WO2012129373A2 - Methods for producing a complex transgenic trait locus - Google Patents
Methods for producing a complex transgenic trait locus Download PDFInfo
- Publication number
- WO2012129373A2 WO2012129373A2 PCT/US2012/030061 US2012030061W WO2012129373A2 WO 2012129373 A2 WO2012129373 A2 WO 2012129373A2 US 2012030061 W US2012030061 W US 2012030061W WO 2012129373 A2 WO2012129373 A2 WO 2012129373A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- plant
- sequence
- seq
- dna
- target sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/06—Processes for producing mutations, e.g. treatment with chemicals or with radiation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Definitions
- the invention relates to the field of plant molecular biology, in particular, to methods for altering the genome of a plant cell.
- Recombinant DNA technology has made it possible to insert foreign DNA sequences into the genome of an organism, thus, altering the organism's phenotype.
- the most commonly used plant transformation methods are Agrobacterium infection and biolistic particle bombardment in which transgenes integrate into a plant genome in a random fashion and in an unpredictable copy number. Thus, efforts are undertaken to control transgene integration in plants.
- One method for inserting or modifying a DNA sequence involves homologous DNA recombination by introducing a transgenic DNA sequence flanked by sequences homologous to the genomic target.
- U.S. Patent No. 5,527,695 describes transforming eukaryotic cells with DNA sequences that are targeted to a predetermined sequence of the eukaryote's DNA. Specifically, the use of site-specific recombination is discussed. Transformed cells are identified through use of a selectable marker included as a part of the introduced DNA sequences.
- the present invention provides methods for producing in a plant a complex transgenic trait locus comprising at least two altered target sequences in a genomic region of interest.
- the methods involve selecting a genomic region in a plant that comprises a first target sequence and a second target sequence and then providing a first double-strand-break-inducing agent and a second double-strand-break-inducing agent.
- the first double-strand-break-inducing agent is capable of inducing a first double-strand break in DNA comprising the first target sequence
- the second double-strand-break-inducing agent is capable of inducing a second double-strand break in DNA comprising the second target sequence.
- the methods further involve contacting at least one plant cell with the first double-strand-break-inducing agent, identifying a cell comprising a first alteration at the first target sequence, and then recovering a first fertile plant from the cell comprising the first alteration.
- the first fertile plant also comprises the first alteration.
- the methods involve contacting at least one plant cell with the second double-strand-break-inducing agent, identifying a cell comprising a second alteration at the second target sequence, and then recovering a second fertile plant from the cell comprising the second alteration.
- the methods further involve obtaining a fertile progeny plant from the second fertile plant, wherein the fertile progeny plant comprises both the first and second alterations in physical linkage.
- the fertile progeny plant is obtained by crossing the first fertile plant and the second fertile plant and selecting the fertile progeny plant comprising both the first and second alterations in physical linkage.
- a cell of the first fertile plant, or progeny thereof comprising the first alteration is contacted with the second double-strand-break- inducing agent.
- the complex transgenic trait locus further comprises at least one polynucleotide of interest in the genomic region of interest.
- a polynucleotide of interest can be, for example, a transgene, a native gene, and a gene that was a native gene prior to a targeted mutation therein.
- the first alteration comprises insertion of a first DNA sequence of interest, or part thereof, into the first target sequence
- the second alteration comprises insertion of a second DNA sequence of interest, or part thereof, into the second target sequence.
- a first and/or a second DNA sequence of interest can be, for example, a DNA for gene silencing, a DNA encoding a phenotypic marker and a DNA encoding a protein providing an agronomic advantage.
- the first and second double-strand-break-inducing agents are selected from the group consisting of an endonuclease, a zinc finger nuclease, or a TAL effector nuclease.
- the endonuclease is modified to specifically cut at the first target sequence or at the second target sequence and no longer cuts at its wild-type endonuclease target sequence.
- the first target sequence and the second target sequence are separated from each other by about 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, O.8., 0.9, 1 , 2, 3, 4, or 5 centimorgans (cM) in the genome of the plant.
- the methods can involve crossing the fertile progeny plant with an additional fertile plant that comprises at least a third altered target sequence in the genomic region of interest and then selecting from the crossing a fertile progeny plant comprising the first alteration, the second and the at least third alteration in physical linkage.
- the third altered target sequence originated from a third target sequence that is recognized and cleaved by a third double-strand-break-inducing agent.
- complex trait loci in plants produced by the methods of the invention and plants, plant cells, plant parts, and seeds thereof comprising at least one complex transgenic trait locus of the invention.
- the present invention further provides a complex transgenic trait locus comprising at least two altered target sequences that are genetically linked in the genome of a plant to a polynucleotide of interest.
- Such altered target sequences originated from a corresponding target sequence that is recognized and cleaved by a double-strand-break-inducing agent.
- the altered target sequences comprise an alteration such as, for example, replacement of at least one nucleotide in the target sequence, a deletion of at least one nucleotide in the target sequence, an insertion of at least one nucleotide in the target sequence, or any combination thereof.
- the polynucleotide interest can be, for example, a transgene, a native gene, and a mutated gene.
- the present invention further provides plants, plant parts, plant cells, and seeds comprising at least one complex transgenic trait locus of the invention.
- At least one altered target sequence comprises a recombinant DNA molecule.
- Recombinant DNA molecules include, but are not limited to, a DNA for gene silencing, a DNA encoding a phenotypic marker, and a DNA encoding a protein providing an agronomic advantage.
- the two altered target sequences of the complex transgenic trait locus are located within about 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8. , 0.9, 1 , 2, 3, 4, 5,6, 7, 8, 9, 10, 1 1 or up to 21 centimorgan (cM) of the polynucleotide of interest.
- the invention provides plants, plant parts, plant cells, and seeds comprising at least one complex transgenic trait locus of the invention.
- an alternative method for producing in a plant a complex transgenic trait locus comprising at least two altered target sequences in a genomic region of interest involves obtaining a first fertile plant comprising a first altered target sequence at the genomic region of interest and a second fertile plant comprising a second altered target sequence at the genomic region of interest.
- the first altered target sequence originated from a first target sequence that is recognized and cleaved by a first double-strand-break-inducing agent
- the second altered target sequence originated from a second target sequence that is recognized and cleaved by a second double-strand-break-inducing agent.
- the alternative method further involves crossing the first fertile plant and the second fertile plant, and then selecting from the crossing a fertile progeny plant comprising the first alteration and the second alteration in physical linkage.
- plants produced by the second method of the invention and plant cells, plant parts, and seeds thereof comprising at least one complex transgenic trait locus.
- the present invention provides a plant comprising an expression construct, which comprises a promoter operably linked to a nucleotide sequence encoding an endonuclease.
- the endonuclease is capable of specifically binding to and creating a double strand break in a target sequence selected from the group consisting of SEQ ID NO:1 , 2, 3, 4, 5, 6, 7, 8, 68, 69, 70, 71 , 72, 73, 74, 75, 76, and 77, wherein the promoter is capable of driving expression of an operably linked nucleotide sequence in a plant cell.
- the nucleotide sequence encoding the endonuclease can comprise a coding sequence of a DNA binding domain of an endonuclease, wherein the coding sequence comprises nucleotides 100-261 and nucleotides 850-101 1 of SEQ ID NO:9, 10, 1 1 , 12, 13, 14, 15, 16, 78, 79, 80, 81 , 82 or 83; or a degenerate coding sequence thereof.
- endonuclease is a nucleotide sequence selected from the group consisting of SEQ ID NO:9, 10, 1 1 , 12, 13, 14, 15, 16, 78, 79, 80, 81 , 82, and 83.
- a plant of the invention comprises at least one altered target sequence, wherein the at least one altered target sequence originated from a corresponding target sequence that was recognized and cleaved by a double-strand break-inducing agent.
- the altered target sequence is in a genomic region of interest that extends from: the target sequence set forth in SEQ ID NO: 4 to the target sequence set forth in SEQ ID NO: 2; the target sequence set forth in SEQ ID NO: 5 to the target sequence set forth in SEQ ID NO: 8; or the target sequence set forth in SEQ ID NO: 68 to the target sequence set forth in SEQ ID NO: 77.
- Such a plant of the invention can be produced by a method comprising providing at least one double-strand-break-inducing agent that is capable of inducing a double-strand break in DNA comprising a target sequence, wherein the target sequence is in a genomic region of interest that extends from: the target sequence set forth in SEQ ID NO: 4 to the target sequence set forth in SEQ ID NO: 2; the target sequence set forth in SEQ ID NO: 5 to the target sequence set forth in SEQ ID NO: 8; or the target sequence set forth in SEQ ID NO: 68 to the target sequence set forth in SEQ ID NO: 77.
- the method further comprises contacting at least one plant cell with the double-strand-break-inducing agent, identifying a cell comprising an alteration at the target sequence, and recovering a fertile plant comprising the alteration.
- the double-strand-break-inducing agent is encoded by a nucleotide sequence comprising a coding sequence of a DNA binding domain of an endonuclease, and wherein the coding sequence is selected from the group consisting of nucleotides 100-261 and nucleotides 850-101 1 of SEQ ID NO: 9, 10, 1 1 , 12, 13, 14, 15, 16, and 80, and degenerate coding sequences thereof.
- the double-strand-break-inducing agent is encoded by a nucleotide sequence comprising a coding sequence of a DNA binding domain of an endonuclease, and wherein the coding sequence is selected from the group consisting of nucleotides 100-261 and nucleotides 661 -822 of SEQ ID NO: 78, 79, 81 , 82 and 83, and degenerate coding sequences thereof.
- the double-strand-break-inducing agent is encoded by a nucleotide sequence is selected from the group consisting of SEQ ID NO: 9, 10, 1 1 , 12, 13, 14, 15, 16, 78, 79, 80, 81 , 82, and 83.
- FIG. 1 DNA double-strand break induced DNA alteration of an endogenous target site.
- A A generalized endogenous target site with flanking genomic DNA sequences designated as DNA 1 and DNA 2 which can be used as DNA exchange regions by homologous recombination.
- B A generalized DNA construct that can be used to express a DNA endonuclease to recognize and cleave the endogenous target site. The DNA endonuclease gene can be physically linked to the donor DNA described in (C) or (D), or substituted by other double-strand break inducing agents.
- C A generalized donor DNA construct having two regions DNA1 and DNA 2 of homology to the genomic target which flank a polynucleotide of interest and/or marker gene.
- D A generalized donor DNA construct that does not have regions of homology to the genomic target to flank a polynucleotide of interest and/or marker gene.
- Insertion of the DNA fragment will produce an insertion of the polynucleotide of interest at or near the recognition site.
- E One expected outcome when the polynucleotide of interest and/or marker gene of donor construct described in (C) or (D) is inserted at the endogenous target site by homologous recombination or non-homologous recombination, respectively.
- F Another outcome when the endogenous target site is altered by a deletion during the repair of the DNA double-strand break cleaved by the DNA endonuclease.
- the polynucleotide of interest and/or marker gene of donor construct described in (C) or (D) can be inserted at unrelated sites by random DNA integration.
- G Another outcome when the endogenous target site is altered by the insertion of an unrelated DNA during the repair of the DNA double-strand breaks cleaved by the DNA
- polynucleotide of interest and/or marker gene of donor construct described in (C) or (D) can be inserted at unrelated sites by random DNA integration.
- Figure 3. A: Schematic diagram of PCR assays to detect TS21 target site modifications and transgenic integrations.
- B Alignment of altered target sequences of selected TS21 transgenic event.
- Figure 4. A: Alignment of altered target sequences of selected TS5 transgenic events.
- B Alignment of altered target sequences of selected TS14 transgenic events
- Figure 6 Location of target sites near a herbicide resistant transgenic event in soybean.
- Figure 7 Use of cluster of meganuclease target sites for stacking of multiple traits either by sequential transformation or genetic crosses.
- Figure 8 The locations of various MHP target sites surrounding a transgenic DNA of interest integration site in a maize plant. Solid black rectangles represent BAC clones. Names and numbers in each box are the target sites. Arrows from box to BAC indicated the target site affiliated to BAC clones. Numbers and arrows on the bottom of the figure indicate the genetic distance of the target sites relative to the insertion location of the transgenic DNA of interest. As indicated at the top of the figure, the physical distance is about 1 .8 Mb nucleotides in this region of the maize chromosome.
- Figure 9 A: Outline of PCR screening for integration of donor at MHP14 target site (donor was PHP44779) B: PCR of MHP14 events: B1 -B12 junction PCR with primers 146773/146775; b1 -b12 junction PCR with primers
- FIG. 10 A: Schematic outline of PCR to confirm ubi:mopat:pinll cassette integration at the endogenous MHP14 target .
- CKP positive control from callus DNA.
- the right panel shows the results of junction PCR on the HR2 side with a moPAT primer (mopatF2) a genomic primer (146772).
- the arrows indicate the locations corresponding to the various primers used.
- Figure 1 1 Alignment of fragments from the plant-optimized nucleotide sequences of meganucleases comprising the nucleotides 100-261 and nucleotides 850-101 1 of SEQ ID NO: 9, 10, 1 1 , 12, 13, 14, 15, 16, and 80, and the nucleotides 100-261 and nucleotides 661 -822 of SEQ ID NO: 78, 79, 81 , 82 and 83 .
- SEQ ID NO: 1 is the nucleotide sequence of the TS21 target site in soybean genome.
- SEQ ID NO: 2 is the nucleotide sequence of the TS14 target site in soybean genome.
- SEQ ID NO: 3 is the nucleotide sequence of the TS30 target site in soybean genome.
- SEQ ID NO: 4 is the nucleotide sequence of the TS5 target site in soybean genome.
- SEQ ID NO: 5 is the nucleotide sequence of the TS7 target site in soybean genome.
- SEQ ID NO: 6 is the nucleotide sequence of the TS4 target site in soybean genome.
- SEQ ID NO: 7 is the nucleotide sequence of the TS22 target site in soybean genome.
- SEQ ID NO: 8 is the nucleotide sequence of the TS24 target site in soybean genome.
- SEQ ID NO: 9 is the plant-optimized nucleotide sequence of the TS21 meganuclease containing a nuclear target site and an ST-LS1 intron.
- SEQ ID NO: 10 is the plant-optimized nucleotide sequence of the TS14 meganuclease containing a nuclear target site and an ST-LS1 intron.
- SEQ ID NO: 1 1 is the plant-optimized nucleotide sequence of the TS30 meganuclease containing a nuclear target site and an ST-LS1 intron.
- SEQ ID NO: 12 is the plant-optimized nucleotide sequence of the TS5 meganuclease containing a nuclear target site and an ST-LS1 intron.
- SEQ ID NO: 13 is the plant-optimized nucleotide sequence of the TS7 meganuclease containing a nuclear target site and an ST-LS1 intron.
- SEQ ID NO: 14 is the plant-optimized nucleotide sequence of the TS4 meganuclease containing a nuclear target site and an ST-LS1 intron.
- SEQ ID NO: 15 is the plant-optimized nucleotide sequence of the TS22 meganuclease containing a nuclear target site and an ST-LS1 intron.
- SEQ ID NO: 16 is the plant-optimized nucleotide sequence of the TS24 meganuclease containing a nuclear target site and an ST-LS1 intron.
- SEQ ID NO: 17 is the homologous region 1 (HR1 ) of the TS21 target site
- SEQ ID NO: 18 is the homologous region 2 (HR2) of the TS21 target site
- SEQ ID NO: 19 is the HR1 of the TS14 target site.
- SEQ ID NO: 20 is the homologous region 2 of the TS14 target site.
- SEQ ID NO: 21 is the HR1 of the TS30 target site.
- SEQ ID NO: 22 is the homologous region 2 of the TS30 target site.
- SEQ ID NO: 23 is the HR1 of the TS5 target site.
- SEQ ID NO: 24 is the homologous region 2 of the TS5 target site.
- SEQ ID NO: 25 is the HR1 of the TS7 target site.
- SEQ ID NO: 26 is the homologous region 2 of the TS7 target site.
- SEQ ID NO: 27 is the HR1 of the TS4 target site.
- SEQ ID NO: 28 is the homologous region 2 of the TS4 target site.
- SEQ ID NO: 29 is the HR1 of the TS22 target site.
- SEQ ID NO: 30 is the homologous region 2 of the TS22 target site.
- SEQ ID NO: 31 is the HR1 of the TS24 target site.
- SEQ ID NO: 32 is the homologous region 2 of the TS24 target site.
- SEQ ID NO: 33 is the plant-optimized nucleotide sequence of the TS21 meganuclease without a ST-LS1 intron.
- SEQ ID NO: 34 is the amino acid sequence of the SV40 nuclear localization signal.
- SEQ ID NO: 35 is the nucleotide sequences of expression cassette RTW317, comprising the TS21 meganuclease plant optimized sequence without an intron and operably linked to the soybean EF1A promoter.
- SEQ ID NO: 36 is the nucleotide sequences of expression cassette RTW322, comprising the TS21 meganuclease plant optimized sequence with an intron and operably linked to the soybean EF1 A promoter.
- SEQ ID NO: 37 is the nucleotide sequence of RTW328A, which is the repair DNA fragment for TS21 meganuclease.
- SEQ ID NO:38 is the nucleotide sequence of TS21 qPCR forward primer Mega21 -190F.
- SEQ ID NO:39 is the nucleotide sequence of TS21 qPCR reverse primer Mega21 -301 R.
- SEQ ID NO:40 is the nucleotide sequence of TS21 qPCR probe mega21 - 250T. The fluorescent probe is labeled with FAM quenched with MGB.
- SEQ ID NO:41 is the nucleotide sequence of TS14 qPCR forward primer Mega14-13F.
- SEQ ID NO:42 is the nucleotide sequence of TS14 qPCR reverse primer
- SEQ ID NO:43 is the nucleotide sequence of TS14 qPCR probe Mega14- 85T.
- the fluorescent probe is labeled with FAM quenched with MGB.
- SEQ ID NO:44 is the nucleotide sequence of TS30 qPCR forward primer Mega30-30F.
- SEQ ID NO:45 is the nucleotide sequence of TS30 qPCR reverse primer Mega30-87R.
- SEQ ID NO:46 is the nucleotide sequence of TS30 qPCR probe Mega30- 52T.
- the fluorescent probe is labeled with FAM quenched with MGB.
- SEQ ID NO:47 is the nucleotide sequence of TS5 qPCR forward primer
- SEQ ID NO:48 is the nucleotide sequence of TS5 qPCR reverse primer Mega5-R1 .
- SEQ ID NO:49 is the nucleotide sequence of TS5 qPCR probe Mega5-T1 .
- the fluorescent probe is labeled with FAM quenched with MGB.
- SEQ ID NO:50 is the nucleotide sequence of the sense primer, WOL133, which is upstream of the TS21 target site in the soybean genome.
- SEQ ID NO:51 is the nucleotide sequence of the antisense primer, WOL134, which is downstream of the TS21 target site in the soybean genome.
- SEQ ID NO:52 is the nucleotide sequence of the sense primer, WOL190 which is further upstream of the TS21 target site beyond the TS21 HR1 fragment in the soybean genome.
- SEQ ID NO:53 is the nucleotide sequence of the antisense primer, WOL242, which is specific to the hygromycin coding sequences.
- SEQ ID NO:54 is the nucleotide sequence of the sense primer, WOL153, which is specific to the NOS Terminator.
- SEQ ID NO:55 is the nucleotide sequence of the antisense primer, WOL247, which is further downstream of the TS21 target site beyond the TS21 HR2 fragment in the soybean genome.
- SEQ ID NO:56 is the nucleotide sequence of the sense primer, WOL121 , which is upstream of the TS14 target site in the soybean genome.
- SEQ ID NO:57 is the nucleotide sequence of the antisense primer, WOL150, which is downstream of the TS21 target site in the soybean genome.
- SEQ ID NO:58 is the nucleotide sequence of the sense primer, WOL192, which is further upstream of the TS14 target site beyond the TS14 HR1 fragment in the soybean genome.
- SEQ ID NO:59 is the nucleotide sequence of the antisense primer, WOL193, which is further downstream of the TS14 target site beyond the TS14 HR2 fragment in the soybean genome.
- SEQ ID NO:60 is the nucleotide sequence of the sense primer, WOL1 13, which is upstream of the TS30 target site in the soybean genome.
- SEQ ID NO:61 is the nucleotide sequence of the antisense primer, WOL1 14, which is downstream of the TS30 target site in the soybean genome.
- SEQ ID NO:62 is the nucleotide sequence of the sense primer, WOL194, which is further upstream of the TS30 target site beyond the TS30 HR1 fragment in the soybean genome.
- SEQ ID NO:63 is the nucleotide sequence of the antisense primer, WOL195, which is further downstream of the TS30 target site beyond the TS30 HR2 fragment in the soybean genome.
- SEQ ID NO:64 is the nucleotide sequence of the sense primer, WOL105, which is upstream of the TS5 target site in the soybean genome.
- SEQ ID NO:65 is the nucleotide sequence of the antisense primer, WOL144, which is downstream of the TS5 target site in thesoybean genome.
- SEQ ID NO:66 is the nucleotide sequence of the sense primer, WOL196, which is further upstream of the TS5 target site beyond the TS5 HR1 fragment in the soybean genome.
- SEQ ID NO:67 is the nucleotide sequence of the antisense primer, WOL197, which is further downstream of the TS5 target site beyond the TS5 HR2 fragment in the soybean genome.
- SEQ ID NO:68 is the nucleotide sequence of the MHP1 target site in the maize genome.
- SEQ ID NO:69 is the nucleotide sequence of the MHP14 target site sequence in the maize genome.
- SEQ ID NO:70 is the nucleotide sequence of the MHP32 target site sequence in the maize genome.
- SEQ ID NO:71 is the nucleotide sequence of the MHP42 target site sequence in the maize genome.
- SEQ ID NO:72 is the nucleotide sequence of the MHP55 target site sequence in the maize genome.
- SEQ ID NO:73 is the nucleotide sequence of the MHP67 target site sequence in the maize genome.
- SEQ ID NO:74 is the nucleotide sequence of the MHP77 target site sequence in the maize genome.
- SEQ ID NO:75 is the nucleotide sequence of the MHP98 target sit sequence in the maize genome.
- SEQ ID NO:76 is the nucleotide sequence of the MHP107 target site sequence in the maize genome.
- SEQ ID NO: 77 is the nucleotide sequence of the MHP1 15 target site sequence in the maize genome.
- SEQ ID NO:78 is the plant-optimized nucleotide sequence of MHP14 comprising a nuclear localization signal and lacking an intron.
- SEQ ID NO:79 is the plant-optimized nucleotide sequence of the MHP14+ comprising a nuclear localization signal and lackingan intron.
- SEQ ID NO:80 is the plant-optimized nucleotide sequence of MHP55 comprising a nuclear localization signal and an intron.
- SEQ ID NO:81 is the plant-optimized nucleotide sequence of MHP55 comprising a nuclear localization signal and lackingan intron.
- SEQ ID NO:82 is the plant-optimized nucleotide sequence of MHP55-2 comprising a nuclear localization signal and lackingan intron.
- SEQ ID NO:83 plant-optimized nucleotide sequence of MHP77 comprising a nuclear localization signal and lackingan intron.
- SEQ ID NO:84 is the HR1 of the MHP14 target site.
- SEQ ID NO:85 is the HR2 of the MHP14 target site.
- SEQ ID NO:86 is the HR1 of the MHP55 target site.
- SEQ ID NO:87 is the HR2 of the MHP55 target site.
- SEQ ID NO:88 is the HR1 of the MHP77 target site.
- SEQ ID NO:89 is the HR2 of the MHP77 target site.
- SEQ ID NO 90 is the HR1 of the MHP1 target site.
- SEQ ID NO 91 is the HR2 of the MHP1 target site.
- SEQ ID NO 92 is the HR1 of the MHP32 target site.
- SEQ ID NO 93 is the HR2 of the MHP32 target site.
- SEQ ID NO 94 is the HR1 of the MHP42 target site.
- SEQ ID NO 95 is the HR2 of the MHP42 target site.
- SEQ ID NO 96 is the HR1 of the MHP67 target site.
- SEQ ID NO 97 is the HR2 of the MHP67 target site.
- SEQ ID NO 98 is the HR1 of the MHP98 target site.
- SEQ ID NO 99 is the HR2 of the MHP98 target site.
- SEQ ID NO 100 is the HR1 of the MHP107 target site.
- SEQ ID NO 101 is the HR2 of the MHP107 target site.
- SEQ ID NO 102 is the HR1 of the MHP1 15 target site.
- SEQ ID NO 103 is the HR2 of the MHP1 15 target site.
- SEQ ID NO 104 is the nucleotide sequence of the plasmid
- SEQ ID NO:105 is the nucleotide sequence of the plasmid PHP44779 (MHP14+ and donor DNA).
- SEQ ID NO:106 is the nucleotide sequence of the MHP14TS probe.
- SEQ ID NO:107 is the nucleotide sequence of the
- SEQ ID NO:108 is the nucleotide sequence of the
- SEQ ID NO:109 is the nucleotide sequence of the primer 146775 on genomic HR1 side.
- SEQ ID NO:1 10 is the nucleotide sequence of the primer 146773 on vector HR1 side.
- SEQ ID NO:1 1 1 is the nucleotide sequence of the primer 146772 on genomic HR2 side.
- SEQ ID NO:1 12 is the nucleotide sequence of the primer 146778 on vector HR2 side.
- SEQ ID NO:1 13 is the nucleotide sequence of the primer mopatF2.
- SEQ ID NO:1 14 is the nucleotide sequence of the primer mopatR2.
- SEQ ID NO:1 15 is the nucleotide sequence of the MHP55TS probe sequence.
- SEQ ID NO:1 16 is the nucleotide sequence of the
- SEQ ID NO:1 17 is the nucleotide sequence of the
- SEQ ID NO:1 18 is the nucleotide sequence of the MHP77TS probe.
- SEQ ID NO:1 19 is the nucleotide sequence of the
- SEQ ID NO:120 is the nucleotide sequence of the
- a “complex transgenic trait locus” is a chromosomal segment within a genomic region of interest that comprises at least two altered target sequences that are genetically linked to each other and can also comprise one or more polynucleotides of interest as described hereinbelow.
- Each of the altered target sequences in the complex transgenic trait locus originates from a corresponding target sequence that was altered, for example, by a mechanism involving a double-strand break within the target sequence that was induced by a double-strand break-inducing agent of the invention.
- the altered target sequences comprise a transgene.
- genomic region of interest is a segment of a chromosome in the genome of a plant that is desirable for producing a complex transgenic trait locus or the segment of a chromosome comprising a complex transgenic trait locus that was produced by the methods of the invention.
- the genomic region of interest can include, for example, one or more polynucleotides of interest prior to producing a complex transgenic trait locus therein.
- a genomic region of interest of the present invention comprises a segment of chromosome that is 0-15 cM.
- recognition sequence or “recognition site” as used herein refers to a DNA sequence at which a double-strand break is induced in the plant cell genome by a double-strand break inducing agent.
- recognition sequence and “recognition site” are used interchangeably herein.
- target site means "target site”, “target sequence”, “target locus”, “genomic target site”, “genomic target sequence”, and “genomic target locus” as used
- An "artificial target sequence” is a target sequence that has been introduced into the genome of a plant.
- Such an artificial target sequence can be identical in sequence to an endogenous or native target sequence in the genome of a plant but be located in a different position (i.e., a non-endogenous or non- native position) in the genome of a plant.
- endogenous target sequence and “native target sequence” are used interchangeable herein to refer to a target sequence that is
- altered target sequence refers to a target sequence as disclosed herein that comprises at least one alteration of the invention when compared to non-altered target sequence.
- Such "alterations" of the invention include, for example: (i) replacement of at least one nucleotide, (ii) a deletion of at least one nucleotide, (iii) an insertion of at least one nucleotide, or (iv) any combination of (i) - (iii).
- double-strand-break-inducing agent refers to any nuclease which produces a double-strand break in the target sequence. Producing the double-strand break in a target sequence or other DNA can be referred to herein as “cutting” or “cleaving" the target sequence or other DNA.
- the double-strand-break-inducing agent has been engineered (or modified) to cut a specific endogenous target sequence, wherein the endogenous target sequence prior to being cut by the engineered double-strand-break-inducing agent was not a sequence that would have been recognized by a native (non-engineered or non-modified) double-strand-break- inducing agent.
- “physically linked,” “in physical linkage”, and “genetically linked” are used to refer to any two or more genes, transgenes, native genes, mutated genes, alterations, target sites, markers, and the like that are part of the same DNA molecule or chromosome.
- a "polynucleotide of interest" within a genomic region of interest is any coding and/or non-coding portion of the genomic region of interest including, but not limited to, a transgene, a native gene, a mutated gene, and a genetic marker such as, for example, a single nucleotide polymorphism (SNP) marker and a simple sequence repeat (SSR) marker.
- SNP single nucleotide polymorphism
- SSR simple sequence repeat
- ORF Open reading frame
- nucleic acid means a polynucleotide and includes a single or a double-stranded polymer of deoxyribonucleotide or ribonucleotide bases. Nucleic acids may also include fragments and modified nucleotides. Thus, the terms “polynucleotide”, “nucleic acid sequence”, “nucleotide sequence” and “nucleic acid fragment” are used interchangeably to denote a polymer of RNA and/or DNA that is single- or double-stranded, optionally containing synthetic, non-natural, or altered nucleotide bases.
- Nucleotides are referred to by their single letter designation as follows: “A” for adenosine or deoxyadenosine (for RNA or DNA, respectively), “C” for cytosine or deoxycytosine, “G” for guanosine or deoxyguanosine, “U” for uridine, “T” for deoxythymidine, “R” for purines (A or G), “Y” for pyrimidines (C or T), "K” for G or T, “H” for A or C or T, “I” for inosine, and “N” for any nucleotide.
- fragment that is functionally equivalent and “functionally equivalent subfragment” are used interchangeably herein. These terms refer to a portion or subsequence of an isolated nucleic acid fragment in which the ability to alter gene expression or produce a certain phenotype is retained whether or not the fragment or subfragment encodes an active enzyme.
- the fragment or subfragment can be used in the design of chimeric genes to produce the desired phenotype in a transformed plant. Chimeric genes can be designed for use in suppression by linking a nucleic acid fragment or subfragment thereof, whether or not it encodes an active enzyme, in the sense or antisense
- conserved domain or "motif means a set of amino acids conserved at specific positions along an aligned sequence of evolutionarily related proteins. While amino acids at other positions can vary between homologous proteins, amino acids that are highly conserved at specific positions indicate amino acids that are essential to the structure, the stability, or the activity of a protein. Because they are identified by their high degree of conservation in aligned sequences of a family of protein homologues, they can be used as identifiers, or "signatures", to determine if a protein with a newly determined sequence belongs to a previously identified protein family.
- polypeptide and nucleic acid sequences, variants thereof, and the structural relationships of these sequences can be described by the terms “homology”, “homologous”, “substantially identical”, “substantially similar” and “corresponding substantially” which are used interchangeably herein. These refer to polypeptide or nucleic acid fragments wherein changes in one or more amino acids or nucleotide bases do not affect the function of the molecule, such as the ability to mediate gene expression or to produce a certain phenotype. These terms also refer to modification(s) of nucleic acid fragments that do not substantially alter the functional properties of the resulting nucleic acid fragment relative to the initial, unmodified fragment. These modifications include deletion, substitution, and/or insertion of one or more nucleotides in the nucleic acid fragment.
- Substantially similar nucleic acid sequences encompassed may be defined by their ability to hybridize (under moderately stringent conditions, e.g., 0.5X SSC, 0.1 % SDS, 60°C) with the sequences exemplified herein, or to any portion of the nucleotide sequences disclosed herein and which are functionally equivalent to any of the nucleic acid sequences disclosed herein.
- Stringency conditions can be adjusted to screen for moderately similar fragments, such as homologous sequences from distantly related organisms, to highly similar fragments, such as genes that duplicate functional enzymes from closely related organisms. Post-hybridization washes determine stringency conditions.
- selective hybridizes includes reference to hybridization, under stringent hybridization conditions, of a nucleic acid sequence to a specified nucleic acid target sequence to a detectably greater degree (e.g., at least 2-fold over background) than its hybridization to non-target nucleic acid sequences and to the substantial exclusion of non-target nucleic acids.
- Selectively hybridizing sequences typically have about at least 80% sequence identity, or 90% sequence identity, up to and including 100% sequence identity (i.e., fully complementary) with each other.
- stringent conditions or “stringent hybridization conditions” includes reference to conditions under which a probe will selectively hybridize to its target sequence in an in vitro hybridization assay. Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences can be identified which are 100% complementary to the probe (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing). Generally, a probe is less than about 1000 nucleotides in length, optionally less than 500 nucleotides in length.
- stringent conditions will be those in which the salt concentration is less than about 1 .5 M Na ion, typically about 0.01 to 1 .0 M Na ion
- Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
- Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCI, 1 % SDS at 37°C, and a wash in 0.5X to 1 X SSC at 55 to 60°C.
- Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCI, 1 % SDS at 37°C, and a wash in 0.1 X SSC at 60 to 65°C. Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution.
- the T m is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. T m is reduced by about 1 °C for each 1 % of
- T m hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with 90% identity are sought, the T m can be decreased 10°C.
- stringent conditions are selected to be about 5°C lower than the thermal melting point (T m ) for the specific sequence and its complement at a defined ionic strength and pH.
- severely stringent conditions can utilize a hybridization and/or wash at 1 , 2, 3 or 4°C lower than the thermal melting point (T m );
- moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9 or 10°C lower than the thermal melting point (T m ); low stringency conditions can utilize a
- hybridization and/or wash at 1 1 , 12, 13, 14, 15 or 20°C lower than the thermal melting point (T m ).
- T m the thermal melting point
- Hybridization and/or wash conditions can be applied for at least 10, 30, 60, 90, 120 or 240 minutes.
- sequence identity or “identity” in the context of nucleic acid or polypeptide sequences refers to the nucleic acid bases or amino acid residues in two sequences that are the same when aligned for maximum correspondence over a specified comparison window.
- percentage of sequence identity refers to the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the results by 100 to yield the percentage of sequence identity.
- percent sequence identities include, but are not limited to, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95%, or any integer percentage from 50% to 100%. These identities can be determined using any of the programs described herein.
- Sequence alignments and percent identity or similarity calculations may be determined using a variety of comparison methods designed to detect homologous sequences including, but not limited to, the MegAlignTM program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wl).
- sequence analysis software is used for analysis, that the results of the analysis will be based on the "default values" of the program referenced, unless otherwise specified.
- default values will mean any set of values or parameters that originally load with the software when first initialized.
- Clustal V method of alignment corresponds to the alignment method labeled Clustal V (described by Higgins and Sharp, (1989) CABIOS 5:151 -153; Higgins et ai, (1992) Comput Appl Biosci 8:189-191 ) and found in the
- sequence identity/similarity values provided herein refer to the value obtained using GAP Version 10 (GCG, Accelrys, San Diego, CA) using the following parameters: % identity and % similarity for a nucleotide sequence using a gap creation penalty weight of 50 and a gap length extension penalty weight of 3, and the nwsgapdna.cmp scoring matrix; % identity and % similarity for an amino acid sequence using a GAP creation penalty weight of 8 and a gap length extension penalty of 2, and the BLOSUM62 scoring matrix (Henikoff and Henikoff, (1989) Proc. Natl. Acad. Sci. USA 89:10915).
- GAP uses the algorithm of Needleman and Wunsch, (1970) J Mol Biol 48:443- 53, to find an alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps. GAP considers all possible alignments and gap positions and creates the alignment with the largest number of matched bases and the fewest gaps, using a gap creation penalty and a gap extension penalty in units of matched bases.
- BLAST is a searching algorithm provided by the National Center for Biotechnology Information (NCBI) used to find regions of similarity between biological sequences. The program compares nucleotide or protein sequences to sequence databases and calculates the statistical significance of matches to identify sequences having sufficient similarity to a query sequence such that the similarity would not be predicted to have occurred randomly. BLAST reports the identified sequences and their local alignment to the query sequence.
- sequence identity is useful in identifying polypeptides from other species or modified naturally or synthetically wherein such polypeptides have the same or similar function or activity.
- Useful examples of percent identities include, but are not limited to, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95%, or any integer percentage from 50% to 100%.
- any integer amino acid identity from 50% to 100% may be useful in describing the present invention, such as 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.
- Gene refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences preceding (5' non-coding sequences) and following (3' non-coding sequences) the coding sequence.
- “Native gene” refers to a gene as found in nature with its own regulatory sequences.
- “Chimeric gene” refers to any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature, or at a different genetic locus than that found in nature.
- a “foreign” gene refers to a gene not normally found in the host organism, but that is introduced into the host organism by gene transfer. Foreign genes can comprise native genes inserted into a non-native organism, or chimeric genes.
- a “mutated gene” is a native gene that has been altered through human intervention. Such a “mutated gene” has a sequence that differs from the sequence of the corresponding native gene by at least one nucleotide addition, deletion, or substitution. In certain embodiments of the invention, the mutated gene comprises an alteration that results from a double-strand-break-inducing agent as disclosed herein.
- transgene is a gene that has been introduced into the genome by a transformation procedure.
- a transgene can, for example encode one or more proteins or RNA that is not translated into protein.
- a transgene of the invention need not encode a protein and/or non-translated RNA.
- the transgene comprises one or more chimeric genes, including chimeric genes comprising, for example, a gene of interest, phenotypic marker, a selectable marker, and a DNA for gene silencing.
- a "targeted mutation” is mutation in a native gene that was made by altering a target sequence within the native gene using a method involving a double-strand-break-inducing agent that is capable of inducing a double-strand break in the DNA of the target sequence as disclosed herein or known in the art.
- gene as it applies to a plant cells encompasses not only chromosomal DNA found within the nucleus, but organelle DNA found within subcellular components (e.g., mitochondria, or plastid) of the cell.
- a "codon-modified gene” or “codon-preferred gene” or “codon-optimized gene” is a gene having its frequency of codon usage designed to mimic the frequency of preferred codon usage of the host cell.
- an "allele” is one of several alternative forms of a gene occupying a given locus on a chromosome. When all the alleles present at a given locus on a chromosome are the same, that plant is homozygous at that locus. If the alleles present at a given locus on a chromosome differ, that plant is heterozygous at that locus.
- Coding sequence refers to a polynucleotide sequence which codes for a specific amino acid sequence.
- regulatory sequences refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include, but are not limited to: promoters, translation leader sequences, 5' untranslated sequences, 3' untranslated sequences, introns, polyadenylation recognition sequences, RNA processing sites, effector binding sites, and stem-loop structures.
- a plant-optimized nucleotide sequence is nucleotide sequence that has been optimized for increased expression in plants, particularly for increased expression in plants or in one or more plants of interest.
- a plant- optimized nucleotide sequence can be synthesized by modifying a nucleotide sequence encoding a protein such as, for example, double-strand-break- inducing agent ⁇ e.g., an endonuclease) as disclosed herein, using one or more plant-preferred codons for improved expression.
- a protein such as, for example, double-strand-break- inducing agent ⁇ e.g., an endonuclease
- plant-preferred codons for improved expression.
- Methods are available in the art for synthesizing plant-preferred genes. See, for example, U.S. Patent Nos. 5,380,831 , and 5,436,391 , and Murray et al. (1989) Nucleic Acids Res. 17:477-498, herein
- Additional sequence modifications are known to enhance gene expression in a plant host. These include, for example, elimination of: one or more sequences encoding spurious polyadenylation signals, one or more exon-intron splice site signals, one or more transposon-like repeats, and other such well-characterized sequences that may be deleterious to gene expression.
- the G-C content of the sequence may be adjusted to levels average for a given plant host, as calculated by reference to known genes expressed in the host plant cell.
- the sequence is modified to avoid one or more predicted hairpin secondary mRNA structures.
- "a plant-optimized nucleotide sequence" of the present invention comprises one or more of such sequence modifications.
- Promoter refers to a DNA sequence capable of controlling the
- the promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers.
- An "enhancer” is a DNA sequence that can stimulate promoter activity, and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specificity of a promoter. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, and/or comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions.
- Translation leader sequence refers to a polynucleotide sequence located between the promoter sequence of a gene and the coding sequence.
- the translation leader sequence is present in the fully processed mRNA upstream of the translation start sequence.
- the translation leader sequence may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency. Examples of translation leader sequences have been described (e.g., Turner and Foster, (1995) Mol Biotechnol 3:225-236).
- 3' non-coding sequences refer to DNA sequences located downstream of a coding sequence and include polyadenylation recognition sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression.
- the polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3' end of the mRNA precursor.
- the use of different 3' non-coding sequences is exemplified by Ingelbrecht et al., (1989) Plant Cell 1 :671 -680.
- RNA transcript refers to the product resulting from RNA polymerase- catalyzed transcription of a DNA sequence. When the RNA transcript is a perfect complementary copy of the DNA sequence, it is referred to as the primary transcript. A RNA transcript is referred to as the mature RNA when it is a RNA sequence derived from post-transcriptional processing of the primary transcript. "Messenger RNA” or “mRNA” refers to the RNA that is without introns and that can be translated into protein by the cell. "cDNA” refers to a DNA that is complementary to, and synthesized from, a mRNA template using the enzyme reverse transcriptase.
- RNA transcript that includes the mRNA and can be translated into protein within a cell or in vitro.
- Antisense RNA refers to an RNA transcript that is complementary to all or part of a target primary transcript or mRNA, and that blocks the expression of a target gene (see, e.g., U.S. Patent No. 5,107,065). The complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e., at the 5' non-coding sequence, 3' non-coding sequence, introns, or the coding sequence.
- RNA refers to antisense RNA, ribozyme RNA, or other RNA that may not be translated but yet has an effect on cellular processes.
- complement and “reverse complement” are used interchangeably herein with respect to mRNA transcripts, and are meant to define the antisense RNA of the message.
- operably linked refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is regulated by the other.
- a promoter is operably linked with a coding sequence when it is capable of regulating the expression of that coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter).
- Coding sequences can be operably linked to regulatory sequences in a sense or antisense orientation.
- the complementary RNA regions can be operably linked, either directly or indirectly, 5' to the target mRNA, or 3' to the target mRNA, or within the target mRNA, or a first
- PCR or “polymerase chain reaction” is a technique for the synthesis of specific DNA segments and consists of a series of repetitive denaturation, annealing, and extension cycles. Typically, a double-stranded DNA is heat denatured, and two primers complementary to the 3' boundaries of the target segment are annealed to the DNA at low temperature, and then extended at an intermediate temperature. One set of these three consecutive steps is referred to as a "cycle".
- chromosomal element often carrying genes that are not part of the central metabolism of the cell, and usually in the form of double-stranded DNA.
- Such elements may be autonomously replicating sequences, genome integrating sequences, phage, or nucleotide sequences, in linear or circular form, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a polynucleotide of interest into a cell.
- Transformation cassette refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that facilitates transformation of a particular host cell.
- Expression cassette refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that allow for expression of that gene in a foreign host.
- a recombinant construct comprises an artificial combination of nucleic acid fragments, e.g., regulatory and coding sequences that are not all found together in nature.
- a chimeric construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature.
- Such a construct may be used by itself or may be used in conjunction with a vector.
- a vector is used, then the choice of vector is dependent upon the method that will be used to transform host cells as is well known to those skilled in the art.
- a plasmid vector can be used.
- the skilled artisan is well aware of the genetic elements that must be present on the vector in order to successfully transform, select and propagate host cells.
- the skilled artisan will also recognize that different independent transformation events may result in different levels and patterns of expression (Jones et ai, (1985) EMBO J 4:241 1 -2418; De Almeida et al., (1989) Mol Gen Genetics 218:78-86), and thus that multiple events are typically screened in order to obtain lines displaying the desired expression level and pattern.
- Such screening may be accomplished standard molecular biological, biochemical, and other assays including Southern analysis of DNA, Northern analysis of mRNA expression, PCR, real time quantitative PCR (qPCR), reverse transcription PCR (RT-PCR), immunoblotting analysis of protein expression, enzyme or activity assays, and/or phenotypic analysis.
- Southern analysis of DNA Northern analysis of mRNA expression, PCR, real time quantitative PCR (qPCR), reverse transcription PCR (RT-PCR), immunoblotting analysis of protein expression, enzyme or activity assays, and/or phenotypic analysis.
- expression refers to the production of a functional end-product (e.g., an mRNA or a protein) in either precursor or mature form.
- a functional end-product e.g., an mRNA or a protein
- introduced means providing a nucleic acid (e.g., expression construct) or protein into a cell. Introduced includes reference to the
- nucleic acid incorporation of a nucleic acid into a eukaryotic or prokaryotic cell where the nucleic acid may be incorporated into the genome of the cell, and includes reference to the transient provision of a nucleic acid or protein to the cell.
- nucleic acid fragment e.g., a recombinant DNA construct/expression construct
- introduction means “transfection” or “transformation” or “transduction” and includes reference to the incorporation of a nucleic acid fragment into a eukaryotic or prokaryotic cell where the nucleic acid fragment may be incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid, or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).
- “Mature” protein refers to a post-translationally processed polypeptide (i.e., one from which any pre- or propeptides present in the primary translation product have been removed).
- "Precursor” protein refers to the primary product of translation of mRNA (i.e., with pre- and propeptides still present). Pre- and propeptides may be but are not limited to intracellular localization signals.
- “Stable transformation” refers to the transfer of a nucleic acid fragment into a genome of a host organism, including both nuclear and organellar genomes, resulting in genetically stable inheritance.
- “transient transformation” refers to the transfer of a nucleic acid fragment into the nucleus, or other DNA-containing organelle, of a host organism resulting in gene expression without integration or stable inheritance.
- Host organisms containing the transformed nucleic acid fragments are referred to as “transgenic” organisms.
- “transgenic” refers to a plant or a cell which comprises within its genome a heterologous polynucleotide. Typically, the heterologous polynucleotide is stably integrated within the genome such that the
- heterologous polynucleotide is passed on to successive generations.
- the heterologous polynucleotide may be integrated into the genome alone or as part of an expression construct.
- Transgenic is used herein to include any cell, cell line, callus, tissue, plant part or plant, the genotype of which has been altered by the presence of heterologous nucleic acid including those transgenics initially so altered as well as those created by sexual crosses or asexual propagation from the initial transgenic.
- the term "transgenic” as used herein does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by
- Plant refers to whole plants, plant organs, plant tissues, seeds, plant cells, seeds and progeny of the same.
- Plant cells include, without limitation, cells from seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen and microspores.
- Plant parts include differentiated and undifferentiated tissues including, but not limited to roots, stems, shoots, leaves, pollens, seeds, tumor tissue and various forms of cells and culture (e.g., single cells, protoplasts, embryos, and callus tissue).
- the plant tissue may be in plant or in a plant organ, tissue or cell culture.
- plant organ refers to plant tissue or a group of tissues that constitute a morphologically and functionally distinct part of a plant.
- gene refers to the entire complement of genetic material (genes and non-coding sequences) that is present in each cell of an organism, or virus or organelle; and/or a complete set of chromosomes inherited as a (haploid) unit from one parent. "Progeny” comprises any subsequent generation of a plant.
- a "fertile plant” is a plant that is capable of producing a progeny plant.
- a fertile plant is a plant that produces viable male and female gametes and is self fertile. Such a self-fertile plant can produce a progeny plant without the contribution from any other plant of a gamete and the genetic material contained therein.
- Other embodiments of the invention can involve the use of a plant that is not self fertile because the plant does not produce male or female gametes that are viable or otherwise capable of fertilization.
- a "male sterile plant” is a plant that does not produce male gametes that are viable or otherwise capable of fertilization.
- a "female sterile plant” is a plant that does not produce female gametes that are viable or otherwise capable of fertilization. It is recognized that male and female sterile plants can be female and mail fertile, respectively. It is further recognized that a male fertile (but female sterile) plant can produce viable progeny when crossed with a female fertile plant and that a female fertile (but male sterile) plant can produce viable progeny when crossed with a male fertile plant.
- centimorgan or “map unit” is the distance between two linked genes, markers, target sites, loci, or any pair thereof, wherein 1 % of the products of meiosis are recombinant.
- a centimorgan is equivalent to a distance equal to an 1 % average recombination frequency between the two linked genes, markers, target sites, loci, or any pair thereof.
- the present invention finds use in the breeding of plants comprising two to more transgenic traits.
- transgenic traits are randomly inserted throughout the plant genome as a consequence of transformation systems based on Agrobacterium, biolistics, or other commonly used procedures.
- gene targeting protocols have been developed that enable directed transgene insertion.
- site-specific integration SSI
- Custom-designed meganucleases and custom- designed zinc finger meganucleases allow researchers to design nucleases to target specific chromosomal locations, and these reagents allow the targeting of transgenes at the chromosomal site cleaved by these nucleases.
- nuclease-mediated gene targeting can be used in methods for producing complex transgenic trait loci comprising multiple transgenes.
- a complex transgenic trait locus is a locus that has multiple transgenes genetically linked to each other. By inserting independent transgenes within 1 , 2 or even 5 centimorgans (cM) from each other, the transgenes can be bred as single genetic locus.
- Figure 7 depicts the process of how two traits could be integrated into the genome at a genetic distance of, for example, 0.2 cM from each other in independent transformation runs or in sequential transformations ⁇ e.g., transformation and re- transformation).
- plants containing the two events can be crossed to form an F1 that contains the events on different chromosomes.
- progeny from these F1 F2 or BC1
- progeny would have the two different transgenes recombined onto the same chromosome.
- the complex locus could then be bred as single genetic locus with both transgene traits. This process could be repeated to stack as many traits as desired.
- the present invention provides methods for producing complex transgenic trait loci at selected genomic regions to simplify breeding with multiple
- transgenes To initiate the development of a complex transgenic trait locus, a region of the genome is first selected. Second, the sequence of nearby genomic regions is compiled and nuclease reagents designed to facilitate targeting additional transgenes to those closely linked sites. Subsequently, algorithms for nuclease design such as, for example, those described in U.S. Patent
- the present invention provides methods for producing in a plant a complex transgenic trait locus comprising at least two altered target sequences in a genomic region of interest.
- the methods involve selecting a genomic region in a plant that comprises a first target sequence and a second target sequence.
- the first target sequence and the second target sequence are separated from each other by about 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8. , 0.9, 1 , 2, 3, 4, or 5 centimorgans (cM) in the genome of the plant.
- the first and second target sequences are physically linked to a polynucleotide of interest such as, for example, a transgene, native gene, or a gene with a targeted mutation, that is within about 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8. , 0.9, 1 , 2, 3, 4, 5,6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 cM of the first and/or the second target sequence.
- a polynucleotide of interest such as, for example, a transgene, native gene, or a gene with a targeted mutation, that is within about 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8. , 0.9, 1 , 2, 3, 4, 5,6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 cM of the first and/or the second target sequence.
- the methods of the invention further involve providing a first double- strand-break-inducing agent and a second double-strand-break-inducing agent.
- the first double-strand-break-inducing agent is capable of inducing a first double-strand break in DNA comprising the first target sequence
- the second double-strand-break-inducing agent is capable of inducing a second double-strand break in DNA comprising the second target sequence.
- the methods of the invention do not depend on a particular double-strand-break- inducing agent but only that the double-strand-break-inducing agent is capable of inducing a double-strand break in DNA in a target sequence of the invention. Any such double-strand-break-inducing agent that is disclosed herein or known in the art can be used in the methods of the present invention.
- the methods involve contacting at least one plant cell with the first double-strand-break-inducing agent, identifying a cell comprising a first alteration at the first target sequence, and then recovering a first fertile plant from the cell comprising the first alteration.
- the first fertile plant also comprises the first alteration.
- the method involves contacting at least one plant cell with the second double-strand-break-inducing agent, identifying a cell comprising a second alteration at the second target sequence, and then recovering a second fertile plant from the cell comprising the second alteration.
- the method further involves obtaining a fertile progeny plant from the second fertile plant, wherein the fertile progeny plant comprises both the first and second alterations in physical linkage.
- the fertile progeny plant is obtained by crossing the first fertile plant and the second fertile plant and selecting for a fertile progeny plant comprising both the first and second alterations in physical linkage.
- a cell of the first fertile plant, or progeny thereof comprising the first alteration is contacted with the second double-strand-break- inducing agent, and the second fertile plant comprises both the first and second alterations, which may or may not be physically linked.
- the second fertile plant can be selfed and a fertile progeny plant selected comprising both the first and second alterations in physical linkage.
- the first and second alterations are selected from the group consisting of (i) replacement of at least one nucleotide, (ii) a deletion of at least one
- the first and/or the second alterations comprise insertion of a DNA sequence of interest including, but not limited to, a DNA for gene silencing, a DNA encoding a phenotypic marker, and a DNA encoding a protein providing an agronomic advantage.
- the first and/or the second alterations comprise a targeted mutation in a native gene.
- the methods disclosed herein can be used to produce in a plant a complex transgenic trait locus comprising 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or more altered target sequences in physical linkage in a genomic region of interest comprising 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or more target sequences of interest.
- Each additional target sequence of interest in the genomic region of interest can be recognized and cleaved by a double-strand-break-inducing agent essentially as described above.
- a third DNA sequence of interest is inserted into a third target sequence by contacting at least one cell of a plant with a third double- strand-break-inducing agent and a third DNA molecule comprising the DNA sequence of interest, and then identifying a cell comprising the DNA sequence of interest.
- the method can further comprising recovering a fertile plant comprising the third DNA sequence of interest.
- the cell comprising the third DNA sequence of interest comprises the first alteration, the second alteration, or both the first alteration and the second alteration.
- the method of the invention can further comprising producing a fertile plant comprising the first alteration, the second alteration, and the third DNA sequence of interest in physical linkage.
- the fertile plant comprising the first alteration, the second alteration, and the third DNA sequence of interest is produced by crossing the fertile plant comprising the first and second alterations with a second fertile plant comprising the third DNA sequence of interest, and selecting a fertile progeny plant from the crossing, wherein the fertile progeny plant comprises the first alteration, the second alteration, and the third DNA sequence of interest in physical linkage.
- the fertile plant comprising the first alteration, the second alteration, and the third DNA sequence of interest can be produced, for example, by: (/ ' ) contacting a cell comprising the first alteration and the second alteration with the third double-strand-break-inducing agent; (/7)identifying a cell from (/ ' ) comprising the third DNA sequence of interest, wherein the cell comprises the first alteration and the second alteration, and wherein the first alteration, the second alteration, and the third DNA sequence of interest are physically linked; and (// ' / ' ) recovering a fertile plant comprising in physical linkage the first alteration, the second alteration, and the third DNA sequence of interest.
- the methods for producing in a plant a complex transgenic trait locus comprising at least two altered target sequences in a genomic region of interest that involve obtaining a first fertile plant comprising a first altered target site at the genomic region of interest and a second fertile plant comprising a second altered target site at the genomic region of interest.
- the first altered target sequence originated from a first target sequence that is recognized and cleaved by a first double-strand-break- inducing agent
- the second altered target sequence originated from a second target sequence that is recognized and cleaved by a second double- strand-break-inducing agent.
- the second method further involves crossing the first fertile plant and the second fertile plant, and then selecting from the crossing a fertile progeny plant comprising the first alteration and the second alteration in physical linkage.
- the second method can optionally involve crossing the fertile progeny plant with an additional fertile plant that comprises at least a third altered target sequence in the genomic region of interest and then selecting from the crossing a fertile progeny plant comprising the first alteration, the second and the at least third alteration in physical linkage.
- the third altered target sequence originated from a third target sequence that is recognized and cleaved by a third double-strand-break-inducing agent.
- a complex transgenic trait locus can be produced comprising 4, 5, 6, 7, 8, 9, 10, or more altered target sequences in physical linkage in the genomic region of interest.
- the present invention provides complex transgenic trait loci in plants as well as plants, plant parts, plant cells, and seeds comprising at least one complex transgenic trait locus of the invention.
- a complex transgenic trait locus of the invention comprises at least two altered target sequences that are genetically linked to a polynucleotide of interest. Such altered target sequences originated from a corresponding target sequence that is recognized and cleaved by a double-strand-break-inducing agent using, for example, the methods disclosed herein.
- the altered target sequences comprise an alteration such as, for example, replacement of at least one nucleotide in the target sequence, a deletion of at least one nucleotide in the target sequence, an insertion of at least one nucleotide in the target sequence, or any combination thereof.
- the polynucleotide interest can be, for example, a transgene, a native gene, and a mutated gene.
- the present invention provides plants, plant parts, plant cells, and seeds comprising at least one complex transgenic trait locus of the invention.
- a complex transgenic trait locus of the invention comprises at least one altered target sequence comprising a recombinant DNA molecule.
- Recombinant DNA molecules of the invention include, but are not limited to, a DNA for gene silencing, a DNA encoding a phenotypic marker, and a DNA encoding a protein providing an agronomic advantage.
- each of the altered target sites of the complex transgenic trait locus are located within about 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8. , 0.9, 1 , 2, 3, 4, 5,6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 centimorgan (cM) of the polynucleotide of interest.
- a double-strand break inducing agent of the present invention is any agent that recognizes and/or binds to a specific polynucleotide recognition sequence to produce a break in the target sequence at or near the recognition sequence.
- double-strand break inducing agents include, but are not limited to, endonucleases, TAL effector nucleases, and zinc finger nucleases, and include modified derivatives, variants, and fragments thereof.
- a recognition sequence is any polynucleotide sequence that is specifically recognized and/or bound by a double-strand break inducing agent.
- the length of the recognition site sequence can vary, and includes, for example, sequences that are at least 4, 6, 8, 10, 12, 14, 16, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70 or more nucleotides in length.
- the recognition site could be palindromic, that is, the sequence on one strand reads the same in the opposite direction on the complementary strand.
- the nick/cleavage site could be within the recognition sequence or the nick/cleavage site could be outside of the recognition sequence.
- the cleavage could occur at nucleotide positions
- the recognition sequence can be endogenous or exogenous. When the recognition site is an endogenous sequence, it may be a recognition sequence recognized by a naturally-occurring, or native double-strand break inducing agent.
- an endogenous recognition site could be recognized and/or bound by a modified or engineered double-strand break inducing agent designed or selected to specifically recognize the endogenous recognition sequence to produce a double-strand break.
- a modified double-strand break inducing agent can be derived from a native, naturally-occurring double-strand break inducing agent or it could be artificially created or synthesized.
- a variety of methods are available to identify those cells having an altered genome at or near the recognition sequence without using a screenable marker phenotype. Such methods can be viewed as directly analyzing a recognition sequence to detect any change in the recognition sequence, including but not limited to PCR methods, sequencing methods, nuclease digestion, Southern blots, and any combination thereof.
- Proteins may be altered in various ways including amino acid
- amino acid sequence variants of the protein(s) can be prepared by mutations in the DNA.
- Methods for mutagenesis and nucleotide sequence alterations include, for example, Kunkel, (1985) Proc. Natl. Acad. Sci. USA 82:488-92; Kunkel et al., (1987) Meth
- substitutions such as exchanging one amino acid with another having similar properties, may be preferable.
- Conservative deletions, insertions, and amino acid substitutions are not expected to produce radical changes in the
- Assays for double-strand-break-inducing activity are known and generally measure the overall activity and specificity of the agent on DNA substrates containing recognition sites.
- Endonudeases are enzymes that cleave the phosphodiester bond within a polynucleotide chain, and include restriction endonudeases that cleave DNA as specific sites without damaging the bases. Restriction endonudeases include Type I, Type II, Type III, and Type IV endonudeases, which further include subtypes. In the Type I and Type III systems, both the methylase and restriction activities are contained in a single complex.
- Type I and Type III restriction endonudeases recognize specific recognition sites, but typically cleave at a variable position from the recognition site, which can be hundreds of base pairs away from the recognition site.
- the restriction activity is independent of any methylase activity, and cleavage typically occurs at specific sites within or near to the recognition site.
- Most Type II enzymes cut palindromic sequences, however Type I la enzymes recognize non-palindromic recognition sites and cleave outside of the recognition site, Type Mb enzymes cut sequences twice with both sites outside of the recognition site, and Type Ms enzymes recognize an asymmetric recognition site and cleave on one side and at a defined distance of about 1 -20 nucleotides from the recognition site.
- Type IV restriction enzymes target methylated DNA. Restriction enzymes are further described and classified, for example in the REBASE database (webpage at rebase.neb.com; Roberts et al., (2003) Nucleic Acids Res 31 :418- 20), Roberts et al., (2003) Nucleic Acids Res 31 :1805-12, and Belfort et al., (2002) in Mobile DNA II, pp. 761 -783, Eds. Craigie et al., (ASM Press,
- Endonudeases also indude meganudeases, also known as homing endonudeases (HEases), which like restriction endonudeases, bind and cut at a specific recognition sequence, however the recognition sites for meganudeases are typically longer, about 18 bp or more.
- Meganudeases have been classified into four families based on conserved sequence motifs, the families are the LAGLIDADG, GIY-YIG, H-N-H, and His-Cys box families. These motifs participate in the coordination of metal ions and hydrolysis of phosphodiester bonds.
- HEases are notable for their long recognition sites, and for tolerating some sequence polymorphisms in their DNA substrates. The naming
- meganuclease is similar to the convention for other restriction endonuclease.
- Meganudeases are also characterized by prefix F-, I-, or PI- for enzymes encoded by free-standing ORFs, introns, and inteins, respectively.
- F-, I-, or PI- enzymes encoded by free-standing ORFs, introns, and inteins, respectively.
- intron-, intein-, and freestanding gene encoded meganuclease from Saccharomyces cerevisiae are denoted l-Scel, Pl-Scel, and F-Scell,
- Any meganuclease can be used as a double-strand break inducing agent including, but not limited to, l-Scel, l-Scell, l-Scelll, l-ScelV, l-SceV, l-SceVI, I- SceVII, l-Ceul, 1-CeuAIIP, l-Crel, 1-CrepsblP, 1-CrepsbllP, 1-CrepsblllP, I- CrepsblVP, l-Tlil, l-Ppol, Pl-Pspl, F-Scel, F-Scell, F-Suvl, F-Tevl, F-Tevll, I- Amal, l-Anil, l-Chul, l-Cmoel, l-Cpal, l-Cpall, l-Csml, l-Cvul, 1-CvuAIP, l-Ddil, I
- the endonuclease can be a modified endonuclease that binds a non- native or exogenous recognition sequence and does not bind a native or endogenous recognition sequence. Modification of the endonuclease can be as little as one nucleotide. A modified endonuclease is not capable of making a double-strand break within a wild-type target sequence. A wild-type (i.e., prior to being modified) endonuclease is capable of making a double-strand break within the wild-type target sequence.
- the endonuclease can be provided via a polynucleotide encoding the endonuclease.
- a polynucleotide encoding an endonuclease can be modified to substitute codons having a higher frequency of usage in a plant, as compared to the naturally occurring polynucleotide sequence.
- the polynucleotide encoding the endonuclease can be modified to substitute codons having a higher frequency of usage in a maize or soybean plant, as compared to the naturally occurring polynucleotide sequence.
- a site-specific recombinase also referred to as a recombinase, is a polypeptide that catalyzes conservative site-specific recombination between its compatible recombination sites, and includes native polypeptides as well as derivatives, variants and/or fragments that retain activity, and native
- One step in the recombination process involves polynucleotide cleavage at or near the recognition site. This cleaving activity can be used to produce a double-strand break.
- This cleaving activity can be used to produce a double-strand break.
- the Integrase family of recombinases has over one hundred members and includes, for example, FLP, Cre, lambda integrase, and R.
- the Integrase family has been grouped into two classes based on the structure of the active sites, serine recombinases and tyrosine recombinases.
- the tyrosine family which includes Cre, FLP, SSV1 , and lambda ( ⁇ ) integrase, uses the catalytic tyrosine's hydroxyl group for a nucleophilic attack on the phosphodiester bond of the DNA.
- members of the tyrosine family initially nick the DNA, which later forms a double-strand break.
- recombination systems include, for example, the streptomycete bacteriophage phiC31 (Kuhstoss et al., (1991 ) J Mol Biol 20:897-908); the SSV1 site-specific recombination system from Sulfolobus shibatae (Maskhelishvili et ai, (1993) Mol Gen Genet 237:334-42); and a retroviral integrase-based integration system (Tanaka et al. , (1998) Gene 17:67-76).
- the recombinase is one that does not require cofactors or a supercoiled substrate, including but not limited to Cre, FLP, and active
- FLP recombinase catalyzes a site- specific reaction during DNA replication and amplification of the two-micron plasmid of S. cerevisiae. FLP recombinase catalyzes site-specific recombination between two FRT sites.
- the FLP protein has been cloned and expressed (Cox (1993) Proc. Natl. Acad. Sci. USA 80:4223-7).
- the bacteriophage recombinase Cre catalyzes site-specific recombination between two lox sites (Guo et al., (1997) Nature 389:40-6; Abremski et al., (1984) J Biol Chem 259:1509-14; Chen et al., (1996) Somat Cell Mol Genet 22:477-88; Shaikh et al., (1977) J Biol Chem 272:5695-702; and Buchholz et al.,
- site-specific recombinases that can be used to produce a double-strand break at a recognition sequence, including for example FLP, Cre, SSV1 , lambda Int, phi C31 , HK022, and R.
- the recognition sites range from about 30 nucleotide minimal sites to a few hundred nucleotides.
- Any recognition site for a recombinase can be used, including naturally occurring sites, and variants. Variant recognition sites are known, see for example Hoess et al., (1986) Nucleic Acids Res 14:2287-300; Albert et al., (1995) Plant J 7:649-59; Thomson et al., (2003) Genesis 36:162-7; Huang et al., (1991 ) Nucleic Acids Res 19:443-8; Siebler and Bode, (1997) Biochemistry 36:1740-7; Schlake and Bode, (1994) Biochemistry 33:12746-51 ; Thygarajan et al., (2001 ) Mol Cell Biol 21 :3926-34; Umlauf and Cox, (1988) EMBO J 7:1845- 52; Lee and Saito, (1998) Gene 216:55-65; WO01/23545; WO99/25821 ;
- a recombinase can be provided via a polynucleotide that encodes the recombinase or it can be provided via a modified polynucleotide encoding the recombinase.
- the polynucleotide (encoding a recombinase) can be modified to substitute codons having a higher frequency of usage in a plant, as compared to the naturally occurring polynucleotide sequence or it can be modified to substitute codons having a higher frequency of usage in a maize or soybean plant, as compared to the naturally occurring polynucleotide sequence.
- TAL effector nucleases are a new class of sequence-specific nucleases that can be used to make double-strand breaks at specific target sequenes in the genome of a plant or other organism.
- TAL effector nucleases are created by fusing a native or engineered transcription activator-like (TAL) effector, or functional part thereof, to the catalytic domain of an endonuclease, such as, for example, Fokl.
- TAL effector nucleases are created by fusing a native or engineered transcription activator-like (TAL) effector, or functional part thereof, to the catalytic domain of an endonuclease, such as, for example, Fokl.
- TAL effector DNA binding domain allows for the design of proteins with potentially any given DNA recognition specificity.
- the DNA binding domains of the TAL effector nucleases can be
- Transposases are polypeptides that mediate transposition of a transposon from one location in the genome to another. Transposases typically induce double-strand breaks to excise the transposon, recognize subterminal repeats, and bring together the ends of the excised transposon, in some systems other proteins are also required to bring together the ends during transposition.
- transposons and transposases include, but are not limited to, the Ac/Ds, Dt/rdt, Mu-M1/Mn, and Spm(En)/dSpm elements from maize, the Tarn elements from snapdragon, the Mu transposon from bacteriophage, bacterial transposons (Tn) and insertion sequences (IS), Ty elements of yeast
- the transposase is provided via a polynucleotide that encodes the transposase.
- DNA topoisomerases modulate DNA secondary and higher order structures and functions related primarily to replication, transcription,
- Topoisomerases share two characteristics: (i) the ability to cleave and reseal the phosphodiester backbone of DNA in two successive transesterification reactions; and (ii) once a topoisomerase cleaved DNA intermediate is formed, the enzyme allows the severed DNA ends to come apart, allowing the passage of another single- or double-stranded DNA segment.
- DNA topoisomerases can be classified into three evolutionary independent families: type IA, type IB and type II.
- type I DNA topoisomerases Those that cleave one strand of DNA and allow single step changes in the linking number of circular DNA are defined as type I DNA topoisomerases.
- the prototype of type IB or I-3' enzymes are found in all eukaryotes and also in vaccinia virus topoisomerase I where the protein is attached to a 3' phosphate.
- yeast DNA topoisomerase I can complement a bacterial DNA topoisomerase I mutant (Bjornsti et al., (1987) Proc. Natl. Acad. Sci. USA
- Type IA topoisomerases relax negatively supercoiled DNA and require magnesium and a single-stranded region of DNA.
- the type II family includes E. coli DNA gyrase, E. coli topoisomerase IV (par E), eukaryotic type II topoisomerases, and archaic topoisomerase VI.
- Type II enzymes are homodimeric (eukaryotic topoisomerase II) or tetrameric
- Zinc finger nucleases are engineered double-strand break inducing agents comprised of a zinc finger DNA binding domain and a double- strand-break-inducing agent domain. Recognition site specificity is conferred by the zinc finger domain, which typically comprising two, three, or four zinc fingers, for example having a C2H2 structure, however other zinc finger structures are known and have been engineered. Zinc finger domains are amenable for designing polypeptides which specifically bind a selected polynucleotide recognition sequence. ZFNs consist of an engineered DNA-binding zinc finger domain linked to a non-specific endonuclease domain, for example nuclease domain from a Type Ms endonuclease such as Fokl.
- Additional functionalities can be fused to the zinc-finger binding domain, including transcriptional activator domains, transcription repressor domains, and methylases.
- dimerization of nuclease domain is required for cleavage activity.
- Each zinc finger recognizes three consecutive base pairs in the target DNA.
- a 3 finger domain recognized a sequence of 9 contiguous nucleotides, with a dimerization requirement of the nuclease, two sets of zinc finger triplets are used to bind a 18 nucleotide recognition sequence.
- engineered zinc finger DNA binding domains can be fused to other double-strand break inducing agents or derivatives thereof that retain DNA nicking/cleaving activity.
- this type of fusion can be used to direct the double-strand break inducing agent to a different target site, to alter the location of the nick or cleavage site, to direct the inducing agent to a shorter target site, or to direct the inducing agent to a longer target site.
- a zinc finger DNA binding domain is fused to a site-specific
- recombinase recombinase, transposase, topoisomerase, or a derivative thereof that retains DNA nicking and/or cleaving activity.
- a zinc-finger nuclease via a polynucleotide that encodes the zinc-finger nuclease.
- This polynucleotide encoding the zinc-finger nuclease can be modified by substituting codons having a higher frequency of usage in a plant, as compared to the naturally occurring polynucleotide sequence or by substituting codons having a higher frequency of usage in a maize or soybean plant, as compared to the naturally occurring polynucleotide sequence.
- Sufficient homology or sequence identity indicates that two polynucleotide sequences have sufficient structural similarity to act as substrates for a homologous recombination reaction.
- the structural similarity includes overall length of each polynucleotide fragment, as well as the sequence similarity of the polynucleotides. Sequence similarity can be described by the percent sequence identity over the whole length of the sequences, and/or by conserved regions comprising localized similarities such as contiguous nucleotides having 100% sequence identity, and percent sequence identity over a portion of the length of the sequences.
- the amount of homology or sequence identity shared by a target and a donor polynucleotide can vary and includes total lengths and/or regions having unit integral values in the ranges of about 1 -20 bp, 20-50 bp, 50-100 bp, 75-150 bp, 100-250 bp, 150-300 bp, 200-400 bp, 250-500 bp, 300-600 bp, 350-750 bp, 400-800 bp, 450-900 bp, 500-1000 bp, 600-1250 bp, 700-1500 bp, 800-1750 bp, 900-2000 bp, 1 -2.5 kb, 1 .5-3 kb, 2-4 kb, 2.5-5 kb, 3-6 kb, 3.5-7 kb, 4-8 kb, 5-10 kb, or up to and including the total length of the target site.
- ranges include every integer within the range, for example, the range of 1 -20 bp includes 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19 and 20 bp.
- the amount of homology can also described by percent sequence identity over the full aligned length of the two polynucleotides which includes percent sequence identity of about at least 50%, 55%, 60%, 65%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
- Sufficient homology includes any combination of polynucleotide length, global percent sequence identity, and optionally conserved regions of contiguous nucleotides or local percent sequence identity, for example sufficient homology can be described as a region of 75-150 bp having at least 80% sequence identity to a region of the target locus. Sufficient homology can also be described by the predicted ability of two polynucleotides to specifically hybridize under high stringency conditions, see, for example, Sambrook et al., (1989) Molecular Cloning: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, NY);
- the double-strand-break-inducing agent and the polynucleotide(s) comprising the recognition site(s) can be provided by contacting the components under the appropriate conditions for DNA cleavage.
- nucleotide sequences and polypeptides are known for the introduction of nucleotide sequences and polypeptides into an organism, including, for example, transformation, sexual crossing, and the introduction of the polypeptide, DNA, or mRNA into the cell.
- Stable transformation indicates that the introduced polynucleotide integrates into the genome of the organism and is capable of being inherited by progeny thereof.
- Transient transformation indicates that the introduced composition is only temporarily expressed or present in the organism.
- Protocols for introducing polynucleotides and polypeptides into plants may vary depending on the type of plant or plant cell targeted for transformation, such as monocot or dicot. Suitable methods of introducing polynucleotides and polypeptides into plant cells and subsequent insertion into the plant genome include microinjection (Crossway et al., (1986) Biotechniques 4:320-34 and U.S. Patent No. 6,300,543), meristem transformation (U.S. Patent No. 5,736,369), electroporation (Riggs et al., (1986) Proc. Natl. Acad. Sci. USA 83:5602-6, Agrobacterium-mediated transformation (U.S. Patent Nos. 5,563,055 and
- Kaeppler et al. (1990) Plant Cell Rep 9:415-8) and Kaeppler et al., (1992) Theor Appl Genet 84:560-6 (whisker-mediated transformation); D'Halluin et al., (1992) Plant Cell 4:1495-505 (electroporation); Li et al., (1993) Plant Cell Rep 12:250-5; Christou and Ford (1995) Annals Botany 75:407-13 (rice) and Osjoda et al., (1996) Nat Biotechnol 14:745-50 (maize via Agrobacterium tumefaciens).
- polynucleotides may be introduced into plants by contacting plants with a virus or viral nucleic acids.
- such methods involve incorporating a polynucleotide within a viral DNA or RNA molecule.
- a polypeptide of interest may be initially synthesized as part of a viral polyprotein, which is later processed by proteolysis in vivo or in vitro to produce the desired recombinant protein.
- Methods for introducing polynucleotides into plants and expressing a protein encoded therein, involving viral DNA or RNA molecules, are known, see, for example, U.S. Patent Nos.
- Transient transformation methods include, but are not limited to, the introduction of polypeptides, such as a double-strand break inducing agent, directly into the organism, the introduction of
- RNA polynucleotides such as DNA and/or RNA polynucleotides, and the introduction of the RNA transcript, such as an mRNA encoding a double-strand break inducing agent, into the organism.
- methods include, for example, microinjection or particle bombardment. See, for example Crossway et al., (1986) Mol Gen Genet 202:179-85; Nomura et al., (1986) Plant Sci 44:53-8; Hepler et ai, (1994) Proc. Natl. Acad. Sci. USA 91 :2176-80; and, Hush et ai, (1994) J Cell Sci 107:775-84.
- Vectors and constructs include circular plasmids, and linear polynucleotides, comprising a polynucleotide of interest and optionally other components including linkers, adapters, regulatory regions, introns, restriction sites, enhancers, insulators, selectable markers, nucleotide sequences of interest, promoters, and/or other sites that aid in vector construction or analysis.
- a recognition site and/or target site can be contained within an intron, coding sequence, 5' UTRs, 3' UTRs, and/or regulatory regions.
- the present invention further provides expression constructs for expressing in a plant, plant cell, or plant part an endonuclease that is capable of binding to and creating a double strand break in a target site.
- the expression constructs of the invention comprise a promoter operably linked to a nucleotide sequence encoding an endonuclease of the present invention.
- the promoter is capable of driving expression of an operably linked nucleotide sequence in a plant cell. Any such promoter that is disclosed herein or known in the art can be used in the present invention.
- the target site of the endonuclease is selected from the group consisting of TS21 , TS14, TS30, TS5, TS7, TS4, TS22, and TS24 target sites of soybean, which have the nucleotide sequences set forth in SEQ ID NO:1 , 2, 3, 4, 5, 6 , 7, and 8, respectively.
- the target site of the endonuclease is selected from the group consisting of MHP1 , MHP14, MHP32, MHP42, MHP55, MHP67, MHP77, MHP98, MHP107, and MHP1 15 target sites of maize, which have the nucleotide sequences set forth in SEQ ID NO:68, 69, 70, 71 , 72, 73, 74, 75, 76, and 77, respectively.
- the expression constructs comprise a nucleotide sequence encoding the endonuclease that has been custom designed or engineered to cut at one the soybean target sites set forth above.
- nucleotide sequences include, for example, the nucleotide sequences set forth in SEQ ID NOS:9, 10, 1 1 , 12, 13, 14, 15, and 16.
- nucleotide sequences of the invention include, but are not limited to, nucleotide sequences comprising a coding sequence of a DNA binding domain of an endonuclease, wherein the coding sequence is nucleotides 100-261 and nucleotides 850-101 1 of SEQ ID NO:9, 10, 1 1 , 12, 13, 14, 15 or 16 and degenerate coding sequences thereof.
- Such a degenerate coding sequence encodes the same amino acid sequence as that encoded by one of the coding sequences set forth in nucleotides 100-261 and nucleotides 850-101 1 of SEQ ID NO:9, 10, 1 1 , 12, 13, 14, 15 or 16 but differs in its nucleotide sequence due to the degeneracy of the genetic code.
- the expression constructs comprise a nucleotide sequence encoding the endonuclease that has been custom designed or engineered to cut at one the maize target sites set forth above.
- nucleotide sequences include, for example, the nucleotide sequences set forth in SEQ ID NOS: 78, 79, 80, 81 , 82, and 83.
- nucleotide sequences of the invention include, but are not limited to, nucleotide sequences comprising a coding sequence of a DNA binding domain of an endonuclease, wherein the coding sequence comprises nucleotides 100-261 and nucleotides 850-101 1 of SEQ ID NO: 80 and degenerate coding sequences thereof.
- a degenerate coding sequence encodes the same amino acid sequence as that encoded by one of the coding sequences set forth in nucleotides 100-261 and nucleotides 850-101 1 of SEQ ID NO: 80but differs in its nucleotide sequence due to the degeneracy of the genetic code.
- nucleotide sequences of the invention include, but are not limited to, nucleotide sequences comprising a coding sequence of a DNA binding domain of an endonuclease, wherein the coding sequence is nucleotides 100-261 and nucleotides 661 -822 of SEQ ID NO: 78, 79, 81 , 82 or 83 and degenerate coding sequences thereof.
- Such a degenerate coding sequence encodes the same amino acid sequence as that encoded by one of the coding sequences set forth in nucleotides 100-261 and nucleotides 661 -822 of SEQ ID NO: 78, 79, 81 , 82 or 83 but differs in its nucleotide sequence due to the degeneracy of the genetic code.
- a promoter is a region of DNA involved in recognition and binding of RNA polymerase and other proteins to initiate transcription.
- a plant promoter is a promoter capable of initiating transcription in a plant cell, for a review of plant promoters, see, Potenza et al., (2004) In Vitro Cell Dev Biol 40:1 -22.
- Constitutive promoters include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO99/43838 and U.S. Patent No. 6,072,050; the core CaMV 35S promoter (Odell et al., (1985) Nature 313:810-2); rice actin (McElroy et al., (1990) Plant Cell 2:163-71 ); ubiquitin (Christensen et al., (1989) Plant Mol Biol 12:619-32; Christensen et al., (1992) Plant Mol Biol 18:675-89); pEMU (Last et al., (1991 ) TheorAppl Genet 81 :581 - 8); MAS (Velten et al., (1984) EMBO J 3:2723-30); ALS promoter (U.S. Patent No. 5,659,026), and the like. Other constitutive promoters are described in, for example, U.
- Pathogen-inducible promoters induced following infection by a pathogen include, but are not limited to those regulating expression of PR proteins, SAR proteins, beta-1 ,3-glucanase, chitinase, etc.
- Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator.
- the promoter may be a chemical-inducible promoter, where application of the chemical induces gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression.
- Chemical-inducible promoters include, but are not limited to, the maize ln2-2 promoter, activated by benzene sulfonamide herbicide safeners (De Veylder et al., (1997) Plant Cell Physiol 38:568-77), the maize GST promoter (GST-ll-27, WO93/01294), activated by hydrophobic electrophilic compounds used as pre-emergent herbicides, and the tobacco PR-1 a promoter (Ono et al., (2004) Biosci
- Biotechnol Biochem 68:803-7 activated by salicylic acid.
- Other chemical- regulated promoters include steroid-responsive promoters (see, for example, the glucocorticoid-inducible promoter (Schena et al., (1991 ) Proc. Natl. Acad. Sci. USA 88:10421 -5; McNellis et al., (1998) Plant J 14:247-257); tetracycline- inducible and tetracycline-repressible promoters (Gatz et al., (1991 ) Mol Gen Genet 227:229-37; U.S. Patent Nos. 5,814,618 and 5,789,156).
- Tissue-preferred promoters can be utilized to target enhanced expression within a particular plant tissue.
- Tissue-preferred promoters include, for example, Kawamata et al., (1997) Plant Cell Physiol 38:792-803; Hansen et al., (1997) Mol Gen Genet 254:337-43; Russell et al., (1997) Transgenic Res 6:157-68; Rinehart et ai, (1996) Plant Physiol 1 12:1331 -41 ; Van Camp et ai, (1996) Plant Physiol 1 12:525-35; Canevascini et al., (1996) Plant Physiol 1 12:513-524; Lam, (1994) Results Probl Cell Differ 20:181 -96; and Guevara-Garcia et al.
- Leaf-preferred promoters include, for example, Yamamoto et al., (1997) Plant J 12:255-65; Kwon et ai, (1994) Plant PhysioH 05:357-67;
- Root-preferred promoters include, for example, Hire et al., (1992) Plant Mol Biol 20:207-18 (soybean root- specific glutamine synthase gene); Miao et al., (1991 ) Plant Cell 3:1 1 -22
- Seed-preferred promoters include both seed-specific promoters active during seed development, as well as seed-germinating promoters active during seed germination. See, Thompson et al., (1989) BioEssays 10:108. Seed- preferred promoters include, but are not limited to, Cim1 (cytokinin-induced message); cZ19B1 (maize 19 kDa zein); and milps (myo-inositol-1 -phosphate synthase); (WO00/1 1 177; and U.S. Patent 6,225,529).
- seed- preferred promoters include, but are not limited to, bean ⁇ -phaseolin, napin, ⁇ - conglycinin, soybean lectin, cruciferin, and the like.
- seed- preferred promoters include, but are not limited to, maize 15 kDa zein, 22 kDa zein, 27 kDa gamma zein, waxy, shrunken 1 , shrunken 2, globulin 1 , oleosin, and nud . See also, WO00/12733, where seed-preferred promoters from END1 and END2 genes are disclosed.
- a phenotypic marker is screenable or selectable marker that includes visual markers and selectable markers whether it is a positive or negative selectable marker. Any phenotypic marker can be used.
- a selectable or screenable marker comprises a DNA segment that allows one to identify, or select for or against a molecule or a cell that contains it, often under particular conditions. These markers can encode an activity, such as, but not limited to, production of RNA, peptide, or protein, or can provide a binding site for RNA, peptides, proteins, inorganic and organic compounds or compositions and the like.
- selectable markers include, but are not limited to, DNA segments that comprise restriction enzyme sites; DNA segments that encode products which provide resistance against otherwise toxic compounds including antibiotics, such as, spectinomycin, ampicillin, kanamycin, tetracycline, Basta, neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT)); DNA segments that encode products which are otherwise lacking in the recipient cell (e.g., tRNA genes, auxotrophic markers); DNA segments that encode products which can be readily identified (e.g., phenotypic markers such as ⁇ -galactosidase, GUS; fluorescent proteins such as green fluorescent protein (GFP), cyan (CFP), yellow (YFP), red (RFP), and cell surface proteins); the generation of new primer sites for PCR (e.g., the juxtaposition of two DNA sequence not previously juxtaposed), the inclusion of DNA sequences not acted upon or acted upon by a restriction endonuclease or other DNA
- Additional selectable markers include genes that confer resistance to herbicidal compounds, such as glufosinate ammonium, bromoxynil,
- the cells having the introduced sequence may be grown or regenerated into plants using conventional conditions, see for example, McCormick et al., (1986) Plant Cell Rep 5:81 -4. These plants may then be grown, and either pollinated with the same transformed strain or with a different transformed or untransformed strain, and the resulting progeny having the desired characteristic and/or comprising the introduced polynucleotide or polypeptide identified. Two or more generations may be grown to ensure that the polynucleotide is stably maintained and inherited, and seeds harvested.
- Any plant can be used, including moncot and dicot plants.
- monocot plants that can be used include, but are not limited to, corn (Zea mays), rice (Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panicum miliaceum), foxtail millet (Setaria italica), finger millet (Eleusine coracana)), wheat (Triticum aestivum), sugarcane (Saccharum spp.), oats (Avena), barley (Hordeum), switchgrass (Panicum virgatum), pineapple (Ananas comosus), banana (Musa spp.), palm, ornamentals, turfgrasses, and other grasses.
- corn Zea mays
- rice Oryza sativa
- rye
- dicot plants examples include, but are not limited to, soybean (Glycine max), canola (Brassica napus and B. campestris), alfalfa (Medicago sativa), tobacco (Nicotiana tabacum), Arabidopsis (Arabidopsis thaliana), sunflower (Helianthus annuus), cotton (Gossypium arboreum), and peanut (Arachis hypogaea), tomato (Solanum lycopersicum), potato (Solanum tuberosum) etc.
- the transgenes, recombinant DNA molecules, DNA sequences of interest, and polynucleotides of interest can comprise one or more genes of interest.
- genes of interest can encode, for example, a protein that provides agronomic advantage to the plant.
- Genes of interest including, but not limited to, those that encode proteins that provide agronomic advantage, can be reflective of the commercial markets and interests of those involved in the development of the crop. Crops and markets of interest change, and as developing nations open up world markets, new crops and technologies will emerge also. In addition, as our understanding of agronomic traits and characteristics such as yield and heterosis increase, the choice of genes for transformation will change accordingly.
- genes of interest include, for example, those genes involved in information, such as zinc fingers, those involved in communication, such as kinases, and those involved in housekeeping, such as heat shock proteins. More specific categories of transgenes, for example, include genes encoding important traits for
- Genes of interest include, generally, those involved in oil, starch, carbohydrate, or nutrient metabolism as well as those affecting kernel size, sucrose loading, and the like.
- Agronomically important traits such as oil, starch, and protein content can be genetically altered in addition to using traditional breeding methods.
- Modifications include increasing content of oleic acid, saturated and unsaturated oils, increasing levels of lysine and sulfur, providing essential amino acids, and also modification of starch.
- Hordothionin protein modifications are described in U.S. Patent Nos. 5,703,049, 5,885,801 , 5,885,802, and 5,990,389, herein incorporated by reference.
- Another example is lysine and/or sulfur rich seed protein encoded by the soybean 2S albumin described in U.S. Patent No.
- Derivatives of the coding sequences can be made by site-directed mutagenesis to increase the level of preselected amino acids in the encoded polypeptide.
- the gene encoding the barley high lysine polypeptide (BHL) is derived from barley chymotrypsin inhibitor, U.S. Application Serial No. 08/740,682, filed November 1 , 1996, and WO 98/20133, the disclosures of which are herein incorporated by reference.
- Other proteins include methionine-rich plant proteins such as from sunflower seed (Lilley et al. (1989) Proceedings of the World Congress on Vegetable Protein Utilization in Human Foods and Animal Feedstuff s, ed.
- Applewhite American Oil Chemists Society, Champaign, Illinois), pp. 497-502; herein incorporated by reference
- corn Pedersen et al. (1986) J. Biol. Chem. 261 :6279; Kirihara et al. (1988) Gene 71 :359; both of which are herein incorporated by reference
- rice agronomically important genes encode latex, Floury 2, growth factors, seed storage factors, and transcription factors.
- Insect resistance genes may encode resistance to pests that have great yield drag such as rootworm, cutworm, European Corn Borer, and the like.
- Such genes include, for example, Bacillus thuringiensis toxic protein genes (U.S.
- Genes encoding disease resistance traits include detoxification genes, such as against fumonosin (U.S. Patent No. 5,792,931 ); avirulence (avr) and disease resistance (R) genes (Jones et al. (1994) Science 266:789; Martin et al. (1993) Science 262:1432; and Mindrinos et al. (1994) Cell 78:1089); and the like.
- Herbicide resistance traits may include genes coding for resistance to herbicides that act to inhibit the action of acetolactate synthase (ALS), in particular the sulfonyl urea-type herbicides (e.g., the acetolactate synthase (ALS) gene containing mutations leading to such resistance, in particular the S4 and/or Hra mutations), genes coding for resistance to herbicides that act to inhibit action of glutamine synthase, such as phosphinothricin or basta (e.g., the bar gene); glyphosate (e.g., the EPSPS gene and the GAT gene; see, for example, U.S. Publication No.
- ALS acetolactate synthase
- ALS sulfonyl urea-type herbicides
- glutamine synthase such as phosphinothricin or basta
- glyphosate e.g., the EPSPS gene and the GAT gene
- the bar gene encodes resistance to the herbicide basta
- the nptll gene encodes resistance to the antibiotics kanamycin and geneticin
- the ALS-gene mutants encode resistance to the herbicide chlorsulfuron.
- Sterility genes can also be encoded in an expression cassette and provide an alternative to physical detasseling. Examples of genes used in such ways include male tissue-preferred genes and genes with male sterility
- phenotypes such as QM, described in U.S. Patent No. 5,583,210.
- Other genes include kinases and those encoding compounds toxic to either male or female gametophytic development.
- PHAs polyhyroxyalkanoates
- Exogenous products include plant enzymes and products as well as those from other sources including procaryotes and other eukaryotes. Such products include enzymes, cofactors, hormones, and the like.
- the level of proteins, particularly modified proteins having improved amino acid distribution to improve the nutrient value of the plant, can be increased. This is achieved by the expression of such proteins having enhanced amino acid content.
- the transgenes, recombinant DNA molecules, DNA sequences of interest, and polynucleotides of interest can be comprise one or more DNA sequences for gene silencing.
- Methods for gene silencing involving the expression of DNA sequences in plant include, but are not limited to, cosuppression, antisense suppression, double-stranded RNA (dsRNA) interference, hairpin RNA (hpRNA) interference, intron-containing hairpin RNA (ihpRNA) interference, transcriptional gene silencing, and micro RNA (miRNA) interference
- Cosuppression may be used to inhibit the expression of plant genes to produce plants having undetectable protein levels for the proteins encoded by these genes. See, for example, Broin et al. (2002) Plant Cell 14:1417-1432. Cosuppression may also be used to inhibit the expression of multiple proteins in the same plant. See, for example, U.S. Patent No. 5,942,657. Methods for using cosuppression to inhibit the expression of endogenous genes in plants are described in Flavell et al. (1994) Proc. Natl. Acad. Sci. USA 91 :3490-3496;
- portions of the antisense nucleotides may be used to disrupt the expression of the target gene.
- sequences of at least 50 nucleotides, 100 nucleotides, 200 nucleotides, 300, 400, 450, 500, 550, or greater may be used.
- Methods for using antisense suppression to inhibit the expression of endogenous genes in plants are described, for example, in Liu et al (2002) Plant Physiol. 129:1732-1743 and U.S. Patent Nos. 5,759,829 and 5,942,657, each of which is herein incorporated by reference.
- Efficiency of antisense suppression may be increased by including a poly-dT region in the expression cassette at a position 3' to the antisense sequence and 5' of the polyadenylation signal. See, U.S. Patent Publication No. 20020048814, herein incorporated by reference.
- the interfering molecules have the same general structure as for hpRNA, but the RNA molecule additionally comprises an intron that is capable of being spliced in the cell in which the ihpRNA is expressed.
- the use of an intron minimizes the size of the loop in the hairpin RNA molecule following splicing, and this increases the efficiency of interference. See, for example, Smith et al. (2000) Nature 407:319-320. In fact, Smith et al. show 100% suppression of endogenous gene expression using ihpRNA-mediated
- Transcriptional gene silencing may be accomplished through use of hpRNA constructs wherein the inverted repeat of the hairpin shares sequence identity with the promoter region of a gene to be silenced. Processing of the hpRNA into short RNAs which can interact with the homologous promoter region may trigger degradation or methylation to result in silencing (Aufsatz et al. (2002) PNAS 99 (Suppl. 4):16499-16506; Mette et al. (2000) EMBO J 19(19):5194- 5201 ).
- the inhibition of the expression of a target protein may be obtained by
- RNA interference by expression of a gene encoding a micro RNA miRNA interference by expression of a gene encoding a micro RNA (miRNA).
- miRNAs are regulatory agents consisting of about 22 ribonucleotides. miRNA are highly efficient at inhibiting the expression of endogenous genes. See, for example Javier et al. (2003) Nature 425: 257-263, herein incorporated by reference.
- the expression cassette is designed to express an RNA molecule that is modeled on an endogenous miRNA gene.
- the miRNA gene encodes an RNA that forms a hairpin structure containing a 22- nucleotide sequence that is complementary to another endogenous gene (target sequence). miRNA molecules are highly efficient at inhibiting the expression of endogenous genes, and the RNA interference they induce is inherited by subsequent generations of plants.
- the frequency of homologous recombination is influenced by a number of factors. Different organisms vary with respect to the amount of homologous recombination and the relative proportion of homologous to non-homologous recombination. Generally, the length of the region of homology affects the frequency of homologous recombination events, the longer the region of homology, the greater the frequency. The length of the homology region needed to observe homologous recombination is also species-variable. In many cases, at least 5 kb of homology has been utilized, but homologous recombination has been observed with as little as 25-50 bp of homology. The minimum length of homology needed has been estimated at 20-50 bp in E.
- Homologous recombination has also been accomplished in other organisms. For example, at least 150-200 bp of homology was required for homologous recombination in the parasitic protozoan Leishmania
- NHEJ nonhomologous end-joining
- the two ends of one double-strand break are the most prevalent substrates of NHEJ (Kirik et al., (2000) EMBO J 19:5562-6), however if two different double-strand breaks occur, the free ends from different breaks can be ligated and result in chromosomal deletions (Siebert and Puchta, (2002) Plant Cell 14:1 121 -31 ), or chromosomal translocations between different chromosomes (Pacher et al., (2007) Genetics 175:21 -9).
- Episomal DNA molecules can also be ligated into the double-strand break, for example, integration of T-DNAs into chromosomal double-strand breaks (Chilton and Que, (2003) Plant Physiol 133:956-65; Salomon and Puchta, (1998) EMBO J 17:6086-95).
- gene conversion pathways can restore the original structure if a homologous sequence is available, such as a homologous chromosome in non-dividing somatic cells, or a sister chromatid after DNA replication (Molinier et al., (2004) Plant Cell 16:342-52).
- Ectopic and/or epigenic DNA sequences may also serve as a DNA repair template for homologous recombination (Puchta, (1999) Genetics 152:1 173-81 ).
- An endogenous, non-selectable gene was targeted in Arabidopsis using a targeting vector containing a region of about 7 kb homologous to the target gene and the targeting frequency was estimated to be at least 3.9 X 10 "4 (Maio and Lam, (1995) Plant J 7:359-65).
- a targeting vector containing a region of about 7 kb homologous to the target gene was estimated to be at least 3.9 X 10 "4 (Maio and Lam, (1995) Plant J 7:359-65).
- homologous recombination was detected with a frequency less than 5.3 X 10 "5 , despite the large flanking sequences available for recombination (Thykjasr et al., (1997) Plant Mol Biol 35:523-30).
- the AGL5 MADS-box gene was knocked out by homologous recombination using a targeting construct consisting of a kanamycin-resistance cassette inserted into the AGL5 sequence roughly 3 kb from the 5' end and 2 kb from the 3' end.
- a targeting construct consisting of a kanamycin-resistance cassette inserted into the AGL5 sequence roughly 3 kb from the 5' end and 2 kb from the 3' end.
- kanamycin-resistant transgenic lines that were generated, one line contained the anticipated insertion (Kempin et al., (1997) Nature
- DNA double-strand breaks appear to be an effective factor to stimulate homologous recombination pathways in every organism tested to date (Puchta et al., (1995) Plant Mol Biol 28:281 -92; Tzfira and White, (2005) Trends Biotechnol 23:567-9; Puchta, (2005) J Exp Bot 56:1 -14).
- DNA-breaking agents two- to nine-fold increase of homologous recombination was observed between artificially constructed homologous DNA repeats in plants (Puchta et al., (1995) Plant Mol Biol 28:281 -92).
- experiments with linear DNA molecules demonstrated enhanced homologous recombination between plasmids (Lyznik et al., (1991 ) Mol Gen Genet 230:209-18).
- Puchta et al. reported that homologous recombination frequency at an artificial target locus was increased by up to two orders of magnitude when DSBs were generated using l-Scel (Puchta et al., (1996) Proc. Natl. Acad. Sci. USA 93:5055-60).
- an l-Scel expression cassette was introduced into transgenic tobacco target lines together with targeting construct by co-inoculation with the two respective Agrobacterium strains. Homologous recombination between T-DNA containing the targeting construct and the target site reconstituted the kanamycin-resistance gene (nptll). There was an apparent correlation between frequency of homologous
- Zinc finger nucleases are engineered endonucleases with altered specificities, for example by fusion of an engineered DNA binding domain to an endonuclease, for example, Fokl (Durai et al., (2005) Nucleic Acids Res
- sulphonylurea herbicides was introduced to replace the endogenous ALS gene at frequencies exceeding 2% of transformed cells (Townsend et ai., (2009) Nature 459:442-5).
- the knock-out of an endogenous gene and the expression of a transgene can be achieved simultaneously by gene targeting.
- the IPK1 gene which encodes inositol-1 , 3,4,5, 6-pentakisphosphate 2-kinase needed in the final step of phytate biosythesis in maize seeds, was targeted using a designed zinc-finger nuclease to insert via homologous recombination a PAT gene, which encodes phosphinothricin acetyl transferase tolerance to glufosinate ammonium herbicides such as bialaphos.
- Another approach uses protein engineering of existing homing
- Homing endonucleases to alter their target specificities. Homing endonucleases, such as l-Scel or l-Crel, bind to and cleave relatively long DNA recognition sequences (18 bp and 22 bp, respectively). These sequences are predicted to naturally occur infrequently in a genome, typically only 1 or 2 sites/genome.
- cleavage specificity of a homing endonuclease can be changed by rational design of amino acid substitutions at the DNA binding domain and/or combinatorial assembly and selection of mutated monomers (see, for example, Arnould et al., (2006) J Mol Biol 355:443-58; Ashworth et al., (2006) Nature 441 :656-9; Doyon et al., (2006) J Am Chem Soc 128:2477 -84; Rosen et al., (2006) Nucleic Acids Res 34:4791 -800; and Smith et al., (2006) Nucleic Acids Res 34:e149; Lyznik et al., (2009) U.S. Patent Application Publication No. 20090133152A1 ; Smith et al.,
- DNA repair mechanisms of cells are the basis of transformation to introduce extraneous DNA or induce mutations on endogenous genes.
- DNA homologous recombination is a specialized way of DNA repair that the cells repair DNA damages using a homologous sequence.
- plants DNA
- a DNA double-strand-break-inducing agent recognizes and cleaves the specific recognition sequence at a target site in the genome
- a DNA double- strand break is formed triggering the cell DNA repair mechanisms to mobilize to repair the damage that could be fatal to the cell.
- the process can be utilized in plant transformation to introduce mutations specifically at the target site to knock out the gene residing at the target site or to insert a donor DNA of interest at the target site.
- a target site containing a recognition sequence ( Figure 1 A) and a DNA double-strand break agent such as a endonuclease ( Figure 1 B) that recognizes specifically the recognition sequence have to be present in the same cell.
- the two free ends can be repaired through end joining by the cell DNA repair machinery without the intervention of any external factors.
- the two ends can be repaired to its original state so no change can be detected or they can be altered before being repaired resulting detectable changes after they are connected again such as the deletion of one or more nucleotides of the recognition sequence and possibly extra surrounding sequences (Figure 1 F). Mutations are introduced at the target site by the latter process.
- a donor DNA containing the DNA of interest has to be simultaneously present in the cell in addition to the target site and the endonuclease.
- the donor DNA can contain the same DNA sequences that flank the target site to flank the gene of interest, i.e., the homologous sequences ( Figure 1 C).
- the DNA of interest can be inserted at the target site by homologous recombination ( Figure 1 E), a process that is
- the donor DNA can also contain only the DNA of interest without any flanking homologous sequences (Figure 1 D).
- the DNA of interest can still be inserted at the target site though in a less predictable fashion through non-homologous recombination.
- any unrelated DNA that happens to be present when the DNA ends are repaired can be inserted at the target site ( Figure 1 G).
- the different outcomes ( Figures 1 E-G) can be obtained simultaneously in the same
- any means to make a DNA double-strand break in vivo can be used as the DNA double-strand-break-inducing agent such as the most commonly used meganucleases which recognize > 18 bp sequences, which are long enough to be unique in most genomes. Even numerous meganucleases have been found and characterized to recognize many different sequences, but such sequences are often not naturally present in important crops such as soybean or maize and even if similar sequences can be found in crop genomes, the limited numbers of these sequences are still too small to be useful.
- Certain meganucleases such as l-Crel can be modified by protein engineering in such a way that it will no longer preferentially recognize the recognition sequence of wild type l-Crel and instead will preferentially recognize specifically selected sequences of interest. Taking advantage of the flexibility of the l-Crel endonuclease, one can design and make a modified l-Crel to cleave a target site of our choice in the genome and subsequently introduce mutations or insert genes of interest at the selected target site. The precise genetic engineering that this methodology provides will solve many problems that traditional plant transformation methods such as Agrobacterium infection and biolistic bombardment currently face, such as unpredictable integration, unwanted endogenous gene interruption, unpredicted transgene expression, etc.
- Soybean lines comprising an endogenous target recognition sequence in their genome were contacted with a custom designed meganuclease,derived from I Crel, which is designed to specifically recognize and create a double- strand break in the endogenous target sequence.
- Soybean embryos comprising an endogenous target site were contacted with the components described below, events selected and characterized.
- TS21 target (SEQ ID NO: 1 ) GGCACTCTCGTGT GTGATTAAA
- TS14 target (SEQ ID NO: 2) CAGACGTACGCAA V GTAGCTTTG
- TS30 target (SEQ ID NO: 3) GAGTCCCACGCAA V GAGCATAAA
- TS5 target (SEQ ID NO: 4) AAGACTTACGTGT V GTACTCGTG
- the double-strand break sites and overhang regions are shown in bold, the enzyme cuts after C13, as indicated by the solid triangle.
- TS5 is about 600 kbp upstream of, and on the same chromosome as, the transgenic event of interest.
- TS30, TS21 and TS14 are on the same chromosome as TS5 and are 120 kbp, 125 kbp and 500 kbp downstream of the transgenic event of interest ( Figure 2).
- the l-Crel meganudease was modified to produce the TS21 , TS14, TS30 and TS5 meganucleases, which are designed to recognize their corresponding target sequences, under a contract with Precision Biosciences (Durham, NC USA). Wild-type l-Crel meganudease is a homodimer. In order to recognize their target sequences, different substitutions were made to each monomer. The coding sequences for each monomer were joined by a linker sequence to produce single-chain fusion polypeptides. Genes encoding the designed meganucleases were optimized for expression in plants. SEQ ID NO: 9 is the plant-optimized nucleotide sequence of the TS21 meganudease.
- SEQ ID NO: 10 is the plant-optimized nucleotide sequence of the TS14 meganudease.
- SEQ ID NO: 1 1 is the plant-optimized nucleotide sequence of the TS30 meganuclease.
- SEQ ID NO: 12 is the plant-optimized nucleotide sequence of the TS5 meganuclease.
- These genes include a nucleus localization signal from the SV40 virus (SEQ ID NO: 34) and an intron from the potato ST-LS1 gene. The intron prevents expression of the genes in bacteria during the cloning process, but is not necessary for expression in plant cells.
- nucleotides 1 -30 encode an SV40 nucleus localization amino acid sequence
- nucleotides 100-261 and nucleotides 850-101 1 encode the 1 st half and 2nd half target site binding amino acid sequences, respectively
- nucleotides 403-591 are the potato ST-LS1 intron
- nucleotides 685-798 encode the amino acid sequence of the polypeptide that links the two re-engineered l-Crel monomers into a single chain.
- Plant optimized nucleotide sequences without the ST-LS1 intron encoding the engineered meganucleases were constructed as well (see, SEQ ID NO: 33 for example).
- meganuclease were constructed using standard molecular biological techniques. All custom designed meganucleases were tested including TS21 , TS14, TS30 and TS5. For each of the meganucleases, a plant expression vector comprising a polynucleotide encoding one of the meganuclease genes was operably linked to a soybean constitutive promoter.
- RTW317 (SEQ ID NO: 35, GM-EF1 A pro::TS21 ::pinll) expression cassette contains the TS21 meganuclease plant optimized sequence without an intron and driven by soybean EF1A promoter.
- RTW322 (SEQ ID NO: 36, GM-EF1A pro::TS21 with ST-LS1
- intron2::pinll expression cassette contains the TS21 meganuclease plant optimized sequence with an intron and driven by soybean EF1A promoter.
- RTW319 GM-EF1A pro::TS14::pinll
- RTW324 GM-EF1A pro::TS14 with ST- LS1 intron2::pinll
- RTW323 GM-EF1A pro::TS5 with ST-LS1 intron2::pinll
- RTW325 GM-EF1A pro::TS30 with ST-LS1 intron2::pinll
- RTW345 GM-UBQ pro::TS21 ::pinll
- RTW351 GM-MTH1 pro::TS21 ::pinll
- RTW339 GM-MTH1 pro::TS21 with ST- LS1 intron2::pinll
- GM-ETF1A is the soybean ETF1A promoter
- GM- UBQ is the soybean ubiquitin promoter
- a repair DNA (donor DNA) containing the gene of interest has to be simultaneously present in the cell in addition to the target site and the endonuclease.
- the gene of interest was flanked by two homologous recombination fragments (HR1 and HR2), which were 1 to 3 kb long genomic DNA sequences flanking the meganuclease target sites.
- the gene of interest can be inserted at the target site by DNA homologous recombination, a process that is stimulated by the DNA double-strand break at the target site.
- Rep- RTW328A (SEQ ID NO: 37) was made for gene integration at TS21 target site in the soybean genome.
- the RTW328 repair DNA consists of a 1020bp TS21 HR1 fragment (SEQ ID NO:17), a hygromycin selection marker cassette and a 1000 bp TS21 HR2 fragment (SEQ ID NO:18).
- the hygromycin selection marker was driven by a SCP1 promoter and a NOS terminator (U.S. Patent No. 6,072,050; Suzuki et al., Gene (2000) 242(1 -2):331 -336) .
- the Rep-TS14 repair DNA vector consists of a 1000 bp TS14 HR1 fragment (SEQ ID NO:19, the same hygromycin selection marker cassette and a 928 bp TS14 HR2 fragment (SEQ ID NO:20).
- the Rep-TS30 repair DNA vector (consists of a 1000 bp TS0 HR1 fragment (SEQ ID NO:21 ), the same hygromycin selection marker cassette and a 1009 bp TS30 HR2 fragment (SEQ ID NO:22).
- the Rep-TS5 repair DNA vector consists of a 1006 bp TS5 HR1 fragment (SEQ ID NO:23), the same hygromycin selection marker cassette and a 1007 bp TS5 HR2 fragment (SEQ ID NO:24).
- a DNA double-strand break agent was simultaneously introduced with the repair DNA to facilitate homologous DNA recombination. It is convenient to transiently express the custom designed meganuclease by co-bombardment of a meganuclease expression vector with its corresponding repair DNA in soybean transformation. The presence or absence of an ST-LS1 intron in the DNA nucleotide sequence encoding a meganuclease did not affect the functionality of the meganuclease. Alterations at the target site were observed when expression of the meganuclease with both a DNA sequence that included or excluded the ST-LS1 intron in the expression cassette.
- PCR and qPCR assays were done following established protocols using gene-specific primers and probes (Li et al., (2007) Plant Mol Biol 65:329-41 ; Li et al., (2009) Plant Physiol 151 :1087-95). qPCR assays specific to the TS21 , TS14, TS30, and TS5 target sequences were developed to identify sequence changes that happen in the region. The primers and probe were designed as below and tested.
- the first group of genomic PCRs were designed to identify mutations in the meganuclease target sites, by amplifying genomic fragments containing the TS21 target site using a primer that anneals in HR1 and another primer that anneals in HR2.
- the primer set WOL133 and WOL134 SEQ ID NO:50 and 51 ) were used to amplify genomic fragments containing the TS21 target site ( Figure 3A).
- the PCR products were cloned and sequenced to identify mutations at the TS21 target site.
- a meganuclease in vitro cutting assay to cut the PCR product of an unmodified target site was used to test if the target site had been modified.
- the PCR products amplified using primers directed to the target site were digested with the meganuclease at 37°C overnight.
- Samples with meganuclease enzyme were treated with proteinase K and SDS to denature the protein.
- the digestion products were separated on a 1 .5 to 2% agarose gel. Undigested products indicate that the target site was modified.
- the undigested PCR products were then cloned and sequenced to verify the genome sequence modification.
- An example of the soybean genome sequence modification on TS21 target site is shown in Figure 3B.
- the second group of genomic PCR amplifications was more focused on transgene integration with border specific PCR.
- the primer set WOL190 SEQ ID NO:52
- WOL242 SEQ ID NO:53
- WOL190 is a sequence specific primer located in soybean genome 5' beyond the TS21 HR1 region
- WOL242 is a sequence specific primer to the 5' hygromycin-resistance marker gene coding sequence in the reverse orientation.
- An 1860 bp PCR product can only be obtained when the RTW328A repair DNA is integrated by homologous recombination facilitated by a double-strand break introduced at the genomic target site by TS21
- WOL153 SEQ ID NO:54
- WOL247 SEQ ID NO: 55
- WOL153 is the sense primer from the NOS terminator
- WOL247 is a sequence specific primer located in soybean genome 3' beyond the TS21 HR2 region.
- a 1727 bp PCR product can only be obtained when the RTW328A repair DNA is integrated by
- WOL1 14 (SEQ ID NO:61 )
- WOL197 (SEQ ID NO:67) Primer pairs were designed with one primer capable of annealing to either the 5' or 3' sequence flanking a target site and another primer capable of annealing to a sequence within the potential insert (i.e., the transgene).
- TS14 target site 18 qPCR positive events were identified from total 68 events by qPCR analyses. Out of the 18 qPCR positive events, three events were confirmed to be perfect TS14 meganuclease mediated transgene integration events by homologous recombination.
- TS7 target (SEQ ID NO: 5) GACATTGTCGTGA V GAAAAGAGA TS4 target (SEQ ID NO: 6) AAATCTGTCTTGC V GAAACGGCA TS22 target (SEQ ID NO: 7) TATTCTCTCATAA V ATAAACTTT TS24 target (SEQ ID NO: 8) GGAATGGACATAA V GAGAACTGT
- the double-strand break sites and overhang regions are shown in bold, the enzyme cuts after C13, as indicated by the solid triangle.
- the l-Crel meganuclease was modified to produce the TS7, TS4, TS22 and TS24 meganudeases, which are designed to recognize their corresponding target sequences, under a contract with Precision Biosciences (Durham, NC USA). Wild-type l-Crel meganuclease is a homodimer. In order to recognize their target sequences, different substitutions were made to each monomer. The coding sequences for each monomer were joined by a linker sequence to produce single-chain fusion polypeptides All these target sites are about 1 to 10 cM away from the cluster of the three disease resistance markers.
- meganuclease (SEQ ID NO: 13), TS4 meganuclease (SEQ ID NO:14), TS22 meganuclease (SEQ ID NO:15) and TS24 meganuclease (SEQ ID NO:16) includes a DNA fragment (from bp 1 -30) encoding an SV40 nuclear localization signal (MAPKKKRKVH; SEQ ID NO: 34) as well as a ST-LS1 intron (from bp 403 to bp 591 of SEQ ID 13-16) in order to eliminate expression in E.coli and
- Nucleotides 685-798 of SEQ ID NOs:13-16 encode the amino acid sequence of the polypeptide that links the two engineered l-Crel monomers into a single chain.
- Nucleotides 100-261 of SEQ ID NOs:13-16 and nucleotides 850-101 1 of SEQ ID NOs:13-16 encode the first half and the second half target site binding amino acid sequences, respectively.
- meganuclease were constructed using standard molecular biological techniques. All custom designed meganucleases were tested including TS7, TS4, TS22 and TS24. For each of the meganucleases, a plant expression vector comprising a polynucleotide encoding one of the meganuclease genes was operably linked to a soybean constitutive promoter.
- a repair DNA (donor DNA) containing the DNA of interest has to be simultaneously present in the cell in addition to the target site and the endonuclease.
- the DNA of interest was flanked by two homologous recombination fragments (HR1 and HR2), which were 1 to 3 kb long genomic DNA sequences flanking the meganuclease target sites.
- the DNA of interest can be inserted at the target site by DNA homologous recombination, a process that is stimulated by the DNA double-strand break at the target site.
- the HR1 and HR2 domains for TS7, TS4, TS22 and TS24 are SEQ ID NOs: 25 and 26, SEQ ID NOs: 27 and 28, SEQ ID NOs: 29 and 30 and SEQ ID NOs: 31 and 32, respectively. Repair DNA vectors were made as described in Example 2 C.
- a DNA double-strand break agent was simultaneously introduced with the repair DNA to facilitate homologous DNA recombination. It is convenient to transiently express the custom designed meganuclease by co-bombardment of a meganuclease expression vector with its corresponding repair DNA in soybean transformation.
- a series of meganuclease target sites can be identified with desirable genetic distances between these target sites.
- Custom designed meganucleases can be used to target a series of trait genes into this defined genome locus either by sequential transformation or by genetic crosses with individual trait genes.
- multiple traits can be stacked in a genomic region of interest that comprises, for example, a transgene or native gene of interest, and other transgenic traits or native trait loci such as disease resistance markers.
- a genomic region encompassing about 1 .8 million nucleotides and representing a genetic region of approximately 4.3 centimorgans (cM) on a maize chromosome was chosen as a target region for generation of a complex trait locus.
- the genomic region was scanned for 22-mer sequences that could serve as target sites containing recognition sequences for double-strand-break inducing meganucleases and be useful for insertion of additional transgenes in order to create a complex trait locus.
- the l-Crel meganuclease was modified to produce endonucleases, which were designed to recognize their corresponding target sequences, (SEQ ID NOs: 68-77).
- SEQ ID NOs: 68-77 The design of custom made meganucleases has been described in United States Patent Application Publication No. US 2007/01 17128 A1 .
- the engineered endonuclease expression cassettes contained the maize codon-optimized nucleotide sequences for better
- the endonuclease gene sequences were also supplemented with DNA sequences encoding a SV40 nuclear localization signal (SEQ ID NO: 34).
- the maize ubiquitin promoter and the potato proteinase inhibitor II gene terminator sequences completed the endonuclease gene designs.
- the MHP55 (SEQ ID NO:80) expression cassette was additionally modified by addition of the ST-LS1 intron to the coding sequence of the first monomer in order to eliminate its expression in E.coli and Agrobacterium.
- SEQ ID NO:82 is the plant-optimized nucleotide sequence of MHP55-2 containing a nuclear localization signal and without an intron.
- SEQ ID NO: 78 is the plant- optimized nucleotide sequence of the MHP14 meganuclease. A custom designed meganuclease, referred to as MHP14+ was made as well.
- SEQ ID NO: 79 is the plant-optimized nucleotide sequence of the MHP14+ meganuclease.
- SEQ ID NO: 83 is the plant-optimized nucleotide sequence of the MHP77 meganuclease
- meganuclease were constructed using standard molecular biological techniques. For each of the meganucleases, a plant expression vector comprising a polynucleotide encoding one of the meganuclease genes was operably linked to a maize constitutive promoter.
- a repair DNA (donor DNA) containing the gene of interest has to be simultaneously present in the cell in addition to the target site and the meganuclease.
- the donor DNA contained an herbicide resistance gene used as the selection marker for transformation.
- the herbicide resistance gene MoPAT encodes a phosphinothricin acetyltransferase, and was flanked by two homologous recombination fragments, HR1 (SEQ ID NO: 84) and HR2 (SEQ ID NO: 85), which were about 1 kb long genomic DNA sequences flanking the meganuclease target sites.
- Each vector PHP44285 or PHP44779 contained the meganuclease cassette, the donor DNA and the homology sequences HR1 and HR2.
- Maize immature embryos 9-12 DAP (days after pollination, approximately 1 .5-2.0 mm in size) from a maize transformable line were used for gene transformation by bombardment (Example 6).
- the immature embryos were placed on 560Y medium for 4 hours at 26°C or alternatively, immature embryos were incubated at temperatures ranging from 26°C to 37°C for 8 to 24 hours prior to placing on 560Y preceding bombardment (as described in Example 6).
- Maize immature embryos were transformed with the vectors PHP44285 or PHP44779.
- PHP44779 conferred bialaphos herbicide resistance, and was used to identify putative events by callus selection on herbicide containing media. Callus tissues and /or plants regenerated from stable transformants using standard culture and regeneration conditions were screened for modification of the endogenous MHP14 target site.
- qPCR Real time PCR
- MHPTS14_forward primer was AGCGACATAGTGGTGTATAAAAGGAA (SEQ ID NO: 107) and MHPTS14_reverse primer was
- TGGATTGTAATATGTGTACCTCATGCT (SEQ ID NO: 108).
- the amplicon was approximately 100 bp.
- Target site mutation rate indirectly measures the meganuclease activity.
- TSMutRate target site mutation rate
- target site mutation rate indicated the modification rate of the MHP14 or LIG3/4 target site (#events with modification/#events * 100%).
- target site mutation rate for both MHP14 and LIG34 was approximately 3X higher when embryos were placed at 32°C for 48 hours after bombardment compared to no temperature elevation treatment.
- Maize calli were also screened for integration of the transgene cassette from the donor DNA (PHP44285 or PHP44779) at the MHP14 target site through junction PCR and selected callus events were regenerated into TO plants.
- Figure 9A shows an outline of PCR screening for integration of the donor DNA fragment via homologous recombination at MHP14 target site (PHP44779 donor). Arrows indicate primer locations.
- Figure 9B shows PCR of MHP14 callus events: B1 - B12 Junction PCR with primers 146773/146775; b1 -b12 Junction PCR with primers 146772/146778.
- Figure 10A shows a schematic outline of long fragment PCR reactions used to confirm UBI:moPAT:Pinll cassette integration at the endogenous MHP14 target .
- Figure 10B shows the results of long fragment PCR on TO plants from three events where integration occurred at the target site. The plant A5 was from event #1 , A6-A8 event #2, and C4-C6 event #3. 10B-left shows the long junction fragment PCR on the HR1 side using genomic primer (146775) and moPAT primer (mopatR2); 10B-right shows the long junction fragment PCR on HR2 side (mopatF2/146772). Arrows indicated PCR primer locations. Primer set
- 146772/mopatF2 amplified a 4kb fragment, spanning from moPAT gene through the UBI intron, UBI promoter, and the HR2 sequence to the adjacent genomic region.
- Primer set 146775/mopatR2 amplified a 2.2kb fragment, spanning from the moPAT gene through the HR1 to the adjacent genomic region.
- T1 seeds from selfed TO plants were planted in flats and T1 plants genotyped by using PCR and/or qPCR.
- the segregation ratio of integration genotypes fit 1 :2:1 for wild type (no integration), heterozygous (one allele having integration and the other wild-type) and homozygous integration of the transgene at the MHP14 target site, demonstrating Mendelian inheritance. No visible phenotype was observed in the homozygous or heterozygous integration plants.
- Trait gene cassettes can be introduced at other target sites of the complex trait locus through homologous recombination mediated by engineered meganucleases.
- Engineered meganucleases were designed to direct double strand breaks a two other MHP target sites, MHP55 (SEQ ID NO: 72) and MHP77 (SEQ ID NO: 74) within the complex trait locus.
- Target site modification was determined using qPCR.
- the probe sequence for qPCR screening of the MHP55 target site was AACCGTCGTGAGACCT (SEQ ID NO: 1 15), the
- MHPTS55_Forward_MGBprimer sequence was AAGGCGCAGCCGTTGAG (SEQ ID NO: 1 16), and MHP55_reverse _MGB primer was
- MHP77_reverse _MGB primer was CATCGGTCAAAAAACACATAAACTTT (SEQ ID NO: 120).
- the trait gene cassettes encoding MHP14, MHP55 and MHP77 were introduced into maize somatic embryos via transformation techniques using bombardment and following bombardment, embryos were incubated on 560P (maintenance medium) for 48 hours at.
- 560P maintenance medium
- maize callus containing the MHP55 target site bombarded with PHP45782 or PHP46924 which include genes encoding MHP55 or MHP55.2 meganucleases, respectively, also lead to an observed increase in the target site mutation rate modified MHP55.2 variant.
- these meganucleases directed mutations to their corresponding target sites and modified versions lead to an increase in the target site mutation rate (approx 2 to 10-fold increase when compared to their original versions) suggesting the newly designed versions of the meganucleases were more active than the original nucleases.
- Meqanuclease activity (defined as target site mutation rate) of original and modified meganucleases
- a maize event obtained through random integration containing a transgene DNA of interest was identified and MHP14, MHP55 and MHP77 target sites surrounding the transgenic DNA of interest were identified as described above.
- Other maize events containing a modification at the MHP14, MHP55 and MHP77 target site were also identified.
- Plants homozygous for the integration of a herbicide resistance gene at the MHP14 target site were crossed with homozygous maize plants containing the transgene DNA of interest. The cross resulted in fertile plants producing F1 seeds. The F1 seeds were planted and out-crossed with Elite inbred line plants and screened for the stacked phenotype. Additional trait genes can be added to the complex trait locus by crossing one transgenic event containing n-transgenes with other trangenic events containing the additional trait gene at the additional target site, and progeny can be screened for the presence of n+1 transgenes. This process can be repeated as many times as the amount of target sites are present in the complex trait locus.
- a complex trait locus can be also be created by serial transformation.
- a first transformed line containing a first trait gene integrated at a first MHP target site can be used to supply embryos.
- the first transformed line can be
- Transformation of Maize Immature Embryos Transformation can be accomplished by various methods known to be effective in plants, including particle-mediated delivery, Agrobacterium-mediated transformation, PEG-mediated delivery, and electroporation.
- Transformation of maize immature embryos using particle delivery is performed as follows. Media recipes follow below.
- the ears are husked and surface sterilized in 30% Clorox bleach plus 0.5% Micro detergent for 20 minutes, and rinsed two times with sterile water.
- the immature embryos are isolated and placed embryo axis side down
- isolated embryos are placed on 560L (Initiation medium) and placed in the dark at temperatures ranging from 26°C to 37°C for 8 to 24 hours prior to placing on 560Y for 4 hours at 26°C prior to bombardment as described above.
- 560L Initiation medium
- a plasmid comprising the Zm-BBM (also referred to as Zm-ODP2) coding sequence (set forth in SEQ ID NO: 9) operably linked to a promoter is
- a weak promoter such as nos
- a tissue-specific promoter such as globulin-1 or oleosin
- an inducible promoter such as In2
- a strong promoter such as ubiquitin plus a plasmid containing the selectable marker gene phosphinothricin N-acetyltransferase (PAT; Wohlleben et al. (1988) Gene 70:25 37) that confers resistance to the herbicide bialaphos.
- plasmids containing the double strand brake inducing agent and donor DNA such as PHP44285 or PHP44779 are constructed as described above and co- bombareded with the plasmids containing the developmental genes ODP2 (AP2 domain transcription factor ODP2 (Ovule development protein 2);
- the plasmids are precipitated onto 1 .1 ⁇ (average diameter) tungsten pellets using a calcium chloride (CaCI 2 ) precipitation procedure by mixing 100 ⁇ prepared tungsten particles in water, 10 ⁇ (1 g) DNA in Tris EDTA buffer (1 g total DNA), 100 ⁇ 2.5 M CaC12, and 10 ⁇ 0.1 M spermidine. Each reagent is added sequentially to the tungsten particle suspension, with mixing. The final mixture is sonicated briefly and allowed to incubate under constant vortexing for 10 minutes. After the precipitation period, the tubes are centrifuged briefly, liquid is removed, and the particles are washed with 500 ml 100% ethanol, followed by a 30 second centrifugation. Again, the liquid is removed, and 105 ⁇ 100% ethanol is added to the final tungsten particle pellet.
- CaCI 2 calcium chloride
- the tungsten/DNA particles are briefly sonicated. 10 ⁇ of the tungsten/DNA particles is spotted onto the center of each macrocarrier, after which the spotted particles are allowed to dry about 2 minutes before
- sample plates are bombarded at level #4 with a Biorad Helium Gun. All samples receive a single shot at 450 PSI, with a total of ten aliquots taken from each tube of prepared particles/DNA.
- somatic embryo maturation 2-4 weeks
- somatic embryos are transferred to medium for germination and transferred to a lighted culture room.
- developing plantlets are
- Plants are then transferred to inserts in flats (equivalent to a 2.5" pot) containing potting soil and grown for 1 week in a growth chamber, subsequently grown an additional 1 -2 weeks in the greenhouse, then transferred to Classic 600 pots (1 .6 gallon) and grown to maturity. Plants are monitored and scored for transformation efficiency, and/or modification of regenerative capabilities.
- Initiation medium comprises 4.0 g/l N6 basal salts (SIGMA C- 1416), 1 .0 ml/l Eriksson's Vitamin Mix (1000X SIGMA-151 1 ), 0.5 mg/l thiamine HCI, 20.0 g/l sucrose, 1 .0 mg/l 2,4-D, and 2.88 g/l L-proline (brought to volume with D-l H2O following adjustment to pH 5.8 with KOH); 2.0 g/l Gelrite (added after bringing to volume with D-l H2O); and 8.5 mg/l silver nitrate (added after sterilizing the medium and cooling to room temperature).
- Maintenance medium comprises 4.0 g/l N6 basal salts (SIGMA C- 1416), 1 .0 ml/l Eriksson's Vitamin Mix (1000X SIGMA-151 1 ), 0.5 mg/l thiamine HCI, 30.0 g/l sucrose, 2.0 mg/l 2,4-D, and 0.69 g/l L-proline (brought to volume with D-l H2O following adjustment to pH 5.8 with KOH); 3.0 g/l Gelrite (added after bringing to volume with D-l H2O); and 0.85 mg/l silver nitrate (added after sterilizing the medium and cooling to room temperature).
- Bombardment medium comprises 4.0 g/l N6 basal salts (SIGMA C-1416), 1 .0 ml/l Eriksson's Vitamin Mix (1000X SIGMA-151 1 ), 0.5 mg/l thiamine HCI, 120.0 g/l sucrose, 1 .0 mg/l 2,4-D, and 2.88 g/l L-proline (brought to volume with D-l H2O following adjustment to pH 5.8 with KOH); 2.0 g/l Gelrite (added after bringing to volume with D-l H2O); and 8.5 mg/l silver nitrate (added after sterilizing the medium and cooling to room temperature).
- Selection medium comprises 4.0 g/l N6 basal salts (SIGMA C-1416), 1 .0 ml/l Eriksson's Vitamin Mix (1000X SIGMA-151 1 ), 0.5 mg/l thiamine HCI, 30.0 g/l sucrose, and 2.0 mg/l 2,4-D (brought to volume with D-l H2O following
- Plant regeneration medium (288J) comprises 4.3 g/l MS salts (GIBCO 1 1 1 17-074), 5.0 ml/l MS vitamins stock solution (0.100 g nicotinic acid, 0.02 g/l thiamine HCL, 0.10 g/l pyridoxine HCL, and 0.40 g/l glycine brought to volume with polished D-l H2O) (Murashige and Skoog (1962) Physiol. Plant.
- Hormone-free medium comprises 4.3 g/l MS salts (GIBCO 1 1 1 17-074), 5.0 ml/l MS vitamins stock solution (0.100 g/l nicotinic acid, 0.02 g/l thiamine HCL, 0.10 g/l pyridoxine HCL, and 0.40 g/l glycine brought to volume with polished D-l H2O), 0.1 g/l myo-inositol, and 40.0 g/l sucrose (brought to volume with polished D-l H2O after adjusting pH to 5.6); and 6 g/l bacto-agar (added after bringing to volume with polished D-l H2O), sterilized and cooled to 60°C.
- GEBCO 1 1 1 17-074 5.0 ml/l MS vitamins stock solution
- Agrobacterium-med ⁇ aied transformation was performed essentially as described in Djukanovic et al. (2006) Plant Biotech J 4:345-57. Briefly, 10-12 day old immature embryos (0.8 -2.5 mm in size) were dissected from sterilized kernels and placed into liquid medium (4.0 g/L N6 Basal Salts (Sigma C-1416), 1 .0 ml/L Eriksson's Vitamin Mix (Sigma E-151 1 ), 1 .0 mg/L thiamine HCI, 1 .5 mg/L 2, 4-D, 0.690 g/L L-proline, 68.5 g/L sucrose, 36.0 g/L glucose, pH 5.2). After embryo collection, the medium was replaced with 1 ml Agrobacterium at a concentration of 0.35-0.45 OD550. Maize embryos were incubated with
- acetosyringone and 3.0 g/L Gelrite, pH 5.8.
- Embryos were incubated axis down, in the dark for 3 days at 20°C, then incubated 4 days in the dark at 28°C, then transferred onto new media plates containing 4.0 g/L N6 Basal Salts (Sigma C-1416), 1 .0 ml/L Eriksson's Vitamin Mix (Sigma E-151 1 ), 1 .0 mg/L thiamine HCI, 1 .5 mg/L 2, 4-D, 0.69 g/L L-proline, 30.0 g/L sucrose, 0.5 g/L MES buffer, 0.85 mg/L silver nitrate, 3.0 mg/L Bialaphos, 100 mg/L carbenicillin, and 6.0 g/L agar, pH 5.8.
- Embryos were subcultured every three weeks until transgenic events were identified. Somatic embryogenesis was induced by transferring a small amount of tissue onto regeneration medium (4.3 g/L MS salts (Gibco 1 1 1 17), 5.0 ml/L MS Vitamins Stock Solution, 100 mg/L myo-inositol, 0.1 ⁇ ABA, 1 mg/L IAA, 0.5 mg/L zeatin, 60.0 g/L sucrose, 1 .5 mg/L Bialaphos, 100 mg/L carbenicillin, 3.0 g/L Gelrite, pH 5.6) and incubation in the dark for two weeks at 28°C.
- regeneration medium 4.3 g/L MS salts (Gibco 1 1 1 17), 5.0 ml/L MS Vitamins Stock Solution, 100 mg/L myo-inositol, 0.1 ⁇ ABA, 1 mg/L IAA, 0.5 mg/L zeatin, 60.0 g/L sucrose, 1 .5 mg/L
- Parameters of the transformation protocol can be modified to ensure that the BBM activity is transient.
- One such method involves precipitating the BBM- containing plasmid in a manner that allows for transcription and expression, but precludes subsequent release of the DNA, for example, by using the chemical PEL
- the BBM plasmid is precipitated onto gold particles with PEI, while the transgenic expression cassette (UBI::moPAT ⁇ GFPm::Pinll; moPAT is the maize optimized PAT gene) to be integrated is precipitated onto gold particles using the standard calcium chloride method.
- gold particles were coated with PEI as follows. First, the gold particles were washed. Thirty-five mg of gold particles, 1 .0 in average diameter (A.S.I. #162-0010), were weighed out in a microcentrifuge tube, and 1 .2 ml absolute EtOH was added and vortexed for one minute. The tube was incubated for 15 minutes at room temperature and then centrifuged at high speed using a microfuge for 15 minutes at 4oC. The supernatant was discarded and a fresh 1 .2 ml aliquot of ethanol (EtOH) was added, vortexed for one minute, centrifuged for one minute, and the supernatant again discarded (this is repeated twice).
- EtOH 1 .2 ml aliquot of ethanol
- coated particles could be stored at - 80oC for at least 3 weeks.
- the particles were rinsed 3 times with 250 ⁇ aliquots of 2.5 mM HEPES buffer, pH 7.1 , with 1 x pulse-sonication, and then a quick vortex before each centrifugation. The particles were then suspended in a final volume of 250 ⁇ HEPES buffer. A 25 ⁇ aliquot of the particles was added to fresh tubes before attaching DNA.
- the particles were pulse-sonicated, then 1 ⁇ g of DNA (in 5 ⁇ water) was added, followed by mixing by pipetting up and down a few times with a
- DNA-2 DNA-2
- precipitation using TFX-50 was used.
- the 45 ⁇ of particles/DNA-1 suspension was briefly sonicated, and then 5 ⁇ of 100 ng/ ⁇ of DNA-2 and 2.5 ⁇ of TFX-50 were added.
- the solution was placed on a rotary shaker for 10 minutes, centrifuged at 10,000g for 1 minute. The supernatant was removed, and the particles resuspended in 60 ⁇ of EtOH.
- the solution was spotted onto macrocarriers and the gold particles onto which DNA-1 and DNA-2 had been sequentially attached were delivered into scutellar cells of 10 DAP Hi-ll immature embryos using a standard protocol for the PDS-1000.
- the DNA-1 plasmid contained a UBI::RFP::pinll expression cassette
- DNA-2 contained a
- UBI::CFP::pinll expression cassette Two days after bombardment, transient expression of both the CFP and RFP fluorescent markers was observed as numerous red & blue cells on the surface of the immature embryo. The embryos were then placed on non-selective culture medium and allowed to grow for 3 weeks before scoring for stable colonies. After this 3-week period, 10
- PEI-precipitation could be used to effectively introduce DNA for transient expression while dramatically reducing integration of the PEI-introduced DNA and thus reducing the recovery of RFP- expressing transgenic events. In this manner, PEI-precipitation can be used to deliver transient expression of BBM and/or WUS2.
- the particles are first coated with UBI::BBM::pinll using PEI, then coated with UBI::moPAT ⁇ YFP using TFX-50, and then bombarded into scutellar cells on the surface of immature embryos.
- PEI-mediated precipitation results in a high frequency of transiently expressing cells on the surface of the immature embryo and extremely low frequencies of recovery of stable
- the PEI- precipitated BBM cassette expresses transiently and stimulates a burst of embryogenic growth on the bombarded surface of the tissue (i.e. the scutellar surface), but this plasmid will not integrate.
- the PAT-GFP plasmid released from the Ca++/gold particles is expected to integrate and express the selectable marker at a frequency that results in substantially improved recovery of transgenic events.
- PEI-precipitated particles containing a UBI::GUS::pinll (instead of BBM) are mixed with the PAT ⁇ GFP/Ca++ particles.
- the BBM plasmid is precipitated onto gold particles with PEI, and then introduced into scutellar cells on the surface of immature embryos, and subsequent transient expression of the BBM gene elicits a rapid proliferation of embryogenic growth.
- the explants are treated with Agrobacterium using standard methods for maize (see Example 1 ), with T-DNA delivery into the cell introducing a transgenic expression cassette such as UBI::moPAT ⁇ GFPm::pinll. After co-cultivation, explants are allowed to recover on normal culture medium, and then are moved onto culture medium containing 3 mg/l bialaphos. After 6-8 weeks, it is expected that GFP+, bialaphos-resistant calli will be observed in the PEI/BBM treatment at a much higher frequency relative to the control treatment (PEI/GUS).
- BBM and/or WUS2 polynucleotide products It may be desirable to "kick start" callus growth by transiently expressing the BBM and/or WUS2 polynucleotide products.
- This can be done by delivering BBM and WUS2 5'-capped polyadenylated RNA, expression cassettes containing BBM and WUS2 DNA, or BBM and/or WUS2 proteins. All of these molecules can be delivered using a biolistics particle gun.
- 5'- capped polyadenylated BBM and/or WUS2 RNA can easily be made in vitro using Ambion's mMessage mMachine kit.
- RNA is co-delivered along with DNA containing a polynucleotide of interest and a marker used for selection/screening such as Ubi::moPAT ⁇ GFPm::Pinll. It is expected that the cells receiving the RNA will immediately begin dividing more rapidly and a large portion of these will have integrated the agronomic gene. These events can further be validated as being transgenic clonal colonies because they will also express the PAT-GFP fusion protein (and thus will display green fluorescence under appropriate illumination). Plants regenerated from these embryos can then be screened for the presence of the polynucleotide of interest.
- a marker used for selection/screening such as Ubi::moPAT ⁇ GFPm::Pinll.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Developmental Biology & Embryology (AREA)
- Botany (AREA)
- Environmental Sciences (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
Claims
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP12712040.0A EP2689019A2 (en) | 2011-03-23 | 2012-03-22 | Methods for producing a complex transgenic trait locus |
| CN201280022453.3A CN103842511A (en) | 2011-03-23 | 2012-03-22 | Method for generating compound transgenic trait loci |
| BR112013024337A BR112013024337A2 (en) | 2011-03-23 | 2012-03-22 | complex transgenic trace locus in a plant, plant or seed, method for producing in a plant a complex transgenic trace locus and expression construct |
| EA201391373A EA201391373A1 (en) | 2011-03-23 | 2012-03-22 | METHODS OF OBTAINING A COMPLEX LOCUS OF TRANSGENIC SIGNS |
| MX2013010911A MX2013010911A (en) | 2011-03-23 | 2012-03-22 | Methods for producing a complex transgenic trait locus. |
| CA2831144A CA2831144A1 (en) | 2011-03-23 | 2012-03-22 | Methods for producing a complex transgenic trait locus |
| ZA2013/07200A ZA201307200B (en) | 2011-03-23 | 2013-09-26 | Methods for producing a complex transgenic trait locus |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161466602P | 2011-03-23 | 2011-03-23 | |
| US61/466,602 | 2011-03-23 | ||
| US201161499443P | 2011-06-21 | 2011-06-21 | |
| US61/499,443 | 2011-06-21 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2012129373A2 true WO2012129373A2 (en) | 2012-09-27 |
| WO2012129373A3 WO2012129373A3 (en) | 2013-03-14 |
Family
ID=45929041
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/030061 Ceased WO2012129373A2 (en) | 2011-03-23 | 2012-03-22 | Methods for producing a complex transgenic trait locus |
Country Status (10)
| Country | Link |
|---|---|
| US (5) | US10030245B2 (en) |
| EP (1) | EP2689019A2 (en) |
| CN (1) | CN103842511A (en) |
| AR (1) | AR085533A1 (en) |
| BR (1) | BR112013024337A2 (en) |
| CA (1) | CA2831144A1 (en) |
| EA (1) | EA201391373A1 (en) |
| MX (1) | MX2013010911A (en) |
| WO (1) | WO2012129373A2 (en) |
| ZA (1) | ZA201307200B (en) |
Cited By (27)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013088446A1 (en) | 2011-12-16 | 2013-06-20 | Targetgene Biotechnologies Ltd | Compositions and methods for modifying a predetermined target nucleic acid sequence |
| WO2013112686A1 (en) * | 2012-01-27 | 2013-08-01 | Pioneer Hi-Bred International, Inc. | Methods and compositions for generating complex trait loci |
| WO2014164466A1 (en) * | 2013-03-12 | 2014-10-09 | E. I. Du Pont De Nemours And Company | Methods for the identification of variant recognition sites for rare-cutting engineered double-strand-break-inducing agents and compositions and uses thereof |
| WO2015026883A1 (en) * | 2013-08-22 | 2015-02-26 | E. I. Du Pont De Nemours And Company | Plant genome modification using guide rna/cas endonuclease systems and methods of use |
| WO2016040030A1 (en) * | 2014-09-12 | 2016-03-17 | E. I. Du Pont De Nemours And Company | Generation of site-specific-integration sites for complex trait loci in corn and soybean, and methods of use |
| WO2016100309A1 (en) | 2014-12-16 | 2016-06-23 | Pioneer Hi-Bred International, Inc. | Restoration of male fertility in wheat |
| WO2017079026A1 (en) * | 2015-11-06 | 2017-05-11 | E. I. Du Pont De Nemours And Company | Generation of complex trait loci in soybean and methods of use |
| WO2017155714A1 (en) | 2016-03-11 | 2017-09-14 | Pioneer Hi-Bred International, Inc. | Novel cas9 systems and methods of use |
| WO2017161264A1 (en) | 2016-03-18 | 2017-09-21 | Pioneer Hi-Bred International, Inc. | Methods and compositions for producing clonal, non-reduced, non-recombined gametes |
| WO2017218185A1 (en) | 2016-06-14 | 2017-12-21 | Pioneer Hi-Bred International, Inc. | Use of cpf1 endonuclease for plant genome modifications |
| WO2017222773A1 (en) | 2016-06-20 | 2017-12-28 | Pioneer Hi-Bred International, Inc. | Novel cas systems and methods of use |
| US9963710B2 (en) | 2014-12-23 | 2018-05-08 | Syngenta Participations Ag | Methods and compositions for identifying and enriching for cells comprising site specific genomic modifications |
| EP3316676A4 (en) * | 2015-06-30 | 2018-12-12 | Regents of the University of Minnesota | Haploid inducer line for accelerated genome editing |
| WO2019118463A1 (en) | 2017-12-15 | 2019-06-20 | Danisco Us Inc | Cas9 variants and methods of use |
| WO2019165168A1 (en) | 2018-02-23 | 2019-08-29 | Pioneer Hi-Bred International, Inc. | Novel cas9 orthologs |
| WO2019177978A1 (en) | 2018-03-12 | 2019-09-19 | Pioneer Hi-Bred International, Inc. | Use of morphogenic factors for the improvement of gene editing |
| US10450576B2 (en) | 2015-03-27 | 2019-10-22 | E I Du Pont De Nemours And Company | Soybean U6 small nuclear RNA gene promoters and their use in constitutive expression of small RNA genes in plants |
| WO2020005667A1 (en) | 2018-06-29 | 2020-01-02 | Pioneer Hi-Bred International, Inc. | Compositions and methods for editing an endogenous nac gene in plants |
| US10676754B2 (en) | 2014-07-11 | 2020-06-09 | E I Du Pont De Nemours And Company | Compositions and methods for producing plants resistant to glyphosate herbicide |
| WO2020123887A2 (en) | 2018-12-14 | 2020-06-18 | Pioneer Hi-Bred International, Inc. | Novel crispr-cas systems for genome editing |
| US10822610B2 (en) | 2011-03-23 | 2020-11-03 | E. I. Du Pont De Nemours And Company | Methods for producing a complex transgenic trait locus |
| CN112105722A (en) * | 2018-04-18 | 2020-12-18 | 先锋国际良种公司 | Genes, constructs and maize event DP-202216-6 |
| WO2021173480A2 (en) | 2020-02-24 | 2021-09-02 | Pioneer Hi-Bred International, Inc. | Intra-genomic homologous recombination |
| WO2023102393A1 (en) | 2021-11-30 | 2023-06-08 | Pioneer Hi-Bred International, Inc. | High efficiency large scale chromosomal genome manipulation |
| WO2024196921A1 (en) | 2023-03-20 | 2024-09-26 | Pioneer Hi-Bred International, Inc. | Cas polypeptides with altered pam recognition |
| US12371702B2 (en) | 2018-04-18 | 2025-07-29 | Pioneer Hi-Bred International, Inc. | Improving agronomic characteristics in maize by modification of endogenous mads box transcription factors |
| EP4696781A2 (en) | 2014-09-26 | 2026-02-18 | Pioneer Hi-Bred International, Inc. | Wheat ms1 polynucleotides, polypeptides, and methods of use |
Families Citing this family (20)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2945315T3 (en) | 2015-01-27 | 2023-06-30 | Inst Genetics & Developmental Biology Cas | Method for making site-specific modifications in the whole plant through transient gene expression |
| EP3262176A1 (en) | 2015-02-25 | 2018-01-03 | Pioneer Hi-Bred International, Inc. | Composition and methods for regulated expression of a guide rna/cas endonuclease complex |
| KR102194612B1 (en) | 2015-03-16 | 2020-12-23 | 인스티튜트 오브 제네틱스 앤드 디벨롭멘털 바이오롤지, 차이니즈 아카데미 오브 사이언시스 | Site-specific modification method of plant genome using non-genetic material |
| EP3294878A1 (en) | 2015-05-15 | 2018-03-21 | Pioneer Hi-Bred International, Inc. | Guide rna/cas endonuclease systems |
| EP3095870A1 (en) | 2015-05-19 | 2016-11-23 | Kws Saat Se | Methods for the in planta transformation of plants and manufacturing processes and products based and obtainable therefrom |
| JP2018527920A (en) | 2015-08-14 | 2018-09-27 | インスティテュート・オブ・ジェネティクス・アンド・ディヴェロプメンタル・バイオロジー、チャイニーズ・アカデミー・オブ・サイエンシズInstitute of Genetics and Developmental Biology, Chinese Academy of Sciences | Method for obtaining glyphosate-tolerant rice by site-specific nucleotide substitution |
| FI4144844T3 (en) | 2015-10-12 | 2025-11-24 | Dupont Us Holding Llc | Protected dna templates for gene modification and increased homologous recombination in cells and methods of use |
| CN108138155A (en) | 2015-10-20 | 2018-06-08 | 先锋国际良种公司 | Restoring the function of a non-functional gene product via a guided CAS system and methods of use |
| DK3387134T3 (en) | 2015-12-11 | 2020-12-21 | Danisco Us Inc | PROCEDURES AND COMPOSITIONS FOR INCREASED NUCLEASE MEDIATED GENERAL MODIFICATION AND REDUCED EFFECTS OUTSIDE THE OBJECTIVE |
| DK3390631T3 (en) | 2015-12-18 | 2020-07-13 | Danisco Us Inc | METHODS AND COMPOSITIONS FOR T-RNA-BASED GUIDE RNA EXPRESSION |
| BR112018015348A2 (en) | 2016-01-26 | 2018-12-18 | Pioneer Hi Bred Int | method for obtaining a waxy maize plant, plant, seed, guide polynucleotide and method for producing a hybrid waxy maize plant |
| WO2017155715A1 (en) | 2016-03-11 | 2017-09-14 | Pioneer Hi-Bred International, Inc. | Novel cas9 systems and methods of use |
| CA3010628A1 (en) | 2016-03-11 | 2017-09-14 | Pioneer Hi-Bred International, Inc. | Novel cas9 systems and methods of use |
| CA3037560A1 (en) | 2016-10-13 | 2018-04-19 | Pioneer Hi-Bred International, Inc. | Generating northern leaf blight resistant maize |
| US20210032645A1 (en) * | 2017-01-11 | 2021-02-04 | Yeda Research And Development Co. Ltd. | Targeted recombination between homologous chromosomes and uses thereof |
| EP3661354A1 (en) | 2017-07-31 | 2020-06-10 | R. J. Reynolds Tobacco Company | Methods and compositions for viral-based gene editing in plants |
| CN112088018A (en) | 2018-05-07 | 2020-12-15 | 先锋国际良种公司 | Methods and compositions for homology-directed repair of double-strand breaks in plant cell genomes |
| US12031140B2 (en) * | 2019-11-25 | 2024-07-09 | Syngenta Crop Protection Ag | Glycine regulatory elements and uses thereof |
| US20220056470A1 (en) | 2020-08-18 | 2022-02-24 | Pioneer Hi-Bred International, Inc. | Multiple disease resistance genes and genomic stacks thereof |
| WO2025184161A1 (en) * | 2024-02-27 | 2025-09-04 | Dryland Genetics, Inc. | Higher-yielding proso varieties dlg197 and dlg317 |
Citations (103)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4873192A (en) | 1987-02-17 | 1989-10-10 | The United States Of America As Represented By The Department Of Health And Human Services | Process for site specific mutagenesis without phenotypic selection |
| US4945050A (en) | 1984-11-13 | 1990-07-31 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues and apparatus therefor |
| US5023179A (en) | 1988-11-14 | 1991-06-11 | Eric Lam | Promoter enhancer element for gene expression in plant roots |
| US5034323A (en) | 1989-03-30 | 1991-07-23 | Dna Plant Technology Corporation | Genetic engineering of novel plant phenotypes |
| US5107065A (en) | 1986-03-28 | 1992-04-21 | Calgene, Inc. | Anti-sense regulation of gene expression in plant cells |
| US5110732A (en) | 1989-03-14 | 1992-05-05 | The Rockefeller University | Selective gene expression in plants |
| WO1993001294A1 (en) | 1991-07-02 | 1993-01-21 | Zeneca Limited | Plant-derived enzyme and dna sequences, and uses thereof |
| US5240855A (en) | 1989-05-12 | 1993-08-31 | Pioneer Hi-Bred International, Inc. | Particle gun |
| US5268463A (en) | 1986-11-11 | 1993-12-07 | Jefferson Richard A | Plant promoter α-glucuronidase gene construct |
| US5283184A (en) | 1989-03-30 | 1994-02-01 | Dna Plant Technology Corporation | Genetic engineering of novel plant phenotypes |
| US5316931A (en) | 1988-02-26 | 1994-05-31 | Biosource Genetics Corp. | Plant viral vectors having heterologous subgenomic promoters for systemic expression of foreign genes |
| US5322783A (en) | 1989-10-17 | 1994-06-21 | Pioneer Hi-Bred International, Inc. | Soybean transformation by microparticle bombardment |
| US5324646A (en) | 1992-01-06 | 1994-06-28 | Pioneer Hi-Bred International, Inc. | Methods of regeneration of Medicago sativa and expressing foreign DNA in same |
| US5366892A (en) | 1991-01-16 | 1994-11-22 | Mycogen Corporation | Gene encoding a coleopteran-active toxin |
| US5380831A (en) | 1986-04-04 | 1995-01-10 | Mycogen Plant Science, Inc. | Synthetic insecticidal crystal protein gene |
| US5399680A (en) | 1991-05-22 | 1995-03-21 | The Salk Institute For Biological Studies | Rice chitinase promoter |
| US5401836A (en) | 1992-07-16 | 1995-03-28 | Pioneer Hi-Bre International, Inc. | Brassica regulatory sequence for root-specific or root-abundant gene expression |
| US5436391A (en) | 1991-11-29 | 1995-07-25 | Mitsubishi Corporation | Synthetic insecticidal gene, plants of the genus oryza transformed with the gene, and production thereof |
| US5459252A (en) | 1991-01-31 | 1995-10-17 | North Carolina State University | Root specific gene promoter |
| US5466785A (en) | 1990-04-12 | 1995-11-14 | Ciba-Geigy Corporation | Tissue-preferential promoters |
| US5527695A (en) | 1993-01-29 | 1996-06-18 | Purdue Research Foundation | Controlled modification of eukaryotic genomes |
| US5563055A (en) | 1992-07-27 | 1996-10-08 | Pioneer Hi-Bred International, Inc. | Method of Agrobacterium-mediated transformation of cultured soybean cells |
| US5569597A (en) | 1985-05-13 | 1996-10-29 | Ciba Geigy Corp. | Methods of inserting viral DNA into plant material |
| US5583210A (en) | 1993-03-18 | 1996-12-10 | Pioneer Hi-Bred International, Inc. | Methods and compositions for controlling plant development |
| US5593881A (en) | 1994-05-06 | 1997-01-14 | Mycogen Corporation | Bacillus thuringiensis delta-endotoxin |
| US5602321A (en) | 1992-11-20 | 1997-02-11 | Monsanto Company | Transgenic cotton plants producing heterologous polyhydroxy(e) butyrate bioplastic |
| US5604121A (en) | 1991-08-27 | 1997-02-18 | Agricultural Genetics Company Limited | Proteins with insecticidal properties against homopteran insects and their use in plant protection |
| US5608142A (en) | 1986-12-03 | 1997-03-04 | Agracetus, Inc. | Insecticidal cotton plants |
| US5608149A (en) | 1990-06-18 | 1997-03-04 | Monsanto Company | Enhanced starch biosynthesis in tomatoes |
| US5608144A (en) | 1994-08-12 | 1997-03-04 | Dna Plant Technology Corp. | Plant group 2 promoters and uses thereof |
| US5633363A (en) | 1994-06-03 | 1997-05-27 | Iowa State University, Research Foundation In | Root preferential promoter |
| US5659026A (en) | 1995-03-24 | 1997-08-19 | Pioneer Hi-Bred International | ALS3 promoter |
| US5703049A (en) | 1996-02-29 | 1997-12-30 | Pioneer Hi-Bred Int'l, Inc. | High methionine derivatives of α-hordothionin for pathogen-control |
| US5723756A (en) | 1990-04-26 | 1998-03-03 | Plant Genetic Systems, N.V. | Bacillus thuringiensis strains and their genes encoding insecticidal toxins |
| US5736514A (en) | 1994-10-14 | 1998-04-07 | Nissan Chemical Industries, Ltd. | Bacillus strain and harmful organism controlling agents |
| US5736369A (en) | 1994-07-29 | 1998-04-07 | Pioneer Hi-Bred International, Inc. | Method for producing transgenic cereal plants |
| US5747450A (en) | 1991-08-02 | 1998-05-05 | Kubota Corporation | Microorganism and insecticide |
| US5750386A (en) | 1991-10-04 | 1998-05-12 | North Carolina State University | Pathogen-resistant transgenic plants |
| WO1998020133A2 (en) | 1996-11-01 | 1998-05-14 | Pioneer Hi-Bred International, Inc. | Proteins with enhanced levels of essential amino acids |
| US5759829A (en) | 1986-03-28 | 1998-06-02 | Calgene, Inc. | Antisense regulation of gene expression in plant cells |
| US5789156A (en) | 1993-06-14 | 1998-08-04 | Basf Ag | Tetracycline-regulated transcriptional inhibitors |
| US5792931A (en) | 1994-08-12 | 1998-08-11 | Pioneer Hi-Bred International, Inc. | Fumonisin detoxification compositions and methods |
| US5792632A (en) | 1992-05-05 | 1998-08-11 | Institut Pasteur | Nucleotide sequence encoding the enzyme I-SceI and the uses thereof |
| US5814618A (en) | 1993-06-14 | 1998-09-29 | Basf Aktiengesellschaft | Methods for regulating gene expression |
| US5837876A (en) | 1995-07-28 | 1998-11-17 | North Carolina State University | Root cortex specific gene promoter |
| US5850016A (en) | 1996-03-20 | 1998-12-15 | Pioneer Hi-Bred International, Inc. | Alteration of amino acid compositions in seeds |
| US5879918A (en) | 1989-05-12 | 1999-03-09 | Pioneer Hi-Bred International, Inc. | Pretreatment of microprojectiles prior to using in a particle gun |
| US5885801A (en) | 1995-06-02 | 1999-03-23 | Pioneer Hi-Bred International, Inc. | High threonine derivatives of α-hordothionin |
| US5886244A (en) | 1988-06-10 | 1999-03-23 | Pioneer Hi-Bred International, Inc. | Stable transformation of plant cells |
| US5885802A (en) | 1995-06-02 | 1999-03-23 | Pioneer Hi-Bred International, Inc. | High methionine derivatives of α-hordothionin |
| US5889191A (en) | 1992-12-30 | 1999-03-30 | Biosource Technologies, Inc. | Viral amplification of recombinant messenger RNA in transgenic plants |
| US5888732A (en) | 1995-06-07 | 1999-03-30 | Life Technologies, Inc. | Recombinational cloning using engineered recombination sites |
| WO1999025841A1 (en) | 1997-11-18 | 1999-05-27 | Pioneer Hi-Bred International, Inc. | Novel nucleic acid sequence encoding flp recombinase |
| WO1999025851A1 (en) | 1997-11-13 | 1999-05-27 | Sumitomo Pharmaceuticals Company, Limited | VARIANT loxP SEQUENCES AND APPLICATION OF THE SAME |
| WO1999025840A1 (en) | 1997-11-18 | 1999-05-27 | Pioneer Hi-Bred International, Inc. | A novel method for the integration of foreign dna into eukaryoticgenomes |
| WO1999025855A1 (en) | 1997-11-18 | 1999-05-27 | Pioneer Hi-Bred International, Inc. | Mobilization of viral genomes from t-dna using site-specific recombination systems |
| WO1999025821A1 (en) | 1997-11-18 | 1999-05-27 | Pioneer Hi-Bred International, Inc. | Compositions and methods for genetic modification of plants |
| US5932782A (en) | 1990-11-14 | 1999-08-03 | Pioneer Hi-Bred International, Inc. | Plant transformation method using agrobacterium species adhered to microprojectiles |
| US5942657A (en) | 1992-05-13 | 1999-08-24 | Zeneca Limited | Co-ordinated inhibition of plant gene expression |
| WO1999043838A1 (en) | 1998-02-24 | 1999-09-02 | Pioneer Hi-Bred International, Inc. | Synthetic promoters |
| WO1999049029A1 (en) | 1998-03-20 | 1999-09-30 | Benitec Australia Ltd | Control of gene expression |
| WO1999053050A1 (en) | 1998-04-08 | 1999-10-21 | Commonwealth Scientific And Industrial Research Organisation | Methods and means for obtaining modified phenotypes |
| US5981840A (en) | 1997-01-24 | 1999-11-09 | Pioneer Hi-Bred International, Inc. | Methods for agrobacterium-mediated transformation |
| US5990389A (en) | 1993-01-13 | 1999-11-23 | Pioneer Hi-Bred International, Inc. | High lysine derivatives of α-hordothionin |
| WO1999061631A1 (en) | 1998-05-26 | 1999-12-02 | Novartis Ag | Dsrna-mediated regulation of gene expression in plants |
| WO2000011177A1 (en) | 1998-08-20 | 2000-03-02 | Pioneer Hi-Bred International, Inc. | Seed-preferred promoters |
| WO2000042219A1 (en) | 1999-01-12 | 2000-07-20 | Sangamo Biosciences, Inc. | Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites |
| WO2000049035A1 (en) | 1999-02-19 | 2000-08-24 | The General Hospital Corporation | Gene silencing |
| US6140466A (en) | 1994-01-18 | 2000-10-31 | The Scripps Research Institute | Zinc finger protein derivatives and methods therefor |
| US6175056B1 (en) | 1996-04-29 | 2001-01-16 | The Procter & Gamble Company | Disposable absorbent article having an expanding topsheet and being capable of self-shaping in use |
| US6177611B1 (en) | 1998-02-26 | 2001-01-23 | Pioneer Hi-Bred International, Inc. | Maize promoters |
| WO2001007572A2 (en) | 1999-07-23 | 2001-02-01 | The Regents Of The University Of California | Dna recombination in eukaryotic cells by the bacteriophage phic31 recombination system |
| WO2001011058A1 (en) | 1999-08-09 | 2001-02-15 | Monsanto Technology Llc | Novel cloning methods and vectors |
| WO2001023545A1 (en) | 1999-09-30 | 2001-04-05 | Sumitomo Pharmaceuticals Company, Limited | Dna containing variant frt sequences |
| US6300543B1 (en) | 1996-07-08 | 2001-10-09 | Pioneer Hi-Bred International, Inc. | Transformation of zygote, egg or sperm cells and recovery of transformed plants from isolated embryo sacs |
| US20020048814A1 (en) | 2000-08-15 | 2002-04-25 | Dna Plant Technology Corporation | Methods of gene silencing using poly-dT sequences |
| WO2002042459A2 (en) | 2000-11-20 | 2002-05-30 | Sangamo Biosciences, Inc. | Position dependent recognition of gnn nucleotide triplets by zinc fingers |
| WO2002099084A2 (en) | 2001-04-04 | 2002-12-12 | Gendaq Limited | Composite binding polypeptides |
| US6511808B2 (en) | 2000-04-28 | 2003-01-28 | Sangamo Biosciences, Inc. | Methods for designing exogenous regulatory molecules |
| WO2003008045A2 (en) | 2001-07-16 | 2003-01-30 | Uv & P Umweltmanagement - Verfahrenstechnik Neubacher & Partner Ges.M.B.H. | Methods for the immobilisation of combustion residues |
| US20030108880A1 (en) | 2001-01-22 | 2003-06-12 | Sangamo Biosciences | Modified zinc finger binding proteins |
| WO2003062455A2 (en) | 2002-01-23 | 2003-07-31 | Syngenta Biotechnology, Inc. | Zinc finger domain recognition code and uses thereof |
| US6610545B2 (en) | 1992-05-05 | 2003-08-26 | Institut Pasteur | Nucleotide sequence encoding the enzyme I-SceI and the uses thereof |
| US20030175965A1 (en) | 1997-05-21 | 2003-09-18 | Lowe Alexandra Louise | Gene silencing |
| US20030180945A1 (en) | 2002-03-14 | 2003-09-25 | Ming-Bo Wang | Modified gene-silencing RNA and uses thereof |
| WO2003078619A1 (en) | 2002-03-15 | 2003-09-25 | Cellectis | Hybrid and single chain meganucleases and use thereof |
| WO2003092360A2 (en) | 2002-04-30 | 2003-11-13 | Verdia, Inc. | Novel glyphosate-n-acetyltransferase (gat) genes |
| WO2004031346A2 (en) | 2002-09-06 | 2004-04-15 | Fred Hutchinson Cancer Research Center | Methods and compositions concerning designed highly-specific nucleic acid binding proteins |
| US20040082770A1 (en) | 2000-10-30 | 2004-04-29 | Verdia, Inc. | Novel glyphosate N-acetyltransferase (GAT) genes |
| WO2004067736A2 (en) | 2003-01-28 | 2004-08-12 | Cellectis | Custom-made meganuclease and use thereof |
| WO2005028942A1 (en) | 2003-09-23 | 2005-03-31 | Carsphairn Limited | A pipeline apparatus |
| US20050172365A1 (en) | 2001-07-04 | 2005-08-04 | Holger Puchta | Recombination systems and methods for eliminating nucleic acid sequences from the genome of eukaryotic organisms |
| WO2005105989A1 (en) | 2004-04-30 | 2005-11-10 | Cellectis | I-dmoi derivatives with enhanced activity at 37°c and use thereof. |
| WO2006097853A1 (en) | 2005-03-15 | 2006-09-21 | Cellectis | I-crei meganuclease variants with modified specificity, method of preparation and uses thereof |
| WO2006097784A1 (en) | 2005-03-15 | 2006-09-21 | Cellectis | I-crei meganuclease variants with modified specificity, method of preparation and uses thereof |
| US20060282914A1 (en) | 2003-11-18 | 2006-12-14 | D Halluin Kathleen | Targeted dna insertion in plants |
| US20070117128A1 (en) | 2005-10-18 | 2007-05-24 | Smith James J | Rationally-designed meganucleases with altered sequence specificity and DNA-binding affinity |
| US20080051288A1 (en) | 2006-06-28 | 2008-02-28 | Pioneer Hi-Bred International, Inc | Soybean event 3560.4.3.5 and compositions and methods for the identification and detection thereof |
| US20080312082A1 (en) | 2006-10-31 | 2008-12-18 | Kinney Anthony J | Soybean event dp-305423-1 and compositions and methods for the identification and/or detection thereof |
| WO2009006297A2 (en) | 2007-06-29 | 2009-01-08 | Pioneer Hi-Bred International, Inc. | Methods for altering the genome of a monocot plant cell |
| US20090036308A1 (en) | 2006-06-28 | 2009-02-05 | Pioneer Hi-Bred International, Inc. | Soybean event 3560.4.3.5 and compositions and methods for the identification and/or detection thereof |
| US20090328252A1 (en) | 2004-02-02 | 2009-12-31 | Pioneer Hi-Bred International, Inc. | Ap2 domain transcription factor odp2 (ovule development protein 2) and methods of use |
| WO2010079430A1 (en) | 2009-01-12 | 2010-07-15 | Ulla Bonas | Modular dna-binding domains and methods of use |
Family Cites Families (129)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US205178A (en) * | 1878-06-25 | Improvement in feather-renovators | ||
| US5036006A (en) | 1984-11-13 | 1991-07-30 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues and apparatus therefor |
| NZ230375A (en) | 1988-09-09 | 1991-07-26 | Lubrizol Genetics Inc | Synthetic gene encoding b. thuringiensis insecticidal protein |
| EP1103616A3 (en) | 1989-02-24 | 2001-06-27 | Monsanto Company | Synthetic plant genes and method for preparation |
| US5959177A (en) | 1989-10-27 | 1999-09-28 | The Scripps Research Institute | Transgenic plants expressing assembled secretory antibodies |
| CA2080584C (en) | 1990-04-18 | 2000-09-05 | Marc Cornelissen | Modified bacillus thuringiensis insecticidal-crystal protein genes and their expression in plant cells |
| US7262055B2 (en) | 1998-08-25 | 2007-08-28 | Gendaq Limited | Regulated gene expression in plants |
| US5693512A (en) | 1996-03-01 | 1997-12-02 | The Ohio State Research Foundation | Method for transforming plant tissue by sonication |
| FR2772787B1 (en) * | 1997-12-24 | 2001-12-07 | Rhone Poulenc Agrochimie | H3C4 PROMOTER OF BUT ASSOCIATED WITH THE FIRST INTRON OF RICE ACTINE, CHIMERIC GENE INCLUDING IT AND TRANSFORMED PLANT |
| WO2000011155A1 (en) * | 1998-08-19 | 2000-03-02 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and compositions for genomic modification |
| US20070083945A1 (en) | 2000-03-10 | 2007-04-12 | Byrum Joseph R | Nucleic acid molecules and other molecules associated with plants |
| US7612251B2 (en) | 2000-09-26 | 2009-11-03 | Pioneer Hi-Bred International, Inc. | Nucleotide sequences mediating male fertility and method of using same |
| US6967263B2 (en) | 2002-09-13 | 2005-11-22 | Monsanto Technology, L.L.C. | Soybean cultivar SN79525 |
| WO2004073390A1 (en) | 2003-02-19 | 2004-09-02 | Commonwealth Scientific And Industrial Research Organisation | Efficient gene silencing in plants using short dsrna sequences |
| US7935862B2 (en) | 2003-12-02 | 2011-05-03 | Syngenta Participations Ag | Targeted integration and stacking of DNA through homologous recombination |
| US20070199095A1 (en) | 2005-10-13 | 2007-08-23 | Edwards Allen | Methods for producing hybrid seed |
| AP2693A (en) * | 2005-05-27 | 2013-07-16 | Monsanto Technology Llc | Soybean event MON89788 and methods for detection thereof |
| EP1907553B1 (en) | 2005-07-18 | 2012-08-22 | Pioneer Hi-Bred International Inc. | Modified frt recombination sites and methods of use |
| US20070016985A1 (en) | 2005-07-18 | 2007-01-18 | Pioneer Hi-Bred International, Inc. | Particle Preparation for Direct-Delivery Transformation |
| NZ597299A (en) | 2005-08-26 | 2013-03-28 | Dupont Nutrition Biosci Aps | Use of a cas gene in combination with CRISPR repeats for modulating resistance in a cell |
| WO2011066384A1 (en) | 2009-11-24 | 2011-06-03 | Dow Agrosciences Llc | Aad-12 event 416, related transgenic soybean lines, and event-specific identification thereof |
| CN101484581A (en) | 2006-05-09 | 2009-07-15 | 密苏里大学学监 | Plant artificial chromosome platform by telomere truncation |
| WO2007134122A2 (en) | 2006-05-09 | 2007-11-22 | The Curators Of The University Of Missouri | Plant artificial chromosome platforms via telomere truncation |
| WO2008083233A2 (en) | 2006-12-29 | 2008-07-10 | Dow Agrosciences Llc | In vitro methods for the induction and maintenance of plant cell lines as single suspension cells with intact cell walls, and transformation thereof |
| AU2008258782B2 (en) * | 2007-06-05 | 2013-09-19 | Bayer Cropscience Ag | Methods and means for exact replacement of target DNA in eukaryotic organisms |
| WO2008148223A1 (en) | 2007-06-07 | 2008-12-11 | Agriculture And Agri-Food Canada | Nanocarrier based plant transfection and transduction |
| US8399218B2 (en) | 2007-09-27 | 2013-03-19 | Dow Agrosciences, Llc | Engineered zinc finger proteins targeting 5-enolpyruvyl shikimate-3-phosphate synthase genes |
| BRPI0817911B8 (en) | 2007-10-05 | 2022-06-28 | Dow Agrosciences Llc | PROCESSES FOR TRANSFER OF MOLECULAR SUBSTANCES INTO PLANT CELLS AND PROCESS FOR EXPRESSION OF A GENE |
| WO2009114321A2 (en) * | 2008-03-11 | 2009-09-17 | Precision Biosciencs, Inc. | Rationally-designed meganucleases for maize genome engineering |
| WO2010011961A2 (en) | 2008-07-25 | 2010-01-28 | University Of Georgia Research Foundation, Inc. | Prokaryotic rnai-like system and methods of use |
| US20100076057A1 (en) | 2008-09-23 | 2010-03-25 | Northwestern University | TARGET DNA INTERFERENCE WITH crRNA |
| AR074783A1 (en) | 2008-12-17 | 2011-02-09 | Dow Agrosciences Llc | METHODS AND COMPOSITIONS TO EXPRESS ONE OR MORE PRODUCTS OF A NUCLEIC ACID INTEGRATED TO LOCUS ZP15 OF A VEGETABLE CELL |
| US8293533B2 (en) | 2008-12-19 | 2012-10-23 | E.I. Du Pont De Nemours And Company | Site-specific integration and stacking of transgenes in soybean via DNA recombinase mediated cassette exchange |
| WO2010083178A1 (en) | 2009-01-16 | 2010-07-22 | Monsanto Technology Llc | Isolated novel nucleic acid and protein molecules from corn and methods of using those molecules to generate transgenic plants with enhanced agronomic traits |
| EP2417262B1 (en) | 2009-04-07 | 2015-05-20 | Dow AgroSciences LLC | Nanoparticle mediated delivery of sequence specific nucleases |
| US8704041B2 (en) | 2009-12-30 | 2014-04-22 | Pioneer Hi Bred International Inc | Methods and compositions for targeted polynucleotide modification |
| US20110203012A1 (en) | 2010-01-21 | 2011-08-18 | Dotson Stanton B | Methods and compositions for use of directed recombination in plant breeding |
| CA2787674C (en) | 2010-01-22 | 2022-09-06 | Dow Agrosciences Llc | Excision of transgenes in genetically modified organisms |
| GEP201606587B (en) | 2010-01-22 | 2017-01-10 | Dow Agrosciences Llc | Engineered landing pads for gene targeting in plants |
| JP5902631B2 (en) | 2010-01-22 | 2016-04-13 | ダウ アグロサイエンシィズ エルエルシー | Targeted genome modification |
| WO2011117249A1 (en) * | 2010-03-22 | 2011-09-29 | Philip Morris Products S.A. | Modifying enzyme activity in plants |
| EP2552191B1 (en) | 2010-03-31 | 2020-11-04 | Dow AgroSciences, LLC | Plant peptide gamma-zein for delivery of biomolecules into plant cells |
| EA024121B9 (en) | 2010-05-10 | 2017-01-30 | Дзе Реджентс Ов Дзе Юниверсити Ов Калифорния | COMPOSITIONS OF ENDORIBONUCLEAS AND METHODS OF THEIR USE |
| KR20130124296A (en) | 2010-07-07 | 2013-11-13 | 다우 아그로사이언시즈 엘엘씨 | Production of functionalized linear dna cassette and quantum dot/nanoparticle mediated delivery in plants |
| CA2804168C (en) | 2010-07-07 | 2020-02-18 | Dow Agrosciences Llc | Linear dna molecule delivery using pegylated quantum dots for stable transformation in plants |
| CA2830531C (en) | 2011-03-23 | 2019-10-15 | Dow Agrosciences Llc | Quantum dot carrier peptide conjugates suitable for imaging and delivery applications in plants |
| EP2689019A2 (en) | 2011-03-23 | 2014-01-29 | Pioneer Hi-Bred International Inc. | Methods for producing a complex transgenic trait locus |
| WO2012164565A1 (en) | 2011-06-01 | 2012-12-06 | Yeda Research And Development Co. Ltd. | Compositions and methods for downregulating prokaryotic genes |
| AR086995A1 (en) | 2011-06-21 | 2014-02-05 | Pioneer Hi Bred Int | METHODS AND COMPOSITIONS TO PRODUCE PLANTS WITH MALE STERILITY |
| US9951346B2 (en) | 2011-08-03 | 2018-04-24 | Pioneer Hi-Bred International, Inc. | Methods and compositions for targeted integration in a plant |
| AU2012299691B2 (en) | 2011-08-22 | 2015-01-29 | BASF Agricultural Solutions Seed US LLC | Methods and means to modify a plant genome |
| EP2776560A2 (en) | 2011-11-07 | 2014-09-17 | The University of Western Ontario | Endonuclease for genome editing |
| US20130157369A1 (en) | 2011-12-15 | 2013-06-20 | Dow Agrosciences Llc | Method for improved transformation using agrobacterium |
| GB201122458D0 (en) | 2011-12-30 | 2012-02-08 | Univ Wageningen | Modified cascade ribonucleoproteins and uses thereof |
| AR089793A1 (en) | 2012-01-27 | 2014-09-17 | Du Pont | METHODS AND COMPOSITIONS TO GENERATE COMPOSITE TRANSGENIC RISK LOCUS |
| US9637739B2 (en) | 2012-03-20 | 2017-05-02 | Vilnius University | RNA-directed DNA cleavage by the Cas9-crRNA complex |
| WO2013141680A1 (en) | 2012-03-20 | 2013-09-26 | Vilnius University | RNA-DIRECTED DNA CLEAVAGE BY THE Cas9-crRNA COMPLEX |
| JP6559063B2 (en) | 2012-05-07 | 2019-08-14 | サンガモ セラピューティクス, インコーポレイテッド | Methods and compositions for nuclease-mediated targeted integration of transgenes |
| RU2014151361A (en) | 2012-05-18 | 2016-07-10 | Пайонир Хай-Бред Интернэшнл, Инк. | SEQUENCES OF INDUCED PROMOTOR FOR REGULATED EXPRESSION AND METHODS OF APPLICATION |
| LT3401400T (en) | 2012-05-25 | 2019-06-10 | The Regents Of The University Of California | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
| JP2015527889A (en) | 2012-07-25 | 2015-09-24 | ザ ブロード インスティテュート, インコーポレイテッド | Inducible DNA binding protein and genomic disruption tools and their applications |
| UA119135C2 (en) | 2012-09-07 | 2019-05-10 | ДАУ АГРОСАЙЄНСІЗ ЕлЕлСі | Engineered transgene integration platform (etip) for gene targeting and trait stacking |
| US20140096284A1 (en) | 2012-10-01 | 2014-04-03 | Iowa State University Research Foundation, Inc. | Method for the delivery of molecules lyophilized onto microparticles to plant tissues |
| PL4397760T3 (en) | 2012-10-23 | 2026-03-30 | Toolgen Incorporated | A COMPOSITION FOR CLEFULNING A TARGET DNA COMPRISING A GUIDE RNA SPECIFIC FOR A TARGET DNA AND A NUCLEIC ACID ENCODING A CAS PROTEIN OR A CAS PROTEIN, AND USE THEREOF |
| US20150291967A1 (en) | 2012-10-31 | 2015-10-15 | Luc Mathis | Coupling herbicide resistance with targeted insertion of transgenes in plants |
| EP3135765A1 (en) | 2012-12-06 | 2017-03-01 | Sigma-Aldrich Co. LLC | Crispr-based genome modification and regulation |
| WO2014093479A1 (en) | 2012-12-11 | 2014-06-19 | Montana State University | Crispr (clustered regularly interspaced short palindromic repeats) rna-guided control of gene regulation |
| CN114634950A (en) | 2012-12-12 | 2022-06-17 | 布罗德研究所有限公司 | CRISPR-CAS component systems, methods, and compositions for sequence manipulation |
| EP2931898B1 (en) | 2012-12-12 | 2016-03-09 | The Broad Institute, Inc. | Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains |
| WO2014093701A1 (en) | 2012-12-12 | 2014-06-19 | The Broad Institute, Inc. | Functional genomics using crispr-cas systems, compositions, methods, knock out libraries and applications thereof |
| ES2576126T3 (en) | 2012-12-12 | 2016-07-05 | The Broad Institute, Inc. | Modification by genetic technology and optimization of improved enzyme systems, methods and compositions for sequence manipulation |
| IL239317B (en) | 2012-12-12 | 2022-07-01 | Broad Inst Inc | Delivery, engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications |
| EP2896697B1 (en) | 2012-12-12 | 2015-09-02 | The Broad Institute, Inc. | Engineering of systems, methods and optimized guide compositions for sequence manipulation |
| JP2016504026A (en) | 2012-12-12 | 2016-02-12 | ザ・ブロード・インスティテュート・インコーポレイテッド | Engineering systems, methods and optimization guide compositions for sequence manipulation |
| US20140310830A1 (en) | 2012-12-12 | 2014-10-16 | Feng Zhang | CRISPR-Cas Nickase Systems, Methods And Compositions For Sequence Manipulation in Eukaryotes |
| US8697359B1 (en) | 2012-12-12 | 2014-04-15 | The Broad Institute, Inc. | CRISPR-Cas systems and methods for altering expression of gene products |
| US20140173783A1 (en) | 2012-12-13 | 2014-06-19 | Dow Agrosciences Llc | Precision gene targeting to a particular locus in maize |
| SG10201912991WA (en) | 2012-12-17 | 2020-03-30 | Harvard College | Rna-guided human genome engineering |
| EP2958996B1 (en) | 2013-02-25 | 2019-10-16 | Sangamo Therapeutics, Inc. | Methods and compositions for enhancing nuclease-mediated gene disruption |
| UA123532C2 (en) | 2013-03-12 | 2021-04-21 | Е. І. Дю Пон Де Немур Енд Компані | Methods for the identification of variant recognition sites for rare-cutting engineered double-strand-break-inducing agents and compositions and uses thereof |
| SG11201507378UA (en) | 2013-03-14 | 2015-10-29 | Caribou Biosciences Inc | Compositions and methods of nucleic acid-targeting nucleic acids |
| US10378027B2 (en) | 2013-03-15 | 2019-08-13 | The General Hospital Corporation | RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci |
| US10113162B2 (en) | 2013-03-15 | 2018-10-30 | Cellectis | Modifying soybean oil composition through targeted knockout of the FAD2-1A/1B genes |
| US20140273235A1 (en) | 2013-03-15 | 2014-09-18 | Regents Of The University Of Minnesota | ENGINEERING PLANT GENOMES USING CRISPR/Cas SYSTEMS |
| US9234213B2 (en) | 2013-03-15 | 2016-01-12 | System Biosciences, Llc | Compositions and methods directed to CRISPR/Cas genomic engineering systems |
| JP2016522679A (en) | 2013-04-04 | 2016-08-04 | プレジデント アンド フェローズ オブ ハーバード カレッジ | Therapeutic use of genome editing with the CRISPR / Cas system |
| WO2014186686A2 (en) | 2013-05-17 | 2014-11-20 | Two Blades Foundation | Targeted mutagenesis and genome engineering in plants using rna-guided cas nucleases |
| WO2014194190A1 (en) | 2013-05-30 | 2014-12-04 | The Penn State Research Foundation | Gene targeting and genetic modification of plants via rna-guided genome editing |
| BR112016000571B1 (en) | 2013-07-10 | 2023-12-26 | President And Fellows Of Harvard College | IN VITRO METHODS FOR MODULATING EXPRESSION AND FOR ALTERING ONE OR MORE TARGET NUCLEIC ACIDS IN A CELL SIMULTANEOUSLY WITH REGULATING THE EXPRESSION OF ONE OR MORE TARGET NUCLEIC ACIDS IN A CELL AS WELL AS A YEAST OR BACTERIAL CELL COMPRISING NUCLEIC ACIDS |
| US20150044772A1 (en) | 2013-08-09 | 2015-02-12 | Sage Labs, Inc. | Crispr/cas system-based novel fusion protein and its applications in genome editing |
| US20150044192A1 (en) | 2013-08-09 | 2015-02-12 | President And Fellows Of Harvard College | Methods for identifying a target site of a cas9 nuclease |
| CA3221516A1 (en) | 2013-08-22 | 2015-02-26 | E. I. Du Pont De Nemours And Company | Plant genome modification using guide rna/cas endonuclease systems and methods of use |
| CA2916060A1 (en) | 2013-08-27 | 2015-03-05 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
| CN105682452B (en) | 2013-09-04 | 2018-10-16 | 美国陶氏益农公司 | Rapid Targeted Analysis for Identifying Donor Insertions in Crops |
| KR102269769B1 (en) | 2013-11-04 | 2021-06-28 | 코르테바 애그리사이언스 엘엘씨 | Optimal maize loci |
| US10077449B2 (en) | 2013-11-04 | 2018-09-18 | Dow Agrosciences Llc | Universal donor system for gene targeting |
| MX358066B (en) | 2013-11-04 | 2018-08-03 | Dow Agrosciences Llc | Optimal soybean loci. |
| UY35814A (en) | 2013-11-04 | 2015-05-29 | Dow Agrosciences Llc | ? OPTIMAL PLACES FOR SOYBEAN ?. |
| BR102014027442B1 (en) | 2013-11-04 | 2022-09-27 | Dow Agrosciences Llc | RECOMBINANT NUCLEIC ACID MOLECULE, USE OF A CORN PLANT, PART OF A CORN PLANT OR CORN PLANT CELL COMPRISING THE SAME AND METHOD TO PRODUCE A TRANSGENIC PLANT CELL COMPRISING A DNA OF INTEREST |
| CA2930877A1 (en) | 2013-11-18 | 2015-05-21 | Crispr Therapeutics Ag | Crispr-cas system materials and methods |
| US20150166984A1 (en) | 2013-12-12 | 2015-06-18 | President And Fellows Of Harvard College | Methods for correcting alpha-antitrypsin point mutations |
| JP2017503514A (en) | 2014-01-24 | 2017-02-02 | ノースカロライナ ステート ユニバーシティーNorth Carolina State University | Methods and compositions relating to sequences that guide CAS9 targeting |
| EP3971283A1 (en) | 2014-02-27 | 2022-03-23 | Monsanto Technology LLC | Compositions and methods for site directed genomic modification |
| US11584936B2 (en) | 2014-06-12 | 2023-02-21 | King Abdullah University Of Science And Technology | Targeted viral-mediated plant genome editing using CRISPR /Cas9 |
| CN106687594A (en) | 2014-07-11 | 2017-05-17 | 纳幕尔杜邦公司 | Compositions and methods for producing plants resistant to glyphosate herbicide |
| WO2016007948A1 (en) | 2014-07-11 | 2016-01-14 | Pioneer Hi-Bred International, Inc. | Agronomic trait modification using guide rna/cas endonuclease systems and methods of use |
| US10450584B2 (en) | 2014-08-28 | 2019-10-22 | North Carolina State University | Cas9 proteins and guiding features for DNA targeting and genome editing |
| BR112017003757A2 (en) | 2014-09-12 | 2017-12-26 | Du Pont | ? corn plants, parts of corn plants or corn seeds? |
| SI3250691T1 (en) | 2015-01-28 | 2023-10-30 | Caribou Biosciences, Inc. | Crispr hybrid dna/rna polynucleotides and methods of use |
| EP3262176A1 (en) | 2015-02-25 | 2018-01-03 | Pioneer Hi-Bred International, Inc. | Composition and methods for regulated expression of a guide rna/cas endonuclease complex |
| WO2016149352A1 (en) | 2015-03-19 | 2016-09-22 | Pioneer Hi-Bred International Inc | Methods and compositions for accelerated trait introgression |
| EP3553178A1 (en) | 2015-03-27 | 2019-10-16 | E. I. du Pont de Nemours and Company | Soybean u6 small nuclear rna gene promoters and their use in constitutive expression of small rna genes in plants |
| EP3294878A1 (en) | 2015-05-15 | 2018-03-21 | Pioneer Hi-Bred International, Inc. | Guide rna/cas endonuclease systems |
| DE102015006335A1 (en) | 2015-05-19 | 2016-11-24 | Kws Saat Se | Methods and constructs for targeted nucleic acid editing in plants |
| US10883103B2 (en) | 2015-06-02 | 2021-01-05 | Monsanto Technology Llc | Compositions and methods for delivery of a polynucleotide into a plant |
| WO2017015015A1 (en) | 2015-07-17 | 2017-01-26 | Emory University | Crispr-associated protein from francisella and uses related thereto |
| CN114606226A (en) | 2015-08-21 | 2022-06-10 | 孟山都技术公司 | Enhanced recombination of genomic loci |
| US11692182B2 (en) | 2015-10-09 | 2023-07-04 | Monsanto Technology Llc | RNA-guided DNA nucleases and uses thereof |
| EP4089175A1 (en) | 2015-10-13 | 2022-11-16 | Duke University | Genome engineering with type i crispr systems in eukaryotic cells |
| CN108138155A (en) | 2015-10-20 | 2018-06-08 | 先锋国际良种公司 | Restoring the function of a non-functional gene product via a guided CAS system and methods of use |
| US20180258438A1 (en) | 2015-11-06 | 2018-09-13 | Pioneer Hi-Bred International, Inc. | Generation of complex trait loci in soybean and methods of use |
| CN115216459B (en) | 2015-12-29 | 2024-06-28 | 孟山都技术公司 | Novel CRISPR-associated transposase and its use |
| WO2017155715A1 (en) | 2016-03-11 | 2017-09-14 | Pioneer Hi-Bred International, Inc. | Novel cas9 systems and methods of use |
| CA3010628A1 (en) | 2016-03-11 | 2017-09-14 | Pioneer Hi-Bred International, Inc. | Novel cas9 systems and methods of use |
| EP3426780A1 (en) | 2016-03-11 | 2019-01-16 | Pioneer Hi-Bred International, Inc. | Novel cas9 systems and methods of use |
| GB201610041D0 (en) | 2016-06-08 | 2016-07-20 | Oxford Genetics Ltd | Methods |
| MX2018014993A (en) | 2016-06-14 | 2019-09-06 | Pioneer Hi Bred Int | Use of cpf1 endonuclease for plant genome modifications. |
| WO2017222773A1 (en) | 2016-06-20 | 2017-12-28 | Pioneer Hi-Bred International, Inc. | Novel cas systems and methods of use |
| CN110914433A (en) | 2017-03-24 | 2020-03-24 | 库尔维科公司 | Nucleic acids encoding CRISPR-associated proteins and uses thereof |
-
2012
- 2012-03-22 EP EP12712040.0A patent/EP2689019A2/en not_active Withdrawn
- 2012-03-22 MX MX2013010911A patent/MX2013010911A/en unknown
- 2012-03-22 CN CN201280022453.3A patent/CN103842511A/en active Pending
- 2012-03-22 CA CA2831144A patent/CA2831144A1/en not_active Abandoned
- 2012-03-22 WO PCT/US2012/030061 patent/WO2012129373A2/en not_active Ceased
- 2012-03-22 US US13/427,138 patent/US10030245B2/en active Active
- 2012-03-22 BR BR112013024337A patent/BR112013024337A2/en not_active Application Discontinuation
- 2012-03-22 EA EA201391373A patent/EA201391373A1/en unknown
- 2012-03-22 AR ARP120100959A patent/AR085533A1/en unknown
-
2013
- 2013-09-26 ZA ZA2013/07200A patent/ZA201307200B/en unknown
-
2018
- 2018-06-13 US US16/007,529 patent/US10822610B2/en active Active
-
2020
- 2020-07-10 US US16/925,973 patent/US11459576B2/en active Active
-
2022
- 2022-08-23 US US17/821,528 patent/US12338444B2/en active Active
-
2025
- 2025-05-16 US US19/210,051 patent/US20250277227A1/en active Pending
Patent Citations (115)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4945050A (en) | 1984-11-13 | 1990-07-31 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues and apparatus therefor |
| US5569597A (en) | 1985-05-13 | 1996-10-29 | Ciba Geigy Corp. | Methods of inserting viral DNA into plant material |
| US5759829A (en) | 1986-03-28 | 1998-06-02 | Calgene, Inc. | Antisense regulation of gene expression in plant cells |
| US5107065A (en) | 1986-03-28 | 1992-04-21 | Calgene, Inc. | Anti-sense regulation of gene expression in plant cells |
| US5380831A (en) | 1986-04-04 | 1995-01-10 | Mycogen Plant Science, Inc. | Synthetic insecticidal crystal protein gene |
| US5268463A (en) | 1986-11-11 | 1993-12-07 | Jefferson Richard A | Plant promoter α-glucuronidase gene construct |
| US5608142A (en) | 1986-12-03 | 1997-03-04 | Agracetus, Inc. | Insecticidal cotton plants |
| US4873192A (en) | 1987-02-17 | 1989-10-10 | The United States Of America As Represented By The Department Of Health And Human Services | Process for site specific mutagenesis without phenotypic selection |
| US5889190A (en) | 1988-02-26 | 1999-03-30 | Biosource Technologies, Inc. | Recombinant plant viral nucleic acids |
| US5316931A (en) | 1988-02-26 | 1994-05-31 | Biosource Genetics Corp. | Plant viral vectors having heterologous subgenomic promoters for systemic expression of foreign genes |
| US5589367A (en) | 1988-02-26 | 1996-12-31 | Biosource Technologies, Inc. | Recombinant plant viral nucleic acids |
| US5866785A (en) | 1988-02-26 | 1999-02-02 | Biosource Technologies, Inc. | Recombinant plant viral nucleic acids |
| US5886244A (en) | 1988-06-10 | 1999-03-23 | Pioneer Hi-Bred International, Inc. | Stable transformation of plant cells |
| US5023179A (en) | 1988-11-14 | 1991-06-11 | Eric Lam | Promoter enhancer element for gene expression in plant roots |
| US5110732A (en) | 1989-03-14 | 1992-05-05 | The Rockefeller University | Selective gene expression in plants |
| US5283184A (en) | 1989-03-30 | 1994-02-01 | Dna Plant Technology Corporation | Genetic engineering of novel plant phenotypes |
| US5034323A (en) | 1989-03-30 | 1991-07-23 | Dna Plant Technology Corporation | Genetic engineering of novel plant phenotypes |
| US5240855A (en) | 1989-05-12 | 1993-08-31 | Pioneer Hi-Bred International, Inc. | Particle gun |
| US5879918A (en) | 1989-05-12 | 1999-03-09 | Pioneer Hi-Bred International, Inc. | Pretreatment of microprojectiles prior to using in a particle gun |
| US5322783A (en) | 1989-10-17 | 1994-06-21 | Pioneer Hi-Bred International, Inc. | Soybean transformation by microparticle bombardment |
| US5466785A (en) | 1990-04-12 | 1995-11-14 | Ciba-Geigy Corporation | Tissue-preferential promoters |
| US5723756A (en) | 1990-04-26 | 1998-03-03 | Plant Genetic Systems, N.V. | Bacillus thuringiensis strains and their genes encoding insecticidal toxins |
| US5608149A (en) | 1990-06-18 | 1997-03-04 | Monsanto Company | Enhanced starch biosynthesis in tomatoes |
| US5932782A (en) | 1990-11-14 | 1999-08-03 | Pioneer Hi-Bred International, Inc. | Plant transformation method using agrobacterium species adhered to microprojectiles |
| US5366892A (en) | 1991-01-16 | 1994-11-22 | Mycogen Corporation | Gene encoding a coleopteran-active toxin |
| US5459252A (en) | 1991-01-31 | 1995-10-17 | North Carolina State University | Root specific gene promoter |
| US5399680A (en) | 1991-05-22 | 1995-03-21 | The Salk Institute For Biological Studies | Rice chitinase promoter |
| WO1993001294A1 (en) | 1991-07-02 | 1993-01-21 | Zeneca Limited | Plant-derived enzyme and dna sequences, and uses thereof |
| US5747450A (en) | 1991-08-02 | 1998-05-05 | Kubota Corporation | Microorganism and insecticide |
| US5604121A (en) | 1991-08-27 | 1997-02-18 | Agricultural Genetics Company Limited | Proteins with insecticidal properties against homopteran insects and their use in plant protection |
| US5750386A (en) | 1991-10-04 | 1998-05-12 | North Carolina State University | Pathogen-resistant transgenic plants |
| US5436391A (en) | 1991-11-29 | 1995-07-25 | Mitsubishi Corporation | Synthetic insecticidal gene, plants of the genus oryza transformed with the gene, and production thereof |
| US5324646A (en) | 1992-01-06 | 1994-06-28 | Pioneer Hi-Bred International, Inc. | Methods of regeneration of Medicago sativa and expressing foreign DNA in same |
| US5792632A (en) | 1992-05-05 | 1998-08-11 | Institut Pasteur | Nucleotide sequence encoding the enzyme I-SceI and the uses thereof |
| US6610545B2 (en) | 1992-05-05 | 2003-08-26 | Institut Pasteur | Nucleotide sequence encoding the enzyme I-SceI and the uses thereof |
| US5942657A (en) | 1992-05-13 | 1999-08-24 | Zeneca Limited | Co-ordinated inhibition of plant gene expression |
| US5401836A (en) | 1992-07-16 | 1995-03-28 | Pioneer Hi-Bre International, Inc. | Brassica regulatory sequence for root-specific or root-abundant gene expression |
| US5563055A (en) | 1992-07-27 | 1996-10-08 | Pioneer Hi-Bred International, Inc. | Method of Agrobacterium-mediated transformation of cultured soybean cells |
| US5602321A (en) | 1992-11-20 | 1997-02-11 | Monsanto Company | Transgenic cotton plants producing heterologous polyhydroxy(e) butyrate bioplastic |
| US5889191A (en) | 1992-12-30 | 1999-03-30 | Biosource Technologies, Inc. | Viral amplification of recombinant messenger RNA in transgenic plants |
| US5990389A (en) | 1993-01-13 | 1999-11-23 | Pioneer Hi-Bred International, Inc. | High lysine derivatives of α-hordothionin |
| US5527695A (en) | 1993-01-29 | 1996-06-18 | Purdue Research Foundation | Controlled modification of eukaryotic genomes |
| US5583210A (en) | 1993-03-18 | 1996-12-10 | Pioneer Hi-Bred International, Inc. | Methods and compositions for controlling plant development |
| US5789156A (en) | 1993-06-14 | 1998-08-04 | Basf Ag | Tetracycline-regulated transcriptional inhibitors |
| US5814618A (en) | 1993-06-14 | 1998-09-29 | Basf Aktiengesellschaft | Methods for regulating gene expression |
| US20030059767A1 (en) | 1994-01-18 | 2003-03-27 | Barbas Iii Carlos F. | Zinc finger protein derivatives and methods therefor |
| US6140466A (en) | 1994-01-18 | 2000-10-31 | The Scripps Research Institute | Zinc finger protein derivatives and methods therefor |
| US5593881A (en) | 1994-05-06 | 1997-01-14 | Mycogen Corporation | Bacillus thuringiensis delta-endotoxin |
| US5633363A (en) | 1994-06-03 | 1997-05-27 | Iowa State University, Research Foundation In | Root preferential promoter |
| US5736369A (en) | 1994-07-29 | 1998-04-07 | Pioneer Hi-Bred International, Inc. | Method for producing transgenic cereal plants |
| US5608144A (en) | 1994-08-12 | 1997-03-04 | Dna Plant Technology Corp. | Plant group 2 promoters and uses thereof |
| US5792931A (en) | 1994-08-12 | 1998-08-11 | Pioneer Hi-Bred International, Inc. | Fumonisin detoxification compositions and methods |
| US5736514A (en) | 1994-10-14 | 1998-04-07 | Nissan Chemical Industries, Ltd. | Bacillus strain and harmful organism controlling agents |
| US5659026A (en) | 1995-03-24 | 1997-08-19 | Pioneer Hi-Bred International | ALS3 promoter |
| US5885801A (en) | 1995-06-02 | 1999-03-23 | Pioneer Hi-Bred International, Inc. | High threonine derivatives of α-hordothionin |
| US5885802A (en) | 1995-06-02 | 1999-03-23 | Pioneer Hi-Bred International, Inc. | High methionine derivatives of α-hordothionin |
| US5888732A (en) | 1995-06-07 | 1999-03-30 | Life Technologies, Inc. | Recombinational cloning using engineered recombination sites |
| US5837876A (en) | 1995-07-28 | 1998-11-17 | North Carolina State University | Root cortex specific gene promoter |
| US5703049A (en) | 1996-02-29 | 1997-12-30 | Pioneer Hi-Bred Int'l, Inc. | High methionine derivatives of α-hordothionin for pathogen-control |
| US5850016A (en) | 1996-03-20 | 1998-12-15 | Pioneer Hi-Bred International, Inc. | Alteration of amino acid compositions in seeds |
| US6175056B1 (en) | 1996-04-29 | 2001-01-16 | The Procter & Gamble Company | Disposable absorbent article having an expanding topsheet and being capable of self-shaping in use |
| US6072050A (en) | 1996-06-11 | 2000-06-06 | Pioneer Hi-Bred International, Inc. | Synthetic promoters |
| US6300543B1 (en) | 1996-07-08 | 2001-10-09 | Pioneer Hi-Bred International, Inc. | Transformation of zygote, egg or sperm cells and recovery of transformed plants from isolated embryo sacs |
| WO1998020133A2 (en) | 1996-11-01 | 1998-05-14 | Pioneer Hi-Bred International, Inc. | Proteins with enhanced levels of essential amino acids |
| US5981840A (en) | 1997-01-24 | 1999-11-09 | Pioneer Hi-Bred International, Inc. | Methods for agrobacterium-mediated transformation |
| US20030175965A1 (en) | 1997-05-21 | 2003-09-18 | Lowe Alexandra Louise | Gene silencing |
| WO1999025851A1 (en) | 1997-11-13 | 1999-05-27 | Sumitomo Pharmaceuticals Company, Limited | VARIANT loxP SEQUENCES AND APPLICATION OF THE SAME |
| WO1999025841A1 (en) | 1997-11-18 | 1999-05-27 | Pioneer Hi-Bred International, Inc. | Novel nucleic acid sequence encoding flp recombinase |
| US5929301A (en) | 1997-11-18 | 1999-07-27 | Pioneer Hi-Bred International | Nucleic acid sequence encoding FLP recombinase |
| WO1999025840A1 (en) | 1997-11-18 | 1999-05-27 | Pioneer Hi-Bred International, Inc. | A novel method for the integration of foreign dna into eukaryoticgenomes |
| WO1999025855A1 (en) | 1997-11-18 | 1999-05-27 | Pioneer Hi-Bred International, Inc. | Mobilization of viral genomes from t-dna using site-specific recombination systems |
| WO1999025821A1 (en) | 1997-11-18 | 1999-05-27 | Pioneer Hi-Bred International, Inc. | Compositions and methods for genetic modification of plants |
| US6331661B1 (en) | 1997-11-18 | 2001-12-18 | Pioneer Hi-Bred International, Inc. | Method for directional stable transformation of eukaryotic cells |
| WO1999043838A1 (en) | 1998-02-24 | 1999-09-02 | Pioneer Hi-Bred International, Inc. | Synthetic promoters |
| US6177611B1 (en) | 1998-02-26 | 2001-01-23 | Pioneer Hi-Bred International, Inc. | Maize promoters |
| WO1999049029A1 (en) | 1998-03-20 | 1999-09-30 | Benitec Australia Ltd | Control of gene expression |
| WO1999053050A1 (en) | 1998-04-08 | 1999-10-21 | Commonwealth Scientific And Industrial Research Organisation | Methods and means for obtaining modified phenotypes |
| WO1999061631A1 (en) | 1998-05-26 | 1999-12-02 | Novartis Ag | Dsrna-mediated regulation of gene expression in plants |
| WO2000011177A1 (en) | 1998-08-20 | 2000-03-02 | Pioneer Hi-Bred International, Inc. | Seed-preferred promoters |
| US6225529B1 (en) | 1998-08-20 | 2001-05-01 | Pioneer Hi-Bred International, Inc. | Seed-preferred promoters |
| US6453242B1 (en) | 1999-01-12 | 2002-09-17 | Sangamo Biosciences, Inc. | Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites |
| WO2000042219A1 (en) | 1999-01-12 | 2000-07-20 | Sangamo Biosciences, Inc. | Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites |
| WO2000049035A1 (en) | 1999-02-19 | 2000-08-24 | The General Hospital Corporation | Gene silencing |
| WO2001007572A2 (en) | 1999-07-23 | 2001-02-01 | The Regents Of The University Of California | Dna recombination in eukaryotic cells by the bacteriophage phic31 recombination system |
| WO2001011058A1 (en) | 1999-08-09 | 2001-02-15 | Monsanto Technology Llc | Novel cloning methods and vectors |
| WO2001023545A1 (en) | 1999-09-30 | 2001-04-05 | Sumitomo Pharmaceuticals Company, Limited | Dna containing variant frt sequences |
| US6511808B2 (en) | 2000-04-28 | 2003-01-28 | Sangamo Biosciences, Inc. | Methods for designing exogenous regulatory molecules |
| US20020048814A1 (en) | 2000-08-15 | 2002-04-25 | Dna Plant Technology Corporation | Methods of gene silencing using poly-dT sequences |
| US20040082770A1 (en) | 2000-10-30 | 2004-04-29 | Verdia, Inc. | Novel glyphosate N-acetyltransferase (GAT) genes |
| WO2002042459A2 (en) | 2000-11-20 | 2002-05-30 | Sangamo Biosciences, Inc. | Position dependent recognition of gnn nucleotide triplets by zinc fingers |
| US20030108880A1 (en) | 2001-01-22 | 2003-06-12 | Sangamo Biosciences | Modified zinc finger binding proteins |
| WO2002099084A2 (en) | 2001-04-04 | 2002-12-12 | Gendaq Limited | Composite binding polypeptides |
| US20050172365A1 (en) | 2001-07-04 | 2005-08-04 | Holger Puchta | Recombination systems and methods for eliminating nucleic acid sequences from the genome of eukaryotic organisms |
| WO2003008045A2 (en) | 2001-07-16 | 2003-01-30 | Uv & P Umweltmanagement - Verfahrenstechnik Neubacher & Partner Ges.M.B.H. | Methods for the immobilisation of combustion residues |
| WO2003062455A2 (en) | 2002-01-23 | 2003-07-31 | Syngenta Biotechnology, Inc. | Zinc finger domain recognition code and uses thereof |
| US20030180945A1 (en) | 2002-03-14 | 2003-09-25 | Ming-Bo Wang | Modified gene-silencing RNA and uses thereof |
| WO2003078619A1 (en) | 2002-03-15 | 2003-09-25 | Cellectis | Hybrid and single chain meganucleases and use thereof |
| WO2003092360A2 (en) | 2002-04-30 | 2003-11-13 | Verdia, Inc. | Novel glyphosate-n-acetyltransferase (gat) genes |
| WO2004031346A2 (en) | 2002-09-06 | 2004-04-15 | Fred Hutchinson Cancer Research Center | Methods and compositions concerning designed highly-specific nucleic acid binding proteins |
| WO2004067736A2 (en) | 2003-01-28 | 2004-08-12 | Cellectis | Custom-made meganuclease and use thereof |
| WO2005028942A1 (en) | 2003-09-23 | 2005-03-31 | Carsphairn Limited | A pipeline apparatus |
| US20060282914A1 (en) | 2003-11-18 | 2006-12-14 | D Halluin Kathleen | Targeted dna insertion in plants |
| US20090328252A1 (en) | 2004-02-02 | 2009-12-31 | Pioneer Hi-Bred International, Inc. | Ap2 domain transcription factor odp2 (ovule development protein 2) and methods of use |
| WO2005105989A1 (en) | 2004-04-30 | 2005-11-10 | Cellectis | I-dmoi derivatives with enhanced activity at 37°c and use thereof. |
| WO2006097854A1 (en) | 2005-03-15 | 2006-09-21 | Cellectis | Heterodimeric meganucleases and use thereof |
| WO2006097784A1 (en) | 2005-03-15 | 2006-09-21 | Cellectis | I-crei meganuclease variants with modified specificity, method of preparation and uses thereof |
| WO2006097853A1 (en) | 2005-03-15 | 2006-09-21 | Cellectis | I-crei meganuclease variants with modified specificity, method of preparation and uses thereof |
| US20070117128A1 (en) | 2005-10-18 | 2007-05-24 | Smith James J | Rationally-designed meganucleases with altered sequence specificity and DNA-binding affinity |
| US20080051288A1 (en) | 2006-06-28 | 2008-02-28 | Pioneer Hi-Bred International, Inc | Soybean event 3560.4.3.5 and compositions and methods for the identification and detection thereof |
| US20100184079A1 (en) | 2006-06-28 | 2010-07-22 | Pioneer Hi-Bred International, Inc. | Soybean event 3560.4.3.5 and compositions and methods for the identification and detection thereof |
| US20090036308A1 (en) | 2006-06-28 | 2009-02-05 | Pioneer Hi-Bred International, Inc. | Soybean event 3560.4.3.5 and compositions and methods for the identification and/or detection thereof |
| US20080312082A1 (en) | 2006-10-31 | 2008-12-18 | Kinney Anthony J | Soybean event dp-305423-1 and compositions and methods for the identification and/or detection thereof |
| US20090133152A1 (en) | 2007-06-29 | 2009-05-21 | Pioneer Hi-Bred International, Inc. | Methods for altering the genome of a monocot plant cell |
| WO2009006297A2 (en) | 2007-06-29 | 2009-01-08 | Pioneer Hi-Bred International, Inc. | Methods for altering the genome of a monocot plant cell |
| WO2010079430A1 (en) | 2009-01-12 | 2010-07-15 | Ulla Bonas | Modular dna-binding domains and methods of use |
Non-Patent Citations (298)
| Title |
|---|
| "Current Protocols in Molecular Biology", 1994, CURRENT PROTOCOLS |
| ABREMSKI ET AL., J BIOL CHEM, vol. 259, 1984, pages 1509 - 14 |
| ABREMSKI ET AL., PROTEIN ENG, vol. 5, 1992, pages 87 - 91 |
| ALBERT ET AL., PLANT J, vol. 7, 1995, pages 649 - 59 |
| AMOLD ET AL., EMBO J, vol. 18, 1999, pages 1407 - 14 |
| AMOULD ET AL., J MOL BIOL, vol. 355, 2006, pages 443 - 58 |
| ASHWORTH ET AL., NATURE, vol. 441, 2006, pages 656 - 9 |
| AUFSATZ ET AL., PNAS, vol. 99, no. 4, 2002, pages 16499 - 16506 |
| AUSUBEL ET AL.,: "Current Protocols in Molecular Biology", 1995, GREENE PUBLISHING AND WILEY-INTERSCIENCE |
| AYARES ET AL., PROC. NATL. ACAD. SCI. USA, vol. 83, 1986, pages 5199 - 203 |
| BAIM ET AL., PROC. NATL. ACAD. SCI. USA, vol. 88, 1991, pages 5072 - 6 |
| BALLESTER ET AL., PLANT CELL REP, vol. 26, 2006, pages 39 - 45 |
| BEERLI; BARBAS, NAT BIOTECHNOL, vol. 20, 2002, pages 135 - 41 |
| BELFORT ET AL.: "Mobile DNA II", 2002, ASM PRESS, pages: 761 - 783 |
| BIBIKOVA ET AL., MOL. CELL BIOI., vol. 21, 2001, pages 289 - 297 |
| BJORNSTI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 84, 1987, pages 8971 - 5 |
| BLEUYARD ET AL., DNA REPAIR, vol. 5, 2006, pages 1 - 12 |
| BOGUSZ ET AL., PLANT CELL, vol. 2, 1990, pages 633 - 41 |
| BONIN, PH.D. THESIS, 1993 |
| BROIN ET AL., PLANT CE/I, vol. 14, 2002, pages 1417 - 1432 |
| BROIN ET AL., PLANT CELL, vol. 14, 2002, pages 1417 - 1432 |
| BRONSON, J BIOL CHEM, vol. 269, 1994, pages 27155 - 8 |
| BROWN ET AL., CELL, vol. 49, 1987, pages 603 - 12 |
| BUCHHOLZ ET AL., NAT BIOTECHNOL, vol. 16, 1998, pages 617 - 8 |
| BUCHHOLZ; STEWART, NAT BIOTECHNOL, vol. 19, 2001, pages 1047 - 52 |
| BYTEBIER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 84, 1987, pages 5345 - 9 |
| CAMPBELL; GOWRI, PLANT PHYSIOL., vol. 92, 1990, pages 1 - 11 |
| CANEVASCINI ET AL., PLANT PHYSIOL, vol. 112, 1996, pages 513 - 524 |
| CAPANA ET AL., PLANT MOL BIOL, vol. 25, 1994, pages 681 - 91 |
| CAPECCHI, TRENDS GENET, vol. 5, 1989, pages 70 - 6 |
| CARROLL ET AL., NATURE PROTOCOLS, vol. 1, 2006, pages 1329 |
| CHAMES ET AL., NUCLEIC ACIDS RES, vol. 33, 2005, pages E178 |
| CHAVEROCHE ET AL., NUCLEIC ACIDS RES, vol. 28, 2000, pages E97 |
| CHEN ET AL., SOMAT CELL MOL GENET, vol. 22, 1996, pages 477 - 88 |
| CHEN; ZHAO, NUCLEIC ACIDS RES, vol. 33, 2005, pages E154 |
| CHEVALIER ET AL., MOL CELL, vol. 10, 2002, pages 895 - 905 |
| CHEVALIER ET AL., NUCLEIC ACIDS RES, vol. 29, 2001, pages 3757 - 3774 |
| CHILTON; QUE, PLANT PHYSIOL, vol. 133, 2003, pages 956 - 65 |
| CHIURAZZI ET AL., PLANT CE, vol. 8, 1996, pages 2057 - 66 |
| CHRIST ET AL., J MOL BIO, vol. 288, 1998, pages 825 - 36 |
| CHRISTENSEN ET AL., PLANT MOL BIOL, vol. 12, 1989, pages 619 - 32 |
| CHRISTENSEN ET AL., PLANT MOL BIOL, vol. 18, 1992, pages 675 - 89 |
| CHRISTIAN ET AL., GENETICS, vol. 186, 2010, pages 757 - 761 |
| CHRISTOPHERSON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 6314 - 8 |
| CHRISTOU ET AL., PLANT PHYSIOL, vol. 87, 1988, pages 671 - 4 |
| CHRISTOU; FORD, ANNALS BOTANY, vol. 75, 1995, pages 407 - 13 |
| CHUANG; MEYEROWITZ, PROC. NATL. ACAD. SCI. USA, vol. 97, 2000, pages 4985 - 4990 |
| COX, PROC. NATL. ACAD. SCI. USA, vol. 80, 1993, pages 4223 - 7 |
| CROSSWAY ET AL., BIOTECHNIQUES, vol. 4, 1986, pages 320 - 34 |
| CROSSWAY ET AL., MOL GEN GENET, vol. 202, 1986, pages 179 - 85 |
| DATTA ET AL., BIOTECHNOLOGY, vol. 8, 1990, pages 736 - 40 |
| DAYHOFF ET AL.: "Atlas of Protein Sequence and Structure", 1978, NATL BIOMED RES FOUND |
| DE ALMEIDA ET AL., MOL GEN GENETICS, vol. 218, 1989, pages 78 - 86 |
| DE VEYLDER ET AL., PLANT CELL PHYSIOL, vol. 38, 1997, pages 568 - 77 |
| DE WET ET AL.: "The Experimental Manipulation of Ovule Tissues", 1985, LONGMAN, pages: 197 - 209 |
| DEGENKOLB ET AL., ANTIMICROB AGENTS CHEMOTHER, vol. 35, 1991, pages 1591 - 5 |
| DEUSCHLE ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 5400 - 4 |
| DEUSCHLE ET AL., SCIENCE, vol. 248, 1990, pages 480 - 3 |
| D'HALLUIN ET AL., PLANT CEG, vol. 4, 1992, pages 1495 - 505 |
| DJUKANOVIC ET AL., PLANT BIOTECH J, vol. 4, 2006, pages 345 - 57 |
| DORGA ET AL., J MOL BIOL, vol. 277, 1998, pages 1059 - 70 |
| DORGAI ET AL., J MOL BIOL, vol. 252, 1995, pages 178 - 88 |
| DOYON ET AL., J AM CHEM SOC, vol. 128, 2006, pages 2477 - 84 |
| DRAY; GLOOR, GENETICS, vol. 147, 1997, pages 689 - 99 |
| DREIER ET AL., J BIOL CHEM, vol. 276, 2001, pages 29466 - 78 |
| DREIER ET AL., J BIOL CHEM, vol. 280, 2005, pages 35588 - 97 |
| DREIER ET AL., J MOL BIOL, vol. 303, 2000, pages 489 - 502 |
| DURAI ET AL., NUCLEIC ACIDS RES, vol. 33, 2005, pages 5978 - 90 |
| EPINAT ET AL., NUCLEIC ACIDS RES, vol. 31, 2003, pages 2952 - 62 |
| ESPOSITO ET AL., NUCLEIC ACIDS RES, vol. 25, 1997, pages 3605 - 14 |
| FIGGE ET AL., CELL, vol. 52, 1988, pages 713 - 22 |
| FINER; MCMULLEN, IN VITRO CELL DEV BIOL, vol. 27P, 1991, pages 175 - 82 |
| FLAVELL ET AL., PROC. NATL. ACAD. SCI. USA, vol. 91, 1994, pages 3490 - 3496 |
| FROMM ET AL., BIOTECHNOLOGY, vol. 8, 1990, pages 833 - 9 |
| FUERST ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 2549 - 53 |
| GAERTIG ET AL., NUCLEIC ACIDS RES, vol. 22, 1994, pages 5391 - 8 |
| GAO ET AL., PLANT J, vol. 61, 2010, pages 176 - 87 |
| GATZ ET AL., MOL GEN GENET, vol. 227, 1991, pages 229 - 37 |
| GEISER ET AL., GENE, vol. 48, 1986, pages 109 |
| GILL ET AL., NATURE, vol. 334, 1988, pages 721 - 4 |
| GIMBLE ET AL., MOL BIOL, vol. 334, 2003, pages 993 - 1008 |
| GLOOR ET AL., SCIENCE, vol. 253, 1991, pages 1110 - 1117 |
| GOLIC ET AL., NUCLEIC ACIDS RES, vol. 25, 1997, pages 3665 |
| GOSSEN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 5547 - 51 |
| GOSSEN, PH.D. THESIS, 1993 |
| GOTOR ET AL., PLANT J, vol. 3, 1993, pages 509 - 18 |
| GRINDLEY ET AL., ANN REV BIOCHEM, vol. 16, 2006, pages 16 |
| GRUEN ET AL., NUCLEIC ACIDS RES, vol. 30, 2002, pages E29 |
| GUAN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 99, 2002, pages 13296 - 301 |
| GUEVARA-GARCIA ET AL., PLANT J, vol. 4, 1993, pages 495 - 505 |
| GUHAN; MUNIYAPPA, CRIT REV BIOCHEM MOL BIOL, vol. 38, 2003, pages 199 - 248 |
| GUO ET AL., NATURE, vol. 389, 1997, pages 40 - 6 |
| HALFTER ET AL., MOL GEN GENET, vol. 231, 1992, pages 186 - 93 |
| HALLUIN ET AL., PLANT BIOTECHNOL. J., vol. 6, 2008, pages 93 - 102 |
| HANIN ET AL., PLANT J, vol. 28, 2001, pages 671 - 7 |
| HANSEN ET AL., MOL GEN GENET, vol. 254, 1997, pages 337 - 43 |
| HARTLEY ET AL., NATURE, vol. 286, 1980, pages 860 - 4 |
| HARTUNG ET AL., J BIOL CHEM, vol. 273, 1998, pages 22884 - 91 |
| HELLIWELL; WATERHOUSE, METHODS, vol. 30, 2003, pages 289 - 295 |
| HENIKOFF; HENIKOFF, PROC. NATL. ACAD. SCI. USA, vol. 89, 1989, pages 10915 |
| HEPLER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 91, 1994, pages 2176 - 80 |
| HIGGINS ET AL., COMPUT APPL BIOSCI, vol. 8, 1992, pages 189 - 191 |
| HIGGINS; SHARP, CABIOS, vol. 5, 1989, pages 151 - 153 |
| HILLEN; WISSMAN, TOPICS MOL STRUC BIOL, vol. 10, 1989, pages 143 - 62 |
| HIRE ET AL., PLANT MOL BIOL, vol. 20, 1992, pages 207 - 18 |
| HLAVKA ET AL.: "Handbook of Experimental Pharmacology", vol. 78, 1985, SPRINGER-VERLAG |
| HOESS ET AL., NUCLEIC ACIDS RES, vol. 14, 1986, pages 2287 - 300 |
| HOOYKAAS-VAN SLOGTEREN ET AL., NATURE, vol. 311, 1984, pages 763 - 4 |
| HOURDA; PASZKOWSKI, MOL GEN GENET, vol. 243, 1994, pages 106 - 11 |
| HU ET AL., CELL, vol. 48, 1987, pages 555 - 66 |
| HUANG ET AL., NUCLEIC ACIDS RES, vol. 19, 1991, pages 443 - 8 |
| HUSH ET AL., J CELL SCI, vol. 107, 1994, pages 775 - 84 |
| INGELBRECHT ET AL., PLANT CE/I, vol. 1, 1989, pages 671 - 680 |
| JAMIESON ET AL., NATURE REV DRUG DISCOV, vol. 2, 2003, pages 361 - 8 |
| JAVIER ET AL., NATURE, vol. 425, 2003, pages 257 - 263 |
| JOHANSEN; CARRINGTON, PLANT PHYSIOL., vol. 126, 2001, pages 930 - 938 |
| JONES ET AL., EMBO J, vol. 4, 1985, pages 2411 - 2418 |
| JONES ET AL., SCIENCE, vol. 266, 1994, pages 789 |
| JORGENSEN ET AL., PLANT MOL. BIOL., vol. 31, 1996, pages 957 - 973 |
| JURICA; STODDARD, CELL MOL LIFE SCI, vol. 55, 1999, pages 1304 - 26 |
| KAEPPLER ET AL., PLANT CELL REP, vol. 9, 1990, pages 415 - 8 |
| KAEPPLER ET AL., THEOR APPL GENET, vol. 84, 1992, pages 560 - 6 |
| KAWAMATA ET AL., PLANT CELL PHYSIOL, vol. 38, 1997, pages 792 - 803 |
| KEELER; GLOOR, MOL CELL BIOL, vol. 17, 1997, pages 627 - 34 |
| KELLER; BAUMGARTNER, PLANT CELL, vol. 3, 1991, pages 1051 - 61 |
| KEMPIN ET AL., NATURE, vol. 389, 1997, pages 802 - 3 |
| KIRIHARA ET AL., GENE, vol. 71, 1988, pages 359 |
| KIRIK ET AL., EMBO J, vol. 19, 2000, pages 5562 - 6 |
| KLEIN ET AL., BIOTECHNOLOGY, vol. 6, 1988, pages 559 - 63 |
| KLEIN ET AL., PLANT PHYSIOL, vol. 91, 1988, pages 440 - 4 |
| KLEIN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 4305 - 9 |
| KLEINSCHNIDT ET AL., BIOCHEMISTRY, vol. 27, 1988, pages 1094 - 104 |
| KLIPPEL ET AL., EMBO J, vol. 7, 1988, pages 3983 - 9 |
| KUHSTOSS ET AL., J MOL BIOL, vol. 20, 1991, pages 897 - 908 |
| KUNKEL ET AL., METH ENZYMOL, vol. 154, 1987, pages 367 - 82 |
| KUNKEL, PROC. NATL. ACAD. SCI. USA, vol. 82, 1985, pages 488 - 92 |
| KUSTER ET AL., PLANT MOL BIO, vol. 29, 1995, pages 759 - 72 |
| KWON ET AL., PLANT PHYSIOL, vol. 105, 1994, pages 357 - 67 |
| LABOW ET AL., MOL CELL BIOL, vol. 10, 1990, pages 3343 - 56 |
| LAM, RESULTS PROBL CELL DIFFER, vol. 20, 1994, pages 181 - 96 |
| LANGE-GUSTAFSON; NASH, J BIOL CHEM, vol. 259, 1984, pages 12724 - 32 |
| LAST ET AL., THEORAPPL GENET, vol. 81, 1991, pages 581 - 8 |
| LEACH; AOYAGI, PLANT SCI, vol. 79, 1991, pages 69 - 76 |
| LEE; SAITO, GENE, vol. 216, 1998, pages 55 - 65 |
| LI ET AL., NUC. ACIDS RES., 2010 |
| LI ET AL., PLANT CELL REP, vol. 12, 1993, pages 250 - 5 |
| LI ET AL., PLANT MOL BIOL, vol. 65, 2007, pages 329 - 41 |
| LI ET AL., PLANT PHYSIOL, vol. 151, 2009, pages 1087 - 95 |
| LILLEY ET AL.: "Proceedings of the World Congress on Vegetable Protein Utilization in Human Foods and Animal Feedstuffs", 1989, AMERICAN OIL CHEMISTS SOCIETY, pages: 497 - 502 |
| LISKAY ET AL., GENETICS, vol. 115, 1987, pages 161 - 7 |
| LIU ET AL., J BIOL CHEM, vol. 277, 2002, pages 3850 - 6 |
| LIU ET AL., PLANT PHYSIOL., vol. 129, 2002, pages 1732 - 1743 |
| LLOYD ET AL., PROC. NATL. ACAD. SCI. USA, vol. 102, 2005, pages 2232 - 7 |
| LORBACH ET AL., J MOL BIOL, vol. 296, 2000, pages 1175 - 81 |
| LUCAS ET AL., NUCLEIC ACIDS RES, vol. 29, 2001, pages 960 - 9 |
| LYZNIK ET AL., MOL GEN GENET, vol. 230, 1991, pages 209 - 18 |
| MAIO; LAM, PLANT J, vol. 7, 1995, pages 359 - 65 |
| MANI ET AL., BIOCHEM BIOPHYS RES COMM, vol. 335, 2005, pages 447 - 57 |
| MARTIN ET AL., SCIENCE, vol. 262, 1993, pages 1432 |
| MASKHELISHVILI ET AL., MOL GEN GENET, vol. 237, 1993, pages 334 - 42 |
| MATSUOKA ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 9586 - 90 |
| MCCABE ET AL., BIOTECHNOLOGY, vol. 6, 1988, pages 923 - 6 |
| MCCORMICK ET AL., PLANT CELL REP, vol. 5, 1986, pages 81 - 4 |
| MCCREATH ET AL., NATURE, vol. 405, 2000, pages 1066 - 9 |
| MCELROY ET AL., PLANT CELL, vol. 2, 1990, pages 163 - 71 |
| MCNELLIS ET AL., PLANT J, vol. 14, 1998, pages 247 - 257 |
| MEINKOTH ET AL., ANAL BIOCHEM, vol. 138, 1984, pages 267 - 284 |
| METTE ET AL., EMBO J, vol. 19, no. 19, 2000, pages 5194 - 5201 |
| MIAO ET AL., PLANT CELL, vol. 3, 1991, pages 11 - 22 |
| MILLER ET AL., CELL, vol. 20, 1980, pages 721 - 9 |
| MILLER ET AL., NATURE BIOTECHNOLOGY, vol. 29, 2011, pages 143 - 148 |
| MINDRINOS ET AL., CE, vol. 78, 1994, pages 1089 |
| MOLINIER ET AL., PLANT CELL, vol. 16, 2004, pages 342 - 52 |
| MORBITZER ET AL., PNAS, 2010 |
| MOURE ET AL., NAT STRUCT BIOL, vol. 9, 2002, pages 764 |
| MURAI ET AL., SCIENCE, vol. 23, 1983, pages 476 - 82 |
| MURASHIGE; SKOOG, PHYSIOL. PLANT., vol. 15, 1962, pages 473 |
| MURRAY ET AL., NUCLEIC ACIDS RES., vol. 17, 1989, pages 477 - 498 |
| MUSUMURA ET AL., PLANT MOL. BIOL., vol. 12, 1989, pages 123 |
| NASSIF; ENGELS, PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 1262 - 6 |
| NEEDLEMAN; WUNSCH, J MOL BIOI, vol. 48, 1970, pages 443 - 53 |
| NOMURA ET AL., PLANT SCI, vol. 44, 1986, pages 53 - 8 |
| ODELL ET AL., NATURE, vol. 313, 1985, pages 810 - 2 |
| OFFRINGA ET AL., EMBO J, vol. 9, 1990, pages 3077 - 84 |
| OFFRINGA ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 7346 - 50 |
| OKAMURO; GOLDBERG: "The Biochemistry of Plants", vol. 115, 1989, ACADEMIC PRESS, pages: 1 - 82 |
| OLIVA ET AL., ANTIMICROB AGENTS CHEMOTHER, vol. 36, 1992, pages 913 - 9 |
| ONO, BIOSCI BIOTECHNOL BIOCHEM, vol. 68, 2004, pages 803 - 7 |
| ORDIZ ET AL., PROC. NATL. ACAD. SCI. USA, vol. 99, 2002, pages 13290 - 5 |
| OROZCO ET AL., PLANT MOL BIOL, vol. 23, 1993, pages 1129 - 38 |
| OSJODA ET AL., NAT BIOTECHNOL, vol. 14, 1996, pages 745 - 50 |
| PABO ET AL., ANN REV BIOCHEM, vol. 70, 2001, pages 313 - 40 |
| PACHER ET AL., GENETICS, vol. 175, 2007, pages 21 - 9 |
| PANDOLFINI ET AL., BMC BIOTECHNOLOGY, vol. 3, pages 7 |
| PANSTRUGA ET AL., MOL. BIOL. REP., vol. 30, 2003, pages 135 - 140 |
| PAPADOPOULOU; DUMAS, NUCLEIC ACIDS RES, vol. 25, 1997, pages 4278 - 86 |
| PASZKOWSKI ET AL., EMBO J, vol. 3, 1984, pages 2717 - 22 |
| PASZKOWSKI ET AL., EMBO J, vol. 7, 1988, pages 4021 - 6 |
| PEDERSEN ET AL., J. BIOL. CHEM., vol. 261, 1986, pages 6279 |
| PORTEUS; CARROLL, NAT BIOTECHNOL, vol. 23, 2005, pages 967 - 73, Retrieved from the Internet <URL:www.zincfinger.org> |
| POTENZA ET AL., IN VITRO CELL DEV BIOL, vol. 40, 2004, pages 1 - 22 |
| PUCHTA ET AL., PLANT MOL BIOL, vol. 28, 1995, pages 281 - 92 |
| PUCHTA ET AL., PROC. NATL. ACAD. SCI. USA, vol. 93, 1996, pages 5055 - 5060 |
| PUCHTA ET AL., PROC. NATL. ACAD. SCI. USA, vol. 93, 1996, pages 5055 - 60 |
| PUCHTA, GENETICS, vol. 152, 1999, pages 1173 - 81 |
| PUCHTA, J EXP BOT, vol. 56, 2005, pages 1 - 14 |
| PUCHTA; BALTIMORE, SCIENCE, vol. 300, 2003, pages 763 |
| REINES ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 1917 - 21 |
| REZNIKOFF, MOL MICROBIOL, vol. 6, 1992, pages 2419 - 22 |
| RIGGS ET AL., PROC. NATL. ACAD. SCI. USA, vol. 83, 1986, pages 5602 - 6 |
| RINEHART ET AL., PLANT PHYSIOL, vol. 112, 1996, pages 1331 - 41 |
| RISSEEUW ET AL., PLANT J, vol. 7, 1995, pages 109 - 19 |
| ROBERTS ET AL., NUCLEIC ACIDS RES, vol. 31, 2003, pages 1805 - 12 |
| ROBERTS ET AL., NUCLEIC ACIDS RES, vol. 31, 2003, pages 418 - 20 |
| ROSEN ET AL., NUCLEIC ACIDS RES, vol. 34, 2006, pages 4791 - 800 |
| RUBNITZ; SUBRAMANI, MOL CELL BIOL, vol. 4, 1984, pages 2253 - 8 |
| RUSSELL ET AL., TRANSGENIC RES, vol. 6, 1997, pages 157 - 68 |
| SADOWSKI, FASEB, vol. 7, 1993, pages 760 - 7 |
| SALOMON; PUCHTA, EMBO J, vol. 17, 1998, pages 6086 - 95 |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS |
| SANFORD ET AL., PARTICULATE SCIENCE AND TECHNOLOGY, vol. 5, 1987, pages 27 - 37 |
| SANGER ET AL., PLANT MOL BIOL, vol. 14, 1990, pages 433 - 43 |
| SANTORO; SCHULTZE, PROC. NATL. ACAD. SCI. USA, vol. 99, 2002, pages 4185 - 90 |
| SAUER, CURR OP BIOTECHNOL, vol. 5, 1994, pages 521 - 7 |
| SAXENA ET AL., BIOCHIM BIOPHYS ACTA, vol. 1340, 1997, pages 187 - 204 |
| SCHENA ET AL., PROC. NATL. ACAD. SCI. USA, vol. 88, 1991, pages 10421 - 5 |
| SCHLAKE; BODE, BIOCHEMISTRY, vol. 33, 1994, pages 12746 - 51 |
| SCHOLZE; BOCH, VIRULENCE, vol. 1, 2010, pages 428 - 432 |
| SCHUBERT ET AL., J. BACTERIOL., vol. 170, 1988, pages 5837 - 5847 |
| SCLIMENTE ET AL., NUCLEIC ACIDS RES, vol. 29, 2001, pages 5044 - 51 |
| SEGAL, BIOCHEMISTRY, vol. 42, 2003, pages 2137 - 48 |
| SEGAL, METHODS, vol. 26, 2002, pages 76 - 83 |
| SEGAL; BARBAS, CURR OPIN BIOTECHNOL, vol. 12, 2001, pages 632 - 7 |
| SELIGMAN ET AL., NUCLEIC ACIDS RES, vol. 30, 2002, pages 3870 - 3879 |
| SELIGMAN ET AL., NUCLEIC ACIDS RES, vol. 30, 2002, pages 3870 - 9 |
| SENGOPTA-GOPALEN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 82, 1988, pages 3320 - 4 |
| SHAIKH ET AL., J BIOL CHEM, vol. 272, 1977, pages 5695 - 702 |
| SHALEV; LEVY, GENETICS, vol. 146, 1997, pages 1143 - 51 |
| SHEN; HUANG, GENETICS, vol. 112, 1986, pages 441 - 57 |
| SHUKLA ET AL., NATURE, 2009 |
| SHUKLA ET AL., NATURE, vol. 459, 2009, pages 437 - 41 |
| SIEBERT; PUCHTA, PLANT CELL, vol. 14, 2002, pages 1121 - 31 |
| SIEBLER; BODE, BIOCHEMISTRY, vol. 36, 1997, pages 1740 - 7 |
| SIMPSON ET AL., EMBO J, vol. 4, 1958, pages 2723 - 9 |
| SINGER ET AL., CELL, vol. 31, 1982, pages 25 - 33 |
| SINGH ET AL., THEOR APPL GENET, vol. 96, 1998, pages 319 - 24 |
| SMITH ET AL., NATURE, vol. 407, 2000, pages 319 - 320 |
| SMITH ET AL., NUCLEIC ACIDS RES, vol. 34, 2006, pages E149 |
| STODDARD, Q REV BIOPHYS, vol. 38, 2006, pages 49 - 95 |
| STOUTJESDIJK ET AL., PLANT PHYSIOL., vol. 129, 2002, pages 1723 - 1731 |
| SUGAWARA; HABER, MOL CELL BIOL, vol. 12, 1992, pages 563 - 75 |
| SUSSMAN ET AL., J MOL BIOL, vol. 342, 2004, pages 31 - 41 |
| SUZUKI ET AL., GENE, vol. 242, no. 1-2, 2000, pages 331 - 336 |
| TANAKA ET AL., GENE, vol. 17, 1998, pages 67 - 76 |
| TEERI ET AL., EMBO J, vol. 8, 1989, pages 343 - 50 |
| TERADA ET AL., NAT BIOTECH, vol. 20, 2002, pages 1030 - 4 |
| THOMPSON ET AL., BIOESSAYS, vol. 10, 1989, pages 108 |
| THOMSON ET AL., GENESIS, vol. 36, 2003, pages 162 - 7 |
| THYGARAJAN ET AL., MOL CELL BIOL, vol. 21, 2001, pages 3926 - 34 |
| THYKJAER ET AL., PLANT MOL BIOL, vol. 35, 1997, pages 523 - 30 |
| TIJSSEN: "Laboratory Techniques in Biochemistry and Molecular Biology--Hybridization with Nucleic Acid Probes", 1993, ELSEVIER |
| TIJSSEN: "Laboratory Techniques in Biochemistry and Molecular Biology--Hybridization with Nucleic Acid Probes", 1993, ELSEVIER, article "Overview of principles of hybridization and the strategy of nucleic acid probe assays" |
| TIMKO ET AL., NATURE, vol. 318, 1988, pages 57 - 8 |
| TOMES ET AL.: "Plant Cell, Tissue, and Organ Culture: Fundamental Methods", 1995, SPRINGER-VERLAG, article "Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment" |
| TOWNSEND ET AL., NATURE, vol. 459, 2009, pages 442 - 5 |
| TURNER; FOSTER, MOL BIOTECHNOL, vol. 3, 1995, pages 225 - 236 |
| TZFIRA; WHITE, TRENDS BIOTECHNOL, vol. 23, 2005, pages 567 - 9 |
| UMLAUF; COX, EMBO J, vol. 7, 1988, pages 1845 - 52 |
| VAN CAMP ET AL., PLANT PHYSIOL, vol. 112, 1996, pages 525 - 35 |
| VELTEN ET AL., EMBO J, vol. 3, 1984, pages 2723 - 30 |
| VERGUNST ET AL., SCIENCE, vol. 290, 2000, pages 979 - 82 |
| VOZIYANOV ET AL., J MOL BIOL, vol. 326, 2003, pages 65 - 76 |
| VOZIYANOV ET AL., NUCLEIC ACIDS RES, vol. 30, 2002, pages 1656 - 63 |
| WALKER AND GAASTRA,: "Techniques in Molecular Biology", 1983, MACMILLAN PUBLISHING COMPANY |
| WANG; WATERHOUSE, CURR. OPIN. PLANT BIOL., vol. 5, 2001, pages 146 - 150 |
| WATERHOUSE ET AL., PROC. NATL. ACAD. SCI. USA, vol. 95, 1998, pages 13959 - 13964 |
| WATERHOUSE; HELLIWELL, NAT. REV. GENET, vol. 4, 2003, pages 29 - 38 |
| WATERHOUSE; HELLIWELL, NAT. REV. GENET., vol. 4, 2003, pages 29 - 38 |
| WATSON ET AL.: "Recombinant DNA, 2nd Ed.,", 1992, WH FREEMAN & CO. |
| WATT ET AL., PROC. NATL. ACAD. SCI. USA, vol. 82, 1985, pages 4768 - 72 |
| WEISSINGER ET AL., ANN REV GENET, vol. 22, 1988, pages 421 - 77 |
| WESLEY ET AL., PLANT J., vol. 27, 2001, pages 581 - 590 |
| WILLIAMSON ET AL., EUR. J. BIOCHEM., vol. 165, 1987, pages 99 - 106 |
| WOHLLEBEN ET AL., GENE, vol. 70, 1988, pages 25 37 |
| WOLFE ET AL., ANN REV BIOPHYS BIOMOL STRUCT, vol. 29, 2000, pages 183 - 212 |
| WRIGHT ET AL., PLANT J, vol. 44, 2005, pages 693 - 705 |
| WRIGHT ET AL., PLANT J., vol. 44, 2005, pages 693 - 705 |
| WYBORSKI ET AL., NUCLEIC ACIDS RES, vol. 19, 1991, pages 4647 - 53 |
| XIAO; PETERSON, MOL GEN GENET, vol. 263, 2000, pages 22 - 9 |
| YAGU ET AL., J MOL BIOL, vol. 252, 1995, pages 163 - 7 |
| YAMAMOTO ET AL., PLANT CELL PHYSIOL, vol. 35, 1994, pages 773 - 8 |
| YAMAMOTO ET AL., PLANT J, vol. 12, 1997, pages 255 - 65 |
| YANG ET AL., PLANT MOL BIOL, vol. 70, 2009, pages 669 - 79 |
| YAO ET AL., CELL, vol. 71, 1992, pages 63 - 72 |
| YARRANTON, CURR OPIN BIOTECH, vol. 3, 1992, pages 506 - 11 |
| YU ET AL., PHYTOCHEMISTRY, vol. 63, 2003, pages 753 - 763 |
| ZAMBRETTI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 3952 - 6 |
Cited By (55)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10822610B2 (en) | 2011-03-23 | 2020-11-03 | E. I. Du Pont De Nemours And Company | Methods for producing a complex transgenic trait locus |
| US12338444B2 (en) | 2011-03-23 | 2025-06-24 | Pioneer Hi-Bred International, Inc. | Methods for producing a complex transgenic trait locus |
| WO2013088446A1 (en) | 2011-12-16 | 2013-06-20 | Targetgene Biotechnologies Ltd | Compositions and methods for modifying a predetermined target nucleic acid sequence |
| US11278560B2 (en) | 2011-12-16 | 2022-03-22 | Targetgene Biotechnologies Ltd. | Compositions and methods for modifying a predetermined target nucleic acid sequence |
| US11458157B2 (en) | 2011-12-16 | 2022-10-04 | Targetgene Biotechnologies Ltd. | Compositions and methods for modifying a predetermined target nucleic acid sequence |
| US11690866B2 (en) | 2011-12-16 | 2023-07-04 | Targetgene Biotechnologies Ltd. | Compositions and methods for modifying a predetermined target nucleic acid sequence |
| US10220052B2 (en) | 2011-12-16 | 2019-03-05 | Targetgene Biotechnologies Ltd | Compositions and methods for modifying a predetermined target nucleic acid sequence |
| WO2013112686A1 (en) * | 2012-01-27 | 2013-08-01 | Pioneer Hi-Bred International, Inc. | Methods and compositions for generating complex trait loci |
| US10435699B2 (en) | 2012-01-27 | 2019-10-08 | E I Du Pont De Nemours And Company | Methods and compositions for generating complex trait loci |
| WO2014164466A1 (en) * | 2013-03-12 | 2014-10-09 | E. I. Du Pont De Nemours And Company | Methods for the identification of variant recognition sites for rare-cutting engineered double-strand-break-inducing agents and compositions and uses thereof |
| RU2694686C2 (en) * | 2013-03-12 | 2019-07-16 | Е.И.Дюпон Де Немур Энд Компани | Methods for identifying variant recognition sites for rare-cutting engineered double-strand-break-inducing agents and compositions and uses thereof |
| US10329574B2 (en) | 2013-03-12 | 2019-06-25 | E I Du Pont De Nemours And Company | Methods for the identification of variant recognition sites for rare-cutting engineered double-strand-break-inducing agents and compositions and uses thereof |
| CN105916987A (en) * | 2013-08-22 | 2016-08-31 | 纳幕尔杜邦公司 | Plant genome modification using a guide RNA/CAS endonuclease system and methods of use thereof |
| US11773400B2 (en) | 2013-08-22 | 2023-10-03 | E.I. Du Pont De Nemours And Company | Methods for producing genetic modifications in a plant genome without incorporating a selectable transgene marker, and compositions thereof |
| US12378566B2 (en) | 2013-08-22 | 2025-08-05 | Pioneer Hi-Bred International, Inc. | Plant genome modification using guide RNA/Cas endonuclease systems and methods of use |
| US12428645B2 (en) | 2013-08-22 | 2025-09-30 | Pioneer Hi-Bred International, Inc. | Methods for producing genetic modifications in a plant genome without incorporating a selectable transgene marker, and compositions thereof |
| US10519457B2 (en) | 2013-08-22 | 2019-12-31 | E I Du Pont De Nemours And Company | Soybean U6 polymerase III promoter and methods of use |
| WO2015026883A1 (en) * | 2013-08-22 | 2015-02-26 | E. I. Du Pont De Nemours And Company | Plant genome modification using guide rna/cas endonuclease systems and methods of use |
| US10676754B2 (en) | 2014-07-11 | 2020-06-09 | E I Du Pont De Nemours And Company | Compositions and methods for producing plants resistant to glyphosate herbicide |
| US12173294B2 (en) | 2014-09-12 | 2024-12-24 | Corteva Agriscience Llc | Generation of site specific integration sites for complex trait loci in corn and soybean, and methods of use |
| US11560568B2 (en) | 2014-09-12 | 2023-01-24 | E. I. Du Pont De Nemours And Company | Generation of site-specific-integration sites for complex trait loci in corn and soybean, and methods of use |
| WO2016040030A1 (en) * | 2014-09-12 | 2016-03-17 | E. I. Du Pont De Nemours And Company | Generation of site-specific-integration sites for complex trait loci in corn and soybean, and methods of use |
| EP3628739A1 (en) * | 2014-09-12 | 2020-04-01 | E. I. du Pont de Nemours and Company | Generation of site-specific-integration sites for complex trait loci in corn and soybean, and methods of use |
| EP4696781A2 (en) | 2014-09-26 | 2026-02-18 | Pioneer Hi-Bred International, Inc. | Wheat ms1 polynucleotides, polypeptides, and methods of use |
| WO2016100309A1 (en) | 2014-12-16 | 2016-06-23 | Pioneer Hi-Bred International, Inc. | Restoration of male fertility in wheat |
| US9963710B2 (en) | 2014-12-23 | 2018-05-08 | Syngenta Participations Ag | Methods and compositions for identifying and enriching for cells comprising site specific genomic modifications |
| US11898149B2 (en) | 2014-12-23 | 2024-02-13 | Syngenta Participations Ag | Methods and compositions for identifying and enriching for cells comprising site specific genomic modifications |
| US11643664B2 (en) | 2014-12-23 | 2023-05-09 | Syngenta Participations Ag | Methods and compositions for identifying and enriching for cells comprising site specific genomic modifications |
| US10450576B2 (en) | 2015-03-27 | 2019-10-22 | E I Du Pont De Nemours And Company | Soybean U6 small nuclear RNA gene promoters and their use in constitutive expression of small RNA genes in plants |
| US11193131B2 (en) | 2015-06-30 | 2021-12-07 | Regents Of The University Of Minnesota | Haploid inducer line for accelerated genome editing |
| US11845943B2 (en) | 2015-06-30 | 2023-12-19 | Regents Of The University Of Minnesota | Haploid inducer line for accelerated genome editing |
| EP3316676A4 (en) * | 2015-06-30 | 2018-12-12 | Regents of the University of Minnesota | Haploid inducer line for accelerated genome editing |
| WO2017079026A1 (en) * | 2015-11-06 | 2017-05-11 | E. I. Du Pont De Nemours And Company | Generation of complex trait loci in soybean and methods of use |
| EP3699281A1 (en) | 2016-03-11 | 2020-08-26 | Pioneer Hi-Bred International, Inc. | Novel cas9 systems and methods of use |
| WO2017155714A1 (en) | 2016-03-11 | 2017-09-14 | Pioneer Hi-Bred International, Inc. | Novel cas9 systems and methods of use |
| WO2017161264A1 (en) | 2016-03-18 | 2017-09-21 | Pioneer Hi-Bred International, Inc. | Methods and compositions for producing clonal, non-reduced, non-recombined gametes |
| WO2017218185A1 (en) | 2016-06-14 | 2017-12-21 | Pioneer Hi-Bred International, Inc. | Use of cpf1 endonuclease for plant genome modifications |
| WO2017222773A1 (en) | 2016-06-20 | 2017-12-28 | Pioneer Hi-Bred International, Inc. | Novel cas systems and methods of use |
| WO2019118463A1 (en) | 2017-12-15 | 2019-06-20 | Danisco Us Inc | Cas9 variants and methods of use |
| WO2019165168A1 (en) | 2018-02-23 | 2019-08-29 | Pioneer Hi-Bred International, Inc. | Novel cas9 orthologs |
| US12084676B2 (en) | 2018-02-23 | 2024-09-10 | Pioneer Hi-Bred International, Inc. | Cas9 orthologs |
| WO2019177978A1 (en) | 2018-03-12 | 2019-09-19 | Pioneer Hi-Bred International, Inc. | Use of morphogenic factors for the improvement of gene editing |
| US12234470B2 (en) | 2018-04-18 | 2025-02-25 | Pioneer Hi-Bred International, Inc. | Genes, constructs and maize event DP-202216-6 |
| US12371702B2 (en) | 2018-04-18 | 2025-07-29 | Pioneer Hi-Bred International, Inc. | Improving agronomic characteristics in maize by modification of endogenous mads box transcription factors |
| CN112105722A (en) * | 2018-04-18 | 2020-12-18 | 先锋国际良种公司 | Genes, constructs and maize event DP-202216-6 |
| US12553060B2 (en) | 2018-04-18 | 2026-02-17 | Pioneer Hi-Bred International, Inc. | Genes, constructs and maize event DP-202216-6 |
| WO2020005667A1 (en) | 2018-06-29 | 2020-01-02 | Pioneer Hi-Bred International, Inc. | Compositions and methods for editing an endogenous nac gene in plants |
| US11807878B2 (en) | 2018-12-14 | 2023-11-07 | Pioneer Hi-Bred International, Inc. | CRISPR-Cas systems for genome editing |
| US12215364B2 (en) | 2018-12-14 | 2025-02-04 | Pioneer Hi-Bred International, Inc. | CRISPR-cas systems for genome editing |
| WO2020123887A2 (en) | 2018-12-14 | 2020-06-18 | Pioneer Hi-Bred International, Inc. | Novel crispr-cas systems for genome editing |
| US12365888B2 (en) | 2018-12-14 | 2025-07-22 | Pioneer Hi-Bred International, Inc. | CRISPR-Cas systems for genome editing |
| US10934536B2 (en) | 2018-12-14 | 2021-03-02 | Pioneer Hi-Bred International, Inc. | CRISPR-CAS systems for genome editing |
| WO2021173480A2 (en) | 2020-02-24 | 2021-09-02 | Pioneer Hi-Bred International, Inc. | Intra-genomic homologous recombination |
| WO2023102393A1 (en) | 2021-11-30 | 2023-06-08 | Pioneer Hi-Bred International, Inc. | High efficiency large scale chromosomal genome manipulation |
| WO2024196921A1 (en) | 2023-03-20 | 2024-09-26 | Pioneer Hi-Bred International, Inc. | Cas polypeptides with altered pam recognition |
Also Published As
| Publication number | Publication date |
|---|---|
| EP2689019A2 (en) | 2014-01-29 |
| EA201391373A1 (en) | 2014-07-30 |
| US20180305706A1 (en) | 2018-10-25 |
| US11459576B2 (en) | 2022-10-04 |
| CA2831144A1 (en) | 2012-09-27 |
| CN103842511A (en) | 2014-06-04 |
| US10030245B2 (en) | 2018-07-24 |
| WO2012129373A3 (en) | 2013-03-14 |
| US20250277227A1 (en) | 2025-09-04 |
| US20230235342A1 (en) | 2023-07-27 |
| US20130263324A1 (en) | 2013-10-03 |
| BR112013024337A2 (en) | 2017-09-26 |
| MX2013010911A (en) | 2015-03-03 |
| US12338444B2 (en) | 2025-06-24 |
| AR085533A1 (en) | 2013-10-09 |
| US10822610B2 (en) | 2020-11-03 |
| US20210062201A1 (en) | 2021-03-04 |
| ZA201307200B (en) | 2014-06-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12338444B2 (en) | Methods for producing a complex transgenic trait locus | |
| US20220177900A1 (en) | Genome modification using guide polynucleotide/cas endonuclease systems and methods of use | |
| US20220364107A1 (en) | Agronomic trait modification using guide rna/cas endonuclease systems and methods of use | |
| US9499837B2 (en) | Methods and compositions for producing male sterile plants | |
| US8912392B2 (en) | Methods for altering the genome of a monocot plant cell | |
| EP3191595A1 (en) | Generation of site-specific-integration sites for complex trait loci in corn and soybean, and methods of use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12712040 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2013/010911 Country of ref document: MX |
|
| ENP | Entry into the national phase |
Ref document number: 2831144 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1301005310 Country of ref document: TH |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012712040 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 201391373 Country of ref document: EA |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112013024337 Country of ref document: BR |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01E Ref document number: 112013024337 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112013024337 Country of ref document: BR Kind code of ref document: A2 Effective date: 20130923 |

