WO2012115437A2

WO2012115437A2 - Pharmaceutical composition for cancer treatment or metastasis inhibition containing expression or activation inhibitors of map7d2 protein, novel cancer therapeutic target

Info

Publication number: WO2012115437A2
Application number: PCT/KR2012/001316
Authority: WO
Inventors: 권기선; 김선영; 최소영; 도소희; 박성섭; 이광표
Original assignee: 한국생명공학연구원
Priority date: 2011-02-25
Filing date: 2012-02-21
Publication date: 2012-08-30
Also published as: WO2012115437A3

Abstract

The present invention relates to the pharmaceutical composition for cancer treatment or metastasis inhibition containing expression or activation inhibitors of MAP7D2 protein as an active ingredient. More specifically a novel anti-cancer therapeutic target has been discovered using data-mining techniques by building a large-scale gene expression database of human cancer tissues, and, based on the gene expression profiles of cancer cell lines, appropriate cancer cell lines were selected and experimentally verified through the inhibition of candidate target genes. Through these, MAP7D2 has been verified as a novel potential anti-cancer target which is over-expressed in a variety of cancer tissues or cells, such as cancer tissues or cells of the kidney, lung, large-intestine, ovary, stomach and liver, and inhibition of which impedes the growth, movement, infiltration and metastasis of cancer cells, thereby leading to cell destruction. As such, expression levels of MAP7D2 can be useful as a diagnostic marker for cancer and an MAP7D2 protein expression or activation inhibitor can be used as an active ingredient in a pharmaceutical composition for cancer treatment or metastasis inhibition.

Description

【Specification】

[Name of invention]

Pharmaceutical compositions for treating cancer or inhibiting cancer metastasis comprising inhibitors of the expression or activity of the MAP 7 D 2 protein as a novel cancer treatment target

Technical Field

The present invention relates to a pharmaceutical composition for treating cancer or inhibiting cancer metastasis, comprising an inhibitor of expression or activity of MAP7D2 protein, which is a novel cancer growth or cancer metastasis therapeutic target.

<2>

Background Art

<3> Cancer Progression is Activation of Cancer-Induced Genes (oncogene) and Tumor Suppressor Genes

This is a complex process that requires the deactivation of the tumor suppressor gene. Recently, studies using mouse models to study or treat human cancers require the continuous expression of certain cancer-causing genes (eg, H- ras, K-ras, Myc, etc.) for tumor maintenance. It is confirmed that cancer is effectively treated by inactivation of a single cancer causing gene. This is defined as oncogene addiction, and an important goal of current anticancer research is to find new methods such as Integrative Genomics and Systems Biology to find these addicted cancer-causing genes in cancer. To find an effective targeting target.

Herceptin, Rituxan, Gefitinib, and Glybag

As successful targeted anticancer drugs such as Gleevec are being used in the clinic, the targeted anticancer drug market is growing rapidly, and multinational pharmaceutical companies are conducting a lot of research and development to develop new targeted anticancer drugs. There are a number of therapeutic agents for targeted anticancer targets that are currently in preclinical or clinical trials, but efforts are still underway worldwide to acquire new targets for various cancers. A representative study is the TCGA The Cancer Genome Atlas, which is jointly conducted by NCI and NHGRI in the United States. Exxon sequencing of various cancer patients finds new targets by finding important mutations that occur frequently in cancer. I'm trying to secure it.

<5>

<6> Cancer is a disease that is very heterogeneous in its cause and progression. Morphological and pathological Although similar in nature, they progress in significantly different forms at the molecular level. Recent clinical experience supports this: ERBB2 and EGFR, the targets of successful clinical drugs such as Herceptin and Zephytinib, are mutated or overexpressed in only about 20-30% of all cancer patients. have.

As the cancer progression is heterogeneous, it is necessary to acquire and analyze as many clinical samples as possible to find important targets. Currently, only a few research groups worldwide have a large gene expression database and are using it to discover targeted cancer treatment targets, and many studies in Korea have yet to secure large databases.

<8>

MAP7D2 (MAP7 domain containing 2) is another protein named FLJ 14503, MGC104944, RP11-393H10.2, which is a type of microtubule-associated protein 7 domain.

To date, studies on MAP7D2 have been directed to genes with reduced expression on the X-chromosome in studies for the diagnosis of Autism spectrum disorder (ASD) (US Patent Publication No. 2010/0029009 A1), or X Expression analysis of X-chromosome for detection of gene copy number variation in patients with chromosome X-linked mental retardat ions affected the replication of approximately 1 Mb detected in X _P 22.12 of Case 4 patients. The state is only listed as a gene (BMCGenomics, 2007, 8: 443, 2007), specifically information about the MAP7D2 gene, its function and its association with cancer are not known at all.

<11>

Accordingly, the present inventors have conducted research to discover targeted cancer treatment targets, and have established a large-scale gene expression database of cancer tissues through original data mining techniques. The present invention was completed by identifying MAP7D2 that is overexpressed in lung cancer, colorectal cancer, ovarian cancer, gastric cancer, and liver cancer and remarkably inhibiting the growth, infiltration and metastasis of cancer cells by inhibition of MAP7D2 expression.

<13>

[Content of invention]

[Technical problem]

<14> An object of the present invention is the MAP7D2 protein, which is a novel cancer growth or cancer metastasis therapeutic target. It is to provide a pharmaceutical composition for treating cancer or inhibiting cancer metastasis, containing an inhibitor of expression or activity as an active ingredient.

Another object of the present invention is to provide a method for screening cancer growth, invasion or metastasis inhibitors using MAP7D2.

In addition, another object of the present invention is to provide a method for monitoring or diagnosing cancer in a subject using MAP7D2.

<17>

Technical Solution

In order to achieve the above object, the present invention provides a pharmaceutical composition for treating cancer or inhibiting cancer metastasis, containing an inhibitor of the expression or activity of MAP7D2 (MAP7 domain containing 2) protein as an active ingredient.

In addition, the present invention provides a method for screening a candidate substance for treating cancer or inhibiting cancer metastasis, comprising the following steps:

1) treating the test substance to the cell line expressing MAP7D2 protein;

<2i> 2) measuring the expression level of MAP7D2 protein in the cell line; And

3) selecting a test substance whose expression level of the MAP7D2 protein is decreased compared to a control group not treated with the test substance.

In addition, the present invention provides a method for screening a candidate substance for cancer treatment or cancer metastasis suppression comprising the following steps:

1) treating the test substance to the MAP7D2 protein;

2) measuring the activity of the MAP7D2 protein; And

3) selecting the test substance whose activity level of the MAP7D2 protein is reduced compared to the control group not treated with the test substance.

In addition, the present invention provides a method for monitoring or diagnosing cancer using MAP7D2 protein:

1) measuring the expression level of MAP7D2 protein in a subject-derived sample; And

2) Determining that the subject with increased expression level of MAP7D2 protein than the control group as a subject at risk of cancer.

The present invention also provides a method for preventing cancer, comprising administering to a subject a pharmaceutically effective amount of an MAP7D2 protein expression or activity inhibitor.

<3i> The present invention also provides a method for treating cancer or inhibiting cancer metastasis, comprising administering a pharmaceutically effective amount of an MAP7D2 protein expression or active inhibitor to a subject with cancer. Provide the law.

In addition, the present invention comprises the step of measuring the expression level of MAP7D2 in cancer cells using any one or more of the nucleic acid complementary to the antibody or gene specifically binding to MAP7D2, the diagnosis of cancer, confirming the treatment result Or provide a method of assessing prognosis.

The present invention also provides a kit for diagnosing cancer, comprising any one or more of nucleic acids complementary to antibodies or / genes that specifically bind to MAP7D2.

The present invention also provides an inhibitor of MAP7D2 protein expression or activity for use in the prophylaxis or treatment of cancer or the pharmaceutical composition for inhibiting cancer metastasis.

In addition, the present invention provides nucleic acids complementary to antibodies or genes that specifically bind to MAP7D2 for use in cancer diagnostic kits.

<36>

Advantageous Effects

In the present invention, a large-scale gene expression database of human cancer tissue was constructed to discover a novel targeting anticancer candidate target MAP7D2 through data mining techniques, and the MAP7D2 is a kidney cancer, lung cancer, colon cancer, ovarian cancer, gastric cancer, and the like. It is particularly remarkably overexpressed in tissue or cells of liver cancer, and inhibition of MAP7D2 significantly inhibits the growth, migration, invasion and metastasis of cancer cells and induces apoptosis, thereby inhibiting the expression or activity inhibitor of MAP7D2 protein. A pharmaceutical composition containing as an ingredient may be usefully used as an active ingredient of a pharmaceutical composition for treating cancer or inhibiting cancer metastasis.

<38>

[Brief Description of Drawings]

FIG. 1 is a diagram showing the results of analyzing the expression pattern of the MAP7D2 gene in clinical tissues with the microarray platform U133plus2.

Figure 2 is a diagram showing the results of analyzing the expression of the MAP7D2 gene in the cancer cell line microarray platform U133plus2.

3 illustrates the use of GAPDH as an internal control for standardization of RNA amounts.

Figure shows the expression of MAP7D2 in colorectal cancer cell line.

4 uses GAPDH as an internal control for standardization of RNA amounts.

Figure shows the expression of MAP7D2 in liver cancer cell line.

FIG. 5 uses GAPDH as an internal control for standardization of RNA amounts.

Figure shows the expression of MAP7D2 in lung cancer cell line. FIG. 6 shows the results of RT-PCR to compare the expression of MAP7D2 in normal and lung cancer tissues of lung cancer patients:

-Act in: beta actin (control); N: normal tissue; And T: cancer tissue.

FIG. 7 shows the results of RT-PCR to compare the expression patterns of MAP7D2 in normal and liver cancer tissues of liver cancer patients:

Β-act in: beta actin (control); N: normal tissue; And T: cancer tissue.

FIG. 8 shows the renal cancer cell line A498 knocked down by the expression of MAP7D2 by siRNA.

The expression of MAP7D2 gene was confirmed by RT-PCR.

Figure 9 shows the results of confirming the inhibitory effect of cell growth in the renal cancer cell line A498 knocked down expression of MAP7D2 by siRNA.

10 is a diagram confirming the expression of the MAP7D2 gene by RT-PCR in lung cancer cell line NCI-H1703 in which expression of MAP7D2 is knocked down by shRNA.

<5i> FIG. 11 is a view of morphology of lung cancer cell line NCI-H1703 observed under a microscope (X100) 5 days after knocking down MAP7D2 expression (shCtrl: Nontarget shControl RNA).

12 is a graph showing changes in cell growth due to knockdown of the MAP7D2 gene in lung cancer cell line NCI-H1703 (bar: standard deviation).

FIG. 13 is a diagram showing the change in cell migration by knockdown of MAP7D2 gene in lung cancer cell line NCI-H1703:

A: A picture of a microscopic observation of a cancer cell migration experiment using a transwell plate of NCI-H1703 cells transduced with shRNA (X100 magnification); And

B: A graph quantifying changes in NCI-H1703 migration due to decreased MAP7D2 expression (X200)

Count the number of randomly selected 8-sided cells in magnification, bar: standard deviation).

FIG. 14 is a diagram showing the change of cell invasion by knockdown of MAP7D2 gene in lung cancer cell line NCI-H1703:

A: microscopic observation of cancer cell infiltration experiments using transwell plates of NCI-H1703 cells transduced with shRNA (X100 magnification); And

B: A graph quantifying changes in NCI-H1703 invasion due to decreased MAP7D2 expression (X200)

Count the number of cells in 8 fields randomly chosen at magnification, bar: standard deviation).

<59>

[Best form for implementation of the invention]

Hereinafter, the present invention will be described in detail. The present invention provides a pharmaceutical composition for treating cancer or inhibiting cancer metastasis, comprising an MAP7D2 (MAP7 domain containing 2) protein expression or activity inhibitor as an active ingredient.

The MAP7D2 protein preferably has an amino acid sequence as set forth in SEQ ID NO: 1, but is not limited thereto.

The cancer is preferably any one selected from the group consisting of kidney cancer, lung cancer, colon cancer, ovarian cancer, gastric cancer, and liver cancer, and more preferably lung cancer or kidney cancer, but is not limited thereto.

The inhibitor of expression of the MAP7D2 protein is from the group consisting of antisense nucleotides, small hairpin RNAs, small interfering RNAs, and ribozymes that complementarily bind to the mRNA of the MAP7D2 gene. The MAP7D2 protein inhibitor is any one selected from the group consisting of compounds, peptides, peptide mimetics, substrate analogs, aptamers, and antibodies that complementarily bind to MAP7D2 proteins. Is preferably, but is not limited thereto.

The siRNA is composed of a 15 to 30 mer sense sequence selected from the base sequence of the mRNA of the gene encoding a human MAP7D2 protein and an antisense sequence complementary to the sense sequence, wherein The sense sequence is not particularly limited thereto, but is preferably composed of 25 bases, but is not limited thereto, and more preferably, SEQ ID NO: 4 or 5, but is not limited thereto.

The antisense nucleotide binds to (generalizes) the complementary sequencing of DNA, immature -mRNA, or mature mRNA, as defined by the Watson-click base pair, thereby disrupting the flow of genetic information as a protein in DNA. will be. The nature of antisense nucleotides that are specific for the target sequence makes them exceptionally versatile. Since antisense nucleotides are long chains of monomeric units they can be easily synthesized for the target RNA sequence. Many recent studies have demonstrated the utility of antisense nucleotides as biochemical means for studying target proteins (Rothenberg et al., J. Natl. Cancer Inst., 81: 1539-1544, 1999). The use of antisense nucleotides can be considered as a new type of inhibitor because of recent advances in oligonucleotide chemistry and in the synthesis of nucleotides that exhibit improved cell adsorption, target binding affinity and nuclease resistance.

Peptide Minetics binds to the binding domain of the MAP7D2 protein. It is to inhibit the activity of the inhibitory MAP7D2 protein. Peptide or non-systematic seuneun peptide may be a non-peptide, _S p i coupling (Benkirane, N., et al J. Biol Chem, 271:... 33218-33224, 1996) and engaged by the same, a non-peptide bond Can be composed of amino acids. Also, a "conformational ly constrained" peptide, between cyclic mimetics, at least one exocyclic domain, binding moiety (binding amino acid) and active site It may be a click mimetics. Peptide mimetics are structured similar to the secondary structural properties of the MAP7D2 protein and are either antibodies (Park, BW et al. Nat Biotechnol 18, 194-198, 2000) or water soluble receptors (Takasaki, W. et al. Nat Biotechnol 15, 1266). -1270, 1997), which can mimic the inhibitory properties of large molecules, and may be novel small molecules that work with the same effect as natural antagonists (Wrighton, NC et al. Nat Biotechnol 15, 1261-1265, 1997).

The aptamer is a single chain DNA or RNA molecule,

Oligomers that bind with specific affinity and selectivity to specific chemical or biological molecules by evolutionary methods using oligonucleotide libraries called systemat ic evo 1 on i 1 and g of s by exponential enrichment (SELEX) Can be obtained separately (C. Tuerand L. Gold, Science 249, 505-510, 2005; AD Ellington and JW Szostak, Nature 346, 818-822, 1990; M. Famulok, et. Al., Acc. Chem. Res. 33, 591-599, 2000; DS Wilson and Szostak, Annu. Rev. Biochem. 68, 611-647, 1999). Aptamers can specifically bind to targets and modulate the activity of the targets, such as by blocking the ability of the targets to function through binding.

The antibody may specifically and directly bind to MAP7D2 to effectively inhibit MAP7D2 activity. As the antibody specifically binding to MAP7D2, it is preferable to use a polyclonal antibody or a monoclonal antibody. The antibody that specifically binds to MAP7D2 may be prepared by known methods known to those skilled in the art, and commercially known MAP7D2 antibodies may be purchased and used. The antibody can be prepared by injecting the immunogen MAP7D2 protein into an external host according to conventional methods known to those skilled in the art. External hosts include mammals such as mice, rats, sheep and rabbits. Immunogens are injected intramuscularly, intraperitoneally or subcutaneously, and can generally be administered in combination with an adjuvant to increase antigenicity. Blood is drawn periodically from an external host to determine the titer and antigen Antibodies can be isolated by collecting specific serum.

The composition may have inhibitory activity of cancer proliferation, migration, invasion or metastasis.

<72>

In a specific embodiment of the present invention, the present inventors describe the gene expression of NCBI.

From the gene expression data of OmniExpress and EBI's ArrayExpress, a microarray analysis was used to build a gene expression database of human samples (see Table 1), which contains gene expression data for normal and cancerous tissues (see Table 1). See Table 2). Cancer Outlier Profile Analysis (COPA) was applied to identify cancer treatment targets from the cancer gene expression database built independently (Tomlins et al. 2005).

In order to select candidate target genes for cancer treatment from the constructed gene expression database, the present inventors selected genes that are specifically overexpressed in specific cancer tissues, and selected cell lines in which the genes were expressed higher than a certain level. At this time, the gene was selected as a novel target gene with little reported on cancer. In this process, MAP7D2 was selected as a candidate target gene for targeted chemotherapy, and the expression of MAP7D2 was analyzed by microarray analysis. As a result, it was found that the renal cancer, lung cancer, colon cancer, ovarian cancer, gastric cancer and liver cancer were expressed higher than normal tissues or other cancer tissues (see FIG. 1). , Lung cancer, colorectal cancer, ovarian cancer, gastric cancer and liver cancer cell lines were confirmed to be relatively high expression (see Figure 2). In addition, the results of MAP7D2 gene expression in colorectal cancer, lung cancer, and liver cancer cell lines, which showed significantly higher MAP7D2 expression than normal tissues or other cancers, showed that the MAP7D2 gene was highly expressed in the cell lines. (See FIGS. 3-5). In addition, it was confirmed that MAP7D2 was expressed higher in lung cancer and liver cancer tissues than normal tissues (see FIGS. 6 and 7), and it could be seen that MAP7D2 can be used as a target protein of colorectal cancer, lung cancer, or liver cancer. In addition, the present inventors transduced short hairpin RNA (shRNA) or small interfering RNA (LNA) genes into lung or kidney cancer cell lines, which show high expression levels of MAP7D2. Expression was inhibited and growth, migration, infiltration and metastasis of cancer cells of the cell line were observed. As a result, it was confirmed that MAP7D2 gene expression was inhibited by introduction of shRNA or siRNA into cancer cells (see FIGS. 8 and 10), and proliferation of cancer cells was markedly reduced and cell death was increased. 9 and 11 to 12, it was observed that the migration and infiltration of cancer cells are inhibited (see FIGS. 13 and 14). Therefore, it was found that inhibition of expression or activity of MAP7D2 inhibits the proliferation of cancer cells such as lung cancer or kidney cancer and plays a decisive role in invasion and metastasis.

Therefore, MAP7D2 is overexpressed in the tissues of renal cancer, lung cancer, colon cancer, ovarian cancer, gastric cancer and liver cancer and the cell lines of the cancer, and the inhibition of the expression of the gene inhibits the growth, migration and invasion of cancer cells. Inhibitors of the expression or activity of MAP7D2 protein may be usefully used as an active ingredient of a pharmaceutical composition for treating cancer or inhibiting cancer metastasis.

<77>

<78> A pharmaceutical composition containing an inhibitor of the expression or activity of MAP7D2 protein of the present invention as an active ingredient, wherein the active ingredient is ₀ . It is preferable to include in ₀₀₀₁ to 50% by weight, but is not limited thereto.

<7> The pharmaceutical composition of the present invention may be prepared by including one or more pharmaceutically acceptable carriers in addition to the above-described active ingredients for administration. Pharmaceutically acceptable carriers include saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, liposomes and one or more of these components in combination. Other conventional additives, such as antioxidants, buffers, bacteriostatics, can be added. In addition, diluents, dispersants, surfactants, binders and lubricants can be added in addition to formulate into injectable formulations, such as aqueous solutions, suspensions, emulsions, pills, capsules, granules or tablets, which will act specifically on target organs. Target organ specific antibodies or other ligands can be used in combination with the carrier so that they can be used. Furthermore, according to the appropriate method in the art or using the method disclosed in Remington's Pharmaceutical Science (Recent), Mack Publishing Company, Easton PA, it is preferred according to each disease or component. It may be formulated.

The nucleotides or nucleic acids used in the present invention may be prepared for the purpose of oral, topical, parenteral, intranasal, intravenous, intramuscular, subcutaneous, intraocular, transdermal and the like. Preferably, the nucleic acid or vector is used in injectable form. Thus, in particular, the area to be treated may be mixed with any pharmaceutically acceptable media for injectable compositions for direct infusion. The pharmaceutical compositions of the present invention may in particular comprise isotonic sterile solutions or lyophilized compositions which allow the composition of injectable solutions upon the addition of dry, in particular sterile water or appropriate physiological saline. patient Direct injection of nucleic acid into tumors of the tumor is advantageous because it allows the treatment efficiency to be focused on the infected tissue. The dosage of nucleic acid used can be adjusted by various parameters, in particular by gene, vector, mode of administration used, disease in question or alternatively required duration of treatment. In addition, the range varies depending on the patient's weight, age, sex, health status, diet, administration time, administration method, excretion rate and the severity of the disease. The daily dose is about 0.0001 to 100 /, preferably 0.001 to 10 /, preferably administered once to several times a day.

<82>

In addition, the present invention provides a method for screening a candidate substance for cancer treatment or cancer metastasis inhibition using MAP7D2 protein.

The cancer is preferably any one selected from the group consisting of kidney cancer, lung cancer, colon cancer, ovarian cancer, gastric cancer and liver cancer, and more preferably lung cancer or kidney cancer, but is not limited thereto.

Specifically, the method

1) treating the test substance to the cell line expressing MAP7D2 protein;

2) measuring the expression level of MAP7D2 protein in the cell line; And

3) preferably, but not limited to, selecting a test substance whose expression level of the MAP7D2 protein is reduced compared to a control group not treated with the test substance.

In the above method, the cell line of step 1) is preferably any one selected from the group consisting of kidney cancer, lung cancer, colon cancer, ovarian cancer, gastric cancer, and liver cancer cell lines, and the lung cancer or kidney cancer cell lines. More preferably, it is not limited to this.

In the above method, the expression level of the protein of step 2) is immunoprecipitation method.

(immunoprecipitation), radioimmunoassay (RIA), enzyme immunoassay (ELISA), immunohistochemistry, RT-PCR, Western blotting and flow cytometry (FACS). Any method of measuring the amount of transcript or protein encoded therefrom known to one skilled in the art can be used.

<91> Another way is

1) treating the test substance to the MAP7D2 protein;

2) measuring the activity of the MAP7D2 protein; And

3) The activity level of the MAP7D2 protein is compared to the control group not treated with the test substance. It is preferable to include the step of screening a reduced test substance compared to but is not limited thereto.

In the above method, the activity level of the protein of step 2) is SDS-PAGE ,.

Method, enzyme immunoassay (ELISA), mass spectrometry and protein chip is preferably measured by any one selected from the group consisting of, but not limited to.

<96>

In a specific embodiment of the present invention, a novel targeting anticancer candidate target MAP7D2 was selected through a data mining technique based on a large gene expression database of human cancer tissue constructed in the present invention. Cancer cells that are overexpressed in tissues and cells of kidney cancer, lung cancer, colon cancer, ovarian cancer, gastric cancer and liver cancer, and inhibited MAP7D2 inhibit growth, migration, invasion and metastasis, and induce apoptosis. Since it has been determined to play a crucial role in the method, the method of measuring the expression or activity of MAP7D2 protein can be usefully used for screening a substance for inhibiting cancer treatment or cancer metastasis.

<98>

In addition, the present invention provides a method for monitoring or diagnosing cancer using MAP7D2 protein.

Specifically, the method

<ιοι> 1) measuring the expression level of MAP7D2 protein in a subject-derived sample; And

2) preferably, but not limited to, a step of determining a subject having an increased risk of expression of MAP7D2 protein as a subject at risk of cancer.

In the above method, MAP7D2 in step 1) preferably has an amino acid sequence set forth in SEQ ID NO: 1, but is not limited thereto.

In the above method, the cancer of step 2) is preferably any one selected from the group consisting of kidney cancer, lung cancer, colon cancer, ovarian cancer, stomach cancer and liver cancer, and more preferably lung cancer or kidney cancer. Or not limited thereto.

<105>

In addition, the present invention provides a method for preventing cancer, comprising administering to a subject a pharmaceutically effective amount of an MAP7D2 protein expression or activity inhibitor.

In another aspect, the present invention provides a method for treating cancer or inhibiting cancer metastasis, comprising administering a pharmaceutically effective amount of an MAP7D2 protein expression or active inhibitor to a subject with cancer. Provide the law.

<i08> The pharmaceutically effective amount is 0.0001 to 100 mg / kg, preferably

0.001 to 10 mg / kg, but is not limited thereto. The dosage can be varied according to the body of the specific patient, age, sex, health status, ^'diet, administration time, administration method, clearance, such as the severity of the disease.

The MAP7D2 protein expression or activity inhibitor may be administered orally or orally during clinical administration and intraperitoneal, rectal, subcutaneous, intravenous, intramuscular, intrauterine It can be administered by injection, cerebrovascular injection, or intrathoracic injection, and can be used in the form of general pharmaceutical preparations.

The subject is a vertebrate and preferably a mammal, more preferably an experimental animal such as a rat, rabbit, guinea pig, hamster, dog, or cat, and most preferably anthropoid animals such as chimpanzees or gorillas. to be.

<112>

In a specific embodiment of the present invention, the present inventors constructed a large-scale gene expression database of human cancer tissue to find a novel targeted anticancer candidate target through data mining techniques. In particular, MAP7D2 is overexpressed in tissues and cells of kidney cancer, lung cancer, colon cancer, ovarian cancer, gastric cancer and liver cancer, and inhibition of MAP7D2 inhibits the growth, migration, invasion and metastasis of lung cancer or kidney cancer cells and apoptosis. This induction confirmed the possibility of MAP7D2 as a target of a novel anticancer agent, and therefore inhibitors of the expression or activity of MAP7D2 protein can be usefully used for the treatment of cancer or inhibition of cancer metastasis.

<114>

<Π5> In addition, the present invention includes the steps of measuring the expression level of MAP7D2 in cancer cells using at least one of an antibody specifically binding to MAP7D2 or a nucleic acid complementary to the gene, the result of the diagnosis and treatment of cancer It provides a method of evaluating or evaluating prognosis.

<Π7> In the cancer diagnosis method, detection of expression of MAP7D2 elevated above normal It means that the patient has cancer. In addition, detection of normal expression of MAP7D2 in diagnostic samples of individuals treated or receiving cancer means that the cancer treatment is successful, and detection of elevated MAP7D2 above normal in the diagnostic samples indicates that treatment should be continued. do. In addition, detection of normal expression of MAP7D2 in a diagnostic sample of a subject with cancer means a good prognosis, and detection of MAP7D2 elevated above normal in the diagnostic sample means a poor prognosis.

<118>.

In addition, the present invention provides a kit for diagnosing cancer comprising any one or more of nucleic acids complementary to an antibody or gene that specifically binds to MAP7D2.

The cancer diagnostic kit may further include one or more substances and reaction product detection reagents and instructions for reacting with MAP7D2. For example, the one or more substances that react with MAP7D2 may be RNA or DNA complementary to the RNA or DNA of MAP7D2, and an antibody that binds to the MAP7D2 protein and the reagent for detecting the reaction product may be a nucleic acid or protein label and a coloring reagent. have.

<121>

In a specific embodiment of the present invention, a novel targeting anticancer candidate target MAP7D2 was selected through a data mining technique based on a large gene expression database of human cancer tissue constructed in the present invention. Cancer cells that are overexpressed in tissues and cells of kidney cancer, lung cancer, colon cancer, ovarian cancer, gastric cancer and liver cancer, and inhibited MAP7D2 inhibit growth growth, invasion and metastasis, and induce apoptosis, thereby inducing MAP7D2 to cancer cells. It was confirmed to play a decisive role. Therefore, the expression level of MAP7D2 can be monitored and cancer can be diagnosed.

<123>

In addition, the present invention is for use in the prevention or treatment of cancer or to inhibit cancer metastasis,

Inhibitors of MAP7D2 protein expression or activity are provided.

The inhibitor of expression of the MAP7D2 protein may be any one selected from the group consisting of antisense nucleotides, short interfering RNAs, and short hairpin RNAs, which complementarily bind to mRNA of a gene. Preferred but not limited to.

The inhibitor of activity of the MAP7D2 protein binds complementarily to the MAP7D2 protein. It is preferably one selected from the group consisting of a compound, a peptide, a peptide mimetics, an aptamer and an antibody, but is not limited thereto.

<129>

In a specific embodiment of the present invention, the inventors constructed a large-scale gene expression database of human cancer tissue to discover novel targeted anticancer candidate targets through data mining techniques. In particular, MAP7D2 is overexpressed in tissues and cells of kidney cancer, lung cancer, colon cancer, ovarian cancer, gastric cancer, and liver cancer, and inhibition of MAP7D2 inhibits the growth, migration, infiltration and metastasis of lung cancer or kidney cancer cells, and apoptosis. Because of this induction, inhibitors of the expression or activity of the MAP7D2 protein can be usefully used for preventing or treating cancer or inhibiting cancer metastasis.

<131>

In addition, the present invention provides a nucleic acid complementary to an antibody or gene that specifically binds to MAP7D2 for use in a kit for cancer diagnosis.

The cancer diagnostic kit may further include one or more substances and reaction products for detecting the reaction with MAP7D2 and instructions thereof. For example, the one or more substances that react with MAP7D2 may be RNA or DNA complementary to the RNA or DNA of MAP7D2, and an antibody that binds to MAP7D2 protein, and the reagent for detecting the reaction product may be a nucleic acid or protein label and a coloring reagent. have.

<134>

In a specific embodiment of the present invention, a novel targeting anticancer candidate target MAP7D2 was selected through a data mining technique based on a large gene expression database of human cancer tissue constructed in the present invention. Cancer cells that are overexpressed in tissues and cells of kidney cancer, lung cancer, colon cancer, ovarian cancer, gastric cancer, and liver cancer, and inhibit MAP7D2 growth, migration, invasion and metastasis, and induce apoptosis, thereby inhibiting MAP7D2 from cancer cells. It was confirmed that it plays a decisive role in. Thus, nucleic acids complementary to antibodies or / genes that specifically bind to MAP7D2 can be usefully used in cancer diagnostic kits.

<136>

[Form for implementation of invention] Hereinafter, the present invention will be described in detail by way of examples and preparation examples.

However, the following Examples and Preparation Examples specifically illustrate the present invention, and the contents of the present invention are not limited to the Examples and Preparation Examples.

Example 1 Screening of a Novel Anticancer Target Gene Showing Database Construction and Oncogene Addiction

<1-1> Gene Expression Database of Large-scale Human Cancer Tissues

Collected and analyzed more than 450 data sets from NCBI's Gene Expression Omnibus and EBI's ArrayExpress published database to generate differentiated gene expression databases comprising more than 33,000 samples, as shown in Table 1 below. Built. Specifically, we have consolidated and organized the data in a consistent way from the microarray raw data file as much as possible to integrate and analyze different data sets. First, only data using the Affymetrix human chip platform was collected. Second, the expression value at each gene level was determined by applying Affymetrix's unique algorithm, the microarray suite 5 (MAS5) method, from the original CEL file. By applying the global mean normalization in the same way, each microarray platform (U133Plus2) was able to integrate more than 10,000 samples into one and perform meta-analysis.

Table 1

Human sample gene expression database

<145>

The database contains gene expression data for more than 22,000 normal and cancerous tissues from almost all tissues, as shown in Table 2 below.

<147>

<148> [Table 2] Tissue π normal sum

Bladder 126 23 149

Blood 1416 1127 2543

Bone Marrow 1736 5 1741

Brain 1285 2239 3524

Breast 3738 158 3896

Cervical (Cervix 138 46 184

Colon 1116 231 1347

Endomet i urn 84 81 165

Esoohagus 32 32 64

Head Neck 253 42 295

Kidnev 928 166 1094

Liver 354 83 437

Lung (L 匿) 1290 426 1716

Lvnrnh node 25 12 37

Lymphocyte (LvmDhocvt e) 180 175 355

Muscle 0 622 622

Ovarv 977 17 994

Pancreas 94 35 129

Prostate 473 188 661

Skin 437 80 517

Small intestine 14 7 21

Spleen 4 10 14

Stomach 295 61 356

Test is 206 26 232

Thyroid (Thvroid) 130 52 182

Uterus 130 25 155

Others 410 268 678

Total 15454 6661 22115

<149>

<150> <1-2> Identification of Gene Expression Changes in Cancer Patients Using Cancer Outlier Profile Analysis (COPA)

As described in Example <1-1>, C0PA analysis was applied in a method different from the conventional approach to discover therapeutic targets from a cancer gene expression database constructed independently (Tomlins et al. 2005). . Currently, the targeted anticancer target genes of therapeutic agents effectively used in the clinic are overexpressed by gene mutation or gene amplification in only a part of the patients. For example, ERBB2, a target of Herceptin, was found to be overexpressed in only about 25-30¾ of breast cancer patients, and EGFR, a target of Iressa or Celuximab, was also used in patients with lung cancer or brain tumors. Overexpression by gene mutation or gene amplification is observed only in about 10-20% of the population. As such, effective target genes may be present in some patients. Since only the variation is observed, the outlier analysis method compares the average of the top 10-20% of the patient group with the average of the normal person, rather than comparing the average of the patient group and the normal person to find genes with different expressions as in the conventional t-test. Since it is effective, this cancer outlier profile analysis (COPA) was performed.

<152>

<1-3> Screening of New Targeted Therapeutic Target Genes

<i54> The C0PA assay was applied to select genes that could be targeted for effective targeting therapy in each cancer from among drug-targeting target receptors, kinases, transporters, and channel proteins. Therapeutic drug targets currently in clinical trials or mainly on the market are mostly cell surface molecules such as receptors, channel transporters, kinases and cell adhesion molecules (CAMs). Candidate target genes were identified. Candidate target genes were identified based on the following criteria. i) Gene expression database mining for clinical tissues formed a pool of candidate target genes that are expressed more specifically in specific cancer tissues than in normal tissues. ii) Select genes that are specifically overexpressed in several cancers to become target genes in the gene pool formed. The more expression of a specific target gene in various cancers, the more likely it is to be a direct and important gene for cancer formation. Because. iii) Among cancer cell lines derived from the same tissues as the clinical tissues in which the target genes are expressed a lot, the cell lines in which the target genes were expressed at a certain level or more were selected. iv) A literature search was conducted on selected candidate target genes to find new addicted oncogenes by selecting genes that have not been studied as much as possible. Based on these criteria, MAP7D2 was selected and validated as the primary candidate target gene for targeted chemotherapy among candidate target genes.

As a result, as shown in FIG. 1, as a result of confirming the expression pattern of MAP7D2 in the clinical tissues of cancer patients, kidney cancer, lung cancer, colon cancer, liver cancer, and ovary It was observed that the expression of MAP7D2 was increased in cancer tissues such as cancer and stomach cancer compared to normal tissues, and thus, MAP7D27} could be an effective therapeutic target for the treatment of cancer (FIG. 1). ).

<156>

Example 2 Confirmation of Expression of MAP7D2 in Various Cancers <i58><2-l> Identification of MAP7D2 Expression Levels through Microarray Platform in Cancer Cell Lines

Microarray Platforms for Expression of MAP7D2 in Various Cancer Cell Lines

Analysis was performed using the U133plus2A gene chip.

As a result, as shown in Figure 2, the expression pattern in the clinical tissue of MAP7D2 is derived from kidney cancer, lung cancer, colon cancer, ovarian cancer, gastric cancer and liver cancer in accordance with the results confirmed in the cancer tissue of Figure 1 It can be seen that they are relatively high in one cancer cell line (FIG. 2).

1 and 2, MAP7D2 is best expressed for each target cancer selected based on the gene expression database for each cell line, in order to select cancer cell lines to be used in the experiment. The cell lines were confirmed, which are shown in Table 3 below.

<162>

<163> [Table 3]

<164>

<165> <2-2> Reverse Transcription Polymerase Chain Reaction in Cancer Cell Lines

Confirmation of MAP7D2 Expression by Polymerase Chain Reaction (RT-PCR)

<i66> In colorectal, lung and liver cancer cell lines where MAP7D2 was overexpressed compared to other cancers

RT-PCR was performed to confirm the expression patterns of MAP7D2, respectively.

Specifically, 11 types of cancer cell lines (4 types of colorectal cancer, 4 types of lung cancer, and 3 types of liver cancer) were used in the easy-BLUE ™ Total RNA Extraction kit (Sol Gent, Cat #: 17061).

After RNA was isolated, cDNA was synthesized using a DiaStar RT kit (SolGent, Cat #: DR13-R10K) with each total RNA 2 / g. cDNA was distilled with sterile distilled water to prepare 2% cDNA, followed by 10 pmole Taq DNA polymerase (Solgent Korea) and primer [Forward primer: 5 '-CTCGAGAGAACAGATTATG-3', sequence No. 2; Reverse primer: RT-PCR was performed using 5'-CTCACTTGTGGAGACACATC-3 ', SEQ ID NO: 3]. At this time, as a gel loading control RT-PCR of GAPDH was performed. The PCR programs used were as shown in Table 4 below.

<170>

<i7i> As a result, as shown in Figures 3 to 5, it was confirmed that the MAP7D2 gene is highly expressed in cell lines such as colorectal cancer, lung cancer and liver cancer as shown in Table 3 above ( 3 to 5).

<172>

<173> <2-3> Confirmation of MAP7D2 Expression by Reverse Transcriptase Polymerase Chain Reaction in Cancer Tissues

In order to confirm the expression pattern of MAP7D2 in lung cancer and liver cancer tissues, normal tissues and cancer tissues of lung cancer or liver cancer patients were separated from each other, and RT-PCR was performed.

Specifically, the human resources of lung cancer and liver cancer were supplied from the Korea Human Resource Base Bank of Pusan National University Hospital. Each tissue was crushed finely using a mortar and pestle while frozen with liquid nitrogen. Using the RNeasyMini kit (Qiagene, Cat #: 74104), the pulverized tissue was isolated from the total RNA, and then the total amount of RNA 2 and the DiaStar RT kit (SolGent, Cat #: DR13-R10K). CDNA was synthesized. cDNA was distilled with sterile distilled water to prepare 2% cDNA, followed by 10 pmole / Taq DNA polymerase (Solgent, Korea) and primer primer: 5 '-CTCGAGAGAACAGAGATTATG-3', SEQ ID NO: 2; Reverse primer: RT-PCR was performed using 5'-CTTCACTTGTGGAGACACATC-3 ', SEQ ID NO: 3]. At this time, RT-PCR of β-act in was performed as a gel loading control, and the PCR program used is shown in Table 4 above.

As a result, it was confirmed that MAP7D2 was highly expressed in lung cancer tissues and more than 33% in liver cancer tissues when compared with normal tissues (FIGS. 6 and 7).

<177>

Example 3 Analysis of the Effect of MAP7D2 Gene Expression Inhibition on Cancer Cell Growth

<i79> MAP7D2 rust using the lung cancer cell line NCI-H1703 and kidney cancer A498 cell line, which grow relatively quickly among the cell lines that express MAP7D2 best, and have high metastasis. The knockdown method was used to inhibit MAP7D2 gene expression and to analyze the effect on cancer cell growth by MAP7D2 gene expression inhibition.

<180>

<i8i> <3-1> Effects of MAP7D2 Gene Expression Inhibition on Kidney Cancer Cell Growth

<i82> MAP7D2 siRNA was used to determine how MAP7D2 gene expression inhibition affects the growth of kidney cancer cells.

Specifically, two MAP7D2 siRNAs (#l Duplex; 5′-)

GCAGGAGAUGUUGGGAAAGAA / UUCUUUCCCAACAUCUCCUGC-3 ', SEQ ID NO: 4 and # 2: Duplex; 5'-CCCAAAUUAUUAGCUCGGAAU / AUUCCGAGCUAAUAAUUUGGG-3 ', SEQ ID NO: 5) was purchased from Bioneer and used. Said siRNA was introduced into renal cancer cell line A498 by electroporation using control siRNA (Bioneer CAT #: SN_1002) and Amaxa as a control group, and the inhibition of MAP7D2 expression was observed 24 hours after electroporation. Cell growth according to the comparison was investigated compared to the control. In order to examine cell proliferation, firstly, cells of 1-4 × 10 ⁴ were dispensed into 24-well plates, incubated at 37 ^° C / 5% C0 ₂ , and incubated for 48 hours each. The cultured cells were recovered, and the inhibition of expression of MAP7D2 protein by MAP7D2 siRNA was confirmed in kidney cancer cells using the RT-PCR method described in Example 2-2.

In addition, after a predetermined time elapses, each plate has a Cell Counting Kit-

Add 50 ul of 8 (CCK-8, D0JIND0, Cat #: CK04-11) solution and react in a 37 C0 ₂ incubator in the dark for 1 hour, then transfer 100 ul into a 96 well plate.

The degree of cell proliferation was observed by measuring absorbance at 450 nm in Victor microplate reader.

As a result, as shown in FIG. 6, when siRNA # 2 was treated with 500 nM compared to the control group, the inhibitory effect of MAP7D2 expression was clearly observed in comparison with GAPDH used as an internal control (FIG. 8).

In addition, as shown in FIG. 7, when the expression of the MAP7D2 siRNA was inhibited compared to the control siRNA used as a control, in the renal cancer cell line A498 after 48 hours, the inhibition of marked growth of about 60% and It was confirmed that the cells were killed (FIG. 9).

<187>

<i88> <3-2> Effect of MAP7D2 Gene Expression Inhibition on Lung Cancer Cell Growth

<i89> How MAP7D2 Gene Expression Inhibition Affects Lung Cancer Cell Growth Example MAP7D2 shRNA was used to cut.

Specifically, the MAP7D2 small-hairpin RNA clones in the TRC lenticiral plasmid vecotr pLKO.l-puro (Sigma)

It was purchased from Sigma's MISSION ™ shRNA clones 1 ibraries (SIGMA, Cat #: SHCLNG- 應 152780). It consists of four sets of shRNA constructs, named TRCN0000108390, TRCN0000108391, TRCN0000108392, and TRCN0000108394, respectively, and used MAP7D2 shRNA # 1 to # 4. In addition to the Lentiviral MAP7D2 shRNA, a nontarget shRNA Control Transduction part icles (SIGMA, cat #: SHC002V) was used as a negative control, and the MISS0N TurboGFP Control was used as a positive control to confirm transduction efficiency and optimize shRNA delivery. Transduction part icles (SIGMA, Cat #: SHC003V) were used together. this

-TM 、、 TO Fu ， Lipofectamine 2000 (invitrogen, Cat #: 11668—027) and Enhancer Q

Virus particles were prepared by transfecting the shRNA into 293T using Transfection Enhancing Reagent (WelGene, Cat #: TR001-02). After 48 hours, the virus culture supernatant was recovered and filtered with syringe filter (mi 11 ipore, Cat #: SLHP033RS), and then mixed 1: 1 with fresh culture medium, in order to improve the effect of infection. 4 yg / niL polybrene (SIGMA, Cat #: L107689) was added and transfected into lung cancer cell lines NCI-H1703 and kidney cancer cell line A498, respectively. After 16 hours, replaced with fresh medium, incubated for 48 hours, and screened by treatment with 2 yg / ml puromycin for 3 days to select NCI-H1703 or A498 cells transfected with MAP7D2 shRNA. It was. At this time, as a selection control, each cancer cell line that was not transduced with shRNA was observed by treating the same amount of puromycin (puromycin). After puromycin screening, the cultured cells were recovered and the expression was inhibited using the RT-PCR method described in Example 2-2, and the cell growth rate according to the inhibition of MAP7D2 expression was controlled. It was investigated in comparison with.

As a result, as shown in FIG. 10, all of shMAP7D2 # 1 to # 4 compared to the control group showed clear MAP7D2 expression inhibition effect compared to β-actin used as an internal control. (FIG. 10).

In addition, as shown in FIGS. 11 and 12, when each of four types of MAP7D2 shRNAs (#l to # 4) were transfected into lung cancer cell line I I-H1703, shMAP7D2 # 2 or # 3 was transfected. In one lung cancer cell line, cell growth was markedly decreased and cell death was increased compared to the control group (Nontarget shControlRNA) (FIG. 11). In particular, MAP7D2 shRNA # 2 Was confirmed to exhibit about 70% growth inhibition and apoptosis effect compared to the control group (FIG. 12).

<193>

Through this, it was confirmed that suppression of MAP7D2 expression in the normal medium containing 10¾ serum lowered the dependence of growth factors and induced cell death, thereby finally lowering the extent of cell growth. Thus, MAP7D2 Has a clear oncogene addiction in renal and lung cancers, and thus may be a good target for chemotherapy in renal and lung cancers.

<195>

<Example 4> Analysis of the effect on cancer cell migration of inhibition of MAP7D2 expression

<i 7> Transwell (transwell Kcoastar, 3422) system was used to confirm whether the inhibition of MAP7D2 expression by cancer cells, the expression of MAP7D2 by the shRNA described in Example <3-2> Lung cancer cell line NCI-H1703 was inhibited. At this time, as in CCK-8 experiment, Nontarget shRNA Control Transduction particles were used as negative control shRNA to exclude nonspecific reaction by lentiviral vector shRNA in cells, and the lentiviral vector to which fluorescent material was attached was used. The introduction efficiency was predicted. The efficiency of introduction was about 80% or more. After 48 hours of phenotypic infection, 2 ug / ml of puromycin was used for 4 days of selection, and then the cancer cells were recovered and examined for their ability to migrate.

<1 8> Specifically, to determine the ability of cancer cells to migrate, trypsin (trypsinXGibco

25300) to inhibit the expression of MAP7D2 and obtain NCI-H1703 cells screened with puromycin, followed by RPMI migration media (RPMI, 10 mM HEPES, 0.5% BSA).

After washing twice, the cells were suspended in transfer medium at ^4χ10 cells / ml. The 24-well transwell plate is then _coated with 0.05% gelatin (Sigma G1393) on the underside of the insert (i _nser t) for one hour at room temperature and after one hour, the remaining gelatin in the insert. Was removed and washed once with PBS. After the procedure, 600 ul of RPMI transfer medium with 5¾ FBS was added to the chamber. After inserting the insert into the chamber using sterile tweezers, the cells were prepared in advance, the cells were placed in the insert into 4xl0 ⁴ year old catcher / 100 ul and incubated for 24 hours at 37 ^° C / 5% CO ² conditions. To measure cell migration, first wipe the top of the insert with a cotton swab moistened in PBS and insert the insert into a chamber containing 500 ul of 3.7% paraformaldehyde. It fixed for 30 minutes at temperature. Then, 1¾ crystal violet / 100 ltiM sodium borate (Sodium Borate, NaBorate) was stained with 500 ul for 30 minutes, washed with water and dried to measure the number of cells at xlOO magnification under a microscope.

As a result, as shown in FIG. 11, the cells whose MAP7D2 expression was suppressed by shRNA # 2 and # 4 were about 80% compared with the cells into which the nontarget shRNA (shCtr 1) introduced as a control was introduced. It showed a clear movement inhibitory effect (Fig. 13), it can be seen that MAP7D2 plays a critical role in the migration of cancer cells.

<200>

<Example 5> Analysis of the effect on cancer cell invasion of MAP7D2 expression inhibition

The effect of inhibition of expression of MAP7D2 on cancer cell invasion was analyzed.

Specifically, the cells were washed twice with RPMI invasion media (RPMI, lOmM HEPES, 0.5% BSA), and then the cells were suspended in the infiltration medium at 4 × 10 cells / ml. 24-well transwell plates (8 urn pore size, costar 3422) were diluted with Matrigel (BD 354234) in serum-free media (RPMI, lOmM HEPES) at 1 mg / ml at room temperature on the top of the insert. Coating for one hour at. After one hour, the Matrigel remaining in the insert was removed and washed once with serum-free medium. Then, 600 ul RPMI infiltration medium with 5% FBS was added. Using sterilized tweezers, insert the insert into the chamber containing the medium / pre-prepared NCI-H1703 cells were incubated for 24 hours at 37 ^° C / 5% CO ^{2 by} adding 100 ul into the insert. To measure the infiltrated cells that passed through the Matrigel, wipe the top of the insert with a cotton swab moistened with PBS, insert the insert into a chamber containing 3.7% paraformaldehyde 500 uKSigma HT50) and fix for 30 minutes at room temperature. . Then, 1% crystal violet (Sigma C3886) / 100 mM NaBorate (Sigma S9640) was stained with 500 ul for 30 minutes, washed with water, dried and photographed at xlOO and x200 magnification under a microscope. Counted.

As a result, as shown in FIG. 12, the cells whose MAP7D2 expression was suppressed by shRNA # 2 and # 4 were about 70% compared with the cells into which the nontarget shRNA (shCtr 1) introduced as a control was introduced. It showed a significant degree of invasion inhibitory effect (FIG. 14), and it can be seen that MAP7D2 plays a critical role in cancer cell invasion.

<205>

Preparation Example 1 Preparation of Pharmaceutical Formulation

1. Preparation of powder

<208> 2 g of inhibitor of expression or activity of MAP7D2 <209> lactose 1 g

The above ingredients were mixed and layered in an airtight cloth to prepare a powder.

<211>

2. Preparation of Tablets

<213> Inhibitor of MAP7D2 expression or activity 100 mg

<214> corn starch 100 nig

<215> Lactose 100 mg

2 mg of magnesium stearate

After the above components were mixed, tablets were prepared by tableting according to a conventional method for preparing tablets.

<218>

3. Preparation of Capsules

<220> 100 nig of inhibitor of expression or activity of MAP7D2

<221> Oa --- J J

~ r nr 100 rag

<222> Lactose 100 mg

<223> magnesium stearate 2 mg

After mixing the above components, the capsule was prepared by filling in gelatin capsules according to a conventional method for preparing capsules.

<225>

4. Preparation of Injectables

Inhibitor of Expression or Activity of MAP7D2 10 // g / m

Dilute hydrochloric acid BP until pH 7.6

<229> Injectable sodium chloride BP up to 1 m «

Dissolve the inhibitor in the expression or activity of MAP7D2 in a suitable volume of sodium chloride BP in a suitable volume, adjust the pH of the resulting solution to pH 7.6 using dilute hydrochloric acid BP, and volume using a sodium chloride BP for main volume. Was adjusted and mixed well. The solution was layered in a 5 mi type I ampoule made of clear glass, encapsulated under the upper grid of air by dissolving the glass, and sterilized by autoclaving at 12 C C for at least 15 minutes to prepare an injection solution.

<231>

5. Preparation of Rings

Inhibitors of expression or activity of MAP7D2 1 <234> Lactose 1.5 g

<235> 1 g of glycerin

<236> 0.5 g of Xili

After mixing the above components, it was prepared to I 4 _g per ring according to a conventional method.

<238>

6. Preparation of Granules

<240> Inhibitor of Expression or Activity of MAP7D2 150 rag

<241> soybean extract 50 nig

<242> glucose 200 rag

<243> starch 600 rag

After mixing the above components, 100 mg of 30% ethane was added, dried at 60 ^° C. to form granules, and then filled into fabric.

<245>

[Industrial availability]

As described above, the present invention enables the development of cancer therapeutic agents using MAP7D2 expression or activity inhibitors, and the development of a method for monitoring or diagnosing cancer using MAP7D2 as a biomarker. It may be usefully used for screening cancer growth or metastasis inhibitors.

Claims

[Range of request]

[Claim 1]

A pharmaceutical composition for treating cancer or inhibiting cancer metastasis, comprising as an active ingredient an inhibitor of MAP7D2 (MAP7 domain containing 2) protein expression or activity.

[Claim 2]

The pharmaceutical composition for treating cancer or inhibiting cancer metastasis according to claim 1, wherein the MAP7D2 protein has an amino acid sequence as set forth in SEQ ID NO: 1.

[Claim 3]

The method of claim 1, wherein the inhibitor of expression of the MAP7D2 protein is selected from the group consisting of antisense nucleotides, short hairpin RNAs, small interfering RNAs, and ribozymes that complementarily bind to mRNAs of the MAP7D2 genes. A pharmaceutical composition for treating cancer or inhibiting cancer metastasis, characterized in that any one.

[Claim 4]

The method according to claim 1, wherein the activity inhibitor of the MAP7D2 protein is any one selected from the group consisting of compounds, peptides, peptide mimetics, substrate analogs, aptamers and antibodies that binds to the MAP7D2 protein complementarily. Pharmaceutical compositions for treating cancer or inhibiting cancer metastasis.

[Claim 5]

The pharmaceutical composition for treating cancer or inhibiting cancer metastasis according to claim 1, wherein the cancer is any one selected from the group consisting of kidney cancer, lung cancer, colon cancer, ovarian cancer, gastric cancer, and liver cancer.

[Claim 6]

1) treating the test substance to the cell line expressing MAP7D2 protein;

2) measuring the expression level of MAP7D2 protein in the cell line; And

3) screening a test substance for treating cancer or inhibiting cancer metastasis, comprising selecting a test substance in which the expression level of the MAP7D2 protein is reduced compared to a control group not treated with the test substance.

[Claim 7]

The method of claim 6, wherein the expression level of the protein of step 2) is determined by immunoprecipitation, radioimmunoassay (RIA), enzyme immunoassay (ELISA), immunohistochemistry, RT-PCR, Western blot (Western). Blotting) and flow cytometry (FACS).

[Claim 8]

1) treating the test substance to the MAP7D2 protein;

2) measuring the activity of the MAP7D2 protein; And

3) screening a test substance for treating cancer or inhibiting cancer metastasis, comprising selecting a test substance whose activity level of the MAP7D2 protein is reduced compared to a control group not treated with the test substance.

[Claim 9]

The method of claim 8, wherein the activity of the protein of step 2) is measured by any one selected from the group consisting of SDS-PAGE, immunofluorescence, enzyme immunoassay (ELISA), mass spectrometry and protein chip.

[Claim 10]

2) A method for diagnosing cancer, comprising: determining a subject having an increased expression level of MAP7D2 protein than a control group as a subject at risk of cancer.

[Claim 11]

The method of claim 6, 8, or 10, wherein the cancer is any one selected from the group consisting of kidney cancer, lung cancer, colon cancer, ovarian cancer, gastric cancer, and liver cancer.

[Claim 12]

A method of preventing cancer, comprising administering to a subject a pharmaceutically effective amount of an MAP7D2 protein expression or activity inhibitor.

[Claim 13]

A method of treating cancer or inhibiting cancer metastasis comprising administering a pharmaceutically effective amount of a MAP7D2 protein expression or activity inhibitor to a subject with cancer.

[Claim 14]

An antibody that specifically binds to MAP7D2 or; ? A method of diagnosing cancer, confirming the outcome of a cancer, or assessing the prognosis, comprising measuring MAP7D2 expression levels in cancer cells using one or more of the genes complementary to the gene.

[Claim 15]

Cancer diagnostic kit comprising any one or more of nucleic acids complementary to the antibody or gene specifically binding to MAP7D2.

[Claim 16]

Inhibitor of MAP7D2 protein expression or activity for use in the prophylaxis or treatment of cancer, or the pharmaceutical composition for inhibiting cancer metastasis.

[Claim 17]

An antibody or 7 ^; ^ nucleic acid complementarily binding to MAP7D2 for use in a cancer diagnostic kit.