies of the vector which are desired in a particular host; and whether it is desirable to be able to "shuttle" the vector between host cells of different species.
  • the DNA construct(s) may be introduced into an appropriate host cell by any of a variety of suitable means: transformation, transfection, conjugation, protoplast fusion, electroporation, calcium phosphate-precipitation, direct microinjection, etc.
  • Host cells to be used in this invention may be either prokaryotic or eukaryotic.
  • Preferred prokaryotic hosts include bacteria such as E. coli, Bacillus, Streptomyces, Pseudomonas, Salmonella, Serratia, etc.
  • Eukaryotic hosts are mammalian cells, e.g., human, monkey, mouse and Chinese hamster ovary (CHO) cells, because they provide post-translational modifications to protein molecules, including correct folding or glycosylation at correct sites. Also yeast cells can carry out post-translational peptide modifications, including glycosylation. After the introduction of the vector, the host cells are grown in a selective medium, which selects for the growth of vector-containing cells. Expression of the cloned gene
  • sequence(s) results in the production of the desired protein or a fragment thereof.
  • the expressed protein is then isolated and purified in accordance with the purification method described in the present application or by any other conventional procedure involving extraction, precipitation, chromatography, electrophoresis, or the like. A further purification procedure that may be used in preference for purifying the protein of the invention
  • Ee to cause mouse cells and tissues, particularly lung, liver and spleen, to express the transgene for alkaline phosphatase.
  • the final product of transgene expression is alkaline phosphatase (protein) which is measured in the transduced cells and tissues to confirm and quantify increased transgene expression when the Ee is utilized.
  • the vector plasmid was modified as follows.
  • MCS Bglll, NotI and Kpnl multiple cloning site
  • JSRV LTR was amplified from the full-length molecular clone of JSRV, pCMVJS 2 i (30), kindly provided by Dr. Massimo Palmarini, University of Glasgow, Scotland.
  • the EIMTV-1 LTR was amplified from the ENTV-1 NA4 isolate (37).
  • the full-length ENTV-2 LTR was constructed using overlapping clones (i) and (ii) (26) generously provided by Dr. Marcelo De las Heras, University of Glasgow, Scotland .
  • done (i) was digested with Ncol, blunted with Klenow and then digested with BamHI .
  • the vector fragment was isolated and subsequently dephosphorylated.
  • Clone (ii) was digested with IMdel, filled in with Klenow and then digested with BamHI.
  • the BamHI-blunt vector and insert fragments were ligated to generate the full-length ENTV-2 LTR.
  • To create AAV vectors expressing Env the AP cDIMA from AJAP, AE X AP and AE 2 AP was replaced with the env coding region from JSRV or EINTV- 1. All vectors contain the AAV2 inverted terminal repeats and all plasmids were propagated in the E. coli strain GT116 (InvivoGen).
  • the AA 6 packaging plasmid pDGM6 was a kind gift from Dr. David Russell, University of Washington.
  • JSRV-LTR-RV ataagatctCCTGCCGCGGCCAGCACAAG 109 - 128 AJAP
  • JJE-LTR-Fwd atatctagaCTGCATATGAAATATAGAAATATG 7103 - 7126 AJEJAP
  • AAV vectors were made using AAV6 capsid proteins, and were produced by co-transfection of HEK 293 cells with vector and packaging plasmids as described previously (13).
  • AAV vector titers were determined by Southern blot (15) and by competitive PCR.
  • DNA was extracted from AAV particles using a novel heat-based method based on the finding that AAV genomes can be uncoated at temperatures of 71°C or greater (24) . 5 yL of an AAV preparation was treated with 2 U of DNAse I (Boehringer-Mannheim) for 15 min at 37°C in a final volume of 20 pL.
  • EDTA Gibco BRL
  • concentration of competitor DNA was determined using a Nanovue spectrophotometer (GE Healthcare, Waukesha, Wisconsin).
  • Competitive PCR was conducted with varying concentrations of competitor DNA and static amounts of target DNA in order to quantify AAV vector genomes.
  • the primer pair: Fwd ext AP (5'-TACGCAGCTCATCTCCAACA-3') and Rev ext AP (5'-TCCAGGCTCAAAGAGACCCA-3') was used under the following PCR conditions: 94°C for 2 min followed by 30 cycles of 94°C for 30 s, 63.5°C for 30 s and 72°C for 30 s. A final extension of 5 min at 72°C concluded the program.
  • mice were obtained from Charles River Laboratories (Saint-Constant, QC) and eight-week old C57BL6/J-Rag2 mice were obtained from Taconic (Hudson, NY).
  • Lightly anesthetized mice received 1 x 10 10 vector genomes (vg) intranasally by the administration of drops to the nose, which were spontaneously inhaled.
  • mice were given 2 x 10 10 vg intravenously via tail-vein injection and 8 x 10 10 vg intraperitoneal ⁇ . Mice were euthanized 1-month after vector administration.
  • Lungs were perfused by way of the heart with 20 ml of phosphate-buffered saline (PBS) and individual lung lobes separated.
  • PBS phosphate-buffered saline
  • the same lobe from each mouse was either flash frozen in liquid nitrogen, preserved in RNAIater (Qiagen) or fixed in 2% paraformaldehyde-PBS for 2.5 h at 22°C. All major organs were preserved in the same manner with the exception that fixation was conducted for 24 h at 22°C.
  • Tissues were washed extensively with PBS (5 x 10 min) prior to inactivation of endogenous AP by incubation at 65°C for 1 h. Tissues were stained for vector-encoded heat-stable AP as described previously (15). Histochemical staining of mouse tissues for AP expression was performed as described (16). Immunohistochemical staining of mouse tissues for Env expression was performed as described (41).
  • Mouse tissues were harvested one month after vector administration, snap- frozen in liquid nitrogen and stored at -80°C until assayed. Tissues were homogenized in TMNC lysis buffer [50 mM Tris HCI pH 7.5, 5 mM MgCI 2 , 100 mM NaCI, 4% (wt/vol) CHAPS] using a hand held homogenizer (PRO200, Diamed). For extraction of total protein from the nasal cavity, one half of the nasal cavity (cut sagittally) was placed in a pulverizer on a bed of dry ice, pulverized into a fine dust and reconstituted in TMNC buffer.
  • TMNC lysis buffer 50 mM Tris HCI pH 7.5, 5 mM MgCI 2 , 100 mM NaCI, 4% (wt/vol) CHAPS
  • PRO200 hand held homogenizer
  • Tissue homogenates were placed in a water bath at 65°C for 1 h to inactivate endogenous heat-labile AP activity and subsequently clarified by centrifugation at 17,900 x g for 15 min at 4°C to remove cell debris.
  • the protein content of each sample was determined by the method of Bradford, and the AP activity in tissue lysates was determined by a fluorometric assay (38) using the 4-methylumbelliferyl phosphate (MUP) (Sigma, St. Louis, MO) substrate.
  • MUP 4-methylumbelliferyl phosphate
  • AP activity was measured by mixing up to 100 ⁇ of cell lysate, 100 pi of 2X SEAP buffer (2 M diethanolamine, 1 mM MgCI 2 , 10 mM L-homoarginine), and 5 ⁇ of MUP solution ( 11.4 mg of MUP [Sigma] per ml in dimethyl sulfoxide) in wells of an opaque black 96-well plate. The plate was incubated at 23°C and fluorescence due to production of 4-methylumbelliferone was measured every 10 min for 1 h with a fluorometer (Fluostar Optima). AP activity was expressed as the amount of enzyme product produced per second per microgram of total protein.
  • RNA extracted from transduced mouse liver and lung was obtained from transduced mouse liver and lung.
  • First strand cDNA synthesis was performed using the reverse primer, AAV INT R (5'- CTTCCAGACCTCTCGTTGTA-3') and Superscript III (Invitrogen) according to the manufacturer's directions.
  • PCR amplification of cDNA originating from the first strand synthesis was performed using a primer in the U5 region of the LTR, U5 JSRV/ENTV F (5'- CTGATCCTCTCAACCCCATC-3'), and a primer in the AAV vector immediately upstream of the AP gene, AAV INT R (5'-CTTCCAGACCTCTCGTTGTA-3'), using 5 PRIME MasterMix (5 PRIME, Gaithersburg, MD) under conditions previously described (37). 5' rapid
  • RACE amplification of cDNA ends
  • the nested gene specific primer, 5RACE AP IN R (5'- CAAGTTCTTAGTTCTGGTGCCG-3') and the abridged anchor primer (5'- GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG-3') provided with the kit were used to carry out amplification of dC-tailed cDNA.
  • a final nested PCR was performed using the abridged universal amplification primer (5'-GGCCACGCGTCGACTAGTAC-3') and the aforementioned reverse primer, AAV INT R, under conditions previously described (37). Products from the final nested PCR were cloned into pGEM-T Easy (Promega) and sequenced.
  • PCR was used to amplify JE or LTR sequences from the molecular do
  • JSRV, pCMV-JS21 (Palmarini et al, 1999) .
  • JE and LTR sequences were cloned into Xbal and Bglll sites in the AAV vector plasmid containing a murine leukemia virus retrovirus intron and human placental alkaline phosphatase reporter gene.
  • the chicken beta actin promoter (AG) was cloned downstream of the JE or JSRV LTR sequences into Bglll and Kpnl sites.
  • Beta-galactosidase assays were performed by the method of J. Miller
  • Promoter constructs were cloned into an AAV2 vector plasmid upstream of an intron and a heat stable alkaline phosphatase reporter gene (human placental alkaline phosphatase).
  • the reference sequence for the complete JSRV genome found by Palmarini et al (1999) can be accessed using GenBank accession number AF105220.1.
  • SEQ ID NO. 1 Sequence for enhancer element EE contained in rAAVEe vector AggEiAP.
  • SEQ ID NO. 2 Sequence for Enhancer element JE contained in rAAVEe vector Aj E JAP.
  • pAAG-AP A construct possessing the chicken beta actin promoter alone.
  • AAAAAGCGAAGCGCGCGGCGGGCG (SEQ ID NO : 5)
  • pAJE72-AP - A construct consisting of position 7105 to the start of the LTR, position 7175. The JE as reported previously.
  • pAiJE328-AP - A construct identical to JE328 consisting of position 6857 to the start of the LTR, position 7175. However its orientation is inverted relative to JE328.
  • pAiJE187-AG-AP - A construct consisting of position 6992 to the start of the LTR, position 7175. A moderately 5' extended version of the IE. However its orientation is inverted relative to JE187. Also possesses the chicken beta actin promoter.
  • pAJE187-U3-AP - A construct consisting of position 6992 to the start of the LTR, position 7175. A moderately 5' extended version of the JE and also the U3 region of the LTR (position 7176 - 7442).
  • LTR position 7175.
  • the JE as reported previously. Also possesses the U3 region of the LTR (position 7176 - 7442).
  • pAJE72-U3-AG-AP - A construct consisting of position 7105 to the start of the LTR, position 7175.
  • the JE as reported previously. Also possesses the U3 reg ion of the LTR (position 7176 - 7442) and the chicken beta actin promoter.
  • pAJE72-U3-R-AP - A construct consisting of position 7105 to the start of the LTR, position 7175.
  • the JE as reported previously. Also possesses the U3 region of the LTR (position 7176 - 7442) and the R reg ion of the LTR (7442 - 7455) .
  • pAJE72-U3-R-AG-AP - A construct consisting of position 7105 to the start of the LTR, position 7175.
  • the JE as reported previously. Also possesses the U3 region of the LTR (position 7176 - 7442) and the R region of the LTR (7442 - 7455). Also possesses the chicken beta actin promoter.
  • pAU3- -U5-AP - A construct consisting of the entire LTR of JSRV as it would exist in the provirus, containing U3, R and U5 regions.
  • pAJE72-U3-R-U5-AP - A construct consisting of position 7105 to the start of the LTR, position 7175.
  • the JE as reported previously. Also possesses the JSRV LTR consisting of U3, R and U5 regions.
  • pAJE328-U3-R-U5-AP - A construct consisting of position 6857 to the start of the LTR, position 7175. A highly 5' extended version of the JE. Also possesses the JSRV LTR consisting of U3, R and U5 regions.
  • pAJE72-eU3-AP - A construct consisting of position 7175 to 7200. A 3' extended version of the JE.
  • pAJE72-eU3-AG-AP - A construct consisting of position 7175 to 7200. A 3' extended version of the JE. Also possesses the chicken beta actin promoter. [00155] aCATATG AAATATAG AAATATGTTACAGCACCAACATCXTATGG AGCTTTTAAAAAA
  • LTR promoters of ovine betaretroviruses show similar activities in the nose and lungs of mice.
  • AAV vectors expressing the AP cDIMA under the control of the JSRV (AJAP), ENTV-1 (AE X AP) or ENTV-2 (AE 2 AP) LTRs were constructed (Fig. 1 ) and 10 10 vg of each vector was administered intranasally to lightly anesthetized mice. Mice were euthanized one month later and tissues from the upper and lower respiratory tract were harvested for analysis of AP expression . The lung, nose and tracheal sections from mice given saline did not express AP (data not shown).
  • JSRV LTR is highly active in epithelial cells of both the upper and lower airway suggesting that at least in mice, JSRV LTR activity is not limited to the lung.
  • the ENTV LTRs are active in both the nose and the lung of mice, albeit to a lesser extent than the JSRV LTR in the lung.
  • One notable difference between JSRV and ENTV LTR activity in mice was in the tracheal and airway epithelium, indicating that the LTRs do display differential activity in vivo but only in a specific subset of cells.
  • ENTV LTRs were inactive in all tissues examined (spleen and kidney: Fig . 4B, D, E, F; heart, pancreas and brain : data not shown).
  • variable region at the 3' end of the env gene increases transgene expression from the 35RV and ENTV LTRs after intranasal administration of AAV vectors.
  • results from the previous experiment suggested that the LTRs are not responsible for the cell-type specific oncogenicity observed in naturally infected sheep and that perhaps other regions of the ovine betaretroviral genome contribute to the disease spectrum.
  • the genomic sequences of JSRV and ENTV differ at the 3' end of the env gene, just upstream of the 3' LTR (29), in a region that has been shown to be dispensable for transformation ( 17) but possesses enhancer functions in other retroviruses (3, 18).
  • variable region at the 3' end of the env gene expands the tissue tropism of the EIMTV LTR after systemic administration of AAV vectors.
  • a JE JAP and A EE EiAP were administered intravenously (2 x 10 10 vg ) and
  • mice intraperitoneal ⁇ (8 x 10 10 vg) to 8 week-old C57BL/6 mice.
  • mice were euthanized and the liver, spleen, kidney, pancreas, heart and brain were harvested and stained for AP expression.
  • Systemic administration of the A JE JAP vector showed stronger AP expression in the liver, spleen and kidney (Fig . 3G, H and I) as compared to the WT JSRV LTR in the same tissues (Fig. 3A, B and C).
  • systemic administration of the A EE EiAP vector led to high levels of AP expression in the liver (Fig . 3J), spleen (Fig .
  • the upstream enhancing elements are not present in AAV vector mRNA.
  • the JE and EE elements contain part of a putative RNA export element termed the signal peptide-responsive element (SPRE) (2) or Rej-responsive element (RejRE) (25).
  • SPRE signal peptide-responsive element
  • RejRE Rej-responsive element
  • 5' RACE was conducted. Total RNA extracted from the liver of vector transduced and saline infected mice, was subjected to 5' RACE. The resultant RT-PCR products were cloned and sequenced.
  • mice immunodeficient C57BL/6-Rag2 mice resulted in robust and rapid tumor formation for all of the AAV vectors tested.
  • mice By 2.5 months post-infection mice had developed signs of respiratory distress necessitating euthanasia.
  • the lungs of mice receiving AAV vectors with any combination of LTR and Env looked very similar.
  • the lungs had nearly doubled in size and were filled with an extensive array of tumor nodules that permeated the entire lung parenchyma (Fig. 6A, B, and C). There was no evidence of tumor formation or foci of hyperplasia in either the nasal epithelium or the trachea in any of the mice examined (data not shown).
  • the JE appears to function as an enhancer as it was able to enhance expression when combined with the chicken beta actin promoter, in either orientation (Figs. 8A-E). Extending the JE in the 5' direction did not seem to increase expression in most cases but may possibly improve expression in HTX cells.
  • a hybrid promoter consisting of the JE72, the U3 region of the JSRV LTR, and the chicken beta actin promoter (AG) (construct pAJE72-U3-AG), or a hybrid promoter consisting of the JE72, the U3 and R regions of the JSRV LTR, and the chicken beta actin promoter (AG) (construct pAJE72-U3- R-AG) both demonstrated very high level expression in 293 and HTX cells comparable to the CMV-IE/chicken beta actin promoter construct (designated pACAGAP).
  • these hybrid promoters may have higher specificity for lung and liver expression since they contain lung and liver specific transcription factor binding sites and are derived from a respiratory tract specific virus.
  • the pAJE72-U3-R-AG-AP construct possessed approximately 6, 11, 22, and 21 fold higher expression in 293, 293T, HTX, and 208F cells, respectively.
  • the Ee sequences may be used to enhance expression of transgenes when encoded within a plasmid vector and delivered via transfection.
  • Figures 8/9 also demonstrate that the Ee of the invention are able to function to enhance expression of transgenes when encoded within a plasmid vector and delivered via transfection, as these constructs were transfected into cells via the calcium phosphate method and were not transduced with the AAV vector system.
  • these plasmids contain AAV sequences in the form of two inverted terminal repeats flanking the transgene cassette, the transgene cassette remains in the non-viral, plasmid based form. As such, it functions as would any other recombinant DNA plasmid.
  • the Ee sequences can be incorporated into any plasmid and can be used to enhance the expression of transgenes encoded on a plasmid when transfected into cells.
  • HNF-3beta is a critical factor for the expression of the Jaagsiekte sheep retrovirus long terminal repeat in type II pneumocytes but not in Clara cells. Virology 292:87-97.
  • Candidate tumor suppressor HYAL2 is a glycosylphosphatidylinositol (GPI)-anchored cell-surface receptor for jaagsiekte sheep retrovirus, the envelope protein of which mediates oncogenic transformation. Proc. Natl. Acad. Sci. USA 98:4443-4448.
  • GPI glycosylphosphatidylinositol

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

This invention provides a transcriptional Enhancer element (Ee) derived from Jaagsiekte sheep retrovirus (JSRV) or Enzootic nasal tumor virus. TheEnhancer element (Ee) is for use with expression vectors and in particular for use in an Adeno-Associated Virus (AAV) vector that comprises a transgene(s) cloned into the AAV vector, wherein the Enhancer element (Ee) is cloned into the AAV vector upstream of a LTR. The novel vector is identified in general as rAAVEe vector. The Ee is encoded by a nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, or subsets and homologs of these sequences. The invention includes compositions where the rAAVEe is transduced into a cell to enhance the expression of the transgene(s) contained in the AAV vector. The invention is useful for therapeutic, diagnostic and industrial uses requiring increased transgene(s) expression or protein production.

Description

Enhancing Protein Expression of Adeno-Associated Virus Vectors FIELD OF THE INVENTION
[0001] The present invention relates generally to the upregulation of transgene expression in cells, and more specifically to novel Enhancer elements "Ee" (nucleotide sequence) for use in a variety of viral and expression vectors and in particular an Adeno- Associated Virus vectors to increase the expression of the transgene(s) for gene therapy and industrial production of proteins.
BACKGROUND OF THE INVENTION
[0002] The therapeutic treatment of diseases and disorders using gene therapy involves using a viral vector to transfer and stably insert new genetic material into the diseased cells. Although a variety of methods have been developed to introduce exogenous genetic material into eukaryotic cells, Adeno-Associated Virus (AAV) vectors have generally been considered one of the most efficient and practical methods. AAV is a small, non-enveloped, replication-defective, single stranded DIMA virus from the genus Dependovirus and family Parvoviridae which can infect humans and other mammals. AAV is considered nonpathogenic because it is not known to cause disease and it generates a very small immune response in its host. AAV can infect both dividing and non-dividing cells and may incorporate its genome into that of the host cell or the AAV vectors can be designed and built so they do not integrate into the host cell's genome. Instead, the AAV genome fuses at its ends via the IT (inverted terminal repeats) to form circular, episomal forms, which are predicted to be the primary cause of the long term expression of the transgenes. These features make AAV a very attractive candidate for creating viral vectors for gene therapy. When using gene therapy to treat disease or produce novel proteins in vitro or in vivo, any method that can increase the expression rate and yield of transgenes to produce proteins of interest, will lower the dose of AAV required per cell, which will improve the efficiency of protein production and minimize any adverse effects of the AAV on transduced cells. As a result fewer AAV vector particles are required per cell to produce the desired level of protein.
[0003] The research literature contains many examples of clinical trials conducted to investigate gene therapy methods using AAV vectors for diseases such as cystic fibrosis with the vector delivered to the lung via aerosol, hemophilia delivered via hepatic artery, arthritis delivered intraarticular^, muscular dystrophy delivered intramuscularly, and Alzheimer's delivered intracranial^, to name a few.
[0004] Jaagsiekte sheep retrovirus (JSRV) and enzootic nasal tumor virus (ENTV) are closely related oncogenic betaretroviruses that infect sheep and goats. These two viruses were used to develop the nucleotide sequence for the Enhancing element (Ee) to be incorporated into an AAV vector, which is the basis of this invention to increase the expression of transgenes when using AAV vectors.
[0005] GenBank publically discloses the entire nucleotide (genome) sequence for
JSRV (Accession No. AF105220) which contains the native sequence for Ee named herein as JE, however JE is not identified, characterized or isolated.
[0006] GenBank also publically discloses the nucleotide (genome) sequence for
ENTV-1 (Accession No. FJ744146) and ENTV-2 (Accession No. IMC_004994), which contain the native sequence for each of the Ee named herein as EE, however neither EE is not identified, characterized or isolated.
[0007] Given the foregoing, it would be desirable to increase the level of expression of transgenes to increase the production level of proteins of interest in transduced mammalian cells or animals, when AAV vectors are used for therapeutic, diagnostic, and industrial purposes.
SUMMARY OF INVENTION
[0008] This invention in aspects is summarized as novel Enhancer elements (Ee) suitable for use in a variety of viral and expression vector systems. The Ee of the invention function to enhance the expression of any nucleic acid sequence/recomb'mant DNA/transgene in a desired vector/expression system in transduced or transfected cells, tissues or mammals
[0009] The Ee of the invention in an embodiment are used in an AAV vector to enhance the expression of transgenes in cells transduced by the AAV vector. It has now been demonstrated that the addition of a transcriptional Enhancer element (Ee) upstream of a promoter of an AAV vector, can significantly enhance the transcription and expression of the transgene(s) contained within the AAV vector, in transduced cells. The invention in aspects also is directed to a composition comprising a recombinant Adeno-Associated Virus (rAVV) vector, containing an Ee, and one or more transgenes, which together shall be termed a 'rAAVEe vector" for the purposes of describing this invention. [0010] The invention encompasses novel Ee sequences, constructs comprising the
Ee sequences, vectors comprising the novel constructs, and compositions comprising such. The invention also encompasses uses of such compositions for therapy such as gene therapy for the treatment of a variety of disorders. The invention also encompasses uses of such compositions as medicaments for the treatment of disease. The invention further encompasses methods of making the compositions and therapeutic methods incorporating such. The invention also encompasses uses of the composition for industrial production of protein(s) in cell culture in vitro. The invention also encompasses kits to verify the presence of the compositions in transduced cells and methods to verify the presence of the composition in transduced cells.
[0011] In an aspect of the invention are novel Ee sequences derived from
Jaagsiekte sheep retrovirus (JS V) and enzootic nasal tumor virus (ENTV). These novel Ee sequences are used in conjunction with a promoter and transgene to form constructs for use in a variety of viral vectors or plasmid for transduction/transfection of cells, tissues and/or mammals.
[0012] In another aspect of the invention are novel Ee sequences derived from
JSRV and ENTV. these novel Ee sequences including fragments and homologous sequences thereof are used in conjunction with a promoter and transgene to form constructs within an AAV vector for transduction of cells, tissues and/or mammals.
[0013] Thus, another aspect of the invention is a rAAVEe vector to enhance the expression of a transgene in mammalian cell culture to increase the production yield of recombinant proteins produced in the cell culture compared to using an AAV vector without an enhancing element. Utilization of a rAAVEe vector requires transducing cells with a rAAVEe vector, then growing and supporting the cells in culture medium known in the art and then harvesting the recombinant protein produced, using methods known in the art. The resulting mammalian cell(s) transduced with the rAAVEe vector becomes capable of exhibiting enhanced expression of the transgene(s).
[0014] In another aspect of the invention a rAAVEe vector is used to increase the expression of transgene(s) contained in or cloned into the rAAVEe vector, in the organs of a mammal, compared to the transgene(s) expression of an AAV vector not containing the Ee. Use of the rAAVEe vector to enhance the expression of a transgene (i.e. enhance the production of a protein of interest) in a specific organ of a mammal requires local administration of a rAAVEE vector to transduce that organ. Likewise to enhance the expression of a transgene in several organs or the entire mammal requires systemic administration of a rAAVEE vector. The rAAVEe would enable the cells of an organ to increase the production of the desired proteins which may have therapeutic benefit to the mammal. The resulting mammal transduced with the rAAVEe vector becomes capable of exhibiting long term enhanced expression of the transgene(s).
To summarize non-limiting aspects of the invention there are provided: a transcriptional Enhancer element (Ee) derived from Jaagsiekte sheep retrovirus (JSRV) or Enzootic nasal tumor virus (ENTV); said JSRV derived Ee comprises the sequence of SEQ ID NO: l ; said ENTV derived Ee comprises the sequence of SEQ ID NO.2.; fragments of the Ee, wherein the fragment enhances expression of a nucleic acid sequence, transgene and/or recombinant DNA (i.e. functional fragments); the fragment can be at least 20 nucleotides in length, at least 30 nucleotides in length, at least 40 nucleotides in length, at least 50 nucleotides in length and at least 60 nucleotides in length; homologd of the Ee sequence of the invention; nucleic acid sequences that share at least 60%, at least 70%, at least 80%, at least 85%, at least 90% or at least 95% sequence identity to the Ee of the invention of SEQ ID NO. 1 or 2; nucleic acid constructs comprising the Ee of the invention; the nucleic acid constructs can further comprise a promoter and transgene; expression vectors comprising the nucleic acid constructs; mammalian expression vectors containing the constructs of the invention; Adeno-Associated Virus (AAV) vector comprising the construct (rAAVEE); the construct comprises a sequence selected from the group consisting of SEQ ID NO. SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 17, SEQ ID NO. 18, SEQ ID NO. 19, SEQ ID NO. 20, SEQ ID NO. 21, SEQ ID NO. 22, SEQ ID NO. 24, SEQ ID NO. 25, SEQ ID NO. 26, SEQ ID NO. 27 and SEQ ID NO. 28 (including fragments and homologs of these sequences); compositions comprising the vector of the invention that incorporates the Enhancer element of the invention; medicaments comprising the vectors; cells transduced/transfected with the vector; the cell is eukaryotic or prokaryotic and selected from the group consisting of human, mouse, rat, bird, cat, dog, goat, sheep, pig, bovid, horse or non-human primate cell; the cell can be selected from the group consisting of fibroblasts, neurons, retinal cells, liver cells, kidney cells, lung cells, bone marrow stem cells and hematopoietic stem cells; the cell is selected from the group consisting of HTX cells, 208 fibroblasts, HEK-293 cells and HEK-293T cells; compositions comprising a cell transfected with a vector containing the Ee of the invention; compositions comprising a cell transduced with a recombinant Adeno-Associated Virus (AAV) vector (rAAVEe) comprising a transgene cloned into the AAV vector, an Enhancer element (Ee) cloned into the AAV vector upstream of a Long Terminal Repeat (LTR), said Ee encoded by a nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, wherein said rAAVEe enhances the expression of the transgene; uses of the composition as herein described for gene therapy; uses of the composition as herein described as a medicament for gene therapy; uses of the Ee of the invention in expression systems for industrial production of protein(s) in cell culture in vitro; methods for producing a desired protein, which comprises culturing a cell comprising a vector comprising the Ee of the invention; and harvesting the expressed protein from the cultured cell or medium; a method for expressing a desired DNA in a host cell, which comprises introducing the vector having the Ee of the invention into the host cell; methods for increasing the expression level of a desired transgene in a host cell, which comprises inserting upstream of the desired transgene an Ee of SEQ ID NO. 1 or 2, including fragments and homologs thereof; and methods to provide a desired transgene to a subject, said method comprising administering to said subject a composition comprising a vector comprising an Ee of the invention upstream of the desired transgene.
[0015] Other aspects and features of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the scope of the invention will become apparent to those skilled in the art from this detailed description. These and other aspects of the invention will become apparent by reference to the detailed description and figures.
BRIEF DESCRIPTION OF THE FIGURES
[0016] FIG. 1. Schematic of AAV vector genomes containing LTRs and upstream enhancing elements derived from the JSRV or ENTV-1 genome. The nucleotide sequence at the start of the enhancer (EE or JE) and LTR is shown above. AJAP, AEIAP and AE2AP are AAV vectors that do not incorporate enhancer elements. AEEE1AP and AJEJAP are AAV vectors (also called rAAVEe vectors) which contain enhancer elements EE and JE respectively.
[0017] FIG. 2. AP expression in mice following intranasal administration of AJAP,
AEiAP, AE2AP, A:EJAP and AEEEiAP. Gross images of mouse tissues transduced intranasally with AJAP (A, F, K), AEiAP (B, G, L), AE2AP (C, H, M), A]EJAP (D, I, N) and ΑΕΕΕιΑΡ (Ε, J, O) and stained for AP expression. Histological sections of mouse tissues transduced intranasally with AJAP (P, U), AE^P (Q, V), AE2AP (R, W) AjEJAP (S, X) and A^AP (T, Y) and stained for AP expression. [0018] FIG. 3. Quantitative analysis of AP enzymatic activity in mouse nose (A), trachea (B) and lung (C) tissue transduced with AAV6 vectors expressing AP from the JSRV (AJAP), ENTV- l (AEXAP) and ENTV-2 (AE2AP) LTRs.
[0019] FIG . 4. AP expression in mouse tissues following intravenous and intraperitoneal administration of AJAP (A, B, C), AEiAP (D, E, F), AJEJAP (G, H, I), and AEE IAP (J, K, L). Histological sections of mouse tissues transduced intravenously and intraperitoneally with A EJAP (M, N, O) and ΑΕΕΕιΑΡ (Ρ, Q, R) and stained for AP expression.
[0020] FIG. 5. Quantitative analysis of AP enzymatic activity in mouse tissues transduced with AAV6 vectors containing JSRV and ENTV-l LTRs with and without enhancing elements. (A) AP expression in the lungs of mice transduced with 1 x 109 vg of JSRV LTR bearing vectors. (B) AP expression in the liver of mice transduced with 2 x 109 vg of JSRV LTR bearing vectors. (C) AP expression in the lungs of mice transduced with 1 x 1010 vg of ENTV-l LTR bearing vectors. (D) AP expression in the liver of mice transduced with 2 x 1010 vg of ENTV-l LTR bearing vectors.
[0021 ] FIG. 6. Tumor induction in mouse lungs following intranasal administration of AAV6 vectors expressing either the ENTV or JSRV Env protein from the JSRV, ENTV-l or ENTV-2 LTR. Images are representative of tumor induction with either envelope since the frequency and magnitude of tumor induction was indistinguishable between all three LTRs. Gross images of mouse lungs transduced with AJJenv (A), AEiJenv (B) and AE2Jenv (C) and a marker vector expressing AP (purple staining). H&E stained histologic section of AJJenv (D), AEjJenv (E) and AE2Jenv (F) transduced mouse lungs. Immunohistochemical staining of AJJenv (G), AExJenv (H) and AE2Jenv (I) transduced mouse lungs with an envelope-specific monoclonal antibody.
[0022] FIG. 7. A schematic view of the various promoter constructs derived from the JE (JSRV Element) sequences. The JSRV complete JSRV genome is shown at the top. The JSRV long terminal repeat (LTR) consisting of unique 3' region (U3), repeat region (R), and unique 5' region (U5) is also shown. JE328 refers to a 5' extended version of JE extending 328 bp upstream of the LTR, JE187 refers to a 5' extended version of JE extending 187 bp upstream of the LTR, and JE72 refers to the original J E which extends 72 bp upstream of the LTR. The chicken beta actin promoter, designated AG, is also included in some constructs. A lowercase "i" in front of the JE sequence denotes that it is in an inverted orientation. CMV-EN refers to the CMV immediate early enhancer which together with the chicken beta actin promoter, AG, make up the CAG promoter. [0023] FIGS. 8A-E. Graphs showing various constructs in 293 (A), 293T(B),
HTX(C), 208F(D) and all cell types (E) effect as measured by relative AP units normalized to B-gal activity.
[0024] FIG. 9. Graph showing a comparison of four different vectors containing Ee of the invention versus control. The pAAG-AP is a non-enhanced vector with a chicken beta actin promoter. pAJE72-AG is an enhanced vector with chicken beta actin promoter. pAJE72-U3-R-AG is an enhanced vector with the U3 region of JSRV as well as the chicken beta actin promoter. pACAG-AP is a vector containing the CMV immediate enhancer and chicken beta actin promoter.
DETAILED DESCRIPTION OF THE INVENTION
[0025] As used herein the specification or claim(s) when used in conjunction with the word "comprising", the words "a" or "an" may mean one or more than one. As used herein "another" may mean at least a second or more.
[0026] Novel Enhancing elements (Ee) are provided derived from JSRV or ENTV. these Ee as understood by one of skill in the art can be used in a variety of viral vectors or other plasmids (expression vectors) in order to enhance expression of a desired nucleic acid sequence/recombinant DNA/transgene. Thus the novel Ee of the invention have use both in the gene therapy field as well as for the preparation of medicaments and in the industrial production of any protein peptide as desired.
[0027] The JSRV or ENTV derived Ee of the invention comprises the nucleotide sequence SEQ ID NO : l
(acatataaatatagatacatgttgcaataccaaaaacttatggatcttgtaaaaaaaggagaggggag or SEQ ID NO : 2 (ctgcatatgaaatatagaaatatgttacagcaccaacatcttatggagcttttaaaaaataaagagaggggag), as well as truncated subsets of these sequences (i.e. fragments) or homologous sequences.
[0028] The invention in further non-limiting aspects provides novel Enhancer elements (Ee) used in conjunction with a promoter and transgene(s) as a construct incorporated into an Adeno-Associated Virus (AAV) vector, herein referred to as rAVVEe vector. The invention also in aspects provides compositions comprising the rAVVEe vector and methods of using/administrating the compositions for gene therapy and as medicaments in mammals such as humans. When these three components (Ee, AAV vector and transgene) are combined they create a novel recombinant AAV vector (rAAVEe vector). A rAAVEe vector can increase the expression of a transgene gene contained in the vector in a mammalian cell which has been transduced with the vector, when compared to an AAV not containing the Ee. The Enhancer elements of the invention are derived from JSRV or ENTV viruses. The Ee comprises the nucleotide sequence SEQ ID NO: l (acatataaatatagatacatgttgcaataccaaaaacttatggatcttgtaaaaaaaggagaggggag or SEQ ID NO: 2 (ctgcatatgaaatatagaaatatgttacagcaccaacatcttatggagcttttaaaaaataaagagaggggag), truncated subsets of these sequences or homologous sequences.
[0029] The Ee of the invention comprises SEQ ID NO.l or SEQ ID NO. 2 as well as sequences that are at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: l or SEQ ID NO:2 set forth herein. The present invention encompasses any fragment of Ee set forth in SEQ ID NOS: 1 and 2.
[0030] The invention provides an isolated, synthetic or recombinant nucleic acid comprising a nucleic acid sequence having at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity to SEQ ID NO: l or 2. The homologous sequences may be obtained using any of the procedures described herein or may result from the correction of a sequencing error.
[0031] It is understood that as discussed herein the use of the terms "homology" and "identity" mean the same thing as similarity. Thus, for example, if the use of the word homology is used to refer to two non-natural sequences, it is understood that this is not necessarily indicating an evolutionary relationship between these two sequences, but rather is looking at the similarity or relatedness between their nucleic acid sequences. Many of the methods for determining homology between two evolutionarily related molecules are routinely applied to any two or more nucleic acids or proteins for the purpose of measuring sequence similarity regardless of whether they are evolutionarily related.
[0032] Those of skill in the art readily understand how to determine the homology of nucleic acids. For example, the homology can be calculated after aligning the two sequences so that the homology is at its highest level. Another way of calculating homology can be performed by published algorithms. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman and Wunsch, J. MoL Biol. 48 :443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A. 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics
Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.; the BLAST algorithm of Tatusova and Madden FEMS Microbiol. Lett. 174:247-250 (1999) available from the National Center for Biotechnology
Information(http://www. ncbi.nlm.nih.gov/blast/bl2seq/bl2. html), or by inspection.
[0033] The same types of homology can be obtained for these Ee sequences for example the algorithms disclosed in Zuker, M. Science 244:48-52, 1989, Jaeger et al. Proc. Natl. Acad. Sci. USA 86 : 7706-7710, 1989, Jaeger et al. Methods Enzymol. 183 : 281 - 306, 1989, which are herein incorporated by reference for at least material related to nucleic acid alignment. It is understood that any of the methods typically can be used and that in certain instances the results of these various methods may differ, but the skilled artisan understands if identity is found with at least one of these methods, the sequences would be said to have the stated identity.
[0034] The Ee of the invention can be used in various AAV vectors known and used in the art of gene therapy or more specifically in the AAV vectors described in Example 1 below. The term "Adeno-Associated Virus vector" or "AAV vector" means a vector comprised of a viral genome based on any of the 11 known serotypes of Adeno-Associated Virus genome, and additional nucleotide sequences (functional genes, transgenes, promoters, enhancers and any other desired gene sequences) that are inserted into the vector through cloning or any other method known in the art of recombinant genetic engineering, which is capable of transducing (infecting) cells and expressing these additional nucleotide sequences in the transduced cells.
[0035] The terms "enhancing" and "up-regulating" are used interchangeably herein and refer to expression of a gene that exceeds the endogenous level of expression, (i.e. transgene expression level achieved using an AAV vector without incorporating an Ee).
[0036] The term "Long Terminal Repeat" or "LTR" means the nucleotide sequence(s) that are found flanking the proviral form of integrated retroviral sequences. They contain promoter elements used to control transcription of retroviral genes. LTRs consist of unique region 3' (U3), R region (R) and unique 5' region (U5).
[0037] The term "Enhancer element" and "Ee" are used as a general term to describe a nucleotide sequence added to or upstream of a promoter, including a LTRof an AAV vector, which increases the expression of transgene(s) contained in the AAV vector compared to the expression of the same vector not containing the same Ee. Provided herein are nucleotide sequences of Ee and AAV vectors incorporating such Enhancer elements. Specifically, provided herein is an AAV nucleic acid vector, comprising an Ee of the present invention referred to as "JE" or "EE", promoter and transgene. [0038] The Ee construct may be made using well-known techniques in the art of gene construct synthesis. Moreover, once prepared, the construct is introduced into anyvector system (in aspects the AAV vector) using recombinant technology that is well- established in the art. Animals and or cells can then be transduced/transfected with a suitable vector incorporating the Ee and the desired transgene(s) using well-known techniques in the art of vector based gene therapy.
[0039] The term rAAVEe vector' " is used to describe an AAV vector which incorporates an Ee and a transgene(s) (or nucleic acid sequence or recombinant DNA molecule of interest).
[0040] It follows that any transgene whose expression is enhanced by the Ee when combined in an AAV vector system will demonstrate an upreguiation in the translation of the corresponding mRNA of this transgene (See e.g., Graham et al., Virol., 52 :456 (1973); Sambrook et al., Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratories, New York (1989); Davis et al., Basic Methods in Molecular Biology, Elsevier, (1986); and Chu et al., Gene 13: 197 (1981). Such techniques may be used to introduce one or more exogenous DNA moieties, such as a gene transfer vector and other nucleic acid molecules, into suitable recipient cells.
[0041] As used herein, the term "transduction" denotes the delivery of a foreign
DNA molecule to a recipient cell either in vivo or in vitro, via a recombinant AAV. As used herein, the terms "stable transduction" and "stably transduced" refers to the introduction and integration of foreign DNA into the genome of a foreign cell.
[0042] As used herein, the term "transfection" refers to the uptake of foreign DNA by a cell. A cell has been "transfected" when exogenous DNA has been introduced inside the cell membrane. A number of transfection techniques are generally known in the art (See e.g., Graham et al., Virol., 52:456 (1973); Sambrook et al., Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratories, New York (1989); Davis et al., Basic Methods in Molecular Biology, Elsevier, (1986); and Chu et al., Gene 13: 197 (1981). Such techniques may be used to introduce one or more exogenous DNA moieties, such as a gene transfer vector and other nucleic acid molecules, into suitable recipient cells. As used herein, the terms "stable transfection" and "stably transfected" refers to the introduction and integration of foreign DNA into the genome of the transfected cell. The term "stable transfectant" refers to a cell, which has stably integrated foreign DNA into the genomic DNA. [0043] As used herein, the term "recipient cell" refers to a cell which has been transduced, or is capable of being transduced, by a nucleic acid construct or vector bearing a selected nucleotide sequence of the invention, ie. the rAVVEe of the invention. The term includes the progeny of the parent cell, whether or not the progeny are identical in morphology or in genetic make-up to the original parent, so long as the selected nucleotide sequence is present. The recipient cell may be the cells of a subject to which the gene therapy vector has been administered.
[0044] As used herein, the terms "gene transfer," "gene delivery," and "gene transduction" refer to methods or systems for reliably inserting a particular nucleotide sequence (e.g., DNA) into targeted cells. As used herein, the term "gene therapy" refers to a method of treating a patient wherein polypeptides or nucleic acid sequences are transferred into cells of a patient such that activity and/or the expression of a particular molecule is restored.
[0045] As used herein, the term "nucleic acid" sequence refers to a DNA or RNA sequence. Nucleic acids can, for example, be single or double stranded. The term includes sequences such as any of the known base analogues of DNA and RNA.
[0046] As used herein, the term "recombinant DNA molecule" refers to a DNA molecule which is comprised of segments of DNA joined together by means of molecular biological techniques.
[0047] As used herein, "transgene" means any piece of DNA which is inserted by artifice into a cell, and becomes part of the genome of the organism (i.e., either stably integrated or as a stable extrachromosomal element) which develops from that cell. Such a transgene may include a gene which is partly or entirely heterologous (i.e., foreign) to the transgenic organism, or may represent a gene homologous to an endogenous gene of the organism. Included within this definition is a transgene created by the providing of an RNA sequence which is transcribed into DNA and then incorporated into the genome.
[0048] It is within the scope of the present invention that any desired nucleic acid sequence, recombinant DNA molecule or transgene can be incorporated into the rAAVEe of the invention as is understood by one of skill in the art. Collectively, these are exogenous nucleic acid sequences.
[0049] A promoter for use in the rAAVEe of the present invention can be any desired promoter, selected by known considerations, such as the level of expression of a nucleic acid functionally linked to the promoter and the cell type in which the vector is to be used. That is, the promoter can be tissue/cell-specific. Promoters can be prokaryotic, eukaryotic, fungal, nuclear, mitochondrial, viral or plant promoters. Promoters can be exogenous or endogenous to the cell type being transduced by the vector. Promoters can include, for example, bacterial promoters, known strong promoters such as SV40 or the inducible metallothionein promoter, or an AAV promoter, such as an AAV p5 promoter. Additionally, chimeric regulatory promoters for targeted gene expression can be utilized. Other promoters include promoters derived from actin genes (i.e. chicken beta actin promoter), immunoglobulin genes, cytomegalovirus (CMV), adenovirus, bovine papilloma virus, adenoviral promoters, such as the adenoviral major late promoter, an inducible heat shock promoter, respiratory syncytial virus, Rous sarcomas virus (RSV), etc.
[0050] The rAAVEe vector provided herein in aspects comprises an exogenous nucleic acid functionally linked to the promoter. By "exogenous" nucleic acid is meant any nucleic acid that is not normally found in wild-type AAV that can be inserted into a vector for transduction into a cell, tissue or organism. The exogenous nucleic acid can be a nucleic acid not normally found in the target cell, or it can be an extra copy or copies of a nucleic acid normally found in the target cell. The terms "exogenous" and "heterologous" are used herein interchangeably. By "functionally linked" is meant that the promoter can promote expression of the exogenous nucleic acid, as is known in the art, and can include the appropriate orientation of the promoter relative to the exogenous nucleic acid. Furthermore, the exogenous nucleic acid preferably has all appropriate sequences for expression of the nucleic acid. The nucleic acid can include in addition to expression control sequences, (i.e. Ee of the invention), necessary information processing sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites, and transcriptional terminator sequences.
[0051 ] The rAAVEe of the invention is useful for gene therapy, as a medicament or as a mechanism to produce large quantities of protein/peptide. With respect to treatment of disorders, the exogenous nucleic acid can encode beneficial proteins or polypeptides that replace missing or defective proteins required by the cell or subject into which the vector is transferred or can encode a cytotoxic polypeptide that can be directed, e.g., to cancer cells or other cells whose death would be beneficial to the subject. The exogenous nucleic acid can also encode antisense RNAs that can bind to, and thereby inactivate, mR As made by the subject that encode harmful proteins. For general methods relating to antisense polynucleotides, see Antisense RNA and DNA, D. A. Melton, Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1988). Non-limiting exemplitive examples of exogenous nucleic acids which can be administered to a cell or subject as part of the present rAAVEe vector can include, but are not limited to the following : nucleic acids encoding secretory and nonsecretory proteins, nucleic acids encoding therapeutic agents, such as tumor necrosis factors (TNF), such as TNFa. ; interferons, such as interferon-a., interferon-β., and interferon-. gamma ., interleukins, such as IL-1, IL-Ιβ., and ILs-2 through -14; GM-CSF; adenosine deaminase; cellular growth factors, such as lymphokines; soluble CD4; Factor VIII; Factor IX; T-cell receptors; LDL receptor; ApoE; ApoC; alpha-1 antitrypsin; ornithine transcarbamylase (OTC); cystic fibrosis transmembrane receptor (CFTR); insulin; Fc receptors for antigen binding domains of antibodies, such as immunoglobulins; anti-HIV decoy tar elements; and antisense sequences which inhibit viral replication, such as antisense sequences which inhibit replication of hepatitis B or hepatitis non-A, non-B virus. The nucleic acid is chosen considering several factors, including the cell to be transduced with the novel rAVVEe of the invention. Where the target cell is a blood cell, for example, particularly useful nucleic acids to use are those which allow the blood cells to exert a therapeutic effect, such as a gene encoding a clotting factor for use in treatment of hemophilia. Another target cell is the lung airway cell, which can be used to administer nucleic acids, such as those coding for the cystic fibrosis transmembrane receptor, which could provide a gene therapeutic treatment for cystic fibrosis. Other target cells include muscle cells where useful nucleic acids, such as those encoding cytokines and growth factors, can be transduced and the protein the nucleic acid encodes can be expressed and secreted to exert its effects on other cells, tissues and organs, such as the liver. Furthermore, the nucleic acid can encode more than one gene product.
[0052] Furthermore, suitable nucleic acids can include those that, when transduced/transfected into a primary cell, such as a blood cell, cause the transferred cell to target a site in the body where that cell's presence would be beneficial. For example, blood cells such as TIL cells can be modified, such as by transfer into the cell of a Fab portion of a monoclonal antibody, to recognize a selected antigen. Another example would be to introduce a nucleic acid that would target a therapeutic blood cell to tumor cells. Nucleic acids useful in treating cancer cells include those encoding chemotactic factors which cause an inflammatory response at a specific site, thereby having a therapeutic effect. Cells, particularly blood cells, muscle cells, airway epithelial cells, brain cells and endothelial cells having such nucleic acids transferred into them can be useful in a variety of diseases, syndromes and conditions. For example, suitable nucleic acids include nucleic acids encoding soluble CD4, used in the treatment of AIDS and .alpha. -antitrypsin, used in the treatment of emphysema caused by a-antitrypsin deficiency. Other diseases, syndromes and conditions in which such cells can be useful include, for example, adenosine deaminase deficiency, sickle cell deficiency, brain disorders such as Alzheimer's disease, thalassemia, hemophilia, diabetes, phenylketonuria, growth disorders and heart diseases, such as those caused by alterations in cholesterol metabolism, and defects of the immune system. [0053] Other cells in which a gene of interest can be expressed include, but are not limited to, fibroblasts, neurons, retinal cells, liver cells, kidney cells, lung cells, bone marrow stem cells and hematopoietic stem cells. The cells in which the gene of interest can be expressed can be dividing cells such as MDCK cells, BHK cells, HeLa cells, 3T3 cells, CVl cells, COS7 cells, HOS cells, HTX cells and 293 cells. The cells can also be embryonic stem cells of mouse, rhesus, human, bovine or sheep origin, as well as stem cells of neural, hematopoietic, muscle, cardiac, immune or other origin. Non-dividing cells can also be contacted with a particle provided herein to express a gene of interest. Such cells include, but are not limited to hematopoietic stem cells and embryonic stem cells that have been rendered non-dividing.
[0054] As another example, hepatocytes can be transduced with the present rAVVEe having useful nucleic acids/transgenes to treat liver disease. For example, a nucleic acid encoding OTC can be used to transfect hepatocytes (ex vivo and returned to the liver or in vivo) to treat congenital hyperammonemia, caused by an inherited deficiency in OTC. Another example is to use a nucleic acid encoding LDL to target hepatocytes ex vivo or in vivo to treat inherited LDL receptor deficiency. Such transfected hepatocytes can also be used to treat acquired infectious diseases, such as diseases resulting from a viral infection. For example, transduced hepatocyte precursors can be used to treat viral hepatitis, such as hepatitis B and non-A, non-B hepatitis, for example by transducing the hepatocyte precursor with a nucleic acid encoding an antisense RIMA that inhibits viral replication. Another example includes transferring a vector provided herein having a nucleic acid encoding a protein, such as .gamma. -interferon, which can confer resistance to the hepatitis virus.
[0055] The invention in aspects provides rAVVEe vectors and compositions comprising such vectors described herein that are for administration to mammals, i.e. animals and humans, for gene therapy and as medicaments. Also provided is a method of delivering an exogenous nucleic acid/transgene to a subject comprising administering to a cell of or from the subject a rAVVEe vector comprising a desired nucleic acid inserted therein, and returning the cell to the subject, thereby delivering the nucleic acid to the subject. For example, in an ex vivo administration, cells are isolated from a subject by standard means according to the cell type and placed in appropriate culture medium, again according to cell type (see, e.g., ATCC catalog). The rAVVEe are then contacted with the cells as described above, and the virus is allowed to transduce the cells. Cells can then be transplanted back into the subject's body, again by means standard for the cell type and tissue (e. g., in general, U.S. Pat. No. 5,399,346; for neural cells, Dunnett, S. B. and Bjorklund, A., eds., Transplantation : Neural Transplantation-A Practical Approach, Oxford University Press, Oxford (1992)). If desired, prior to transplantation, the cells can be studied for degree of transduction by the virus, by known detection means and as described herein. Cells for ex vivo transduction followed by transplantation into a subject can be selected from those listed above, or can be any other selected cell.
[0056] Further provided is a method of delivering an exogenous nucleic acid sequence (transgene) to a cell in a subject comprising administering to the subject a rAVVEe vector comprising the nucleic acid (transgene), thereby delivering the nucleic acid/transgene to a cell in the subject. Administration can be an ex vivo administration directly to a cell removed from a subject, such as any of the cells listed above, followed by replacement of the cell back into the subject, or administration can be in vivo administration to a cell in the subject. Modes of administration may include but are not limited to gastrointestinal or enteral (oral), epidural, intra-cerebral, intra- cerebroventricular, transdermal, intradermal, subcutaneous, nasal, intravenous, intraarterial, intramuscular, intra-cardiac, intra-osseous infusion, intra-peritoneal, intra-vesical and intra-vitreal administrations.
[0057] In aspects of the invention are in vivo methods for treating or preventing a disorder, A subject is administered a rAAVEe vector, (for example JE72-U3-R-AG) in which the vector has a desired nucleic acid sequence. The rAAVEe vector can be packaged with pharmaceutically suitable salts and solvates, administered to a subject. Administering the rAAVEe vector with a desired gene may be conveniently administered in unit dosage form, and may be prepared by any of the methods well known in the pharmaceutical art. The gene therapy agent further comprises at least one other agent of common excipients, such as sterile water or saline, polyalkylene glycols, oils of vegetable origin, hydrogenated naphtalenes, and the like.
[0058] The rAAVEe vectors of the invention with desired gene and at least a packaging material may be formulated into pharmaceutical compositions by admixture with pharmaceutically acceptable non-toxic excipients or carriers, such as salt and solvates. Such compounds and compositions may be prepared in the intravenous form, subcutaneous form, or intramuscular form for parenteral administration, particularly in the form of liquid solutions or suspensions in aqueous physiological buffer solutions; for oral administration, particularly in the form of tablets or capsules; or in inhalation form for intranasal administration, particularly in the form of powders, nasal drops, or aerosols; or on the mucosa forms of liquid solutions or suspensions for applications. Sustained release compositions are also encompassed by the present invention. Compositions for other routes of administration may be prepared as desired using standard methods. [0059] Thus the present invention provides a method of performing gene transfer and/or gene therapy by transducing a cell using the rAAVEe vector where the vector comprises a desired transgene. In various embodiments, the present invention provides biopharmaceutical compositions including a biopharmaceutically acceptable excipient along with a therapeutically effective amount of rAAVEe. "Biopharmaceutically acceptable excipient" means an excipient that is useful in preparing a biopharmaceutical composition that is generally safe, non-toxic, and desirable, and includes excipients that are acceptable for veterinary use as well as for human biopharmaceutical use. Such excipients may be solid, liquid, semisolid, or, in the case of an aerosol composition, gaseous. In various embodiments, the biopharmaceutical compositions according to the invention may be formulated for delivery via any route of administration. "Route of administration" may refer to any administration pathway known in the art, including but not limited to aerosol, nasal, oral, transmucosal, transdermal or parenteral. "Parenteral" refers to a route of administration that is generally associated with injection, including intraorbital, infusion, intraarterial, intracapsular, intracardiac, intradermal, intramuscular, intraperitoneal, intrapulmonary, intraspinal, intrasternal, intrathecal, intrauterine, intravenous, subarachnoid, subcapsular, subcutaneous, transmucosal, or transtracheal. Via the parenteral route, the compositions may be in the form of solutions or suspensions for infusion or for injection, or as lyophilized powders. The biopharmaceutical compositions according to the invention can also contain any biopharmaceutically acceptable carrier. "Biopharmaceutically acceptable carrier" as used herein refers to a pharmaceutically acceptable material, composition, or vehicle that is involved in carrying or transporting a compound of interest from one tissue, organ, or portion of the body to another tissue, organ, or portion of the body. For example, the carrier may be a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, or a combination thereof. Each component of the carrier must be "biopharmaceutically acceptable" in that it must be compatible with the other ingredients of the formulation. It must also be suitable for use in contact with any tissues or organs with which it may come in contact, meaning that it must not carry a risk of toxicity, irritation, allergic response, immunogenicity, or any other complication that excessively outweighs its therapeutic benefits.
[0060] The biopharmaceutical compositions according to the invention can also be encapsulated, tableted or prepared in an emulsion or syrup for oral administration. Biopharmaceutically acceptable solid or liquid carriers may be added to enhance or stabilize the composition, or to facilitate preparation of the composition. Liquid carriers include syrup, peanut oil, olive oil, glycerin, saline, alcohols and water. Solid carriers include starch, lactose, calcium sulfate, dihydrate, terra alba, magnesium stearate or stearic acid, talc, pectin, acacia, agar or gelatin. The carrier may also include a sustained release material such as glyceryl monostearate or glyceryl distearate, alone or with a wax. The biopharmaceutical preparations are made following the conventional techniques of pharmacy involving milling, mixing, granulation, and compressing, when necessary, for tablet forms; or milling, mixing and filling for hard gelatin capsule forms. When a liquid carrier is used, the preparation will be in the form of a syrup, elixir, emulsion or an aqueous or non-aqueous suspension. Such a liquid formulation may be administered directly p.o. or filled into a soft gelatin capsule.
[0061] The biopharmaceutical compositions according to the invention comprising a rAAVEe may be delivered in a therapeutically effective amount. The precise therapeutically effective amount is that amount of the composition that will yield the most effective results in terms of efficacy of treatment in a given subject. This amount will vary depending upon a variety of factors, including but not limited to the characteristics of the therapeutic compound (including activity, pharmacokinetics, pharmacodynamics, and bioavailability), the physiological condition of the subject (including age, sex, disease type and stage, general physical condition, responsiveness to a given dosage, and type of medication), the nature of the biopharmaceutically acceptable carrier or carriers in the formulation, and the route of administration. One skilled in the clinical and biopharmacological arts will be able to determine a therapeutically effective amount through routine experimentation, for instance, by monitoring a subject's response to administration of a compound and adjusting the dosage accordingly. For additional guidance, see Remington : The Science and Practice of Pharmacy(Gennaro ed. 20th edition, Williams & Wilkins PA, USA) (2000). Actual dosage will depend upon the judgment of the physician, the condition of the patient, and the effectiveness of the therapeutic method based, for example, on the in vitro responsiveness of the relevant primary cultured cells or histocultured tissue sample or the responses observed in the appropriate animal models.
[0062] The present invention also relates to methods for producing desired proteins and methods for expressing desired DNAs, using the Ee of the invention incorporated into any desired vector able to express the desired DNAs. Production systems for proteins include in-vitro and in-vivo production systems. In-vitro production systems include those using eukaryotic or prokaryotic cells. For example, desired proteins can be obtained by culturing the above-described host cells in vitro. Such a culture can be achieved according to known methods. For example, liquid culture media for animal cells include DMEM, MEM, RPM 11640, IMDM, F10 medium, and F12 medium. The culture media may comprise serum supplements such as fetal calf serum (FCS), or may be serum-free culture media. Furthermore, a transactivator may be added to the media. The culture pH is preferably about 6 to 8. The cultivation is typically carried out at about 30°C to 40°C for about 15 to 200 hours; if required, the medium is changed, aerated and stirred. Since culture conditions vary depending on the cell type used, those skilled in the art can appropriately determine suitable conditions. For example, typically, CHO cells may be cultured, under an atmosphere of 0% to 40% C02 gas, preferably, 2% to 10%, at 30°C. to 39°., preferably, at about 37°C, for 1 to 14 days. Various culture apparatuses can be used for animal cells, examples being fermentation tank-type tank culture apparatuses, airlift-type culture apparatuses, culture flask-type culture apparatuses, spinner flask-type culture apparatuses, microcarrier-type culture apparatuses, flow tank-type culture apparatuses, hollow fiber-type culture apparatuses, roller bottle-type culture apparatuses, and packed bed-type culture apparatuses.
[0063] In-vivo production systems for proteins include, for example, production systems using animals or plants. A transgene of interest is introduced into such an animal or plant, and the polypeptide produced in the animal or plant in vivo is collected. The "hosts" of the present invention includes such animals and plants. Production systems using animals include systems using mammals or insects. Such mammals include goats, pigs, sheep, mice, and cattle (Vicki Glaser, SPECTRUM Biotechnology Applications, 1993). Transgenic animals can also be used as the mammals. For example, DIMAs encoding desired proteins are prepared as fusion genes comprising genes encoding polypeptides such as goat β casein specifically produced into milk. Then, DNA fragments comprising the fusion genes are injected into goat embryos, and the resulting goat embryos are transplanted into female goats. The desired proteins can be obtained from milk produced by transgenic goats born of the goats that have received the embryos, or their progenies. Hormones may be appropriately given to the transgenic goats to increase the amount of milk comprising the polypeptides produced by the transgenic goats (Bio/Technology, Vol. 12, p. 699-702, 1994). In addition, insects such as silkworm can be used. When silkworms are used, they are infected with a baculovirus into which a DNA encoding a desired protein is inserted and the desired protein can be obtained from body fluid (Nature, Vol. 315, p. 592-594, 1985).
[0064] Furthermore, when using plants, for example, tobacco may be used. When tobacco is used, a DNA encoding a desired protein is inserted into a plant expression vector, for example, pMON 530, and the vector is introduced into a bacterium such as Agrobacterium tumefaciens. Tobacco (for example, Nicotiana tabacum) is infected with the bacterium. The desired protein can be obtained from leaves of the resulting tobacco (Eur. J. Immunol., Vol. 24, p. 131-138, 1994).
[0065] The rAVVEe vectors and desired proteins obtained by the present invention can be isolated from inside or outside (medium or such) of the host cells and purified as substantially pure homogeneous proteins. The proteins can be isolated and purified by conventional protein isolation/purification methods. There is no limitation on the type of methods for isolating and purifying the proteins. The proteins can be isolated and purified by appropriately selecting and using in combination, a chromatography column, filter, ultrafiltration, salting out, solvent precipitation, solvent extraction, distillation, immunoprecipitation, SDS-polyacrylamide gel electrophoresis, isoelectrofocusing, dialysis, recrystallization, and such. Chromatography includes, for example, affinity chromatography, ion exchange chromatography, hydrophobic chromatography, gel filtration, reverse phase chromatography, and adsorption chromatography (Strategies for Protein Purification and Characterization : A Laboratory Course Manual. Ed Daniel R. Marshak et al. , Cold Spring Harbor Laboratory Press, 1996) . These chromatographic methods can be conducted using liquid chromatography, for example, HPLC and FPLC. Any modifications or partial removal of peptides can be achieved by reacting the proteins with appropriate protein modification enzymes before or after purification. Such protein modification enzymes include, for example, trypsin, chymotrypsin, lysyl endopeptidase, protein kinase, and glucosidase.
[0066] The rAVVEe vectors, constructs including the Ee, or host cells of the present invention can be used to produce desired proteins, including protein fragments and peptides. Specifically, the desired proteins include, for example but not limited to, antibodies, cytokines, and growth factors, such as erythropoietin, colony-stimulating factor (granulocyte, macrophage, and granulocyte macrophage), interleukins 1 to 31, interferons, RANTES, lymphotoxin β, Fas ligand, flt-3 ligand, ligand (RANKL) for NF-KB receptor activation factor, TNF-related apoptosis-inducing ligand (TRAIL), CD40 ligand, 0X40 ligand, 4- lBB ligand (and other members belonging to the TNF family), thymic stroma-derived lymphopoietin, mast cell growth factor, stem cell growth factor, epidermal growth factor, growth hormone, tumor necrosis factor, leukemia inhibitory factor, oncostatin M, and hematopoietic factors such as thrombopoietin.
[0067] The invention also provides cells transduced with a rAVVEe of the invention.
The host cell may be any of the host cells familiar to those skilled in the art, including prokaryotic cells, eukaryotic cells, such as bacterial cells, fungal cells, yeast cells, mammalian cells, insect cells, or plant cells. Exemplary bacterial cells include any species within the genera Escherichia, Bacillus, Streptomyces, Salmonella, Pseudomonas, Lactococcus, and Staphylococcus, including, e.g., Escherichia coli, Lactococcus lactic, Bacillus subtilis, Bacillus cereus, Salmonella typhimurium, Pseudomonas fluorescens. Exemplary fungal cells include any species of Aspergillus, including Aspergillus niger. Exemplary yeast cells include any species of Pichia, Saccharomyces, Schizosaccharomyces, or Schwanniomyces, including Pichia pastoris, Saccharomyces cerevisiae, or Schizosaccharomyces pombe. Exemplary insect cells include any species of Spodoptera or Drosophila, including Drosophila S2 and Spodoptera S/9. Exemplary insect cells include Drosophila S2 and Spodoptera Sf9. Exemplary yeast cells include Pichia pastoris, Saccharomyces cerevisiae or Schizosaccharomyces pombe. Exemplary animal cells include CHO, COS or Bowes melanoma or any mouse or human cell line. Particularly useful cells are human, mouse, rat, bird, cat, dog, goat, sheep, pig, bovid, horse or non- human primate cell. The selection of an appropriate host is within the abilities of those skilled in the art.
[0068] The rAWEe vector of the invention may be introduced into the host cells using any of a variety of techniques, including transduction (viral infection), gene guns, or Ti-mediated gene transfer. Particular methods include calcium phosphate transfection, DEAE-Dextran mediated transfection, lipofection, or electroporation (Davis, L, Dibner, M., Battey, I., Basic Methods in Molecular Biology, (1986)).
[0069] Where appropriate, the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the genes of the invention, Following transduction of a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter may be induced by appropriate means (e.g., temperature shift or chemical induction) and the cells may be cultured for an additional period to allow them to produce the desired polypeptide or fragment thereof. Cells can be harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract is retained for further purification. Microbial cells employed for expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents. Such methods are well known to those skilled in the art. The expressed polypeptide or fragment thereof can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the polypeptide. If desired, high performance liquid chromatography (HPLC) can be employed for final purification steps.
[0070] Various cells can be used for transduction with the rAAVEe of the invention including but not limited to COS-7 lines of monkey kidney fibroblasts, C127, 3T3, CHO, HeLa and BHK cell lines. The vectors will comprise an origin of replication, a suitable promoter and the Ee of the invention, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking non-transcribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required non- transcribed genetic elements.
[0071] Host cells containing the nucleotide sequence of interest can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying genes. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan. The clones which are identified as having the specified enzyme activity may then be sequenced to identify the polynucleotide sequence encoding an enzyme having the enhanced activity.
[0072] The invention provides kits comprising the compositions, e.g., nucleic acids, rAAVEe vectors, cells, polypeptides of the invention. The kits also can contain instructional material teaching the methodologies and industrial uses of the invention, as described herein.
[0073] In more general embodiments of the invention, the Ee of the present invention is incorporated into any desired vector to express desired transgene(s). The novel Ee sequences are not limited for use in the rAAVEe, but rather can be used in any appropriately constructed expression vector by techniques well known in the art (see Maniatis et al., op cit). For the gene to be transcribed, it must be preceded by a promoter recognizable by RNA polymerase, to which the polymerase binds and thus initiates the transcription process. There are a variety of such promoters in use, which work with different efficiencies (strong and weak promoters) and are different for prokaryotic and eukaryotic cells. High levels of gene expression in prokaryotic cells are achieved by using also ribosome-binding sites, such as the Shine-Dalgarno sequence (SD sequence). For eukaryotic hosts, different transcriptional and translational regulatory sequences may be employed, depending on the nature of the host. They may be derived from viral sources, such as adenovirus, bovine papilloma virus, Simian virus, or the like, where the regulatory signals are associated with a particular gene which has a high level of expression. Examples are the TK promoter of Herpes virus, the SV40 early promoter, the yeast gal4 gene promoter, etc. Transcriptional initiation regulatory signals (i.e. Ee of the invention) may be selected which allow for repression and activation, so that expression of the genes can be modulated.
[0074] The Ee of the invention can be inserted into any vector which is capable of integrating the desired gene sequences into the host cell chromosome. The cells which have stably integrated the introduced DNA into their chromosomes can be selected by also introducing one or more markers which allow for selection of host cells which contain the expression vector. In embodiments as described herein, the introduced DNA molecule can be incorporated into a plasmid or viral vector (i.e. rAAVEe of the invention) capable of autonomous replication in the recipient host. Prokaryotic and eukaryotic plasmids are well known from the literature. Factors of importance in selecting a particular plasmid or viral vector include the ease with which recipient cells that contain the vector may be recognized and selected from those recipient cells which do not contain the vector; the number of copies of the vector which are desired in a particular host; and whether it is desirable to be able to "shuttle" the vector between host cells of different species. Once the vector or DNA sequence containing the construct(s) has been prepared for expression, the DNA construct(s) may be introduced into an appropriate host cell by any of a variety of suitable means: transformation, transfection, conjugation, protoplast fusion, electroporation, calcium phosphate-precipitation, direct microinjection, etc. Host cells to be used in this invention may be either prokaryotic or eukaryotic. Preferred prokaryotic hosts include bacteria such as E. coli, Bacillus, Streptomyces, Pseudomonas, Salmonella, Serratia, etc. Eukaryotic hosts are mammalian cells, e.g., human, monkey, mouse and Chinese hamster ovary (CHO) cells, because they provide post-translational modifications to protein molecules, including correct folding or glycosylation at correct sites. Also yeast cells can carry out post-translational peptide modifications, including glycosylation. After the introduction of the vector, the host cells are grown in a selective medium, which selects for the growth of vector-containing cells. Expression of the cloned gene
sequence(s) results in the production of the desired protein or a fragment thereof. The expressed protein is then isolated and purified in accordance with the purification method described in the present application or by any other conventional procedure involving extraction, precipitation, chromatography, electrophoresis, or the like. A further purification procedure that may be used in preference for purifying the protein of the invention
[0075] Embodiments of the invention are described in the following examples comparing rAAVEe vectors to AAV vectors, which are not to be construed as limiting. Example 1
[0076] An example of the invention is described below using AAV vectors with an
Ee (rAAVEe) to cause mouse cells and tissues, particularly lung, liver and spleen, to express the transgene for alkaline phosphatase. The final product of transgene expression is alkaline phosphatase (protein) which is measured in the transduced cells and tissues to confirm and quantify increased transgene expression when the Ee is utilized.
Materials and Methods
[0077] Cell culture.
[0078] Human embryonic kidney (HEK) 293 cells (12) were maintained in
Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (GIBCO, Invitrogen, Carlsbad, CA), 100 units/ml penicillin, 100 g/ml streptomycin and 2 mM L- glutamine in a humidified 5% C02 atmosphere at 37°C.
[0079] AAV vector plasmid construction.
[0080] To facilitate cloning into the AAV vector, ARAP4 (1), the vector plasmid was modified as follows. The intron from pSX2.Jenv (31), consisting of the splice donor and acceptor signals from Moloney MLV, was inserted upstream of the AP cDNA, and a Bglll, NotI and Kpnl multiple cloning site (MCS) was inserted between the RSV promoter and the intron using overlap extension PCR to generate pARMCS.jntronAP. These modifications made it possible to easily replace the promoter in this AAV vector by using an Xbal site upstream of the RSV promoter and one of the restriction sites in the MCS. All ovine beta retroviral promoter sequences were cloned into the Xbal-Bglll site of pARMCs-imronAP using primers described in Table 1. The JSRV LTR was amplified from the full-length molecular clone of JSRV, pCMVJS2i (30), kindly provided by Dr. Massimo Palmarini, University of Glasgow, Scotland. The EIMTV-1 LTR was amplified from the ENTV-1 NA4 isolate (37). The full-length ENTV-2 LTR was constructed using overlapping clones (i) and (ii) (26) generously provided by Dr. Marcelo De las Heras, University of Glasgow, Scotland . Specifically, done (i) was digested with Ncol, blunted with Klenow and then digested with BamHI . The vector fragment was isolated and subsequently dephosphorylated. Clone (ii) was digested with IMdel, filled in with Klenow and then digested with BamHI. The BamHI-blunt vector and insert fragments were ligated to generate the full-length ENTV-2 LTR. To create AAV vectors expressing Env, the AP cDIMA from AJAP, AEXAP and AE2AP was replaced with the env coding region from JSRV or EINTV- 1. All vectors contain the AAV2 inverted terminal repeats and all plasmids were propagated in the E. coli strain GT116 (InvivoGen). The AA 6 packaging plasmid pDGM6 was a kind gift from Dr. David Russell, University of Washington.
[0100] TABLE 1
Nucleotide
Position in JSRVb,
Primer Sequence (5'-3')a ENTV-lc and ENTV-2d
AAV construct
JSRV-LTR-Fwd a ta tcta g a ATG CG G G G G ACG ACCCTGTAAG 7174 - 7197 AJAP
JSRV-LTR-RV ataagatctCCTGCCGCGGCCAGCACAAG 109 - 128 AJAP
JJE-LTR-Fwd atatctagaCTGCATATGAAATATAGAAATATG 7103 - 7126 AJEJAP
ENTV-l-LTR-Fwd aatctagaCTGCGGGGGACAACCCGCGGAG 7176 - 7197 AE1AP
ENTV-1-LTR-RV ataagatctCTTGCCGCAGCCAGCACGGAC 101 - 127 AE1AP
EEE-LTR-Fwd a a tcta g a AC ATATG A AATATAG ATAC ATG 7107 - 7128 AEEE1AP
ENTV-2-LTR-Fwd aatctagaCTGCGGGGGACAACCCGTGAAGG 7171- 7193 AE2AP
ENTV-2-LTR-RV ataagatctCCTGCCGCGACCAGCACTGACAAGGA 101 -
126 AE2AP a : Lower case letters indicate non-viral sequence e.g. restriction sites
b: JSRV accession number AF105220
c: ENTV-1 accession number FJ744146
d : ENTV-2 accession number NC„004994
[0081] AAV vector production and quantification.
[0082] AAV vectors were made using AAV6 capsid proteins, and were produced by co-transfection of HEK 293 cells with vector and packaging plasmids as described previously (13). AAV vector titers were determined by Southern blot (15) and by competitive PCR. For competitive PCR, DNA was extracted from AAV particles using a novel heat-based method based on the finding that AAV genomes can be uncoated at temperatures of 71°C or greater (24) . 5 yL of an AAV preparation was treated with 2 U of DNAse I (Boehringer-Mannheim) for 15 min at 37°C in a final volume of 20 pL. To terminate the reaction, EDTA (Gibco BRL) was added to a final concentration of 5 mM and heated at 75°C for 15 min to completely inactivate the DNAse I enzyme. With the vector genomes liberated from the capsid, a competitive PCR method was conducted as previously described (42). The concentration of competitor DNA, containing a 26 bp insertion in the AP gene, was determined using a Nanovue spectrophotometer (GE Healthcare, Waukesha, Wisconsin). Competitive PCR was conducted with varying concentrations of competitor DNA and static amounts of target DNA in order to quantify AAV vector genomes. The primer pair: Fwd ext AP (5'-TACGCAGCTCATCTCCAACA-3') and Rev ext AP (5'-TCCAGGCTCAAAGAGACCCA-3') was used under the following PCR conditions: 94°C for 2 min followed by 30 cycles of 94°C for 30 s, 63.5°C for 30 s and 72°C for 30 s. A final extension of 5 min at 72°C concluded the program.
[0083] AAV vector delivery.
[0084] Mouse experiments were performed in accordance with the guidelines set forth by the Canadian Council on Animal Care (CCAC). Eight-week old C57BL6/J mice were obtained from Charles River Laboratories (Saint-Constant, QC) and eight-week old C57BL6/J-Rag2 mice were obtained from Taconic (Hudson, NY). Lightly anesthetized mice received 1 x 1010 vector genomes (vg) intranasally by the administration of drops to the nose, which were spontaneously inhaled. For systemic administration, mice were given 2 x 1010 vg intravenously via tail-vein injection and 8 x 1010 vg intraperitoneal^. Mice were euthanized 1-month after vector administration. Lungs were perfused by way of the heart with 20 ml of phosphate-buffered saline (PBS) and individual lung lobes separated. For consistency, the same lobe from each mouse was either flash frozen in liquid nitrogen, preserved in RNAIater (Qiagen) or fixed in 2% paraformaldehyde-PBS for 2.5 h at 22°C. All major organs were preserved in the same manner with the exception that fixation was conducted for 24 h at 22°C. Tissues were washed extensively with PBS (5 x 10 min) prior to inactivation of endogenous AP by incubation at 65°C for 1 h. Tissues were stained for vector-encoded heat-stable AP as described previously (15). Histochemical staining of mouse tissues for AP expression was performed as described (16). Immunohistochemical staining of mouse tissues for Env expression was performed as described (41).
[0085] Determination of AP enzymatic activity.
[0086] Mouse tissues were harvested one month after vector administration, snap- frozen in liquid nitrogen and stored at -80°C until assayed. Tissues were homogenized in TMNC lysis buffer [50 mM Tris HCI pH 7.5, 5 mM MgCI2, 100 mM NaCI, 4% (wt/vol) CHAPS] using a hand held homogenizer (PRO200, Diamed). For extraction of total protein from the nasal cavity, one half of the nasal cavity (cut sagittally) was placed in a pulverizer on a bed of dry ice, pulverized into a fine dust and reconstituted in TMNC buffer. Tissue homogenates were placed in a water bath at 65°C for 1 h to inactivate endogenous heat-labile AP activity and subsequently clarified by centrifugation at 17,900 x g for 15 min at 4°C to remove cell debris. The protein content of each sample was determined by the method of Bradford, and the AP activity in tissue lysates was determined by a fluorometric assay (38) using the 4-methylumbelliferyl phosphate (MUP) (Sigma, St. Louis, MO) substrate. Briefly, AP activity was measured by mixing up to 100 μΙ of cell lysate, 100 pi of 2X SEAP buffer (2 M diethanolamine, 1 mM MgCI2, 10 mM L-homoarginine), and 5 μΙ of MUP solution ( 11.4 mg of MUP [Sigma] per ml in dimethyl sulfoxide) in wells of an opaque black 96-well plate. The plate was incubated at 23°C and fluorescence due to production of 4-methylumbelliferone was measured every 10 min for 1 h with a fluorometer (Fluostar Optima). AP activity was expressed as the amount of enzyme product produced per second per microgram of total protein.
[0087] NA extraction, RT-PCR and 5' RACE.
[0088] Total RNA was extracted from mouse tissues by homogenization in TRIZOL
(Invitrogen) according to the manufacturer's instructions. Reverse transcriptase (RT)-PCR was conducted on RNA extracted from transduced mouse liver and lung. First strand cDNA synthesis was performed using the reverse primer, AAV INT R (5'- CTTCCAGACCTCTCGTTGTA-3') and Superscript III (Invitrogen) according to the manufacturer's directions. PCR amplification of cDNA originating from the first strand synthesis was performed using a primer in the U5 region of the LTR, U5 JSRV/ENTV F (5'- CTGATCCTCTCAACCCCATC-3'), and a primer in the AAV vector immediately upstream of the AP gene, AAV INT R (5'-CTTCCAGACCTCTCGTTGTA-3'), using 5 PRIME MasterMix (5 PRIME, Gaithersburg, MD) under conditions previously described (37). 5' rapid
amplification of cDNA ends (RACE) was performed on 5 pg of total RNA isolated from vector transduced mouse livers using the 5' Race System for Rapid Amplification of cDNA Ends (Invitrogen). First strand synthesis was carried out using Superscript III (Invitrogen) and a gene specific primer, 5 RACE AP OUT R (5'-TGCAGCCCAAGCTGATCCAC-3') as directed by the manufacturer. The nested gene specific primer, 5RACE AP IN R (5'- CAAGTTCTTAGTTCTGGTGCCG-3') and the abridged anchor primer (5'- GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG-3') provided with the kit were used to carry out amplification of dC-tailed cDNA. A final nested PCR was performed using the abridged universal amplification primer (5'-GGCCACGCGTCGACTAGTAC-3') and the aforementioned reverse primer, AAV INT R, under conditions previously described (37). Products from the final nested PCR were cloned into pGEM-T Easy (Promega) and sequenced.
[0089] Cloning
[0090] PCR was used to amplify JE or LTR sequences from the molecular do
JSRV, pCMV-JS21 (Palmarini et al, 1999) . JE and LTR sequences were cloned into Xbal and Bglll sites in the AAV vector plasmid containing a murine leukemia virus retrovirus intron and human placental alkaline phosphatase reporter gene. The chicken beta actin promoter (AG) was cloned downstream of the JE or JSRV LTR sequences into Bglll and Kpnl sites.
[0091] Transfection/Transduction
[0092] Approximately 5 x 10Λ6 cells were seeded onto three 10 cm dishes for each construct 24 h prior to transfection. Cells were transfected with 10 pg each of pCMV- gal and the construct of interest using polyethylenimine (Polysciences Inc, Warrington, PA) for 208F rat fibroblast cells and calcium phosphate for human HEK 293, HEK 293T and HTX cells. Polyethylenimine transfection was conducted according to manufacturer's directions. Transfection using the calcium phosphate method was conducted according to the method of Sambrook and Miller (2001).
[0093] Cell Harvesting
[0094] After 48 h, cells were washed with 10 ml_ of ice cold PBS and scraped off the plate using a rubber policeman into PBS. Cells and PBS were spun down at 6000 rpm for 2 min to recover cells. 500 pL of TMNC lysis buffer (50 mM Tris-HCI [pH 7.5], 5 mM MgCI 2 , 100 mM NaCI, and 4% [wt/vol] CHAPS {3-[(3-cholamidopropyl)-dimethylammonio]-l- propanesulfonate}) was added to each pellet before pipetting up and down to resuspend the cells. Cells were allowed to lyse for at least 15 min on ice. Cell debris was removed by centrifuging the sample at 14000 rpm and the supernatant was recovered for use in subsequent assays. A Bradford assay was performed on cell lysates according to the method of Sambrook and Miller (2001) to determine total protein concentration.
[0095] B-gal assay
[0096] Beta-galactosidase assays were performed by the method of J. Miller
(1972). The following solutions were mixed together prior to performing the assay: lOOx Mg2+ solution containing 0.1 M MgCI2 and 4.5 M β-mercaptoethanol, lx ONPG solution containing 4 mg/mL o-nitrophenyl- -D-Galactoside (ONPG) dissolved in 0.1 M dibasic sodium phosphate buffer pH (7.5), and 0.1 M dibasic sodium phosphate buffer (pH 7.5). 3 pL of lOOx Mg2+, 66 μί. of lx ONPG, 30 pL of cell lysate, and 201 pL of 0.1 M sodium phosphate were mixed together to initiate the reaction. Reactions were incubated at 37°C until a faint yellow color developed. Reactions were stopped by adding 500 pL of 1 M Na2C03. To determine beta-galactosidase activity, absorbance was read at 420 nm using a BioTeK Powerwave XS2 plate reader. [0097] Alkaline phosphatase assay
[0098] Cell lysates were heated at 65°C for 40 min to inactivate endogenous alkaline phosphatases. For 208F cells, 30 pg of total protein as determined by Bradford assay was loaded into each well of a 96 well plate for each 10 cm dish. For HTX, HEK 293, and HEK 293T cells, 100 pg of total protein as determined by Bradford assay were loaded into each well of a 96 well plate. The remainder of the alkaline phosphatase assay was performed as described previously (Yu et al, 2011).
[0099] Description of Constructs
[00100] Promoter constructs were cloned into an AAV2 vector plasmid upstream of an intron and a heat stable alkaline phosphatase reporter gene (human placental alkaline phosphatase). The reference sequence for the complete JSRV genome found by Palmarini et al (1999) can be accessed using GenBank accession number AF105220.1.
[00101] SEQ ID NO. 1. Sequence for enhancer element EE contained in rAAVEe vector AggEiAP.
[00102] acatataaatatagatacatgttgcaataccaaaaacttatggatcttgtaaaaaaagga
gaggggag
[00103] SEQ ID NO. 2. Sequence for Enhancer element JE contained in rAAVEe vector AjEJAP.
[00104] ctgcatatgaaatatagaaatatgttacagcaccaacatcttatggagct
tttaaaaaataaagagaggggag
[00105] pAJE328-AP - A construct consisting of position 6857 to the start of the
LTR, position 7175. A highly 5' extended version of the JE.
[00106] CGTTAGACCTTTTACAACTGCATAATGAGATTCTTGATATTGAAAATTCGCCGAAG GCTACACTAAATATAGCCGATACTGTTGATAATTTCTTGCAAAATTTATTCTCTAATTTTCCTAGTCT CCATTCGCTGTG G A AA ACCCTG ATTG GTGTAG G A ATACTTGTGTTTATTATA ATTGTCGTAATCCTT ATATTTCCTTGCCTTGTTCGTGGCATGGTTCGCGATTTTCTAAAGATGAGAGTTGAAATGCTGCATA TG A AATATAG AAATATGTTACAG C ACC AACATCTTATGG AG CTTTTAAAAAATAAAG AG AGG G G AG
(SEQ ID NO : 3)
[00107] pAAG-AP - A construct possessing the chicken beta actin promoter alone. [00108] TGGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCC ACCCCCAATTTTGTATTTATTTA I I I I I I AATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGG GGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGC GGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGG CGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCG (SEQ ID NO:4)
[00109] pAJE328-AG-AP - A construct possessing position 6857 to the start of the
LTR, position 7175 and also the chicken beta actin promoter
[001 10] CGTTAGACCTTTTACAACTGCATAATG AG ATTCTTGATATTG AAAATTCGCCG AAG
GCTACACTAAATATAGCCGATACTGTTGATAATTTCTTGCAAAATTTATTCTCTAATTTTCCTAGTCT
CCATTCGCTGTGGAAAACCCTGATTGGTGTAGGAATACTTGTGTTTATTATAATTGTCGTAATCCTT
ATATTTCCTTGCCTTGTTCGTGGCATGGTTCGCGATTTTCTAAAGATGAGAGTTGAAATGCTGCATA
TGAAATATAGAAATATGTTACAGCACCAACATCTTATGGAGCTTTTAAAAAATAAAGAGAGGGGAG
TGGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATT
TTGTATTTATTTA I I I I I I AATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGCGCGCGC
CAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGC
CAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTAT
AAAAAGCGAAGCGCGCGGCGGGCG (SEQ ID NO : 5)
[001 1 1] pAJE187-AP - A construct consisting of position 6992 to the start of the LTR, position 7175. A moderately 5' extended version of the JE.
[001 12] ACCCTG ATTGGTGTAGGAATACTTGTGTTTATTATAATTGTCGTAATCCTTATATTT
CCTTGCCTTGTTCGTGGCATGGTTCGCGATTTTCTAAAGATGAGAGTTGAAATGCTGCATATGAAA TATAGAAATATGTTACAGCACCAACATCTTATGGAGCTTTTAAAAAATAAAGAGAGGGGAG (SEQ ID NO :6)
[001 13] pAJJE187-AG-AP - A construct consisting of position 6992 to the start of the LTR, position 7175. A moderately 5' extended version of the JE and also the chicken beta actin promoter
ACCCTG ATTGGTGTAGGAATACTTGTGTTT ATT ATAATTGTCGTAATCCTT AT ATTTCCTTGCCTTGT
TCGTGGCATGGTTCGCGATTTTCTAAAGATGAGAGTTGAAATGCTGCATATGAAATATAGAAATAT
GTTACAGCACCAACATCTTATGGAGCTTTTAAAAAATAAAGAGAGGGGAGTGGGTCGAGGTGAGC
CCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTT
TTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGC
GGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCG
CTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGC
GGCGGGCG (SEQ ID NO :7) [001 14] pAJE72-AP - A construct consisting of position 7105 to the start of the LTR, position 7175. The JE as reported previously.
[001 15] ACATATGAAATATAG AAATATGTTACAGCACCAACATCTTATGG AGCTTTTAAAAAA
TAAAGAGAGGGGAG (SEQ ID NO :8)
[001 16] pAJE72-AG-AP - A construct consisting of position 7105 to the start of the
LTR, position 7175. The JE as reported previously with the addition of the chicken beta actin promoter.
[001 17] ACATATGAAATATAG AAATATGTTACAGCACCAACATCTTATGGAGCTTTTAAAAAA
TAAAGAGAGGGGAGTGGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCC TCCCCACCCCCAATTTTGTATTTATTTA I I I I I I AATTATTTTGTGCAGCGATGGGGGCGGGGGGGG GGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAG GTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCG GCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCG (SEQ ID NO : 9)
[001 18] pAiJE328-AP - A construct identical to JE328 consisting of position 6857 to the start of the LTR, position 7175. However its orientation is inverted relative to JE328.
[001 19] GCAATCTGGAAAATGTTGACGTATTACTCTAAGAACTATAACTTTTAAGCGGCTTC CGATGTGATTTATATCGGCTATGACAACTATTAAAGAACGTTTTAAATAAGAGATTAAAAGGATCAG AGGTAAGCGACACCTTTTGGGACTAACCACATCCTTATGAACACAAATAATATTAACAGCATTAGGA AT AT A AAGG AACG G A ACAAG C ACCGTACC A AG CG CTA A A AG ATTTCTACTCTCA ACTTTACG ACGT ATACTTTATATCTTTATACAATGTCGTGGTTGTAGAATACCTCGAAAA I I I I I I ATTTCTCTCCCCTC
(SEQ ID NO : 10)
[00120] pAiJE328-AG-AP - A construct identical to JE328 consisting of position
6857 to the start of the LTR, position 7175. However its orientation is inverted relative to JE328. Also possesses the chicken beta actin promoter.
[00121 ] GCAATCTGGAAAATGTTGACGTATTACTCTAAG AACTATAACTTTTAAGCGGCTTC
CGATGTGATTTATATCGGCTATGACAACTATTAAAGAACGTTTTAAATAAGAGATTAAAAGGATCAG
AGGTAAGCGACACCTTTTGGGACTAACCACATCCTTATGAACACAAATAATATTAACAGCATTAGGA
ATATAAAGGAACGGAACAAGCACCGTACCAAGCGCTAAAAGATTTCTACTCTCAACTTTACGACGT
ATACTTTATATCTTTATACAATGTCGTGGTTGTAGAATACCTCGAAAA I I I I I I ATTTCTCTCCCCTCT
GGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTT
TGTATTTATTTATTTTTTAATTAT TTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGCGCGCGCC
AGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCC AATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATA AAAAGCGAAGCGCGCGGCGGGCG (SEQ ID NO: 11 )
[00122] pAiJE187-AP - A construct consisting of position 6992 to the start of the
LTR, position 7175. A moderately 5' extended version of the JE. However its orientation is inverted relative to JE187.
[00123] TGGGACTAACCACATCCTTATGAACACAAATAATATTAACAGCATTAGGAATATAA AGGAACGGAACAAGCACCGTACCAAGCGCTAAAAGATTTCTACTCTCAACTTTACGACGTATACTT TATATCTTTATACAATGTCGTGGTTGTAGAATACCTCGAAAA I I I I I I ATTTCTCTCCCCTC (SEQ ID NO: 12)
[00124] pAiJE187-AG-AP - A construct consisting of position 6992 to the start of the LTR, position 7175. A moderately 5' extended version of the IE. However its orientation is inverted relative to JE187. Also possesses the chicken beta actin promoter.
[00125] TGGGACTAACCACATCCTTATGAACACAAATAATATTAACAGCATTAGGAATATAA AGGAACGGAACAAGCACCGTACCAAGCGCTAAAAGATTTCTACTCTCAACTTTACGACGTATACTT TATATCTTTATACAATGTCGTGGTTGTAGAATACCTCGAAAA I I I I I I ATTTCTCTCCCCTCTGGGTC GAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATT TATTTA I N i l I AATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGCGCGCGCCAGGCG GGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCA GAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAG CGAAGCGCGCGGCGGGCG (SEQ ID NO : 13)
[00126] pAiJE72-AP - A construct consisting of position 7105 to the start of the
LTR, position 7175. The JE as reported previously. However its orientation is inverted relative to JE72.
[00127] CTCCCCTCTCTTTATTTTTTAAAAGCTCCATAAGATGTTGGTGCTGTAACATATTTC TATATTTCATATGT (SEQ ID NO: 14)
[00128] pAiJE72-AG-AP - A construct consisting of position 7105 to the start of the
LTR, position 7175. The JE as reported previously. However its orientation is inverted relative to JE72.
[00129] CTCCCCTCTCTTTA I I I I I I A A A AG CTCC ATA AG ATGTTG GTG CTGTA A C ATATTTC
TATATTTCATATGTTGGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTC CCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGG GGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGG TGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGG CGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCG (SEQ ID NO: 15)
[00130] pAU3-AP - A construct possessing the U3 region of the JSRV LTR, position
7175 to 7442.
[00131] ATGCGGGGGACGACCCGTGAAGGGTTAAGTCCTGGGAGCTCTTTGGCAGAAGCC AAAGCCTAGGACAAGTACCTAAGCTCCCTGTCCCGCCACCCTCAAGAATTTTTAAAAGCTCTTAAG GCTCGGATGTTTGCTTTTGGCACTGCTTCATAGAAATACCAGGAAATCTGATTATATAAGAATCCGG TGATTGTGTAAGAATCCGGTGGGTGTAGTGAATAATGAATAAACAAGTTATGTACTTTATAAATATA G C ATTGTAATAA A (SEQ ID NO: 16)
[00132] pAJE328-U3-AP - A construct possessing position 6857 to the start of the
LTR, position 7175 and also the U3 region of the LTR (position 7176 - 7442).
[00133] CGTTAGACCTTTTACAACTGCATAATGAGATTCTTGATATTGAAAATTCGCCGAAG
GCTACACTAAATATAGCCGATACTGTTGATAA I I I L I I GCAAAATTTATTCTCTAATTTTCCTAGTCT
CCATTCGCTGTGGAAAACCCTGATTGGTGTAGGAATACTTGTGTTTATTATAATTGTCGTAATCCTT
ATATTTCCTTGCCTTGTrCGTGGCATGGTTCGCGATTTTCTAAAGATGAGAGTTGAAATGCTGCATA
TGAAATATAGAAATATGTTACAGCACCAACATCTTATGGAGCTTTTAAAAAATAAAGAGAGGGGAG
ATGCGGGGGACGACCCGTGAAGGGTTAAGTCCTGGGAGCTCTTTGGCAGAAGCCAAAGCCTAGG
ACAAGTACCTAAGCTCCCTGTCCCGCCACCCTCAAGAA I I I I I AAAAGCTCTTAAGGCTCGGATGTT
TGCTTTTGGCACTGCTTCATAGAAATACCAGGAAATCTGATTATATAAGAATCCGGTGATTGTGTAA
GAATCCGGTGGGTGTAGTGAATAATGAATAAACAAGTTATGTACTTTATAAATATAGCATTGTAATA
AA (SEQ ID NO : 17)
[00134] pAJE187-U3-AP - A construct consisting of position 6992 to the start of the LTR, position 7175. A moderately 5' extended version of the JE and also the U3 region of the LTR (position 7176 - 7442).
[00135 ] ACCCTG ATTG GTGTAG G AATACITGTGTTTATTATAATTGTCGTAATCCTTATATTT
CCTTGCCTTGTTCGTGGCATGGTTCGCGATTTTCTAAAGATGAGAGTTGAAATGCTGCATATGAAA TATAGAAATATGTTACAGCACCAACATCTTATGGAGCTTTTAAAAAATAAAGAGAGGGGAGATGCG GGGGACGACCCGTGAAGGGTTAAGTCCTGGGAGCTCTTTGGCAGAAGCCAAAGCCTAGGACAAG TACCTAAG CTCCCTGTCCCG CCACCCTCAAG AATTTTTAAAAG CTCTTAAG GCTCGG ATGTTTG CTT TTGGCACTGCTTCATAGAAATACCAGGAAATCTGATTATATAAGAATCCGGTGATTGTGTAAGAATC CG GTGG GTGTAGTG AATAATG AATAAACAAGTTATGTACTTTATAAATATAG CATTGTAATAAA
(SEQ ID NO: 18) [00136] pAJE72-U3-AP - A construct consisting of position 7105 to the start of the
LTR, position 7175. The JE as reported previously. Also possesses the U3 region of the LTR (position 7176 - 7442).
[00337] ACATATGAAATATAGAAATATGTTACAGCACCAACATCTTATGGAGCTTTTAAAAAA
TAAAGAGAGGGGAGATGCGGGGGACGACCCGTGAAGGGTTAAGTCCTGGGAGCTCTTTGGCAGA
AGCCAAAGCCTAGGACAAGTACCTAAGCTCCCTGTCCCGCCACCCTCAAGAATTTTTAAAAGCTCT
TAAGGCTCGGATGTTTGCTTTTGGCACTGCTTCATAGAAATACCAGGAAATCTGATTATATAAGAAT
CCGGTGATTGTGTAAGAATCCGGTGGGTGTAGTGAATAATGAATAAACAAGTTATGTACTTTATAA
ATATAG CATTGTAATAAA (SEQ ID NO : 19)
[00138] pAJE72-U3-AG-AP - A construct consisting of position 7105 to the start of the LTR, position 7175. The JE as reported previously. Also possesses the U3 reg ion of the LTR (position 7176 - 7442) and the chicken beta actin promoter.
[00139] ACATATGAAATATAGAAATATGTTACAGCACCAACATCTTATGGAGCTTTTAAAAAA TAAAGAGAGGGGAGATGCGGGGGACGACCCGTGAAGGGTTAAGTCCTGGGAGCTCTTTGGCAGA AGCCAAAGCCTAGGACAAGTACCTAAGCTCCCTGTCCCGCCACCCTCAAGAA I I I I I AAAAGCTCT TAAG GCTCG G ATGTTTG CTTTTG G C ACTG CTTC AT AG AA ATACC AG G A AATCTG ATTATATAAG AAT CCGGTGATTGTGTAAGAATCCGGTGGGTGTAGTGAATAATGAATAAACAAGTTATGTACTTTATAA ATATAGCATTGTAATAAATGGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCC CCCTCCCCACCCCCAATTTTGTATTTATTTA I I I I I I AATTATTTTGTGCAGCGATGGGGGCGGGGG GGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGA GAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCG GCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCG (SEQ ID NO : 20)
[00140] pAJE72-U3-R-AP - A construct consisting of position 7105 to the start of the LTR, position 7175. The JE as reported previously. Also possesses the U3 region of the LTR (position 7176 - 7442) and the R reg ion of the LTR (7442 - 7455) .
[00141 ] aCATATGAAATATAGAAATATGTTACAGCACCAACATCTTATGGAGCTTTTAAAAAA TAAAGAGAGGGGAGATGCGGGGGACGACCCGTGAAGGGTTAAGTCCTGGGAGCTCTTTGGCAGA AGCCAAAGCCTAGGACAAGTACCTAAGCTCCCTGTCCCGCCACCCTCAAGAA I I I I I AAAAGCTCT TAAGGCTCGGATGTTTGCTTTTGGCACTGCTTCATAGAAATACCAGGAAATCTGATTATATAAGAAT CCGGTGATTGTGTAAGAATCCGGTGGGTGTAGTGAATAATGAATAAACAAGTTATGTACTTTATAA ATATAGC ATTGTA ATA A Ag ca g a g ta tea g c (SEQ ID NO : 21 )
[00142] pAJE72-U3-R-AG-AP - A construct consisting of position 7105 to the start of the LTR, position 7175. The JE as reported previously. Also possesses the U3 region of the LTR (position 7176 - 7442) and the R region of the LTR (7442 - 7455). Also possesses the chicken beta actin promoter.
[00143] aCATATGAAATATAGAAATATGTTACAGCACCAACATCTTATGGAGCTTTTAAAAAA
TAAAGAGAGGGGAGATGCGGGGGACGACCCGTGAAGGGTTAAGTCCTGGGAGCTCTTTGGCAGA
AGCCAAAGCCTAGGACAAGTACCTAAGCTCCCTGTCCCGCCACCCTCAAGAATTTTTAAAAGCTCT
TAAGGCTCGGATGTTrGCTTTTGGCACTGCTTCATAGAAATACCAGGAAATCTGATTATATAAGAAT
CCGGTGATTGTGTAAGAATCCGGTGGGTGTAGTGAATAATGAATAAACAAGTTATGTACTTTATAA
ATATAGCATTGTAATAAAgcagagtatcagcTGGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCC
CATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTA I I I I I I AATTATTTTGTGCAGCGATGG
GGGCGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGG
GCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGG
CGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCG (SEQ ID NO:22)
[00144] pAU3- -U5-AP - A construct consisting of the entire LTR of JSRV as it would exist in the provirus, containing U3, R and U5 regions.
[00145] ATGCGGGGGACGACCCGTGAAGGGTTAAGTCCTGGGAGCTCTTTGGCAGAAGCC AAAGCCTAGGACAAGTACCTAAGCTCCCTGTCCCGCCACCCTCAAGAA I I I I I AAA AG CTCTTAAG G CTCGG ATGTTTG CTTTTGG CACTG CTTC ATAG AAATACCAGG AAATCTG ATTATATAAG AATCCG G TGATTGTGTAAGAATCCGGTGGGTGTAGTGAATAATGAATAAACAAGTTATGTACTTTATAAATATA G CATTGTAATAAAG CAG AGTATCAG CCATTTTGGTCTG ATCCTCTC A ACCCCATCTTTTGTCTCTCT CTTATTTTCTTAGCG AG GACG CTCCGTTCTCTCCCTGTGC AG GTGCG ACTCTTGCTTGTG CTGG CC GCGGCAGG (SEQ ID NO : 23)
[00146] pAJE72-U3-R-U5-AP - A construct consisting of position 7105 to the start of the LTR, position 7175. The JE as reported previously. Also possesses the JSRV LTR consisting of U3, R and U5 regions.
[00147] ACATATGAAATATAGAAATATGTTACAGCACCAACATCTTATGGAGCTTTTAAAAAA TAAAGAGAGGGGAGATGCGGGGGACGACCCGTGAAGGGTTAAGTCCTGGGAGCTCTTTGGCAGA AGCCAAAGCCTAGGACAAGTACCTAAGCTCCCTGTCCCGCCACCCTCAAGAA I I I I I AAAAGCTCT TAAGGCTCGGATGTTTGCTTTTGGCACTGCTTCATAGAAATACCAGGAAATCTGATTATATAAGAAT CCGGTGATTGTGTAAGAATCCGGTGGGTGTAGTGAATAATGAATAAACAAGTTATGTACTTTATAA ATATAGCATTGTAATAAAGCAGAGTATCAGCCATTTTGGTCTGATCCTCTCAACCCCATCTTTTGTC TCTCTCTTATTTTCTTAGCGAGGACGCTCCGTTCTCTCCCTGTGCAGGTGCGACTCTTGCTTGTGCT GGCCGCGGCAGG (SEQ ID NO : 24) [00148] pAJE187-U3-R-U5-AP - A construct consisting of position 6992 to the start of the LTR, position 7175. A moderately 5' extended version of the JE. Also possesses the JSRV LTR consisting of U3, R and U5 regions.
[00149] ACCCTG ATTGGTGTAGG AATACTTGTGTTTATTATAATTGTCGTAATCCTTATATTT
CCTTGCCTTGTTCGTGGCATGGTTCGCGATTTTCTAAAGATGAGAGTTGAAATGCTGCATATGAAA
TATAGAAATATGTTACAGCACCAACATCTTATGGAGCTTTTAAAAAATAAAGAGAGGGGAGATGCG
GGGGACGACCCGTGAAGGGTTAAGTCCTGGGAGCTCTTTGGCAGAAGCCAAAGCCTAGGACAAG
TACCTAAGCTCCCTGTCCCGCCACCCTCAAGAA I I I I I AAAAGCTCTTAAGGCTCGGATGTTTGCTT
TTGGCACTGCTTCATAGAAATACCAGGAAATCTGATTATATAAGAATCCGGTGATTGTGTAAGAATC
CGGTGGGTGTAGTGAATAATGAATAAACAAGTTATGTACTTTATAAATATAGCATTGTAATAAAGCA
GAGTATCAGCCATTTTGGTCTGATCCTCTCAACCCCATCTTTTGTCTCTCTCTTATTTTCTTAGCGAG
GACGCTCCGTTCTCTCCCTGTGCAGGTGCGACTCTTGCTTGTGCTGGCCGCGGCAGG (SEQ ID
NO : 25)
[00150] pAJE328-U3-R-U5-AP - A construct consisting of position 6857 to the start of the LTR, position 7175. A highly 5' extended version of the JE. Also possesses the JSRV LTR consisting of U3, R and U5 regions.
[00151 ] CGTTAGACCTTTTACAACTGCATAATGAG ATTCTTGATATTGAAAATTCGCCGAAG
GCTACACTAAATATAGCCGATACTGTTGATAA I I I C I I GCAAAATTTATTCTCTAATTTTCCTAGTCT CCATTCG CTGTG G AAAACCCTG ATTG GTGTAG G AATACTTGTGTTTATTATAATTGTCGTAATCCTT ATATTTCCTTGCCTTGTTCGTGGCATGGTTCGCGATTTTCTAAAGATGAGAGTTGAAATGCTGCATA TGAAATATAGAAATATGTTACAGCACCAACATCTTATGGAGCTTTTAAAAAATAAAGAGAGGGGAG ATGCGGGGGACGACCCGTGAAGGGTTAAGTCCTGGGAGCTCTTTGGCAGAAGCCAAAGCCTAGG ACAAGTACCTAAGCTCCCTGTCCCGCCACCCTCAAGAA I I I I I AAAAGCTCTTAAGGCTCGGATGTT TG CTTTTG GC ACTG CTTC ATAG A A ATACC AG G A AATCTG ATTATATAAG A ATCCG GTG ATTGTGTA A GAATCCGGTGGGTGTAGTGAATAATGAATAAACAAGTTATGTACTTTATAAATATAGCATTGTAATA AAG CAG AGTATCAG CCATTTTG GTCTG ATCCTCTC AACCCCATCTTTTGTCTCTCTCTTATTTTCTTA GCGAGGACGCTCCGTTCTCTCCCTGTGCAGGTGCGACTCTTGCTTGTGCTGGCCGCGGCAGG
(SEQ ID NO : 26)
[00152] pAJE72-eU3-AP - A construct consisting of position 7175 to 7200. A 3' extended version of the JE.
[00153] aCATATGAAATATAGAAATATGTTACAGCACCAACATCTTATGG AGCTTTTAAAAAA
TAAAGAGAGGGGAGATGCGGGGGACGACCCGTGAAGGGT (SEQ ID NO : 27)
[001 54] pAJE72-eU3-AG-AP - A construct consisting of position 7175 to 7200. A 3' extended version of the JE. Also possesses the chicken beta actin promoter. [00155] aCATATG AAATATAG AAATATGTTACAGCACCAACATCXTATGG AGCTTTTAAAAAA
TAAAGAGAGGGGAGATGCGGGGGACGACCCGTGAAGGGTTGGGTCGAGGTGAGCCCCACGTTCT
GCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTT
GTGCAGCGATGGGGGCGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGG
GGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAG
TTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCG
(SEQ ID NO : 28)
[00156] pACAG-AP - A construct that possesses the CMV Immediate early enhancer and the chicken beta actin promoter.
[00157] ACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCAT
TGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGG
TGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCC
CTATTG ACGTCA ATG ACGGT A A ATGG CCCG CCTG GC ATT ATGCCC AGTAC ATG ACCTTATGG G ACT
TTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTAACATGGTCGAGGTGAGCCCCACGTT
CTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTA I I I I I I AATTATT
TTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGC
GAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCG
AAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGG
GC (SEQ ID NO : 29)
RESULTS
[00158] The LTR promoters of ovine betaretroviruses show similar activities in the nose and lungs of mice. AAV vectors expressing the AP cDIMA under the control of the JSRV (AJAP), ENTV-1 (AEXAP) or ENTV-2 (AE2AP) LTRs were constructed (Fig. 1 ) and 1010 vg of each vector was administered intranasally to lightly anesthetized mice. Mice were euthanized one month later and tissues from the upper and lower respiratory tract were harvested for analysis of AP expression . The lung, nose and tracheal sections from mice given saline did not express AP (data not shown). Those given the AJAP vector expressed AP in the nasal epithelium, the trachea and the lung as indicated by the dark staining in all three tissues (Fig. 2A, F and K, respectively). As predicted, the AE^P and AE2AP vectors expressed AP in the nasal epithelium (Fig . 2B and C, respectively) . When looking at the sagittal view of the nasal cavity with the nasal septum removed, it appeared that all three vectors transduced the maxilloturbinate and the nasal turbinate, but only the AEiAP vector transduced the ethmoid turbinate to any significant extent (data not shown).
Examination of the trachea revealed that the three LTRs displayed differing levels of transcriptional activity, with JSRV being the strongest, followed by ENTV-1 and finally, ENTV-2 (Fig. 2F, G and H, respectively). In contrast to the staining in the lung parenchyma, where all three LTRs were active (Fig . 2K, L and M), the AEXAP vector gave minimal AP staining in the airway (Fig. 2L), whereas the AE2AP vector gave no staining (Fig. 2M) .
[00159] Histologic analysis showed that instillation of the AJAP vector resulted in abundant AP staining in all respiratory epithelium including the trachea (Fig . 2P), the alveolar type II and Clara cells of the distal lung, as well as the large airway (Fig. 2U). Infection with the AEiAP vector resulted in moderate AP expression in the tracheal epithelium (Fig. 2Q), sparse staining in the Clara cells lining the bronchioles, and fairly robust expression in the alveolar type II cells of the distal airway (Fig. 2V). Infection with the AE2AP vector resulted in very poor levels of AP expression in the trachea (Fig. 2R), no expression in Clara cells of the distal airway (Fig . 2W), but rather robust AP expression in the alveolar type II cells of the distal airway (Fig. 2W), nearing that of AJAP.
[00160] The amount of heat stable AP protein produced as a result of vector transduction was further evaluated using a quantitative enzymatic assay. Results from these experiments revealed that the JSRV LTR produced nearly 6 times more AP protein in the nose than the ENTV LTRs (Fig . 3A). While it was difficult to obtain protein from the trachea (due to its small size), it appeared that the JSRV LTR produced the most AP protein in this tissue (Fig. 3B) . Interestingly, the JSRV and ENTV-2 LTRs produced nearly equivalent amounts of AP protein in the lung (Fig . 3C).
[00161] In summary, these results show that the JSRV LTR is highly active in epithelial cells of both the upper and lower airway suggesting that at least in mice, JSRV LTR activity is not limited to the lung. Similarly, the ENTV LTRs are active in both the nose and the lung of mice, albeit to a lesser extent than the JSRV LTR in the lung. One notable difference between JSRV and ENTV LTR activity in mice was in the tracheal and airway epithelium, indicating that the LTRs do display differential activity in vivo but only in a specific subset of cells.
[00162] Activities of the LTR promoters following systemic administration. To examine the transcriptional activity of ovine betaretroviral LTRs in non-respiratory tissue, the AJAP, AEiAP and AE2AP vectors were administered to mice via tail vein (2 x 1010 vg) and intraperitoneal (8 x 1010 vg) injections. One month post-infection, mice were euthanized and a full-body necropsy conducted . Staining for heat-stable AP expression revealed that the JSRV LTR was highly active in the liver (Fig. 4A), moderately active in the spleen (Fig . 4B) and poorly active in the kidney (Fig . 4C). Other than a few AP+ foci in the livers of AE2AP transduced mice (data not shown), the ENTV LTRs were inactive in all tissues examined (spleen and kidney: Fig . 4B, D, E, F; heart, pancreas and brain : data not shown).
[00163] The variable region at the 3' end of the env gene increases transgene expression from the 35RV and ENTV LTRs after intranasal administration of AAV vectors. Results from the previous experiment suggested that the LTRs are not responsible for the cell-type specific oncogenicity observed in naturally infected sheep and that perhaps other regions of the ovine betaretroviral genome contribute to the disease spectrum. The genomic sequences of JSRV and ENTV differ at the 3' end of the env gene, just upstream of the 3' LTR (29), in a region that has been shown to be dispensable for transformation ( 17) but possesses enhancer functions in other retroviruses (3, 18). To test the potential role of this region in determining disease tropism, we incorporated the ~75 bp sequence upstream of the JSRV and ENTV-1 3' LTRs into AJAP and AEjAP to create AJEJAP and AEEEjAP, where JE stands for JSRV element and EE stands for ENTV element (Fig. 1). The putative enhancer was cloned upstream of the LTR because an RNA export function has been ascribed to a region containing this domain (2, 25) . Because our interest was in testing the enhancer function of this domain exclusively, we wanted to ensure that this sequence was not present in the mRNA. These vectors were administered intranasally to 8-week-old C57BL/6 mice and one month later the mice were euthanized .
[00164] Analysis of AP staining in the lungs, nose and trachea revealed a significant increase in transgene expression from the JSRV JE-LTR containing vectors (Fig. 2D, I and N) relative to the vectors encoding the JSRV LTR alone in all three tissues (Fig. 2A, F and K). Histological analysis of AP staining showed that the level of AP expression was dramatically increased in the epithelium lining the trachea (compare Fig . 2S to P) in the tissues exposed to the JE-LTR containing vector. The increase in AP expression in the lungs of JE-LTR containing vectors was not as obvious histologically (Fig. 2U and X).
Based on the intensity of AP staining, it is very likely that a dose of 1 x 1010 vg saturated the lung tissue.
[001 5] Results from the intranasal administration of AEEEjAP were not as dramatic.
Upon gross analysis of AP stained tissues, it appeared that the staining intensity was elevated in the lungs of mice that received AEEEXAP compared to the wild type LTR containing vector, AEiAP (Fig . 20 and L). This difference was more obvious upon histological examination of AP stained lung sections where in alveolar type II cells, AP expression was much stronger (compare Fig . 2Y to V) . These results indicate that sequence elements immediately upstream of the 3' LTR of JSRV and ENTV increase transgene expression from the JSRV and ENTV LTRs following intranasal delivery. The sequence approximately 75 nucleotides upstream of the JSRV LTR had a much greater effect on transgene expression than did the sequence upstream of the EIMTV LTR, at least in the mouse respiratory tract.
[00166] The variable region at the 3' end of the env gene expands the tissue tropism of the EIMTV LTR after systemic administration of AAV vectors. To determine whether the JE and EE sequence elements had an effect on transgene expression following systemic delivery, AJEJAP and AEEEiAP were administered intravenously (2 x 1010 vg ) and
intraperitoneal^ (8 x 1010 vg) to 8 week-old C57BL/6 mice. One month post-infection, mice were euthanized and the liver, spleen, kidney, pancreas, heart and brain were harvested and stained for AP expression. Systemic administration of the AJEJAP vector showed stronger AP expression in the liver, spleen and kidney (Fig . 3G, H and I) as compared to the WT JSRV LTR in the same tissues (Fig. 3A, B and C). Simila rly, systemic administration of the AEEEiAP vector led to high levels of AP expression in the liver (Fig . 3J), spleen (Fig . 3 ) and pancreas (data not shown) while virtually no AP expression could be detected in these same tissues when the WT ENTV- 1 LTR was used (Fig . 3D and E). Unlike the JE containing vectors, there was very little visible AP expression in the kidney of mice transduced with the AEEEiAP (Fig. 3L).
[00167] H istolog ical examination of AP expression in the liver of AJEJAP and AEEEiAP transduced mice demonstrated intense apical staining of the hepatocytes in both cases (Fig . 3M and P, respectively), with AJeJAP producing a sig nificantly greater level of AP expression . AP expression from both AJEJAP and A^E^P was restricted to the red pulp and the occasional artery in the spleen (Fig . 3N and Q, respectively). In the kidney, AP expression could readily be detected in the glomerulus and glomerular arterioles of AJEJAP transduced mice (Fig . 30) a nd to a lesser extent in the AEEEiAP transduced mice (Fig . 3R) . These data suggest that the upstream sequence elements that enhanced tra nsgene expression from the JSRV and ENTV LTR in the mouse respiratory tract have similar activity in other organs, with the most d ramatic effect observed in the liver and spleen.
[00168] To more accurately eva luate the difference in transgene expression from JE and EE containing vectors, the level of AP expression was quantified using an enzymatic assay. The liver and lung were chosen as these tissues demonstrated the greatest increase in AP expression when JE and EE were present. Note that because the AJAP a nd A:EJAP vector doses used in the first part of the study appeared to be saturating the tissues, we inoculated mice with 10 times less virus for the AP quantification assay.
Indeed, by using a lower dose of vector, we were able to demonstrate that the amount of AP expression from the AJEJAP vector was over 50 fold greater in the lung (Fig. 5A) and nearly 1 ,000 fold greater in the liver than the AJAP vector (Fig . 5B) . Conversely, AP expression from the AEEEJAP vector was approximately 3 fold higher than its WT AEtAP counterpart in the lung (Fig. 5C) and 5 fold higher in the liver (Fig. 5D). Taken together, these data confirm what was observed grossly, that the 3' end of the env gene contains sequences that enhance the activity of the JSRV and ENTV LTRs in vivo, particularly in the lung and liver.
[00169] The upstream enhancing elements are not present in AAV vector mRNA. The JE and EE elements contain part of a putative RNA export element termed the signal peptide-responsive element (SPRE) (2) or Rej-responsive element (RejRE) (25). To determine whether the mRNA transcripts produced from the A3EJAP and AEEEiAP vectors in vivo might contain the upstream JE and EE enhancing elements, 5' RACE was conducted. Total RNA extracted from the liver of vector transduced and saline infected mice, was subjected to 5' RACE. The resultant RT-PCR products were cloned and sequenced. One dominant band was amplified from both the AJEJAP and AEEE:AP transduced liver and sequencing of the cloned cDNA revealed that both transcripts initiated within the R region of the LTR (data not shown), in the same region as the WT LTR, indicating that the upstream enhancing elements are not incorporated into the messenger RNA and thus do not function in cis to enhance mRNA export, stability, or translation.
[00170] Administration of AAV vectors expressing the JSRV or ENTV Env proteins from the JSRV or ENTV LTRs results in lung tumor induction with no evidence of nasal tumors.
[00171 ] In previous experiments, administration of 5 x 1010 vg of AAV vectors expressing the JSRV or ENTV Env protein from a strong RSV promoter resulted in robust tumor formation in the distal lung of immunodeficient mice by 5 months post-infection (39, 40). We hypothesized that expressing ENTV Env from its native LTR instead of the previously used RSV promoter might lead to nasal tumor formation. We therefore constructed a series of AAV vectors expressing the JSRV Env from the ENTV-1, ENTV-2 and JSRV LTRs and similarly, the ENTV-1 Env from the ENTV-1, ENTV-2 and JSRV LTRs. Note that these vectors carry the JE or EE enhancer elements as part of the Env coding regions. Intranasal administration of 5 x 1010 vg of these AAV vectors into
immunodeficient C57BL/6-Rag2 mice resulted in robust and rapid tumor formation for all of the AAV vectors tested. By 2.5 months post-infection mice had developed signs of respiratory distress necessitating euthanasia. Upon gross inspection, the lungs of mice receiving AAV vectors with any combination of LTR and Env looked very similar. The lungs had nearly doubled in size and were filled with an extensive array of tumor nodules that permeated the entire lung parenchyma (Fig. 6A, B, and C). There was no evidence of tumor formation or foci of hyperplasia in either the nasal epithelium or the trachea in any of the mice examined (data not shown). Histologic analysis of lung tumor sections revealed that nearly all of the normal lung tissue had been replaced by adenomatous tissue (Fig. 6D, E and F) that stained positive for Env expression when measured with an Env-specific monoclonal antibody (41) (Fig. 6G, H and I). The results from these experiments indicate that expression of the JSRV or ENTV Env protein from an ovine betaretrovirus LTR promotes more extensive and rapid tumor formation in
immunodeficient mice than when an RSV promoter is used. The cognate promoter-Env combination exacerbated tumorigenesis in the lung but did not result in tumorigenesis in the nose. Both JSRV and ENTV env genes gave similar results irrespective of which ovine beta retroviral LTR was used. Interestingly, there was no sign of tumor induction or evidence hyperplasia in the nasal cavity despite high levels of transcriptional activity from both the ENTV and JSRV LTRs driving AP in this tissue.
[00172] The JE appears to function as an enhancer as it was able to enhance expression when combined with the chicken beta actin promoter, in either orientation (Figs. 8A-E). Extending the JE in the 5' direction did not seem to increase expression in most cases but may possibly improve expression in HTX cells. A hybrid promoter consisting of the JE72, the U3 region of the JSRV LTR, and the chicken beta actin promoter (AG) (construct pAJE72-U3-AG), or a hybrid promoter consisting of the JE72, the U3 and R regions of the JSRV LTR, and the chicken beta actin promoter (AG) (construct pAJE72-U3- R-AG) both demonstrated very high level expression in 293 and HTX cells comparable to the CMV-IE/chicken beta actin promoter construct (designated pACAGAP). However, these hybrid promoters may have higher specificity for lung and liver expression since they contain lung and liver specific transcription factor binding sites and are derived from a respiratory tract specific virus. Relative to the wildtype JSRV promoter (pAU3-R-U5), the pAJE72-U3-R-AG-AP construct possessed approximately 6, 11, 22, and 21 fold higher expression in 293, 293T, HTX, and 208F cells, respectively.
[00173] In-vitro use of the JE (not EE) enhancer (Figure 9) in forward and inverted modes, in combination with different promoters (Chicken beta actin and in combination with U3 region. The constructs are used in comparison to the gold standard vector containing promoter Cytomegalovirus and a C V enhancer. This data supports that the enhancer of the invention does enhance expression of a target nucleic acid sequence in targeted cells.
[00174] The Ee sequences may be used to enhance expression of transgenes when encoded within a plasmid vector and delivered via transfection. Figures 8/9 also demonstrate that the Ee of the invention are able to function to enhance expression of transgenes when encoded within a plasmid vector and delivered via transfection, as these constructs were transfected into cells via the calcium phosphate method and were not transduced with the AAV vector system. Although these plasmids contain AAV sequences in the form of two inverted terminal repeats flanking the transgene cassette, the transgene cassette remains in the non-viral, plasmid based form. As such, it functions as would any other recombinant DNA plasmid. Thus the Ee sequences can be incorporated into any plasmid and can be used to enhance the expression of transgenes encoded on a plasmid when transfected into cells.
REFERENCES
[00175] Allen, J. M., C. L. Halbert, and A. D. Miller. 2000. Improved adeno- associated virus vector production with transfection of a single helper adenovirus gene, E4orf6. Mol. Ther. 1:88-95.
[00176] Caporale, M., F. Afnaud, M. Mura, M. Golder, C. Murgia, and M. Palmarini. 2009. The signal peptide of a simple retrovirus envelope functions as a posttranscriptional regulator of viral gene expression. J. Virol. 83:4591-4604.
[00177] Chesters, P. M., L. P. Smith, and V. Nair. 2006. E (XSR) element contributes to the oncogenicity of Avian leukosis virus (subgroup J). J. Gen. Virol. 87:2685-2692.
[00178] Choi, S. Y., and D. V. Faller. 1994. The long terminal repeats of a murine retrovirus encode a trans-activator for cellular genes. J. Biol. Chem. 269:19691-19694.
[00179] Choi, S. Y., and D. V. Faller. 1995. A transcript from the long terminal repeats of a murine retrovirus associated with trans activation of cellular genes. J. Virol. 69:7054-7060.
[00180] Cote, M., T. J. Kucharski, and S.-L. Liu. 2008. Enzootic nasal tumor virus envelope requires a very acidic pH for fusion activation and infection. J. Virol. 82:9023- 9034.
[00181 ] Cousens, C, E. Minguijon, R. G. Dalziel, A. Ortin, M. Garcia, J. Park, L. Gonzalez, J. M. Sharp, and M. De las Heras. 1999. Complete sequence of enzootic nasal tumor virus, a retrovirus associated with transmissible intranasal tumors of sheep. J. Virol. 73:3986-3993.
[00182] Dakessian, R. M., and H. Fan. 2008. Specific in vivo expression in type II pneumocytes of the jaagsiekte sheep retrovirus long terminal repeat in transgenic mice. Virology 372:398-408.
[00183] De las Heras, M., A. Ortin, C. Cousens, E. Minguijon, and J. M. Sharp.
2003. Enzootic nasal adenocarcinoma of sheep and goats. Curr. Top. Microbiol. Immunol. 275:201-223. [00184] Dirks, C, F. M. Duh, S. K. Rai, M. I. Lerman, and A. D. Miller. 2002. Mechanism of cell entry and transformation by enzootic nasal tumor virus. J. Virol. 76:2141-2149.
[00185] Forma n, L. W., R. Pal-Ghosh, R. A. Spanjaard, D. V. Faller, and S. K. Ghosh. 2009. Identification of LTR-specific small non-coding RNA in FeLV infected cells. FEBS Lett. 583:1386-1390.
[00186] Graham, F. L., J. Smiley, W. C. Russell, and R. Nairn. 1977. Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J. Gen. Virol. 36:59-74.
[00187] Halbert, C. L., J. M. Allen, and A. D. Miller. 2002. Efficient mouse airway transduction following recombination between AAV vectors carrying parts of a larger gene. Nat. Biotechnol. 20:697-701.
[00188] Halbert, C. L., S. L. Lam, and A. D. Miller. 2007. High-efficiency promoter-dependent transduction by adeno-associated virus type 6 vectors in mouse lung. Hum. Gene Ther. 18:344-354.
[00189] Halbert, C. L., T. A. Standaert, M. L. Aitken, I. E. Alexander, D. W.
Russell, and A. D. Miller. 1997. Transduction by adeno-associated virus vectors in the rabbit airway : efficiency, persistence, and readministration. J. Virol. 71:5932-5941.
[00190] Halbert, C. L., T. A. Standaert, C. B. Wilson, and A. D. Miller. 1998.
Successful readministration of adeno-associated virus vectors to the mouse lung requires transient immunosuppression during the initial exposure. J. Virol. 72:9795-9805.
[00191] Hull, S., and H. Fan. 2006. Mutational analysis of the cytoplasmic tail of jaagsiekte sheep retrovirus envelope protein. J. Virol. 80:8069-8080.
[00192] Laimins, L. A., P. Tsichlis, and G. Khoury. 1984. Multiple enhancer domains in the 3' terminus of the Prague strain of Rous sarcoma virus. Nucleic Acids Res. 12:6427-6442.
[00193] Liu, S.-L., F. M. Duh, M. I. Lerman, and A. D. Miller. 2003. Role of virus receptor Hyal2 in oncogenic transformation of rodent fibroblasts by sheep betaretrovirus env proteins. J. Virol. 77:2850-2858. [00194] Luciw, P. A., 3. M. Bishop, H. E. Varmus, and . R. Capecchi. 1983.
Location and function of retroviral and SV40 sequences that enhance biochemical transformation after microinjection of DNA. Cell 33:705-716.
[00195] Mattick, J. S. 2003. Challenging the dogma: the hidden layer of non- protein-coding NAs in complex organisms. Bioessays 25:930-939.
[00196] McGee-Estrada, K., and H. Fan. 2007. Comparison of LTR enhancer elements in sheep betaretroviruses: insights into the basis for tissue-specific expression. Virus Genes 35:303-312.
[00197] McGee-Estrada, K., M. Palmarini, and H. Fan. 2002. HNF-3beta is a critical factor for the expression of the Jaagsiekte sheep retrovirus long terminal repeat in type II pneumocytes but not in Clara cells. Virology 292:87-97.
[00198] Miller, J.H. (1972). Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York, USA.
[00199] Murphy, S. L., A. Bhagwat, S. Edmonson, S. Zhou, and . A. High.
2008. High-throughput screening and biophysical interrogation of hepatotropic AAV. Mol. Ther. 16: 1960-1967.
[00200] Nitta, T., A. Hofacre, S. Hull, and H. Fan. 2009. Identification and mutational analysis of a Rej response element in Jaagsiekte sheep retrovirus RNA. J. Virol. 83:12499-12511.
[00201] Ortin, A., C. Cousens, E. Minguijon, Z. Pascual, M. P. Villarreal, J. M.
Sharp, and M. De las Heras. 2003. Characterization of enzootic nasal tumour virus of goats: complete sequence and tissue distribution. J. Gen. Virol. 84:2245-2252.
[00202] Palmarini, M., S. Datta, R. Omid, C. Murgia, and H. Fan. 2000. The long terminal repeat of Jaagsiekte sheep retrovirus is preferentially active in differentiated epithelial cells of the lungs. J. Virol. 74:5776-5787.
[00203] Palmarini, M., and H. Fan. 2003. Molecular biology of jaagsiekte sheep retrovirus. Curr. Top. Microbiol. Immunol. 275:81-115.
[00204] Palmarini, M., C. Hallwirth, D. York, C. Murgia, T. de Oliveira, T. Spencer, and H. Fan. 2000. Molecular cloning and functional analysis of three type D endogenous retroviruses of sheep reveal a different cell tropism from that of the highly related exogenous jaagsiekte sheep retrovirus. J. Virol. 74:8065-8076. [00205] Palmarini, M., J. M. Sharp, M. De las Heras, and H. Fan. 1999. Jaagsiekte sheep retrovirus is necessary and sufficient to induce a contagious lung cancer in sheep. J. Virol. 73:6964-6972.
[00206] Rai, S. K., J. C. DeMartini, and A. D. Miller. 2000. Retrovirus vectors bearing jaagsiekte sheep retrovirus Env transduce human cells by using a new receptor localized to chromosome 3p21.3. J. Virol. 74:4698-4704.
[00207] Rai, S. K., F. M. Dun, V. Vigdorovich, A. Danilkovitch-Miagkova, M. I. Lerman, and A. D. Miller. 2001. Candidate tumor suppressor HYAL2 is a glycosylphosphatidylinositol (GPI)-anchored cell-surface receptor for jaagsiekte sheep retrovirus, the envelope protein of which mediates oncogenic transformation. Proc. Natl. Acad. Sci. USA 98:4443-4448.
[00208] Sambrook, J, D.W. Russel. (2001). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York, USA.
[00209] Sanlioglu, S., M. M. Monick, G. Luleci, G. W. Hunninghake, and 3. F. Engelhardt. 2001. Rate limiting steps of AAV transduction and implications for human gene therapy. Curr. Gene Ther. 1:137-147.
[00210] Sharp, J. M., and J. C. DeMartini. 2003. Natural history of 3SRV in sheep. Curr. Top. Microbiol. Immunol. 275:55-79.
[00211] Tsichlis, P. N., L. Donehower, G. Hager, N. Zeller, R. Malavarca, S. Astrin, and A. M. Skalka. 1982. Sequence comparison in the crossover region of an oncogenic avian retrovirus recombinant and its nononcogenic parent: genetic regions that control growth rate and oncogenic potential. Mol. Cell. Biol. 2:1331-1338.
[00212] Van Hoeven, N. S., and A. D. Miller. 2005. Improved enzootic nasal tumor virus pseudotype packaging cell lines reveal virus entry requirements in addition to the primary receptor Hyal2. J. Virol. 79:87-94.
[00213] Walsh, S. R., N. M. Linnerth-Petrik, A. N. Laporte, P. I. Menzies, R. A.
Foster, and S. K. Wootton. 2010. Full-length genome sequence analysis of enzootic nasal tumor virus reveals an unusually high degree of genetic stability. Virus Res. 151:74- 87.
[00214] Wolgamot, G., and A. D. Miller. 1999. Replication of Mus dunni endogenous retrovirus depends on promoter activation followed by enhancer multimerization. J. Virol. 73:9803-9809. [00215] Wootton, S. K C. L Halbert, and A. D. Miller. 2006. Envelope proteins of jaagsiekte sheep retrovirus and enzootic nasal tumor virus induce similar bronchioalveolar tumors in lungs of mice. J. Virol. 80:9322-9325.
[00216] Wootton, S. K., C. L. Halbert, and A. D. Miller. 2005. Sheep retrovirus structural protein induces lung tumours. Nature 434:904-907.
[00217] Wootton, S. K., M. J. Metzger, K. L. Hudkins, C. E. Alpers, D. York, J. C. Demartini, and A. D. Miller. 2006. Lung cancer induced in mice by the envelope protein of jaagsiekte sheep retrovirus (JSRV) closely resembles lung cancer in sheep infected with JSRV. Retrovirology 3:94.
[00218] Yu, D. L., N. M. Linnerth-Petrik, C. L. Halbert, S. R. Walsh, A D. Miller, and S.K. Wootton. (2011) JSRV and ENTV Promoters Drive Gene Expression in All Airway Epithelial Cells of Mice but Only Induce Tumors in the Alveolar Region of the Lung. Journal of Virology. 85: 7535-7545.
[00219] Zentilin, L., and M. Giacca. 2007. Competitive PCR for precise nucleic acid quantification. Nat. Protoc. 2:2092-2104.

Claims

We Claim:
1. A transcriptional Enhancer element (Ee) derived from Jaagsiekte sheep retrovirus (JSRV) or Enzootic nasal tumor virus (ENTV).
2. The Ee of claim 1, wherein said JSRV derived Ee comprises the sequence of SEQ ID NO: l.
3. The Ee of claim 1, wherein said ENTV derived Ee comprises the sequence of SEQ ID NO.2.
4. A fragment of the Ee of claim 2 or 3, wherein said fragment enhances expression of a nucleic acid sequence, transgene and/or recombinant DNA.
5. The fragment of any one of claims 1 to 4, wherein said fragment is at least 20 nucleotides in length, at least 30 nucleotides in length, at least 40 nucleotides in length, at least 50 nucleotides in length and at least 60 nucleotides in length.
6. A homolog of the Ee sequence of any one of claims 1 to 5.
7. A nucleic acid sequence that shares at least 60%, at least 70%, at least 80%, at least 85%, at least 90% or at least 95% sequence identity to the Ee of any one of claims 1 to 5.
8. A nucleic acid construct comprising the Ee of any one of claims 1 to 7.
9. The nucleic acid construct of claim 8 further comprising a promoter and transgene.
10. The nucleic acid construct of claim 9, wherein said Ee is upstream of a Long Terminal Repeat (LTR).
11. An expression vector comprising the nucleic acid construct of any one of claims 8, 9 or 10.
12. The vector of claim 11, wherein said expression vector is mammalian.
13. An Adeno-Associated Virus (AAV) vector comprising the construct of any one of claims 8, 9 or 10.
14. The vector of claim 13, wherein said construct comprises a sequence selected from the group consisting of SEQ ID NO. SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 17, SEQ ID NO. 18, SEQ ID NO. 19, SEQ ID NO. 20, SEQ ID NO. 21, SEQ ID NO. 22, SEQ ID NO. 24, SEQ ID NO. 25, SEQ ID NO. 26, SEQ ID NO. 27 and SEQ ID NO. 28.
15. The vector of claim 14 comprising SEQ ID NO.22.
16. A composition comprising the vector of any one of claims 11 to 15.
17. A medicament comprising the vector of any one of claims 11 to 15.
18. A cell transduced/transfected with the vector of any one of claims 11 to 15.
19. The cell of claim 18, wherein said cell is eukaryotic or prokaryotic,
20. The cell of claim 19, wherein said cell is mammalian and selected from the group consisting of human, mouse, rat, bird, cat, dog, goat, sheep, pig, bovid, horse or non- human primate cell.
21. The cell of claim 20, wherein said cell is human.
22. The cell of claim 20 or 21, wherein said cell is selected from the group consisting of fibroblasts, neurons, retinal cells, liver cells, kidney cells, lung cells, bone marrow stem cells and hematopoietic stem cells.
23. The cell of claim 22, wherein said cell is selected from the group consisting of HTX cells, 208 fibroblasts, HEK-293 cells and HEK-293T cells.
24. A composition comprising a cell transduced with a recombinant Adeno-Associated Virus (AAV) vector (rAAVEe) comprising a transgene cloned into the AAV vector, an Enhancer element (Ee) cloned into the AAV vector upstream of a Long Terminal Repeat (LTR), said Ee encoded by a nucleotide sequence of SEQ ID NO : 1 or SEQ ID NO : 2, wherein said rAAVEe enhances the expression of the transgene.
25. The composition of claim 24, wherein said Ee is a fragment of SEQ ID NO : l or 2, wherein said fragment enhances expression of said transgene.
26. The composition of claim 24, wherein said Ee is a homolog of SEQ ID NO : l or 2.
27. The composition of claim 26, wherein said homolog shares at least 60%, at least 70%, at least 80%, at least 85%, at least 90% or at least 95% sequence identity to the SEQ ID NO. 1 or 2.
28. The composition of any one of claims 24 to 27, wherein the cell is a mammalian cell.
29. The composition of claim 28, wherein the cell is a human cell.
30. The composition of claim 28, wherein the cell is a mouse, rat, bird, cat, dog, goat, sheep, pig, bovid, horse or non-human primate cell.
31. The use of the composition of any one of claims 24 to 30 for gene therapy.
32. The use of the composition of any one of claims 24 to 30 in a medicament for gene therapy.
33. The use of the composition of any one of claims 24 to 30, for industrial production of protein(s) in cell culture in vitro.
34. A method for producing a desired protein, which comprises culturing a cell comprising the vector of any one of claims 11 to 15 ; and harvesting the expressed protein from the cultured cell or medium.
35. A method for expressing a desired DNA in a host cell, which comprises introducing the vector of any one of claims 11 to 15 into the host cell.
36. A method for increasing the expression level of a desired transgene in a host cell, which comprises inserting upstream of the desired transgene an Ee of SEQ ID NO. 1 or 2, including fragments and homologs thereof.
37. A method to provide a desired transgene to a subject, said method comprising administering to said subject the composition of claim 16.
PCT/CA2012/000256 2011-03-25 2012-03-23 Enhancing protein expression of adeno-associated virus vectors Ceased WO2012129648A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161467527P 2011-03-25 2011-03-25
US61/467,527 2011-03-25

Publications (1)

Publication Number Publication Date
WO2012129648A1 true WO2012129648A1 (en) 2012-10-04

Family

ID=46929241

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2012/000256 Ceased WO2012129648A1 (en) 2011-03-25 2012-03-23 Enhancing protein expression of adeno-associated virus vectors

Country Status (1)

Country Link
WO (1) WO2012129648A1 (en)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013151666A2 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of biologics and proteins associated with human disease
WO2013151736A2 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics In vivo production of proteins
WO2015034925A1 (en) 2013-09-03 2015-03-12 Moderna Therapeutics, Inc. Circular polynucleotides
WO2015034928A1 (en) 2013-09-03 2015-03-12 Moderna Therapeutics, Inc. Chimeric polynucleotides
WO2015051214A1 (en) 2013-10-03 2015-04-09 Moderna Therapeutics, Inc. Polynucleotides encoding low density lipoprotein receptor
WO2016014846A1 (en) 2014-07-23 2016-01-28 Moderna Therapeutics, Inc. Modified polynucleotides for the production of intrabodies
WO2017100562A1 (en) 2015-12-09 2017-06-15 Alexion Pharmaceuticals, Inc, Modified mrna encoding a uridine diphopsphate glucuronosyl transferase and uses thereof
WO2019018765A1 (en) 2017-07-21 2019-01-24 Modernatx, Inc. Modified mrna encoding a propionyl-coa carboxylase and uses thereof
WO2019023179A1 (en) 2017-07-24 2019-01-31 Modernatx, Inc. Modified mrna encoding a glucose-6-phosphatase and uses thereof
EP3578663A1 (en) 2013-03-15 2019-12-11 ModernaTX, Inc. Manufacturing methods for production of rna transcripts
EP4159741A1 (en) 2014-07-16 2023-04-05 ModernaTX, Inc. Method for producing a chimeric polynucleotide encoding a polypeptide having a triazole-containing internucleotide linkage

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030104357A1 (en) * 2001-03-30 2003-06-05 Fred Hutchinson Cancer Research Center Jaagsiekte sheep retroviral packaging cell lines and methods relating thereto
WO2004104032A2 (en) * 2003-05-14 2004-12-02 The University Of Iowa Research Foundation Methods and compositions related to high-titer pseudotyped retroviruses

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030104357A1 (en) * 2001-03-30 2003-06-05 Fred Hutchinson Cancer Research Center Jaagsiekte sheep retroviral packaging cell lines and methods relating thereto
WO2004104032A2 (en) * 2003-05-14 2004-12-02 The University Of Iowa Research Foundation Methods and compositions related to high-titer pseudotyped retroviruses

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 10 March 2011 (2011-03-10), COUSENS, C. ET AL.: "Ovine enzootic nasal tumor virus, complete genome.", retrieved from http://wwv.ncbi.nlm.nih.gov/nuccore/NC 007015.1 Database accession no. NC_007015.1 *
DATABASE GENBANK [online] 2 December 2008 (2008-12-02), BISHOP, J. V. ET AL.: "Ovine pulmonary adenocarcinoma virus, complete sequence; and flanking Ovis aries sequence", retrieved from http://www.ncbi.nlm.nih.gov/nuccore/af357971 Database accession no. AF375971.1 *
DATABASE GENBANK 9 August 2010 (2010-08-09), WALSH, S.R. ET AL.: "Ovine enzootic nasal tumor virus isolate ENTV-1NA4, complete genome", retrieved from URL:http://www.ncbi.nlm.nih.gv/nuccore/fj74146 Database accession no. FJ744146.1 *
MCGEE-ESTRADA, K. ET AL.: "Comparison of LTR enhancer elements in sheep betaretroviruses: insights into the basis for tissue-specific expression", VIRUS GENES, vol. 35, no. 2, October 2007 (2007-10-01), pages 303 - 312, XP019534941, DOI: doi:10.1007/s11262-007-0079-y *
YU, D.L. ET AL.: "Taagsiehte sheep reh-ovnus and enzootic nasal tumor virus promoters drive gene expression in all airway epithelial cells of mice, but only induce tumors in the alveolar region of the lungs", JOURNAL OF VIROLOGY, vol. 85, no. 15, August 2011 (2011-08-01), pages 7535 - 7545 *

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3501550A1 (en) 2012-04-02 2019-06-26 Moderna Therapeutics, Inc. Modified polynucleotides for the production of proteins associated with human disease
WO2013151736A2 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics In vivo production of proteins
WO2013151668A2 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of secreted proteins
WO2013151665A2 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of proteins associated with human disease
WO2013151666A2 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of biologics and proteins associated with human disease
EP3978030A1 (en) 2012-04-02 2022-04-06 ModernaTX, Inc. Modified polynucleotides for the production of proteins associated with human disease
EP3578663A1 (en) 2013-03-15 2019-12-11 ModernaTX, Inc. Manufacturing methods for production of rna transcripts
WO2015034925A1 (en) 2013-09-03 2015-03-12 Moderna Therapeutics, Inc. Circular polynucleotides
WO2015034928A1 (en) 2013-09-03 2015-03-12 Moderna Therapeutics, Inc. Chimeric polynucleotides
WO2015051214A1 (en) 2013-10-03 2015-04-09 Moderna Therapeutics, Inc. Polynucleotides encoding low density lipoprotein receptor
EP4159741A1 (en) 2014-07-16 2023-04-05 ModernaTX, Inc. Method for producing a chimeric polynucleotide encoding a polypeptide having a triazole-containing internucleotide linkage
WO2016014846A1 (en) 2014-07-23 2016-01-28 Moderna Therapeutics, Inc. Modified polynucleotides for the production of intrabodies
WO2017100562A1 (en) 2015-12-09 2017-06-15 Alexion Pharmaceuticals, Inc, Modified mrna encoding a uridine diphopsphate glucuronosyl transferase and uses thereof
WO2019018765A1 (en) 2017-07-21 2019-01-24 Modernatx, Inc. Modified mrna encoding a propionyl-coa carboxylase and uses thereof
WO2019023179A1 (en) 2017-07-24 2019-01-31 Modernatx, Inc. Modified mrna encoding a glucose-6-phosphatase and uses thereof

Similar Documents

Publication Publication Date Title
WO2012129648A1 (en) Enhancing protein expression of adeno-associated virus vectors
JP7532360B2 (en) Compositions and methods for treating Wilson's disease
AU2019258830B2 (en) Modified AAV capsid polypeptides for treatment of muscular diseases
JP6759177B2 (en) AAV virions with reduced immunoreactivity, and their use
KR102737836B1 (en) Compositions and methods for treating phenylketonuria
JP6683691B2 (en) Adeno-associated virus vector variants and methods for efficient genome editing
Miah et al. Emerging gene therapies for cystic fibrosis
KR20220070075A (en) Adeno-associated virus variant capsids and methods of use thereof
CA2678572C (en) Mitochondrial targeting and import of a virus to deliver a nucleic acid
WO2019068854A1 (en) Gene therapy of neurodegenerative diseases using aav vectors
CN114174520A (en) Compositions and methods for selective gene regulation
JP2018520646A (en) Gene therapy for Fabry disease
US20210403947A1 (en) Miniaturized dystrophins and uses thereof
CN112225793A (en) A lysosome targeting peptide and fusion protein thereof, adeno-associated virus vector carrying fusion protein coding sequence and application thereof
CN116322744A (en) Mutant beta-glucocerebrosidase with increased stability
Moscoso et al. The evolution of gene therapy in the treatment of metabolic liver diseases
EP3262065B1 (en) Methods and compositions for treating dystroglycanopathy disorders
US20130287739A1 (en) Serca2 therapeutic compositions and methods of use
JP2023529371A (en) Compositions and methods for the treatment of synucleinopathies
JP2024537178A (en) Compositions and methods for treating p53-mediated cancers - Patents.com
CN1418224A (en) TCF responsive element
US20170065685A1 (en) Serca2 therapeutic compositions and methods of use
ES2325711B1 (en) EXPRESSION VECTORS UNDERSTANDING THE PROMOTER OF THE HUMAN PKLR GENE AND ITS USE FOR THE ELABORATION OF PHARMACEUTICAL COMPOSITIONS INTENDED FOR SOMATIC GENE THERAPY WITH SPECIFIC EXPRESSION IN ERYTHROID CELLS.
JP2022525136A (en) Gene therapy compositions and methods for treating Parkinson's disease
US20050112098A1 (en) Pseudotyped viruses and methods for their use

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12763992

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12763992

Country of ref document: EP

Kind code of ref document: A1