WO2012107073A1

WO2012107073A1 - Ubiad1 for cellular coenzyme q10 synthesis and cardiovascular oxidative protection

Info

Publication number: WO2012107073A1
Application number: PCT/EP2011/051738
Authority: WO
Inventors: Massimo SANTORO
Original assignee: Santoro Massimo
Priority date: 2011-02-07
Filing date: 2011-02-07
Publication date: 2012-08-16

Abstract

The present invention concerns the field of antioxidants. In particular the invention concerns prenyltransferases, for enhancing the production of Coenzyme Q10. The invention further regards the use of prenyltransferases in the treatment of diseases that result from oxidative stress and their use in the field of cosmetics.

Description

UBIAD1 FOR CELLULAR COENZYME Q10 SYNTHESIS AND CARDIOVASCULAR

OXIDATIVE PROTECTION

Field of the invention

State of the art

There is growing evidence that reactive oxygen species (ROS) play an important role in signal transduction and physiological regulation of the cardiovascular system facilitating various biological responses such as gene expression, cell proliferation and migration, apoptosis, and senescence in heart and endothelial cells (EC) (1 ,2). ROS are produced endogenously in response to several stimuli so that an antioxidant network is necessary and required to balance these ROS in cardiovascular tissue. An excess amount of ROS may contribute to different cardiovascular pathologies, including endothelial apoptosis and dysfunction, atherosclerosis, and also heart failure (3,4). While several enzymes responsible for ROS production in EC has been identified, molecules involved in the endogenous antioxidant network are still unknown.

A promising molecule shown to play an important antioxidant role in the cardiovascular network is Coenzyme Q10 or CoQ10, also known as ubiquinone. CoQ10 is present in all cells and functions as a component of the mitochondrial respiratory chain and as the only endogenously synthesized cell membrane lipid-soluble antioxidant (5, 6, 7).

This latter antioxidant function is associated to its localization in cellular membranes such as lysosomes, Golgi and plasma membranes, where it is present at even higher concentrations than in the mitochondria (5, 8). Interestingly, several in vivo and in slices precursor labeling experiments suggest that in addition to mitochondria, CoQ10 synthesis may also occur in the Golgi and endoplasmic reticulum membranes. Although hypothesized, a "non-mitochondrial" CoQ10 biosynthetic enzyme has never been reported so far (9, 7). Identification of such enzyme could very useful to counteract excess of ROS production in blood vessels and heart during normal and pathological conditions as well as in other tissues. Anti-oxidant therapies are very difficult to achieve since supplement of CoQ10 to cells has always been a challenging task.

The importance of this invention is linked to the increasing need for a promising discovery that allows the increase of endogenous CoQ10 synthesis.

The objective of the present invention is the identification of a gene product that is a promising alternative to the already known CoQ10 antioxidant dietary supply therapies. Summary of the invention

The present invention concerns Ubiadi for use as a medicament.

As it will be further described in the detailed description of the invention, the medicament of the present invention has the advantages of being a new cellular CoQ10 biosynthetic enzyme that is required to balance endogenous ROS signaling in all tissues, in particular heart and endothelial cells.

A further aspect of the present invention is an Ubiadi for use in the treatment of diseases which result from oxidative stress (e.g aging, cancer progression and statin- induced myopathies).

A still further aspect of the present invention is an Ubiadi for use in the treatment of diseases which result from the formation of reactive oxygen species.

A still further aspect of the present invention regards an Ubiadi for use in the treatment of Schnyder Crystalline Corneal Dystrophy.

The present invention further concerns Ubiadi for use in up-regulating CoQ10 synthesis.

The present invention still further concerns a cosmetic preparation comprising Ubiadi together with common cosmetic additives.

Brief description of the drawings

The characteristics and advantages of the present invention will be apparent from the detailed description reported below, from the Examples given for illustrative and non- limiting purposes, and from the annexed Figures 1 -18, wherein:

Figure 1 : shows that the absence of Ubiadi induces cardiovascular failure in zebrafish embryos described in Example 1.

(a) Wild-type siblings (sib) and barolo (bar) mutant embryos at 65 hpf. Vascular hemorrhage and heart failure (arrowhead) are visible in bar mutants (arrows). Scale bar, 100mm.

(b) Fluorescent micrographs of Tg(kdrl:GFP)s843 sib and bar mutant embryos at 65 hpf. bar mutants show vascular integrity defects and regression (arrows) as detectable in the Tg(kdrl:GFP)s843 background both in brain and trunk vasculature. Endothelial cell regression is observed throughout the vascular network of bar mutants at 65hpf. A collapsed heart is also evident (arrowhead). Scale bar, 100mm.

(c) Magnification of ISV of Tg (kdrl:GFP)s843 background. Loss of intersomitic vessels (ISV) integrity and collapsed dorsal aorta (DA) are evident and typical of bar mutants. PCV, posterior cardinal vein. Scale bar, 100mm.

(d) Confocal images of ISV of Tg(FN1 a:GFP)Y1 bar mutants show endothelial integrity defects at different magnifications.

(e) Confocal images of brain vasculature of Tg(FN1 a:GFP)Y1 sib and bar mutants at 72hpf. bar mutants show severe loss of cranial network vasculature and fragmented endothelium (arrowheads) .

(f) Confocal transverse sections of Tg(kdrl:GFP)s843 sib (left) and bar mutant (right) embryos stained for DNA (dark grey) and TUNEL (grey) at 72 hpf. Endothelial cells in bar mutants are positive for TUNEL. Scale bars, 20 mm.

(g) Magnification of the areas outlined in h). Endothelial cells within the dorsal aorta and posterior cardinal vein are positive for TUNEL (arrows), and feature cell fragmentation, characteristic of cells undergoing programmed cell death. Sections shown are at the level of the tenth somite. Scale bars, 20 mm. NT, neural tube; NC, notochord; DA, dorsal aorta; PCV, posterior cardinal vein.

(h) Genetic map of the barolo locus. The corresponding SSLP markers (z22307) has been used to identified the "zero recombinant" region by analysis of 987 diploid mutants. This region is located closed to the ubiadl locus that is located in ZV8_scaffold 1 100.

(i) Schematic representation of zebrafish Ubiadl protein containing an N-terminal region with unknown function and an UbiA domain. The bart31 131 allele bears an 123 T>-A base change that introduces a stop codon at amino acid 41 leading to an early truncation of the Ubiadl protein. The bars847 allele bears an 185 A>-T base change that introduces a glutamine at amino acid 62 leading to amino acid substitution of a conserved leucine residue in the UbiA domain of the protein.

Figure 2: shows Barolo mutant embryos, characterized by heart failure and apoptosis in endocardial cells described in Example 1.

(A) Fluorescent micrographs of Tg(kdrl:GFP)s843 wild-type siblings (sib) and bar mutants {bat) at 65 hpf. bar mutants show brain vascular regression (arrows) and cardiac failure (arrowheads) as detectable in the Tg(kdrl:GFP)s843 and Tg(myl7:GFP)twu26.

(B) Fluorescent micrographs of Tg(kdrl:GFP)s843 wild-type siblings (sib) and bar mutants at 65 hpf background. Scale bar, 50 μππ.

(C) Confocal transverse sections of Tg(kdrl:GFP)s843 sib (left) and bar mutant (right) embryos stained for DNA (dark grey) and TUNEL (grey) at 72 hpf.

(D) Magnifications of the heart outflow tract region show endocardial cells, (but not branchial arches) of bar mutants positive for TUNEL (arrows). Scale bar, 20 μππ.

Figure 3: shows confocal analyses of blood vessel regression and endothelial cell fragmentation in barolo lg (fli1a:GFP)y1 described in Example 1.

(A) Intersomitic blood vessels comparison between wild-type siblings (sib) and bar mutants {bar) at 72hpf. Vasculature of bar embryos develops normally compared to wild-type embryos. However, starting from 48hpf dorsal aorta and intersomitic vessels progressively regress due to endothelial cell fragmentation. At 72hpf vasculature of bar embryos show a more severe regression characterized by specific endothelial cell apoptosis (arrowheads) (see text for details). Scale bar, 100μπι.

Figure 4: shows barolo⁵⁸⁴⁷ characterization at 65hpf described in Example 1.

(A) Bright-field images of developing vasculature in wild-type siblings (sib) and bars847 mutants {bar) as observed in the Tg(/(aW:GFP)s843 line at 65hpf.

(B) Fluorescent micrographs of developing vasculature in wild-type siblings (sib) and bars847 mutants {bar) as observed in the Tg(/(aW:GFP)s843 line at 65hpf. Heart failure (arrowheads) and blood pooling (arrows) are evident and circulation is missing. Vascular regression and heart failure takes place as indicated by the downregulation of GFP expression in the heart (endocardium)(arrowheads), brain and trunk vasculature (arrows). Scale bar, 100 μππ.

Figure 5: shows Knock-down of ubiadl by morpholino (MO) injection phenocopies bar mutations described in Example 1.

Bright-field images of wild-type embryos injected with a control MO or 4 ng of ubiadl MO. at:

(A) 48 hpf ; and

(B) 72hpf

(C) Fluorescent micrographs of ISV of control MO and ubiadl MO injected embryos at 72hpf in Tg(kdr1 :GFP)s843 background.

Knock-down of ubiadl led to hemorrhage (arrows), cardiac failure and vascular regression (arrowhead) as observed in bar mutants.

Figure 6: shows that ubiadl is ubiquitously expressed during zebrafish development described in Example 1.

(A) Whole-mount ISH analyses show ubiadl mRNA expression throughout the embryo at 24hpf;

(B) Specific expression in the developing heart can be detected at 48hpf.

Figure 7: shows the alignment of the Human UBIAD1 UbiA domain with prenyltransferase enzymes of other species described in Example 2.

Aminoacid sequence comparison among human, mouse, zebrafish and drosophila

Ubiadl is conserved between species.

Aminoacids involved in barolo and SCCD disease are indicated

Figure 8: shows Barolo mutant embryos, characterized by CoQ10 deficiency as described in Example 2.

(a) HPLC-UV analyses of lipid extractions of sib and bar mutant embryos at 72 hpf. From peak areas, through calibration curves, concentration dates were calculated to build figure histograms in panel c and d.

(b) Mass detection of CoQ10 is showed by HPLC-MS chromatogram. Confirmatory HPLC-MS analysis show the mass spectra of ubiquinone (m/z=881 for CoQ10-NH4+). (c,d) Histograms show measurement of CoQ10 (c) and cholesterol (d) by HPLC-UV methods in bar and ubiadl morphants. bar mutants and ubiadl morphants show reduced amount of CoQ10 compared to controls. On the contrary, total cholesterol do not change.

(e,f) Histograms show measurements of CoQ10 (e) and cholesterol (f) by HPLC-UV during zebrafish development starting from 24hpf to 72hpf embryos. Whole embryos (black) and deyolk embryos (grey) lipid extracts were used in these analyses. While cholesterol is present mainly in yolk sac, CoQ10 is produced entirely by zygotic tissues. Samples are pool of embryos at the same developmental stage,

g) Embryos from bar heterozygote intercrosses injected at one-cell stage with CoQ10 and Vitamin K2 and histograms indicating the percentage of rescued bar mutants are shown. Exogenous supplement of CoQ10, but not of VitaminK2, can rescue bar mutant embryos. Different formulations of CoQ10 were used: liposomal CoQ10 preparation (L- CoQ10; 0,6 mM) or LiQsorb® Liposomal CoQ10 Gel (GCoQI O; 0,6 mM). Liposomal Vitamin K2 (L-VitK; 0,3mM) preparation was used.

Error bars, s.d.

Figure 9: shows inhibition of protein isoprenylation or cholesterol synthesis which do not interfere with cardiovascular development in zebrafish embryos described in Example 3.

(A) Treatments of wild-type zebrafish embryos with specific inhibitors of farnesyl and geranylgeranyl transferases (FTI-277 and GGTI-2133) do not phenocopy barolo mutants embryos.

(B) Histograms show percentage of wt phenotype embryos after GGTI and FTI treatments. Error bar, s.d.

(C) Lack of cholesterol synthesis by squalene synthase inhibitor (SQI) treatment does not phenocopy barolo or produce any cardiovascular phenotype.

(D) Histograms show percentage of wild-type phenotype embryos after SQI treatments. Scale bar, 100 μππ. Error bar, s.d.

Figure 10: shows statin treatment which causes impairment of CoQ10 synthesis and cardiovascular failure in zebrafish embryos as described in Example 3.

a) Bright-field pictures of zebrafish embryos at 72hpf treated with different

concentrations of statins (mevastatin) between 54 and 72hpf. Statin treatment induces a bar-like phenotype characterized by severe cardiovascular defects in zebrafish embryos, such as hemorrhages (arrows) and heart failure (arrowheads).

b) Fluorescent micrographs of trunk vasculature at 72hpf of DMSO and statins treated zebrafish embryos. Mevalonate deficiency by statin treatments induces specific blood vessels regression and fragmentation in the brain (not shown) and in the trunk (arrows). ISV, intersomitic vessels. Scale bar, 100 mm.

c) Histograms show the percentage of zebrafish embryos with hemorrhages, heart failure and endothelial vessel regression (bar-like phenotype). Different types of statins were used in these experiments, such as mevastatin (mev), simvastatin (sim) and mevinolin (men).

d) Histograms show catalase activity in statin-treated embryos compared to controls. Statin treatments increase catalase activity and oxidative stress in zebrafish embryos. e,f) Histograms show measurement of CoQ10 (e) and cholesterol (f) in statins-treated zebrafish embryos by HPLC-UV. Statins-treated embryos show a significant reduction of CoQ10 compared to controls. Surprisingly, cholesterol does not change among DMSO and statins-treated zebrafish embryos.

Figure 11 : shows stress balancing in cardiovascular tissues by UBIAD1 as described in Example 4.

a,b) Histograms show measurements of catalase activity (a) and NADP/NADPH ratio

(b) among sib and bar mutants embryos, bar embryos show increased redox state compared to control sib, meaning of oxidative stress. Error bars, s.d.

(c) Confocal transverse sections of heart of Tg(kdrl:GFP)s843 sib and bar mutant embryos stained for the ROS detector, hydroethydine (). Heart sections of bar compared to sib show stronger signal in the myocardium (arrowhead) and specific staining in the endocardium (arrows). Scale bars, 75 mm. A, atrium; V, ventricle.

(d) Fluorescent micrographs of Tg(kdrl:GFP)s843 bar mutant embryos at 72 hpf after injection of tnnt2 morpholino. Scale bar, 100mm. ISV, intersomitic vessels.

e) Histograms show a quantification of bar embryos with ISV integrity defects after tnnt2 MO injection. Block of blood circulation and possibly shear stress can rescue ISV endothelial regression in bar mutant embryos at significant extent. Error bars, s.d.

(f) Histograms show CoQ10 quantification in UBIAD1 siRNA-transfected endothelial cells (siUBIADI ) compared to control (siCTRL). These experiments indicate that impairment of UBIAD1 reduce CoQ10 synthesis in EC.

(g) Confocal images of endothelial cells transfected with siCTRL and siUBIADI and treated with H2O2 for 10 minutes. A specific role for UBIAD1 in oxidative stress protection also in human cells is evident since Mitosox® () is metabolized only by siUBIADI -tranfected cells. Scale bar, 10mm.

(h) Immunoblotting analyses of ROS signaling activation in siUBIAD-treated

endothelial cells. Compared to controls UBIAD1 siRNA-transfected cells show a reduction in Akt and p38 phosphorylation and activation after stimulation with H202 for 20 min. These data suggest that UBIAD1 protect from ROS. Anti-tubulin immunoblot serves as protein control for loading.

Figure 12: shows tranfection of siRNAs for UBIAD1 which efficiently reduce endogenous UBIAD1 protein and mRNA levels in endothelial cells described in Example 4.

(A) Western blot analyses of human primary endothelial cells transfected with control siRNA (siCTRL), UBIAD1 siRNA (siUBIADI ) or hsUBIADI (as positive control). Total protein extracts are prepared 48 hours post transfection and Ubiadl expression is evaluated with the monoclonal antibody 9D4. Bactin is used as loading control.

(B) Cells are transfected with control siRNA (siCTRL) or UBIAD1 siRNA (siUBIADI ) and total RNA is extracted after 48 hours. UBIAD1 mRNA is measured by qRT-PCR and normalize with18S. Error bars, s.d. Both at mRNA and protein levels cells transfected with siUbiadl show a reduced UBIAD1 expression.

Figure 13: shows Endothelial cells lacking UBIAD1 display ROS and stress granules formation after H202 exposure described in Example 4.

Confocal images of human endothelial cells transfected with siCTRL and siUBIADI and treated with pro-oxidant stimulus such as H₂O₂ (500 μΜ) for 10 minutes.

(A) ROS are monitored by hydroethidine, and

(B) PARP antibody (a marker for stress granules).

EC with reduced UBIAD1 expression are more sensitive to environmental stress (H202) and develop ROS and stress conditions. Scale bar, 10 μππ.

Figure 14: shows a structure prediction of the zebrafish Ubiadl , which is predicted to be a transmembrane protein described in Example 5.

Hypothetical transmembrane domains of zebrafish Ubiadl . This structure prediction is based on homology with human UBIAD1 Aminoacidic residues responsible for barolo phenotype are in the N-terminal portion of the protein (circles). Figure 15: shows UBIAD1 localization in the ER-Golgi compartment as described in Example 5.

A) Confocal images of human endothelial cells stained for UBIAD1 (light grey), GM130 (grey) and DNA (dark grey). UBIAD1 co-localizes with the Golgi marker, GM130 in human primary endothelial cells. Scale bar, 10mm.

B) Confocal images of endothelial cells transfected with Ubiadi -GFP and stained for GFP (light grey), GM130 (grey) and DNA (dark grey). Zebrafish Ubiadi co-localizes with the Golgi marker, GM130 in human primary endothelial cells. Scale bar, 10mm.

C) Confocal images of endothelial cells transfected with Ubiadi -GFP and treated or not with brefeldin A (BFA). After BFA treatment and Golgi disassembly Ubiadi is rapidly delocalizated Scale bar, 10mm.

Figure 16: shows protection from ROS-mediated cardiovascular failure and enhancement of CoQ10 production by UBIAD1-SCCD mutations as described in Example 6.

A) Embryos from bar heterozygote intercrosses injected at one-cell stage with mRNA encoding for human UBIAD1 , UBIAD1 N102S and UBIADD1 12G. Histograms show the percentage of bar mutant embryos identified at 72 hpf after injection. Both wild-type and SCCD mutant version of UBIAD1 rescue bar mutants at significant extent. Error bars, s.d.

B) Confocal images of endothelial cells transfected with plasmids encoding for human UBIAD1 , UBIAD1 N102S and UBIADD1 12G and stained for UBIAD1 (light grey), TGN46 (grey) and DNA (dark grey). A specific signal is strictly perinuclear only for wild-type UBIAD1 overexpression. Scale bar, 10mm.

(C,D) Endothelial cells were transfected with plasmids encoding for human UBIAD1 , UBIAD1 N102S and UBIADD1 12G. CoQ10 as well as cholesterol were evaluated by HPLC-UV methods. All constructs are able to produce equal amount of cholesterol . Interestingly, UBIAD SCCD mutations synthesize a larger quantity of CoQ10 compared to others. Scale bar, 10mm.

E) Schematic flow-chart representation of ubiquinone (CoQ10) synthesis by mevalonate pathway and tyrosine metabolism. Mevalonate-derived farnesylpyrophasphates (FPP) are key intermediate for protein isoprenylation, as well as dolichol, cholesterol and ubiquinone biosynthesis. FPP is converted in polyprenyl-PP and then transferred to 4- OH-benzoic acid by Ubiadi (grey) to form CoQ10.

Figure 17: shows Co-localization analyses of Ubiadi in the Golgi compartment of human endothelial cells described in Example 5.

Human primary endothelial cells were transfected with Ubiadi -GFP and:

(A-C) stained for DNA (dark grey) and the cis-Golgi (GM130) and

(B-D) trans-Golgi (g-adaptin) markers (grey).

(C-D) High magnification of Golgi compartments showing colocalization between Ubiadi and Golgi markers, g-adaptin stains also vesicles released by Golgi. Scale bar, 10 μππ.

Detailed description of the invention

The present invention concerns an Ubiadi for use as a medicament.

In the present invention, by Ubiadi is intended the UbiA prenyltransferase domain- containing protein 1 (UBIAD1 ) also known as transitional epithelial response protein 1 (TERE1 ), a protein that in for example humans, zebrafish and mouse is encoded by the UBIAD1 gene.

For the purposes of the present invention, the human, zebrafish and mouse Ubiadi have corresponding SEQ ID NO. as follows:

SEQ ID NO. 1 corresponds to the aminoacidic sequence of human Ubiadi gene, GenelD: 29914, NCBI Reference Sequence: NP_037451 .1 ;

SEQ ID NO. 2 corresponds to the nucleotidic sequence of human Ubiadi gene, NCBI Reference Sequence: MM_...013319.2;

SEQ ID NO. 3 corresponds to the aminoacidic sequence of human Ubiadi N102S gene;

SEQ ID NO. 4 corresponds to the nucleotidic sequence of human Ubiadi N102S gene; SEQ ID NO.5 corresponds to the aminoacidic sequence of human Ubiadi D1 12G gene; SEQ ID NO. 6 corresponds to the nucleotidic sequence of human Ubiadi D1 12G gene; SEQ ID NO. 7 corresponds to the aminoacidic sequence of the Zebrafish Ubiadi gene, GenelD:558410 (ZFIN:ZDB-GENE-030131 -3205);

NCBI Reference Sequence: NP_001 186655 XP_686705.3 (336 aa), NCBI Reference Sequence: XP_686705.2 (333 aa)

SEQ ID NO. 8 corresponds to the nucleotidic sequence of the Zebrafish Ubiadl gene, NCBI Reference Sequence: NM_001 199726 XM_681613;

SEQ ID NO. 9 corresponds to the aminoacidic sequence of the Zebrafish Ubiadl gene of barolo⁵⁸⁴⁷, NCBI Reference Sequence: XP_686705.3 : L65Q, NCBI Reference Sequence: XP_686705.2 : L62Q;

SEQ ID NO. 10 corresponds to the nucleotidic sequence of the Zebrafish Ubiadl gene of barolo⁵⁸⁴⁷ NCBI Reference Sequence: XM_681613.3: 194 t>a, NCBI Reference Sequence: XM_681613.2: 185 t>a;

SEQ ID NO. 1 1 corresponds to the aminoacidic sequence of the Zebrafish Ubiadl gene of baro/o^t31131 NCBI Reference Sequence: XP_686705.3 : C44X, NCBI Reference Sequence: XP_686705.2 : C41 X;

SEQ ID NO. 12 corresponds to the nucleotidic sequence of the Zebrafish Ubiadl gene NCBI Reference Sequence: XM_681613.3: 132 t>a, NCBI Reference Sequence: XM_681613.2: 123 t>a;

SEQ ID NO. 13 corresponds to the aminoacidic sequence of the mouse Ubiadl gene; SEQ ID NO. 14 corresponds to the nucleotidic sequence of the mouse Ubiadl gene. In a further aspect the invention regards the Ubiadl for use as a medicament, wherein said medicament is an antioxidizing agent.

An antioxidizing agent or antioxidant, is a molecule capable of inhibiting the oxidation of other molecules. Oxidation is a chemical reaction that transfers electrons from a substance to an oxidizing agent. Oxidation reactions can produce free radicals. In turn, these radicals can start chain reactions that damage cells. Antioxidants terminate these chain reactions by removing free radical intermediates, and inhibit other oxidation reactions.

In a further aspect the invention regards the Ubiadl for use as a medicament, wherein said medicament activates CoQ10.

Coenzyme Q10 or CoQ10, is also known as ubiquinone, ubidecarenone, coenzyme Q. CoQ10 is a 1 ,4-benzoquinone, where Q refers to the quinone chemical group, and 10 refers to the number of isoprenyl chemical subunits in its tail.

The importance of CoQ10 is well known, but up to now it has been seen that the bioavailability is extremely low after oral administration. Dietary administration is so far the only possible approach but, because of the poor rate uptake, this does not seem an optimal solution. Several approaches have been attempted and different formulations and forms have been developed in order to find a principle to boost the bioavailability of CoQ10.

An advantage of the present invention is an Ubiadl for use in the treatment of diseases that result from oxidative stress.

A further advantage of the present invention is an Ubiadl for use in the treatment of diseases that result from the formation of reactive oxygen species.

Oxidative stress represents an imbalance between the production and manifestation of reactive oxygen species and a biological system's ability to readily detoxify the reactive intermediates or to repair the resulting damage. Disturbances in the normal redox state of tissues can cause toxic effects through the production of peroxides and free radicals that damage all components of the cell, including proteins, lipids, and DNA.

In a further aspect the invention provides the Ubiadl for use in the treatment of diseases that result from oxidative stress, wherein said diseases are cardiovascular diseases.

In a further aspect the invention provides the Ubiadl for use in the treatment of diseases which result from the formation of reactive oxygen species, wherein said diseases are cardiovascular diseases.

A further advantage of the present invention is that of providing the Ubiadl for use in the treatment of cardiovascular diseases, wherein said cardiovascular diseases are chosen from the group consisting of hypertension, atherosclerosis, ischemic heart disease, cardiomyopathies, myocardial infarction and congestive heart failure.

The UBIAD1 plays a key role buffering the excess of ROS in cardiovascular tissues and then preventing the failing of endothelial cells and cardiovascular tissues.

In a further aspect the invention provides the Ubiadl for use in the treatment of diseases which result from oxidative stress, wherein said oxidative stress results in cardiac and vascular myocyte impairment caused by statins or not.

In a still further aspect the invention provides the Ubiadl for use in the treatment of diseases which result from oxidative stress, wherein said oxidative stress results in hyperlipidemia or excess deposition of cholesterol.

The invention further relates to the Ubiadl for use in the treatment of diseases, wherein oxidative stress results in an excess deposition of cholesterol that occurs in the corneal stroma.

A still further aspect of the present invention relates to Ubiadl for use in the treatment of diseases, wherein an excess deposition of cholesterol in the corneal stroma determines Schnyder Crystalline Corneal Dystrophy (SCCD).

A still further aspect of the present invention relates to Ubiadl for use in the treatment of diseases, wherein reactive oxygen species enhance the toxicity of statins.

UBIAD1 has important therapeutic implications for many different pathological conditions such as aging, cancer and cardiovascular diseases also due to the opportunity to detoxify from ROS or alter tumor cell metabolism, and to oppose the side effects and toxicity of statins.

In particular, elevated rates of reactive oxygen species (ROS) have been detected in almost all cancers, where they can promote many aspects of tumour development and progression. However, tumour cells also express increased levels of antioxidant proteins to detoxify from ROS, suggesting that a delicate balance of intracellular ROS levels is required for cancer cell function. For these reasons Ubiadl may be overexpressed in cancer progression. Accordingly downregulation of Ubiadl can be used to prevent cancer progression and metastasis.

Oxidative stress is defined as an imbalance between the production of reactive oxygen species (ROS) and the antioxidant network, in favor of the former. While it is clear that oxidative damage increases with age, its role in the aging process is uncertain. Testing the free radical theory of aging requires experimentally manipulating ROS production or detoxification and examining the resulting effects on lifespan.

During normal lifestyle (smoking, alcoholism, obesity, intense physical exercise), a significant increase the production of ROS in our organism can occur. This is potentially associated with an increased risk of developing ageing-related pathologies such as cardiovascular diseases and cancer. As a matter of prevention, it is necessary to increase our knowledge on pathway for increase our antioxidant defense and then decrease the oxidative damages in DNA, proteins and lipids. It is well known that ROS scavenging can keep animals young and metabolically fit. A specific role for Ubiadl as potent anti-aging factor is also an interesting possibility.

In a further aspect, the invention relates to the Ubiadl for use in the treatment of diseases, wherein reactive oxygen species enhance the toxicity of statins, and wherein said toxicity of statins is counteracted.

The Ubiadl for use in the treatment of diseases which result from the formation of reactive oxygen species, wherein said diseases are myopathies.

A myopathy is a muscular disease in which the muscle fibers do not function for any one of many reasons, resulting in muscular weakness.

The Ubiadl for use in the treatment of diseases which result from the formation of reactive oxygen species, wherein said diseases are statin-induced myopathies.

A still further aspect of the present invention regards an Ubiadl for use in the treatment of Schnyder Crystalline Corneal Dystrophy.

The present invention further concerns an Ubiadl for use in up-regulating CoQ10 synthesis.

In a still further aspect the present invention relates to a cosmetic preparation comprising Ubiadl together with common cosmetic additives.

Said preparations are of particular use in skin or face creams for the cosmetic treatment of skin aging phenomena, in particular, of wrinkles; to facial preparations which cleanse and soften the skin and improve its texture or to a UV-protective cosmetic preparation comprising one or more UV absorbers.

EXAMPLES

Example 1.

Cardiovascular failure and apoptosis characterize Barolo zebrafish embryos

Zebrafish and human UBIAD1 constructs.

Zebrafish ubiadl (GeneBank accession number: XM 681613.2) and human UBIAD1 (GeneBank accession number NM 013319.2,) cDNAs were amplified using the following primers FW: 5'-ATG AAGCCGGCTGCGCTTTC-3' ; RW: 5'-

TC AC AATAACG G C AG G CT-3 ' ; FW: 5'-ATGGCGGCCTCTCAGGTCCTG-3' ; RW: 5'- TT A AATTTTG GGCAGACTGCCTGCTGG-3' respectively and cloned in PCS2+ vector. All constructs were then amplified and subcloned into pGEM T-easy vector with following primers:

human UBIAD1 forms: FW: 5'-AAAGAATTCTCCATGGCGGCCTCTCAG-3', RW: 5'- GAAAGATCTAATTTTGGGCAGACTGCC-3',

zebrafish ubiadl : FW: 5' - AAAGAATTCGAGATGAAGCCGGCTGCG-3', RW: 5'- TTTGGATCCCAATAACGGCAGGCTGCC-3'. Constructs were then subcloned into pEGFP-N3 vector with specific restriction enzymes. All constructs were tested for comparable levels of expression/lethality in cells.

Zebrafish strains, mapping, qenotvpinq, in situ hybridization, morpholinos, RNA injections.

Embryos and adult fish were raised and maintained under standard laboratory conditions. The following lines were used: bar³⁸⁴⁷, bar^t31131 ; wt AB/UMBRIA, Tg (kdrl:GFP)³⁸⁴³, Tg [(kdrl:GFP)^s843; gatal :dsRed)^sd2 ], Tg (fli1 a:EGFP)^y1 , Tg (myl7:GFP). barolo³⁸⁴⁷ and barolo^t31131 mutants were generated by ENU mutagenesis as previously described (19).

Fine mapping of the barolo mutation was performed with marker z22307 close to the mutation on contig: Zv8_scaffold 1 100 of the zebrafish genome. Sequencing the coding region of the ubiadl gene (ubiadl , Ioc554810) revealed a t>a mutation at nucleotide

123 in bar^t31131 and a t>a mutation at nucleotide position 185 in bar³⁸⁴⁷.

Whole mount in situ hybridization was performed as previously described (18)

The following oligonucleotides were used for anti-sense dig labeled probe: FW: 5'-

CCGCAGG ACGTGGTGATGTTTG-3' ,

RW: 5'- CGCGGGACATGGACTCAGAC-3'. Genotyping were performed by two sequential PCR, which products were analyzed by sequencing. We used following primers:

I PCR: FW: 5'-CCTGTGTGTGTTGTGATCG-3';

RW: 5'-TAGGTGTTGACCAGGTTTCC-3',

II PCR: FW 5'- TGTAAAACGACGGCCAGTCTGGATGCAGGAGATGAAG -3'; RW: 5'- AGGAAACAGCTATGACCATCCAGCTTGTAGGCCAGAG-3').

Control, ubiadl splice morpholino (5'- GAAGCCAATCGGTATATTCACCTCC-3'; 0.2 mM), and tnnt2a morpholino ( 5' - CATGTTTGCTCTGATCTGACACGCA - 3'; 0.2 mM) were injected at one cell-stage in different strains and phenotype was assayed between 48-72hpf as described. Tnnt2-injected bar embryos were scored after genotyping.

Embryos from bar heterozygote intercrosses were injected at one-cell stage with 80pg of mRNA (mMessage mMachine, Ambion) encoding for the different proteins. A control mRNA for H2B-cherry (50pg) was included in each injection. Rescued phenotypes were analysed at 72hpf.

Chemical treatments.

Zebrafish embryos were treated with Statins (Mevastatin, Simvastatin or Mevinolin)(Sigma) from 54hpf to 72hpf, Squalene Inhibitor (Calbiochem) from 32hpf to 72hpf, GGTI-2133 and FTI-277 (Sigma) from 54hpf to 72hpf. Phenotypes were analyzed at 72hpf. As control, embryos were treated with DMSO. Brefeldin A treatment (Sigma) was done using 36μΜ for 3h in cell culture medium.

TUN EL Assay

The TUNEL cell death assay was carried out using the "In Situ Cell Death Detection Kit" TMR Red (Roche) as previously reported (18). ROS were in vivo detected by incubating 72hpf embryos with 10μΜ Hydroethydine (Invitrogen). Agarose sections of fixed embryos were then analysed using confocal microscope.

Statistical Analyses.

All experiments were performed three times, and the error bars represent the mean of ± the standard error of the mean, unless otherwise stated. Statistical significance was performed by a Student's test or ANOVA, as appropriate, and significance is reported in accordance with p-value (^*<0.05, ^**≤0.01 , ^***<0.001 ).

Image acquisition.

Images were acquired with TCS SP5X confocal microscope, MZ16 FA stereomicroscope equipped with DCF300FY camera (Leica) and ApoTome AxioObserver Z1 (Zeiss). LAS AF and AxioVision softwares were used for analyses. Real-time quantitative PCR.

Total RNA of cells was isolated with PureLink Micro-to-Midi Total RNA Purification System (Invitrogen). cDNA was made with RT High Capacity kit (Applied Biosystems) according to the manufacturer's protocol. qRT-PCR were performed with ABI Prism 7300 real-time PCR System (Applied Biosystems) using Platinum Quantitative PCR SuperMix-UDG with ROX (Invitrogen). We used for human UBIAD1 (GeneBank accession number NM_013319.2) the following primers: fw: 809-832; rw:874-895 and probe #36 (Roche), 18S rRNA was used as internal control.

Results

The barolo mutation was identified during two independent forward genetic mutagenesis screens for cardiovascular mutants. The bar mutation is recessive and shows complete penetrance and expressivity. Bar mutants show distinct cranial vascular hemorrhages and cardiac edema in the context of wild-type body morphology (Figure 1 a). To examine whether this phenotype is associated with cardiovascular defects, the mutation was crossed into Tg(kdrl:GFP)s843 and Tg(myl7:GFP), two transgenic lines expressing the green fluorescent protein (GFP) in endothelial and myocardial cells in the developing embryos. Fluorescence microscopy analyses showed that the hemorrhagic phenotype in bar mutants is accompanied by specific blood vessel regression and fragmentation starting between 48 and 65 hours post-fertilization (hpf) in the cranial and trunk vascular compartments (Figure1 b-e and Figure 2a,b and 2a-c). At 65hpf the heart of bar mutants showed a progressive failure ending in heart shrinking as showed by myocardium- specific fluorescent staining (Figure 2a,b). To evaluate whether vascular regression correlated with cell death the presence of apoptotic endothelial cells in bar mutant embryos and siblings was examined (Figure 1 f,g and Figure 2c,d). Indeed, endothelial and endocardial cells in bar mutants were positive for TUNEL staining, and showed typical morphological features of apoptotic cells at this stage. Starting from 80hpf, bar mutant embryos showed necrotic features also in the brain and pronephric ducts (data not shown). Altogether these data suggested that a specific cell death program is activated in blood vessel and heart of bar mutant embryos.

By positional cloning, we determined that bar encodes UbiA prenyltransferase domain containing 1 , Ubiadl (Figure 1 h). Sequence analysis showed that the bart31 131 mutant allele contains a nonsense mutation in ubiadl gene that introduces a premature stop codon in the protein at amino acid position 41 , likely generating a null allele (Figure 1 i). A second allele of bar (bars847) that bears a 185 T>A base change at aminoacid position 65, leading to the replacement of a conserved leucine residue to glutammine. bars847 show the same features of bart31 131 (Figure 4). To further confirm that Ubiadl regulates cardiovascular integrity, we knocked down Ubiadi expression using an antisense morpholino oligonucleotide, ubiadi morphants show the same hemorrhagic phenotype and cardiovascular defects as bar mutant embryos (Figure 5).

Analyses of ubiadi expression in developing zebrafish embryos by RT-PCR and

WISH revealed an ubiquitous and heart expression (Figure 6).

Example 2.

Ubiadi is a new CoQ10 biosynthetic enzyme

Sample preparation, HPLC analyses and liposome formulations.

Samples (cells or zebrafish embryos) were lysed in 500μΙ water-ethanol 2:3 and a 5μΙ lysate aliquot was analyzed with Bradford assay for protein contents. Lysates were extracted two times with 500μΙ of hexane and the resulting organic phase was evaporated dry under reduced pressure. The residue was dissolved in 200μΙ of methanol, sonicated, centrifuged (12000rpm, 5min) and the upper layer was immediately subjected to HPLC. CoQ9 was added to cells or zebrafish embryos as internal standard before extraction. HPLC-UV analyses were performed on a Waters Alliance System (separations module: 2695 model) equipped with a photodiode array detector (model 2998) and a Waters Symmetry C18 reverse phase column (4.6 mm x 75mm, 3.5μπι); pure methanol was used for the separation of lipid extracts at flow rate of 1 ml/min in 45 minutes. HPLC-MS analyses were performed on a liquid- chromatography/electrospray ionization tandem mass spectrometry system (HPLC-ESI- MS, Waters 515 HPLC pump-3100mass detector). 5mM of ammonium formate was added to the eluent (100% methanol) to promote ionization of the analytes. Quantitation of the analytes was done by external calibration curves and corrected to % recovery evaluated on CoQ9. The composition of liposomes used for rescue test was: 65% POPC (2-Oleoyl-1 -palmitoyl-sn-glycero-3-phosphocholine), 5% DPPG (1 ,2-Dipalmitoyl- sn-glycero-3-phosphoglycerol), 25% cholesterol, 5% ubiquinone or menaquinone. A mixture of the appropriate amounts of phospholipids and cholesterol was dissolved in chloroform and this solution was evaporated to dryness using rotation evaporation at 20 mbar and 30 °C. The lipid film was subsequently put under a nitrogen flow for 2 hours to remove traces of organic solvents. Subsequently, the film was heated to 65 °C and hydrated with dialysis buffered at 65 °C for 10 min. The resulting lipid dispersion was sonicated sequentially two times for 20 seconds at very low frequency. Overnight dialysis completes the preparation of the liposome suspension. The mean hydrodynamic diameter of the liposomes was determined by dynamic lightscattering measurements carried out on a Malvern ZS Nanosizer (Malvern Instrumentation, UK) while the efficiency of incorporation of ubiquinone-menaquinone into phospholipid liposomes was assessed by HPLC-UV. Liposome suspensions typically contain 0.3mM of CoQ10 or vitK2. All chemicals and solvents were purchased from Sigma and Avanti Polar Lipids.

Results

Bioinformatics analyses of Ubiadl showed that it contains a conserved UbiA domain, that in vertebrate genome is present in only other two genes, Coq2 and Cox-10 (Figure 8a). Sequence homology between Ubiadl and Coq2 implied a similar function for these two genes. The mitochondrial enzyme Coq2 has been demonstrated to catalyze the prenylation of 4-hydroxybenzoic acid by oligoprenyl diphosphates during the biosynthesis of CoQ10 (18). CoQ10 is formed by a redox active benzoquinone ring which is connected to a long isoprenoid side chain (9/10-unit in vertebrates) (13). To test our hypothesis we measured CoQ10 levels in bar and ubiadl morphants by HPLC- UV and HPLC-MS techniques in order to show that Ubiadl catalyses the biosynthesis of CoQ10 (Figure 9a,b). The absence of Ubiadl in zebrafish embryos significantly reduced CoQ10 level, while other mevalonate-derived products such as cholesterol and dolichols do not change (Figure 9c,d and data not shown). By time-course synthesis analyses we found that CoQ10 synthesis increased during zebrafish embryonic development. Interestingly, CoQ10 is almost entirely produced by the zygote without any contribution from the yolk sac, on the opposite for cholesterol where there is both a maternal and zygotic contribution (Figure 9e,f).

To further demonstrate that it is the absence of CoQ10 synthesis in zebrafish embryos that caused the bar phenotype CoQ10 was injected in zebrafish embryos at 1 -single cell stage (Figure 9g). Two different CoQ10 formulations significantly rescued bar mutant embryos suggesting that the intake of CoQ10 in Ubiadl deficient embryos restores a normal cardiovascular development and balance ROS overproduction in these cardiovascular tissues. It was shown that UBIAD1 is required for Vitamin K2 production (1 1 ). Surprisingly, exogenous Vitamin K2 do not rescue bar mutant embryos.

Example 3.

Statins cause CoQ10 deficiency and severe cardiovascular defects in zebrafish embryos

The rate-limiting reaction in CoQ10 synthesis is the transfer of the polyprenylpyrophosphate (polyprenyl-PP) derived from mevalonate on the 4-OH- benzoic acid derived from tyrosine metabolism (7) (Figure 16e). To reduce the pool of polyprenyl-PP available for CoQ10 synthesis we treated zebrafish embryos with different HMGCoA reductase inhibitors (Statins). Zebrafish embryos treated with different kinds of Statins showed at high penetrance a barolo-like phenotype characterized by cranial hemorrhages, vascular regression and heart failure (Figure 10a-c). Statins treatment produce oxidative stress in zebrafish embryos as measured by catalase activity (Figure 10d). Embryo treatment with Statins even for a short period of time efficiently reduces CoQ10 synthesis while do not interfere with cholesterol synthesis (Figure 10e,f). Zebrafish embryos treated at the same developmental stages with the squalene synthase inhibitor (SQI) and with farnesyl or geranyl-geranyl tranferase inhibitors (FTI or GGTI) did not show these developmental defects (Figure 9a-d).

These data indicate that the absence of CoQ10 (but not of cholesterol and/or of protein prenylation, two other final products of the mevalonate pathway) is not the cause of the Statin-induced cardiovascular oxidative phenotype. Overall these data suggest that Ubiadl is a new enzyme involved in CoQ10 synthesis and its depletion by Statins treatment must be counteracted by CoQ10 intake.

Example 4.

Loss of UBIAD1 expression cause oxidative stress in cardiovascular tissues

Cell culture, western blot and UBIAD1 localization studies.

We cultured primary human endothelial cells (HUVECs and HUAECs) according to the manufacturer's protocols (Lonza). Endothelial cells were transfected with same amount (60pmoles/sample) of siRNA CTRL and UBIAD1 (siGENOME, Dharmacon) or expression constructs. pCDNA-GFP was used as control of electroporation (Amaxa). Western blot analyses were performed as previously described (18). For UBIAD1 localization studies cells were plated on fibronectin-coated glass slides. After 48 hours cells were washed and fixed in 4% paraformaldehyde. Cells were then permeabilized and incubated with the following primary antibodies: goat anti UBIAD1 (1 :50, Santa Cruz biotechnology), mouse anti GM130 (1 :100, BD Biosciences), mouse anti γ-adaptin (1 :100, BD Biosciences), mouse anti PABP (1 :100Sigma). Secondary antibodies were from Alexa Fluor (Invitrogen). Nuclei were stained with Hoechst.

ROS detection, Catalase and NADP/NADPH assays.

For intracellular ROS detection cells were incubated with following probes: MitoSox®

Red mitochondrial superoxide indicator (Invitrogen) and Hydroethidium (Invitrogen) and then fixed in 4% paraformaldehyde and analysed at confocal microscope.

Catalase Activity and NADP/NADPH ratio (Abeam) were measured on pools of 25 embryos at 72hpf. Embryos were microhomogenizated in cold assay buffer and 50μΙ were used for quantifications according to manufacturer's protocol.

Ubiadi Monoclonal antibody.

Monoclonal antibody against UBIAD1 (clone 9D4) was produced in our laboratory by immunizing mice with recombinant GST- Ubiadi (aa 96-126) fusion protein and its reactivity was characterized in ELISA, completion with peptide, western blot and immunofluorescence.

Results

Oxidative stress analyses were performed in bar mutant embryos (Figure. 1 1 a,b) to see whether bar mutant embryos suffer of unbalance ROS production and oxidative stress in cardiovascular tissues. We determined that catalase activity and NADP/NADPH ratio were significantly increased in bar mutants compared to respective sibling embryos. To evaluate whether this redox disequilibrium is caused by oxidative stress we used specific ROS detector on bar and sibling embryos (Figure 1 1 c). Myocardial and endothelial cells of bar mutant embryos showed ROS overproduction suggesting that the absence of ubiadi may cause accumulation of ROS in heart and blood vessels and following cell death and cardiovascular failure. Since vertebrate ubiadi is ubiquitously expressed and shows high levels in heart (Figure 6) a challenging question is why mainly cardiovascular tissues are sensitive to the absence of ubiadi . Hemodynamic environment, such as increased blood flow shear stress, are known to lead to vascular remodeling by ROS generation (12, 13). It was tested whether shear stress-induced ROS signaling modulated the phenotype of endothelial cells during early development. Blood circulation and shear stress were blocked by injecting tnnt2 morpholino in bar mutant embryos (Figure 1 1 d). Surprisingly, we detected a significant rescue of bar phenotype evaluated as heart failure and ISV regression (data not shown and Figure 1 1 e). Also, when we treated bar embryos starting at 46hpf with the anaesthetic tricaine methanesulphonate to arrest the heart and block circulation a significant percentage of bar mutant embryos fails to show EC and heart regression (data not shown).

To further investigate the role of UBIAD1 in regulating ROS excess and oxidative stress in cardiovascular tissues we depleted endogenous UBIAD1 in human primary endothelial cells by siRNA transfection (Figure 12a,b). Depletion of UBIAD1 reduced CoQ10 level (Figure 1 1 f) and increased oxidative stress (data not shown). To address the role of UBIAD1 as an antioxidant enzyme we expose control-cells (siCTRL) and cells depleted of UBIAD1 (siUBIADI ) to oxidative stress (H2O2 exposure). While siCTRL-transfected cells can buffer H2O2-mediated oxidative stress (e.g. ROS), siUBIADI -treated cells show oxidative stress (Figure 13a,b) and ROS-mediated signaling as demonstrated by Mitosox® staining and western blot analyses for Akt and p38 pathway activation (Figure 1 1 g,h). Overall these data suggest that UBIAD1 is a new anti-oxidant enzyme that protects endothelial cells via CoQ10 synthesis.

Example 5.

UBIAD1 is localized in the Golgi compartment in endothelial cells

In order to verify whether Ubiadl might be a new enzyme responsible for cellular (non- mitochondrial) CoQ10 production, we examined its subcellular localization. On the basis of its amino-acid structure, Ubiadl is conserved among species and it has been predicted to be a transmembrane protein (Figure 7 and Figure 14). Using primary human endothelial cells we performed immunolocalization studies on endogenous UBIAD1 localization (Figure 15a). UBIAD1 is localized in a perinuclear region like the Golgi compartment. Colocalization studies using the Golgi markers GM130 and TGN46 were are able to identify endogenous UBIAD1 in proximity of the Golgi compartment. Similar results were obtained with human endothelial cells expressing a GFP-tagged zebrafish Ubiadl fusion protein (Figure 15b,c). GFP stains a perinuclear region typical of Golgi compartments and co-localized with the Golgi markers GM- 130 and γ-adaptin (Figure 17). To further confirm that Ubiadl is a Golgi protein, we treated Ubiadl - expressing cells with Brefeldin A (BFA), an antibiotic that causes disassembly of the Golgi complex and accumulation of secretory proteins in the endoplasmic reticulum. We demonstrated a rapid redistribution of Ubiadl proteins into the ER-Golgi in cells treated with brefeldin A supporting its physiological Golgi localization (Figure 15c). These results strongly suggest that UBIAD1 may be a new cellular CoQ10 biosynthetic enzyme specifically localized in the Golgi compartment where a large amount of cellular CoQ10 are normally synthesized (9) and plays an important anti-oxidant function.

Example 6.

SCCD mutations protect cardiovascular tissues from oxidative stress by CoQ10 production

Human UBIAD1 constructs.

Human SCCD mutant isoforms UBIAD1 -N102S and UBIAD1 -D1 12G were generated with QuickChange site-directed mutagenesis kit (Stratagene) with following primers: D1 12G FW: 5'- CTTTTC C AAG G G C ATTG G C C AC A AAA AG AG TG ATG -3 ' , RW: 5'- C ATC ACTCTTTTTG TG G C C AATG C C CTTG G AAA AG -3 ' ) and

N102S: FW:5'-CGGGGCCGGTAATTTGGTCAGCACTTACTATGACTTTTCC-3', RW:5'-

GGAAAAGTCATAGTAAGTGCTGACCAAATTACCGGCCCCG-3'.

All constructs were then amplified and subcloned into pGEM T-easy vector with following primers: human UBIAD1 forms:

FW: 5'-AAAGAATTCTCCATGGCGGCCTCTCAG-3',

RW: 5'-GAAAGATCTAATTTTGGGCAGACTGCC-3'.

Results

Mutations in the UBIAD1 gene are found to cause the autosomal dominant eye disease Schnyder Crystalline Corneal Syndrome or SCCD (MIM 121800) (14, 15).

SCCD patients are characterized by an abnormal deposition of cholesterol and phospholipids in the cornea resulting in progressive corneal opacification and visual loss.

Thirty-one apparently unrelated families have been examined and fifteen different mutations have been characterized (16). Genetic analysis of families revealed putative mutations hotspot that altered an asparagine at position 102 to a serine reside and a aspartic acid at position 1 12 to a glycine (14, 15, 17). In order to investigate whether these mutations have similar effects to bar mutations and whether protein activity is up- or down- regulated by familial mutations, we generated human UBIAD1 constructs bearing these two SCCD mutations (UBIAD1 -N102S and UBIAD1 - D1 12G) and used them to rescue the bar mutant embryos (Figure 16a). Surprisingly, both SCCD mutations as well as the UBIAD1 are able to rescue the genetic absence of Ubiadl during zebrafish development. We therefore expressed these mutant forms in endothelial cells. Interestingly we detected a more diffuse and non-Golgi distribution suggesting a putative mislocalization of these mutant forms in the cells compared to wild-type form (Figure 16b). Furthermore, when introduced in ECs the SCCD mutant forms produced higher amount of CoQ10 compared to wild-type protein (Figure 16c). Surprisingly, all forms synthesize the same amount of cholesterol (Figure 16d). We also demonstrated that SCCD-mutations interfere with cellular CoQ10 synthesis possibly increasing CoQ10 synthesis due to protein mislocalization.

From the above description and the above-noted examples, the advantage attained by the present invention are apparent.

References

1 Finkel, T. & Holbrook, N.J., Oxidants, oxidative stress and the biology of ageing. Nature 408 (6809), 239-247 (2000).

2 Hare, J.M. & Stamler, J.S., NO/redox disequilibrium in the failing heart and cardiovascular system. J Clin Invest 1 15 (3), 509-517 (2005).

3 Finkel, T., Oxidant signals and oxidative stress. Curr Opin Cell Biol 15 (2), 247-254 (2003).

4 Giordano, F.J., Oxygen, oxidative stress, hypoxia, and heart failure. J Clin Invest 1 15 (3), 500-508 (2005).

5 Crane, F.L., Discovery of ubiquinone (coenzyme Q) and an overview of function. Mitochondrion 7 Suppl, S2-7 (2007).

6 Navas, P., Villalba, J.M., & de Cabo, R., The importance of plasma membrane coenzyme Q in aging and stress responses. Mitochondrion 7 Suppl, S34-40 (2007).

7 Bentinger, M., Tekle, M., & Dallner, G., Coenzyme Q~biosynthesis and functions. Biochem Biophys Res Commun 396 (1 ), 74-79 (2010).

8 Bentinger, M. et al., Stimulation of coenzyme Q synthesis. Biofactors 32 (1 - 4), 99-1 1 1 (2008).

9 Kalen, A., Appelkvist, E.L., Chojnacki, T., & Dallner, G., Nonaprenyl-4- hydroxybenzoate transferase, an enzyme involved in ubiquinone biosynthesis, in the endoplasmic reticulum-Golgi system of rat liver. J Biol Chem 265 (2), 1 158-1 164 (1990).

10 Forsgren, M. et al., Isolation and functional expression of human COQ2, a gene encoding a polyprenyl transferase involved in the synthesis of CoQ.

Biochem J 382 (Pt 2), 519-526 (2004).

1 1 Nakagawa, K. et al., Identification of UBIAD1 as a novel human

menaquinone-4 biosynthetic enzyme. Nature 468 (7320), 1 17-121 .

12 Ungvari, Z., Wolin, M.S., & Csiszar, A., Mechanosensitive production of reactive oxygen species in endothelial and smooth muscle cells: role in microvascular remodeling? Antioxid Redox Signal 8 (7-8), 1 121 -1 129 (2006).

13 Matlung, H.L., Bakker, E.N., & VanBavel, E., Shear stress, reactive oxygen species, and arterial structure and function. Antioxid Redox Signal 1 1 (7), 1699-1709 (2009).

14 Orr, A. et al., Mutations in the UBIAD1 gene, encoding a potential

prenyltransferase, are causal for Schnyder crystalline corneal dystrophy. PLoS

ONE 2 (1 ), e685 (2007).

15 Weiss, J.S. et al., Mutations in the UBIAD1 gene on chromosome short arm 1 , region 36, cause Schnyder crystalline corneal dystrophy. Invest Ophthalmol

Vis Sci 48 (1 1 ), 5007-5012 (2007).

16 Weiss, J.S. et al., Genetic analysis of 14 families with Schnyder crystalline

corneal dystrophy reveals clues to UBIAD1 protein function. Am J Med Genet

A 146 (3), 271 -283 (2008).

17 Yellore, V.S. et al., Identification of mutations in UBIAD1 following

exclusion of coding mutations in the chromosome 1 p36 locus for Schnyder

crystalline corneal dystrophy. Mol Vis 13, 1777-1782 (2007).

18. Santoro, M.M., Samuel, T., Mitchell, T., Reed, J.C., and Stainier, D.Y. (2007). Birc2 (clap1 ) regulates endothelial cell integrity and blood vessel homeostasis. Nat. Genet. 39, 1397-1402.

19. Jin, S.W., Herzog, W., Santoro, M.M., Mitchell, T.S., Frantsve, J., Jungblut, B., Beis, D., Scott, I.C., D'Amico, L.A., Ober, E.A. et al., (2007). A transgene-assisted genetic screen identifies essential regulators of vascular development in vertebrate embryos. Dev. Biol. 307, 29-42.

Claims

1 . An Ubiadl for use as a medicament.

2. The Ubiadl according to claim 1 , wherein said medicament is an antioxidizing agent.

3. The Ubiadl according to claim 2, wherein said medicament produces and activates Coenzyme Q10.

4. An Ubiadl for use in the treatment of diseases that result from oxidative stress.

5. An Ubiadl for use in the treatment of diseases that result from the formation of reactive oxygen species.

6. The Ubiadl according to anyone of claims 4 or 5, wherein said diseases are cardiovascular diseases.

7. The Ubiadl according to claim 6, wherein said cardiovascular diseases are chosen from the group consisting of hypertension, atherosclerosis, ischemic heart disease, cardiomyopathies, myocardial infarction and congestive heart failure.

8. The Ubiadl according to claim 4, wherein said oxidative stress results in cardiac and vascular myocyte impairment.

9. The Ubiadl according to claim 4, wherein said oxidative stress results in hyperlipidemia or excess deposition of cholesterol.

10. The Ubiadl according to claim 9, wherein said excess deposition of cholesterol occurs in the corneal stroma.

1 1. The Ubiadl according to claim 10, wherein said excess deposition of cholesterol in the corneal stroma determines Schnyder Crystalline Corneal Dystrophy.

12. The Ubiadl according to claim 5, wherein said reactive oxygen species enhances the toxicity of statins.

13. The Ubiadl according to claim 12, wherein said toxicity of statins is counteracted.

14. The Ubiadl according to claim 5, wherein said diseases are myopathies.

15. The Ubiadl according to claim 14, wherein said diseases are statin-induced myopathies.

16. An Ubiadi for use in the treatment of Schnyder Crystalline Corneal Dystrophy.

17. An Ubiadi for use in up-regulating Coenzyme Q10 synthesis.

18. A cosmetic preparation comprising Ubiadi together with common cosmetic additives.