WO2012122649A1 - Recombinant orf virus - Google Patents

Abstract

The present invention relates to recombinant orf virus, and use and methods involving such recombinant orf virus in the treatment of hyperproliferative disorders. The recombinant orf virus contains one or more heterologous host range genes. Advantageously, such engineering allows the orf virus to better replicate in human cells, while still maintaining the orf virus' unique immune stimulatory profile.

Description

RECOMBINANT ORF VTRUS

FIELD OF THE INVENTION

[0001] The present application relates to a recombinant orf virus for the treatment of hyperproliferative conditions.

BACKGROUND OF THE INVENTION

[0002] Cancer is a complex disease affecting millions of people every year. The majority of current therapies often result in mild to severe side effects, poor efficacy, and a high mortality rate. New options for targeted, well-tolerated therapeutics with a high therapeutic index are needed.

[0003] Oncolytic viruses are viruses that preferentially infect and lyse cancer cells.

They may function by direct destruction of tumour cells, or, if modified, as vectors enabling genes expressing anticancer proteins to be delivered specifically to the tumor site. Oncolytic viruses have also been shown to elicit both innate, and adaptive anti-tumour immune responses. Oncolytic viruses offer many benefits to traditional chemotherapeutic or immunotherapeutic drugs: they are targeted to cancer cells by nature, with little to no adverse affects, they offer a self-amplifying dose, some can target metastatic sites, they are immune-stimulating, they are easily manipulated, and they can be genetically modified to carry other therapeutic genes.

[0004] Several viruses have also been shown to exhibit tumoricidal properties, for example parvovirus H-l (Dupressoir et al, 1996. Cancer Res, 49:3203-3208), Newcastle disease virus (Reichand et al, 1992. J. Surg. Res, 52:448-453) or retroviral vectors containing drug susceptibility genes (Takamiya et al, 1993. J. Neurosurg, 79: 104-110). WO97/26904 and WO96/03997 disclose a mutant herpes simplex virus (HSV-1761) that inhibits tumour cell growth. Administration of HSV-1716 comprising a 759 base pair deletion in each copy of γ34.5 of the long repeat region (R_L) to tumour cells kills these cells. However, this virus is specific for neuronal cells, as HSV is known to selectively infect the neuronal system. Furthermore, the use of common human pathogens as oncolytic viruses is limited, as it is likely that the general population has been infected and acquired an immune response to such viruses. A pre-existing immune response to a viral strain similar to the one used as a therapeutic agent in the treatment of a cancer may attenuate the effectiveness of the virus as therapeutic agent.

[0005] Other virus strains have been reported to have oncolytic activity. The

ONYX-015 human adenovirus (produced by ONYX pharmaceuticals) is believed to replicate preferentially in p53 negative tumour cells. This virus shows promise in clinical trials with head and neck cancer patients (Kim, D., T. et al, Nat Med, 1998. 4: 1341-1342). Reovirus type 3 is being developed by Oncolytics Biotech as a cancer therapeutic, which preferentially grows in PKR-/- cells (Yin, H. S., J. Virol Methods, 1997. 67:93-101 ; Strong, J. E. and P. W. Lee., J Virol, 1996. 70:612-616; Strong, J. E., et al, Virology, 1993. 197:405-411 ; Minuk, G. Y., et al, J Hepatol, 1987. 5:8-13; Rozee, K. R., et al., Appl Environ Microbiol, 1978. 35:297-300). Reovirus, type III exhibited enhanced replication properties in cells which expressed the mutant ras oncogene (Coffey, M. C, et al, Science, 1998. 282: 1332-1334; Strong, J. E., et al, Embo J, 1998. 17:3351-1362). Mundschau and Faller (Mundschau, L. J. and D. V. Faller, J Biol Chem, 1992. 267:23092- 23098) have shown that the ras oncogene product activated an inhibitor of PKR, and this coupled with the observation that the PKR chemical inhibitor 2-aminopurine increased the growth of Reo type III in normal cells implicates PKR is a critical regulator of the growth of reovirus.

[0006] WO 99/18799 reports the cytotoxic activity of Newcastle Disease Virus (NDV) and Sindbis virus towards several human cancer cells. Both viruses demonstrated selectivity in their cytotoxic activity towards tumor cells. WO 99/18799 also discloses the cytotoxic activity of VSV cells against KB cells (head and neck carcinoma) and HT 1080 (Fibrosarcoma), and alleviation of cytotoxicity in normal and tumor cells, by VSV, in the presence of interferon. No other cell types were tested for VSV cytotoxic activity.

[0007] There is a need for additional compositions and methods for treating cancer and cancer metastasis, particularly oncolytic virus compositions, methods, and uses.

SUMMARY OF THE INVENTION

[0008] It is an obj ect of the present invention to overcome one or more disadvantages of previous oncolytic viruses. [0009] Generally, the present application provides a parapoxvirus, methods for the treatment of hyperproliferative disorders, and uses of such parapoxviruses in the treatment of hyperproliferative disorders.

[0010] In one aspect the parapoxvirus is an orf virus.

[0011] In one aspect, the present invention provides a recombinant orf virus

(ORFV) containing one or more heterologous host range genes or homologues thereof, wherein said heterologous host range genes enable replication of the recombinant orf in human cells.

[0012] In one aspect, the recombinant ORFV is an oncolytic virus.

[0013] In one aspect, the recombinant ORFV replicates in human cancer cells.

[0014] In one aspect of the invention, said host range genes are any heterologous host range genes that aid in or enable replication of the recombinant orf virus in human cells.

[0015] In one aspect, the heterologous host range genes are from Poxviridae, and include, but not limited to, one or more of: SPI-1, SPI-2, KIL, C7L, p28/NlR, B5R, E3L, K3L, M-T2, M-T4, M-T5, M11L, M13L, M063, and F11L. The host range genes may further include homologues thereof.

[0016] Thus, in one aspect the present invention provides an engineered orf virus containing one more host range genes from a poxvirus, such as from vaccinia virus.

Advantageously, such engineering allows the parapoxvirus to better replicate in human cells, while still maintaining the parapoxvirus' unique immune stimulatory profile.

[0017] In one aspect, the recombinant orf virus is a live orf virus.

[0018] In a further aspect, the present invention provides a method for the treatment of hyperproliferative disorders, comprising administering to a patient a therapeutically effective amount of a parapoxvirus in accordance with the invention.

[0019] In another aspect, the invention provides a parapoxvirus in accordance with the invention for use in the treatment of a hyperproliferative disorder or for use in the manufacture of a medicament for use in the treatment of a hyperproliferative disorder.

[0020] In another aspect, the invention provides a method for manufacturing a parapoxvirus, comprising producing the parapoxvirus in human cancer cells.

[0021] In a further aspect, the invention provides a method for preventing or reducing surgery induced cancer metastasis, comprising administering to a patient, a therapeutically effective amount of an oncolytic parapoxvirus in accordance with any one of claims 1 to 7, in combination with cancer surgery.

[0022] In one aspect, the invention provides an orf virus expressing one or more heterologous host genes, such as those from vaccinia. Particular benefits of orf virus expressing heterologous host range genes may include one or more of the following:

• Better replication of the virus in cancer cells may allow for an enhanced system to manufacture the virus. Currently, the production of orf virus by other groups (according to the current literature) is always performed in primary normal untransformed cell lines. Applicant's data has shown for the first time that human cancer cells can be used to produce large quantities of concentrated orf virus.

• Better replication of the virus in cancer cells would lead to enhanced anti-tumour efficacy in mouse models of cancer, and potentially in humans.

• An Orf virus oncolytic virus is safer than other oncolytic viruses. Even wild type orf virus backbone has minimal pathogenicity in humans, which is different from other oncolytic viruses (herpes virus, vaccinia virus, Adeno-virus, measles, Polio virus, rhabdoviruses etc.).

• UV inactivated forms of the virus have anti-cancer properties, suggesting that the shell of the virus itself is immune stimulatory. This is unique to Orf virus

• The majority of the population has had little to no contact with the virus, and will therefore have no pre-existing immunity to impede its use as a therapeutic.

• Orf virus is one of the few viruses that has the ability to repeatedly infect its host, despite an apparent normal immune response. This characteristic is important, as it means the virus may be able to escape clearance by the immune system, allowing for multiple treatments of the virus in the clinic.

• Orf virus infection leads to potent innate immune cell activation with minimal side effect: the immune stimulation is described in the literature as being 'self- regulated'. Meaning, the virus induces a very robust pro-inflammatory response, which the virus follows up with the induction of an anti-inflammatory response.

• Orf virus may be better suited for intra-venous delivery than other similar oncolytic viruses since the virus expresses a homologue of Vascular Endothelial Growth Factor. The lesions induced by orf virus infection have an extensive vascular accumulation, and dilation. This may allow for better delivery and spread of the virus within tumours beds.

BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Embodiments will now be described, by way of example only, with reference to the attached Figures.

[0024] Figure 1: The ability of wild type ORFV to replicate in mouse cancer cells was examined, (a) Phase contrast images of mock-infected, ORFV infected (MOI of 0.1, and 1) or UV-inactivated ORFV infected (MOI 1) B16F10-LacZ and CT26-LacZ cells at 48 hours post infection at a magnification of 40X. (b) Cytotoxicity assays of B16F 10- LacZ and CT26LacZ cells mock-infected (control), or ORFV-infected at the indicated MOI. Percent live cells was determined at 72 hours post-infection by normalization to mock-infected controls. N=4, mean +SEM. (c) ORFV growth curves were performed on B 16F10-LacZ and CT26-LacZ cell lines at an MOI of 0.3. Cells were infected at time 0, and cell lysates collected and processed by plaque assay at time-points post infection.

N=2, mean + SEM. (d) C57B1/6 mice challenged with 3x105 B16F10-LacZ cells i.v., and dosed 3 times with sham-infected cell lysates, live or UV-inactivated ORFV (107). Day 14 after cell challenge, lungs were isolated and metastases counted. Bars represent the mean for each group. (*P <0.01 , **P O.005 using an unpaired T test with Welch's correction). (e) Balb/c mice challenged with 10⁵ CT26-LacZ cells i.v., and dosed 3 times with sham- infected cell lysate, live or UV-inactivated ORFV (10⁷). Day 10 after cell challenge, lungs were isolated and metastases counted. Bars represent the mean for each group. (*P <0.05 using an unpaired T test with Welch's correction). PBS, phosphate-buffered saline; pfu, plaque-forming unit; p.i., post-infection.

[0025] Figure 2: ORFV efficacy compared to other oncolytic viruses. (*P <0.0001 using an unpaired, T test with Welch's correction). PBS, phosphate-buffered saline;

VAVC, oncolytic vaccinia virus; MYXV, oncolytic myxoma virus; RCNV, oncolytic raccoonpoxvirus.

[0026] Figure 3: Flow cytometry analysis of Balb/c mouse splenocytes, 6 days post treatment (l e7 Live Orf virus, or PBS intravenously).

[0027] Figure 4: The quantitation of number of lung metastases in C57B1/6 mice in the presence and absence of NK cells. [0028] Figure 5 Ex vivo cytotoxicity assays were performed on NK cells isolated from ORFV or PBS treated C57B1/6 mice.

[0029] Figure 6 ORFV treatment of human xenograft tumours, (a) ORFV growth curves on A549 and nHDF cells were performed on a panel of human cancer cell lines at an MOI of 1. Cells were infected at time 0, and cell lysates collected and processed for virus by OA3.Ts plaque assay at time-points post infection. Virus titer was compared to input titers at 72 hours post infection to calculate the fold increase in ORFV.

Representative ORFV growth curves are shown, (b) Phase contrast images of mock- infected, and ORFV infected A549 and nHDF cells at an MOI of 0.05, at 72 hours post infection at a magnification of 40X. (c) Human A549 cells (2x106) were seeded sub- cutaneously into the right flank of CD-I nude mice. ORFV or PBS treatments were given intra-tumorally on days 24, 27, 29, 31 and 34-post tumour implantation. Mouse tumour volume was monitored over time. N=5, mean + SEM, (*P O.05 using an unpaired T test with Welch's correction). PBS, phosphate-buffered saline; pfu, plaque-forming unit; MOI, multiplicity of infection.

[0030] Figure 7. Sequence of amplified VV-E3L. Start site (ATG) and stop site

(TGA) are underlined, restriction sites used for cloning are bold (SEQ ID NO: l)

[0031] Figure 8. Sequence of C7L. Restriction sites used are in bold and underlined are the start (ATG) and stop (TAA) (SEQ ID NO:2).

[0032] Figure 9. Sequence of K1L. Restriction sites used in bold and underlined are the start (ATG) and stop (TAA) (SEQ ID NO:3).

[0033] Figure 10. Characterization of recombinant OrfVmE3L by PCR analysis to confirm presence of inserted Vaccinia Virus (VV) E3L gene.

[0034] Figure 11. Characterization of recombinant OrfVmE3L by western blots analysis to confirm presence of inserted Vaccinia virus (VV) E3L gene.

[0035] Figure 12. Plaque phenotype assay, a) Visual representation of variability in plaque size at each time point, b) Plaque area of Wt OrfV and OrfVmE3L.

[0036] Figure 13. Infection Assay to compare the ability of OrfV and OrfVmE3L to productively infect a panel of cell lines.

[0037] Figure 14. Comparing recombinant Orf mE3L killing ability to parental

OrfV (***p>0.0001 using unpaired student t-test with Welch's correction; MOI multiplicity of infection). [0038] Figure 15. Safety Assay. Infectivity of HeLa cells by OrfVmE3L was compared to normal cell line nHDF to assess infection specificity and safety.

[0039] Figure 16. In vivo lung metastasis model demonstrating tumour clearing capacity of OrfVmE3L.

DETAILED DESCRIPTION OF THE INVENTION Parapoxyiruses

[0040] The parapoxvirus genus belongs to the Poxviridae family. Like all members of Poxviridae, parapoxviruses are oval, relatively large, double-stranded DNA viruses. Parapoxviruses have a unique spiral coat that distinguishes them from other poxviruses. Notable zoonotic hosts of Parapoxvirus include sheep, goats, and cattle. Parapoxviruses include orf virus, pseudocowpox, bovine papular stomatitis virus, parapoxvirus of red deer in New Zealand, and squirrel parapoxvirus. The term "parapoxvirus" refers to any parapoxvirus, such as orf virus, pseudocowpox, and bovine papular stomatitis virus.

[0041] Orf virus is a species of the Parapoxvirus genus of the Poxviridae family.

There are various orf virus strains, including NZ-2 (New Zealand-2) and NZ-7 (New Zealand-7) referring to the location where they were originally isolated (see U.S. Patent Publication 2003/0013076, which is incorporated herein by reference in its entirety), abbreviated OV NZ2 and OV NZ7, respectively. There is also OV-SA00. The present invention may include all strains of the orf virus.

[0042] Orf virus has a worldwide distribution and causes dermal skin lesions in its natural host: goat and sheep, and occasionally humans. Typically, orf virus infections are initiated and maintained in the damaged skin, with no evidence of systemic spread. There have been no human deaths associated with the disease, even among immunocompromised patients (New England Joumal of Medicine 363(27):2621-7 and Clin Infect. Dis. 2007 Jun 1, 44(l l):el00-3 Epub 2007 Apr 19).

[0043] The use of orf virus as a vaccine vector to protect animals from infections of other, more severe viruses has been the subject of study. However, prior to work by the present inventors, it is believed that no live, replicating orf virus had ever been shown to be useful in treating hyperproliferative conditions. In one aspect, the present invention relates to use of an orf virus in the treatment of hyperproliferative conditions. [0044] As shown in the Examples, wild type orf virus (strain NZ2) was tested for its ability to replicate in human cancer cells. Although it was found that Wild Type orf virus was able to infect up to 50% of human cancer cell lines tested, only 10% of the tested cell lines had significant viral production.

[0045] Despite this low viral reproduction in cancer cells, the Applicants have surprisingly shown that Orf virus may be as effective or may, in some circumstances, outperform other known replicating, established oncolytic viruses. The in vivo anti cancer properties of Orf virus is at least partially replication independent, since the virus is able to effectively reduce tumours even when the virus is UV-inactivated (unable to replicate). In one aspect, live replicating Orf virus has superior anti-cancer properties to its inactivated counterpart.

[0046] The Applicants have found that at least part of the efficacy is mediated by the action of natural killer cells (NK cells). The Applicants have shown for the first time that orf virus can dramatically activate a cytotoxic and cytokine-producing phenotype of NK cells, which in turn are at least partially responsible for clearing tumour cells from the animals. This immune stimulation profile is unique to orf virus, making it an attractive immunotherapy cancer therapeutic. In one aspect, the present invention relates to use of an orf parapoxvirus in the treatment of hyperproliferative conditions.

[0047] The terms "ORFV", "orf virus", and "ORF virus" are used interchangeably throughout the specification.

Host Range Genes

[0048] The range of host cells that a virus can infect is called its "host range". This can be narrow or, as when a virus is capable of infecting many species, broad.

[0049] The term "host range gene" refers to a gene encoding a gene product (i.e. protein), which is necessary such that a given virus having said host range gene is able to replicate on cells of species on which the virus does not replicate in the absence of the functional host range. If the respective host range gene is deleted the viral replication may be restricted to cells from fewer or only one animal species.

[0050] By way of example, one can examine the poxvirus family (poxviridae). The term "poxvirus" refers to any poxvirus, such as avipoxvirus (including fowlpox virus), capripoxvirus (including sheeppox virus), leporipoxvirus (including myxoma virus), molluscipoxvirus (including molluscum contagiosum), orthopoxvirus (including vaccinia virus), parapoxvirus (including orf virus), suipoxvirus (including swinepox virus), yatapoxvirus (including yaba monkey tumour virus), entomopoxvirus A (including Melolontha melolontha entomopoxvirus), entomopoxvirus B (including Amsacta moorei entomopoxvirus) and entomopoxvirus C (including Chironomus luridus entomopoxvirus).

[0051] At the cellular level, poxvirus tropism (a process of tropism that determines which cells can become infected by a poxvirus) is dependent not upon specific cell surface receptors, but rather upon: (1) the ability of the cell to provide intracellular complementing factors needed for productive virus replication, and (2) the ability of the specific virus to successfully manipulate intracellular signaling networks that regulate cellular antiviral processes downstream of virus entry. The large genomic coding capacity of poxviruses enables the virus to express a unique collection of viral proteins that function as host range factors, which specifically target and manipulate host signaling pathways to establish optimal cellular conditions for viral replication. Functionally, the known host range factors from poxviruses have been associated with manipulation of a diverse array of cellular targets, which includes cellular kinases and phosphatases, apoptosis, and various antiviral pathways.

[0052] As a family of viruses, poxviruses collectively exhibit a broad host range and most of the individual members are capable of replicating in a wide array of cell types from various host species, at least in vitro. Poxviruses (Poxviridae) can, as a family, infect both vertebrate and invertebrate animals. Four genera of poxviruses typically infect humans: orthopox, parapox, yatapox, molluscipox. Orthopox includes smallpox virus (variola), vaccinia virus, cowpox virus, and monkeypox virus. Yatapox includes tanapox virus and yaba monkey tumor virus. Molluscipox includes molluscum contagiosum virus (MCV).

[0053] In another aspect, the host range genes may be from the Orthopoxvirus genus. By way of example, reference is made to the vaccinia virus genes K1L, C7L and E3L. It has been shown that the expression of either K1L or C7L allows vaccinia virus replication in human MRC-5 cells; the E3L to gene was shown to be required for vaccinia virus replication in monkey Vero and human HeLa cells (Wyatt et al, Virology 1998, 251 : 334-342). [0054] Also included is Fl 1L, a host range gene from the Orthopoxvirus genus.

Fl 1L is a gene that was deleted from MVA (a vaccine version of vaccina virus that is very attenuated for its ability to replicate). MVA is considered a very safe virus, with limited pathogenicity - which is because at least most if not all of its 'host range genes' have been deleted from the virus. These include C7L and K1L, among many others. Fl 1L therefore may not technically be considered a host range gene as defined in the prior art, but certainly is broadly associated with this title since it is one of the genes that was deleted from MVA to make the virus more attenuated. The actual function of the gene is a motility protein (helps the virus move around from cell to cell). However, for the purpose of the present application, Fl 1L shall be considered to be a host range gene and falls within the scope of the definition provided above.

[0055] Examples of vaccinia virus host range genes also include the genes CI 8L,

C17L, B4R, B23R and B24R according to the nomenclature as used in Johnson et al, Virology 1993, 196: 381-401 and genes (CHO) hr and SPI-1 as specified in Wyatt et al, Virology 1998, 251 : 334-342.

[0056] Other orthopoxvirus host range genes include SPI-1, SPI-2, p28/NlR, B5R, and K3L.

[0057] In one embodiment, host range genes from the Leporipox virus genus are contemplated. These include M-T2, M-T4, M-T5, M11L, M13L, M063, found in the Myxoma virus species.

[0058] In one aspect, the host range genes may be from the Orthopoxvirus genus and/or from the Leporipoxvirus genus.

[0059] Preferred heterologous host range genes are host range genes, heterologous to orf virus, that confer replication competency on orf virus, such that when inserted into the orf genome, they provide or improve the ability of orf virus to replicate in human cells.

Heterologous means derived from a different organism, in this case a different virus.

[0060] In one aspect, such heterologous host range genes confer replication competency for orf virus on human cells, and are for example E3L, K1L and C7L.

However, the present invention contemplates all heterologous host range genes that confer replication competency on orf virus on human cells. In once aspect, human cells includes human cancer cells. [0061] While parapoxviruses also contain some host range genes (e.g. OV20.0L (a

E3L homologue) is known to date), these genes are adapted for replication in the natural hosts of these species (i.e. ungulates for orf virus infection). In other words, parapoxvirus host range genes are not adapted to allow the viruses to replicate well in human cancer cells. Thus, the applicants sought to enhance the oncolytic properties of the virus, by increasing the ability of the virus to replicate productively in cancer cells, while maintaining the virus's unique ability to stimulate the immune system to produce a parapoxvirus based, multi-modality cancer therapeutic platform. The recombinant ORFV may contain its natural host range genes. In an alternative embodiment, one or more the natural host range genes are not expressed.

[0062] Some of the host range genes, such as E3L and K3L prevent the activation of protein kinase R (PKR), both directly and indirectly. Inhibition of PKR serves to inhibit the cellular anti-viral response. In one aspect, inhibition of PKR, i.e. preventing its activation so that PKR cannot signal, is desirable for the rORF virus of the invention.

[0063] The term "homologue of a host range gene" refers to a gene having a homology of at least 50%, preferably at least 70%, more preferably of at least 80%, 90%, 95%, 97%, 98%, or 99% in the coding part of the nucleotide sequence with a host range gene, wherein the "homologue of the host range gene" has the same, similar or identical biological function of a host range gene. The biological function and definition of a host range gene is defined above. Specific tests how to determine whether a gene has the biological function of a host range gene are known to the person skilled in the art. In particular reference is made to Wyatt et al., Virology 1998, 251 :334.342, Perkus et al., Virology 1990, 179: 276-286 and Gillard et al, J. Virol. 1985, 53: 316-318. Recombinant Orf Virus (ORFV)

[0064] The Applicant have shown for the first time that the oncolytic potency of orf virus can be increased by transferring heterologous host range genes into the parapoxvirus genome.

[0065] Orf virus, and the parapoxvirus genus generally, lack a number of the vaccinia virus host range genes, which may be one of the reasons why orf virus does not replicate well on human cancer cells. Furthermore, the host range genes that are present in orf are not particularly effective. [0066] Thus, in one aspect the present invention provides a recombinant orf virus containing one or more host range genes or homologues thereof. The host range genes are not orf host range genes. The host range genes enable replication of the recombinant orf in humans. Examples include host range genes from poxviridae, such as from the

orthopoxvirus genus, including vaccinia and other members of the orthopoxvirus genus, and from the leporipoxvirus genus, including myxoma virus. Advantageously, such engineering allows the orf virus to better replicate in human cancer cells, while still maintaining the orf virus' unique immune stimulatory profile.

[0067] The recombinant orf virus may be prepared using techniques commonly known in the art. The one or more host range genes can be introduced at any location within the orf virus genome, so long as such introduction(s) does not serve to disrupt necessary functions of the orf virus, and in particular does not disrupt the immune stimulatory effect of the orf virus.

[0068] In one aspect, the recombinant orf virus is an oncolytic virus. Oncolytic viruses are viruses that preferentially infect and lyse cancer cells. In one aspect, oncolytic viruses productively infect (i.e. replicate) in cancer cells. They may function by direct destruction of tumour cells, or, by indirect destruction using an immune-mediated attack. If modified, they can also function as vectors enabling genes expressing anti-cancer proteins to be delivered specifically to the tumor site.

Formulations

[0069] The recombinant oncolytic virus of this disclosure may be administered in a convenient manner such as by the oral, intravenous, intra-arterial, intra-tumoral, intramuscular, subcutaneous, intranasal, intradermal, or suppository routes or by implantation (e.g., using slow release molecules). In order to administer the composition by other than parenteral administration, the agents may be coated by, or administered with, a material to prevent inactivation.

[0070] The recombinant oncolytic virus of the present invention may also be administered parenterally or intraperitoneally. Dispersions of the recombinant oncolytic virus component can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms, such as an antibiotic like gentamycin.

[0071] As used herein "pharmaceutically acceptable carrier and/or diluent" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for biologically active substances is well known in the art. Supplementary active ingredients, such as antimicrobials, can also be incorporated into the compositions.

[0072] The carrier can be a solvent or dispersion medium containing, for example, water, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be effected by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0073] Sterile injectable solutions are prepared by incorporating the recombinant oncolytic viruses of the present disclosure in the required amount of the appropriate solvent with various other ingredients enumerated herein, as required, followed by suitable sterilization means. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle that contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying techniques, which yield a powder of the recombinant oncolytic virus plus any additional desired ingredient from a previously sterile-filtered solution thereof.

[0074] It may be advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the mammalian subjects to be treated; each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required pharmaceutically or veterinary acceptable carrier.

[0075] Pharmaceutical compositions comprising the recombinant oncolytic virus of this disclosure may be manufactured by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes. Pharmaceutical viral compositions may be formulated in conventional manner using one or more physiologically acceptable carriers, diluents, excipients or auxiliaries that facilitate formulating active recombinant oncolytic virus into preparations that can be used biologically or pharmaceutically. The recombinant oncolytic virus compositions can be combined with one or more biologically active agents and may be formulated with a pharmaceutically acceptable carrier, diluent or excipient to generate pharmaceutical or veterinary compositions of the instant disclosure.

[0076] Pharmaceutically acceptable carriers, diluents or excipients for therapeutic use are well known in the pharmaceutical art, and are described herein and, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro, ed., 18^th Edition (1990)) and in CRC Handbook of Food, Drug, and Cosmetic Excipients, CRC Press LLC (S. C. Smolinski, ed. (1992)). In certain embodiments, recombinant oncolytic virus compositions may be formulated with a pharmaceutically or veterinary-acceptable carrier, diluent or excipient is aqueous, such as water or a mannitol solution (e.g., about 1% to about 20%), hydrophobic solution (e.g., oil or lipid), or a combination thereof (e.g., oil and water emulsions). In certain embodiments, any of the biological or pharmaceutical compositions described herein have a preservative or stabilizer (e.g., an antibiotic) or are sterile.

[0077] The biologic or pharmaceutical compositions of the present disclosure can be formulated to allow the recombinant oncolytic virus contained therein to be bioavailable upon administration of the composition to a subject. The level of recombinant oncolytic virus in serum, tumors, and other tissues after administration can be monitored by various well-established techniques, such as antibody-based assays (e.g., ELISA). In certain embodiments, recombinant oncolytic virus compositions are formulated for parenteral administration to a subject in need thereof (e.g., a subject having a tumor), such as a non-human animal or a human. Preferred routes of administration include

intravenous, intra-arterial, subcutaneous, intratumoral, or intramuscular. [0078] Proper formulation is dependent upon the route of administration chosen, as is known in the art. For example, systemic formulations are an embodiment that includes those designed for administration by injection, e.g. subcutaneous, intra- arterial, intravenous, intramuscular, intrathecal or intraperitoneal injection, as well as those designed for intratumoral, transdermal, transmucosal, oral, intranasal, or pulmonary administration. In one embodiment, the systemic or intratumoral formulation is sterile. In embodiments for injection, the recombinant oncolytic virus compositions of the instant disclosure may be formulated in aqueous solutions, or in physiologically compatible solutions or buffers such as Hanks's solution, Ringer's solution, mannitol solutions or physiological saline buffer. In certain embodiments, any of the recombinant oncolytic virus compositions described herein may contain formulator agents, such as suspending, stabilizing or dispersing agents. In embodiments for transmucosal administration, penetrants, solubilizers or emollients appropriate to the harrier to be permeated may be used in the formulation. For example, l-dodecylhexahydro-2H-azepin-2-one (Azon®), oleic acid, propylene glycol, menthol, diethyleneglycol ethoxyglycol monoethyl ether

(Transcutol®), polysorbate polyethylenesorbitan monolaurate (Tween®-20), and the drug 7-chloro-l-methyl-5-phenyl-3H-l,4-benzodiazepin-2-one (Diazepam), isopropyl myristate, and other such penetrants, solubilizers or emollients generally known in the art may be used in any of the compositions of the instant disclosure.

[0079] Administration can be achieved using a combination of routes, e.g., first administration using an intra-arterial route and subsequent administration via an intravenous or intratumoral route, or any combination thereof.

Methods of Use

[0080] In one aspect the present invention provides methods and uses involving the orf viruses of the invention in order to inhibit the growth of tumors, cancers, neoplastic tissue and other premalignant and non-neoplastic hyperproliferative disorders, all of which are together referred to as hyperproliferative disorders herein. Also included are methods of preventing metastasis and/or recurrence.

[0081] Examples of tumors, cancers and neoplastic tissue that can be treated by the present invention include but are not limited to malignant disorders such as lymphomas; ovarian cancers; breast cancers; osteosarcomas; angiosarcomas; fibrosarcomas and other sarcomas; leukemias; sinus tumors; uretal, bladder, prostate and other genitourinary cancers; colon esophageal and stomach cancers and other gastrointestinal cancers; lung cancers; myelomas; pancreatic cancers; liver cancers; kidney cancers; endocrine cancers; skin cancers; and brain or central and peripheral nervous (CNS) system tumors, malignant or benign, including gliomas and neuroblastomas.

[0082] Examples of premalignant and nonneoplastic hyperproliferative disorders include but are not limited to myelodysplastic disorders; cervical carcinoma-in-situ;

familial intestinal polyposes such as Gardner syndrome; oral leukoplakias; histiocytoses; keloids; hemangiomas; hyperproliferative arterial stenosis; EBV-induced

lymphoproliferative disease, hyperkeratoses and papulosquamous eruptions including arthritis, autoimmune disorders such as lupus, inflammatory arthritis, graft-vs-host disease. The methods of treatment disclosed herein may be employed with any subject known or suspected of carrying or at risk of developing a hyperproliferative disorder as defined herein.

[0083] As used herein, "treatment" of a hyperproliferative disorder refers to methods of killing, inhibiting or slowing the growth or increase in size of a body or population of hyperproliferative cells or tumor or cancerous growth, reducing

hyperproliferative cell numbers, or preventing spread to other anatomic sites, as well as reducing the size of a hyperproliferative growth or numbers of hyperproliferative cells. As used herein, "treatment" is not necessarily meant to imply cure or complete abolition of hyperproliferative growths. As used herein, a treatment effective amount is an amount effective to result in the killing, the slowing of the rate of growth of hyperproliferative cells, the decrease in size of a body of hyperproliferative cells, and/or the reduction in number of hyperproliferative cells.

[0084] Subjects to be treated by the methods of the present invention include both human subjects and animal subjects for veterinary purposes. Animal subjects are preferably mammalian subjects including horses, cows, dogs, cats, rabbits, sheep, and the like.

[0085] In another aspect, the present disclosure provides methods of inhibiting the growth or promoting the killing of a tumor cell or treating cancer, by administering a recombinant oncolytic virus according to the instant disclosure at a multiplicity of infection sufficient to inhibit the growth of a tumor cell or to kill a tumor cell. In certain embodiments, the recombinant oncolytic virus is administered more than once, preferably twice, three times, or up to 10 times. In certain other embodiments, the tumor cell can be treated in vivo, ex vivo, or in vitro.

[0086] Examples of other tumor cells or cancers that may be treated using the methods of this disclosure include breast cancer (e.g., breast cell carcinoma), ovarian cancer (e.g., ovarian cell carcinoma), renal cell carcinoma (RCC), melanoma (e.g., metastatic malignant melanoma), prostate cancer, colon cancer, lung cancer (including small cell lung cancer and non-small cell lung cancer), bone cancer, osteosarcoma, rhabdomyosarcoma, leiomyosarcoma, chondrosarcoma, pancreatic cancer, skin cancer, fibrosarcoma, chronic or acute leukemias including acute lymphocytic leukemia (ALL), adult T-cell leukemia (T-ALL), acute myeloid leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia, lymphangiosarcoma, lymphomas (e.g., Hodgkin's and non-Hodgkin's lymphoma, lymphocytic lymphoma, primary CNS lymphoma, T-cell lymphoma, Burkitt's lymphoma, anaplastic large-cell lymphomas (ALCL), cutaneous T-cell lymphomas, nodular small cleaved-cell lymphomas, peripheral T-cell lymphomas, Lennert's lymphomas, immunoblastic lymphomas, T-cell

leukemia/lymphomas (ATLL), entroblastic/centrocytic (eb/cc) follicular lymphomas cancers, diffuse large cell lymphomas of B lineage, angioimmunoblastic lymphadenopathy (AILD)-like T cell lymphoma and HIV associated body cavity based lymphomas), Castleman's disease, Kaposi's Sarcoma, hemangiosarcoma, multiple myeloma,

Waldenstrom's macroglobulinemia and other B-cell lymphomas, nasopharangeal carcinomas, head or neck cancer, myxosarcoma, liposarcoma, cutaneous or intraocular malignant melanoma, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, cervical carcinoma, vaginal carcinoma, vulvar carcinoma, transitional cell carcinoma, esophageal cancer, malignant gastrinoma, small intestine cancer, cholangiocellular carcinoma, adenocarcinoma, endocrine system cancer, thyroid gland cancer, parathyroid gland cancer, adrenal gland cancer, sarcoma of soft tissue, urethral, penile cancer, testicular cancer, malignant teratoma, solid tumors of childhood, bladder cancer, kidney or ureter cancer, carcinoma of the renal pelvis, malignant meningioma, neoplasm of the central nervous system (CNS), event in tumorigenesis, spinal axis tumor, pituitary adenoma, epidermoid cancer, squamous cell cancer, environmentally induced cancers including those induced by asbestos, e.g., mesothelioma, and combinations of these cancers.

[0087] In still another embodiment, the methods involve parenteral administration of a recombinant oncolytic virus, preferably via an artery or via an in-dwelling medical device.

[0088] In another embodiment, the recombinant oncolytic virus treatment may be combined with surgery (e.g., tumor excision), radiation therapy, chemotherapy, or immunotherapy, and can be administered before, during or after a complementary treatment.

[0089] In one aspect thereof, the oncolytic virus may be administered as a method for preventing or reducing surgery induced cancer metastasis, comprising administering to a patient, a therapeutically effective amount of the oncolytic parapoxvirus in combination with cancer surgery (e.g. tumour excision). By the term "in combination with cancer surgery" is meant that the oncolytic parapoxvirus can be administered before, during, or after a surgical cancer treatment, such that a metastasis is reduced or inhibited.

[0090] The following non-limiting examples are provided to illustrate various aspects of the present disclosure. All references, patents, patent applications, published patent applications, and the like are incorporated by reference in their entireties herein. Experimental

Wild Type orf virus tested against 30 human cell lines

[0091] Wild type orf virus has been demonstrated to replicate in and kill approximately 50% of the 30 human cancer cell lines tested from the NCI-60 cell panel (see Table 1). The cell lines were screened by infecting at a multiplicity of infection

(MOI) of 1 and harvesting the virus/cell suspensions at days 0 through 4 inclusive. The concentration of orf virus was determined at each of the time points so as to conclude which cell lines were permissive to infection. A cut-off of more than 10-fold increase in orf virus particles was deemed significant. Interestingly, even in those cell lines deemed non-permissive to orf virus infection, the virus was still able to cause cell death in a percentage of those tested (data not shown). [0092] The concentration of Orf virus particles was determined at each time point, and the maximal fold increase in Orf virus production determined by comparing the highest Orf virus output to the input concentration determined from the concentration of Orf virus particles at the day 0 time-point. Each cell line was deemed permissive (+) or non-permissive (-) based on a greater than 10-fold increase in Orf virus concentration.

Table 1: In vitro screen of the NCI-60 cell panel with Orf virus.

Cell Line Cell Origin Permissive Fold Increase Day

MDA

MD435 Melanoma / Breast carcinoma + 19 1

Head and Neck squamous cell

Cal27 carcinoma - 3 1

HCT1 16 Colon carcinoma - 3 1

SKMEL-28 Melanoma - 3 1

HOP-62 Non-small cell lung carcinoma - 3 1

NCI-H23 Adeno lung carcinoma - 0 1

Caski Epidermoid carcinoma 0

¹

Head and Neck squamous cell

SCC25 carcinoma - 0 1

HT1080 Fibrosarcoma + 207 2

PLC/PRF/5 Renal carcinoma + 88 2

MCF-7 Breast cancer + 10 2

M14 Melanoma + 10 2

OVCAR-8 Ovarian carcinoma - 8 2

SNB19 CNS carcinoma 7 2

Head and Neck squamous cell

SCC9 carcinoma - 4 2

C41 Cervical carcinoma - 3 2

SW620 Colon carcinoma - 3 2

786-0 Renal carcinoma - 3 2

SF268 CNS sarcoma - 2 2

HT29 Colon carcinoma - 2 2 HeLa Cervical carcinoma + 551 3

SF295 Glioblastoma + 54 3

SKMEL-3 Melanoma + 37 3

HOP92 Lung carcinoma + 32 3

ME180 Cervical carcinoma + 26 3

UACC62 Melanoma + 21 3

SKMEL-2 Melanoma + 15 3

A549 Lung adenocarcinoma + 1090 4

U20S Osteosarcoma + 16 4

PC3 Prostate carcinoma + 12 4

Growing orf virus in human cancer cells

[0093] From Applicant's knowledge, the entire Parapoxvirus research field uses primary, normal animal cell lines to manufacture and produce stocks of Wild Type orf virus. Applicants have now developed new methods for growing the virus on human cervical cancer cells (HeLa cells). Growth curves of orf virus infected HeLa cells (ATCC) were performed (Table 1). The results indicate that HeLa cells produce nearly as many virus particles as do the primary cells (OA3T.S cells - date not shown). There are a number of advantages to using a transformed cell line for production: cancer cells grow faster, are more easily maintained, are cheaper to maintain, and ultimately grow forever.

Effects of wild type orf virus in animal models

[0094] The ability of wild type ORFV to replicate in mouse cancer cells was examined (Fig 1). Phase contrast images of B16F10-LacZ cells and CT26-LacZ cells at 48 hours post infection showed cell rounding, indicative of a virus induced cytopathic effect (CPE). The dose dependency of ORFV-induced cell death was quantified (Fig. lb) and found to be dependent upon productive infection as UV inactivated ORFV did not induce CPE in either cell line (Fig. la). The amount of infectious ORFV produced by B16F10- LacZ and CT26-LacZ cancer cells was determined by multi-step growth curve analysis

(Fig. lc) and revealed that both cell lines can support a modest amount of virus

replication. To determine if ORFV replication was important for the in vivo efficacy achieved in the C57B1/6 and Balb/c lung models, UV inactivated ORFV was compared to live ORFV (Fig. ld,e). Quantification of the number of surface lung metastases in both models indicated that although UV inactivated virus could significantly reduce lung metastases in these models, replicating ORFV was required to achieve maximum efficacy.

[0095] This data demonstrates that Orf virus has the ability to replicate in and kill mouse cancer cell lines CT26-LacZ and BlFlO-LacZ in vitro. The fact that live replicating virus performs better than inactivated virus is important. Others have reported the use of chemically inactivated ORFV as an anti cancer agent. Here, the Applicant shows the benefit of using live replicating Orf virus as an oncolytic agent; the present invention has the added benefit of viral induced oncolysis. Additionally, Applicant demonstrates that live virus is also better at stimulating the immune system for added anti cancer benefit: refer to figures 4 and 5.

[0096] With regard to Figure 2, Balb/c mice were challenged with 10⁵ CT26-LacZ cells i.v., and dosed 3 times with the indicated virus (at 10⁷ unless otherwise indicated), or 100 of PBS. At day 10 after cell injection, lung metastases were quantified. Bars represent the mean for each group. Interestingly, despite only modest ORFV replication in murine cancer cell lines, ORFV therapy was as good, or better than oncolytic Vaccinia virus (VACV), Raccoonpox (RCNV) and Myxoma (MYXV) at reducing lung metastasis in both lung models (Fig. 2), even at a log lower dose (Fig. 2). Characterizing mechanism of orf virus mediated tumour reduction

[0097] To further characterize the mechanism of the orf virus mediated reduction in lung tumour burden, immune profiling was performed using Wild Type Live orf virus. Lung tumour bearing Balb/c mice were treated with le7 pfu orf virus intravenously, and spleens were removed and analyzed for size 5 days post virus injection. From Figure 3, animals treated with orf virus showed extensive splenomegaly (large spleen), which correlated well with an expansion of cells in the spleen. Flow cytometry analysis demonstrated that although there is a doubling in size of the spleens at this timepoint, there appears to be a disproportionate amount of innate cell types in the spleen: 5 times as many Natural Killer cells (NK cells), and nearly 10 times more dendritic cells. These results suggest that Orf virus may be stimulating an innate immune response.

[0098] C57B1/6 mice were treated with IgG control antibody N=15 (25uL -

Cedarlane) or Anti-asialo antibody N=15 (25uL - Cedarlane) intravenously every 3 or 4 days, beginning on day -3. Mice were challenged with 3e5 B16LacZ cells intravenously to establish lung tumours on day 1. Animals were treated with PBS control, le7 UV inactivated orf, or le7 live orf virus intravenously on day 2. Animals were sacrificed on day 14, and their lungs stained to visualize lung metastasis. From Figure 4, orf virus performs worse in the absence of NK cells. This is shown as quantitative data, and as pictures of representative lung images. Interestingly, UV inactivated Orf virus does not reduce lung mestastases in the absence of NK cells, suggesting that the NK cell immune stimulation is likely attributed to a component of the virus particle, and is independent of productive viral infection. These data also demonstrate that live replicating Orf virus is capable of inducing anti-cancer effects above and beyond immune stimulation; likely the direct lysis of tumour cells.

[0099] To further characterize the anti-tumour capabilities of Orf virus activated

NK cells, NK cytotoxicity towards B16LacZ tumour cells was analyzed using an ex vivo killing assay (Figure 5). Tumour naive C57B1/6 animals were treated intravenously with le7 UV inactivated orf virus, or Live orf virus or PBS control. 24 hours post treatment, animals were sacrificed, and spleens were harvested, and cell sorted for NK cells by DX5⁺ cell sorting. NK cells were mixed with chromium labeled B16LacZ target cells in triplicate, at different effectortarget ratios, and the amount of cancer cell death was measured by the release of chromium into the media after a 4 hour incubation. Shown is the percent killing of target B16F10-LacZ cells at 24 hours post infection. N=3, mean + SEM. NK cells from Live and UV inactivated orf virus treated animals induce robust cytotoxicity towards B16LacZ targets at 24 hours post virus injection. Importantly, live Orf virus performs better than UV inactivated Orf virus. Orf virus can specifically kill human tumour cells

[00100] To evaluate the safety of Orf virus, the Applicant performed growth curve analysis comparing replication in human lung cancer cells (A549) to replication in normal human dermal fibroblast cells (nHDF): The applicant has thus shown that Wild Type Orf virus is safe on normal human cells (Figure 6a). It does not replicate in them, nor does it cause any noticeable cell death (Figure 6b). Since Applicant has shown in Table 1 that Orf virus is not as potent as other onolcytic viruses, Applicant's approach is not to attenuate the virus by deletion of host range gene(s), (ie OV20L) but instead the addition of host range genes to allow increased oncolytic potency of the virus. In Figure 6, Applicant also demonstrates that Orf virus has in vivo efficacy in an A549 xenograft model of human cancer in CD-I nude mice. For CD-I nude xenograft experiments, 2xl0⁶ A549 cells were injected subcutaneously into the right flank of mice. At 23 days post-implantation, mice were treated intra-tumorally with 5 doses of 10⁷ pfu Orf virus or PBS control. Subcutaneous tumours were measured 2-3 times per week using digital calipers. Animals were sacrificed when tumour burden reached a volume of 1500 mm³

Creating recombinant orf viruses expressing vaccinia virus (VACV) host range genes

[00101] Wildtype parental NZ2 orf virus was obtained from Dr. Mercer at Otago in New Zealand. pV41 cloning vector from Dr. Mercer was used as the backbone into which vaccinia Virus (VV) host range genes were introduced. Using a pV41 cloning vector, the Applicant introduced vaccinia host range cDNA into the ankyrin-like region of the orf virus genome following the 11-10 locus. Parental pV41 was digested with Xbal

(Invitrogen) and Bglll (NEB) to allow for the insertion of VV host range genes into the Orf virus genome.

[00102] Recombinant mE3L orf Virus Construction. E3L cDNA was amplified from vaccinia Western Reserve strain (purchased from ATCC) using primers:

FWD: CCTCTAGAGAAACGACGAACCACCAGAG (SEQ ID NO:4), and

REV: GGCCAGATCTTCAGAATCTAATGATGAC (SEQ ID NO:5) allowing for the insertion of specific restriction sites for cloning into the pV41 vector. Vaccinia virus host range genes were subcloned into the pT7-Blue-3 (Novagen) expression vector. The pT7-Blue-3-mE3L vector was transformed into Nova Blue competent cells (Novagen), amplified and extracted. The insertion was sequenced to demonstrate proper amplification. pT7-Blue-3-mE3L clone #9 was sequenced effectively (see Figure 7, SEQ ID NO: 1 ). The vector of clone #9 was digested with Xbal (Invitrogen) and Bglll (NEB) and the vaccinia mE3L was isolated by gel extraction. The mE3L was then cloned into the pV41 cloning vector at the multiple cloning site. pV41-mE3L-09_01 was transformed into Nova Blue competent cells (Novagen), amplified and extracted The pV41-mE3L-09_01 vector was linearized with Seal (Invitrogen). 293T cells were infected at an MOI of 0.05 with wildtype orf virus and subsequently transfected with the linearized pV41-mE3L vector using Lipofectamine 2000 reagent (Invitrogen). The recombinant pV41 vector introduces the vaccinia host range cDNA into the ankyrin-like region of the orf virus genome following the 11-10 locus. Orf-mE3L was selected for using the X-gluc (Cedarlane) GUS reporter system (β-glucuronidase) and plaque purified 3X on OA3.Ts cells. The recombinant was filtered through a 0.22 μΜ pore to eliminate any wildtype- recombinant aggregates. The pure recombinant was then grown on OA3.Ts and harvested using a standard virus manufacturing protocol.

[00103] Recombinant C7L orf virus (orf-mC7L): C7L cDNA was amplified from vaccinia Copenhagen strain (ATCC) using:

forward primer: GGAGATCTCATGACAATTTCCGAAGATGG (SEQ ID NO:6), and

reverse primer: CCTCTAGATTACTATTAACGCCGTCGGTATT (SEQ ID

NO:7)

C7L gene was PCR amplified and subcloned into the pT7blue.3 expression vector (Novagen). pT7blue.3-mC7L vector was transformed into Nova Blue competent cells (Novagen). Clones were amplified and DNA was extracted to allow for sequencing of clones, to confirm proper orientation using SeqMan (DNASTAR). pT7blue.3-mC7L1.3 was sequenced effectively (Figure 8, SEQ ID NO:2). pT7blue.3-mC7L1.3 was digested with Xbal (Invitrogen) and Bglll (NEB) and VV mCL7 was isolated by gel extraction. The mC7L fragment was then cloned into pV41 cloning vector. pV41-mC7L1.3 vector was transformed into Nova Blue competent cells (Novagen), amplified and extracted. pV41-mC7L1.3 vector was linearized with Xhol (Invitrogen). 293T cells (le6 cells/wells) were infected at an MOI of 5, 0.5, 1 and 0.1 with wildtype orf virus and subsequently transfected with either 1.6 μg or 3 μg linearlized pV41-mC7L1.3 vector using

Lipofectamine 2000 reagent (Invitrogen). Orf-mC7L is selected for by using the X-Gluc (Cedarlane) GUS reporter system (β-glucuronidase) and is plaque purified 3X on OA3.Ts cells. The recombinant is filtered through a 0.22 μΜ pore to eliminate any wildtype- recombinant aggregates. The pure recombinant is grown on OA3.Ts, harvested and purified using a standard virus manufacturing protocol.

[00104] Recombinant K1L orf virus (orf-mKIL). K1L cDNA was amplified from vaccinia Copenhagen strain (ATCC) using: forward primer: GGTCTAGAATGTTAACAAAAATGTGGGAG (SEQ ID NO: 8), and

reverse primer: ACTCGAGTATACACTAATTAGCGTCTCG (SEQ ID NO:9) K1L gene was PCR amplified and subcloned into the pT7blue.3 expression vector (Novagen). pT7blue.3-mKlL vector was transformed into Nova Blue competent cells (Novagen). Clones were amplified and DNA was extracted to allow for sequencing of clones, to confirm proper orientation using SeqMan (DNASTAR). pT7blue.3-mKlL.9 was sequenced effectively (Figure 9, SEQ ID NO:3). pT7blue.3-mKlL.9 is digested with Sacl (Invitrogen) and Kpnl (Invitrogen) and VV mKlL is isolated by gel extraction. The mKIL fragment is then cloned into pV41 cloning vector. pV41-mKlL.9 vector is transformed into Nova Blue competent cells (Novagen), amplified and extracted. pV41- mKlL.9 vector is linearized with Xhol (Invitrogen). 293T cells (le6 cells/wells) are infected at an MOI of 5, 0.5, 1 and 0.1 with wildtype orf virus and subsequently transfected with either 1.6 μg or 3 μg linearlized pV41-mKlL.9 vector using

Lipofectamine 2000 reagent (Invitrogen). Orf-mKIL is selected for by using the X-Gluc (Cedarlane) GUS reporter system (β-glucuronidase) and is plaque purified 3X on OA3.Ts cells. The recombinant is filtered through a 0.22 μΜ pore to eliminate any wildtype- recombinant aggregates. The pure recombinant is grown on OA3.Ts, harvested and purified using a standard virus manufacturing protocol.

[00105] Other Orf virus recombinants. Other recombinant Orf viruses containing one or more heterologous host range genes can readily be manufactured by a person of the art using similar methods to those described above.

Confirming the successful cloning and creation of OrfVmE3L

[00106] To confirm the successful creation of OrfV mE3L, the Applicant demonstrated PCR analysis of DNA from the recombination plasmid, OrfmE3L virus, and Wild Type OrfV for either the ankyrin-like region (ALR) or E3L gene. The ankyrin-like region (ALR) common to the recombinant plasmid, wildtype OrfV and recombinant OrfVmE3L was amplified as a positive PCR control. As seen from Figure 10, E3L DNA was only detected from the new OrfV mE3L virus, and the recombinant plasmid. The expression of E3L protein was also analyzed (Figure 11). Characterization of recombinant OrfVmE3L by western blots analysis to confirm presence of inserted Vaccinia virus (VV) E3L gene. The VV-E3L protein was demonstrated to be present in VV Western Reserve (positive control), as well as, OrfVmE3L, but not in the parental OrfV. HeLa cells were seeded at le6 cells/well in 6-well dishes. The next day, the wells were infected at MOI 1 with either Vaccinia Virus Western Reserve strain (positive control), OrfV (negative control) or recombinant OrfVmE3L. 24 hours post infection, whole cell protein lysate was collected using NP-40 lysis buffer with complete protease inhibitor and complete phosphatase inhibitor. Proteins were separated by SDS-PAGE (Bio-Rad), transferred to PVDF (Amersham Biosciences) and subsequently blocked with 5% (wt/vol) skim milk. The membrane was then probed with mouse monoclonal E3 antibody (1 :500; a gift from Stuart Isaacs, University of Pennsylvania). B-Tubulin was used as a loading control).

Comparing anti-cancer efficacy of Wild type and new recombinant OrfVmE3L

[00107] The Applicant compared the size of virus plaque on primary ovine testis cells (OA3.Ts) over time (Figure 12). Wt OrfV and OrfVmE3L were plaqued on OA3t.s cells, seeded in 12 wells to produce a confluent monolayer and incubated at 37°C and 5% C0₂. Images were taken at 4, 5, 6 and 7 days post infection at lOx magnification (n=5 per virus per day). Plaque area was quantified using ImageJ software. The new OrfVmE3L virus produced much larger plaque size on these cells than did wild type Orf virus, suggesting that the new virus spreads better.

[00108] The Applicant compared the ability of OrfV and OrfVmE3L to productively infect a panel of cell lines (Figure 13). Cell lines OA3.Ts (sheep testes epithelial cell), HeLa (human cervical carcinoma, CT2A (murine astrocytoma) and nHDF (normal human dermal fibroblast) were cultured in DMEM with 10% FBS. Cells were seeded in 12 well dishes to produce a confluent monolayer. Each cell line was infected 24 hours later at an MOI of 0.1, and 0.01 by wildtype NZ2 OrfV or the recombinant

OrfVmE3L. The entire contents of each well was harvested 72 h.p.i. and subsequently titred to quantify viral output. On normal nHDF cells, infection was not enhanced as a result of the E3L mutation, while on cancer cell lines HeLa and CT2A as well as goat cell line OA3t.s, increased viral replication of mE3L ORFV was demonstrated. OrfVmE3L demonstrated an enhanced level of replication as well as a greater host cell range when compared to Wt ORFV in the cancer and sheep cell lines, but was not enhanced in the normal human cell line. [00109] Figure 14 shows the results of a comparison of recombinant OrfV mE3L killing ability to parental OrfV. HeLa cells and BHK21 cells were seeded at le4 cells/well in 96-well dishes. The next day, HeLa cells and BHK21 cells were infected at MOI 0.1 and 1, respectively, with either OrfV or recombinant OrfVmE3L. 72 hours post infection, cytotoxicity was assessed using alamar blue reagent., OrfVmE3L induces significantly more cell death in HeLa and BHK21 cells compared to WT Orf virus in vitro at 72 hours post infection.

[00110] To further demonstrate the tumour specific replication of the new

OrfVmE3L virus, a spreading assay was performed (Figure 15). HeLa and nHDF cells were seeded in 12 well dishes to produce confluent monolayers. Cells were infected at an MOI of 0.01 and 0.005. Wells were stained with X-gluc 24 hpi and pictures were taken at 48 and 72 hpi. OrfVmE3L more readily infects and spreads in the cancer cells than in normal cells, as demonstrated by X-gluc staining (blue) of viral replication.

[00111] To compare the in vivo efficacy of the OrfV mE3L virus, lung models of cancer were used. Figure 16 shows an in vivo lung metastasis model demonstrating in vivo anti -tumour capacity of OrfVmE3L. CT26LacZ and B16LacZ cells were injected IV (intra-venously) into Balb/c and C57B1/6 mice, respectively. On day 4, mice were either treated with le7 pfu OrfV or OrfVmE3L or PBS. Mice were sacrificed on day 11, lungs harvested, stained with X-Gal and lung mets were enumerated. OrfVmE3L significantly reduced tumor burden in both models compared to PBS controls.

[00112] The above-described embodiments are intended to be examples only. Alterations, modifications and variations can be effected to the particular embodiments by those of skill in the art without departing from the scope, which is defined solely by the claims appended hereto.

Claims

WHAT IS CLAIMED IS:

1. A recombinant orf virus containing one or more heterologous host range genes or homologues thereof, wherein said heterologous host range genes enable replication of the recombinant orf in human cells.

2. The recombinant orf virus of claim 1, wherein said virus is an oncolytic virus.

3. The recombinant orf virus of claim 1 or 2, wherein said recombinant orf virus replicates in human cancer cells.

4. The recombinant orf virus of claim 1, 2, or 3, wherein said heterologous host range genes are poxviridae host range genes.

5. The recombinant orf virus of claim 4, wherein said heterologous host range genes are selected from the group consisting of orthopoxvirus and leporipoxvirus genera.

6. The recombinant orf virus of claim 5, wherein said heterologous host range genes are from vaccinia virus.

7. The recombinant orf virus of claim 5, wherein said heterologous host range genes are from myxoma virus.

8. The recombinant orf virus of claim 4, wherein said host range genes are one or more selected from the group consisting of SPI-1, SPI-2, KIL, C7L, p28/NlR, B5R, E3L, K3L, F11L, M-T2, M-T4, M-T5, M11L, M13L, M063, and homologues thereof.

9. The recombinant orf virus of claim 4, wherein the heterologous host range genes are C7L, KIL, E3L, or homologues thereof.

10. The recombinant orf virus of any one of claims 1 to 9, for the use in the treatment of hyperproliferative disorders.

11. The recombinant orf virus of any one of claims 1 to 10, wherein the virus is a live orf virus.

12. A method for the treatment of hyperproliferative disorders, comprising administering to a patient, a therapeutically effective amount of the recombinant orf virus in accordance with any one of claims 1 to 11.

13. A method for manufacturing a recombinant orf virus of any one of claims 1 to 11, comprising producing the recombinant orf virus in human cancer cells.

14. A human cancer cell line transformed to produce the virus of any one of claims 1 to l l .

15. A pharmaceutical composition comprising the recombinant orf virus of any one of claims 1 to 11, in admixture with a suitable diluent or carrier.

16. A method for preventing or reducing surgery induced cancer metastasis, comprising administering to a patient, a therapeutically effective amount of an oncolytic parapoxvirus in accordance with any one of claims 1 to 7, in combination with cancer surgery.