WO2012113064A1 - Method of diagnosing primary mediastinal b-cell lymphoma or classical hodgkin lymphoma by detecting functional mutation at ciita locus. - Google Patents

Method of diagnosing primary mediastinal b-cell lymphoma or classical hodgkin lymphoma by detecting functional mutation at ciita locus. Download PDF

Info

Publication number
WO2012113064A1
WO2012113064A1 PCT/CA2012/000165 CA2012000165W WO2012113064A1 WO 2012113064 A1 WO2012113064 A1 WO 2012113064A1 CA 2012000165 W CA2012000165 W CA 2012000165W WO 2012113064 A1 WO2012113064 A1 WO 2012113064A1
Authority
WO
WIPO (PCT)
Prior art keywords
ciita
pmbcl
chl
functional mutation
mutation
Prior art date
Application number
PCT/CA2012/000165
Other languages
French (fr)
Inventor
Christian STEIDL
Randy Gascoyne
Original Assignee
Bc Cancer Agency Branch
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bc Cancer Agency Branch filed Critical Bc Cancer Agency Branch
Publication of WO2012113064A1 publication Critical patent/WO2012113064A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the present disclosure relates generally to CIITA gene fusions and their use in the identification, diagnosis, and treatment of cancer.
  • MHC class II molecules are expressed on the surfaces of antigen-presenting cells and B lymphocytes. By binding antigens and presenting the antigens to T cells, the MHC class II molecules are involved in triggering an immune response. Thus, the level of expression of the MHC class II molecules affects the induction of an immune response.
  • MHC-II expression is principally regulated at the level of transcription.
  • CIITA is the human gene which encodes the class II, major histocompatibility complex, transactivator protein.
  • MHC-II major histocompatibility complex class II
  • Mutations in the CIITA gene are responsible for the bare lymphocyte syndrome in which the immune system is severely compromised and is often unable to effectively fight infection.
  • the present disclosure provides CIITA gene fusions and their use in identification, diagnosis, prognosis, treatment, and/or monitoring of cancer progression.
  • Gene fusion events may serve as biomarkers, and/or provide novel targets for the selective treatment of cancer. Furthermore, gene fusion events can provide diagnostic and prognostic information as well as guidance for the appropriate treatment of patients.
  • the present disclosure provides a method of diagnosis and/or confirming a diagnosis of primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin (cHL) lymphoma in a subject, the method comprising
  • a detected functional mutation at the CIITA gene locus is indicative of a diagnosis of PMBCL or cHL.
  • a detected functional mutation at the CIITA gene locus is indicative of a poor prognosis.
  • a method of determining a propensity for developing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject comprising providing/obtaining a biological sample from a subject; and detecting a functional mutation at the CIITA gene locus in the sample.
  • a detected functional mutation at the CIITA gene locus is indicative of a propensity to developing PMBCL or cHL.
  • a method of determining primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin (cHL) lymphoma treatment efficacy comprising providing/obtaining a biological sample from a PMBCL or cHL subject; detecting a functional mutation at the CIITA gene locus in the sample;
  • the present disclosure provides a kit for diagnosing and/or confirming a diagnosis of primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject, comprising: reagents for detecting a functional mutation at the CIITA gene locus in a patient sample; and instructions for use in diagnosing PMBCL or cHL.
  • a detected functional mutation a the CIITA gene locus is indicative of a diagnosis of PMBCL or cHL.
  • RECTIFIED SHEET (RULE 91.1) lymphoma (cHL), comprising: reagents for detecting a functional mutation at the CIITA gene locus in a patient sample; and instructions for use in determining prognosis.
  • a detected functional mutation at the CIITA gene locus is indicative of a poor prognosis.
  • kits for determining primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) treatment efficacy comprising: reagents for quantifying the proportion of cells having a functional mutation at the CIITA gene locus in a PMBCL or cHL subject sample; and instructions for use in determining treatment efficacy.
  • PMBCL primary mediastinal B-cell lymphoma
  • cHL classical Hodgkin lymphoma
  • kits for determining propensity for developing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject comprising: reagents for detecting a functional mutation at the CIITA gene locus in a patient sample; and instructions for use in determining propensity for developing PMBCL or cHL.
  • a detected functional mutation a the CIITA gene locus is indicative of a propensity to developing PMBCL or cHL.
  • the present disclosure provides a biomarker of primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) comprising a functional mutation at the CIITA gene locus.
  • PMBCL primary mediastinal B-cell lymphoma
  • cHL classical Hodgkin lymphoma
  • a biomarker of poor prognosis in primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin (cHL) comprising a functional mutation at the CIITA gene locus.
  • a biomarker of primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) treatment efficacy comprising a functional mutation at the CIITA gene locus.
  • a biomarker of propensity to developing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) comprising a functional mutation at the CIITA gene locus.
  • the present disclosure provides a use of a functional mutation at the CIITA gene locus for diagnosing and/or confirming diagnosis of primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL).
  • PMBCL primary mediastinal B-cell lymphoma
  • cHL classical Hodgkin lymphoma
  • RECTIFIED SHEET (RULE 91.1)
  • PMBCL primary mediastinal B-cell lymphoma
  • cHL classical Hodgkin lymphoma
  • a functional mutation at the CIITA gene locus as a biomarker of treatment efficacy in associated primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL).
  • PMBCL primary mediastinal B-cell lymphoma
  • cHL classical Hodgkin lymphoma
  • a functional mutation at the CIITA gene locus as a biomarker of propensity to developing primary mediastinal B- cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL).
  • the present disclosure provides a method of treating primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject having a CIITA translocation involving a fusion partner comprising: administering an inhibitor of the fusion partner to said subject.
  • PMBCL primary mediastinal B-cell lymphoma
  • cHL classical Hodgkin lymphoma
  • the present disclosure provides a use of an inhibitor of a fusion partner involved in a CIITA translocation for treating primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject harboring the CIITA translocation.
  • PMBCL primary mediastinal B-cell lymphoma
  • cHL classical Hodgkin lymphoma
  • a method of selecting treatment for a subject having a B-cell lymphoma comprising: providing/obtaining a sample from a B-cell lymphoma subject; detecting a translocation at the CIITA gene locus; identifying a translocation fusion partner; and selecting a treatment regimen comprising an inhibitor of the fusion partner.
  • Figure 1 depicts cumulative distribution plots of expression for both KM-H2 and L428 showing the proportion of genes expressed at increasing coverage levels.
  • Figure 2a is an illustration of a CIITA - BX648577 gene fusion using paired-end massively parallel whole transcriptome sequencing where the mate-pair sequences are shown aligning on either side of the breakpoint and the genomic exon coordinates are shown.
  • Figure 2b is an illustration of a CIITA - BX648577 gene fusion using paired-end massively parallel whole transcriptome sequencing where the split-reads are depicted lying on the breakpoint, the histogram illustrates the absolute frequency of each sequence read spanning the breakpoint.
  • Figure 3 depicts validation of BAT2L1-MGMT fusion transcripts by FISH and direct sequencing.
  • Figure 4 depicts alignment of BAC and Fosmid clones for BAT2L1-MGMT fusion and break-apart assays.
  • Figure 5 depicts validation of ELM01-SLC03A1 fusion transcripts by FISH and direct sequencing.
  • Figure 6 depicts alignment of BAC clones for ELM01-SLC03A1 fusion and break-apart assays.
  • Figure 7 depicts validation of complex chromosome 16 rearrangements in
  • Figure 8 illustrates alignment of BAC and Fosmid clones for CIITA-
  • Figure 9 illustrates the molecular characterization of the gene fusion
  • Figure 10 depicts immuno-fluorescence staining with N-terminal CIITA antibody.
  • Figure 11 depicts high-resolution single nucleotide polymorphism analysis and FISH confirm chromosomal unbalances accompanying complex rearrangements involving chromosomes 15 and 16 in KM-H2.
  • Figure 12 depicts detailed molecular-cytogenetic characterization of KM-
  • Figure 13 depicts inhibition of CIITA/BX648577 fusion gene expression by a lentiviral shRNAmir vector.
  • Figure 14 illustrates data indicating that genes of the "Antigen
  • FIG. 15 is an illustration of FISH on tissue microarrays (TMA) showing recurrent CIITA break-apart in cHL and PMBCL and associated cumulative survival of subjects with and without CIITA break-apart.
  • TMA tissue microarrays
  • Figure 16 depicts genomic breakpoints in the CIITA gene defining a
  • Figure 17 depicts the full length CIITA-BX648577 (BX648577.1 ) cDNA in KM-H2 (longest transcript) and putative translation (used for forced expression in
  • Figure 18 depicts the full length CIITA-CD274 cDNA in a PMBCL case and putative translation (used for forced expression in U2940) having translational start and stop codons, SEQ ID NO. 43 and 44 respectively.
  • Figure 19a depicts the full length CIITA-PDCD1LG2 cDNA in a PMBCL case having the CIITA start codon mutation underlined and the putative translation starts at the PDCD1 LG2 start codon in bold, SEQ ID NO. 45 .
  • Figure 19b depicts the putative translation of the cDNA from Figure 19a (used for forced expression in U2940), SEQ ID NO. 46.
  • Figure 20a depicts the full length CIITA-RALGDS cDNA in a PMBCL case
  • Figure 20b depicts the putative translation of the cDNA from Figure 20a
  • Figure 21 depicts the full length CIITA-C160RF75 cDNA in a PMBCL case and putative translation, SEQ ID NO. 49 and 50 respectively.
  • Figure 22 illustrates results indicating that expression of CD274 or CD273 fusions in PMBCL cells inhibits T cell activation.
  • Figures 23a-23e illustrate further data on the effects of CD274 and CD273 fusion expression (and inhibition thereof).
  • Figure 24 illustrates additional results indicating that CD274 / CD273 expression on PMBCL cells inhibits T cell activation.
  • Figure 25 depicts the results of cytometric analysis of intracellular cleaved
  • Gene fusion events may serve as biomarkers, and/or provide novel targets for the selective treatment of cancer. Furthermore, gene fusion events can provide
  • KECTIFIED SHEET (RULE 91.1) diagnostic and prognostic information as well as guidance for the appropriate treatment of patients.
  • Chromosomal translocations are a paradigm of molecular pathogenesis in
  • B cell lymphomas and highly recurrent and specific rearrangements have defined distinct molecular subtypes linked to unique clinicopathological features. 1,2 In contrast, several well characterized lymphoma entities still lack disease-defining translocation events.
  • RNA-seq whole-transcriptome paired- end sequencing
  • CIITA chromosomal rearrangement of CIITA is involved in the pathogenesis of both Hodgkins lymphoma and primary mediastinal B cell lymphoma (PMBCL). Furthermore, following subsequent evaluation of 263 B cell lymphomas, the Applicant has demonstrated that genomic CIITA breaks were highly recurrent in primary mediastinal B cell lymphoma (about 38%) and classical Hodgkin lymphoma (about 15%).
  • Lymphoma is the fifth most common cancer in North America, impacting the cells which play a role in the immune system. Lymphomas are cancers that arise from lymphocytes, white blood cells that circulate primarily through the lymphoid system. Each year thousands of North Americans are impacted by primary mediastinal B-cell lymphoma and Hodgkin lymphoma, two of the most common types of lymphoma cancers affecting people under the age of 40. Lymphomas are generally called either B-cell or T-cell lymphoma depending on the type of lymphocyte that has become cancerous. For example, Hodgkin lymphoma usually starts with a B-cell lymphocyte.
  • B cell lymphomas include: Chronic lymphocytic leukemia/Small lymphocytic lymphoma, B-cell prolymphocytic leukemia; Lymphoplasmacytic lymphoma (such as Waldenstrom macrogiobulinemia); Splenic marginal zone lymphoma; Plasma cell neoplasms including Plasma cell myeloma, Plasmacytoma, Monoclonal immunoglobulin deposition diseases, and Heavy chain diseases; Extranodal marginal zone B cell lymphoma, also called MALT lymphoma; Nodal marginal zone B cell lymphoma (NMZL); Follicular lymphoma; Mantle cell lymphoma; Diffuse large B cell lymphoma (including PMBCL); Mediastinal (thymic)
  • RECTIFIED SHEET (RULE 91.1) large B cell lymphoma; Intravascular large B cell lymphoma; Primary effusion lymphoma; and Burkitt lymphoma/leukemia.
  • Diffuse large B-cell lymphoma (DLBL, DLBCL, or DLCL) is a type of aggressive non-Hodgkin lymphoma. It accounts for approximately 40% of lymphomas among adults. The median age at diagnosis is 70 years, but it also occurs in children and young adults. As with most non-Hodgkin lymphomas, there is a male predominance, although primary cutaneous diffuse large B cell lymphoma is more common in women. Of all cancers involving the same class of blood cell, 31 % of cases are DLBL. [4]
  • DLBCLs consists of cells that are 4-5 times the diameter of a small lymphocytes and typically have marked cell-to-cell variation in size and shape. Their cytoplasm is typically basophilic and moderate in abundance. Nucleoli can be small but conspicuous to large and prominent and may be peripheral and/or central. Large playful cells can occasionally mimic Reed-Sternberg cells, seen in Hodgkin lymphoma.
  • Primary mediastinal B-cell lymphoma is a subset of Diffuse Large B-cell lymphoma, which arises in the thymus, and presents as a mass in the mediastinum. It primarily affects younger patients in their 30's and 40's, and is more common in women than men. It closely resembles Hodgkin lymphoma, and has a similar prognosis to similarly staged DLBC.
  • PMBCL is an aggressive lymphoma which often presents with symptoms related to its location. Breathing problems, shortness of breath, pleural effusions, superior vena cava syndrome, fevers, etc. On initial diagnosis it is almost always limited to the mediastinal mass, but if a relapse occurs it is likely to occur in the kidneys, liver, central nervous system.
  • Hodgkin lymphoma (cHL), previously known as Hodgkin disease, is a type of lymphoma, which is a cancer originating from white blood cells called lymphocytes. Hodgkin lymphoma is characterized by the orderly spread of disease from one lymph node group to another and by the development of systemic symptoms with advanced disease. When Hodgkins cells are examined microscopically, multinucleated Reed- Sternberg cells (RS cells) are the characteristic histopathologic finding. Hodgkin lymphoma may be treated with radiation therapy, chemotherapy, or hematopoietic stem cell transplantation, with the choice of treatment depending on the age and sex of the patient and the stage, bulk, and histological subtype of the disease. The disease occurrence shows two peaks: the first in young adulthood (age 15-35) and the second in those over 55 years old. [3]
  • Reed-Sternberg cells (typical and variants) admixed within a reactive cell infiltrate composed of variable proportions of lymphocytes, histiocytes, eosinophils, and plasma cells.
  • the Reed-Sternberg cells are identified as large often bi-nucleated cells with prominent nucleoli and an unusual CD45-, CD30+, CD15+/- immunophenotype. In approximately 50% of cases, the Reed-Sternberg cells are infected by the Epstein-Barr virus. Characteristics of classic Reed-Sternberg cells include large size (20-50 micrometres), abundant, amphophilic, finely
  • cytoplasm granular/homogeneous cytoplasm; two mirror-image nuclei (owl eyes) each with an eosinophilic nucleolus and a thick nuclear membrane (chromatin is distributed at the cell periphery).
  • CIITA is a promiscuous partner of various in-frame gene fusions.
  • the Applicant found that CIITA gene alterations impact survival in primary mediastinal B cell lymphoma.
  • the Applicant further discovered a down-regulation of surface HLA class II expression and overexpression of ligands of the receptor molecule programmed cell death 1 (CD274/PDL1 and CD273/PDL2). These receptor-ligand interactions have been shown to impact antitumour immune responses in a number of cancers 3 , while decreased MHC class II expression has been linked to reduced tumour cell
  • CIITA tumour-microenvironment interactions across a spectrum of lymphoid cancers.
  • RNA-sequence data was generated from the HL cell lines KM-H2 and
  • Fusion transcripts were detected using defuse and validation of fusion transcripts was performed by FISH and PCR. Protein expression of the CIITA- BX648577 fusion protein was detected by Western blotting and immunofluorescence. Fusion transcript knockdown in KM-H2 cells was performed by lentiviral transduction of a vector expressing a shRNAmir interfering with BX648577 sequences. Forced expression of the CIITA gene fusions was achieved using a lentiviral 29 and an inducible retroviral vector 30 . Gene expression in KM-H2 cells was measured using gene expression profiling and flow cytometry. Primary paraffin tissue samples of 263 subjects with B cell lymphoma were studied using FISH. For 8 selected PMBCL cases with CIITA
  • RECTIFIED SHEET (RULE 91.1) cells.
  • Jurkat T cells were used for co-culture experiments measuring T cell activation by CD69 flow cytometric analysis and IL-2 enzyme-linked immunosorbent assays (ELISA).
  • ELISA enzyme-linked immunosorbent assays
  • a method of diagnosing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin (cHL) lymphoma in a subject comprising: providing/obtaining a biological sample from a subject; and detecting a functional mutation at the CIITA gene locus in the sample; wherein a detected functional mutation at the CIITA gene locus is indicative of a diagnosis of PMBCL or cHL.
  • additional clinical criteria may be used to distinguish between PMBCL and cHL.
  • PMBCL arises primarily in the mediastinum, and its initial anatomical location may be used as a hallmark to identify PMBCL.
  • Microscopic examination of blood cells, and immunophenotype may also be used to assist in differentiation between the two clinical entities.
  • the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
  • the functional mutation may be an inactivating mutation in the CIITA gene.
  • the inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
  • the functional mutation is a translocation involving the CIITA gene.
  • the translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof.
  • transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation.
  • the translocation involves fusion of C//7>4 to BX648577, CD274, CD273, RALGDS,
  • the activated fusion partner leads to decreased HLA class II gene expression.
  • the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments,
  • the fusion partner is a PD-1 ligand. In some embodiments, the
  • translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
  • a method of confirming a diagnosis primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject suspected of having PMBCL or cHL the method
  • PMBCL arises primarily in the mediastinum, and its initial anatomical location may be used as a hallmark to identify PMBCL.
  • Microscopic examination of blood cells, and immunophenotype may also be used to assist in differentiation between the two clinical entities.
  • the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
  • the functional mutation may be an inactivating mutation in the CIITA gene.
  • the inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
  • the functional mutation is a translocation involving the CIITA gene.
  • the translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof.
  • transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation.
  • the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
  • the activated fusion partner leads to decreased HLA class II gene expression.
  • the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments,
  • the fusion partner is a PD-1 ligand. In some embodiments, the
  • translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
  • PMBCL primary mediastinal B-cell lymphoma
  • cHL classical Hodgkin lymphoma
  • the poor prognosis is a poor prognosis under a cyclophosphamide-hydroxyldaunorubicin-oncovin-prednisone (CHOP) combination or a
  • a CHOP-like regimen may include CHOP, CHOEP (CHOP plus etoposide) or MACOP-B (methotrexate with leucovorin rescue, doxorubicin, cyclophosphamide, vincristine, prednisone, and bleomycin).
  • the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
  • the functional mutation may be an inactivating mutation in the CIITA gene.
  • the inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
  • the functional mutation is a translocation involving the CIITA gene.
  • the translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof.
  • transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation.
  • the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
  • the activated fusion partner leads to decreased HLA class II gene expression.
  • the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments,
  • the fusion partner is a PD-1 ligand. In some embodiments, the
  • translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
  • a method of determining a propensity for developing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject comprising: providing/obtaining a biological sample from a subject; and detecting a functional mutation at the CIITA gene locus in the sample; wherein a detected functional mutation at the CIITA gene locus is indicative of a propensity to developing PMBCL or cHL.
  • PMBCL primary mediastinal B-cell lymphoma
  • cHL classical Hodgkin lymphoma
  • the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
  • the functional mutation may be an inactivating mutation in the CIITA gene.
  • the inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
  • the functional mutation is a translocation involving the CIITA gene.
  • the translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof.
  • transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation.
  • the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
  • the activated fusion partner leads to decreased HLA class II gene expression.
  • the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments,
  • the fusion partner is a PD-1 ligand. In some embodiments, the
  • translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
  • a method of determining primary mediastinal B-celi lymphoma (PMBCL) or classical Hodgkin (cHL) lymphoma treatment efficacy comprising: providing/obtaining a biological sample from a PMBCL or cHL subject; detecting a functional mutation at the CIITA gene locus in the sample; quantifying the proportion of cells having the functional mutation at the CIITA gene locus; comparing the proportion of cells having the functional mutation at the CIITA gene locus against a suitable control wherein a reduced number of cells having the functional mutation at the CIITA gene locus compared to the suitable control is indicative of an efficacious treatment.
  • PMBCL primary mediastinal B-celi lymphoma
  • cHL classical Hodgkin
  • the suitable control may be a sample taken earlier from the same subject. In an exemplary embodiment, the suitable control may be a sample taken earlier from the same subject prior to treatment.
  • the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
  • the functional mutation may be an inactivating mutation in the CIITA gene.
  • the inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
  • the functional mutation is a translocation involving the CIITA gene.
  • the translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof.
  • transcription or expression of the fusion partner may involve fusion of CIITA to a fusion partner, or a fragment thereof.
  • RECTIFIED SHEET (RULE 91.1) (or fragment thereof) is activated by the translocation.
  • the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
  • the activated fusion partner leads to decreased HLA class II gene expression.
  • the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments,
  • the fusion partner is a PD-1 ligand. In some embodiments, the
  • translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
  • kits for diagnosing primary mediastinal B- cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject comprising:
  • reagents for detecting a functional mutation at the CIITA gene locus in a patient sample and instructions for use in diagnosing PMBCL or cHL, wherein a detected functional mutation a the CIITA gene locus is indicative of a diagnosis of PMBCL or cHL.
  • additional clinical criteria may be used to distinguish between PMBCL and cHL.
  • PMBCL arises primarily in the mediastinum, and its initial anatomical location may be used as a hallmark to identify PMBCL.
  • Microscopic examination of blood cells, and immunophenotype may also be used to assist in differentiation between the two clinical entities.
  • the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
  • the functional mutation may be an inactivating mutation in the CIITA gene.
  • the inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
  • the functional mutation is a translocation involving the CIITA gene.
  • the translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof.
  • transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation.
  • the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
  • the activated fusion partner leads to decreased HLA class II gene expression.
  • the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA
  • KECTIFIED SHEET (RULE 91.1) to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof).
  • the fusion partner is a PD-1 ligand. In some embodiments, the
  • translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
  • kits for confirming a diagnosis primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject suspected of having PMBCL or cHL comprising: reagents for detecting a functional mutation at the CIITA gene locus in a sample from a subject suspected of having PMBCL or cHL; and instructions for use in diagnosing PMBCL or cHL, wherein a detected functional mutation a the CIITA gene locus is confirms diagnosis of PMBCL or cHL.
  • additional clinical criteria may be used to distinguish between PMBCL and cHL.
  • PMBCL arises primarily in the mediastinum, and its initial anatomical location may be used as a hallmark to identify PMBCL.
  • Microscopic examination of blood cells, and immunophenotype may also be used to assist in differentiation between the two clinical entities.
  • the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
  • the functional mutation may be an inactivating mutation in the CIITA gene.
  • the inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
  • the functional mutation is a translocation involving the CIITA gene.
  • the translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof.
  • transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation.
  • the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
  • the activated fusion partner leads to decreased HLA class II gene expression.
  • the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments,
  • the fusion partner is a PD-1 ligand. In some embodiments, the
  • translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
  • kits for determining prognosis of a subject with primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL), comprising: reagents for detecting a functional mutation at the CIITA gene locus in a patient sample; and instructions for use in determining prognosis; wherein a detected functional mutation at the CIITA gene locus is indicative of a poor prognosis.
  • PMBCL primary mediastinal B-cell lymphoma
  • cHL classical Hodgkin lymphoma
  • the poor prognosis is a poor prognosis under a cyclophosphamide-hydroxyldaunorubicin-oncovin-prednisone (CHOP) combination or a CHOP-like chemotherapy treatment regimen.
  • a CHOP-like regimen may include CHOP, CHOEP or MACOP-B.
  • the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
  • the functional mutation may be an inactivating mutation in the CIITA gene.
  • the inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
  • the functional mutation is a translocation involving the CIITA gene.
  • the translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof.
  • transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation.
  • the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
  • the activated fusion partner leads to decreased HLA class II gene expression.
  • the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments,
  • the fusion partner is a PD-1 ligand. In some embodiments, the
  • translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
  • kits for determining primary mediastinal B-cell lymphoma (PMBCL) treatment efficacy comprising: reagents for quantifying the proportion of cells having a functional mutation at the CIITA gene locus in a PMBCL or cHL subject sample; and instructions for use in determining treatment efficacy; wherein a reduced proportion of cells having the functional mutation at the CIITA gene locus compared to a suitable control is indicative of an efficacious treatment.
  • PMBCL primary mediastinal B-cell lymphoma
  • the suitable control may be a sample taken earlier from the same patient. In an exemplary embodiment, the suitable control may be a sample taken earlier from the same patient prior to treatment.
  • the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
  • the functional mutation may be an inactivating mutation in the CIITA gene.
  • the inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
  • the functional mutation is a translocation involving the CIITA gene.
  • the translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof.
  • transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation.
  • the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
  • the activated fusion partner leads to decreased HLA class II gene expression.
  • the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments,
  • the fusion partner is a PD-1 ligand. In some embodiments, the
  • translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
  • kits for determining propensity for developing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject comprising: reagents for detecting a functional mutation at the CIITA gene locus in a patient sample; and instructions for use in determining propensity for developing PMBCL or cHL, wherein a detected functional mutation a the CIITA gene locus is indicative of a propensity to developing PMBCL or cHL.
  • PMBCL primary mediastinal B-cell lymphoma
  • cHL classical Hodgkin lymphoma
  • the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
  • the functional mutation may be an inactivating mutation in the CIITA gene.
  • the inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
  • the functional mutation is a translocation involving the CIITA gene.
  • the translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof.
  • transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation.
  • the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
  • the activated fusion partner leads to decreased HLA class II gene expression.
  • the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments,
  • the fusion partner is a PD-1 ligand. In some embodiments, the
  • translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
  • PMBCL mediastinal B-cell lymphoma
  • cHL classical Hodgkin lymphoma
  • PMBCL arises primarily in the mediastinum, and its initial anatomical location may be used as a hallmark to identify PMBCL.
  • Microscopic examination of blood cells, and immunophenotype may also be used to assist in differentiation between the two clinical entities.
  • the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
  • the functional mutation may be an inactivating mutation in the CIITA gene.
  • the inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
  • the functional mutation is a translocation involving the CIITA gene.
  • the translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof.
  • transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation.
  • the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
  • the activated fusion partner leads to decreased HLA class II gene expression.
  • the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA
  • KECTIFIED SHEET (RULE 91.1) to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof).
  • the fusion partner is a PD-1 ligand. In some embodiments, the
  • translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
  • a biomarker of poor prognosis in primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin (cHL) comprising a functional mutation at the CIITA gene locus.
  • the poor prognosis is a poor prognosis under a cyclophosphamide-hydroxyldaunorubicin-oncovin-prednisone (CHOP) combination or a CHOP-like chemotherapy treatment regimen.
  • a CHOP-like regimen may include CHOP, CHOEP or MACOP-B.
  • the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
  • the functional mutation may be an inactivating mutation in the CIITA gene.
  • the inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
  • the functional mutation is a translocation involving the CIITA gene.
  • the translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof.
  • transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation.
  • the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
  • the activated fusion partner leads to decreased HLA class II gene expression.
  • the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments,
  • the fusion partner is a PD-1 ligand. In some embodiments, the
  • translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
  • PMBCL mediastinal B-cell lymphoma
  • cHL classical Hodgkin lymphoma
  • the suitable control may be a sample taken earlier from the same patient. In an exemplary embodiment, the suitable control may be a sample taken earlier from the same patient prior to treatment.
  • the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
  • the functional mutation may be an inactivating mutation in the CIITA gene.
  • the inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
  • the functional mutation is a translocation involving the CIITA gene.
  • the translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof.
  • transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation.
  • the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
  • the activated fusion partner leads to decreased HLA class II gene expression.
  • the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments,
  • the fusion partner is a PD-1 ligand. In some embodiments, the
  • translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
  • a biomarker of propensity to developing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) comprising a functional mutation at the CIITA gene locus.
  • the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
  • the functional mutation may be an inactivating mutation in the CIITA gene.
  • the inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
  • the functional mutation is a translocation involving the CIITA gene.
  • the translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof.
  • transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation.
  • the fusion partner or fragment thereof
  • RECTIFIED SHEET (RULE 91.1) translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
  • the activated fusion partner leads to decreased HLA class II gene expression.
  • the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments,
  • the fusion partner is a PD-1 ligand. In some embodiments, the
  • translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
  • a functional mutation at the CIITA gene locus for diagnosing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL).
  • additional clinical criteria may be used to distinguish between PMBCL and cHL.
  • PMBCL arises primarily in the mediastinum, and its initial anatomical location may be used as a hallmark to identify PMBCL.
  • Microscopic examination of blood cells, and immunophenotype may also be used to assist in differentiation between the two clinical entities.
  • the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
  • the functional mutation may be an inactivating mutation in the CIITA gene.
  • the inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
  • the functional mutation is a translocation involving the CIITA gene.
  • the translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof.
  • transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation.
  • the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
  • the activated fusion partner leads to decreased HLA class II gene expression.
  • the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments,
  • the fusion partner is a PD-1 ligand. In some embodiments, the
  • RECTIFIED SHEET (RULE 91.1) translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
  • a functional mutation at the CIITA gene locus for confirming diagnosing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL).
  • PMBCL arises primarily in the mediastinum, and its initial anatomical location may be used as a hallmark to identify PMBCL.
  • Microscopic examination of blood cells, and immunophenotype may also be used to assist in differentiation between the two clinical entities.
  • the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
  • the functional mutation may be an inactivating mutation in the CIITA gene.
  • the inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
  • the functional mutation is a translocation involving the CIITA gene.
  • the translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof.
  • transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation.
  • the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
  • the activated fusion partner leads to decreased HLA class II gene expression.
  • the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments,
  • the fusion partner is a PD-1 ligand. In some embodiments, the
  • translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
  • a functional mutation at the CIITA gene locus as a biomarker of poor prognosis in a primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) patient.
  • PMBCL primary mediastinal B-cell lymphoma
  • cHL classical Hodgkin lymphoma
  • the poor prognosis is a poor prognosis under a cyclophosphamide-hydroxyldaunorubicin-oncovin-prednisone (CHOP) combination or a
  • a CHOP-like regimen may include CHOP, CHOEP or MACOP-B.
  • the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
  • the functional mutation may be an inactivating mutation in the CIITA gene.
  • the inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
  • the functional mutation is a translocation involving the CIITA gene.
  • the translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof.
  • transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation.
  • the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
  • the activated fusion partner leads to decreased HLA class II gene expression.
  • the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments,
  • the fusion partner is a PD-1 ligand. In some embodiments, the
  • translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
  • a functional mutation at the CIITA gene locus as a biomarker of treatment efficacy in associated primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL).
  • PMBCL primary mediastinal B-cell lymphoma
  • cHL classical Hodgkin lymphoma
  • the suitable control may be a sample taken earlier from the same patient. In an exemplary embodiment, the suitable control may be a sample taken earlier from the same patient prior to treatment.
  • the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
  • the functional mutation may be an inactivating mutation in the CIITA gene.
  • the inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
  • the functional mutation is a translocation involving the CIITA gene.
  • the translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof.
  • transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation.
  • the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
  • the activated fusion partner leads to decreased HLA class II gene expression.
  • the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments,
  • the fusion partner is a PD-1 ligand. In some embodiments, the
  • translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
  • a functional mutation at the CIITA gene locus as a biomarker of propensity to developing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL).
  • the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
  • the functional mutation may be an inactivating mutation in the CIITA gene.
  • the inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
  • the functional mutation is a translocation involving the CIITA gene.
  • the translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof.
  • transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation.
  • the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
  • the activated fusion partner leads to decreased HLA class II gene expression.
  • the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments,
  • the fusion partner is a PD-1 ligand. In some embodiments, the
  • translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
  • KECTIFIED SHEET (RULE 91.1) [00181]
  • a method of treating primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject having a CIITA translocation involving a fusion partner comprising administering an inhibitor of the fusion partner to the subject.
  • the fusion partner is a PD-1 ligand
  • the inhibitor is an inhibitor of PD-1.
  • the inhibitor may further comprise an antibody which binds specifically to PD-1.
  • the antibody may be CT011 or MDX-1106.
  • an inhibitor of a fusion partner involved in a CIITA translocation for treating primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject harbouring the CIITA translocation.
  • the fusion partner is a PD-1 ligand
  • the inhibitor is an inhibitor of PD-1.
  • the inhibitor may further comprise an antibody which specifically binds to PD-1.
  • the antibody may be CT011 or MDX-1106.
  • a method of selecting treatment for a subject having a B-cell lymphoma comprising providing a sample from a B-cell lymphoma subject; detecting a translocation at the CIITA gene locus; identifying a translocation fusion partner; and selecting a treatment regimen comprising an inhibitor of the fusion partner.
  • fusion partner is a PD-1 ligand
  • the inhibitor is an inhibitor of thePD-1 ligand.
  • the inhibitor may further comprise an antibody which binds specifically to PD-1.
  • the antibody may be CT011 or MDX-1106.
  • the B-cell lymphoma may be a primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL).
  • a method of determining whether a standard cyclophosphamide-hydroxyldaunorubicin-oncovin-prednisone (CHOP) chemotherapeutic regimen or CHOP-related regimen is likely to be effecacious in treating a primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin comprising: providing a biological sample from a PMBCL or a cHL subject; and detecting a functional mutation at the CIITA gene locus in the sample.
  • CHOP cyclophosphamide-hydroxyldaunorubicin-oncovin-prednisone
  • a detected functional mutation at the CIITA gene locus indicates that the standard CHOP or CHOP-like chemotherapeutic regimen is likely to be a less efficacious treatment compared to a PMBCL or cHL subject not having functional mutation at the CIITA gene locus.
  • a CHOP-like regimen may include CHOP, CHOEP or MACOP-B.
  • the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
  • the functional mutation may be an inactivating mutation in the CIITA gene.
  • the inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
  • the functional mutation is a translocation involving the CIITA gene.
  • the translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof.
  • transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation.
  • the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
  • the activated fusion partner leads to decreased HLA class II gene expression.
  • the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments,
  • the fusion partner is a PD-1 ligand. In some embodiments, the
  • translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
  • RECTIFIED SHEET (RULE 91.1) effectors of CIITA may be effective as treatments for patients harbouring CIITA
  • translocations and/or other functional mutations involving the CIITA gene or gene locus are translocations and/or other functional mutations involving the CIITA gene or gene locus.
  • siRNA or shRNA targeted to the fusion partner portion of a transcript may be useful in treating subjects harbouring a translocation.
  • Standard guidelines for generating siRNA would be well known to a skilled person and include those referenced at
  • RNAi/siRNA_Design and described in Reynolds. A. , et at. Rational siRNA design for RNA interference. Nat Biotechnol. 2004 Mar;22(3):326-30), the contents of which are expressly incorporated by reference.
  • antibodies targeted at the fusion partner protein (or portion thereof) may be useful in treating subjections harbouring a translocation. Having identified a fusion partner, a skilled person would readily be able to generate monoclonal, humanized, or human antibodies to a particular fusion partner (or epitope thereof) using established techniques.
  • Techniques for conferring immunogenicity on a peptide are well known in the art and include, for example, conjugation to carriers.
  • the peptide can be administered in the presence of adjuvant.
  • the progress of immunization can be monitored by detection of antibody titers in plasma or serum.
  • Standard ELISA or other immunoassay procedures can be used with the immunogen as antigen to assess antibody levels.
  • antisera can be obtained and, if desired, polyclonal antibodies isolated from the sera.
  • polyclonal antibodies Conventional methods can be used to prepare polyclonal antibodies.
  • a mammal e.g. a mouse, hamster, or rabbit
  • an immunogenic form of the novel conformational epitope which elicits an antibody response in the mammal.
  • B- lymphocytes antibody-producing cells
  • myeloma cells by standard somatic cell fusion procedures to form immortal hybridoma cells.
  • Such techniques are well known in the art, (e.g., the hybridoma technique originally developed by Kohler and Milstein (Nature 256, 495-497(1975)) as well as other techniques such as the human B-cell hybridoma technique (Kozbor et al., Immunol. Today 4, 72 (1983)), the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al.,
  • Hybridoma cells can be screened immunochemically for production of antibodies specifically reactive with a selected novel conformational epitope and the monoclonal antibodies can be isolated.
  • Chimeric antibodies directed to fusion partners are also contemplated within the scope of the invention.
  • Chimeric antibodies may comprise sequences from two different antibodies. They may comprise sequences from antibodies from two different species.
  • Chimeric antibody molecules can include, for example, the antigen binding domain from an antibody of a mouse, rat, or other species with a constant human peptide region.
  • Conventional methods may be used to make chimeric antibodies containing the immunoglobulin variable region which recognizes the novel conformational epitope of the invention (See, for example, Morrison et al., Proc. Natl Acad. Sci. U.S.A.
  • Humanized antibodies may also be generated which are targeted to fusion partners. These typically comprise antibody sequences from non-human species whose protein sequences have been modified to increase their similarity to antibody variants produced naturally in humans. These may be considered as a specific subset of chimeric antibodies, in some instances. However, "humanization" is usually seen as distinct from the creation of a simple chimera. Having said that, the humanization process may include the creation of a mouse-human chimera in an initial step (for example, a mouse Fab may be spliced to human Fc). Thereafter the chimera might be further humanized by the selective alteration of the sequence of amino acids in the Fab portion of the molecule.
  • the process is usually "selective" to retain the specificity for which the antibody was originally developed.
  • the portions of the Fab sequence that differ from those in humans can be mutated by exchanging the appropriate individual amino acids. This is accomplished at the DNA level using mutagenesis. It is possible to produce a humanized antibody without creating a chimeric intermediate.
  • "Direct" creation of a humanized antibody can be accomplished by inserting the appropriate CDR coding segments (responsible for the desired binding properties) into a human antibody "scaffold". As discussed above, this is achieved through recombinant DNA methods using an appropriate vector and expression in mammalian cells. That is, after an antibody is developed in mouse (for example) which exhibits the desired properties, the DNA coding for that antibody can be isolated, cloned into a vector and
  • KECTIFIED SHEET (RULE 91.1) sequenced.
  • the DNA sequence corresponding to the antibody CDRs can then be determined.
  • a strategy can be devised for inserting these sequences appropriately into a construct containing the DNA for a human antibody variant.
  • the strategy may also employ synthesis of linear DNA fragments based on the reading of CDR sequences.
  • Diversity libraries may be generated using synthetic diversity-containing oligonucleotide primers.
  • the resulting pool of clones may be further screened to identify optimized humanized antibody clones using known methods.
  • Human antibodies to a particular epitope may be generated, for example, through immunization of a mouse having a reconstituted/humanized immune system with the epitope in question.
  • translocations such as those involving activated fusion partners.
  • inhibitors of the PD-1 signaling pathway would likely be effective for treating patients harbouring such translocations.
  • Such inhibitors may include, for example, antibodies or small molecules which reduce activity of this pathway, or siRNAs or shRNAs directed to components of the pathway, including PD-1 itself.
  • Suitable antibodies include polyclonal, monoclonal, humanized, chimeric, or human antibodies. For instance, Brahmer et al.
  • KECTIFIED SHEET (RULE 91.1) fusion to PD-1 ligands.
  • Other PD-1 antibodies (such as those that could be made by a skilled on the basis of the above-described techniques) may also be useful for treating such patients.
  • “Functional mutation”, as used herein, denotes any DNA sequence change, deletion (including microdeletions) or rearrangement which ultimately impacts protein function.
  • Functional mutations include those which reduce or abrogate protein activity compared to the normal biological state for a given cell or tissue not containing the functional mutation. The reduced or abrogated protein activity may be the result of decreased protein expression, decreased stability, or increased turnover.
  • Functional mutations include those which alter the amino acid sequence of a given protein (e.g. missense or nonsense mutations), leading to reduced activity, reduced stability, or increased turnover. Functional mutations may also reduce or abrogate one or a subset of total protein functions (for example, by disrupting a key protein-protein interaction).
  • Such mutations may include DNA sequence changes which are situated in the coding sequence of a gene. They may also include mutations which occur in regulatory elements which reduce or abrogate transcription, alter or abrogate splicing, reduce or abrogate translation, or impact stability or degradation of the mRNA or protein. Functional mutations may include for example a translocation (which may be balanced or unbalanced), a more complex chromosomal rearrangement, a point mutation, or a microdeletion.
  • Inactivating mutation indicates a functional mutation which abrogates/eliminates protein function, at least from the relevant allele. Inactivating mutations may include nonsense mutations, insertions, deletions, splice site mutations, etc. Inactivating mutations may also include dominant negative mutations.
  • down-regulated will be understood to encompass a decrease as compared to a normal (e.g. non-diseased) biological state, or that of the average level in a general population.
  • up-regulated will be understood to encompass an increase as compared to a normal (e.g. non-diseased) biological state, or the average level the general population.
  • a skilled person would be well aware of numerous techniques for detecting mutations and rearrangements involving the CIITA locus. Such techniques may include PCR or RT-PCR, followed by sequencing. Rearrangements and translocations may be detected, as described herein, using fluorescence in situ hybridization (FISH), including metaphase FISH, interphase FISH, fibre FISH, etc. They may also be detected using paired end sequencing, such as whole transcriptase paired end sequencing (RNA-seq) analysis. For recurrent mutations, it may be feasible to use techniques for identifying single nucleotide polymorphisms (SNPs).
  • FISH fluorescence in situ hybridization
  • RNA-seq whole transcriptase paired end sequencing
  • Array-based methodologies may be used as a first pass to detect reduced expression of CIITA (or altered expression of a fusion partner), and such a result could be followed up with other methods to further define the CIITA mutation/rearrangement.
  • an antibody could be used in a standard technique, such as an enzyme-linked immunosorbent assay (ELISA) to detect aberrant expression of CIITA (or a fusion partner), and such a result could similarly be followed up with other methods to further define the CIITA mutation/rearrangement
  • CIITA locus constitute functional mutations (or, indeed, inactivating mutations) using standard experimental techniques.
  • cells deficient in CIITA i.e. having reduced HC class II expression (such as those derived from bare lymphocyte syndrome patients; or cells from PMBCL patients bearing translocations described herein which disrupt CIITA) could be transfected or transduced with an exogenous expression construct including a CIITA gene bearing the mutation in question.
  • Standard techniques could be used to assess whether the exogenous gene is able to functionally complement or otherwise compensate for the CIITA deficiency (for example, by restoring MHC class II expression).
  • sequence change in question constitutes a functional mutation.
  • the CIITA mutation in question could be integrated into the genome of a cell in a site-specific manner and the resultant mutant cell line could be studied to assess whether it exhibits hallmarks of CIITA deficiency (e.g. reduced MHC
  • Fusion partner indicates gene or a portion of a gene fused to the CIITA locus (or a portion thereof) following a chromosomal
  • Fusion partners may be upstream or
  • the fusion partner is downstream of CIITA and expression of the fusion partner (or portion thereof) is driven by CIITA regulatory elements. Transcription and expression of the fusion partner may be activated by the translocation.
  • fusion partners may be identified by rapid amplification of cDNA ends (RACE), or whole transcriptome paired end sequencing, as described in the Examples herein.
  • RACE rapid amplification of cDNA ends
  • fusion partner is thus intended to encompass fragments of the gene encoding functional portions of the encoded protein, such as one or more functional domain.
  • Prognosis denotes a short- or long-term survival which is significantly worse than average survival for a given disease.
  • a poor prognosis in patients with CIITA mutations denotes a short- or long-term survival which is significantly worse than that of a group of PMBCL patients not bearing CIITA mutations.
  • efficacious treatment indicates a treatment or therapy which reduces, mediates, or eliminates an effect of disease.
  • An efficacious treatment may be one which improves short- or long-term survival. It may be one which reduces symptoms of disease, or one which improves quality of life.
  • An efficacious treatment, in the context of cancer, may reduce the number of cancer cells, or induce remission.
  • Biological sample is a sample of body fluid or tissue or organ sample from a subject, usually a subject suspected of having lymphoma, particularly a B cell lymphoma, for example PMBCL or Hodgkin lymphoma.
  • a tissue or organ sample such as that obtained from a solid or semi-solid tissue or organ, may be digested, extracted or otherwise rendered to a liquid form.
  • a biological sample or samples may be taken from a subject at any appropriate time, including before the subject is diagnosed with, or suspected of having lymphoma, during a therapeutic regimen for the treatment or amelioration of symptoms of that disease or disorder, after death of the subject (regardless of the cause, or suspected cause). Alternately, a
  • KECTIFIED SHEET (RULE 91.1) biological sample may include donated body fluid or tissue, such as blood, plasma or platelets when in care of a centralized blood supply organization or institution.
  • Biomarker is used herein to designate a biological molecule or specific variant thereof whose presence or abundance is associated with or indicative of a particular biological trait, such as a disease, or risk thereof.
  • a biomarker may also be indicative of disease severity, disease progression, or treatment efficacy.
  • CIITA gene locus indicates the CIITA gene in its genomic context, including all its cis-acting regulatory elements.
  • PMBCL subject indicates a person or animal who has PMBCL, has been diagnosed with PMBCL, or (in some instances) is suspected of having PMBCL in a clinical context.
  • cHL subject indicates a person or animal who has cHL, has been diagnosed with cHL, or (in some instances) is suspected of having cHL in a clinical context.
  • Suitable control may be for example a clinically selected control, a stored dataset of results generated from studies of the presence of a functional mutation in the CIITA gene locus in one or more population(s) of subjects having a lymphoma, a stored dataset of results generated from studies of the presence of a functional mutation in the CIITA gene locus in one or more population(s) of subjects having PMBCL, a stored dataset of results generated from studies of the presence of a functional mutation in the CIITA gene locus in one or more population(s) of subjects having PMBCL and responsive to a chemotherapeutic treatment, a stored dataset of results generated from studies of the presence of a functional mutation in the CIITA gene locus in samples collected from a single subject having lymphoma over an extended period of time, or combinations thereof.
  • Control samples from subjects having a lymphoma may preferably have a B-cell lymphoma, or more preferably PMBCL or cHL.
  • a clinically selected control may be for example a physiological specimen having lymphoma or a physiological specimen having PMBCL.
  • a suitable control may be a healthy individual, who may or may not be age and/or gender matched.
  • a suitable control may be a sample previously taken from the same subject.
  • inhibitor denotes any molecule which lowers, or reduces at least one aspect of normal function of a target protein or pathway.
  • an inhibitor may, for example, prevent ligand binding or
  • KECTIFIED SHEET (RULE 91.1) otherwise reduce or inhibit normal signaling.
  • Inhibitors may include small molecules, or antibodies which bind and block (directly or indirectly) ligand binding.
  • Propensity of developing or "risk of developing” a particular disease or condition indicates a risk which is higher than that of the general population, or that of control individuals who do not carry the functional mutations in the gene (e.g. CIITA) which leads to the increased propensity or risk.
  • CIITA functional mutations in the gene
  • Proportion of cells indicates the relative number of cells.
  • the “proportion of cells” may refer to the proportion of cells with a particular mutation, exhibiting a particular phenotype (e.g. morphological or
  • proportion of cells may refer to the relative number of cells in a given field exhibiting a trait, such as a particular pattern of fluorescent probe signals indicative of a translocation.
  • the proportion of cells may be measured using flow cytometry, including fluorescence- assisted cell sorting (FACS).
  • FACS fluorescence- assisted cell sorting
  • the proportion of cells may also be determined using methods such as quantitative or semi-quantitative PCR or RT-PCR which, for example, may be used to detect the prevalence of a particular cellular genotype, as compared to a base line signal derived from all cells. In PCR or RT-PCR, the relative signal strength can be indicative of a relative number of cells in a total population.
  • HL cell lines KM-H2 and L428 were selected for whole transcriptome paired end sequencing (RNA-seq) analysis. Both cell lines originated from patients with cHL (Epstein Barr virus negative mixed cellularity and nodular sclerosis, respectively). Additionally, cHL cell lines L540, L1236, HDLM2 and microdissected germinal center cells were used for comparison of gene expression levels. All cell lines were obtained from the German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig,
  • FISH fluorescence in situ hybridization
  • KECTIFIED SHEET (RULE 91.1) PMBCL patients were treated with CHOP and CHOP-like chemotherapy as previously described. 17 Additionally, 8 PMBCL cases were studied using rapid amplification of cDNA ends (RACE). All cases included in this study were independently reviewed by two hematopathologists before analysis. Ethical approval for this study was obtained from the University of British Columbia - British Columbia Cancer Agency Research Ethics Board (UBC BCCA REB). Previously published gene expression profiling data of 203 biopsy samples with defined molecular subtypes of DLBCL, including PMBCL, were reanalyzed. 23
  • cell line U2940 derived from a DLBCL with features consistent with PMBCL 25 , U2932 (DLBCL, activated B cell (ABC) phenotype) 31 and SUDHL4 (DLBCL, germinal center B cell (GCB) phenotype) 32 .
  • DLBCL activated B cell
  • SUDHL4 DLBCL, germinal center B cell (GCB) phenotype
  • Jurkat T cells were used for co-culture experiments measuring T cell activation.
  • RNA-seq was performed as previously described. 28,33 In brief, double stranded cDNA was synthesized from polyadenylated RNA and sheared. The 190-210bp fraction was isolated and amplified with 10 cycles of PCR using the lllumina Genome Analyzer (GA) paired end library protocol (lllumina Inc, Hayward CA). The resulting libraries were then sequenced on an lllumina G j.
  • GA lllumina Genome Analyzer
  • Clusters of discordantly aligning reads are then used to inform a targeted search for reads split by fusion breakpoints.
  • the results produced by deFuse were further filtered to reduce the number of false positives: 1 ) Predictions had to be supported by at least 8 reads spanning a fusion breakpoint and 5 reads split by a fusion breakpoint; 2) Fusions between adjacent genes were removed unless implied in genomic inversion or eversion; 3) Predictions involving ribosomal proteins or small nuclear ribosomal proteins were removed; 4)
  • the results were filtered against fusion predictions from 41 ovarian cancer libraries in an attempt to remove systematic technical artifacts. After these series of filters were applied, a candidate list of fusions was carried forward for further analysis.
  • KM-H2 knockdown cultures see below
  • the freely-available software DCHIP was used (available at http://biosun1.harvard.edu/complab/dchip/). Overrepresentation and pathway analysis was preformed using Ingenuity Pathway Analysis (Ingenuity® Systems,
  • Genome-wide copy number analysis was performed using Human SNP 6.0 arrays (Affymetrix Inc, U.S.A) following the standard protocol and manufacturer's instructions. Hybridized arrays were washed, stained and scanned using Affymetrix Fluidics Station 450 and Affymetrix GeneChip Scanner. The Affymetrix SNP 6.0 data were processed using the R-based aroma. affymetrix package (Bengsston et al,
  • RNA-seq The validation of fusion transcripts was performed using both genomic and reverse-transcriptase (RT) PCR using forward and reverse primer combinations designed within the margins of the paired end read sequences detected by RNA-seq (Table 1 ).
  • Consensus sequences were determined from at least 5 separate colonies. For further validation by FISH fusion probes were used to confirm gene fusions in interphase and metaphase nuclei of KM-H2 and L428.
  • RNA interference (RNAi) with the CIITA-BX648577 fusion transcript was performed using lentiviral transduction of a vector (pGIPZ-sh.FLJ27352, clone
  • TGCTGTTGACAGTGAGCGCGACAGCCACCTCACTATCAAATAGTGAAGCCACAGAT GTATTTGATAGTGAGGTGGCTGTCTTGCCTACTGCCTCGGA A vector with a non-interfering shRNA insert (non-silencing control) was used for comparison.
  • shRNAmir constructs were co-transfected along with the helper and packaging plasmids (pHDM-G, pHDM-Hgpm2, pHDM-tatl b, and pRC/CMV-rev1 b) into 293T cells by calcium phosphate-mediated transfection (CalPhos Mammalian Transfection kit (Clontech)). Supernatant was collected 48h and 72h after transfection and concentrated by ultracentrifugation for 2h at 25,000 rpm at 4C. The lentiviral particles were resuspended in IMDM and then used for transduction of KM- H2 cells.
  • helper and packaging plasmids pHDM-G, pHDM-Hgpm2, pHDM-tatl b, and pRC/CMV-rev1 b
  • KM-H2 parental cells were transduced by adding 8 ug/ml polybrene, with both pGIPZ-sh.FLJ27352 and non-silencing control virus, and GFP-positive cells were sorted on a BD FACSAria cell sorter (BD Biosciences) 3 days after transduction and cultured using standard recommendations (http://www.dsmz.de/). Purity (GFP positivity) was greater 93% for all experiments. Efficiency of RNAi was evaluated by measuring residual expression of the fusion transcript by quantitative RT-PCR (see Table 1 for primer sequences). Samples were run in triplicate on a iQ5 real-time PCR instrument (BioRad) under standard conditions using SYBRGreen (ABI) for detection. Measurements were quantified using the AACT method (Pfaffl) and expressed relative to the expression in parental (wildtype) KM-H2 cells.
  • KECTIFIED SHEET (RULE 91.1)
  • lentiviral vectors and helper plasmids were co-transfected into 293T cells.
  • KM-H2 cells and primary human B cells were attached to poly- lysine coated slides.
  • To fix the cells we incubated them with 4% PFA for 10 minutes at room temperature and treated with 0.15% Triton X in PBS for 2 minutes at room temperature.
  • After blocking cells were incubated with an anti-C//7V ⁇ antibody (clone 7-1 H, Santa Cruz Biotechnologies, Santa Cruz, CA) overnight at 4C.
  • After washing, cells were incubated with Alexa Fluor 594 rabbit anti-mouse IgG (Invitrogen, Carlsbad, CA) for 45 minutes at 37C. After stringent washing, cells were counterstained with DAPI and covered. Slides were analyzed on a laser confocal microscope (LEICA SP5 AOBS, LEICA, Bannockburn, IL).
  • FISH Fluorescence in situ hybridization
  • TMA tissue microarrays
  • TMAs were constructed using archival, formalin-fixed, paraffin embedded diagnostic biopsy specimens and 0.6mm duplicate cores for DLBCL and PMBCL cases and 1.5mm cores for cHL, respectively. Optimal areas of the biopsies were chosen containing frequent large B or HRS cells, respectively. FISH was performed as previously
  • 3' RACE PCR amplification of the cDNA was performed using gene-specific primers for CIITA exon 1 and Universal Primer mix (UPM).
  • Quantitative RT-PCT was performed to measure expression levels of CD274 and CD273 mRNA using an Applied Biosystems (ABI, Streetsville, Ontario, Canada) 7900HT realtime PCR system. Primers were designed for SYBR Green (ABI) detection of both wildtype and fusion transcripts for each gene (Table 1 ). RNA was extracted from cell line U2940 and 7 PMBCL lymph node samples (cell disaggregates) using Allprep extraction kits (Qiagen Inc., ON, Canada). PMBCL cases included one case with previously identified CIITA-CD274 fusion and 2 cases with CIITA-CD273 fusions. As
  • KECTIFIED SHEET (RULE 91.1) expression controls magnetically-enriched CD77+ cells were used (benign tonsillar cell disaggregates) (Miltenyi Biotec, Auburn, CA, USA) as previously described. 40
  • U2940, U2932 and SUDHL4 cell pellets were washed in 1x PBS with 1% FCS buffer and incubated with antibodies against CD69, CD2, CD274, CD273, and PD1 (all from BD Pharmingen, CA, USA).
  • Jurkat T cells were stimulated with anti-CD3 and anti-CD28 antibodies (BD Pharmingen).
  • Recombinant human PD1-Fc, CD274-Fc, CD273-Fc, CTLA4-Fc and control IgG (R&D systems) were used for specific inhibition of surface molecules.
  • KM-H2 and SUDHL4 cells were incubated with PE-Cy5 conjugated anti human HLA-DR antibody (Beckman Coulter, Brea, CA), and analyzed on a BD FACSAria II instrument (BD Biosciences, San Jose, CA).
  • IL-2 levels were measured using the Human IL-2 ELISA kit (R&D System, Inc. #D2050) according to the
  • PD1 cDNA (Invitrogen) was subcloned into an pBMN-IRES-EGFP vector, which was modified from the original Moloney LTR vector pBMN-IRES-Lyt2 (kindly provided by G. Nolan lab, Stanford University) by replacing Lyt2 with EGFP.
  • Lipofectamine 2000 (Invitrogen, CA, USA) was used to transfect 293T producer cells with a plasmid mixture for gag and pol, a mutant ecotropic env, and each particular retrovirus. After two days, supernatant was passed through a 0.45- ⁇ filter, mixed with Polybrene (8pg/ml) and used for centrifugal transduction of target cells expressing the ecotropic retroviral receptor. In some instances a second infection was performed, using fresh supernatant collected three days after transfection of producer cells.
  • U2932 cells were first transduced with a feline endogenous virus (FEV) expressing the ecotropic retroviral receptor.
  • FEV feline endogenous virus
  • Ecotropic receptor-expressing cells were then transduced with a retrovirus expressing the bacterial tetracycline repressor (TETR) using blasiticidin as the selectable marker.
  • Single cell clones were screened for TETR expression.
  • An inducible retroviral vector was used to drive expression of C//LA-CD274 or C//L4-CD273 fusions under the control of a CMV promoter containing TETR binding sites as described previously. 30 A mixture of C//LA-CD274- or C//7A-CD273-containing
  • RECTIFIED SHEET (RULE 91.1) plasmid DNA
  • the mutant ecotropic envelope-expressing plasmid pHIT/EA6x3* and gag- pol expressing plasmid pHIT60 was used to transfect 293T cells using the Lipofectamine 2000 reagent (Invitrogen). Two days after transfection, retrovirus supernatants were collected to infect the engineered U2932 cells in the presence of 8 mg/ml polybrene (Sigma) in a single spin infection and puromycin was used to select for stable integrants over 6 days. Fusion gene expression was induced by doxycycline (20 ng/ml) for two days before flow cytometry analysis and Jurkat T cell co-culture experiments.
  • Pharmingen #51-68655X antibodies diluted in FACS buffer containing 0.25% saponin (Sigma).
  • DSS disease-specific survival
  • RNA- seq Massively parallel, paired end sequencing of expressed transcripts (RNA- seq) provides an analytical platform suitable for genome-wide mapping of translocation breakpoints, sequence variants and quantitative expression. 6,7 This sequencing technology was used to detect novel gene fusions in the two HL cell lines KM-H2 and L428, including 82.9 million paired end reads for KM-H2, of which 71.1 million mapped to the reference human genome (86%, 3.6 gigabases), and 61.5 million paired end reads for L428, of which 55.5 million (90%, 2.8 gigabases) mapped to the reference genome.
  • Figure 1 depicts cumulative distribution plots of the expression for both KM-H2 and L428 showing the proportion of genes expressed at increasing coverage levels.
  • Figures 2a and 2b illustrate the fusion prediction with the highest read support involving MHC class II transactivator CIITA and an uncharacterized gene
  • Figure 3 depicts the first of these fusions, involving the genes BAT2L1 (chromosome 9q34.13) and MGMT (chromosome 10q26.3) in KM-H2.
  • Figure 3 panel a depicts co-localization of the BAT2L1 (RP1 1-643E14) and MGMT (RP1 1-1063D3) gene loci (arrow).
  • Figure 3 panel b shows direct sequencing and breakpoint sequence of a BAT2L1 -MGMT fusion transcript as predicted by RNA-seq.
  • Figure 4 depicts alignment of BAC probes for BAT2L1-MGMT fusion and break-apart assays.
  • Figure 5 depicts the second fusion involving the genes SLC03A1
  • Panel a shows co-localization of the SLC03A1 (RP1 1-79A7) and ELM01 (RP1 1-12H6) gene loci (arrow).
  • Panel b shows direct sequencing and breakpoint sequence of an ELM01- SLC03A1 fusion transcript as predicted by RNAseq.
  • Figure 6 depicts alignment of BAC probes for ELM01 -SLC03A1 fusion and break-apart assays.
  • Figure 7 shows detection of the C//7A-BX648577 gene fusion.
  • the figure depicts validation of complex chromosome 16 rearrangements in KM-H2 leading to expression of CIITA-BX648577 fusion transcripts.
  • Arrows indicate co-localization of the gene loci of CIITA and BX648577 in interphase ( Figure 7, panels a, b) and metaphase ( Figure 7, panels c, d) cells.
  • Figure 8 depicts alignment of BAC and Fosmid probes for CIITA- BX648577 fusion and break-apart assays.
  • RECTIFIED SHEET (RULE 91.1) was found to be the essential transactivator of MHC class II expression functioning in a complex of transcription factors (RFX, NFY, X2BP) that bind to class II MHC
  • Figure 9 depicts molecular characterization of the gene fusion CIITA- BX648577. Using PCR, the genomic breakpoint coordinates were mapped to
  • Figure 10 depicts the staining. This staining pattern is in agreement with loss of a C-terminal nuclear localization sequence (NLS)1 1 of CIITA in the chimaeric protein.
  • Figure 10 panel a depicts confocal microscopy images showing a perinuclear staining pattern of the fusion protein in KM-H2 cells.
  • Figure 10 panel b shows that the staining pattern in primary B cells is predominantly nuclear.
  • Lower panels show slice views from the side which were derived from Z stack image series.
  • Figure 11 depicts the results of high-resolution SNP analysis indicating that the rearrangement involving chromosomes 15 and 16 was associated with relative genomic imbalances at the breakpoints.
  • High-resolution single nucleotide polymorphism analysis and FISH confirm chromosomal unbalances accompanying complex
  • Figure 11 depicts the relative amplification of chromosomal material telomeric of the BX648577 breakpoint in KM-H2 is confirmed by FISH (4 fused + 1 red signal).
  • Figure 11 depicts relative amplification of chromosomal material centromeric of the CIITA breakpoint in KM-H2 is confirmed by FISH (2 fused + 2 green + 3 red signals). L428 is shown as reference.
  • Figure 12 depicts the results of multicolor-FISH in representative metaphases of KM-H2 and interphase-FISH showing complex chromosomal
  • FIG. 12 panel a shows 24-colour FISH of a representative KM-H2 metaphase matching the same metaphase of Figure 12, panel b, which is stained with locus-specific FISH probes for the CIITA (WI2-1388110) and BX648577 (WI2- 2329H16) gene loci (Fosmid probes).
  • the Banding pattern is shown in inverted DAPI.
  • the four derivative chromosomes with involvement of the CIITA and BX648577 loci are shown in higher magnification (Panels 1-4).
  • Locus-specific FISH using Fosmid probes for CIITA and BX648577 confirmed co-localization of the CIITA and BX648577 gene loci on two derivative chromosomes 16, both harbouring insertions of chromosome 15 material. These complex rearrangements are likely to place the fusion gene in a different positional context that might add to the high promotor activity of CIITA driving expression of the fusion transcripts in this cell line. As part of complex rearrangements between
  • chromosomes 15 and 16 chromosomal material telomeric of the CIITA breakpoint is fused with chromosomal material telomeric of the BX648577 breakpoint on two derivative chromosomes 16 (1 +2).
  • the derivative chromosome der(?)(15;9;16;9;15) (3) does not harbour C//L4-BX648577 gene fusions as FISH showed no break-apart signals for the CIITA and BX648577 gene loci on this derivative chromosome (data not shown).
  • KM-H2 cells were stably transduced by either an shRNAmir (clone H5), or a non-silencing control were examined for imRNA and protein expression of the
  • Figure 13 depicts the results of quantitative RT-PCR ( Figure 13, panel a) showing reduction of fusion transcript levels by 85%, and Western blotting ( Figure 13, panel b) demonstrating a marked reduction in C//L4-BX648577 fusion protein compared to non-silencing controls.
  • CIITA is an essential transactivator of MHC class II expression9 and deletion mutants have been described that inhibit wild type CIITA function in vitro13,14, we studied transcriptional changes of shRNA-transduced cells using gene expression microarrays (Table 5).
  • NS-1 non-silencing control, baseline replicate 1
  • NS-2 non-silencing control, baseline replicate 2
  • Figure 15 depicts representative FISH images of the break-apart assay demonstrating involvement of all cells of the malignant cell compartment (CD30+ Hodgkin Reed Sternberg cells).
  • Figure 15, panel a depicts the alignment of probes.
  • Figure 15, panels b and c depict representative FISH images. In 4 of the 8 cases we detected an unbalanced rearrangement. Since PMBCL shares clinical and biological features with
  • CIITA+ CIITA break-apart present
  • CIITA- CIITA break-apart absent
  • RECTIFIED SHEET (RULE 91.1) panel c depicts the breakpoint cluster as defined by genomic breakpoints found in 5 PMBCL cases.
  • Figure 17 depicts a CIITA-BX648577 fusion transcript and putative translation.
  • Figure 18 depicts a CIITA-CD274 fusion transcript and putative
  • Figure 19a depicts a CIITA-CD273 (PDCD1 LG2) fusion transcript.
  • Figure 19b depicts a putative translation of the CIITA-CD273
  • Figure 20a depicts a CIITA-RALGDS fusion transcript.
  • Figure 20b depicts a putative translation of the CIITA-RALGDS fusion transcript.
  • Figure 21 depicts a CIITA- C160RF75 fusion transcript and putative translation.
  • CD274 (PDL1 )
  • CD273 (PDL2)
  • RUNDC2A the fusion transcripts merged exon 1 of CIITA with exon 2 of the respective fusion partners resulting in open reading frames.
  • CIITA start codon mutations were detected resulting in translational reading frames beginning at the original CD273 start site.
  • FIG. 22 panel a presents data demonstrating that overexpression of CD274 and CD273 closely linked to copy number gain has been previously described in PMBCL and HL19-21 , and expression of CD274 has been shown to correlate with poor prognosis in other cancers.22 Furthermore, re-analysis of gene expression profiling data confirmed overexpression of both genes in over 50% of PMBCL cases.
  • panel b displays quantitative RT-PCR data showing that in all three cases CD274 and CD273 were highly overexpressed (fold changes: 451 , 41 15 and 1729 respectively) as part of the respective CIITA fusions compared to germinal center B cells. Importantly, expression levels markedly exceeded the levels of PMBCL cases without translocations.
  • FIG 23 panel a depicts induction of PD-1 and CD69 by anti-CD3 and anti-CD28 antibodies in Jurkat T cells, and confirms that PD-1 expression was induced in Jurkat T cells upon TCR stimulation.
  • FIG 23 panel b shows that after 4 hours of co-culture, Jurkat T cell activation, measured by CD69 expression, was markedly decreased with increasing admixture of U2940 cells.
  • FIG 23 panel d shows that inhibition of T cell activation by U2940 cells was reversible by incubation with inhibitors against PD1 , CD274 and CD273, but not against CTLA4.
  • FIG 23 panel e depicts flow cytometry data which indicates that PD1 expression on Jurkat T cells augments T cell inhibition by PMBCL cells, indicating dependence on the PD-1 pathway.
  • Figure 24 depicts results of investigation into the effects of forced expression of the CIITA-CD274 and CIITA-CD273 gene fusions in U2932 cells that do not express wildtype PD-1 ligands on their surface.
  • Ectopic expression of the full length coding cDNA of the fusions in U2932 markedly increased surface expression of the respective proteins in transduced cells and, similar to U2940, decreased CD69 and IL-2 expression of PD-1 over-expressing Jurkat T cells in comparison to empty vector controls.
  • these data show that both wildtype PD-1 ligand expression and the
  • RECTIFIED SHEET (RULE 91.1) identified C//L4-CD274/CD273 gene fusions are negatively regulating Jurkat T cell activation.
  • Figure 25 depicts the results of flow cytometric analysis of indicating that intracellular cleaved PARP and active caspase 3 do not show differences between transduced and wildtype U2932 cells.
  • Consequences of CIITA rearrangements appear to be diverse as evidenced by multiple fusion partners, and concomitant chromosomal imbalances as described previously in PMBCL.
  • functional study of the most frequent specific gene fusions suggest that escape from immunosurveillance through various mechanisms might play an important role in the pathogenesis of these lymphomas.
  • our data raise the possibility that deletion of tumour suppressor genes27, overexpression of oncogenes resulting from gene fusion, and CIITA loss of function might be concurrent consequences of a single genetic event.
  • PFS Progression free survival
  • Table 10 depicts tabulation of survival data
  • Table 11 depicts calculated Chi-Square Test values
  • a- 7 cells (58.3%) have expected count less than 5.
  • immunoglobulin loci are recurrent in Hodgkin and Reed-Stern berg cells of classical Hodgkin lymphoma. Cancer Res 66, 10332-8 (2006).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Pathology (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Biotechnology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Oncology (AREA)

Abstract

A method of diagnosing or confirming a diagnosis of primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin (cHL) lymphoma in a subject, the method comprising providing a biological sample from a subject; and detecting a functional mutation at the CIITA gene locus in the sample. A detected functional mutation at the CIITA gene locus is indicative of a diagnosis of PMBCL or cHL. A method of determining a prognosis of a subject with primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) a propensity for developing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL), the method comprising providing/obtaining a biological sample from a subject; and detecting a functional mutation at the CIITA gene locus in the sample. A method of determining primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin (cHL) lymphoma treatment efficacy. Use of functional mutations at the CIITA gene locus in the identification, diagnosis, prognosis, treatment, and/or monitoring of primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin (cHL) lymphoma progression.

Description

4W-90 CIITA GENE FUSIONS INDICATIVE OF CANCER
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of priority of U.S. Provisional Patent Application No. 61/446,876 filed February 25, 2012, which is incorporated herein by reference in its entirety.
FIELD
[0002] The present disclosure relates generally to CIITA gene fusions and their use in the identification, diagnosis, and treatment of cancer.
BACKGROUND
[0003] The major histocompatability (MHC) class II molecules are expressed on the surfaces of antigen-presenting cells and B lymphocytes. By binding antigens and presenting the antigens to T cells, the MHC class II molecules are involved in triggering an immune response. Thus, the level of expression of the MHC class II molecules affects the induction of an immune response.
[0004] MHC-II expression is principally regulated at the level of transcription.
CIITA is the human gene which encodes the class II, major histocompatibility complex, transactivator protein. By virtue of CIITA's control over major histocompatibility complex class II (MHC-II) gene expression, CIITA represents a key molecule in the regulation of adaptive immune responses.
[0005] Mutations in the CIITA gene are responsible for the bare lymphocyte syndrome in which the immune system is severely compromised and is often unable to effectively fight infection.
SUMMARY
[0006] It is an object of the present disclosure to obviate or mitigate at least one disadvantage of the prior art. Any advantages stated in this specification are intended to be non-limiting, and may only pertain to certain embodiments.
[0007] The present disclosure provides CIITA gene fusions and their use in identification, diagnosis, prognosis, treatment, and/or monitoring of cancer progression.
Gene fusion events may serve as biomarkers, and/or provide novel targets for the selective treatment of cancer. Furthermore, gene fusion events can provide diagnostic and prognostic information as well as guidance for the appropriate treatment of patients.
- 1 -
RECTIFIED SHEET (RULE 91.1) [0008] In a first aspect, the present disclosure provides a method of diagnosis and/or confirming a diagnosis of primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin (cHL) lymphoma in a subject, the method comprising
providing/obtaining a biological sample from a subject; and detecting a functional mutation at the CIITA gene locus in the sample. A detected functional mutation at the CIITA gene locus is indicative of a diagnosis of PMBCL or cHL.
[0009] In a further embodiment, there is provided a method of determining a prognosis of a subject with primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL), the method comprising providing/obtaining a biological sample from a subject with PMBCL or cHL; and detecting a functional mutation at the CIITA gene locus in the sample. A detected functional mutation at the CIITA gene locus is indicative of a poor prognosis.
[0010] In another embodiment there is provided, a method of determining a propensity for developing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject, the method comprising providing/obtaining a biological sample from a subject; and detecting a functional mutation at the CIITA gene locus in the sample. A detected functional mutation at the CIITA gene locus is indicative of a propensity to developing PMBCL or cHL.
[0011] In another embodiment there is provided, a method of determining primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin (cHL) lymphoma treatment efficacy, the method comprising providing/obtaining a biological sample from a PMBCL or cHL subject; detecting a functional mutation at the CIITA gene locus in the sample;
quantifying the proportion of cells having the functional mutation at the CIITA gene locus; and comparing the proportion of cells having the functional mutation at the CIITA gene locus against a suitable control. A reduced number of cells having the functional mutation at the CIITA gene locus compared to the suitable control is indicative of an efficacious treatment.
[0012] In a further aspect, the present disclosure provides a kit for diagnosing and/or confirming a diagnosis of primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject, comprising: reagents for detecting a functional mutation at the CIITA gene locus in a patient sample; and instructions for use in diagnosing PMBCL or cHL. A detected functional mutation a the CIITA gene locus is indicative of a diagnosis of PMBCL or cHL.
[0013] In a further embodiment there is provided, a kit for determining prognosis of a subject with primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin
RECTIFIED SHEET (RULE 91.1) lymphoma (cHL), comprising: reagents for detecting a functional mutation at the CIITA gene locus in a patient sample; and instructions for use in determining prognosis. A detected functional mutation at the CIITA gene locus is indicative of a poor prognosis.
[0014] In another embodiment there is provided, a kit for determining primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) treatment efficacy, comprising: reagents for quantifying the proportion of cells having a functional mutation at the CIITA gene locus in a PMBCL or cHL subject sample; and instructions for use in determining treatment efficacy. A reduced proportion of cells having the functional mutation at the C//TA gene locus compared to a suitable control is indicative of an efficacious treatment.
[0015] In another embodiment there is provided, a kit for determining propensity for developing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject, comprising: reagents for detecting a functional mutation at the CIITA gene locus in a patient sample; and instructions for use in determining propensity for developing PMBCL or cHL. A detected functional mutation a the CIITA gene locus is indicative of a propensity to developing PMBCL or cHL.
[0016] In a further aspect, the present disclosure provides a biomarker of primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) comprising a functional mutation at the CIITA gene locus.
[0017] In a further embodiment there is provided, a biomarker of poor prognosis in primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin (cHL) comprising a functional mutation at the CIITA gene locus.
[0018] In another embodiment there is provided, a biomarker of primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) treatment efficacy comprising a functional mutation at the CIITA gene locus.
[0019] In another embodiment there is provided, a biomarker of propensity to developing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) comprising a functional mutation at the CIITA gene locus.
[0020] In further aspect, the present disclosure provides a use of a functional mutation at the CIITA gene locus for diagnosing and/or confirming diagnosis of primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL).
[0021] In a further embodiment there is provided, use of a functional mutation at the CIITA gene locus for confirming diagnosing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL).
RECTIFIED SHEET (RULE 91.1) [0022] In another embodiment there is provided, use of a functional mutation at the CIITA gene locus as a biomarker of poor prognosis in a primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) patient.
[0023] In another embodiment there is provided, use of a functional mutation at the CIITA gene locus as a biomarker of treatment efficacy in associated primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL).
[0024] In another embodiment there is provided, use of a functional mutation at the CIITA gene locus as a biomarker of propensity to developing primary mediastinal B- cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL).
[0025] In further aspect, the present disclosure provides a method of treating primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject having a CIITA translocation involving a fusion partner comprising: administering an inhibitor of the fusion partner to said subject.
[0026] In another aspect, the present disclosure provides a use of an inhibitor of a fusion partner involved in a CIITA translocation for treating primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject harboring the CIITA translocation.
[0027] In a further embodiment, there is provided a method of selecting treatment for a subject having a B-cell lymphoma, comprising: providing/obtaining a sample from a B-cell lymphoma subject; detecting a translocation at the CIITA gene locus; identifying a translocation fusion partner; and selecting a treatment regimen comprising an inhibitor of the fusion partner.
[0028] Other aspects and features of the present disclosure will become apparent to those ordinarily skilled in the art upon review of the following description of specific embodiments in conjunction with the accompanying Figures.
BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Embodiments of the present disclosure will now be described, by way of example only, with reference to the attached Figures wherein:
[0030] Figure 1 depicts cumulative distribution plots of expression for both KM-H2 and L428 showing the proportion of genes expressed at increasing coverage levels.
[0031] Figure 2a is an illustration of a CIITA - BX648577 gene fusion using paired-end massively parallel whole transcriptome sequencing where the mate-pair sequences are shown aligning on either side of the breakpoint and the genomic exon coordinates are shown.
RECTIFIED SHEET (RULE 91.1) [0032] Figure 2b is an illustration of a CIITA - BX648577 gene fusion using paired-end massively parallel whole transcriptome sequencing where the split-reads are depicted lying on the breakpoint, the histogram illustrates the absolute frequency of each sequence read spanning the breakpoint.
[0033] Figure 3 depicts validation of BAT2L1-MGMT fusion transcripts by FISH and direct sequencing.
[0034] Figure 4 depicts alignment of BAC and Fosmid clones for BAT2L1-MGMT fusion and break-apart assays.
[0035] Figure 5 depicts validation of ELM01-SLC03A1 fusion transcripts by FISH and direct sequencing.
[0036] Figure 6 depicts alignment of BAC clones for ELM01-SLC03A1 fusion and break-apart assays.
[0037] Figure 7 depicts validation of complex chromosome 16 rearrangements in
KM-H2 leading to expression of CIITA-BX648577 fusion transcripts. Arrows indicate co- localization of the gene loci of CIITA and BX648577.
[0038] Figure 8 illustrates alignment of BAC and Fosmid clones for CIITA-
BX648577 fusion and break-apart assays.
[0039] Figure 9 illustrates the molecular characterization of the gene fusion
CIITA-BX648577 Ίη HL cell line KM-H2.
[0040] Figure 10 depicts immuno-fluorescence staining with N-terminal CIITA antibody.
[0041] Figure 11 depicts high-resolution single nucleotide polymorphism analysis and FISH confirm chromosomal unbalances accompanying complex rearrangements involving chromosomes 15 and 16 in KM-H2.
[0042] Figure 12 depicts detailed molecular-cytogenetic characterization of KM-
H2 bearing rearrangements involving CIITA.
[0043] Figure 13 depicts inhibition of CIITA/BX648577 fusion gene expression by a lentiviral shRNAmir vector.
[0044] Figure 14 illustrates data indicating that genes of the "Antigen
Presentation Pathway" are up-regulated by knockdown of the fusion C//IA-BX648577 fusion construct.
[0045] Figure 15 is an illustration of FISH on tissue microarrays (TMA) showing recurrent CIITA break-apart in cHL and PMBCL and associated cumulative survival of subjects with and without CIITA break-apart.
RECTIFIED SHEET (RULE 91.1) [0046] Figure 16 depicts genomic breakpoints in the CIITA gene defining a
1 ,630bp breakpoint cluster region in intronl based on 5 cases with CIITA
rearrangements.
[0047] Figure 17 depicts the full length CIITA-BX648577 (BX648577.1 ) cDNA in KM-H2 (longest transcript) and putative translation (used for forced expression in
SUDHL4) having expressed "intronic" BX648577 sequence underlined and translational start and stop codons in bold, SEQ ID NO. 41 and 42.
[0048] Figure 18 depicts the full length CIITA-CD274 cDNA in a PMBCL case and putative translation (used for forced expression in U2940) having translational start and stop codons, SEQ ID NO. 43 and 44 respectively.
[0049] Figure 19a depicts the full length CIITA-PDCD1LG2 cDNA in a PMBCL case having the CIITA start codon mutation underlined and the putative translation starts at the PDCD1 LG2 start codon in bold, SEQ ID NO. 45 .
[0050] Figure 19b depicts the putative translation of the cDNA from Figure 19a (used for forced expression in U2940), SEQ ID NO. 46.
[0051] Figure 20a depicts the full length CIITA-RALGDS cDNA in a PMBCL case,
SEQ ID NO. 47.
[0052] Figure 20b depicts the putative translation of the cDNA from Figure 20a,
SEQ ID NO. 48.
[0053] Figure 21 depicts the full length CIITA-C160RF75 cDNA in a PMBCL case and putative translation, SEQ ID NO. 49 and 50 respectively.
[0054] Figure 22 illustrates results indicating that expression of CD274 or CD273 fusions in PMBCL cells inhibits T cell activation.
[0055] Figures 23a-23e illustrate further data on the effects of CD274 and CD273 fusion expression (and inhibition thereof).
[0056] Figure 24 illustrates additional results indicating that CD274 / CD273 expression on PMBCL cells inhibits T cell activation.
[0057] Figure 25 depicts the results of cytometric analysis of intracellular cleaved
PARP and active caspase 3 on transduced and wildtype U2932 cells.
DETAILED DESCRIPTION
[0058] Generally, the present disclosure provides CIITA gene fusions and their use in identification, diagnosis, prognosis, treatment, and/or monitoring of cancer progression. Gene fusion events may serve as biomarkers, and/or provide novel targets for the selective treatment of cancer. Furthermore, gene fusion events can provide
- 6 -
KECTIFIED SHEET (RULE 91.1) diagnostic and prognostic information as well as guidance for the appropriate treatment of patients.
[0059] Chromosomal translocations are a paradigm of molecular pathogenesis in
B cell lymphomas and highly recurrent and specific rearrangements have defined distinct molecular subtypes linked to unique clinicopathological features.1,2 In contrast, several well characterized lymphoma entities still lack disease-defining translocation events.
[0060] In Hodgkin lymphoma, translocations or chromosomal breakpoints have only rarely been described, whereas in PMBCL no recurrent translocation events have been reported. The Applicant analyzed two Hodgkin lymphoma cell lines and identified novel fusion transcripts resulting from translocations using whole-transcriptome paired- end sequencing (RNA-seq). Massively parallel, paired-end sequencing of expressed transcripts (RNA-seq) provides an analytical platform suitable for genome-wide mapping of translocation breakpoints, sequence variants and quantitative expression. 6, 7 This sequencing resulted in the Applicant's discovery of a highly expressed gene fusion involving the MHC class II transactivator CIITA (MHC2TA) in KM-H2 cells. The Applicant has demonstrated that chromosomal rearrangement of CIITA is involved in the pathogenesis of both Hodgkins lymphoma and primary mediastinal B cell lymphoma (PMBCL). Furthermore, following subsequent evaluation of 263 B cell lymphomas, the Applicant has demonstrated that genomic CIITA breaks were highly recurrent in primary mediastinal B cell lymphoma (about 38%) and classical Hodgkin lymphoma (about 15%).
[0061] Lymphoma is the fifth most common cancer in North America, impacting the cells which play a role in the immune system. Lymphomas are cancers that arise from lymphocytes, white blood cells that circulate primarily through the lymphoid system. Each year thousands of North Americans are impacted by primary mediastinal B-cell lymphoma and Hodgkin lymphoma, two of the most common types of lymphoma cancers affecting people under the age of 40. Lymphomas are generally called either B-cell or T-cell lymphoma depending on the type of lymphocyte that has become cancerous. For example, Hodgkin lymphoma usually starts with a B-cell lymphocyte. Examples of B cell lymphomas include: Chronic lymphocytic leukemia/Small lymphocytic lymphoma, B-cell prolymphocytic leukemia; Lymphoplasmacytic lymphoma (such as Waldenstrom macrogiobulinemia); Splenic marginal zone lymphoma; Plasma cell neoplasms including Plasma cell myeloma, Plasmacytoma, Monoclonal immunoglobulin deposition diseases, and Heavy chain diseases; Extranodal marginal zone B cell lymphoma, also called MALT lymphoma; Nodal marginal zone B cell lymphoma (NMZL); Follicular lymphoma; Mantle cell lymphoma; Diffuse large B cell lymphoma (including PMBCL); Mediastinal (thymic)
RECTIFIED SHEET (RULE 91.1) large B cell lymphoma; Intravascular large B cell lymphoma; Primary effusion lymphoma; and Burkitt lymphoma/leukemia.
[0062] Diffuse large B-cell lymphoma (DLBL, DLBCL, or DLCL) is a type of aggressive non-Hodgkin lymphoma. It accounts for approximately 40% of lymphomas among adults. The median age at diagnosis is 70 years, but it also occurs in children and young adults. As with most non-Hodgkin lymphomas, there is a male predominance, although primary cutaneous diffuse large B cell lymphoma is more common in women. Of all cancers involving the same class of blood cell, 31 % of cases are DLBL. [4]
[0063] DLBCLs consists of cells that are 4-5 times the diameter of a small lymphocytes and typically have marked cell-to-cell variation in size and shape. Their cytoplasm is typically basophilic and moderate in abundance. Nucleoli can be small but conspicuous to large and prominent and may be peripheral and/or central. Large bizarre cells can occasionally mimic Reed-Sternberg cells, seen in Hodgkin lymphoma.
[0064] Primary mediastinal B-cell lymphoma is a subset of Diffuse Large B-cell lymphoma, which arises in the thymus, and presents as a mass in the mediastinum. It primarily affects younger patients in their 30's and 40's, and is more common in women than men. It closely resembles Hodgkin lymphoma, and has a similar prognosis to similarly staged DLBC. PMBCL is an aggressive lymphoma which often presents with symptoms related to its location. Breathing problems, shortness of breath, pleural effusions, superior vena cava syndrome, fevers, etc. On initial diagnosis it is almost always limited to the mediastinal mass, but if a relapse occurs it is likely to occur in the kidneys, liver, central nervous system.
[0065] Hodgkin lymphoma (cHL), previously known as Hodgkin disease, is a type of lymphoma, which is a cancer originating from white blood cells called lymphocytes. Hodgkin lymphoma is characterized by the orderly spread of disease from one lymph node group to another and by the development of systemic symptoms with advanced disease. When Hodgkins cells are examined microscopically, multinucleated Reed- Sternberg cells (RS cells) are the characteristic histopathologic finding. Hodgkin lymphoma may be treated with radiation therapy, chemotherapy, or hematopoietic stem cell transplantation, with the choice of treatment depending on the age and sex of the patient and the stage, bulk, and histological subtype of the disease. The disease occurrence shows two peaks: the first in young adulthood (age 15-35) and the second in those over 55 years old. [3]
[0066] Microscopic examination of the lymph node biopsy in Hodgkin lymphoma reveals complete or partial effacement of the lymph node architecture by scattered large
- 8 - ECTIFIED SHEET (RULE 91.1) malignant cells known as Reed-Sternberg cells (RSC) (typical and variants) admixed within a reactive cell infiltrate composed of variable proportions of lymphocytes, histiocytes, eosinophils, and plasma cells. The Reed-Sternberg cells are identified as large often bi-nucleated cells with prominent nucleoli and an unusual CD45-, CD30+, CD15+/- immunophenotype. In approximately 50% of cases, the Reed-Sternberg cells are infected by the Epstein-Barr virus. Characteristics of classic Reed-Sternberg cells include large size (20-50 micrometres), abundant, amphophilic, finely
granular/homogeneous cytoplasm; two mirror-image nuclei (owl eyes) each with an eosinophilic nucleolus and a thick nuclear membrane (chromatin is distributed at the cell periphery).
[0067] The Applicant has further discovered that CIITA is a promiscuous partner of various in-frame gene fusions. The Applicant found that CIITA gene alterations impact survival in primary mediastinal B cell lymphoma. In addition, as functional consequences of CIITA gene fusions, the Applicant further discovered a down-regulation of surface HLA class II expression and overexpression of ligands of the receptor molecule programmed cell death 1 (CD274/PDL1 and CD273/PDL2). These receptor-ligand interactions have been shown to impact antitumour immune responses in a number of cancers3, while decreased MHC class II expression has been linked to reduced tumour cell
immunogenicity.4
[0068] The recurrent rearrangements of CIITA represent a novel genetic mechanism underlying tumour-microenvironment interactions across a spectrum of lymphoid cancers.
[0069] RNA-sequence data was generated from the HL cell lines KM-H2 and
L428 as described below. Fusion transcripts were detected using defuse and validation of fusion transcripts was performed by FISH and PCR. Protein expression of the CIITA- BX648577 fusion protein was detected by Western blotting and immunofluorescence. Fusion transcript knockdown in KM-H2 cells was performed by lentiviral transduction of a vector expressing a shRNAmir interfering with BX648577 sequences. Forced expression of the CIITA gene fusions was achieved using a lentiviral29 and an inducible retroviral vector30. Gene expression in KM-H2 cells was measured using gene expression profiling and flow cytometry. Primary paraffin tissue samples of 263 subjects with B cell lymphoma were studied using FISH. For 8 selected PMBCL cases with CIITA
rearrangements the Applicant analyzed the samples using 3' RACE. Quantitative RT- PCR was performed to measure expression of CIITA-BX648577 fusion transcripts, CD274 and CD273. For in-vitro studies the Applicant used U2940, U2932 and SUDHL4
RECTIFIED SHEET (RULE 91.1) cells. Jurkat T cells were used for co-culture experiments measuring T cell activation by CD69 flow cytometric analysis and IL-2 enzyme-linked immunosorbent assays (ELISA).
[0070] In one aspect, there is provided a method of diagnosing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin (cHL) lymphoma in a subject, the method comprising: providing/obtaining a biological sample from a subject; and detecting a functional mutation at the CIITA gene locus in the sample; wherein a detected functional mutation at the CIITA gene locus is indicative of a diagnosis of PMBCL or cHL.
[0071] In some embodiments, additional clinical criteria may be used to distinguish between PMBCL and cHL. For example, PMBCL arises primarily in the mediastinum, and its initial anatomical location may be used as a hallmark to identify PMBCL. Microscopic examination of blood cells, and immunophenotype may also be used to assist in differentiation between the two clinical entities.
[0072] In some embodiments, the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
[0073] In some embodiments, the functional mutation may be an inactivating mutation in the CIITA gene. The inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
[0074] In an exemplary embodiment, the functional mutation is a translocation involving the CIITA gene.
[0075] The translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof. In some embodiments, transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation. In some embodiments, the translocation involves fusion of C//7>4 to BX648577, CD274, CD273, RALGDS,
RUNDC2A, or C160RF75 (or a fragment thereof). In some embodiments, the activated fusion partner leads to decreased HLA class II gene expression. In some embodiments, the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some
embodiments, the fusion partner is a PD-1 ligand. In some embodiments, the
translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
[0076] In another aspect, there is provided a method of confirming a diagnosis primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject suspected of having PMBCL or cHL, the method
comprising: providing/obtaining a biological sample from a subject suspected of having
- 10 - ECTIFIED SHEET (RULE 91.1) PMBCL; and detecting a functional mutation at the CIITA gene locus in the sample;
wherein a detected functional mutation at the CIITA gene locus confirms a diagnosis of PMBCL or cHL
[0077] In some embodiments, additional clinical criteria may be used to distinguish between PMBCL and cHL. For example, PMBCL arises primarily in the mediastinum, and its initial anatomical location may be used as a hallmark to identify PMBCL. Microscopic examination of blood cells, and immunophenotype may also be used to assist in differentiation between the two clinical entities.
[0078] In some embodiments, the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
[0079] In some embodiments, the functional mutation may be an inactivating mutation in the CIITA gene. The inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
[0080] In an exemplary embodiment, the functional mutation is a translocation involving the CIITA gene.
[0081] The translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof. In some embodiments, transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation. In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
RUNDC2A, or C160RF75 (or a fragment thereof). In some embodiments, the activated fusion partner leads to decreased HLA class II gene expression. In some embodiments, the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some
embodiments, the fusion partner is a PD-1 ligand. In some embodiments, the
translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
[0082] In another aspect, there is provided a method of determining a prognosis of a subjecting with primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL), the method comprising: providing/obtaining a biological sample from a subject with PMBCL or cHL; and detecting a functional mutation at the CIITA gene locus in the sample; wherein a detected functional mutation at the CIITA gene locus is indicative of a poor prognosis.
[0083] In some embodiments, the poor prognosis is a poor prognosis under a cyclophosphamide-hydroxyldaunorubicin-oncovin-prednisone (CHOP) combination or a
- 1 1 -
RECTIFIED SHEET (RULE 91.1) CHOP-like chemotherapy treatment regimen. In an exemplary embodiment, a CHOP-like regimen may include CHOP, CHOEP (CHOP plus etoposide) or MACOP-B (methotrexate with leucovorin rescue, doxorubicin, cyclophosphamide, vincristine, prednisone, and bleomycin).
[0084] In some embodiments, the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
[0085] In some embodiments, the functional mutation may be an inactivating mutation in the CIITA gene. The inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
[0086] In an exemplary embodiment, the functional mutation is a translocation involving the CIITA gene.
[0087] The translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof. In some embodiments, transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation. In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
RUNDC2A, or C160RF75 (or a fragment thereof). In some embodiments, the activated fusion partner leads to decreased HLA class II gene expression. In some embodiments, the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some
embodiments, the fusion partner is a PD-1 ligand. In some embodiments, the
translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
[0088] In another aspect, there is provided a method of determining a propensity for developing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject, the method comprising: providing/obtaining a biological sample from a subject; and detecting a functional mutation at the CIITA gene locus in the sample; wherein a detected functional mutation at the CIITA gene locus is indicative of a propensity to developing PMBCL or cHL.
[0089] In some embodiments, the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
[0090] In some embodiments, the functional mutation may be an inactivating mutation in the CIITA gene. The inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
RECTIFIED SHEET (RULE 91.1) [0091] In an exemplary embodiment, the functional mutation is a translocation involving the CIITA gene.
[0092] The translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof. In some embodiments, transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation. In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
RUNDC2A, or C160RF75 (or a fragment thereof). In some embodiments, the activated fusion partner leads to decreased HLA class II gene expression. In some embodiments, the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some
embodiments, the fusion partner is a PD-1 ligand. In some embodiments, the
translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
[0093] In another aspect, there is provided a method of determining primary mediastinal B-celi lymphoma (PMBCL) or classical Hodgkin (cHL) lymphoma treatment efficacy, the method comprising: providing/obtaining a biological sample from a PMBCL or cHL subject; detecting a functional mutation at the CIITA gene locus in the sample; quantifying the proportion of cells having the functional mutation at the CIITA gene locus; comparing the proportion of cells having the functional mutation at the CIITA gene locus against a suitable control wherein a reduced number of cells having the functional mutation at the CIITA gene locus compared to the suitable control is indicative of an efficacious treatment.
[0094] In some embodiments, the suitable control may be a sample taken earlier from the same subject. In an exemplary embodiment, the suitable control may be a sample taken earlier from the same subject prior to treatment.
[0095] In some embodiments, the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
[0096] In some embodiments, the functional mutation may be an inactivating mutation in the CIITA gene. The inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
[0097] In an exemplary embodiment, the functional mutation is a translocation involving the CIITA gene.
[0098] The translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof. In some embodiments, transcription or expression of the fusion partner
- 13 -
RECTIFIED SHEET (RULE 91.1) (or fragment thereof) is activated by the translocation. In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
RUNDC2A, or C160RF75 (or a fragment thereof). In some embodiments, the activated fusion partner leads to decreased HLA class II gene expression. In some embodiments, the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some
embodiments, the fusion partner is a PD-1 ligand. In some embodiments, the
translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
[0099] In aspect, there is provided a kit for diagnosing primary mediastinal B- cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject, comprising:
[00100] reagents for detecting a functional mutation at the CIITA gene locus in a patient sample; and instructions for use in diagnosing PMBCL or cHL, wherein a detected functional mutation a the CIITA gene locus is indicative of a diagnosis of PMBCL or cHL.
[00101] In some embodiments, additional clinical criteria may be used to distinguish between PMBCL and cHL. For example, PMBCL arises primarily in the mediastinum, and its initial anatomical location may be used as a hallmark to identify PMBCL. Microscopic examination of blood cells, and immunophenotype may also be used to assist in differentiation between the two clinical entities.
[00102] In some embodiments, the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
[00103] In some embodiments, the functional mutation may be an inactivating mutation in the CIITA gene. The inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
[00104] In an exemplary embodiment, the functional mutation is a translocation involving the CIITA gene.
[00105] The translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof. In some embodiments, transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation. In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
RUNDC2A, or C160RF75 (or a fragment thereof). In some embodiments, the activated fusion partner leads to decreased HLA class II gene expression. In some embodiments, the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA
- 14 -
KECTIFIED SHEET (RULE 91.1) to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some
embodiments, the fusion partner is a PD-1 ligand. In some embodiments, the
translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
[00106] In another aspect, there is provided a kit for confirming a diagnosis primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject suspected of having PMBCL or cHL, comprising: reagents for detecting a functional mutation at the CIITA gene locus in a sample from a subject suspected of having PMBCL or cHL; and instructions for use in diagnosing PMBCL or cHL, wherein a detected functional mutation a the CIITA gene locus is confirms diagnosis of PMBCL or cHL.
[00107] In some embodiments, additional clinical criteria may be used to distinguish between PMBCL and cHL. For example, PMBCL arises primarily in the mediastinum, and its initial anatomical location may be used as a hallmark to identify PMBCL. Microscopic examination of blood cells, and immunophenotype may also be used to assist in differentiation between the two clinical entities.
[00108] In some embodiments, the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
[00109] In some embodiments, the functional mutation may be an inactivating mutation in the CIITA gene. The inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
[00110] In an exemplary embodiment, the functional mutation is a translocation involving the CIITA gene.
[00111] The translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof. In some embodiments, transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation. In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
RUNDC2A, or C160RF75 (or a fragment thereof). In some embodiments, the activated fusion partner leads to decreased HLA class II gene expression. In some embodiments, the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some
embodiments, the fusion partner is a PD-1 ligand. In some embodiments, the
translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
- 15 -
KECTIFIED SHEET (RULE 91.1) [00112] In another aspect, there is provided a kit for determining prognosis of a subject with primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL), comprising: reagents for detecting a functional mutation at the CIITA gene locus in a patient sample; and instructions for use in determining prognosis; wherein a detected functional mutation at the CIITA gene locus is indicative of a poor prognosis.
[00113] In some embodiments, the poor prognosis is a poor prognosis under a cyclophosphamide-hydroxyldaunorubicin-oncovin-prednisone (CHOP) combination or a CHOP-like chemotherapy treatment regimen. In an exemplary embodiment, a CHOP-like regimen may include CHOP, CHOEP or MACOP-B.
[00114] In some embodiments, the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
[00115] In some embodiments, the functional mutation may be an inactivating mutation in the CIITA gene. The inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
[00116] In an exemplary embodiment, the functional mutation is a translocation involving the CIITA gene.
[00117] The translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof. In some embodiments, transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation. In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
RUNDC2A, or C160RF75 (or a fragment thereof). In some embodiments, the activated fusion partner leads to decreased HLA class II gene expression. In some embodiments, the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some
embodiments, the fusion partner is a PD-1 ligand. In some embodiments, the
translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
[00118] In another aspect, there is provided a kit for determining primary mediastinal B-cell lymphoma (PMBCL) treatment efficacy, comprising: reagents for quantifying the proportion of cells having a functional mutation at the CIITA gene locus in a PMBCL or cHL subject sample; and instructions for use in determining treatment efficacy; wherein a reduced proportion of cells having the functional mutation at the CIITA gene locus compared to a suitable control is indicative of an efficacious treatment.
- 16 -
KECTIFIED SHEET (RULE 91.1) [00119] In some embodiments, the suitable control may be a sample taken earlier from the same patient. In an exemplary embodiment, the suitable control may be a sample taken earlier from the same patient prior to treatment.
[00120] In some embodiments, the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
[00121] In some embodiments, the functional mutation may be an inactivating mutation in the CIITA gene. The inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
[00122] In an exemplary embodiment, the functional mutation is a translocation involving the CIITA gene.
[00123] The translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof. In some embodiments, transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation. In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
RUNDC2A, or C160RF75 (or a fragment thereof). In some embodiments, the activated fusion partner leads to decreased HLA class II gene expression. In some embodiments, the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some
embodiments, the fusion partner is a PD-1 ligand. In some embodiments, the
translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
[00124] In another aspect, there is provided a kit for determining propensity for developing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject, comprising: reagents for detecting a functional mutation at the CIITA gene locus in a patient sample; and instructions for use in determining propensity for developing PMBCL or cHL, wherein a detected functional mutation a the CIITA gene locus is indicative of a propensity to developing PMBCL or cHL.
[00125] In some embodiments, the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
[00126] In some embodiments, the functional mutation may be an inactivating mutation in the CIITA gene. The inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
[00127] In an exemplary embodiment, the functional mutation is a translocation involving the CIITA gene.
- 17 -
KECTIFIED SHEET (RULE 91.1) [00128] The translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof. In some embodiments, transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation. In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
RUNDC2A, or C160RF75 (or a fragment thereof). In some embodiments, the activated fusion partner leads to decreased HLA class II gene expression. In some embodiments, the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some
embodiments, the fusion partner is a PD-1 ligand. In some embodiments, the
translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
[00129] In another aspect, there is provided a biomarker of primary
mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) comprising a functional mutation at the CIITA gene locus.
[00130] In some embodiments, additional clinical criteria may be used to distinguish between PMBCL and cHL. For example, PMBCL arises primarily in the mediastinum, and its initial anatomical location may be used as a hallmark to identify PMBCL. Microscopic examination of blood cells, and immunophenotype may also be used to assist in differentiation between the two clinical entities.
[00131] In some embodiments, the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
[00132] In some embodiments, the functional mutation may be an inactivating mutation in the CIITA gene. The inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
[00133] In an exemplary embodiment, the functional mutation is a translocation involving the CIITA gene.
[00134] The translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof. In some embodiments, transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation. In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
RUNDC2A, or C160RF75 (or a fragment thereof). In some embodiments, the activated fusion partner leads to decreased HLA class II gene expression. In some embodiments, the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA
- 18 -
KECTIFIED SHEET (RULE 91.1) to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some
embodiments, the fusion partner is a PD-1 ligand. In some embodiments, the
translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
[00135] In another aspect, there is provided a biomarker of poor prognosis in primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin (cHL) comprising a functional mutation at the CIITA gene locus.
[00136] In some embodiments, the poor prognosis is a poor prognosis under a cyclophosphamide-hydroxyldaunorubicin-oncovin-prednisone (CHOP) combination or a CHOP-like chemotherapy treatment regimen. In an exemplary embodiment, a CHOP-like regimen may include CHOP, CHOEP or MACOP-B.
[00137] In some embodiments, the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
[00138] In some embodiments, the functional mutation may be an inactivating mutation in the CIITA gene. The inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
[00139] In an exemplary embodiment, the functional mutation is a translocation involving the CIITA gene.
[00140] The translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof. In some embodiments, transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation. In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
RUNDC2A, or C160RF75 (or a fragment thereof). In some embodiments, the activated fusion partner leads to decreased HLA class II gene expression. In some embodiments, the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some
embodiments, the fusion partner is a PD-1 ligand. In some embodiments, the
translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
[00141] In another aspect, there is provided a biomarker of primary
mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) treatment efficacy comprising a functional mutation at the CIITA gene locus.
- 19 -
KECTIFIED SHEET (RULE 91.1) [00142] In some embodiments, the suitable control may be a sample taken earlier from the same patient. In an exemplary embodiment, the suitable control may be a sample taken earlier from the same patient prior to treatment.
[00143] In some embodiments, the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
[00144] In some embodiments, the functional mutation may be an inactivating mutation in the CIITA gene. The inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
[00145] In an exemplary embodiment, the functional mutation is a translocation involving the CIITA gene.
[00146] The translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof. In some embodiments, transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation. In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
RUNDC2A, or C160RF75 (or a fragment thereof). In some embodiments, the activated fusion partner leads to decreased HLA class II gene expression. In some embodiments, the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some
embodiments, the fusion partner is a PD-1 ligand. In some embodiments, the
translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
[00147] In another aspect, there is provided a biomarker of propensity to developing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) comprising a functional mutation at the CIITA gene locus.
[00148] In some embodiments, the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
[00149] In some embodiments, the functional mutation may be an inactivating mutation in the CIITA gene. The inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
[00150] In an exemplary embodiment, the functional mutation is a translocation involving the CIITA gene.
[00151] The translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof. In some embodiments, transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation. In some embodiments, the
- 20 -
RECTIFIED SHEET (RULE 91.1) translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
RUNDC2A, or C160RF75 (or a fragment thereof). In some embodiments, the activated fusion partner leads to decreased HLA class II gene expression. In some embodiments, the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some
embodiments, the fusion partner is a PD-1 ligand. In some embodiments, the
translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
[00152] In another aspect, there is provided a use of a functional mutation at the CIITA gene locus for diagnosing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL).
[00153] In some embodiments, additional clinical criteria may be used to distinguish between PMBCL and cHL. For example, PMBCL arises primarily in the mediastinum, and its initial anatomical location may be used as a hallmark to identify PMBCL. Microscopic examination of blood cells, and immunophenotype may also be used to assist in differentiation between the two clinical entities.
[00154] In some embodiments, the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
[00155] In some embodiments, the functional mutation may be an inactivating mutation in the CIITA gene. The inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
[00156] In an exemplary embodiment, the functional mutation is a translocation involving the CIITA gene.
[00157] The translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof. In some embodiments, transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation. In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
RUNDC2A, or C160RF75 (or a fragment thereof). In some embodiments, the activated fusion partner leads to decreased HLA class II gene expression. In some embodiments, the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some
embodiments, the fusion partner is a PD-1 ligand. In some embodiments, the
- 21 -
RECTIFIED SHEET (RULE 91.1) translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
[00158] In another aspect, there is provided a use of a functional mutation at the CIITA gene locus for confirming diagnosing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL).
[00159] In some embodiments, additional clinical criteria may be used to
distinguish between PMBCL and cHL. For example, PMBCL arises primarily in the mediastinum, and its initial anatomical location may be used as a hallmark to identify PMBCL. Microscopic examination of blood cells, and immunophenotype may also be used to assist in differentiation between the two clinical entities.
[00160] In some embodiments, the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
[00161] In some embodiments, the functional mutation may be an inactivating mutation in the CIITA gene. The inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
[00162] In an exemplary embodiment, the functional mutation is a translocation involving the CIITA gene.
[00163] The translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof. In some embodiments, transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation. In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
RUNDC2A, or C160RF75 (or a fragment thereof). In some embodiments, the activated fusion partner leads to decreased HLA class II gene expression. In some embodiments, the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some
embodiments, the fusion partner is a PD-1 ligand. In some embodiments, the
translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
[00164] In another aspect, there is provided a use of a functional mutation at the CIITA gene locus as a biomarker of poor prognosis in a primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) patient.
[00165] In some embodiments, the poor prognosis is a poor prognosis under a cyclophosphamide-hydroxyldaunorubicin-oncovin-prednisone (CHOP) combination or a
- 22 -
KECTIFIED SHEET (RULE 91.1) CHOP-like chemotherapy treatment regimen. In an exemplary embodiment, a CHOP-like regimen may include CHOP, CHOEP or MACOP-B.
[00166] In some embodiments, the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
[00167] In some embodiments, the functional mutation may be an inactivating mutation in the CIITA gene. The inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
[00168] In an exemplary embodiment, the functional mutation is a translocation involving the CIITA gene.
[00169] The translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof. In some embodiments, transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation. In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
RUNDC2A, or C160RF75 (or a fragment thereof). In some embodiments, the activated fusion partner leads to decreased HLA class II gene expression. In some embodiments, the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some
embodiments, the fusion partner is a PD-1 ligand. In some embodiments, the
translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
[00170] In another aspect, there is provided a use of a functional mutation at the CIITA gene locus as a biomarker of treatment efficacy in associated primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL).
[00171] In some embodiments, the suitable control may be a sample taken earlier from the same patient. In an exemplary embodiment, the suitable control may be a sample taken earlier from the same patient prior to treatment.
[00172] In some embodiments, the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
[00173] In some embodiments, the functional mutation may be an inactivating mutation in the CIITA gene. The inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
[00174] In an exemplary embodiment, the functional mutation is a translocation involving the CIITA gene.
- 23 -
KECTIFIED SHEET (RULE 91.1) [00175] The translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof. In some embodiments, transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation. In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
RUNDC2A, or C160RF75 (or a fragment thereof). In some embodiments, the activated fusion partner leads to decreased HLA class II gene expression. In some embodiments, the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some
embodiments, the fusion partner is a PD-1 ligand. In some embodiments, the
translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
[00176] In another aspect, there is provided a use of a functional mutation at the CIITA gene locus as a biomarker of propensity to developing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL).
[00177] In some embodiments, the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
[00178] In some embodiments, the functional mutation may be an inactivating mutation in the CIITA gene. The inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene.
[00179] In an exemplary embodiment, the functional mutation is a translocation involving the CIITA gene.
[00180] The translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof. In some embodiments, transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation. In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
RUNDC2A, or C160RF75 (or a fragment thereof). In some embodiments, the activated fusion partner leads to decreased HLA class II gene expression. In some embodiments, the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some
embodiments, the fusion partner is a PD-1 ligand. In some embodiments, the
translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
- 24 -
KECTIFIED SHEET (RULE 91.1) [00181] In another aspect, there is provided a method of treating primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject having a CIITA translocation involving a fusion partner comprising administering an inhibitor of the fusion partner to the subject. In some embodiments, the fusion partner is a PD-1 ligand, and the inhibitor is an inhibitor of PD-1. In some embodiments the inhibitor may further comprise an antibody which binds specifically to PD-1. In one exemplary embodiment, the antibody may be CT011 or MDX-1106.
[00182] In another aspect, there is provided a use of an inhibitor of a fusion partner involved in a CIITA translocation for treating primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject harbouring the CIITA translocation. In some embodiments the fusion partner is a PD-1 ligand, and the inhibitor is an inhibitor of PD-1. In some embodiments, the inhibitor may further comprise an antibody which specifically binds to PD-1. In one exemplary embodiment, the antibody may be CT011 or MDX-1106.
[00183] In another aspect, there is provided a method of selecting treatment for a subject having a B-cell lymphoma, comprising providing a sample from a B-cell lymphoma subject; detecting a translocation at the CIITA gene locus; identifying a translocation fusion partner; and selecting a treatment regimen comprising an inhibitor of the fusion partner. In some embodiments, fusion partner is a PD-1 ligand, and the inhibitor is an inhibitor of thePD-1 ligand. In some embodiments, the inhibitor may further comprise an antibody which binds specifically to PD-1. In one exemplary embodiment, the antibody may be CT011 or MDX-1106. In another exemplary embodiment, the B-cell lymphoma may be a primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL).
[00184] In another aspect, there is provided a method of determining whether a standard cyclophosphamide-hydroxyldaunorubicin-oncovin-prednisone (CHOP) chemotherapeutic regimen or CHOP-related regimen is likely to be effecacious in treating a primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin, the method comprising: providing a biological sample from a PMBCL or a cHL subject; and detecting a functional mutation at the CIITA gene locus in the sample. A detected functional mutation at the CIITA gene locus indicates that the standard CHOP or CHOP-like chemotherapeutic regimen is likely to be a less efficacious treatment compared to a PMBCL or cHL subject not having functional mutation at the CIITA gene locus. In an exemplary embodiment, a CHOP-like regimen may include CHOP, CHOEP or MACOP-B.
- 25 -
KECTIFIED SHEET (RULE 91.1) [00185] In some embodiments, the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
[00186] In some embodiments, the functional mutation may be an inactivating mutation in the CIITA gene. The inactivating mutation may be due to nonsense mutation, a frameshift mutation, a deletion, or a dominant negative mutation in the CIITA gene. In an exemplary embodiment, the functional mutation is a translocation involving the CIITA gene.
[00187] The translocation may involve fusion of CIITA to a fusion partner, or a fragment thereof. In some embodiments, transcription or expression of the fusion partner (or fragment thereof) is activated by the translocation. In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, RALGDS,
RUNDC2A, or C160RF75 (or a fragment thereof). In some embodiments, the activated fusion partner leads to decreased HLA class II gene expression. In some embodiments, the translocation involves fusion of CIITA to of BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some embodiments, the translocation involves fusion of CIITA to BX648577, CD274, CD273, or RUNDC2A (or a fragment thereof). In some
embodiments, the fusion partner is a PD-1 ligand. In some embodiments, the
translocation involves fusion of CIITA to CD274 or CD273 (or a fragment thereof). In some embodiments, the translocation activates CD274 or CD273 (or a fragment thereof).
[00188] Based on the PMBCL-associated or cHL-associated translocations which disrupt the CIITA gene observed and described herein, it is reasonable to conclude that other functional mutations involving the CIITA gene locus, including point mutations (e.g. nonsense mutations, missense mutations, or mutations in associated regulatory elements) and microdeletions are likely to be associated with and/or causative of PMBCL or cHL.
[00189] Given that mutations (e.g. translocations) which appear to abrogate an allele of the CIITA gene described herein appear to be causative of or otherwise associated with PMBCL or cHL, it is reasonable to conclude that other mutations which reduce (but do not necessarily abrogate) C//T>4 function are likely to be causative of or associated with PMBCL of cHL.
[00190] Given that CIITA translocations described herein have been shown to disrupt the CIITA gene and reduce its expression or activity in PMBCL or cHL, it is reasonable to conclude that treatments aimed ameliorating downstream effects of reduced CIITA expression may be efficacious in treating PMBCL or cHL. For example, treatments aimed at (1 ) enhancing residual CIITA activity, or (2) stimulating downstream
- 26 -
RECTIFIED SHEET (RULE 91.1) effectors of CIITA may be effective as treatments for patients harbouring CIITA
translocations and/or other functional mutations involving the CIITA gene or gene locus.
[00191] Given that CIITA translocations described herein have been shown to enhance expression of fusion partners, it is reasonable to conclude that treatments which reduce or down-regulate expression or activity of these fusion partners will likely be useful in treating patients with PMBCL or cHL harbouring such translocations. For example, siRNA or shRNA targeted to the fusion partner portion of a transcript may be useful in treating subjects harbouring a translocation. Standard guidelines for generating siRNA would be well known to a skilled person and include those referenced at
www.rnaiweb.com/RNAi/siRNA_Design/ and described in Reynolds. A. , et at. Rational siRNA design for RNA interference. Nat Biotechnol. 2004 Mar;22(3):326-30), the contents of which are expressly incorporated by reference. Alternatively, antibodies targeted at the fusion partner protein (or portion thereof) may be useful in treating subjections harbouring a translocation. Having identified a fusion partner, a skilled person would readily be able to generate monoclonal, humanized, or human antibodies to a particular fusion partner (or epitope thereof) using established techniques.
[00192] Techniques for conferring immunogenicity on a peptide are well known in the art and include, for example, conjugation to carriers. The peptide can be administered in the presence of adjuvant. The progress of immunization can be monitored by detection of antibody titers in plasma or serum. Standard ELISA or other immunoassay procedures can be used with the immunogen as antigen to assess antibody levels. Following immunization, antisera can be obtained and, if desired, polyclonal antibodies isolated from the sera.
[00193] Conventional methods can be used to prepare polyclonal antibodies. To produce polyclonal antibodies, a mammal, (e.g. a mouse, hamster, or rabbit) can be immunized with an immunogenic form of the novel conformational epitope which elicits an antibody response in the mammal.
[00194] To produce monoclonal antibodies, antibody-producing cells (B- lymphocytes) are harvested from an immunized animal and fused with myeloma cells by standard somatic cell fusion procedures to form immortal hybridoma cells. Such techniques are well known in the art, (e.g., the hybridoma technique originally developed by Kohler and Milstein (Nature 256, 495-497(1975)) as well as other techniques such as the human B-cell hybridoma technique (Kozbor et al., Immunol. Today 4, 72 (1983)), the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al.,
Monoclonal Antibodies in Cancer Therapy (1985) Allen R. Bliss, Inc., pages 77-96), and
- 27 -
KECTIFIED SHEET (RULE 91.1) screening of combinatorial antibody libraries (Huse et al., Science 246, 1275 (1989)). Hybridoma cells can be screened immunochemically for production of antibodies specifically reactive with a selected novel conformational epitope and the monoclonal antibodies can be isolated.
[00195] Chimeric antibodies directed to fusion partners are also contemplated within the scope of the invention. Chimeric antibodies may comprise sequences from two different antibodies. They may comprise sequences from antibodies from two different species. Chimeric antibody molecules can include, for example, the antigen binding domain from an antibody of a mouse, rat, or other species with a constant human peptide region. Conventional methods may be used to make chimeric antibodies containing the immunoglobulin variable region which recognizes the novel conformational epitope of the invention (See, for example, Morrison et al., Proc. Natl Acad. Sci. U.S.A. 81 ,6851 (1985); Takeda et al., Nature 314, 452(1985), Cabilly et al., U.S. Pat. No. 4,816,567; Boss et al., U.S. Pat. No. 4,816,397; Tanaguchi et al., European Patent Publication EP171496; European Patent Publication 0173494, United Kingdom patent GB 2177096B).
[00196] Humanized antibodies may also be generated which are targeted to fusion partners. These typically comprise antibody sequences from non-human species whose protein sequences have been modified to increase their similarity to antibody variants produced naturally in humans. These may be considered as a specific subset of chimeric antibodies, in some instances. However, "humanization" is usually seen as distinct from the creation of a simple chimera. Having said that, the humanization process may include the creation of a mouse-human chimera in an initial step (for example, a mouse Fab may be spliced to human Fc). Thereafter the chimera might be further humanized by the selective alteration of the sequence of amino acids in the Fab portion of the molecule. The process is usually "selective" to retain the specificity for which the antibody was originally developed. For example, aside from the CDR segments, the portions of the Fab sequence that differ from those in humans can be mutated by exchanging the appropriate individual amino acids. This is accomplished at the DNA level using mutagenesis. It is possible to produce a humanized antibody without creating a chimeric intermediate. "Direct" creation of a humanized antibody can be accomplished by inserting the appropriate CDR coding segments (responsible for the desired binding properties) into a human antibody "scaffold". As discussed above, this is achieved through recombinant DNA methods using an appropriate vector and expression in mammalian cells. That is, after an antibody is developed in mouse (for example) which exhibits the desired properties, the DNA coding for that antibody can be isolated, cloned into a vector and
- 28 -
KECTIFIED SHEET (RULE 91.1) sequenced. The DNA sequence corresponding to the antibody CDRs can then be determined. Once the precise sequence of the desired CDRs are known, a strategy can be devised for inserting these sequences appropriately into a construct containing the DNA for a human antibody variant. The strategy may also employ synthesis of linear DNA fragments based on the reading of CDR sequences. Diversity libraries may be generated using synthetic diversity-containing oligonucleotide primers. The resulting pool of clones may be further screened to identify optimized humanized antibody clones using known methods.
[00197] Human antibodies to a particular epitope may be generated, for example, through immunization of a mouse having a reconstituted/humanized immune system with the epitope in question.
[00198] Based on the fact that the number of fusion partners identified herein for CIITA translocations function (directly or indirectly) in the same pathway as CIITA and may have similar downstream consequences (i.e. suppression of MHC class II gene expression), it is reasonable to predict that treatments which enhance the MHC class II gene expression pathway would be efficacious in treating subjects with CIITA
translocations, such as those involving activated fusion partners.
[00199] Since some CIITA translocations identified herein involve genes which are PD-1 ligands (e.g. PD-L1 encoded by CD274; and PDCD1 LG2/PD-L2 encoded by PDCD1LG2/CD273), it is reasonable to conclude that inhibitors of the PD-1 signaling pathway would likely be effective for treating patients harbouring such translocations. Such inhibitors may include, for example, antibodies or small molecules which reduce activity of this pathway, or siRNAs or shRNAs directed to components of the pathway, including PD-1 itself. Suitable antibodies include polyclonal, monoclonal, humanized, chimeric, or human antibodies. For instance, Brahmer et al. (2010) have described a Phase I study of patients with treatment-refractory metastatic melanoma, castrate- resistant prostate cancer, renal cell carcinoma (RCC), non-small-cell lung cancer (NSCLC), or colorectal cancer (CRC) with MDX-1 106 (BMS-936558/ONO-4538): a genetically engineered, and fully human immunoglobulin G4 (lgG4) mAb specific for human PD-1. Results indicated that the antibody was well-tolerated and associated with evidence of antitumor activity. In another study, Berger et al. (2008) described a Phase I study of treatment of patients with hematological malignancies with CT-01 1 , a humanized antibody which interacts which targets PD-1 . On the basis of this data, together with results described herein, it is reasonable to conclude that antibodies such as MDX-1 106 or CT-01 1 would also be useful in treating patients harbouring CIITA mutations involving
- 29 -
KECTIFIED SHEET (RULE 91.1) fusion to PD-1 ligands. Other PD-1 antibodies (such as those that could be made by a skilled on the basis of the above-described techniques) may also be useful for treating such patients.
[00200] Based on the observed CIITA translocations disclosed in the present application which are associated with PMBCL or cHL, it is reasonable presume that functional mutations in CIITA may contribute to oncogenesis and the underlying biology of the cancer phenotype. In many other cancers (e.g. those associated with mutations in p53, BRCA1 , or BRCA2) mutations which are associated with tumours themselves (e.g. after a series of mutations or "hits") may also confer a predisposition (propensity to develop) a particular cancer, including familial/inherited predisposition. Certain CIITA functional mutations may therefore also predispose a subject to developing PMBCL or cHL.
DEFINITIONS
[00201] "Functional mutation", as used herein, denotes any DNA sequence change, deletion (including microdeletions) or rearrangement which ultimately impacts protein function. Functional mutations include those which reduce or abrogate protein activity compared to the normal biological state for a given cell or tissue not containing the functional mutation. The reduced or abrogated protein activity may be the result of decreased protein expression, decreased stability, or increased turnover. Functional mutations include those which alter the amino acid sequence of a given protein (e.g. missense or nonsense mutations), leading to reduced activity, reduced stability, or increased turnover. Functional mutations may also reduce or abrogate one or a subset of total protein functions (for example, by disrupting a key protein-protein interaction). Such mutations may include DNA sequence changes which are situated in the coding sequence of a gene. They may also include mutations which occur in regulatory elements which reduce or abrogate transcription, alter or abrogate splicing, reduce or abrogate translation, or impact stability or degradation of the mRNA or protein. Functional mutations may include for example a translocation (which may be balanced or unbalanced), a more complex chromosomal rearrangement, a point mutation, or a microdeletion.
[00202] "Inactivating mutation", as used here, indicates a functional mutation which abrogates/eliminates protein function, at least from the relevant allele. Inactivating mutations may include nonsense mutations, insertions, deletions, splice site mutations, etc. Inactivating mutations may also include dominant negative mutations.
- 30 -
KECTIFIED SHEET (RULE 91.1) [00203] "Reduced function", "reduced activity", "reduce expression", and
"down-regulated" will be understood to encompass a decrease as compared to a normal (e.g. non-diseased) biological state, or that of the average level in a general population.
[00204] Likewise "up-regulated", "activated", "increased function", "increased activity", and "increased expression", etc. will be understood to encompass an increase as compared to a normal (e.g. non-diseased) biological state, or the average level the general population.
[00205] A skilled person would be well aware of numerous techniques for detecting mutations and rearrangements involving the CIITA locus. Such techniques may include PCR or RT-PCR, followed by sequencing. Rearrangements and translocations may be detected, as described herein, using fluorescence in situ hybridization (FISH), including metaphase FISH, interphase FISH, fibre FISH, etc. They may also be detected using paired end sequencing, such as whole transcriptase paired end sequencing (RNA-seq) analysis. For recurrent mutations, it may be feasible to use techniques for identifying single nucleotide polymorphisms (SNPs). Array-based methodologies may be used as a first pass to detect reduced expression of CIITA (or altered expression of a fusion partner), and such a result could be followed up with other methods to further define the CIITA mutation/rearrangement. Likewise, an antibody could be used in a standard technique, such as an enzyme-linked immunosorbent assay (ELISA) to detect aberrant expression of CIITA (or a fusion partner), and such a result could similarly be followed up with other methods to further define the CIITA mutation/rearrangement
[00206] A skilled person would readily be able to determine which sequence changes or rearrangements involving the CIITA locus constitute functional mutations (or, indeed, inactivating mutations) using standard experimental techniques. As but one example, cells deficient in CIITA i.e. having reduced HC class II expression (such as those derived from bare lymphocyte syndrome patients; or cells from PMBCL patients bearing translocations described herein which disrupt CIITA) could be transfected or transduced with an exogenous expression construct including a CIITA gene bearing the mutation in question. Standard techniques could be used to assess whether the exogenous gene is able to functionally complement or otherwise compensate for the CIITA deficiency (for example, by restoring MHC class II expression). If not, it would be reasonable to conclude that the sequence change in question constitutes a functional mutation. Alternatively, the CIITA mutation in question could be integrated into the genome of a cell in a site-specific manner and the resultant mutant cell line could be studied to assess whether it exhibits hallmarks of CIITA deficiency (e.g. reduced MHC
- 31 -
RECTIFIED SHEET (RULE 91.1) class II transcription). If so, it would be reasonable to conclude that the sequence change in question constitutes a functional mutation.
[00207] "Fusion partner", as described herein, indicates gene or a portion of a gene fused to the CIITA locus (or a portion thereof) following a chromosomal
rearrangement such as a translocation. Fusion partners may be upstream or
downstream of CIITA. In one embodiment, the fusion partner is downstream of CIITA and expression of the fusion partner (or portion thereof) is driven by CIITA regulatory elements. Transcription and expression of the fusion partner may be activated by the translocation. For translocations involving CIITA, fusion partners may be identified by rapid amplification of cDNA ends (RACE), or whole transcriptome paired end sequencing, as described in the Examples herein. A skilled person would readily understand that when a particular gene is referenced as a fusion partner, the complete gene sequence need not necessarily be fused; "fusion partner" is thus intended to encompass fragments of the gene encoding functional portions of the encoded protein, such as one or more functional domain.
[00208] "Poor prognosis" denotes a short- or long-term survival which is significantly worse than average survival for a given disease. In the context of PMBCL and CIITA mutations, a poor prognosis in patients with CIITA mutations denotes a short- or long-term survival which is significantly worse than that of a group of PMBCL patients not bearing CIITA mutations.
[00209] "Efficacious treatment", as used herein, indicates a treatment or therapy which reduces, mediates, or eliminates an effect of disease. An efficacious treatment may be one which improves short- or long-term survival. It may be one which reduces symptoms of disease, or one which improves quality of life. An efficacious treatment, in the context of cancer, may reduce the number of cancer cells, or induce remission.
[00210] "Biological sample", as discussed herein, is a sample of body fluid or tissue or organ sample from a subject, usually a subject suspected of having lymphoma, particularly a B cell lymphoma, for example PMBCL or Hodgkin lymphoma. A tissue or organ sample, such as that obtained from a solid or semi-solid tissue or organ, may be digested, extracted or otherwise rendered to a liquid form. A biological sample or samples may be taken from a subject at any appropriate time, including before the subject is diagnosed with, or suspected of having lymphoma, during a therapeutic regimen for the treatment or amelioration of symptoms of that disease or disorder, after death of the subject (regardless of the cause, or suspected cause). Alternately, a
- 32 -
KECTIFIED SHEET (RULE 91.1) biological sample may include donated body fluid or tissue, such as blood, plasma or platelets when in care of a centralized blood supply organization or institution.
[00211] "Biomarker" is used herein to designate a biological molecule or specific variant thereof whose presence or abundance is associated with or indicative of a particular biological trait, such as a disease, or risk thereof. A biomarker may also be indicative of disease severity, disease progression, or treatment efficacy.
[00212] "CIITA gene locus" as used herein, indicates the CIITA gene in its genomic context, including all its cis-acting regulatory elements.
[00213] "PMBCL subject", as used herein indicates a person or animal who has PMBCL, has been diagnosed with PMBCL, or (in some instances) is suspected of having PMBCL in a clinical context.
[00214] "cHL subject", as used herein indicates a person or animal who has cHL, has been diagnosed with cHL, or (in some instances) is suspected of having cHL in a clinical context.
[00215] "Suitable control", as used herein, may be for example a clinically selected control, a stored dataset of results generated from studies of the presence of a functional mutation in the CIITA gene locus in one or more population(s) of subjects having a lymphoma, a stored dataset of results generated from studies of the presence of a functional mutation in the CIITA gene locus in one or more population(s) of subjects having PMBCL, a stored dataset of results generated from studies of the presence of a functional mutation in the CIITA gene locus in one or more population(s) of subjects having PMBCL and responsive to a chemotherapeutic treatment, a stored dataset of results generated from studies of the presence of a functional mutation in the CIITA gene locus in samples collected from a single subject having lymphoma over an extended period of time, or combinations thereof. Control samples from subjects having a lymphoma, may preferably have a B-cell lymphoma, or more preferably PMBCL or cHL. A clinically selected control may be for example a physiological specimen having lymphoma or a physiological specimen having PMBCL. In some contexts, a suitable control may be a healthy individual, who may or may not be age and/or gender matched. In some instances (e.g. monitoring disease progression or treatment efficacy over time) a suitable control may be a sample previously taken from the same subject.
[00216] "Inhibitor", as used herein, denotes any molecule which lowers, or reduces at least one aspect of normal function of a target protein or pathway. In the context of a signaling receptor, an inhibitor may, for example, prevent ligand binding or
- 33 -
KECTIFIED SHEET (RULE 91.1) otherwise reduce or inhibit normal signaling. Inhibitors may include small molecules, or antibodies which bind and block (directly or indirectly) ligand binding.
[00217] "Propensity of developing" or "risk of developing" a particular disease or condition, as used herein, indicates a risk which is higher than that of the general population, or that of control individuals who do not carry the functional mutations in the gene (e.g. CIITA) which leads to the increased propensity or risk.
[00218] "Proportion of cells" indicates the relative number of cells. For example, in the context of leukemia, the "proportion of cells" may refer to the proportion of cells with a particular mutation, exhibiting a particular phenotype (e.g. morphological or
immunophenotype), or exhibiting a particular staining. In the context of microscopy,
"proportion of cells" may refer to the relative number of cells in a given field exhibiting a trait, such as a particular pattern of fluorescent probe signals indicative of a translocation. The proportion of cells may be measured using flow cytometry, including fluorescence- assisted cell sorting (FACS). The proportion of cells may also be determined using methods such as quantitative or semi-quantitative PCR or RT-PCR which, for example, may be used to detect the prevalence of a particular cellular genotype, as compared to a base line signal derived from all cells. In PCR or RT-PCR, the relative signal strength can be indicative of a relative number of cells in a total population. EXAMPLES
Materials and Patient Samples
[00219] The HL cell lines KM-H2 and L428 were selected for whole transcriptome paired end sequencing (RNA-seq) analysis. Both cell lines originated from patients with cHL (Epstein Barr virus negative mixed cellularity and nodular sclerosis, respectively). Additionally, cHL cell lines L540, L1236, HDLM2 and microdissected germinal center cells were used for comparison of gene expression levels. All cell lines were obtained from the German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig,
Germany) and cultures were grown following standard recommendations of the DSMZ (accessible, for example, at http://www.dsmz.de/). DNA and RNA were extracted using Allprep extraction kits (Qiagen Inc., ON, Canada).
[00220] For validation in primary tissue samples paraffin material from 263 patients was studied using fluorescence in situ hybridization (FISH). All cases were identified through the Lymphoid Cancer Database of the British Columbia Cancer Agency (BCCA) including 131 patients with diffuse large B cell lymphomas (DLBCL), 77 with primary mediastinal B cell lymphoma (PMBCL) and 55 with classical Hodgkin lymphoma (cHL).
- 34 -
KECTIFIED SHEET (RULE 91.1) PMBCL patients were treated with CHOP and CHOP-like chemotherapy as previously described.17 Additionally, 8 PMBCL cases were studied using rapid amplification of cDNA ends (RACE). All cases included in this study were independently reviewed by two hematopathologists before analysis. Ethical approval for this study was obtained from the University of British Columbia - British Columbia Cancer Agency Research Ethics Board (UBC BCCA REB). Previously published gene expression profiling data of 203 biopsy samples with defined molecular subtypes of DLBCL, including PMBCL, were reanalyzed.23
[00221] For functional in-vitro studies we used cell line U2940, derived from a DLBCL with features consistent with PMBCL25, U2932 (DLBCL, activated B cell (ABC) phenotype)31 and SUDHL4 (DLBCL, germinal center B cell (GCB) phenotype)32. Jurkat T cells were used for co-culture experiments measuring T cell activation.
Whole Transcriptome Paired End Sequencing (RNA-seq)
[00222] RNA-seq was performed as previously described. 28,33 In brief, double stranded cDNA was synthesized from polyadenylated RNA and sheared. The 190-210bp fraction was isolated and amplified with 10 cycles of PCR using the lllumina Genome Analyzer (GA) paired end library protocol (lllumina Inc, Hayward CA). The resulting libraries were then sequenced on an lllumina G j.
[00223] Short read sequences obtained from the GAii were mapped to the reference human genome (NBCI build 36.1 , hg18, http://genome.ucsc.edu/cgi- bin/hgGateway), and spliced (cDNA) and unspliced gene sequences (EnsembI v54) were aligned using the Bowtie algorithm.34 Fusion transcript discovery was performed using deFuse (http://compbio.bccrc.ca). Briefly, deFuse identifies fusion transcripts by clustering discordantly aligning paired end reads as potential evidence of reads that span a fusion breakpoint. Clusters of discordantly aligning reads are then used to inform a targeted search for reads split by fusion breakpoints. The results produced by deFuse were further filtered to reduce the number of false positives: 1 ) Predictions had to be supported by at least 8 reads spanning a fusion breakpoint and 5 reads split by a fusion breakpoint; 2) Fusions between adjacent genes were removed unless implied in genomic inversion or eversion; 3) Predictions involving ribosomal proteins or small nuclear ribosomal proteins were removed; 4) The results were filtered against fusion predictions from 41 ovarian cancer libraries in an attempt to remove systematic technical artifacts. After these series of filters were applied, a candidate list of fusions was carried forward for further analysis.
- 35 -
KECTIFIED SHEET (RULE 91.1) [00224] Gene expression levels were determined according to the total coverage of a gene, which was defined as the sum of the coverage of each non-redundant exonic nucleotide normalized by total mapped nucleotides. Gene Expression Profiling of HL Cell Lines
[00225] RNA-seq data were compared to gene expression data of HL cell lines (KM-H2, L428, L540, L1236 and HDLM2) and microdissected germinal center cells (n=5) derived from Affymetrix HG 2.0 Plus gene expression arrays using 2-cycle labeling reactions according to the standard protocol. For comparison of KM-H2 knockdown cultures (see below) the freely-available software DCHIP was used (available at http://biosun1.harvard.edu/complab/dchip/). Overrepresentation and pathway analysis was preformed using Ingenuity Pathway Analysis (Ingenuity® Systems,
www.ingenuity.com). High-resolution Single Nucleotide Polymorphism analysis
[00226] Genome-wide copy number analysis was performed using Human SNP 6.0 arrays (Affymetrix Inc, U.S.A) following the standard protocol and manufacturer's instructions. Hybridized arrays were washed, stained and scanned using Affymetrix Fluidics Station 450 and Affymetrix GeneChip Scanner. The Affymetrix SNP 6.0 data were processed using the R-based aroma. affymetrix package (Bengsston et al,
Bioinformatics 2009). Total copy number was estimated according to the CRMA procedure, calibrating for allelic cross talk, nucleotide-position probe sequence effects, robust probe summarization and correction for fragment length effects. CRMA normalized data were then compared to a reference derived from the HapMap 270 set of arrays downloaded from the Affymetrix website. Breakpoints were determined by a modified version of a hidden Markov model described before.35 Software (including visualization routines) is available as part of the CNA-HMMer package available at:
http://compbio.bccrc.ca. Genomic and Reverse-transcriptase Polymerase Chain Reaction (RT-PCR) and Fluorescence in-situ Hybridization (FISH)
[00227] The validation of fusion transcripts was performed using both genomic and reverse-transcriptase (RT) PCR using forward and reverse primer combinations designed within the margins of the paired end read sequences detected by RNA-seq (Table 1 ).
- 36 -
KECTIFIED SHEET (RULE 91.1) Table 1 : Primer sequences used for validation
Figure imgf000038_0001
NOTE: M13 sequence tags are Underlined
[00228] Expressed fusion transcript variants were cloned into pCR 2.1 -TOPO vectors for amplification in chemically competent E.coli (TOPO TA cloning kit, Invitrogen,
- 37 -
RECTIFIED SHEET (RULE 91.1) CA). Consensus sequences were determined from at least 5 separate colonies. For further validation by FISH fusion probes were used to confirm gene fusions in interphase and metaphase nuclei of KM-H2 and L428.
[00229] For detailed cytogenetic characterization of KM-H2 we used multicolour- FISH using 24Xcyte multi-color probes (MetaSystems, Germany) as previously described36 and locus-specific FISH using Fosmid probes available from Children's Hospital & Research Center of Oakland (CHRCO) for the gene loci of CUT A (WI2- 1388110, G248P83694E5) and BX648577 (WI2-2329H 16, G248P88223D8). Lentiviral transductions
[00230] RNA interference (RNAi) with the CIITA-BX648577 fusion transcript was performed using lentiviral transduction of a vector (pGIPZ-sh.FLJ27352, clone
V2LHS_212659, Thermo Scientific Open Biosystems, Huntsville, AL, USA) expressing a small hairpin RNA (shRNA:
TGCTGTTGACAGTGAGCGCGACAGCCACCTCACTATCAAATAGTGAAGCCACAGAT GTATTTGATAGTGAGGTGGCTGTCTTGCCTACTGCCTCGGA) that, after processing to mature siRNA, interferes with BX648577 exon 2 sequence as part of the CIITA- BX648577 fusion transcript. A vector with a non-interfering shRNA insert (non-silencing control) was used for comparison. In brief, the shRNAmir constructs were co-transfected along with the helper and packaging plasmids (pHDM-G, pHDM-Hgpm2, pHDM-tatl b, and pRC/CMV-rev1 b) into 293T cells by calcium phosphate-mediated transfection (CalPhos Mammalian Transfection kit (Clontech)). Supernatant was collected 48h and 72h after transfection and concentrated by ultracentrifugation for 2h at 25,000 rpm at 4C. The lentiviral particles were resuspended in IMDM and then used for transduction of KM- H2 cells. KM-H2 parental cells were transduced by adding 8 ug/ml polybrene, with both pGIPZ-sh.FLJ27352 and non-silencing control virus, and GFP-positive cells were sorted on a BD FACSAria cell sorter (BD Biosciences) 3 days after transduction and cultured using standard recommendations (http://www.dsmz.de/). Purity (GFP positivity) was greater 93% for all experiments. Efficiency of RNAi was evaluated by measuring residual expression of the fusion transcript by quantitative RT-PCR (see Table 1 for primer sequences). Samples were run in triplicate on a iQ5 real-time PCR instrument (BioRad) under standard conditions using SYBRGreen (ABI) for detection. Measurements were quantified using the AACT method (Pfaffl) and expressed relative to the expression in parental (wildtype) KM-H2 cells.
- 38 -
KECTIFIED SHEET (RULE 91.1) [00231] For forced expression of the C//L4-BX648577 gene fusion, we PCR- amplified the full-length cDNA from KM-H2 cells, and cloned it into the pGEM-T easy TA cloning vector (Promega, Madison, Wl). The fusion gene was then transferred into the pCAD-IRES-GFP lentiviral vector.29 An empty vector was used as a negative control. For lentivirus production, lentiviral vectors and helper plasmids were co-transfected into 293T cells. Supernatant was harvested, and the lentiviral particles were concentrated by ultracentrifugation (L7-65, Beckman, Brea, CA) at 25,000rpm, 2hours, 4C. The resultant concentrated lentiviral suspension was then used to transduce SUDHL4 target cells. 3 to 5 days after transduction we sorted GFP positive cells, which were used for subsequent experiments.
Western blotting and Immunfluorescence
[00232] Semiquantitative measurement of fusion protein expression was performed by semi-dry Western blotting using a mouse monoclonal anii-CIITA primary antibody ((7- 1 H, Santa Cruz Biotechnology, Santa Cruz, CA) directed against the N-terminus of CIITA, and a goat anti-mouse IgG-HRP secondary antibody (Santa Cruz). An anti^-actin goat polyclonal antibody (C-11 ) followed by a donkey anti-goat IgG-HRP (both Santa Cruz) served as a control. RNA extraction of cell cultures and gene expression profiling using Affymetrix GeneChip HG 133 2.0 plus arrays (Affymetrix Inc., U.S.A) was performed as previously described.37
[00233] KM-H2 cells and primary human B cells (CD20+) were attached to poly- lysine coated slides. To fix the cells we incubated them with 4% PFA for 10 minutes at room temperature and treated with 0.15% Triton X in PBS for 2 minutes at room temperature. After blocking, cells were incubated with an anti-C//7V\ antibody (clone 7-1 H, Santa Cruz Biotechnologies, Santa Cruz, CA) overnight at 4C. After washing, cells were incubated with Alexa Fluor 594 rabbit anti-mouse IgG (Invitrogen, Carlsbad, CA) for 45 minutes at 37C. After stringent washing, cells were counterstained with DAPI and covered. Slides were analyzed on a laser confocal microscope (LEICA SP5 AOBS, LEICA, Bannockburn, IL).
Fluorescence in situ hybridization (FISH) on tissue microarrays (TMA)
[00234] TMAs were constructed using archival, formalin-fixed, paraffin embedded diagnostic biopsy specimens and 0.6mm duplicate cores for DLBCL and PMBCL cases and 1.5mm cores for cHL, respectively. Optimal areas of the biopsies were chosen containing frequent large B or HRS cells, respectively. FISH was performed as previously
- 39 -
RECTIFIED SHEET (RULE 91.1) described38 using in-house BAC break-apart and fusion probes for the loci of CIITA and BX648577. For FICTION experiments (Fluorescence Immunophenotyping and Interphase Cytogenetics as a tool for the Investigation of Neoplasms) we used a primary monoclonal mouse CD30 antibodies (Ber-H2, Dako, ON, Canada) and Alexa Fluor 594, goat anti- mouse (IgG, Invitrogen, Molecular Probes, Canada), following a standard protocol as previously described.39 Commercially available Vysis LSI BCL6 Dual Color, Break Apart Rearrangement probes (Abbott Molecular, IL, USA) were used in selected samples. All cases were independently scored by CS and SBN. For DLBCL and PMBCL cases were recorded as rearranged for a certain locus if break-apart occurred in more than 5% of nuclei in three different high-power fields. All other signal constellations were regarded as negative. cHL cases were scored positive, if at least 10 cells with a signal split were detected in typically large cells distributed across the biopsy core. Unbalanced
rearrangements were recorded if unequal numbers of red or green signals were seen in the majority of nuclei.
Rapid amplification of cDNA ends (RACE) and quantitative RT-PCR
[00235] We used 3' RACE to identify aberrant transcript variants of CIITA in selected PMBCL samples. Total RNA was extracted from 8 PMBCL cases with fresh- frozen lymph node material available after mechanical homogenization using Allprep extraction kits (Qiagen Inc., ON, Canada). cDNA was prepared from 150ng to 1 ug of total RNA using the SMARTer RACE cDNA Amplification kit (Clontech Laboratories Inc., Mountain View, CA, USA) following the manufacturer's protocol. 3' RACE PCR amplification of the cDNA was performed using gene-specific primers for CIITA exon 1 and Universal Primer mix (UPM). Aberrant lengths products were gel-purified and sequenced directly or were cloned into pCR 2.1 -TOPO vectors (TOPO TA cloning kit, Invitrogen, CA) and fully sequenced. Chimaeric mRNAs were confirmed by RT-PCR of randomly primed cDNA of the respective cases using gene-specific primers.
[00236] Quantitative RT-PCT was performed to measure expression levels of CD274 and CD273 mRNA using an Applied Biosystems (ABI, Streetsville, Ontario, Canada) 7900HT realtime PCR system. Primers were designed for SYBR Green (ABI) detection of both wildtype and fusion transcripts for each gene (Table 1 ). RNA was extracted from cell line U2940 and 7 PMBCL lymph node samples (cell disaggregates) using Allprep extraction kits (Qiagen Inc., ON, Canada). PMBCL cases included one case with previously identified CIITA-CD274 fusion and 2 cases with CIITA-CD273 fusions. As
- 40 -
KECTIFIED SHEET (RULE 91.1) expression controls magnetically-enriched CD77+ cells were used (benign tonsillar cell disaggregates) (Miltenyi Biotec, Auburn, CA, USA) as previously described.40
Flow cytometric analysis and enzyme-linked immunosorbent assay (ELISA)
[00237] U2940, U2932 and SUDHL4 cell pellets were washed in 1x PBS with 1% FCS buffer and incubated with antibodies against CD69, CD2, CD274, CD273, and PD1 (all from BD Pharmingen, CA, USA). Jurkat T cells were stimulated with anti-CD3 and anti-CD28 antibodies (BD Pharmingen). Recombinant human PD1-Fc, CD274-Fc, CD273-Fc, CTLA4-Fc and control IgG (R&D systems) were used for specific inhibition of surface molecules. KM-H2 and SUDHL4 cells were incubated with PE-Cy5 conjugated anti human HLA-DR antibody (Beckman Coulter, Brea, CA), and analyzed on a BD FACSAria II instrument (BD Biosciences, San Jose, CA). IL-2 levels were measured using the Human IL-2 ELISA kit (R&D System, Inc. #D2050) according to the
manufacturer's instructions. Plates were read at 405 nm using an ELISA reader
(Molecular Devices).
Retroviral transduction
[00238] PD1 cDNA (Invitrogen) was subcloned into an pBMN-IRES-EGFP vector, which was modified from the original Moloney LTR vector pBMN-IRES-Lyt2 (kindly provided by G. Nolan lab, Stanford University) by replacing Lyt2 with EGFP.
[00239] Lipofectamine 2000 (Invitrogen, CA, USA) was used to transfect 293T producer cells with a plasmid mixture for gag and pol, a mutant ecotropic env, and each particular retrovirus. After two days, supernatant was passed through a 0.45-μΜ filter, mixed with Polybrene (8pg/ml) and used for centrifugal transduction of target cells expressing the ecotropic retroviral receptor. In some instances a second infection was performed, using fresh supernatant collected three days after transfection of producer cells.
[00240] U2932 cells were first transduced with a feline endogenous virus (FEV) expressing the ecotropic retroviral receptor. Ecotropic receptor-expressing cells were then transduced with a retrovirus expressing the bacterial tetracycline repressor (TETR) using blasiticidin as the selectable marker. Single cell clones were screened for TETR expression.
[00241] An inducible retroviral vector was used to drive expression of C//LA-CD274 or C//L4-CD273 fusions under the control of a CMV promoter containing TETR binding sites as described previously.30 A mixture of C//LA-CD274- or C//7A-CD273-containing
- 41 -
RECTIFIED SHEET (RULE 91.1) plasmid DNA, the mutant ecotropic envelope-expressing plasmid pHIT/EA6x3* and gag- pol expressing plasmid pHIT60 was used to transfect 293T cells using the Lipofectamine 2000 reagent (Invitrogen). Two days after transfection, retrovirus supernatants were collected to infect the engineered U2932 cells in the presence of 8 mg/ml polybrene (Sigma) in a single spin infection and puromycin was used to select for stable integrants over 6 days. Fusion gene expression was induced by doxycycline (20 ng/ml) for two days before flow cytometry analysis and Jurkat T cell co-culture experiments. For flow cytometric analysis of intracellular cleaved PARP and active caspase 3 in U2932, cells were fixed in PBS containing 2% paraformaldehyde, and then permeabilized and co- stained with anti-PARP (BD Pharmingen, clone F21-852) and anti-caspase-3 (BD
Pharmingen #51-68655X) antibodies diluted in FACS buffer containing 0.25% saponin (Sigma).
Statistical analysis
[00242] Group comparisons were performed using student t-tests and Chi-Square analysis. For time-to-event analyses we used disease-specific survival (DSS) as the primary endpoint. DSS was defined as the time from initial diagnosis to lymphoma- or treatment-related death. Time to event analyses using the Kaplan Meier method was performed using SPSS Software Version 1 1.0.0. Multivariate analysis was performed using a Cox regression model (forward stepwise) with the input variables, age, tumour stage, serum LDH concentration, WHO performance status, number of extranodal sites and presence of CIITA rearrangement.
Example 1 - Detection of Gene Fusions
[00243] Massively parallel, paired end sequencing of expressed transcripts (RNA- seq) provides an analytical platform suitable for genome-wide mapping of translocation breakpoints, sequence variants and quantitative expression.6,7 This sequencing technology was used to detect novel gene fusions in the two HL cell lines KM-H2 and L428, including 82.9 million paired end reads for KM-H2, of which 71.1 million mapped to the reference human genome (86%, 3.6 gigabases), and 61.5 million paired end reads for L428, of which 55.5 million (90%, 2.8 gigabases) mapped to the reference genome.
[00244] Figure 1 depicts cumulative distribution plots of the expression for both KM-H2 and L428 showing the proportion of genes expressed at increasing coverage levels.
- 42 -
RECTIFIED SHEET (RULE 91.1) [00246] Using whole transcriptome paired end sequencing (RNA-seq), 14 distinct fusion transcript predictions for KM-H2 and 5 for L428 were discovered. These predictions are shown in Table 2 and Table 3 below for KM-H2 and L428.
- 43 -
KECTIFIED SHEET (RULE 91.1)
Figure imgf000045_0001
CHR - chromosome STR - Strand
Table 3 - Fusion transcript predictions in L428
Figure imgf000046_0002
Figure imgf000046_0001
£9l000/Zl0ZV3/13d t90£H/ZT0Z OAV AGCGAGCAGCCCGCGCCGCCGCCTCGCAATCCGCCGCCATCCCGCCGCCCCCGTGCCCGACCGCCGCCCGACTG CCATCGCCCGGCCCGGCCGCGCCCGCGGAACCAGACCAGGT|ACTTGGAAAAATGGACAAGGATTGTGAAATGAAA CGCACCACACTGGACAGCCC I I I GGGGAAGCTGGAGCTGTCTGGTTGTGAGCAGGGTCTGCACGAAATAAAGCTCC TGGGCAAGGGGACGTCTGCAGCTGATGCCGTGGAGGTCCCAGCCCCCGCTGCGGTTCTCGGAGGTCCGGAG
26 AAAAATGGCTAATGCAAAGCAGCTAAGCTCAGATGCAGAGGCCCAGAAGCTGGGGAAGCCCTCTGCCCATGCCTCA
CAAAGCTTCTGTGAAAGTTCTAGTGGTGAGTGTGATTGTAGATTATTCTTGTCTCCACCTAAATTATAATCTGGAATGG
AAAGTTGGCGAGAACTGCATGCTT|ATATCATTGTGTCTGAGGGCCAGATATGATTATGAAGCTTTTTCCAAAGATCCA
GGGATGGGAATGGGAGTGGGTAGGAGGGGTAATGCGGTCATTGGAGTCGGGGGCTGGAACATTATGAGTGCTCAAT
AAATATAAACTAATGAGAAT
27 CATATAAAATATGCAACTCTTAGTTAAAGGCCTTATTATCAGTCTTACCTATACAAGTAGTAAATTTTGTCATTGCTTTAG
TTACAACCATCTGTAAATAACTTAAAAGACTTATTATGTGGGGTTCAAATTGAGTGGAATAAAGTATAGATTAAAAGTAT
A|GATCAAAAGGTTCAGTAACTTCCCTAAGATTATGAAACTGTGACCAGATCTAGCCCATCTTACTCCAGG I I I GATACT CTTTCCACAATACTGAGCTGCCTCAGAATCCTCAAAATCAGTTTTTATATTCCCCAAAAGAAGAAGGAAACCAAGGAGT
28 CGGGAGCTTCCGGGAGGGCGGCTCGCAGGCACCATGACTCCTGTGAGGATGCAGCACTCCCTGGCAGGTCAGACC
TATGCCGTGCCCTTCATCCAGCCAGACCTGCGGCGAGAGGAGGCCGTCCAGCAGATGGCGGATGCCCTGCAGTACC
TGCAGAAGGTCTCTGGAGACATCTTCAGCAG|CTTGTAGATGCCTGGATTGAGATGGGCAGCCGGCTGGATGCTCGT
CAGCTCATTCCTGCCCTGGTGAACTACAGCCAGGGTGGTGAGGTCCAGCAGGTGAGCCAGGCCATCCGCTACATGG
AGTTCTGCGTGAACGTGCTGGGGGAGACTGAGCAGGCCATCCACAACTACCTGCTGTCA
29 TGGGGGGTGCCCTAATACCTGACGACCATTCATTGATGGGCAGTCAGACCCCTCTCCCCAAGGTGGGTACAATAGAG
ACTCACCTTGGGCTTTCATTGATTGTGTGAGTTGGTCTCTGGTTTTTCTCAAAGTAGAGCACATAGGACCAGATGAIAG
TGCCTCAAAATTAGACCTTTTTTATTTTTTATTTTTGCTTTTCTATTAACTATATTCAACATCAACAGTGACATCAAAAAAT
CTTAATTTTATAATTACAGCTTCTGCGATGGGCATTATTAATCAATGGCTTGTTTTCATTTATCTTTTTAAATGTATATGT
AT
30 CACCTCGGCGGCGGCTGCCTCCTCCTCGTCCTCGTCTACCTCCACCTCCATGGCCGTGGCGGTGGCCTCGGGCTCC
GCGCCTCCCGGTGGCCCGGGGCCAGGCCGCACCCCCGCCCCGGTGCAGATGAACCTGTACGCCACCTGGGAGGT GGACCGGAGCTCGTCCAGCTGCGTGCCTAGGICGCCAGGAGCGACAGCGC I I I GCTGAGTACCAGGCGGAGCTGCA AGGCATCCAGCACAGGGTGCAGGCCCGGCCCTTCCTGTTCCAGCAGGCTATGCAGGCCAATGCCCGGCTCACCGTC ACTCGGCGCTTCTCCCAGGTGCTGTCAGCACTGGGGCTGGATGAGGAGCAGCT
31 CCCCTCCCGCTGCCCTCGGGCCGGGCTGGGTCGAGCTGCGATGCCCTCGGACTTCATCTCATTGCTCAGCGCGGAC
CTAGACCTGGAATCGCCCAAGTCCCTCTACTCGCGAGATTCTCTGAAGTTACACCCATCACAGAATTTTCATAGAGCT GGACTATTGG|AAGGACCCTTCAAAAAATGATACATGCAAAAGTTGCTGGGCATATTGGA I I I I ACCCATCATAGGCGC TGTTCTCTTAGG I I I CCTGTACCGCTACTACACATCGGAAAGCAAATCCTCCTGAGGAGGCCTTGCTGAAGTTAGAAA GTGCATCCAC I I I G G G G CG AAAACTAG AG ACTTG CTTG G G G G CT
32 CTGTCAGAGCCCCAAGGCAGCTCACAGTGTGCCACCATGGAGTTGGGGCCCCTAGAAGGTGGCTACCTGGAGCTTC
TTAACAGCGATGCTGACCCCCTGTGCCTCTACCACTTCTATGACCAGATGGACCTGGCTGGAGAAGAAGAGATTGAG
CTCTACTCAG|GATAAGAAAAGTACTTCACCTTCAAATTCAGACACAGAAATGAAATCTGAACAACTGCCTCCTTGTGT
GAACCCTGGCAATCCTGTGTTTTCATGTATGTTGGATCCAAAGACACTCCAGACAGCCACCTCACTATCAAAACCTCA
AATG
33 AACGATTTGGAAATTGGCTGAAAGATGCACGTGACTGGACAATTTCCAGAAACAGATACTGGGGCACCCCCATCCCA
CTGTGGGTCAGCGATGACTTTGAGG|AGAAATTGGCTGGTGGAAAAAAATCAAACATGAAGATTGCAGTTTTG 1 1 1 I GT TTTTTTCTGCTTATCATTTTTCAAACTGACTTTGGAAAAAATGAAGAAATTCCTAGGAAGCAAAGGAGGAAGATCTACC ACAGAAGGTTGAGGAAAAGTTCAACCTCACACAAG
34 CCGGGAGGGCGGCTCGCAGGCACCATGACTCCTGTGAGGATGCAGCACTCCCTGGCAGGTCAGACCTATGCCGTG
CCCTTCATCCAGCCAGACCTGCGGCGAGAGGAGGCCGTCCAGCAGATGGCGGATGCCCTGCAGTACCTGCAGAAG
GTCTCTGGAGACATCTTCAGCAGGTGG|ATGTGGACCTGGCCAAGCAGTGTGCAGACCTGCCTGAGGAGGATGAGGA
ATTGCGCAAGAAGCTGTGGCTGAAGATCGCACGGCACGTGGTGCAGGAAGAGGAAGATGTACAGACAGCCATGGCT
TGCCTGGCTAGCTGCCCCTTGCTCAAGATTGAGGATGTGCT
35 GGGAGTGGAAGGAACAGATGGTGTCAAAAAGAGAAAAAGGAAACCATACAGACCAGGTATTGGTGGATTTATGGTGC
GGCAAAGAAGTCGAACTGGGCAAGGGAAAACCAAAAGATCTGTGATCAGAAAAGATTCCTCAGGCTCTA 1 1 1 CCGAG CAGTTACCTTGCAGAGATGATG|AGAATGTTGGACCGACGACACAAGACCTCAGACTTGTGTTATTCTAGCAGCTGAA CACACCCCAGGCTCTTCTGCCCGGCAGTGGCTCTGGAAGCAGTCTGGTGTATAGAGTTATGGATTCACTACCAGATT CTACTGTATGCTCTTGACAACTATGACCACAATGGTCCA
36 TCCAGATCGCATCCCAGGCGCGCGATGCCCGGGCCCGCGAGCGCGAGGCTGGCAGGCCAGGGGTCCTGCAGGCG
CCCCCCGGCTCCCCGCGGCCTCTGGACCGGCCCGAGGGCCTGCGCGAGAAGAACTCGGTCATCCGCTCGCTCAAG
CGGCCGCCCCCCGCGGATGCCCCCACGGTGCGGGCCACACGCGCCTC|CGCCCAGCACATCTGCTCCTCCACCTG
CACCTGACTCCCTGGCCCTCGTGAAGCCACTCCCATACTCCTAGACAGGGCTGCTGCGCCCTCCACTTCTGGGCTCC
TGACCAGCTCTGGTATGTCAGTTTCTGCATTCATTCCTGTCTCTATTAGTTATAAGGCAAGTTCTGTGGGATGGGAACT
ACATC
37 GGTATAGACACGTGTGGCCGTTTACGCTGTAGGATCCTCATTCCCACTGGCTTTGAACATTTTGGGGACTTACAATGC
CGCCACCCGCGGACATCGTCAAGGTGGCCATAGAATGGCCGGGCGCCTACCCCAAACTCATGGAAATTGATCIAGGC TAGATCGTAAAAGATGTTGCTG 1 1 1 CTACCCTGCTCTCTTGGATCGCTTGCTCTGGAGGGAAGCTGGTCACCATGTTG TGAGGACACCTAAGCAGGCTGTGGAAAGGACCGCATGGAGAGCTGAGCCTTCCTGCCAACAACCAGC
38 CTTTTTCTGTCATTCCTCATTAGGTATAGACACGTGTGGCCGTTTACGCTGTAGGATCCTCATTCCCACTGGCTTTGAA
CATTTTGGGGACTTACAATGCCGCCACCCGCGGACATCGTCAAGGTGGCCATAGAATGGCCGGGCGCCTACCCCAA ACTCATGGAAATTGAT|CAGACCATTAGAATGTGACCTCTGTGAAGACAACAGAAATGGAGGAGGCGATCCATGGGCA TCTTCTGAAGCTGTTTTGGTTAACTTTGATTTGGAAGTCCTGGTTCCAGGTTCTCCTGTTTCCTGGGACCAGCTCCAGA
Figure imgf000049_0001
O
CD
CD
<
I- o
<
I- 00
< "3- o
CD
I—
CD
CD
O
I- I- o
**■ <3- **·
[00247] Figures 2a and 2b illustrate the fusion prediction with the highest read support involving MHC class II transactivator CIITA and an uncharacterized gene
BX648577 (FL727352/hypothetical LOC145788) found in KM-H2. Example 2 - Analysis of Gene Fusions
[00248] Three fusion predictions were validated by direct sequencing and fluorescence-in-situ hybridization (FISH)
[00249] Figure 3 depicts the first of these fusions, involving the genes BAT2L1 (chromosome 9q34.13) and MGMT (chromosome 10q26.3) in KM-H2. Figure 3, panel a depicts co-localization of the BAT2L1 (RP1 1-643E14) and MGMT (RP1 1-1063D3) gene loci (arrow). Figure 3, panel b shows direct sequencing and breakpoint sequence of a BAT2L1 -MGMT fusion transcript as predicted by RNA-seq.
[00250] Figure 4 depicts alignment of BAC probes for BAT2L1-MGMT fusion and break-apart assays.
[00251] Figure 5 depicts the second fusion involving the genes SLC03A1
(chromosome 15q26.1 ) and ELM01 (chromosome 7p14.1 -14.2) in L428. Panel a shows co-localization of the SLC03A1 (RP1 1-79A7) and ELM01 (RP1 1-12H6) gene loci (arrow). Panel b shows direct sequencing and breakpoint sequence of an ELM01- SLC03A1 fusion transcript as predicted by RNAseq.
[00252] Figure 6 depicts alignment of BAC probes for ELM01 -SLC03A1 fusion and break-apart assays.
[00253] Figure 7 shows detection of the C//7A-BX648577 gene fusion. The figure depicts validation of complex chromosome 16 rearrangements in KM-H2 leading to expression of CIITA-BX648577 fusion transcripts. Arrows indicate co-localization of the gene loci of CIITA and BX648577 in interphase (Figure 7, panels a, b) and metaphase (Figure 7, panels c, d) cells.
[00254] Figure 8 depicts alignment of BAC and Fosmid probes for CIITA- BX648577 fusion and break-apart assays.
[00255] In all three cases the breakpoint sequences were confirmed as predicted. While all of the identified gene fusions are likely to contribute to the specific phenotype of the affected cells, we focused on the CIITA - BX648577 fusion transcripts given the known involvement of CIITA in B cell immune function and the high read-support. The CIITA gene was initially studied in patients with bare lymphocyte syndrome, a rare autosomal recessive disease, in which CIITA mutations lead to loss of MHC class II expression and clinical manifestations due to an immunodeficiency phenotype.8 CIITA
49
RECTIFIED SHEET (RULE 91.1) was found to be the essential transactivator of MHC class II expression functioning in a complex of transcription factors (RFX, NFY, X2BP) that bind to class II MHC
promoters.9, 10
[00256] Figure 9 depicts molecular characterization of the gene fusion CIITA- BX648577. Using PCR, the genomic breakpoint coordinates were mapped to
chrl 5:53,489,063 and chrl 6: 10,900,305 (NCBI Build 36.1 ) falling within CIITA exon 5 and BX648577 intron 1 (Figure 9, panels a and b). Two major transcripts of this gene fusion were identified. Sequences of the first alternative transcript aligned to exons 1 -4 of CIITA (chromosome 16) and exon 2 of BX648577 (chromosome 15), while the second alternative transcript contained an additional sequence of 62bp aligning to BX648577 intron 1 , which has not been previously annotated as expressed (Figure 9, panels c and d). Gene expression analysis demonstrated that BX648577 was highly overexpressed in KM-H2 compared to other HL cell lines (35.0 fold) and microdissected germinal center B cells (138.3 fold) (Figure 9, panels e and f). The longer isoform has an open reading frame consistent with a predicted 255 amino acid protein containing the N-terminal MHC class II transactivator domains 1-4, an amino acid sequence originating from the novel BX648577 exon, and the C-terminus of the hypothetical BX648577 protein shown in Figure 9, panel d. Example 3 - Analysis of cellular localization of the gene fusion protein
[00257] We next performed immunofluorescence to investigate the cellular localization of the fusion protein and found a strong perinuclear cytoplasmic staining pattern in KM-H2 compared to primary peripheral blood B cells in which we observed a predominantly nuclear localization of wildtype CIITA.
[00258] Figure 10 depicts the staining. This staining pattern is in agreement with loss of a C-terminal nuclear localization sequence (NLS)1 1 of CIITA in the chimaeric protein. Figure 10, panel a depicts confocal microscopy images showing a perinuclear staining pattern of the fusion protein in KM-H2 cells. Figure 10, panel b shows that the staining pattern in primary B cells is predominantly nuclear. Lower panels show slice views from the side which were derived from Z stack image series.
[00259] Figure 11 depicts the results of high-resolution SNP analysis indicating that the rearrangement involving chromosomes 15 and 16 was associated with relative genomic imbalances at the breakpoints. High-resolution single nucleotide polymorphism analysis and FISH confirm chromosomal unbalances accompanying complex
rearrangements involving chromosomes 15 and 16 in KM-H2. Results of high-resolution
50
RECTIFIED SHEET (RULE 91.1) genotyping arrays and FISH using CIITA (RP1 1 -109M19, RP11 -66H6) and BX648577 (RP11 -139H15, RP1 1-161 E4) break-apart probes are shown. Copy number changes are colorcoded according to five discrete copy number states: green=loss; blue=neutral; dark red=gain; medium red=amplification; bright red=high level amplification. Predicted breakpoints in CIITA and BX648577 by RNA-seq are indicated by the hatched lines. Figure 11 (upper panel) depicts the relative amplification of chromosomal material telomeric of the BX648577 breakpoint in KM-H2 is confirmed by FISH (4 fused + 1 red signal). Figure 11 (lower panel) depicts relative amplification of chromosomal material centromeric of the CIITA breakpoint in KM-H2 is confirmed by FISH (2 fused + 2 green + 3 red signals). L428 is shown as reference.
[00260] Figure 12 depicts the results of multicolor-FISH in representative metaphases of KM-H2 and interphase-FISH showing complex chromosomal
rearrangements with various marker chromosomes and subclonal variation as shown by others for this cell Iine12. Figure 12, panel a shows 24-colour FISH of a representative KM-H2 metaphase matching the same metaphase of Figure 12, panel b, which is stained with locus-specific FISH probes for the CIITA (WI2-1388110) and BX648577 (WI2- 2329H16) gene loci (Fosmid probes). The Banding pattern is shown in inverted DAPI. The four derivative chromosomes with involvement of the CIITA and BX648577 loci are shown in higher magnification (Panels 1-4). Locus-specific FISH using Fosmid probes for CIITA and BX648577 confirmed co-localization of the CIITA and BX648577 gene loci on two derivative chromosomes 16, both harbouring insertions of chromosome 15 material. These complex rearrangements are likely to place the fusion gene in a different positional context that might add to the high promotor activity of CIITA driving expression of the fusion transcripts in this cell line. As part of complex rearrangements between
chromosomes 15 and 16, chromosomal material telomeric of the CIITA breakpoint is fused with chromosomal material telomeric of the BX648577 breakpoint on two derivative chromosomes 16 (1 +2). Note that the derivative chromosome der(?)(15;9;16;9;15) (3) does not harbour C//L4-BX648577 gene fusions as FISH showed no break-apart signals for the CIITA and BX648577 gene loci on this derivative chromosome (data not shown).
[00261] To investigate the functional consequence of the C//7 \-BX648577 gene fusion in KM-H2 cells we generated stable KM-H2 fusion transcript knockdowns by RNA interference.
[00262] KM-H2 cells were stably transduced by either an shRNAmir (clone H5), or a non-silencing control were examined for imRNA and protein expression of the
CIITA/BX648577 fusion.
51
RECTIFIED SHEET (RULE 91.1) [00263] Figure 13 depicts the results of quantitative RT-PCR (Figure 13, panel a) showing reduction of fusion transcript levels by 85%, and Western blotting (Figure 13, panel b) demonstrating a marked reduction in C//L4-BX648577 fusion protein compared to non-silencing controls. As CIITA is an essential transactivator of MHC class II expression9 and deletion mutants have been described that inhibit wild type CIITA function in vitro13,14, we studied transcriptional changes of shRNA-transduced cells using gene expression microarrays (Table 5).
Table 5 - Differentially expressed genes between KMH2 CIITA-FLJ27352
knockdown cultures and non-silencing controls
Figure imgf000053_0001
52
RECTIFIED SHEET (RULE 91.1) 202403_s_at AA788711 56.38 53.28 54.68 37.27 32.9 35.14 -1.56 -1.35
243309_at AA398658 879.78 947.45 914.53 620.59 590.34 605.96 -1.51 -1.35
223839_s_at AF132203 172.71 151.81 162.92 95.43 103.98 98.97 -1.65 -1.34
203685_at NM_000633 122.4 148.7 135.97 81.1 85.9 83.49 -1.63 -1.34
226959 at AL137430 97.41 97.5 97.45 64.61 52.57 58.74 -1.66 -1.33
201626_at BG292233 958.63 835.33 898.32 597.01 580.89 589.06 -1.53 -1.33
203592_s_at NM_005860 102.11 170.94 136.29 62.61 58.03 60.12 -2.27 -1.31
31837_at U62317 64.98 61.66 63.71 42.19 30.08 36.34 -1.75 -1.31
201951_at BF242905 238.11 224.71 231.28 166.2 149.72 158.1 -1.46 -1.31
207963_at NM_014354 43.24 50.26 46.36 29.03 13.81 21.32 -2.17 -1.3
234675_x_at AK027219 90.28 88.6 89.54 62.17 52.68 57.28 -1.56 -1.3
228468_at BF108964 82.02 85.22 83.41 55.64 58.26 56.65 -1.47 -1.3
228171_s_at AI056683 85.16 87.25 86.18 62.41 58.91 60.64 -1.42 -1.29
203020_at NM_014857 56.68 51.73 53.79 34.89 30.36 32.53 -1.65 -1.28
205089__at NM_003416 88.73 81.57 84.82 56.57 55.95 56.22 -1.51 -1.28
201296_s_at NM_015626 336.23 328.19 332.87 248.65 220.39 234.51 -1.42 -1.28
202048_s_at NM_014292 212.98 216.81 214.73 154.68 156.21 155.56 -1.38 -1.28
217814_at NM_020198 270.49 271.1 270.76 198.12 192.21 195.58 -1.38 -1.28
1556385_at BQ028191 80.13 60.76 70.37 44.76 36.02 40.34 -1.74 -1.27
212500_at AL049319 78.17 84.87 80.68 50.11 56.23 52.77 -1.53 -1.27
215716_s_at L14561 96.9 91.94 94.59 67.28 56.96 62.25 -1.52 -1.27
231992_x_at AK024371 72.13 67.25 69.7 42.62 49.43 46.14 -1.51 -1.27
208072_s_at NM_003648 91 86.69 88.6 62.14 57.95 59.87 -1.48 -1.27
53
RECTIFIED SHEET (RULE 91.1) 2 8381_s_at NM_007279 296.35 274.84 285.86 205.6 210.21 208.13 -1.37 -1.27
217678_at AA488687 44.06 63.24 53.52 26.91 30.65 28.47 -1.88 -1.26
241380_at BF508325 52.42 41.75 47.14 28.19 30.41 29.01 -1.63 -1.26
1569522_at BCO 15443 100.94 91.27 96.24 68.24 50.96 59.69 -1.61 -1.26
214149_s_at AI252582 92.85 100.65 97.25 68.84 63.02 65.88 -1.48 -1.26
219805_at NM_022101 47.14 47.23 47.19 34.22 29.7 32.1 -1.47 -1.26
224847_at AW051349 115.92 112.74 114.31 81.63 82.1 81.81 -1.4 -1.26
227728_at AA886888 134.77 133.79 134.32 95.41 101.41 98.14 -1.37 -1.26
200832_s_at AB032261 1048.81 1085.85 1067.28 814.68 814.75 814.73 -1.31 -1.26
215623_x_at AK002200 98.42 69.52 84.1 49.34 42.83 46.46 -1.81 -1.25
213275_x_at W47179 70.02 57.73 63.46 39.93 41.42 40.61 -1.56 -1.25
224791 _at AW513835 105.27 100.42 103.25 73.08 74.83 74.1 -1.39 -1.25
205890_s_at NM_006398 231.7 231.51 231.63 173.47 176.07 174.78 -1.33 -1.25
206147_x_at NM_006089 54.63 65.44 60 41.9 30.46 36.1 -1.66 -1.24
201887_at NM_001560 146.12 171.33 158.78 106.63 107.18 106.86 -1.49 -1.24
226254_s_at AI912523 274.08 296.35 285.95 204.37 199.07 202.05 -1.42 -1.24
212373_at AW139179 81.47 85.41 83.49 56.97 61.67 59.18 -1.41 -1.24
211452_x_at AF130054 152.1 148.19 150.23 107.96 112.5 110.04 -1.37 -1.24
229419_at BF222826 178.45 171.3 174.74 131.99 125.93 129.11 -1.35 -1.24
212930_at AW576457 33.25 33.29 33.27 22.64 20.35 21.46 -1.55 -1.23
213813_x_at AI345238 44.21 47.49 45.86 32.58 26.63 29.76 -1.54 -1.23
201373_at NM_000445 56.21 51.07 53.6 33.62 40.16 36.86 -1.45 -1.23
212561_at AA349595 192.87 202.88 198.77 144.41 133.19 137.71 -1.44 -1.23
54
RECTIFIED SHEET (RULE 91.1) 203845_at AV727449 52.01 56.3 53.66 39.26 35.01 37.46 -1.43 -1.23
204407_at AF080255 98.09 88.79 93.39 67.39 64.72 66.24 -1.41 -1.23
213497_at AL050374 89.14 92.26 90.74 67 60.75 64.22 -1.41 -1.23
203966_s_at NM_021003 235.8 228.63 231.64 177.92 160.15 169.21 -1.37 -1.23
213225_at AJ271832 135.99 132.1 134.12 98.29 100.57 99.45 -1.35 -1.23
227068_at AA069778 699.44 702.47 701.4 553.24 536.48 545.17 -1.29 -1.23
209229_s_at BC002799 76.7 86 81.26 55.37 42.76 49.13 -1.65 -1.22
213951_s_at BE964655 64.92 68.86 66.42 48.05 34.7 41.32 -1.61 -1.22
1569190_at BC014677 81.64 80.18 80.73 58.9 47.14 53.47 -1.51 -1.22
65086_at Z78349 49.41 41.72 45.77 30.57 30.57 30.57 -1.5 -1.22
230098_at AW612407 66.46 70.79 68.27 49.33 45.25 47.19 -1.45 -1.22
225445_at AI332346 61.52 66.94 63.99 47.21 42.01 44.42 -1.44 -1.22
202260_s_at NM_003165 117.97 117.83 117.92 89.65 77.64 84.1 -1.4 -1.22
203395_s_at NM_005524 87.55 87.07 87.29 64.88 66.41 65.32 -1.34 -1.22
213168_at AU145005 292.23 282.02 286.77 216.83 212.8 214.74 -1.34 -1.22
214599_at NM_005547 14.58 21.04 17.55 7.66 8.86 8.06 -2.18 -1.21
201928_at AA194254 112.79 113.83 113.27 82.67 72.46 77.5 -1.46 -1.21
225569_at AI813489 63.23 71.41 67.94 47.92 45.24 46.97 -1.45 -1.21
213017_at AL534702 153.13 139.71 146.25 110.22 103.35 106.39 -1.37 -1.21
207663_x_at NM_001473 471.99 458.17 466.15 361.94 365.07 363.19 -1.28 -1.21
215127 s at AL517946 397.07 386.49 391.98 312.49 302.04 307.64 -1.27 -1.21
204970_s_at NM_002359 111.68 125.73 118.28 72.61 88.86 80.82 -1.46 -1.2
204003_s_at NM_007342 63.32 62.81 63.07 44.15 46.07 45.32 -1.39 -1.2
55
RECTIFIED SHEET (RULE 91.1) 1569973_at BC015774 76.8 81.96 78.99 59.57 55.23 57.69 -1.37 -1.2
224984_at W61007 129.53 126.37 128.1 94.2 99.23 96.61 -1.33 -1.2
217788_s_at NM_004481 248.53 243.38 246.39 308.31 314.91 312.41 1.27 1.2
202564_x_at NM_001667 131.55 132.32 132.01 169.44 173.66 171.9 1.3 1.2
203708_at NM_002600 126.08 127.26 126.58 171.38 163.16 167.49 1.32 1.2
208692_at U 14990 1145.96 1245.69 1195.37 1570.41 1580.59 1574.63 1.32 1.2
217140_s_at AJ002428 129.94 122.98 126.57 169.08 165.64 167.25 1.32 1.2
229113_s_at W16779 107.72 109.12 108.48 143.45 142.2 142.93 1.32 1.2
200011_s_at NM_001659 139.9 142.39 140.92 187.05 189.11 187.98 1.33 1.2
210982_s_at M60333 322.76 323.94 323.3 422.97 437.19 430.13 1.33 1.2
214473_x_at NM_005395 90.72 86.37 88.72 113.86 120.66 117.64 1.33 1.2
226400_at N92917 220.44 223.26 221.84 284.2 307.35 296.03 1.33 1.2
209344_at BC002827 43.08 41.25 42.04 57.45 58.34 57.93 1.38 1.2
210178_x_at AF047448 121.5 105.7 1 4.24 159.54 156.81 158.1 1.38 1.2
205967_at NM_003542 230.89 226.03 228.19 294.69 343.83 318.71 1.4 1.2
2029 5_s_at BF1 5776 64.73 63.81 64.29 84.14 97.31 90.43 1.41 1.2
219336_s_at NM_015947 47.62 55.23 52.35 71.62 75.49 73.95 1.41 1.2
223591 _at BC005084 46.93 44.38 45.64 64.72 66.59 65.58 1.44 1.2
223917_s_at BC000085 69.2 58.43 63.39 87.69 94.34 91.1 1.44 1.2
218206_x_at NM_016558 38.36 45.95 42.12 58.85 63.05 61.44 1.46 1.2
226436_at N49935 150.92 120.87 136.01 195.68 200.78 197.94 1.46 1.2
234947_s_at AK026630 31.62 31.79 31.69 42.87 51.18 46.87 1.48 1.2
225320_at AA579630 143.65 139.16 141.49 176.56 184.6 180.42 1.28 1.21
56
RECTIFIED SHEET (RULE 91.1) 224932_at AI814909 471.53 476.2 474 598.58 631.4 614.19 1.3 1.21
212305_s_at AK025122 90.39 86.49 88.52 117.7 116.65 117.2 1.32 1.21
215952_s_at AF090094 952.5 964.19 958.43 1315.2 1224.1 1268.46 1.32 1.21
37966_at AA187563 57.97 56.65 57.24 74.77 77.62 76.29 1.33 1.21
218118_s_at NM_006327 55.61 54.67 55.27 74.05 74.17 74.11 1.34 1.21
224981 _at AL520900 75.69 77.95 76.76 101.77 103.2 102.6 1.34 1.21
226319_s_at AF047002 167.7 162.75 165.43 229.91 212.28 221.03 1.34 1.21
219971_at NM_021798 210.76 188.04 199.5 264.82 273.68 269.21 1.35 1.21
202513_s_at NM_006245 63.29 59.07 60.96 82.45 83.46 82.97 1.36 1.21
226467_at AK022750 41.35 44.32 42.9 57.24 59.5 58.5 1.36 1.21
201316_at AL523904 52.28 51.52 51.8 68.7 73.2 70.83 1.37 1.21
203460_s_at NM_007318 62.69 60.52 61.69 83.02 90.36 86.56 1.4 1.21
204331 _s_at NM_021107 151.39 139.24 144.46 212.38 193.5 202.4 1.4 1.21
202658_at NM_003846 43.3 45.87 44.33 62.32 62.25 62.29 1.41 1.21
203388_at NM_004313 53.12 48.15 51.13 73.65 70.18 72.18 1.41 1.21
225003_at BF343862 41.42 40.04 40.8 56.07 59.86 57.78 1.42 1.21
228899_at AI870903 68.61 80.16 74.09 107 102.75 104.97 1.42 1.21
202387_at NM_004323 99.67 86.26 93.98 128.73 138.27 134.1 1.43 1.21
1555193_a_at BC020626 36.01 38.62 37.34 51.47 55.39 53.34 1.43 1.21
201233_at NM_002817 62.86 56.07 59.81 85.58 86.18 85.82 1.44 1.21
204610_s_at NM_006848 82 72.97 78.06 106.64 120.62 113.98 1.46 1.21
206919_at NM_021795 36.93 33.36 35.14 49.03 54.31 51.57 1.47 1.21
32032_at L77566 43.5 38.27 40.47 57.72 61.56 59.91 1.48 1.21
57
RECTIFIED SHEET (RULE 91.1) 227864_s_at AI091713 70.17 61.72 65.79 104.51 90.54 97.49 1.48 1.21
204044_at NM_014298 24.33 25.13 24.73 37.89 36.05 36.92 1.49 1.21
201940_at AA897514 43.7 50.65 47.95 66.42 78.59 72.68 1.52 1.21
211530_x_at M90686 36.94 53.98 45.35 72.79 73.44 73.05 1.61 1.21
208447_s_at NM_002764 66.16 46.77 56.28 98.14 86.46 92.23 1.64 1.21
210664_s_at AF021834 27.45 40.87 34.28 56.29 58.93 57.63 1.68 1.21
215193_x_at AJ297586 701.38 700 700.78 914.14 911.65 912.89 1.3 1.22
223040_at BC005181 168.93 165.83 167.43 216.65 222.61 219.24 1.31 1.22
200975_at NM_000310 449.51 421.99 435.65 585.54 564.65 573.81 1.32 1.22
225161_at AI659020 167.47 160.28 163.88 219.61 211.15 215.62 1.32 1.22
203650_at NM_006404 44.84 45.29 45.05 59.53 60.59 60 1.33 1.22
200746_s_at NM_002074 350.35 324.98 340.82 467.2 454.62 460.63 1.35 1.22
217979_at NM_014399 159.22 178.93 169.06 224.46 232.67 228.52 1.35 1.22
207809_s_at NM_001183 127.11 129.23 128.17 195.63 170.23 182.21 1.42 1.22
37226_at U15172 36.94 42.85 40.38 59.24 57.18 58.26 1.44 1.22
200751 _s_at BE898861 142.39 119.3 130.17 183.34 196.69 189.32 1.45 1.22
211475_s_at AF116273 196.4 159.97 177.77 262.42 253.12 257.15 1.45 1.22
201875_s_at NM_024569 66.41 71.85 69.24 93.79 108.44 100.88 1.46 1.22
225954_s_at AL512725 55.89 42.13 48.74 75.1 77.39 76.02 1.56 1.22
200712_s_at AI633566 42.27 60.92 52.14 82.67 85.27 83.77 1.61 1.22
211998_at AW138159 53.42 37.46 46.04 85.22 72.92 79.09 1.72 1.22
202552_s_at NM_016441 66.92 65.41 66.05 90.57 85.27 88.06 1.33 1.23
215719_x_at X83493 129.07 125.34 127.14 171.22 170.58 170.8 1.34 1.23
58
RECTIFIED SHEET (RULE 91.1) 200607__s_at BG289967 208.78 205.92 207.48 278.94 282.63 280.74 1.35 1.23
204670_x_at NM_002125 819.73 911.79 865.93 1170.24 1188.96 1177.36 1.36 1.23
202246_s_at NM_000075 374.04 330.3 351.63 481.16 484.82 483.15 1.37 1.23
206332_s_at NM_005531 411.54 463.93 438.89 631.51 584.38 608.61 1.39 1.23
202637_s_at AI608725 319.79 350.47 335.6 490.37 449.98 470.31 1.4 1.23
221090_s_at NM_018233 63 62.18 62.62 84 92.28 88.03 1.41 1.23
210978_s_at BC002616 205.28 238.19 222.19 319.42 311.4 315.78 1.42 1.23
218105_s_at NM_0 5956 59.87 58.46 59.17 83.8 84.03 83.9 1.42 1.23
201523_x_at BE262760 95.53 89.12 91.96 38.68 125.72 131.56 1.43 1.23
218229_s_at NM_017542 73.04 68.24 70.59 97.83 102.85 100.7 1.43 1.23
216252_x_at Z70519 90 105.01 96.56 143.22 137.56 140.13 1.45 1.23
218119_at NM_006327 42.02 43.14 42.68 61.57 63.18 62.53 1.46 1.23
208629_s_at BG472176 69.95 69.96 69.96 95.66 112.16 103.38 1.48 1.23
212432_at AL542571 68.35 66.75 67.71 109.21 96.61 102.14 1.51 1.23
209270_at L25541 29.29 29.76 29.51 42.17 47.71 44.84 1.52 1.23
208750_s_at AA580004 50.76 40.25 46.03 70.08 75.22 72.42 1.57 1.23
209222_s_at BC000296 46.71 46.8 46.75 63.74 62.79 63.21 1.35 1.24
202424_at NM_030662 206.91 195.11 201.33 275.51 275.95 275.71 1.37 1.24
221267_s__at NM_031213 122.88 111.27 117.24 160.73 166.23 163.52 1.39 1.24
238010_at BF970340 47.45 43.73 45.8 65.43 64.35 64.77 1.41 1.24
221770_at BE964473 46.58 40.26 43.38 63.28 63.77 63.48 1.46 1.24
1555812_a_at AF498927 58.41 52.74 55.83 83.52 79.22 81.48 1.46 1.24
202706_s_at D86227 35.17 42.81 39.31 57.37 60.48 59.01 1.5 1.24
59
RECTIFIED SHEET (RULE 211012_s_at BC000080 31.72 36.63 34.11 52.35 51.7 51.96 1.52 1.24
201571_s_at AI656493 164.35 160.79 162.74 217.09 217.9 217.58 1.34 1.25
202284_s_at NM_000389 135.58 139.34 137.26 179.85 189.17 184.41 1.34 1.25
220230_s_at NM_016229 380.91 363.71 371.08 500.81 493.82 496.53 1.34 1.25
224903_at AL519818 471.22 508.74 491.37 679.42 652.69 666.18 1.36 1.25
201720_s_at Al 589086 181.36 171.43 176.05 239.58 242.25 240.91 1.37 1.25
209893_s_at M58596 76.61 73.92 75.5 101.97 105.42 103.66 1.37 1.25
228204_at AA630330 219.05 239.59 228.47 309.52 317.28 313.76 1.37 1.25
209995_s_at BC003574 231.22 235.22 233.36 310.29 334.46 321.55 1.38 1.25
202361 _at NM_004922 86.31 83.69 84.85 119.06 117.22 117.93 1.39 1.25
210222_s_at BC000314 85.75 96.77 91.05 130.05 127.26 128.33 1.41 1.25
223666_at BC002724 101.21 98.72 99.94 147.48 136.17 141.14 1.41 1.25
205621 _at NM_006020 48.63 54.44 51.44 72.54 74.6 73.59 1.43 1.25
223709_s_at AY009400 73.47 68.37 70.73 107.26 100.44 103.63 1.47 1.25
226911_at BF114725 47.95 54.17 50.64 72.98 76.3 74.52 1.47 1.25
233878_s_at BE536170 54.39 50.28 52.18 81.14 72.62 76.96 1.47 1.25
228867_at BE541548 50.93 51.52 51.23 70.41 80.93 75.97 1.48 1.25
224410_s_at AF348513 40.57 43.96 42.33 60.68 71.63 66.18 1.56 1.25
206929_s_at NM_005597 43.94 27.34 35.65 65.02 63.79 64.49 1.81 1.25
39318_at X82240 447.84 443.23 445.24 575.29 602.95 589.14 1.32 1.26
202736_s_at AA112507 128.58 124.02 126.35 171.33 172.65 171.98 1.36 1.26
224573_at BE744389 402.13 428.76 413.96 563.67 576.95 569.8 1.38 1.26
201168_x_at NM_004309 139.23 144.91 141.86 193.05 206.91 199.43 1.41 1.26
60
RECTIFIED SHEET (RULE 91.1) 215714_s_at AF254822 102.47 104.38 103.34 148.56 144.92 146.8 1.42 1.26
222425_s_at AW151250 49.36 49.65 49.5 75.84 71.44 73.84 1.49 1.26
204118_at NM_00 778 148.59 79.66 163.93 252.39 246.45 248.73 1.52 1.26
218220_at NM_021640 48.57 49.86 49.3 77.96 71.31 74.96 1.52 1.26
1557910_at BG612458 324.59 266.13 294.98 422.55 491.61 457.06 1.55 1.26
202357_s_at NM_00 710 71.24 79.75 75.33 131.85 106.64 119.23 1.58 1.26
201234_at NM_004517 235.39 241.25 238.24 325.34 320.26 322.97 1.36 1.27
208887_at BC000733 274.46 259.61 266.03 373.14 367.53 370.26 1.39 1.27
213175_s_at AL049650 615.89 576.14 593.49 819.34 841.62 827.71 1.39 1.27
208687_x_at AF352832 1067.69 973.61 1017.35 1378.72 1473.68 1427.39 1.4 1.27
217806_s_at NM_0 5584 88.34 90.08 89.04 129.45 122.27 125.72 1.41 1.27
221270_s_at NM_031209 86.75 87.62 87.28 127.26 121.57 124.81 1.43 1.27
200927_s_at AA919115 143.86 129.7 136.95 204.87 188.58 196.55 1.44 1.27
201562_s_at NM_003104 41.01 41.22 41.09 57.74 62.51 59.71 1.45 1.27
223012_at AF272894 80.45 82.56 81.41 15.21 119.99 117.97 1.45 1.27
200841 __s_at AI142677 112.4 100.24 106.17 148.53 163.42 155.87 1.47 1.27
204116_at NM_000206 103.72 122.95 113.87 176.84 164.34 170.22 1.49 1.27
219978_s_at NM_018454 119.92 102.22 110.86 159.04 183.09 171.11 1.54 1.27
202094_at AA648913 42.97 34.3 38.87 61.59 63.04 62.24 1.6 1.27
209953_s_at U63131 109.58 82.69 96.19 155.4 152.28 154.16 1.6 1.27
213887_s_at AI554759 58.81 48.19 53.37 87.08 83.46 85.2 1.6 1.27
208894_at M60334 290.85 288.99 289.98 394.49 415.44 405.74 1.4 1.28
209312_x_at U65585 840.21 822.65 831.37 1127.01 1199.25 1160.1 1.4 1.28
61
RECTIFIED SHEET (RULE 91.1) 200866_s_at M32221 89.88 95.62 92.71 131.22 134.24 132.65 1.43 1.28
203931 _s_at NM_002949 201.01 181.63 190.55 282.12 268.13 274.8 1.44 1.28
229713_at AW665227 108.21 121.78 114.86 168.44 163.67 166.32 1.45 1.28
200736_s_at NM_000581 202.55 181.09 190.83 290.67 272.43 281.76 1.48 1.28
207831 _x_at NM_013407 71.28 83.97 77.13 120.87 114.36 117.61 1.52 1.28
218493_at NM_024571 72.96 70.58 71.56 114.96 103.32 108.98 1.52 1.28
215728_s_at AL031848 43.6 37.03 40.67 62.9 63.7 63.39 1.56 1.28
217786_at NM_006109 92.38 75.61 84.92 138.51 130.1 133.52 1.57 1.28
205996_s_at NM_013411 56.87 57.34 57.12 85.51 82.35 83.9 1.47 1.29
222531 _s_at AW137526 84.67 81.74 82.59 126.37 116.09 121.19 1.47 1.29
201946_s_at AL545982 214.39 191.38 202.94 287.54 331.15 308.64 1.52 1.29
217362_x_at AF005487 41.85 36.93 39.47 64.04 60.52 61.95 1.57 1.29
212379_at BE966876 51.79 46.84 49.36 73.71 85.15 79.28 1.61 1.29
223318_s_at BC004393 40.04 33.76 36.88 61.01 62.21 61.56 1.67 1.29
208306_x_at NM_021983 728.97 773.36 752.51 1033.17 1088.32 1057.13 1.4 1.3
208675_s_at D29643 338.95 355.49 348.18 503.49 489.64 495.81 1.42 1.3
200722_s_at BG258784 88.95 95.19 91.88 132.48 135.68 134.28 1.46 1.3
221069_s_at NMJD16360 41.15 43.58 42.63 65.55 64.24 64.87 1.52 1.3
22 550_at BC002382 37.34 42.53 40.2 61.76 67.08 64.33 1.6 1.3
2021 8_s_at AA541758 68.98 61.68 65.17 95.47 113.71 104.78 1.61 1.3
213104_at AI799802 32.37 23.87 28.25 45.81 50.06 48.06 1.7 1.3
202862_at NM_000137 85.66 80.71 83.19 120.01 122.41 120.93 1.45 1.31
203013_at NM_007265 78.42 79.59 78.91 110.88 121.01 116.11 1.47 1.31
62
RECTIFIED SHEET (RULE 91.1) 228582_x_at AI475544 130.19 123.2 126.91 181.1 203.22 191.33 1.51 1.31
214836_x_at BG536224 65.05 71.88 68.93 100.72 113.31 106.6 1.55 1.31
1555730_a_at D00682 233.42 203.68 219.04 373.43 332.44 354.76 1.62 1.31
205965_at NM_006399 513.82 461.76 485.77 774 697.77 735.88 1.51 1.32
225823_at AA699669 83.75 75.65 79.49 117.06 131.82 123.84 1.56 1.32
204683_at NM_000873 44.66 44.12 44.37 74.3 64.79 69.57 1.57 1.32
211600 at U20489 661.4 556.65 610.28 907.29 1073.59 991.58 1.62 1.32
211716_x_at BC005851 297.22 292.48 294.83 406 421.58 413.44 1.4 1.33
217388_s_at D55639 373.53 372.97 373.17 540.06 519.84 529.28 1.42 1.33
202799_at NM_006012 155.55 153.66 154.6 231.24 222.9 227.58 1.47 1.33
222703_s_at BE464161 72.52 75.31 74.02 104.3 115.77 110.4 1.49 1.33
208965_s_at BG256677 149.52 122.92 136.14 210.88 241.81 224.92 1.65 1.33
231821_x_at AK024248 26.15 46.46 36.33 74.01 69.86 72.06 1.98 1.33
225647_s_at AI246687 131.75 130.29 130.83 190.12 187.09 188.69 1.44 1.34
201391_at NM_016292 245.4 229.29 237.58 343.18 346.75 344.96 1.45 1.34
202475_at NM_006326 177.1 199.23 188.53 283.41 286.88 284.74 1.51 1.34
203105_s_at NM_012062 100.78 92.59 96.91 150.34 145.99 148.38 1.53 1.34
216483_s_at AC005339 88.06 75.31 82.11 130.19 125.3 127.57 1.55 1.34
210154_at M55905 37.74 41.63 39.6 65.43 61.25 63.12 1.59 1.34
203 09_at NM_003969 75.02 59.52 67.23 109.31 112.37 111.06 1.65 1.34
215241_at AJ 300461 44.76 36.54 40.13 66.84 71.29 69.4 1.73 1.34
1553551 _s_at NM_173709 1375.43 1375.45 1375.44 1952.21 2152.52 205 .44 1.49 1.35
63
RECTIFIED SHEET (RULE 91.1) 201476_s_at AI692974 280.42 249.13 264.46 388.88 425.85 407.18 1.54 1.35
223578_x_at AF113016 111.63 104.96 107.87 163.72 179.15 170.87 1.58 1.36
212338_at AA621962 46 46.48 46.24 86.43 70.96 78.63 1.7 1.36
200883_at NM_003366 145.81 133.47 140.13 212.49 209.37 211.02 1.51 1.37
223037_at AF151061 116.64 121.8 119.55 179.47 183.76 181.59 1.52 1.37
214359_s_at AI218219 279.39 257.19 268.73 431.56 398.55 415.36 1.55 1.37
202151_s_at NM_016172 91.89 94.72 93.12 149.28 147.34 148.55 1.6 1.37
201118_at NM_002631 75.01 79.57 76.82 119.32 129.96 124.75 1.62 1.37
212401_s_at AI767436 63.67 58.52 61.38 114.99 98.19 106.74 1.74 1.37
212411_at BE747342 81.82 74.89 77.84 119.26 122.21 121.06 1.56 1.38
202697__at NM_007006 65.55 72.83 69.53 110.23 117.5 113.97 1.64 1.4
202833_s_at NM_000295 70.26 81.76 75.66 131.04 121.5 126.65 1.67 1.4
224601 _at BE891646 167.41 154.1 161.25 246.56 256.86 251.04 1.56 1.41
212016_s_at AA679988 65.92 58.58 62.48 100.42 99.12 99.67 1.6 1.41
223221 _at AF183424 69.34 69.49 69.41 108.3 114.49 111.2 1.6 1.41
233029_at AB046859 53.87 61.25 57.48 108.51 92.1 100.02 1.74 1.41
217791_s_at NM_002860 158.7 156.2 157.52 238.02 238.94 238.63 1.51 1.42
217741_s_at AW471220 65.31 75.11 71.11 117.58 114.12 115.86 1.63 1.42
238623_at AI633559 87.44 98.22 93.12 150.96 153.33 152.23 1.63 1.42
1564494_s_at AK075503 44.4 42.98 43.64 78.41 72.44 75.6 1.73 1.42
206343_s_at NM_013959 62.09 57.65 60.42 95.52 100.67 97.97 1.62 1.43
210663_s_at BC000879 134.81 128.46 131.34 210.89 210.36 210.68 1.6 1.47
1554464_a_al BC008745 39.53 38.37 39.01 62.28 67.81 64.85 1.66 1.47
64
RECTIFIED SHEET (RULE 91.1) 221782_at BG168666 42.29 39.85 40.73 74.09 69.28 71.57 1.76 1.48
210338_s_at AB034951 402.55 349.05 375.86 632.41 634.13 633.28 1.68 1.49
223360_at AL136871 30.06 27.64 28.65 54.27 52.42 53.44 1.87 1.49
203828_s_at NM_004221 139.08 141.85 140.23 234.31 227.9 231.89 1.65 1.51
1555226_s_at BC008306 95.17 88.7 91.58 155.87 165.19 161.08 1.76 1.53
208677_s_at AL550657 99.86 94.35 97.23 168.7 162.65 166.05 1.71 1.54
225070_at BF1 2132 84.58 81.01 82.65 142.34 150.14 145.93 1.77 1.55
37079_at U823 9 39.95 37.46 38.73 67.04 85.66 76.43 1.97 1.55
225071 _at BG 168247 188.56 197.11 192.48 318.61 340.32 329.09 1.71 1.57
209692_at U7 207 37.49 42.96 40.43 73.01 78.56 75.81 1.88 1.57
49306_at AI890191 36.48 31.75 33.9 65.7 62.78 64.2 1.89 1.57
219049_at NM_018371 53.38 46.55 50.41 95.77 92.42 94.63 1.88 1.58
212009_s_at AL553320 35.47 41.09 37.93 69.25 74.48 72.01 1.9 1.59
221972_s_at AL571362 151.62 164.02 58 317.21 278.26 297.3 1.88 1.62
229640_x_at AW439242 159.44 164.1 161.29 290.37 331.6 310.81 1.93 1.66
215207_x_at BF695847 50.75 48.35 49.27 93.74 111.13 102.38 2.08 1.73
206325_at NM_001756 51.63 39.92 46.1 105.36 102.59 104.24 2.26 1.79
210342_s_at M17755 66.34 69.54 67.75 134.47 141.22 137.66 2.03 1.82
203559_s_at NM_001091 21.51 16.89 19.07 46.57 48.04 47.13 2.47 1.85
NS-1 : non-silencing control, baseline replicate 1
NS-2: non-silencing control, baseline replicate 2
H5-1 : fusion gene knockdown, experiment replicate 1 (clone H5)
H5-2, fusion gene knockdown, experiment replicate 2 (clone 5)
Fold change (FC): negative values indicate lower expression in knockdown cells, positive values higher expression knockdown cells.
65
RECTIFIED SHEET (RULE 91.1) [00264] Figure 14 depicts, most strikingly, that overrepresentation analysis identified genes of the "Antigen Presentation Pathway" significantly enriched amongst the up-regulated genes (p=0.03) and flow cytometry confirmed increased surface expression of HLA-DR in KM-H2 cells with fusion transcript knockdown (Figure 14, panel a). We also transduced DLBCL cell line SUDHL4 with a lentiviral vector containing the full length coding cDNA of the C//7V\-BX648577 fusion (second alternative transcript), which led to decreased surface HLA-DR expression (Figure 14, panel b). These data demonstrate that the C//77\-BX648577 fusion suppresses expression of HLA class II genes in KM-H2 and SUDHL4. Diminished expression of HLA class II in B cell lymphomas has been linked to reduced immunogenicity, escape from immunosurveillance and inferior survival.
Example 4 - Analysis of CIITA breakpoint reoccurrence
[00265] To determine if breakpoints within CIITA are recurrent in primary HL cases, we used FISH on tissue microarrays and found 8 of 55 cases (15%) rearranged (Table 6).
Table 6: Frequency of CIITA rearrangements detected by FISH in 263 B cell lymphomas
Figure imgf000067_0001
*significant overrepresentation compared to all cases [00266] Figure 15 depicts representative FISH images of the break-apart assay demonstrating involvement of all cells of the malignant cell compartment (CD30+ Hodgkin Reed Sternberg cells). Figure 15, panel a depicts the alignment of probes. Figure 15, panels b and c depict representative FISH images. In 4 of the 8 cases we detected an unbalanced rearrangement. Since PMBCL shares clinical and biological features with
66
RECTIFIED SHEET (RULE 91.1) cHL, we also studied PMBCL and found 29 (38%) of 77 cases positive for break-apart of the CIITA locus. Only 4 of 131 studied DLBCL cases (3%) showed break-apart of the CIITA locus. Hence, the occurrence of CIITA rearrangements in PMBCL and cHL was significantly higher than in DLBCL (p<0.0001 ).
Example 5 - Correlation of CIITA translocation with clinical outcome
[00267] We also studied the correlation of CIITA translocation with clinical outcome in 57 PMBCL patients that were treated with curative intent using multi-agent
chemotherapy with or without radiotherapy.17 The clinical characteristics of this cohort are summarized in Table 7.
67
RECTIFIED SHEET (RULE 91.1) Table 7: Clinical characteristics in a selected cohort of 57 patients with PMBCL, homogeneously treated with CHOP or CHOP-like chemotherapy
Figure imgf000069_0001
t CIITA+ = CIITA break-apart present; CIITA- = CIITA break-apart absent
*limited=stage l/ll and maximal tumor diameter <10 cm and the absence of B symptoms
[00268] Figure 15, panel d shows that presence of a CIITA rearrangement significantly correlated with a shorter disease-specific survival (10-year DSS 63.6% vs 85.0%, p=0.044). Multivariate testing using a Cox regression model including the
International Prognostic Index (IPI)18 score and the individual clinical prognostic factors, showed that the presence of CIITA rearrangement had independent prognostic significance (p=0.013) for decreased disease-specific survival together with elevated LDH serum levels (p=0.001 ) (Table 8). Table 8: Cox regression model for disease-specific survival in 57 patients with PMBCL
68
RECTIFIED SHEET (RULE 91.1) Univariate Multivariate
Variable Class N (%) analysis analysis p-value p-value
Fluorescence in situ hybridization
CIITA rearrangement present 22 (38.6%) 0.043 0.013
Clinical parameters
Age (years) >60 6 (10.5%) 0.622
Ann Arbor Stage 111,1V 16 (28.1 %) 0.347
Serum LDH elevated 44 (77.2%) 0.0001 0.0008
WHO performance status >1 20 (35.1 %) 0.301
Number of extranodal
>1 21 (36.8%) 0.144
sites
IPI score >2 17 (29.8%) 0.042
1 ) Univariate Cox proportional hazards regression model
2) Multivariate Cox proportional hazards regression model (forward stepwise, likelihood ratio) IPI = International Prognostic Index Example 6 - Determination of fusion partners in CIITA translocations
[00269] To determine fusion partners involved in CIITA rearrangements we used 3' RACE in 8 cases of PMBCL that were positive for CIITA translocation by FISH. In total, we identified 5 new translocation partners (CD274, CD273, RALGDS, RUNDC2A and C160RF75) (Table 9).
69
RECTIFIED SHEET (RULE 91.1) Table 9: Translocation partners of CIITA resulting in expressed gene fusions (identified by RNA-seq and CIITA 3* RACE)
Figure imgf000071_0001
*For cDNA sequence and amino acid sequence see supplemental text; aa = amino acids.
† Identical fusion transcript was found in two cases
††Missense mutations in CIITA translational start codon
[00270] Figure 16 presents data on precise mapping revealed that the
corresponding genomic breakpoints in CIITA all fell within a 1.6kb-spanning breakpoint cluster region in intron 1 indicating a "hot spot" area for chromosomal breaks. Figure 16, panel a (left) depicts cHL case with unbalanced CIITA rearrangement in aberrant large HRS (arrows) cells displaying 1 fusion signal and 3 green signals (telomere side of the breakpoint), while Figure 16, panel a (right) depicts a PMBCL case with rearrangement of one allele while the other CIITA allele seems intact (1 fused + 1 red + 1 green signal). Figure 16, panel b depicts BAC alignment for CIITA break-apart assay. The hatched box indicates location of CIITA intron 1 containing a breakpoint cluster region. Figure 16,
70
RECTIFIED SHEET (RULE 91.1) panel c depicts the breakpoint cluster as defined by genomic breakpoints found in 5 PMBCL cases.
[00271] Figure 17 depicts a CIITA-BX648577 fusion transcript and putative translation.
[00272] Figure 18 depicts a CIITA-CD274 fusion transcript and putative
translation.
[00273] Figure 19a depicts a CIITA-CD273 (PDCD1 LG2) fusion transcript.
[00274] Figure 19b depicts a putative translation of the CIITA-CD273
(PDCD1 LG2) fusion transcript.
[00275] Figure 20a depicts a CIITA-RALGDS fusion transcript.
[00276] Figure 20b depicts a putative translation of the CIITA-RALGDS fusion transcript.
[00277] Figure 21 depicts a CIITA- C160RF75 fusion transcript and putative translation.
[00278] In the cases of CD274 (PDL1 ), CD273 (PDL2) and RUNDC2A the fusion transcripts merged exon 1 of CIITA with exon 2 of the respective fusion partners resulting in open reading frames. Of note, in both cases with CIITA-CD273 fusions, CIITA start codon mutations were detected resulting in translational reading frames beginning at the original CD273 start site.
[00279] Figure 22, panel a presents data demonstrating that overexpression of CD274 and CD273 closely linked to copy number gain has been previously described in PMBCL and HL19-21 , and expression of CD274 has been shown to correlate with poor prognosis in other cancers.22 Furthermore, re-analysis of gene expression profiling data confirmed overexpression of both genes in over 50% of PMBCL cases. Figure 22, panel b displays quantitative RT-PCR data showing that in all three cases CD274 and CD273 were highly overexpressed (fold changes: 451 , 41 15 and 1729 respectively) as part of the respective CIITA fusions compared to germinal center B cells. Importantly, expression levels markedly exceeded the levels of PMBCL cases without translocations. Overall, these results indicate that substitution of active CIITA promotors24 can lead to overexpression of partner genes in a B cell context. Next, the functional consequences of CD274 and CD273 wildtype overexpression were studied. Figure 22, panel c shows selection of cell line U294025 (consistent with PMBCL features) expressing high levels of both CD274 and CD273 mRNA and membrane protein.
71
RECTIFIED SHEET (RULE 91.1) [00280] To study the effects of CD274 and CD273 surface expression on T cell activation in particular, we analyzed a co-culture system in which Jurkat T cells were co- incubated with U2940 cells.
[00281] Figure 23, panel a depicts induction of PD-1 and CD69 by anti-CD3 and anti-CD28 antibodies in Jurkat T cells, and confirms that PD-1 expression was induced in Jurkat T cells upon TCR stimulation.
[00282] Figure 23, panel b shows that after 4 hours of co-culture, Jurkat T cell activation, measured by CD69 expression, was markedly decreased with increasing admixture of U2940 cells.
[00283] Figure 23, panel c depicts inhibition of T cell activation by P BCL
(U2940) cells but not by ABC (U2932) or GCB (SUDHL4) DLBCL cells. These results indicated that, in contrast, inhibition of T cell activation was not observed when U2932 and SUDHL4 cells were co-incubated that did not express CD274 or CD273 on their surface.
[00284] Figure 23, panel d shows that inhibition of T cell activation by U2940 cells was reversible by incubation with inhibitors against PD1 , CD274 and CD273, but not against CTLA4.
[00285] Figure 23, panel e depicts flow cytometry data which indicates that PD1 expression on Jurkat T cells augments T cell inhibition by PMBCL cells, indicating dependence on the PD-1 pathway. Jurkat T cells transduced with bicistronic PD1 -GFP vector (right panel) or empty GFP vector (left panel) in monoculture (upper panel) and in co-culture mixed with U2940 cells (ratio 1 :4) (bottom panel) were stimulated with anti- CD3 and anti-CD28 for 4 h before harvesting. Shown are FACS plots of Jurkat T cells (CD-2 positive). Dot plots display the expression levels of PD1 vs GFP. Histograms show the expression levels of CD69 in GFP positive cells (red histograms) vs GFP negative cells (blue histograms, internal controls). Non-stimulated Jurkat cells served as negative controls (gray histograms).
[00286] Figure 24 depicts results of investigation into the effects of forced expression of the CIITA-CD274 and CIITA-CD273 gene fusions in U2932 cells that do not express wildtype PD-1 ligands on their surface. Ectopic expression of the full length coding cDNA of the fusions in U2932 markedly increased surface expression of the respective proteins in transduced cells and, similar to U2940, decreased CD69 and IL-2 expression of PD-1 over-expressing Jurkat T cells in comparison to empty vector controls. In summary, these data show that both wildtype PD-1 ligand expression and the
72
RECTIFIED SHEET (RULE 91.1) identified C//L4-CD274/CD273 gene fusions are negatively regulating Jurkat T cell activation.
[00287] Figure 25 depicts the results of flow cytometric analysis of indicating that intracellular cleaved PARP and active caspase 3 do not show differences between transduced and wildtype U2932 cells.
[00288] Taken together, we discovered breakpoints in the master regulator of MHC class II expression CIITA that were novel and highly recurrent in PMBCL. Moreover, the occurrence of CIITA breaks in cHL further substantiates the relatedness of cHL and PMBCL.19,26 We observed CIITA breaks in only 3% of DLBCL cases, contrasting with 38% in PMBCL, highlighting the relative specificity of this genetic event. In PMBCL, CIITA breaks were significantly correlated with outcome demonstrating the potential clinical importance of these rearrangements, a finding that will require validation in additional patient cohorts. Consequences of CIITA rearrangements appear to be diverse as evidenced by multiple fusion partners, and concomitant chromosomal imbalances as described previously in PMBCL. However, functional study of the most frequent specific gene fusions suggest that escape from immunosurveillance through various mechanisms might play an important role in the pathogenesis of these lymphomas. Furthermore, our data raise the possibility that deletion of tumour suppressor genes27, overexpression of oncogenes resulting from gene fusion, and CIITA loss of function might be concurrent consequences of a single genetic event.
Example 7 - Survival data
[00289] Survival was studied in 61 PMBCL patients treated with R-CHOP. Of these patients, 53/61 has interpretable CIITA FISH results, and 16/53 patients were found to be positive for CIITA rearrangments (30.2%).
[00290] Progression free survival (PFS) for patients positive and negative for CIITA break apart treated with R-CHOP was studied.
[00291] Overall survival for patients positive and negative for CIITA break apart treated with R-CHOP was studied.
[00292] Table 10 depicts tabulation of survival data, and Table 11 depicts calculated Chi-Square Test values.
73
RECTIFIED SHEET (RULE 91.1) Table 10
CIITA_BA * IPI Crosstabulation
Count
Figure imgf000075_0001
Table 11
Chi-Square Tests
Figure imgf000075_0002
a- 7 cells (58.3%) have expected count less than 5. The
minimum expected count is .30.
[00293] In summary, no significant correlation was observed between progression free survival (PFS), International Prognostic Score (IPS), overall survival (OS); and CIITA break apart status for patients treated with R-CHOP.
[00294] In the preceding description, for purposes of explanation, numerous details are set forth in order to provide a thorough understanding of the embodiments. However, it will be apparent to one skilled in the art that these specific details are not required. In other instances, well-known electrical structures and circuits are shown in block diagram form in order not to obscure the understanding. For example, specific details are not provided as to whether the embodiments described herein are implemented as a software routine, hardware circuit, firmware, or a combination thereof.
[00295] The above-described embodiments are intended to be examples only. Alterations, modifications and variations can be effected to the particular embodiments by those of skill in the art without departing from the scope, which is defined solely by the claims appended hereto.
74
RECTIFIED SHEET (RULE 91.1) [00296] References
[00297] 1. Dyer, M.J. The pathogenetic role of oncogenes deregulated by chromosomal translocation in B-cell malignancies. Int J Hematol 77, 315-20 (2003).
[00298] 2. Kerckaert, J. P. et al. LAZ3, a novel zinc-finger encoding gene, is disrupted by recurring chromosome 3q27 translocations in human lymphomas. Nat Genet 5, 66-70 (1993).
[00299] 3. Blank, C, Gajewski, T.F. & Mackensen, A. Interaction of PD-L1 on tumor cells with PD-1 on tumor-specific T cells as a mechanism of immune evasion: implications for tumor immunotherapy. Cancer Immunol Immunother 54, 307-14 (2005).
[00300] 4. Rimsza, L.M. et al. Loss of MHC class II gene and protein expression in diffuse large B-cell lymphoma is related to decreased tumor immunosurveillance and poor patient survival regardless of other prognostic factors: a follow-up study from the
Leukemia and Lymphoma Molecular Profiling Project. Blood 103, 4251 -8 (2004).
[00301] 5. Martin-Subero, J.I. et al. Chromosomal breakpoints affecting
immunoglobulin loci are recurrent in Hodgkin and Reed-Stern berg cells of classical Hodgkin lymphoma. Cancer Res 66, 10332-8 (2006).
[00302] 6. Mortazavi, A., Williams, B.A., McCue, K., Schaeffer, L. & Wold, B.
Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat Methods 5, 621-8 (2008).
[00303] 7. Palanisamy, N. et al. Rearrangements of the RAF kinase pathway in prostate cancer, gastric cancer and melanoma. Nat Med 16, 793-8 (2010).
[00304] 8. Reith, W. & Mach, B. The bare lymphocyte syndrome and the regulation of MHC expression. Annu Rev Immunol 19, 331-73 (2001 ).
[00305] 9. Silacci, P., Mottet, A., Steimle, V., Reith, W. & Mach, B. Developmental extinction of major histocompatibility complex class II gene expression in plasmocytes is mediated by silencing of the transactivator gene C//TA J Exp Med 180, 1329-36 (1994).
[00306] 10. Masternak, K. et al. CIITA is a transcriptional coactivator that is recruited to MHC class II promoters by multiple synergistic interactions with an
enhanceosome complex. Genes Dev 14, 1 156-66 (2000).
[00307] 1 1. Cressman, D.E., Chin, K.C., Taxman, D.J. & Ting, J. P. A defect in the nuclear translocation of CIITA causes a form of type II bare lymphocyte syndrome.
Immunity 10, 163-71 (1999).
75
RECTIFIED SHEET (RULE 91.1) [00308] 12. Joos, S. et al. Hodgkin lymphoma cell lines are characterized by frequent aberrations on chromosomes 2p and 9p including REL and JAK2. Int J Cancer 103, 489-95 (2003).
[00309] 13. Chin, K.C., Li, G. & Ting, J. P. Activation and transdominant
suppression of MHC class II and HLA-DMB promoters by a series of C-terminal class II transactivator deletion mutants. J Immunol 159, 2789-94 (1997).
[00310] 14. Zhou, H., Su, H.S., Zhang, X., Douhan, J., 3rd & Glimcher, L.H. CIITA- dependent and -independent class II MHC expression revealed by a dominant negative mutant. J Immunol 158, 4741 -9 (1997).
[00311] 15. Roberts, R.A. et al. Loss of major histocompatibility class II gene and protein expression in primary mediastinal large B-cell lymphoma is highly coordinated and related to poor patient survival. Blood 108, 311-8 (2006).
[00312] 16. Diepstra, A. et al. HLA class II expression by Hodgkin Reed-Sternberg cells is an independent prognostic factor in classical Hodgkin lymphoma. J Clin Oncol 25, 3101 -8 (2007).
[00313] 17. Savage, K.J. et al. Favorable outcome of primary mediastinal large B- cell lymphoma in a single institution: the British Columbia experience. Ann Oncol 17, 123- 30 (2006).
[00314] 18. A predictive model for aggressive non-Hodgkin lymphoma. The International Non-Hodgkin Lymphoma Prognostic Factors Project. N Engl J Med 329, 987-94 (1993).
[00315] 19. Rosenwald, A. et al. Molecular diagnosis of primary mediastinal B cell lymphoma identifies a clinically favorable subgroup of diffuse large B cell lymphoma related to Hodgkin lymphoma. J Exp Med 198, 851-62 (2003).
[00316] 20. Yamamoto, R. et al. PD-1 -PD-1 ligand interaction contributes to immunosuppressive microenvironment of Hodgkin lymphoma. Blood 1 1 1 , 3220-4 (2008).
[00317] 21. Green, M.R. et al. Integrative analysis reveals selective 9p24.1 amplification, increased PD-1 ligand expression, and further induction via JAK2 in nodular sclerosing Hodgkin lymphoma and primary mediastinal large B-cell lymphoma. Blood (2010).
[00318] 22. Thompson, R.H. et al. Costimulatory B7-H1 in renal cell carcinoma patients: Indicator of tumor aggressiveness and potential therapeutic target. Proc Natl Acad Sci U S A 101 , 17174-9 (2004).
[00319] 23. Lenz, G. et al. Molecular subtypes of diffuse large B-cell lymphoma arise by distinct genetic pathways. Proc Natl Acad Sci U S A 105, 13520-5 (2008).
76
RECTIFIED SHEET (RULE 91.1) [00320] 24. Lennon, A.M. et al. Isolation of a B-cell-specific promoter for the human class II transactivator. Immunogenetics 45, 266-73 (1997).
[00321] 25. Sambade, C. et al. U-2940, a human B-cell line derived from a diffuse large cell lymphoma sequential to Hodgkin lymphoma. Int J Cancer 1 18, 555-63 (2006).
[00322] 26. Savage, K.J. et al. The molecular signature of mediastinal large B-cell lymphoma differs from that of other diffuse large B-cell lymphomas and shares features with classical Hodgkin lymphoma. Blood 102, 3871 -9 (2003).
[00323] 27. Melzner, I. et al. Biallelic deletion within 16p13.13 including SOCS-1 in Karpas1 106P mediastinal B-cell lymphoma line is associated with delayed degradation of JAK2 protein. Int J Cancer 1 18, 1941 -4 (2006).
[00324] 28. Morin, R. et al. Profiling the HeLa S3 transcriptome using randomly primed cDNA and massively parallel short-read sequencing. Biotechniques 45, 81-94
(2008) .
[00325] 29. Steidl, U. et al. A distal single nucleotide polymorphism alters long- range regulation of the PU.1 gene in acute myeloid leukemia. J Clin Invest (2007).
[00326] 30. Ngo, V.N. et al. A loss-of-function RNA interference screen for molecular targets in cancer. Nature 441 , 106-10 (2006).
[00327] 31. Amini, R. M. et al. A novel B-cell line (U-2932) established from a patient with diffuse large B-cell lymphomafollowing Hodgkin lymphoma. Leuk. Lymphoma 43, 2179-2189 (2002).
[00328] 32. Epstein, A. L. et al. Biology of the human malignant lymphomas. IV. Functional characterization of ten diffuse histiocytic lymphoma cell lines. Cancer 42, 2379-2391 (1978).
[00329] 33. Shah, S. P. et al. Mutational evolution in a lobular breast tumour profiled at single nucleotide resolution. Nature 461 , 809-813 (2009).
[00330] 34. Langmead, B., Trapnell, C, Pop.M.&Salzberg, S. L. Ultrafast andmemory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 10, R25 (2009).
[00331] 35. Bengtsson, H., Wirapati, P. & Speed, T. P. A single-array
preprocessing method for estimating full-resolution raw copy numbers fromall Affymetrix genotyping arrays including GenomeWideSNP 5 & 6. Bioinformatics 25, 2149-2156
(2009) .
[00332] 36. Shah, S. P. et al. Integrating copy number polymorphisms into array CGH analysis using a robust HMM. Bioinformatics 22, e431-e439 (2006).
77
RECTIFIED SHEET (RULE 91.1) [00333] 37. Lestou, V. S. et al. Multicolour fluorescence in situ hybridization analysis of t(14;18)-positive follicular lymphoma and correlation with gene expression data and clinical outcome. Br. J. Haematol. 122, 745-759 (2003).
[00334] 38. Steidl, C. et al. Tumor-associated macrophages and survival in classic Hodgkin lymphoma. N. Engl. J. Med. 362, 875-885 (2010).
[00335] 39. Shustik, J. et al. Correlations between BCL6 rearrangement and outcome in patients with diffuse large B-cell lymphoma treated with CHOP or R-CHOP. Haematologica 95, 96-101 (2010).
[00336] 40. Martinez-Ramirez, A. et al. Simultaneous detection of the
immunophenotypic markers and genetic aberrations on routinely processed paraffin sections of lymphoma samples by means of the FICTION technique. Leukemia 18, 348- 353 (2004).
[00337] 41. Klein, U. et al. Transcriptional analysis of the B cell germinal center reaction. Proc. Natl Acad. Sci. USA 100, 2639-2644 (2003).
[00338] All references cited herein are expressly incorporated by reference in their entireties.
78
RECTIFIED SHEET (RULE 91.1)

Claims

WHAT IS CLAIMED IS:
1. A method of diagnosing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin (cHL) lymphoma in a subject, the method comprising:
- providing a biological sample from a subject; and
- detecting a functional mutation at the CIITA gene locus in the sample;
wherein a detected functional mutation at the CIITA gene locus is indicative of a diagnosis of PMBCL or cHL.
2. A method of confirming a diagnosis primary mediastinal B-cell lymphoma
(PMBCL) or classical Hodgkin lymphoma (cHL) in a subject suspected of having PMBCL or cHL, the method comprising:
- providing a biological sample from a subject suspected of having PMBCL; and
- detecting a functional mutation at the CIITA gene locus in the sample;
wherein a detected functional mutation at the CIITA gene locus confirms a diagnosis of PMBCL or cHL
3. A method of determining a prognosis of a subject with primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL), the method comprising:
- providing a biological sample from a subject with PMBCL or cHL; and
- detecting a functional mutation at the CIITA gene locus in the sample;
wherein a detected functional mutation at the CIITA gene locus is indicative of a poor prognosis.
4. A method of determining a propensity for developing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject, the method comprising:
- providing a biological sample from a subject; and
- detecting a functional mutation at the CIITA gene locus in the sample;
wherein a detected functional mutation at the CIITA gene locus is indicative of a propensity to developing PMBCL or cHL.
5. A method of determining primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin (cHL) lymphoma treatment efficacy, the method comprising:
- providing a biological sample from a PMBCL or cHL subject;
- detecting a functional mutation at the CIITA gene locus in the sample;
- quantifying the proportion of cells having the functional mutation at the CIITA gene locus; and
79
RECTIFIED SHEET (RULE 91.1) - comparing the proportion of cells having the functional mutation at the CIITA gene locus against a suitable control,
wherein a reduced number of cells having the functional mutation at the CIITA gene locus compared to the suitable control is indicative of an efficacious treatment.
6. The method according to any one of claims 1 or 2, wherein additional clinical criteria are used to distinguish between PMBCL and cHL.
7. The method according to any one of claims 1 to 5, wherein the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
8. The method according to claim 7, wherein the functional mutation is an inactivating mutation.
9. The method according to claim 7 or 8, wherein the functional mutation is a translocation involving the CIITA gene.
10. The method according to claim 9, wherein the translocation involves fusion of CIITA to a fusion partner, or a fragment thereof.
11. The method of claim 10, wherein transcription of the fusion partner or fragment thereof is activated.
12. The method of claim 1 1 , wherein activation of the fusion partner or fragment thereof leads to decreased HLA class II gene expression.
13. The method according to claim 10, wherein the fusion partner is BX648577, CD274, CD273, RALGDS, RUNDC2A, C160RF75, or a fragment thereof.
14. The method according to claim 10, wherein the fusion partner is BX648577, CD274, CD273, or RUNDC2A, or a fragment thereof.
15. The method according to claim 10, wherein the fusion partner is a PD-1 ligand.
16. The method of claim 15, wherein the PD-1 ligand is CD274 or CD273, or a fragment thereof.
17. The method of claim 3, wherein the poor prognosis is a poor prognosis under a cyclophosphamide-hydroxyldaunorubicin-oncovin-prednisone (CHOP) combination or a CHOP-like chemotherapy treatment regimen.
18. The method according to claim 5, wherein a suitable control is an earlier sample from the same subject, a clinically selected control, a stored dataset of results generated from studies of the presence of a functional mutation in the CIITA gene locus in one or more population(s) of subjects having PMBCL or cHL, a stored dataset of results generated from studies of the presence of a functional mutation in the CIITA gene locus in one or more population(s) of subjects having PMBCL or cHL, a stored dataset of
80
RECTIFIED SHEET (RULE 91.1) results generated from studies of the presence of a functional mutation in the CIITA gene locus in one or more population(s) of subjects having PMBCL or cHL and responsive to a chemotherapeutic treatment, a stored dataset of results generated from studies of the presence of a functional mutation in the CIITA gene locus in samples collected from a single subject having PMBCL or cHL over an extended period of time, or combinations thereof.
19. The method of claim 18, wherein the earlier sample is a sample obtained prior to treatment.
20. A kit for diagnosing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject, comprising:
reagents for detecting a functional mutation at the CIITA gene locus in a patient sample; and
instructions for use in diagnosing PMBCL or cHL,
wherein a detected functional mutation a the CIITA gene locus is indicative of a diagnosis of PMBCL or cHL
21. A kit for confirming a diagnosis primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject suspected of having PMBCL or cHL, comprising:
reagents for detecting a functional mutation at the CIITA gene locus in a sample from a subject suspected of having PMBCL or cHL; and
instructions for use in diagnosing PMBCL or cHL,
wherein a detected functional mutation a the CIITA gene locus is confirms diagnosis of PMBCL or cHL.
22. A kit for determining prognosis of a subject with primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL), comprising:
reagents for detecting a functional mutation at the CIITA gene locus in a patient sample; and
instructions for use in determining prognosis;
wherein a detected functional mutation at the CIITA gene locus is indicative of a poor prognosis.
23. A kit for determining primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) treatment efficacy, comprising:
reagents for quantifying the proportion of cells having a functional mutation at the CIITA gene locus in a PMBCL or cHL subject sample; and
81
RECTIFIED SHEET (RULE 91.1) instructions for use in determining treatment efficacy;
wherein a reduced proportion of cells having the functional mutation at the CIITA gene locus compared to a suitable control is indicative of an efficacious treatment.
24. A kit for determining propensity for developing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject, comprising: reagents for detecting a functional mutation at the CIITA gene locus in a patient sample; and
instructions for use in determining propensity for developing PMBCL or cHL, wherein a detected functional mutation a the CIITA gene locus is indicative of a propensity to developing PMBCL or cHL.
25. A kit according to any one of claims 20 or 21 , wherein additional clinical criteria are used to distinguish between PMBCL and cHL.
26. The kit according to any one of claims 20 to 24, wherein the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the C//L4 gene.
27. The kit according to claim 26, wherein the functional mutation is an inactivating mutation.
28. The kit according to claim 26 or 27, wherein the functional mutation is a translocation involving the CIITA gene.
29. The kit according to claim 28, wherein the translocation involves fusion of CIITA to a fusion partner, or a fragment thereof.
30. The kit of claim 29, wherein transcription of the fusion partner or fragment thereof is activated.
31. The kit of claim 30, wherein activation of the fusion partner or fragment thereof leads to decreased HLA class II gene expression.
32. The kit according to claim 29, wherein the fusion partner is BX648577, CD274, CD273, RALGDS, RUNDC2A, C160RF75, or a fragment thereof.
33. The kit according to claim 29, wherein the fusion partner is BX648577, CD274, CD273, or RUNDC2A, or a fragment thereof.
34. The kit according to claim 29, wherein the fusion partner is a PD-1 ligand.
35. The kit of claim 34, wherein the PD-1 ligand is CD274 or CD273, or a fragment thereof.
82
RECTIFIED SHEET (RULE 91.1)
36. The kit of claim 22, wherein the poor prognosis is a poor prognosis under a cyclophosphamide-hydroxyldaunorubicin-oncovin-prednisone (CHOP) combination or a CHOP-like chemotherapy treatment regimen.
37. The kit according to claim 23, wherein a suitable control is an earlier sample from the same subject, a clinically selected control, a stored dataset of results generated from studies of the presence of a functional mutation in the CIITA gene locus in one or more population(s) of subjects having PMBCL or cHL, a stored dataset of results generated from studies of the presence of a functional mutation in the CIITA gene locus in one or more population(s) of subjects having PMBCL or cHL, a stored dataset of results generated from studies of the presence of a functional mutation in the CIITA gene locus in one or more population(s) of subjects having PMBCL or cHL and responsive to a chemotherapeutic treatment, a stored dataset of results generated from studies of the presence of a functional mutation in the CIITA gene locus in samples collected from a single subject having PMBCL or cHL over an extended period of time, or combinations thereof.
38. The kit of claim 37, wherein the earlier sample is a sample obtained prior to treatment.
39. A biomarker of primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) comprising a functional mutation at the CIITA gene locus.
40. A biomarker of poor prognosis in primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin (cHL) comprising a functional mutation at the CIITA gene locus.
41. A biomarker of primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) treatment efficacy comprising a functional mutation at the CIITA gene locus.
42. A biomarker of propensity to developing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) comprising a functional mutation at the CIITA gene locus.
43. A biomarker according to any one of claims 39 or 40, wherein additional clinical criteria are used to distinguish between PMBCL and cHL.
44. The biomarker according to any one of claims 39 to 42, wherein the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
45. The biomarker according to claim 44, wherein the functional mutation is an inactivating mutation.
83
RECTIFIED SHEET (RULE 91.1)
46. The biomarker according to claim 44 or 45, wherein the functional mutation is a translocation involving the CIITA gene.
47. The biomarker according to claim 46, wherein the translocation involves fusion of CIITA to a fusion partner, or a fragment thereof.
48. The biomarker of claim 47, wherein transcription of the fusion partner or fragment thereof is activated.
49. The biomarker of claim 48, wherein activation of the fusion partner or fragment thereof leads to decreased HLA class II gene expression.
50. The biomarker according to claim 47, wherein the fusion partner is BX648577, CD274, CD273, RALGDS, RUNDC2A, C160RF75, or a fragment thereof.
51. The biomarker according to claim 47, wherein the fusion partner is BX648577, CD274, CD273, or RUNDC2A, or a fragment thereof.
52. The biomarker according to claim 47, wherein the fusion partner is a PD-1 ligand.
53. The biomarker of claim 52, wherein the PD-1 ligand is CD274 or CD273, or a fragment thereof.
54. The biomarker of claim 40, wherein the poor prognosis is a poor prognosis under a cyclophosphamide-hydroxyldaunorubicin-oncovin-prednisone (CHOP) combination or a CHOP-like chemotherapy treatment regimen.
55. Use of a functional mutation at the CIITA gene locus for diagnosing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL).
56. Use of a functional mutation at the CIITA gene locus for confirming diagnosing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL).
57. Use of a functional mutation at the CIITA gene locus as a biomarker of poor prognosis in a primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) patient.
58. Use of a functional mutation at the CIITA gene locus as a biomarker of treatment efficacy in associated primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL).
59. Use of a functional mutation at the CIITA gene locus as a biomarker of propensity to developing primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL).
60. A use according to any one of claims 55 or 56, wherein additional clinical criteria are used to distinguish between PMBCL and cHL.
84
RECTIFIED SHEET (RULE 91.1)
61. The use according to any one of claims 55 to 59, wherein the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
62. The use according to claim 61 , wherein the functional mutation is an inactivating mutation.
63. The use according to claim 61 or 62, wherein the functional mutation is a translocation involving the CIITA gene.
64. The use according to claim 63, wherein the translocation involves fusion of CIITA to a fusion partner, or a fragment thereof.
65. The use of claim 64, wherein transcription of the fusion partner or fragment thereof is activated.
66. The use of claim 65, wherein activation of the fusion partner or fragment thereof leads to decreased HLA class II gene expression.
67. The use according to claim 64, wherein the fusion partner is BX648577, CD274, CD273, RALGDS, RUNDC2A, C160RF75, or a fragment thereof.
68. The use according to claim 64, wherein the fusion partner is BX648577, CD274, CD273, or RUNDC2A, or a fragment thereof.
69. The use according to claim 64, wherein the fusion partner is a PD-1 ligand.
70. The use of claim 69, wherein the PD-1 ligand is CD274 or CD273, or a fragment thereof.
71. The use of claim 57, wherein the poor prognosis is a poor prognosis under a cyclophosphamide-hydroxyldaunorubicin-oncovin-prednisone (CHOP) combination or a CHOP-like chemotherapy treatment regimen.
72. A method of treating primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject having a CIITA translocation involving a fusion partner comprising:
- administering an inhibitor of said fusion partner to said subject.
73. The method of claim 72, wherein the fusion partner is a PD-1 ligand, and the inhibitor is an inhibitor of PD-1.
74. The method of claim 73, wherein the inhibitor comprises an antibody which binds specifically to PD-1.
75. The method of claim 74, wherein the antibody is CT01 1 or MDX-1 106.
85
RECTIFIED SHEET (RULE 91.1)
76. A use of an inhibitor of a fusion partner involved in a CIITA translocation for treating primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL) in a subject harbouring the CIITA translocation.
77. The use of claim 76, wherein the fusion partner is a PD-1 ligand, and the inhibitor is an inhibitor of PD-1.
78. The use of claim 77, wherein the inhibitor comprises an antibody which specifically binds to PD-1.
79. The use of claim 78, wherein the antibody is CT011 or MDX-1 106.
80. A method of selecting treatment for a subject having a B-cell lymphoma, comprising:
- providing a sample from a B-cell lymphoma subject;
- detecting a translocation at the CIITA gene locus;
- identifying a translocation fusion partner; and
- selecting a treatment regimen comprising an inhibitor of said fusion partner.
81. The method of claim 80, wherein the fusion partner is a PD-1 ligand, and the inhibitor is an inhibitor of said PD-1 ligand.
82. The method of claim 81 , wherein the inhibitor comprises an antibody which binds specifically to PD-1.
83. The method of claim 82, wherein the antibody is CT011 or MDX-1 106.
84. The method of any one of claims 80-83, wherein the B-cell lymphoma is primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL).
85. A method of determining whether a standard cyclophosphamide- hydroxyldaunorubicin-oncovin-prednisone (CHOP) chemotherapeutic regimen or CHOP- like regimen is likely to be efficacious in treating a primary mediastinal B-cell lymphoma (PMBCL) or classical Hodgkin lymphoma (cHL), the method comprising:
- providing a biological sample from a PMBCL or cHL subject; and
- detecting a functional mutation at the CIITA gene locus in the sample;
wherein a detected functional mutation at the CIITA gene locus indicates that the standard CHOP or CHOP-like chemotherapeutic regimen is likely to be a less efficacious treatment compared to a PMBCL or cHL subject not having functional mutation at the CIITA gene locus.
86. The method according to claim 85, wherein the functional mutation comprises a translocation, a rearrangement, a point mutation, or a microdeletion involving the CIITA gene.
86
RECTIFIED SHEET (RULE 91.1)
87. The method according to claim 86, wherein the functional mutation is an inactivating mutation.
88. The method according to claim 85 or 86, wherein the functional mutation is a translocation involving the CIITA gene.
89. The method according to claim 88, wherein the translocation involves fusion of CIITA to a fusion partner, or a fragment thereof.
90. The method of claim 89, wherein transcription of the fusion partner or fragment thereof is activated.
91. The method of claim 90, wherein activation of the fusion partner or fragment thereof leads to decreased HLA class II gene expression.
92. The method according to claim 89, wherein the fusion partner is BX648577, CD274, CD273, RALGDS, RUNDC2A, C160RF75, or a fragment thereof.
93. The method according to claim 89, wherein the fusion partner is BX648577, CD274, CD273, or RUNDC2A, or a fragment thereof.
94. The method according to claim 89, wherein the fusion partner is a PD-1 ligand.
95. The method of claim 94, wherein the PD-1 ligand is CD274 or CD273, or a fragment thereof.
87
RECTIFIED SHEET (RULE 91.1)
PCT/CA2012/000165 2011-02-25 2012-02-24 Method of diagnosing primary mediastinal b-cell lymphoma or classical hodgkin lymphoma by detecting functional mutation at ciita locus. WO2012113064A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161446876P 2011-02-25 2011-02-25
US61/446,876 2011-02-25

Publications (1)

Publication Number Publication Date
WO2012113064A1 true WO2012113064A1 (en) 2012-08-30

Family

ID=46720050

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2012/000165 WO2012113064A1 (en) 2011-02-25 2012-02-24 Method of diagnosing primary mediastinal b-cell lymphoma or classical hodgkin lymphoma by detecting functional mutation at ciita locus.

Country Status (1)

Country Link
WO (1) WO2012113064A1 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014078617A1 (en) * 2012-11-16 2014-05-22 Albert Einstein College Of Medicine Of Yeshiva University Identification and use of new tumor-promoting gene in hematological malignancies
RU2533816C2 (en) * 2013-03-11 2014-11-20 Государственное бюджетное образовательное учреждение высшего профессионального образования "Новосибирский государственный медицинский университет" Министерства здравоохранения Российской Федерации (ГБОУ ВПО НГМУ Минздрава России) Method of predicting efficiency of treatment of patients with high grade non-hodgkin lymphoma
US10344090B2 (en) 2013-12-12 2019-07-09 Shanghai Hangrui Pharmaceutical Co., Ltd. PD-1 antibody, antigen-binding fragment thereof, and medical application thereof
CN110195106A (en) * 2019-05-10 2019-09-03 广州安必平医药科技股份有限公司 For detecting probe groups, kit and its application of PD-L1 gene unconventionality
WO2022194036A1 (en) * 2021-03-15 2022-09-22 成都益安博生物技术有限公司 Peripheral blood tcr marker for classical hodgkin lymphoma, detection kit therefor, and application thereof

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
FARIS, J. ET AL.: "Primary mediastinal large B-cell Lymphoma.", CLINICAL ADVANCES IN HEMATOLOGY & ONCOLOGY, vol. 7, no. 2, 1 February 2009 (2009-02-01), pages 125 - 133 *
RIMSZA, L. ET AL.: "Loss of major histocompatibility class II expression in non-immune-privileged site diffuse large B-cell lymphoma is highly coordinated and not due to chromosomal deletions.", BLOOD, vol. 107, no. 3, 1 February 2006 (2006-02-01), pages 1101 - 1107 *
ROBERTS, R. ET AL.: "Loss of major histocompatibility class II gene and protein expression in primary mediastinal large B-cell lymphoma is highly coordinated and related to poor patient survival.", BLOOD, vol. 108, no. 1, 1 July 2006 (2006-07-01), pages 311 - 318 *
STEIDL,C. ET AL.: "MHC class II transactivator CIIT4 is a recurrent gene fusion partner in lymphoid cancers.", NATURE, vol. 471, no. 7338, 17 March 2011 (2011-03-17), pages 377 - 381 *
WESSENDORF, S. ET AL.: "Further delineation of chromosomal consensus regions in primary mediastinal B-cell lymphomas: an analysis of 37 tumor samples using high resolution genomic profiling (array-CGH).", LEUKEMIA, vol. 21, no. 12, 1 December 2007 (2007-12-01), pages 2463 - 2469 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014078617A1 (en) * 2012-11-16 2014-05-22 Albert Einstein College Of Medicine Of Yeshiva University Identification and use of new tumor-promoting gene in hematological malignancies
US10941209B2 (en) 2012-11-16 2021-03-09 Albert Einstein College Of Medicine Identification and use of new tumor-promoting gene in hematological malignancies
RU2533816C2 (en) * 2013-03-11 2014-11-20 Государственное бюджетное образовательное учреждение высшего профессионального образования "Новосибирский государственный медицинский университет" Министерства здравоохранения Российской Федерации (ГБОУ ВПО НГМУ Минздрава России) Method of predicting efficiency of treatment of patients with high grade non-hodgkin lymphoma
EA024246B1 (en) * 2013-03-11 2016-08-31 Государственное бюджетное образовательное учреждение высшего профессионального образования "Новосибирский государственный медицинский университет" Министерства здравоохранения Российской Федерации (ГБОУ ВПО НГМУ Минздрава России) Method for predicting efficiency of treatment of patients with non-hodgkin high-grade lymphoma
US10344090B2 (en) 2013-12-12 2019-07-09 Shanghai Hangrui Pharmaceutical Co., Ltd. PD-1 antibody, antigen-binding fragment thereof, and medical application thereof
US11365255B2 (en) 2013-12-12 2022-06-21 Suzhou Suncadia Biopharmaceuticals Co., Ltd. PD-1 antibody, antigen-binding fragment thereof, and medical application thereof
CN110195106A (en) * 2019-05-10 2019-09-03 广州安必平医药科技股份有限公司 For detecting probe groups, kit and its application of PD-L1 gene unconventionality
WO2022194036A1 (en) * 2021-03-15 2022-09-22 成都益安博生物技术有限公司 Peripheral blood tcr marker for classical hodgkin lymphoma, detection kit therefor, and application thereof

Similar Documents

Publication Publication Date Title
Steidl et al. MHC class II transactivator CIITA is a recurrent gene fusion partner in lymphoid cancers
Johnson et al. Tumor-specific MHC-II expression drives a unique pattern of resistance to immunotherapy via LAG-3/FCRL6 engagement
Gide et al. Distinct immune cell populations define response to anti-PD-1 monotherapy and anti-PD-1/anti-CTLA-4 combined therapy
Wang et al. Siglec-15 as an immune suppressor and potential target for normalization cancer immunotherapy
US20230375555A1 (en) Markers selectively deregulated in tumor-infiltrating regulatory t cells
Chiarle et al. Increased proteasome degradation of cyclin-dependent kinase inhibitor p27 is associated with a decreased overall survival in mantle cell lymphoma
US8524238B2 (en) Cancer targets and uses thereof
US9846162B2 (en) Immune biomarkers and assays predictive of clinical response to immunotherapy for cancer
US20190323085A1 (en) Asxl1 as a new diagnostic marker of myeloid neoplasms
CA2854255C (en) Mutations of histone proteins associated with proliferative disorders
US20230105008A1 (en) Methods and compositions for identifying castration resistant neuroendocrine prostate cancer
US20190135921A1 (en) Methods of preventing or treating slamf7 positive and slamf7 negative cancers
Marçais et al. Adult T cell leukemia aggressivenness correlates with loss of both 5-hydroxymethylcytosine and TET2 expression
CN113166972A (en) Novel immune checkpoint inhibitors
WO2012113064A1 (en) Method of diagnosing primary mediastinal b-cell lymphoma or classical hodgkin lymphoma by detecting functional mutation at ciita locus.
WO2020072126A2 (en) Modulating ptpn2 to increase immune responses and perturbing gene expression in hematopoietic stem cell lineages
EP2148932B1 (en) Sox11 expression in malignant lymphomas
Hishizawa et al. Serological identification of adult T‐cell leukaemia‐associated antigens
US20240067970A1 (en) Methods to Quantify Rate of Clonal Expansion and Methods for Treating Clonal Hematopoiesis and Hematologic Malignancies
El Hussein et al. Microsatellite instability assessment by immunohistochemistry in acute myeloid leukemia: A reappraisal and review of the literature
US20220298580A1 (en) Immune signatures predictive of response to pd-1 blockade in richter&#39;s transformation
Kit et al. IMMUNOTHERAPY FOR EPITHELIAL TUMORS OF THE THYMUS
US20210155691A1 (en) Methods of preventing or treating non-hematopoietic slamf7 positive and slamf7 negative cancers
Barkal Boosting Macrophage Appetites for Cancer Immunotherapy
KR20230165212A (en) How to treat red blood cell disorders

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12750026

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12750026

Country of ref document: EP

Kind code of ref document: A1