CN112522215A

CN112522215A - 008 gene-deleted recombinant orf virus and construction method thereof

Info

Publication number: CN112522215A
Application number: CN201910879817.3A
Authority: CN
Inventors: 余远迪; 许国洋; 杨柳; 张素辉
Original assignee: Chongqing Academy of Animal Sciences
Current assignee: Chongqing Academy of Animal Sciences
Priority date: 2019-09-18
Filing date: 2019-09-18
Publication date: 2021-03-19
Anticipated expiration: 2039-09-18
Also published as: CN112522215B

Abstract

The invention provides a recombinant orf virus, which knocks out a 008 gene encoding one of F-box-like/ANK anchor proteins; the sequence of the 008 gene is shown in SEQ ID NO. 1. The recombinant orf virus has good replication capacity, obviously reduces the toxicity, but keeps good immunogenicity, thereby providing scientific data for enriching pathogenic mechanisms of the orf disease and providing a new target for developing gene-deleted attenuated vaccines of the orf virus.

Description

008 gene-deleted recombinant orf virus and construction method thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a recombinant virus of sheep infectious pus with a 008 gene deletion and a construction method thereof.

Background

Aphtha is an acute, highly contagious zoonosis caused by Orf virus (ORFV), which affects mainly goats and sheep. Clinically, viral infection of sheep is typically characterized by proliferative inflammation, manifested by the onset of erythema at the lips, tongue, nose, breast, etc., followed by erythema forming papules, vesicles, yellowish, creamy, purulent exterior and crusting which eventually dry, and the virus can repeatedly infect the host. In the infection process of the orf virus, the immune system of a host plays an important role, CD4+ T cells, interferon and the like generated in the host can inhibit the replication of the virus, but can not prevent the virus from infecting the host repeatedly, which shows that the orf virus develops a strategy of escaping the host immunity by utilizing some virulence factors existing in the orf virus through the interaction with the host, and the orf virus virulence genes play important roles in carrying out the immune regulation on the host.

The orf virus belongs to the parapoxvirus genus of the poxviridae family, is a linear double-stranded DNA virus, has a genome size of 134-139kb, and has a large central coding region in the middle of the virus genome, and participates in the assembly and release of the virus; the inverted terminal repeats are present at both ends (ORF001-ORF008, ORF112-ORF 134). Virulence genes of the virus, encoding genes related to host tropism and immunoregulatory genes are positioned at terminal regions on two sides of a genome, the terminal genes of the orf virus are not completely annotated at present, and functions of some important proteins need to be further discovered and verified so as to clarify replication and infection mechanisms of the orf virus and the relationship between the virus and the host.

It has been shown that dockerin repeats and F-box domain proteins are widely present in poxviruses, ranging in size from 400-650 amino acids, with 5-10 ANK repeats at the N-terminus and conserved sequences similar to the F-box domain at the C-terminus, with the recruitment of substrates to the cellular SCF (SKP-1, cullin, F-box) ubiquitin ligase complex (Sonnberg et al; Herbert et al 2015). The orf virus F-box-like dockerin ORFV008 is functionally related to the SCF ubiquitin ligase complex, and is expressed early in a virus-infected host, and plays a role in virus replication capacity and virulence.

The regularly interspaced clustered short palindromic repeats/Cas protein (CRISPR/Cas9) system is a natural microbial immune mechanism against the invasion of other pathogens. The system consists of RNA-guided Cas9 endonuclease (from Streptococcus pyogenes), single guide RNA (sgRNA) and trans-activation CRISPR RNA (tracrRNA) which has genome editing suitable for eukaryotic cells, can be pulled by the sgRNA to the vicinity of a target gene, recognizes PAM sequence NGG (N is A, T, C, G) of the target gene and cuts at the position of 3-4 bases on the PAM sequence, destroys the target gene sequence and triggers a repair mechanism of DNA in cells, wherein one repair mode is mutation, deletion and insertion of bases at a joint so as to delete the target gene, and the other mode is homologous recombination repair mode, wherein the former is dominant.

Disclosure of Invention

The invention aims to provide a recombinant orf virus, which can not affect the in vitro replication capacity of the orf virus, can obviously reduce the toxicity of the virus, keeps good immunogenicity and can be used as a new scheme of an orf virus attenuated vaccine.

The purpose of the invention is realized by the following measures:

a recombinant orf virus having a knock-out 008 gene encoding one of the F-box-like/ANK anchor proteins.

The sequence of the 008 gene is shown in SEQ ID NO. 1.

The invention also aims to provide a preparation method of the recombinant orf virus.

The preparation method of the recombinant orf virus comprises the step of knocking out 008 gene of the orf virus by using CRISPR/Cas9 plasmid, wherein the primer of the plasmid is as follows:

Oligo1-F：5’-ACCGCGTCAGTTGCCACGAGCGCG-3’

Oligo1-R：5’-AAACCGCGCTCGTGGCAACTGACGC-3’

Oligo2-F：5’-ACCGCATCACGTCCACGAGCGCGG-3’

Oligo2-R：5’-AAACCCGCGCTCGTGGACGTGATGC-3’。

specifically, the preparation method of the orf recombinant virus comprises the following steps:

(1) obtaining pUgRV-ORFV008-1 and pUgRV-ORFV008-2 plasmids with orf virus gene sequences: using a orf virus strain 008 gene sequence as a template, adding ACCG at the 5 'end of a primer coding strand, adding AAAC at the 5' end of a non-coding strand template, designing two pairs of primers of the 008 gene, annealing in vitro to form a double strand, and connecting the double strand with a UgRV vector digested by Bbs I to obtain pUgRV-ORFV008-1 and pUgRV-ORFV008-2 plasmids;

(2) purification of viral genome: extracting virus genome DNA, purifying by an ethanol precipitation method, and identifying the genome DNA by PCR amplification of orf virus conserved gene F1L;

(3) rescue of recombinant virus: extracting endotoxin-removed plasmids pUgRV-ORFV008-1, pUgRV-ORFV008-2 and empty vector plasmids, co-transfecting LT cells with virus genomes, collecting virus-containing supernate, and repeatedly screening and purifying plaques to obtain P3 generation recombinant orf virus, which is named rORFV 008-mut.

Advantageous effects

1. The orf virus obtained by the invention has high virus multiplication titer, good stability, obviously reduced virus toxicity, safety and stronger immunogenicity, the immunization and the strength infection of the orf virus are similar to those of a parent strain, and an organism can generate immune response to various antigens of the virus, is suitable for local inoculation and induces mucosal immunity. Provides a new direction and thought for the development and production of the orf virus attenuated vaccine.

2. The orf virus has large genome capacity, the deletion of a 008 gene site does not influence the replication capacity of the virus, and a plurality of exogenous genes can be inserted into the site to construct a recombinant orf virus expressing other exogenous genes.

3. Because the orf virus skeleton genome is relatively large (about 134kb) and the GC content of the genome is up to 63% -64%, if the target gene is deleted by using a conventional homologous recombination method, the success rate is very low. The invention adopts a specific CRISPR/Cas9 gene editing technology, can greatly improve the DNA repair probability in cells by destroying a target gene sequence, increases the recombination probability, is easy to screen recombinant viruses, and simply, conveniently and efficiently obtains the recombinant orf virus with the 008 gene deletion.

4. The invention designs and synthesizes 2 gRNA sequences capable of specifically recognizing 008 genes, constructs CRISPR/Cas9 plasmid to knock out orf virus 008 genes, saves recombinant viruses and performs sequencing identification. The virus infects goat mucosa and body surface skin, the forming condition of body surface focus and skin biopsy pathology are dynamically observed, the neutralizing titer of the antibody in serum is detected, and the toxicity and immunogenicity of the recombinant orf virus with the deletion of 008 gene are evaluated.

Drawings

FIG. 1 schematic diagram of UgRV (CRISPR vector) plasmid inserted into orf virus 008 gene

FIG. 2 shows the cleavage result of UgRV plasmid vector Bbs I (M: Marker; 1: cleavage identification result);

FIG. 3 depicts the identification of pUgRV-ORFV008-1 plasmid sequencing;

FIG. 4 depicts the identification of pUgRV-ORFV008-2 plasmid sequencing;

FIG. 5 is a view showing the identification of orf virus (M: Marker; 1: result of virus identification by isolation)

FIG. 6 is a map of virus-infected cells at P2 generation, wherein a is a map of the lesion of infected cells at P2 generation, and b is a blank control;

FIG. 7 shows the electrophoresis of the PCR-identified P2 generation virus (M: Marker; 1: P2 generation recombinant virus PCR product);

FIG. 8 is a map of virus-infected cells at P3 generation, wherein a is a map of the lesion of infected cells at P2 generation, and b is a blank control;

FIG. 9 is an electrophoretogram of PCR identification of P3 generation virus;

FIG. 10 is a sequencing alignment of recombinant viruses;

FIG. 11 shows the virus proliferation potency assay.

Detailed Description

The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

The nucleotide sequence of the orf virus 008 gene aimed by the invention is shown in SEQ ID NO. 1.

1. Obtaining the orf virus with the deletion of the 008 gene:

1) the gene sequence of orf virus strain 008 is used as a template, ACCG is added at the 5 'end of a coding strand of a primer, AAAC is added at the 5' end of a non-coding strand template, and the primers are as follows:

the aphtha strains are derived from commercial OV-SA00 (NCBI: AY386264.1), OV-IA82 (NCBI: AY386263.1), NZ2(DQ184476.1), D1701(HM133903.1) aphtha strains or clinical isolates of the aphtha obtained from goats in Chongqing. The method comprises the following specific steps:

step 1: cloning gRNA of the 008 gene onto CRISPR vector (fig. 1): two pairs of primers are respectively annealed in vitro to form double strands and are connected with an UgRV vector which is cut by BbsI (figure 2) to obtain pUgRV-ORFV008-1 and pUgRV-ORFV008-2 plasmids, and the sequencing result is consistent with the primer sequence (figure 3, figure 4).

Step 2, purification of viral genome: viral genomic DNA was extracted and purified by ethanol precipitation, and the genomic DNA was identified by PCR (primers for F1L gene: F1L-F: 5'-ATGGATCCGCCGGAAATTAC-3'; F1L-R: 5'-AACAATGGCGGTAACCAGCA-3') using orf virus conserved gene F1L (FIG. 5).

Step 3 rescue of recombinant viruses: extracting endotoxin-removed plasmids pUgRV-ORFV008-1, pUgRV-ORFV008-2 and empty vector plasmids, co-transfecting LT cells with virus genomes until cytopathic effect reaches 70-80%, repeatedly freezing and thawing a cell plate for 3 times, centrifuging at 3000rpm for 5 minutes, and collecting virus-containing supernatant. LT cells are paved on a 6-well cell culture plate, virus supernatant is inoculated in cell wells, after 72 hours, single plaques are picked up and added into 500 mu L DMEM, and the supernatant virus solution is obtained by repeated blowing and dissolving. After the cells were completely diseased but not exfoliated by inoculating 50. mu.L of the above LT cells on a 12-well plate (FIG. 6), the cell supernatant was collected, viral genomes were extracted, and the gene F1L of step 2 was used for PCR identification, and a band of about 1000bp was detected in the amplification product by 1% agarose gel electrophoresis (FIG. 7). The virus fluid identified as positive for the P2 passage was purified to P3 passage by the next plaque screening (fig. 8, fig. 9). Sequencing results show that the 008 gene in the recombinant virus is knocked out (FIG. 10), and the recombinant virus is named rORFV 008-mut.

TABLE 1 rescue of recombinant viruses

2. Virus replication capacity detection by virus multiplication curve

The fetal sheep turbinate bone cell (OFTu) cells are fully paved on a 12-hole cell plate, when the cell density reaches 50-60%, a virus parent strain ORFV-WT and a recombinant orf virus rORFV-mut lacking 008 genes are respectively inoculated at the dose of 0.01MOI, incubation is carried out at 37 ℃, the cells are gently shaken once every 15min, after incubation is carried out for 1h, virus solution is removed, PBS is used for washing the cells twice, and DMEM containing 0.2% BSA is added as maintenance solution. Supernatants were taken at 24, 36, 48, 60 and 72h post virus infection, frozen at-80 ℃ and assayed for TCID on MDBK cells₅₀Curves were drawn, with three replicates per time point. The results showed no difference in the proliferation potency of the two viruses (FIG. 11), indicating that the 008 gene-deleted orf virus still has good replication potency.

3. The orf virus lacking the 008 gene has obviously reduced toxicity and stronger immunogenicity.

Healthy 3-5 month-old lambs without orf virus infection and without orf vaccine were selected and randomly divided into three groups of three lambs each (three control vaccinated groups, three ORFV-WT vaccinated groups, three ORFV008-mut vaccinated groups). The lambs were sedated with safety medication and the inoculated sites were washed with sterile water physiological saline. The test animals were scored along 2cm and 5cm inside the right labial mucosa, right back and right hind thigh, respectively, and would contain 10⁷TCID50/ml of virus (0.5ml) was inoculated into each site using a cotton swab, and PBS was used as a control in the control group.

(1) After inoculation, the lesion formation is observed and evaluated day by day, the body temperature is detected regularly, the day of inoculation is recorded as 0d, and 21d is observed. The criteria evaluated were the degree of erythema, papules, pustules and adherent crusting, each scored according to the width of the lesion along the score: 1 point, lesion <0.5 cm; 2 minutes, 0.5cm < lesion < cm; and 3 points, lesions are larger than 1 cm, the daily total score of each lamb is the sum of three lesion types, the lesions are scored according to lesion widths in the appearance observation process, and the rORFV008-mut inoculation group is reduced by 30-66 percent compared with the parent strain group.

(2) Skin biopsy specimens were collected on days 2, 5, 8, 12 and 21, fixed with 10% buffered formalin, paraffin embedded, sectioned, stained with hematoxylin and eosin standard methods, and sections were viewed microscopically to show: compared with the inoculation parental strain group, the lesions of the rORFV008-mut inoculation group are not obvious, which shows that the virulence of the recombinant virus is obviously reduced.

(3) After inoculation, body temperature was monitored daily and re-inoculated 4 weeks later. The neutralizing titer of the antibodies is detected by sheep serum at 3, 4, 6 and 8 weeks, the antibody titer of the parental strain group and the rORFV008-mut inoculation group is obviously higher than that of the control group, but no difference exists between the two inoculation groups, which indicates that the orf virus without the 008 gene still has good immunogenicity.

<110> institute of zootechnics in Chongqing City

<120> recombinant orf virus deleted 008 gene and construction method thereof

<160>

<210> 1

<211> 1551

<212> DNA

<213> Artificial (Artificial sequence)

<400> 1

atgctctcgc gggagtccgt cgtggctccg cacgcggacc tgctcttccg ctacctggag 60

tccgggcagg tggatctcgc cacggtccgc gcgctcgtgg caactgacgc ggacgtgaac 120

ttccgcggcg agtacgggcg cacgccgctg cacctctgcg tgcacttcgc gcggcacgag 180

cagtgtgcgg agatcgtgcg cgtgctgctg gaggctggcg cggacgtaaa cgccaaggac 240

acctgcggct tcacgccgct gcacgcctac gtgcagcacg actgcgtgcg gccggaggtg 300

gtcgcgctca tgctggaggc gggcgcagac gtggtctgcg acgacagctt cgtcttctac 360

gacagcgcgc tctcctcctt cctgtcttcc tgcggctccg acggcaccga gctcgaggtc 420

gcgcggctgc tgctggacgc gggcgcgcgc gtgaacgagg gcgacaccta cggcatgacg 480

ccgctgcacg tgtacgccaa gaaccagtgg atccgcgagg acgtgctgcg gctgctgctc 540

gagcgcggcg cgaacccaaa cgcctgcgac tgccacggcg tgacgccgct ggcggcgctg 600

ctgggctccg gcggcgtctc cgccgcgctc gtggacgtga tgctgcgcgc gggcgcagac 660

gcacgcgccg tggacgcata caggcgcacg acactgcacc acctcgcgcg cacggccaag 720

atctccgagg gcctggtgcg catgctcacg ggcctgggcg tggacccggc cgcggtagac 780

gcgagtggga acaccatgct gcactacatg gcgacctacg ggcgctgcgc tcgcggcgtc 840

gtggaattcg tgctcgagcg cgggctggac ctgaacctgc gcaacaacaa cctgcagacc 900

gcgctgcacc gcgcggcggt gttcagccac ggcgcctgct gccggctggt gcgcatgggc 960

gcggagctcg ggcacgtggc ggcctcgggc ctatgcgcgg tctctgagat gctgcgccgc 1020

aacaacgtgc gtgcgacggc cgccgtgctc gcgcgccggc cgccgacgga actgctcgtg 1080

cgcgcgctgc tcacatccga gcgctggggc cacgtgttca aacgctcgga ggccgcgctg 1140

ctgtgcgtgc aggagctggc gctgcgcggc gagggcgcgc gcctgctggc ggagcgagcg 1200

ctggcggact acgcgaccgt ggtccgcgcg tgcgagcagg agatcgcgag catgcgcgcg 1260

gtgcgctgcc acacggacgc gacgctgctg gacgtgctgc gcgcggcgca cgacgcgaag 1320

gcgctcttcg tgtcgaacgc cttcctggag cgcgcggccg agttccccat ctacgggacg 1380

gcgctcttcg gcaaggtctg catgatgcgg ctgcgcgtct cgctggctga gcagatcgcc 1440

ggcctcatgt gcccgtgcgc cctgccgccg gagatcgtga cctccatcct gtgcttcctg 1500

ccgtacgagt cgctgctgga cctgcgccgc gccatgctga cccgcccctg a 1551

Claims

1. A recombinant orf virus, characterized in that: the 008 gene encoding one of the F-box-like/ANK dockerin was knocked out.

2. The recombinant orf virus of claim 1, wherein the 008 gene has the sequence shown in SEQ ID No. 1.

3. The method for constructing the orf recombinant virus of claim 1, comprising the steps of:

step 1, designing two pairs of primers aiming at a gene sequence of a orf virus strain 008, annealing in vitro to form a double strand, and connecting the double strand with a UgRV vector digested by Bbs I to obtain 2 gRNA sequences capable of specifically recognizing the gene 008 to construct a CRISPR/Cas9 gene editing plasmid;

step 2, extracting the orf virus genome DNA and purifying by an ethanol precipitation method, and identifying the genome DNA by PCR amplification of an orf virus conserved gene F1L;

step 3, Lipofectamine liposome is used^TM2000 transfection method, co-transfection of gene editing plasmid and virus genome DNA on LT cell, continuous observation of cytopathic effect, and harvesting virus after the occurrence of cytopathic effect as P1 generation virus; collecting the virus-containing supernatant, and performing repeated plaque screening and purification to obtain P3 generation recombinant orf virus, wherein the lesions of cells are obvious, and the virus is identified as the orf virus by PCR.

4. The method for constructing a recombinant orf virus of claim 3, wherein the primers used in the plasmid construction are:

Oligo1-F：5’- ACCGcgtcagttgccacgagcgcg -3’

Oligo1-R：5’- AAACCGCGCTCGTGGCAACTGACGC -3’

Oligo2- F：5’-ACCGcatcacgtccacgagcgcgg-3’

Oligo2-R：5’-AAACCCGCGCTCGTGGACGTGATGC-3’。