WO2012106175A1 - Trrap and grin2a mutations and use thereof for the diagnosis and treatment of melanoma - Google Patents
Trrap and grin2a mutations and use thereof for the diagnosis and treatment of melanoma Download PDFInfo
- Publication number
- WO2012106175A1 WO2012106175A1 PCT/US2012/022687 US2012022687W WO2012106175A1 WO 2012106175 A1 WO2012106175 A1 WO 2012106175A1 US 2012022687 W US2012022687 W US 2012022687W WO 2012106175 A1 WO2012106175 A1 WO 2012106175A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- grin2a
- mutation
- seq
- trrap
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Definitions
- This disclosure concerns diagnostic markers for melanoma. In particular, this disclosure concerns identification of mutations in the
- TRRAP transformation/transcription domain- associated protein
- GIN2A glutamate receptor, ionotropic, N-methyl D-aspartate 2A
- Melanoma is the most deadly form of skin cancer. Despite years of research, metastatic melanoma disease has a dismal prognosis and is often fatal (Jemal et al, CA Cancer J Clin 59:225-249, 2009). There are few therapeutic options for melanoma patients, demonstrating a need for new clinically relevant targets.
- Glutamate antagonists have previously been shown to inhibit proliferation of human tumor cells (Rzeski et al, Proc Natl Acad Sci USA 98(11):6372-6377, 2001). Glutamate is known to activate two different types of receptors - ionotropic glutamate receptors (iGluRs) and metabotropic glutamate receptors (mGlus).
- iGluRs ionotropic glutamate receptors
- mGlus metabotropic glutamate receptors
- iGluRs are ligand-gated ion channels that allow cations, such as calcium and potassium, to pass through the plasma membrane of the cell after being bound by glutamate. iGluRs are subdivided into three receptor types according to agonist response, one of which is N-methyl-D-aspartate (NMD A) (Hollmann and
- GRIN2A N-methyl D-aspartate 2A
- TRRAP transformation/transcription domain-associated protein
- TRRAP is an adaptor protein found in various multiprotein chromatin complexes with histone acetyltransferase activity, which in turn is responsible for epigenetic transcription activation.
- TRRAP plays a central role in the transcriptional activity of p53, c-Myc, E2F1 and other transcription factors (McMahon et al, Cell 94:363-374, 1998; Barlev et al, Mol Cell 8: 1243-1254, 2001).
- TRRAP knockout mice are embryonic lethal suggesting that TRRAP is essential for cell survival (Herceg et al., Nat Genet 29:206- 211, 2001).
- Disclosed herein are 68 human genes with an elevated mutation frequency in melanoma. This disclosure specifically describes the identification of nine genes with recurring mutations in melanoma and 16 genes that are highly mutated in melanoma. In particular, disclosed herein is the identification of a recurrent
- a method of diagnosing a subject as having melanoma, or having a greater susceptibility to developing melanoma by detecting at least one mutation in the TRRAP gene or the GRIN2A gene.
- the presence of the at least one mutation indicates the subject has melanoma or is susceptible to developing
- the TRRAP mutation is C2165T (numbered with reference to SEQ ID NO: 1).
- the GRIN2A mutation is a mutation that occurs in the PBPl_iGluR_NMDA_NR2 domain, the Lig_chan domain or the NMDAR2_C domain of GRIN2A.
- the GRIN2A mutation is selected from one or more of G20A, C170T, T547A, G754A, C833T, G1028A, G1111A, G1116A, G1117A, G1346A, T1376C, A1784G, C1793T, G1959A, G2135A, G2218A, G2666A, C2671T, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A, G3812A, C3827G, G3854A, C3952T, C4097T, G4261A, C4274T, G4276A and C4385G (numbered with reference to SEQ ID NO: 3).
- the subject who has the detected mutation is further treated with an anti-melanoma therapy.
- a method of selecting a therapy for a subject diagnosed with melanoma by detecting the presence or absence of a C2165T mutation in the TRRAP gene (SEQ ID NO: 1). An inhibitor of TRRAP is selected if the C2165T mutation in the TRRAP gene is present. Also provided is a method of selecting a therapy for a subject diagnosed with melanoma, comprising detecting the presence or absence of at least one mutation in the GRIN2A gene disclosed herein. An inhibitor of GRIN2A or a glutamate antagonist is selected for therapy if at least one mutation in GRIN2A is identified.
- the present disclosure further provides synthetic oligonucleotides as probes that specifically hybridize with a nucleic acid molecule encoding human TRRAP or human GRIN2A comprising at least one of the mutations disclosed herein. Also provided are arrays comprising a substrate to which are bound one or more of the oligonucleotides specific for mutant TRRAP or mutant GRIN2A.
- oligonucleotides may be located at addressable locations on the array.
- FIG. 1 is a series of schematic illustrations showing the distribution of novel nonsynonymous recurrent mutations in melanoma in TRRAP, DCC, PLCHl, NOSl, LRRN3, ZNF831 and SLC17A5. Seven novel nonsynonymous recurrent mutations identified in the study disclosed herein are presented on relevant protein schematics.
- Black arrows indicate locations of recurrent mutations and conserved protein functional domains are indicated as boxes (1: Immunoglobulin I-set domain; 2: Fibronectin type III domain; 3: Neogenin C-terminus; 4: Phosphoinositide-specific phospholipase C, efhand-like; 5: Phosphatidylinositol- specific phospholipase C, X domain; 6: Phosphatidylinositol- specific phospholipase C, Y domain; 7: C2 domain; 8: PDZ domain; 9: Nitric oxide synthase, oxygenase domain; 10: Flavodoxin; 11: FAD binding domain; 12: Oxidoreductase NAD-binding domain; 13: LRRNT: Leucine rich repeat N-terminal domain; 14: Leucine Rich Repeat; 15:
- Immunoglobulin I-set domain 16: Fibronectin type III domain; 17: Major Facilitator Superfamily).
- FIGS. 2A-2J are a series of graphs and immunoblots showing the effect of mutant TRRAP on cell growth.
- FIG. 2A is a table showing mutant TRRAP induces cell transformation in NIH 3T3 cells. The table shows focus formation of NIH 3T3 cells transfected with the indicated constructs or empty vector control. KRas° 12V was included as a positive control for cell transformation.
- FIG. 2B is an
- FIG. 2C shows an immunoblot of cell lysates from HEK 293T cells transiently transfected with either control vector or shRNAs that target TRRAP. For normalization, lysates were analyzed in parallel by anti-a- tubulin immunoblotting.
- FIG. 2D is an anti-TRRAP immunoblot of melanoma cells transduced with shRNA targeting TRRAP. For normalization, lysates were analyzed in parallel by anti-a-tubulin immunoblotting.
- FIGS. 2E-2H are graphs showing TRRAP mutation confers resistance to apoptosis.
- FIG. 3A is a schematic illustration showing the locations of somatic mutations in GRIN2A.
- NMDAR2_C N-methyl D-aspartate receptor 2B3 C-terminus). Somatic mutations are indicated with arrows and the amino acid changes are listed. Recurrent mutations in GRIN2A are S278F, E371K and El 175K. Nonsense mutations are indicated by black boxes.
- FIG. 3B is a schematic illustration showing glutamate signaling pathway mutations in melanoma.
- the genes that function in glutamate signaling are specified. Circled genes have somatic mutations. The number of mutations in each gene is indicated by the number adjacent to the circle (PSD complex: post synaptic density complex; NMDAR: N-methyl-D-aspartic acid (NMDA) receptor; RTK: receptor tyrosine kinase) .
- PSD complex post synaptic density complex
- NMDAR N-methyl-D-aspartic acid (NMDA) receptor
- RTK receptor tyrosine kinase
- FIG. 4 is a graph showing mutation spectra of single base pair substitutions in melanoma whole exome sequencing. The number of each of the six classes of base substitutions resulting in nonsynonymous changes in the whole exome screen is shown.
- FIG. 5 is a series of chromatograms showing a recurrent hotspot mutation in
- TRRAP in representative melanoma tumor samples and the commercially available A375 cell line.
- the top sequence chromatogram was obtained from normal tissue and the lower sequence chromatogram from the indicated tumors. Arrows indicate the location of the missense mutations.
- the nucleotide and amino acid alterations are indicated below the chromatograms.
- the sequences shown in the chromatograms are TGTCTCCCTCT (SEQ ID NO: 5) for normal tissue;
- TGTCTYCCTCT (SEQ ID NO: 6) for tumor samples; and TGTCTYYCTCT (SEQ ID NO: 7) for the A375 cell line.
- FIG. 6 is a sequence comparison of conserved serine-722 of human TRRAP with its orthologs.
- the human TRRAP orthologs for 12 species were compared using the indicated NCBI accession numbers by COBALT algorithm (available online at www.ncbi.nlm.nih.gov/tools/cobalt/colbat.cgi).
- the human TRRAP sequence (amino acids 697-747 of SEQ ID NO: 2) is compared with sequences from Canis familiaris (SEQ ID NO: 8), Pan troglodytes (SEQ ID NO: 9), Bos Taurus (SEQ ID NO: 10), Rattus norvegicus (SEQ ID NO: 11), Gallus gallus (SEQ ID NO: 12), Danio rerio (SEQ ID NO: 13), Mus musculus (SEQ ID NO: 14), D.
- SEQ ID NO: 15 melanogaster
- Anopheles gamiae SEQ ID NO: 16
- C. elegans SEQ ID NO: 17
- S. cerevisiae SEQ ID NO: 18
- FIG. 7 is a graph showing mutation spectra of single base pair substitutions in GRIN2A. The number of each of the six classes of base substitutions resulting in nonsynonymous changes in GRIN2A is shown.
- FIG. 8 is a schematic of the whole exome capture and sequencing analysis of 14 melanoma samples.
- FIG. 9 is a table showing score cutoff for determination of melanoma somatic mutations.
- FIGS. 10A-10D are a series of graphs showing the effect of mutant TRRAP on cell growth. Apoptosis was quantified for melanoma cell lines transduced with shRNA control or shRNAs targeting TRRAP. Cells were grown in medium containing 10% serum for the indicated times. Apoptosis was assessed by fluorescence microscopy of Hoechst 33258-stained cells.
- FIGS. 11A-11B demonstrate that melanoma cells expressing mutant forms of GRIN2A have increased ability for anchorage-independent growth.
- FIGS. 12A-12B are a set of graphs showing GRIN2A functions as a tumor suppressor in melanoma cells. Endogenous GRIN2A was stably depleted in melanoma cells using shRNA specific for human GRIN2A.
- A Proliferation assay of mutant expressing GRIN2A cell lines depleted of endogenous GRIN2A. Knock- down using GRIN2 A- specific shRNA (#1, #2 and #3) resulted in little to no change in proliferation for 125T or 501Mel melanoma cell lines.
- B Proliferation assay of wild-type expressing GRIN2A cell lines depleted of GRIN2A. Knock-down resulted in increased proliferation for both 3 IT and 39T compared to empty vector control (pLKO.l).
- FIGS. 13A-13B demonstrate that somatic mutations in GRIN2A have adverse effects on receptor function and formation.
- A Influx of calcium upon NMDA stimulation of transiently transfected HEK293T cells shows decreased calcium permeability in cells expressing mutant forms of GRIN2A.
- B Mutant forms of GRIN2A bind GRIN1 with reduced affinity, thus causing decreased
- HEK293T cells were transiently transfected with WT GRIN! and GRIN2A (WT or mutants) or empty vectors as control and
- Immunoprecipitates were probed with anti-GRIN2A and anti-GRINl to confirm binding. Lysates were probed with anti- GRIN2A and anti-GAPDH as a loading control.
- nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.
- sequence Listing is submitted as an ASCII text file, created on January 18, 2012, 82.6 KB, which is incorporated by reference herein. In the accompanying sequence listing:
- SEQ ID NO: 1 is the nucleotide sequence of human TRRAP (CCDS ID NO: 1).
- SEQ ID NO: 2 is the amino acid sequence of human TRRAP (CCDS ID 5659.1).
- SEQ ID NO: 3 is the nucleotide sequence of human GRIN2A (CCDS ID 10539.1).
- SEQ ID NO: 4 is the amino acid sequence of human GRIN2A (CCDS ID 10539.1).
- SEQ ID NOs: 5-7 are nucleotide sequences of the region surrounding the TRRAP hotspot mutation from a control sample, a tumor sample and A375 cells, respectively.
- SEQ ID NOs: 8-18 are amino acid sequences of a segment of the TRRAP protein from several different species.
- SEQ ID NOs: 19-24 are nucleotide sequences of TRRAP primers used for recurrent mutation confirmation.
- SEQ ID NOs: 25-62 are nucleotide sequences of GRIN2A primers used for PCR and sequencing.
- SEQ ID NOs: 63-66 are nucleotide sequences of TRRAP mutation primers.
- SEQ ID Nos: 67-72 are TRRAP- specific shRNA sequences.
- Administration The introduction of a composition into a subject by a chosen route.
- the chosen route is intravenous
- the composition is administered by introducing the composition into a vein of the subject.
- Antagonist A molecule or compound that blocks or inhibits the activity of another molecule or compound (such as a drug that inhibits the function of a protein).
- Array An arrangement of molecules, such as biological macromolecules (such as peptides or nucleic acid molecules) or biological samples (such as tissue sections), in addressable locations on or in a substrate.
- a "microarray” is an array that is miniaturized so as to require or be aided by microscopic examination for evaluation or analysis. Arrays are sometimes called DNA chips or biochips.
- the array of molecules makes it possible to carry out a very large number of analyses on a sample at one time.
- one or more molecules (such as an oligonucleotide probe) will occur on the array a plurality of times (such as twice), for instance to provide internal controls.
- the number of addressable locations on the array can vary, for example from at least two, at least four, at least six, to at least 9, at least 10, at least 14, at least 15, at least 20, at least 30, at least 50, at least 75, at least 100, at least 150, at least 200, at least 300, at least 500, least 550, at least 600, at least 800, at least 1000, or more.
- an array includes 2-100 addressable locations, such as 4-20 addressable locations.
- an array consists essentially of oligonucleotide probes specific for the somatic mutations in TRRAP and/or GRIN2A disclosed herein.
- an array includes nucleic acid molecules, such as oligonucleotide sequences that are at least 15 nucleotides in length, such as about 15-40 nucleotides in length.
- each arrayed sample is addressable, in that its location can be reliably and consistently determined within at least two dimensions of the array.
- the feature application location on an array can assume different shapes.
- the array can be regular (such as arranged in uniform rows and columns) or irregular.
- the location of each sample is assigned to the sample at the time when it is applied to the array, and a key may be provided in order to correlate each location with the appropriate target or feature position.
- ordered arrays are arranged in a symmetrical grid pattern, but samples could be arranged in other patterns (such as in radially distributed lines, spiral lines, or ordered clusters).
- Addressable arrays usually are computer readable, in that a computer can be programmed to correlate a particular address on the array with information about the sample at that position (such as hybridization or binding data, including for instance signal intensity).
- the individual features in the array are arranged regularly, for instance in a Cartesian grid pattern, which can be correlated to address information by a computer.
- Clinical outcome refers to the health status of a patient following treatment for a disease or disorder (such as melanoma), or in the absence of treatment.
- Clinical outcomes include, but are not limited to, an increase in the length of time until death, a decrease in the length of time until death, an increase in the chance of survival, an increase in the risk of death, survival, disease-free survival, chronic disease, metastasis, advanced or aggressive disease, disease recurrence, death, and favorable or poor response to therapy.
- Decrease in survival refers to a decrease in the length of time before death of a patient, or an increase in the risk of death for the patient.
- a decrease in survival also can refer to a decrease in the average time to death in a group, such as a group of patients diagnosed with melanoma.
- Diagnosing refers to the process of identifying the nature or cause of a disease or disorder.
- Glutamate antagonist refers to any compound that blocks glutamate function, such as glutamate function mediated through ionotropic glutamate receptors.
- suitable glutamate antagonists include, for example, compounds that bind ionotropic glutamate receptors (iGluRs), including NMDA receptors (e.g., GRIN2A).
- iGluRs ionotropic glutamate receptors
- NMDA receptors e.g., GRIN2A
- Compounds that bind ionotropic glutamate receptors include compounds which bind -amino-3-hydroxy-5-methyl-4-isoxazole-propionate (AMPA), NMDA, or kainate receptors in a competitive manner or interact with ionotropic glutamate receptor mediated signals in a non-competitive manner.
- AMPA -amino-3-hydroxy-5-methyl-4-isoxazole-propionate
- NMDA NMDA
- kainate receptors in
- glutamate antagonists include, for example, glutathione promoting agents, GABA stimulating agents and certain neurotransmitters.
- Glutamate antagonists are known in the art (see, for example, U.S. Patent Application Publication Nos. 2007/0135413 and 2007/0248690).
- the glutamate antagonist is dizocilpine, GYKI52466, MK-801, AP-5 or CGS 19755 (selfotel).
- GRIN2A glutamate receptor, ionotropic, N-methyl D-aspartate 2A: A subunit of N-methyl-D-aspartate (NMDA) receptors.
- NMDA receptors are a class of ionotropic glutamate-gated ion channels. These receptors have been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning.
- NMDA receptor channels are heteromeric complexes composed of the key receptor subunit NMDARl (GRINl) and 1 or more of the 4 NMDAR2 subunits: NMDAR2A (GRIN2A), NMDAR2B (GRIN2B), NMDAR2C (GRIN2C) and NMDAR2D
- GRIN2D which is also known as NR2A and NMDAR2A, contains the antagonist binding site for glutamate.
- GenBank Accession Nos. NM_000833 and NP_000824 are the nucleotide and amino acid sequences, respectively, of human GRIN2A transcript variant 2.
- GenBank Accession Nos. NM_000833 and NP_000824 are the nucleotide and amino acid sequences, respectively, of human GRIN2A transcript variant 2.
- NCBI CCDS database also provides nucleotide and amino acid sequences for GRIN2A under CCDS ID 10539.1.
- GenBank Accession numbers and CCDS ID numbers listed above and disclosed herein are incorporated by reference as they appear in the database as of December 3, 2010.
- somatic mutations in GRIN2A identified in melanoma tumor samples are referred to by the location of the GRIN2A mutation with reference to SEQ ID NO: 3 (nucleotide) and SEQ ID NO: 4 (amino acid).
- the C833T mutation refers to a cytosine to thymidine substitution at nucleotide 833 (SEQ ID NO: 3), which results in a serine to phenylalanine change at amino acid 278 (S278F; SEQ ID NO: 4).
- Some somatic mutations result in the introduction of a stop codon (a nonsense mutation), for example, the G20A GRIN2A mutation.
- the corresponding amino acid change for the G20A mutation (which occurs at position 7 of SEQ ID NO: 4) is therefore designated W7*.
- the GRIN2A mutation occurs in a portion of the GRIN2A gene that encodes the
- PBPl_iGluR_NMDA_NR2 domain a portion of the GRIN2A gene that encodes the Lig_chan domain; or a portion of the GRIN2A gene that encodes the NMDAR2_C domain.
- the PBPl_iGluR_NMDA_NR2 domain is encoded by nucleotides 94-1176 of SEQ ID NO: 3 and the amino acid sequence of the
- PBP l_iGluR_NMDA_NR2 domain corresponds to residues 32-392 of SEQ ID NO: 4;
- the Lig_chan domain is encoded by nucleotides 1660-2484 of SEQ ID NO: 3 and the amino acid sequence of the Lig_chan domain corresponds to residues 554-828 of SEQ ID NO: 4;
- the NMDAR2_C domain is encoded by nucleotides 2515-4392 of SEQ ID NO: 3 and the amino acid sequence of the NMDAR2_C domain corresponds to residues 839-1464 of SEQ ID NO: 4.
- the GRIN2A mutation is selected from G20A, C170T, T547A, G754A, C833T, G1028A, G1111A, G1116A, G1117A, G1346A, T1376C, A1784G, C1793T, G1959A, G2135A, G2218A, G2666A, C2671T, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A, G3812A, C3827G, G3854A, C3952T, C4097T, G4261A, C4274T, G4276A and C4385G (SEQ ID NO: 3).
- an “inhibitor” refers to any compound that is capable of reducing or altering the expression or activity of a target molecule (such as a nucleic acid molecule or a protein).
- the inhibitor is an inhibitor of TRRAP or GRIN2A.
- Label An agent capable of detection, for example by enzyme-linked immunosorbent assay (ELISA), spectrophotometry, flow cytometry or microscopy.
- ELISA enzyme-linked immunosorbent assay
- a label can be attached to a nucleic acid molecule or protein, thereby permitting detection of the nucleic acid molecule or protein.
- labels include, but are not limited to, radioactive isotopes, enzyme substrates, co-factors, ligands, chemiluminescent agents, fluorophores, haptens, enzymes, and
- the label is a fluorophore ("fluorescent label").
- Fluorophores are chemical compounds, which when excited by exposure to a particular wavelength of light, emits light ⁇ i.e., fluoresces), for example at a different wavelength. Fluorophores can be described in terms of their emission profile, or "color.” Green fluorophores, for example Cy3, FITC, and Oregon GreenTM, are characterized by their emission at wavelengths generally in the range of 515-540 ⁇ . Red fluorophores, for example Texas RedTM, Cy5 and tetramethylrhodamine, are characterized by their emission at wavelengths generally in the range of 590-690 ⁇ .
- fluorophores examples include for instance: 4-acetamido-4'- isothiocyanatostilbene-2,2'disulfonic acid, acridine and derivatives such as acridine and acridine isothiocyanate, 5-(2'-aminoethyl)aminonaphthalene-l-sulfonic acid (EDANS), 4-amino-N-[3-vinylsulfonyl)phenyl]naphthalimide-3,5 disulfonate
- cyanosine 4',6-diaminidino-2-phenylindole (DAPI); 5', 5"-dibromopyrogallol- sulfonephthalein (Bromopyrogallol Red); 7-diethylamino-3-(4'- isothiocyanatophenyl)-4-methylcoumarin; diethylenetriamine pentaacetate; 4,4'- diisothiocyanatodihydro-stilbene-2,2'-disulfonic acid; 4,4'-diisothiocyanatostilbene- 2,2'-disulfonic acid; 5-[dimethylamino]naphthalene-l-sulfonyl chloride (DNS, dansyl chloride); 4-(4'-dimethylaminophenylazo)benzoic acid (DABCYL); 4- dimethylaminophenylazophenyl-4'-isothiocyanate (DABITC); eosin
- Malachite Green isothiocyanate 4-methylumbelliferone; ortho cresolphthalein; nitrotyrosine; pararosaniline; Phenol Red; B-phycoerythrin; o-phthaldialdehyde; pyrene and derivatives such as pyrene, pyrene butyrate and succinimidyl 1-pyrene butyrate; Reactive Red 4 (CibacronTM Brilliant Red 3B-A); rhodamine and derivatives such as 6-carboxy-X-rhodamine (ROX), 6-carboxyrhodamine (R6G), lissamine rhodamine B sulfonyl chloride, rhodamine (Rhod), rhodamine B, rhodamine 123, rhodamine X isothiocyanate, sulforhodamine B, sulforhodamine 101 and sulfonyl chloride derivative of s
- fluorophores include GFP (green fluorescent protein), LissamineTM, diethylaminocoumarin, fluorescein chlorotriazinyl,
- Melanoma A form of cancer that originates in melanocytes (cells that make the pigment melanin). Melanocytes are found primarily in the skin, but are also present in the bowel and eye.
- melanoma refers to any stage of melanoma, or any subtype of melanoma, such as superficial spreading melanoma, nodular melanoma, acral lentiginous melanoma, lentigo maligna, melanoma-in-situ, mucosal melanoma and uveal melanoma.
- Metastasis Refers to the spread of cancer cells from the original tumor to other sites in the body.
- Mutation Any change of the DNA sequence within a gene or chromosome. In some instances, a mutation will alter a characteristic or trait (phenotype), but this is not always the case. Types of mutations include base substitution point mutations (e.g. , transitions or transversions), deletions and insertions. Missense mutations are those that introduce a different amino acid into the sequence of the encoded protein; nonsense mutations are those that introduce a new stop codon. In the case of insertions or deletions, mutations can be in-frame (not changing the frame of the overall sequence) or frame shift mutations, which may result in the misreading of a large number of codons (and often leads to abnormal termination of the encoded product due to the presence of a stop codon in the alternative frame).
- base substitution point mutations e.g. , transitions or transversions
- nonsense mutations are those that introduce a new stop codon.
- mutations can be in-frame (not changing the frame of the overall sequence) or frame shift mutations, which
- This term specifically encompasses variations that arise through somatic mutation, for instance those that are found only in disease cells (such as cancer cells), but not constitutionally, in a given individual. Examples of such somatically- acquired variations include the point mutations that frequently result in altered function of various genes that are involved in development of cancers.
- This term also encompasses DNA alterations that are present constitutionally, that alter the function of the encoded protein in a readily demonstrable manner, and that can be inherited by the children of an affected individual. In this respect, the term overlaps with "polymorphism,” as discussed below, but generally refers to the subset of constitutional alterations that have arisen within the past few generations in a kindred and that are not widely disseminated in a population group.
- a mutation in TRRAP refers to a nucleotide substitution in the TRRAP gene or cDNA, or an amino acid substitution in the TRRAP protein.
- a mutation in GRIN2A refers to a nucleotide substitution in the GRIN2A gene or cDNA, or an amino acid substitution in the GRIN2A protein.
- Oligonucleotide A linear polynucleotide sequence of up to about 100 nucleotide bases in length. In some embodiments, the oligonucleotide is 15-40 nucleotides in length.
- patient includes human and non-human animals.
- the preferred patient for treatment is a human.
- compositions are conventional. Remington's
- compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compounds, molecules or agents are known.
- parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
- pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
- physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like
- solid compositions for example, powder, pill, tablet, or capsule forms
- conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate.
- compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
- non-toxic auxiliary substances such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
- Polymorphism Variant in a sequence of a gene, or any genomic sequence, usually carried from one generation to another in a population. Polymorphisms can be those variations (nucleotide sequence differences) that, while having a different nucleotide sequence, produce functionally equivalent gene products, such as those variations generally found between individuals, different ethnic groups, and geographic locations.
- the term polymorphism also encompasses variations that produce gene products with altered function, i.e., variants in the gene sequence that lead to gene products that are not functionally equivalent. This term also encompasses variations that produce no gene product, an inactive gene product, a truncated gene product, or increased or increased activity gene product.
- Polymorphisms can be referred to, for instance, by the nucleotide position at which the variation exists, by the change in amino acid sequence caused by the nucleotide variation, or by a change in some other characteristic of the nucleic acid molecule or protein that is linked to the variation (e.g. , an alteration of a secondary structure such as a stem-loop, or an alteration of the binding affinity of the nucleic acid for associated molecules, such as polymerases, RNAses, a change in the availability of a site for cleavage by a restriction endonuclease, either the formation of a new site, or lose of a site, and so forth).
- a change in some other characteristic of the nucleic acid molecule or protein that is linked to the variation e.g. , an alteration of a secondary structure such as a stem-loop, or an alteration of the binding affinity of the nucleic acid for associated molecules, such as polymerases, RNAses, a change in the availability
- Polypeptide A polymer in which the monomers are amino acid residues which are joined together through amide bonds. When the amino acids are alpha- amino acids, either the L-optical isomer or the D-optical isomer can be used.
- polypeptide or protein as used herein are intended to encompass any amino acid sequence and include modified sequences such as glycoproteins.
- polypeptide is specifically intended to cover naturally occurring proteins, as well as those which are recombinantly or synthetically produced.
- amino acid residue includes reference to an amino acid that is incorporated into a protein, polypeptide, or peptide.
- Conservative amino acid substitutions are those substitutions that, when made, least interfere with the properties of the original protein, that is, the structure and especially the function of the protein is conserved and not significantly changed by such substitutions. Examples of conservative substitutions are shown in the following table.
- Conservative substitutions generally maintain (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain.
- substitutions which in general are expected to produce the greatest changes in protein properties will be non-conservative, for instance changes in which (a) a hydrophilic residue, for example, seryl or threonyl, is substituted for (or by) a hydrophobic residue, for example, leucyl, isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, for example, lysyl, arginyl, or histadyl, is substituted for (or by) an electronegative residue, for example, glutamyl or aspartyl; or (d) a residue having a bulky side chain, for example, phenylalanine, is substituted for (or by) one not having a side chain, for example, glycine.
- a hydrophilic residue for example, seryl or threonyl
- inhibiting refers to inhibiting the full development of a disease.
- Treating refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition after it has begun to develop.
- Treating refers to the reduction in the number or severity of signs or symptoms of a disease.
- a probe comprises an isolated nucleic acid capable of hybridizing to a target nucleic acid.
- a detectable label or reporter molecule can be attached to a probe or primer.
- Typical labels include radioactive isotopes, enzyme substrates, co-factors, ligands, chemiluminescent or fluorescent agents, haptens, and enzymes. Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed, for example in Sambrook et al. (In Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989) and Ausubel et al. (In Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1998).
- an "oligonucleotide” is a probe or primer.
- a probe includes at least one fluorophore, such as an acceptor fluorophore or donor fluorophore.
- a fluorophore can be attached at the 5'- or 3'-end of the probe.
- the fluorophore is attached to the base at the 5'-end of the probe, the base at its 3'-end, the phosphate group at its 5'-end or a modified base, such as a T internal to the probe.
- Probes are generally at least 15 nucleotides in length, such as at least 15, at least 16, at least 17, at least 18, at least 19, least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50 at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least 67, at least 68, at least 69, at least 70, or more contiguous nucleotides complementary to the target nucleic acid molecule, such
- Primers are short nucleic acid molecules, for instance DNA oligonucleotides 15 nucleotides or more in length, which can be annealed to a complementary target nucleic acid molecule by nucleic acid hybridization to form a hybrid between the primer and the target nucleic acid strand.
- a primer can be extended along the target nucleic acid molecule by a polymerase enzyme. Therefore, primers can be used to amplify a target nucleic acid molecule.
- a primer that includes 30 consecutive nucleotides will anneal to a target sequence with a higher specificity than a corresponding primer of only 15 nucleotides.
- probes and primers can be selected that include at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70 or more consecutive nucleotides.
- a primer is at least 15 nucleotides in length, such as at least 15 contiguous nucleotides complementary to a target nucleic acid molecule.
- primers having at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, or more contiguous nucleotides complementary to the target nucleic acid molecule to be amplified, such as a primer of 15-70 nucleotides, 15-60 nucleotides, 15-50 nucleotides, 15-40 nucleotides or 15-30 nucleotides.
- Primer pairs can be used for amplification of a nucleic acid sequence, for example, by PCR, real-time PCR, or other nucleic-acid amplification methods known in the art.
- An "upstream” or “forward” primer is a primer 5' to a reference point on a nucleic acid sequence.
- a “downstream” or “reverse” primer is a primer 3' to a reference point on a nucleic acid sequence. In general, at least one forward and one reverse primer are included in an amplification reaction.
- Nucleic acid probes and primers can be readily prepared based on the nucleic acid molecules provided herein. It is also appropriate to generate probes and primers based on fragments or portions of these disclosed nucleic acid molecules, for instance regions that encompass the identified mutations of interest.
- PCR primer pairs can be derived from a known sequence by using computer programs intended for that purpose such as Primer (Version 0.5, ⁇ 1991, Whitehead Institute for Biomedical Research, Cambridge, MA) or PRIMER EXPRESS® Software (Applied Biosystems, AB, Foster City, CA).
- Prognosis The likelihood of the clinical outcome for a subject afflicted with a specific disease or disorder.
- the prognosis is a representation of the likelihood (probability) that the subject will survive (such as for one, two, three, four or five years) and/or respond to anti-melanoma treatment, and/or the likelihood (probability) that the tumor will metastasize.
- a "poor prognosis” indicates a greater than 50% chance that the subject will not survive to a specified time point (such as one, two, three, four or five years), and/or a greater than 50% chance that the tumor will metastasize.
- a poor prognosis indicates that there is a greater than 60%, 70%, 80%, or 90% chance that the subject will not survive and/or a greater than 60%, 70%, 80% or 90% chance that the tumor will metastasize.
- a "good prognosis" indicates a greater than 50% chance that the subject will survive to a specified time point (such as one, two, three, four or five years), and/or a greater than 50% chance that the tumor will not metastasize.
- a good prognosis indicates that there is a greater than 60%, 70%, 80%, or 90% chance that the subject will survive and/or a greater than 60%, 70%, 80% or 90% chance that the tumor will not metastasize.
- Sample A biological specimen containing genomic DNA, RNA, protein, or combinations thereof, obtained from a subject. Examples include, but are not limited to, peripheral blood, urine, saliva, tissue biopsy (such as skin tissue), surgical specimen, and autopsy material.
- a sample includes a biopsy of a melanoma tumor or a sample of normal tissue, such as skin tissue (from a subject not afflicted with a known disease or disorder, such as a cancer-free subject).
- Specific hybridization refers to the binding, duplexing, or hybridizing of a molecule only or substantially only to a particular nucleotide sequence when that sequence is present in a complex mixture (e.g. total cellular DNA or RNA). Specific hybridization may also occur under conditions of varying stringency.
- Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing DNA used. Generally, the temperature of hybridization and the ionic strength (especially the Na + concentration) of the hybridization buffer will determine the stringency of hybridization. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed by Sambrook et al. (In: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989 ch. 9 and 11). By way of illustration only, a hybridization experiment may be performed by hybridization of a DNA molecule to a target DNA molecule which has been electrophoresed in an agarose gel and transferred to a nitrocellulose membrane by Southern blotting (Southern, J. Mol. Biol. 98:503, 1975), a technique well known in the art and described in Sambrook et al. ⁇ Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989).
- Stringent conditions may be defined as those under which DNA molecules with more than 25%, 15%, 10%, 6% or 2% sequence variation (also termed "mismatch") will not hybridize. Stringent conditions are sequence dependent and are different in different circumstances. Longer sequences hybridize specifically at higher temperatures. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point T m for the specific sequence at a defined ionic strength and pH. An example of stringent conditions is a salt concentration of at least about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and a temperature of at least about 30°C for short probes ⁇ e.g. 10 to 50 nucleotides). Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide. For example, conditions of 5 X SSPE (750 mM NaCl, 50 mM
- Na Phosphate, 5 mM EDTA, pH 7.4) and a temperature of 25-30°C are suitable for allele- specific probe hybridizations.
- a perfectly matched probe has a sequence perfectly complementary to a particular target sequence.
- the test probe is typically perfectly complementary to a portion (subsequence) of the target sequence.
- the term "mismatch probe” refers to probes whose sequence is deliberately selected not to be perfectly complementary to a particular target sequence.
- Somatic mutation An acquired mutation that occurs in a somatic cell (as opposed to a germ cell).
- Subject Living multi-cellular vertebrate organisms, a category that includes both human and non-human mammals.
- the subject is a human subject.
- Therapeutic agent A chemical compound, small molecule, or other composition, such as an antisense compound, antibody, peptide or nucleic acid molecule capable of inducing a desired therapeutic or prophylactic effect when properly administered to a subject.
- therapeutic agents for melanoma include agents that prevent or inhibit development or metastasis of melanoma.
- the therapeutic agent is an inhibitor of TRRAP, an inhibitor of GRTN2A or a glutamate antagonist.
- Therapeutically effective amount A quantity of a specific substance sufficient to achieve a desired effect in a subject being treated.
- a therapeutically effective amount of a therapeutic agent to treat melanoma can refer to the amount necessary to inhibit tumor growth, decrease tumor volume, inhibit tumor metastasis, or prolong survival.
- therapy refers to administration of a therapeutic agent.
- therapy includes administration of an inhibitor of TRRAP, an inhibitor of GRIN2A or a glutamate antagonist.
- therapy includes surgery, such as surgical resection of a melanoma tumor, chemotherapy, radiation therapy, administration of a second therapeutic agent, or any combination thereof.
- TRRAP transformation/transcription domain-associated protein
- TRRAP may function as an oncogene in pancreatic cancer (Loukopoulos et al, Cancer Sci 98(3):392-400, 2007; Bashyam et al., Neoplasia 7(6):556-562, 2005).
- NCBI CCDS database also known as NM_003496 and NP_003487.
- TRRAP telomere telomere telomere telomere sequence
- the C2165T mutation refers to a cytosine to thymidine substitution at nucleotide 2165 (SEQ ID NO: 1), which results in a serine to phenylalanine change at amino acid 722 (S722F; SEQ ID NO: 2).
- Tumor, neoplasia, malignancy or cancer A neoplasm is an abnormal growth of tissue or cells that results from excessive cell division. Neoplastic growth can produce a tumor. The amount of a tumor in an individual is the "tumor
- a tumor that does not metastasize is referred to as "benign.”
- a tumor that invades the surrounding tissue and/or can metastasize is referred to as "malignant.”
- a "non- cancerous tissue” is a tissue from the same organ wherein the malignant neoplasm formed, but does not have the characteristic pathology of the neoplasm. Generally, noncancerous tissue appears histologically normal.
- a "normal tissue” is tissue from an organ, wherein the organ is not affected by cancer or another disease or disorder of that organ.
- a "cancer-free" subject has not been diagnosed with a cancer of that organ and does not have detectable cancer.
- Described herein is the identification of 68 human genes with an elevated frequency of somatic mutations in melanoma.
- Nine genes were identified that exhibited recurring mutations in melanoma.
- the TRRAP gene was mutated at nucleotide 2165 (C2165T) in six different melanoma tumor samples.
- 16 genes were identified that were highly mutated in melanoma samples.
- the most highly mutated gene identified was GRIN2A, which was mutated in 34% of melanoma tumor samples.
- the study disclosed herein identified 34 different nonsynonymous somatic mutations in GRIN2A among 36 melanoma tumor samples.
- the at least one mutation is in the human TRRAP gene (SEQ ID NO: 1).
- the mutation is the C2165T mutation in human TRRAP.
- the at least one mutation is in the human GRIN2A gene (SEQ ID NO: 3). In some examples, the mutation occurs in a portion of the GRIN2A gene that encodes the PBP l_iGluR_NMDA_NR2 domain, the Lig_chan domain or the NMDAR2_C domain of human GRIN2A. In other examples, the at least one mutation is G20A, G1346A or T1376C in the GRIN2A gene (SEQ ID NO: 3).
- the mutation in the portion of the GRIN2A gene that encodes the PBP l_iGluR_NMDA_NR2 domain is C170T, T547A, G754A, C833T, G1028A, Gl 111A, Gl 116A or Gl 117A (SEQ ID NO: 3). In other particular examples, the mutation in the portion of the GRIN2A gene that encodes the
- Lig_chan domain is A1784G, C1793T, G1959A, G2135A or G2218A (SEQ ID NO: 3).
- the mutation in the portion of the GRIN2A gene that encodes the NMDAR2_C domain is G2666A, C2671T, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A, G3812A, C3827G, G3854A, C3952T, C4097T, G4261A, C4274T, G4276A or C4385G (SEQ ID NO: 3).
- the at least one mutation is selected from G20A, C170T, T547A, G754A, C833T, G1028A, G1111A, G1116A, G1117A, G1346A, T1376C, A1784G, C1793T, G1959A, G2135A, G2218A, G2666A, C2671T, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A, G3812A, C3827G, G3854A, C3952T, C4097T, G4261A, C4274T, G4276A and C4385G in human GRIN2A (SEQ ID NO: 3).
- the mutation is a recurring mutation in GRIN2A identified herein, such as C833T, Gl 111A, G3523A or G3812A (SEQ ID NO: 3).
- detecting the presence or absence of the at least one mutation comprises detecting the presence or absence of the mutation in a skin sample obtained from the subject.
- the method further includes providing a test output (i.e., the result of the test to detect mutations in TRRAP or GRIN2A) to a user (such as a physician or health care worker, the patient or laboratory personnel).
- a test output i.e., the result of the test to detect mutations in TRRAP or GRIN2A
- the output includes the presence or absence of the at least one mutation, a diagnosis, a treatment recommendation, or any combination thereof.
- Examples of such output include a printout or display screen that reports the output by displaying it to a clinician to technician.
- Other examples are electronic medical record reports or other records that include the output in a form discernible to the clinician or technician.
- the subject is further treated with an appropriate therapy, such as with a TRRAP inhibitor (if a mutation in TRRAP is identified), or a GRIN2A inhibitor or glutamate antagonist (if a mutation in GRIN2A is identified).
- an appropriate therapy can include administration of a second therapeutic agent known to be effective for the treatment of melanoma, removal of tumor tissue, radiation therapy, chemotherapy, or any combination thereof.
- a method of selecting a therapy for a subject diagnosed with melanoma by detecting the presence or absence of a C2165T mutation in the TRRAP gene (SEQ ID NO: 1).
- An inhibitor of TRRAP is selected if the C2165T mutation in the TRRAP gene is present.
- An inhibitor of GRIN2A or a glutamate antagonist is selected for therapy if the at least one mutation in GRIN2A is present.
- the at least one mutation is (i) a mutation in a portion of the GRIN2A gene that encodes the PBP l_iGluR_NMDA_NR2 domain (nucleotides 94-1176 of SEQ ID NO: 3); (ii) a mutation in a portion of the GRIN2A gene that encodes the Lig_chan domain (nucleotides 1660-2484 of SEQ ID NO: 3); (iii) a mutation in a portion of the GRIN2A gene that encodes the NMDAR2_C domain (nucleotides 2515-4392 of SEQ ID NO: 3); (iv) G20A in the GRIN2A gene (SEQ ID NO: 3); (v) G1346A in the GRIN2A gene (SEQ ID NO: 3); or (vi) T1376C in the GRIN2A gene (SEQ ID NO: 3).
- the mutation in the portion of the GRIN2A gene that encodes the PBP l_iGluR_NMDA_NR2 domain is C170T, T547A, G754A, C833T, G1028A, Gl 111A, Gl 116A or Gl 117A (SEQ ID NO: 3).
- the mutation in the portion of the GRIN2A gene that encodes the Lig_chan domain is A1784G, C1793T, G1959A, G2135A or G2218A (SEQ ID NO: 3).
- the mutation in the portion of the GRIN2A gene that encodes the NMDAR2_C domain is G2666A, C2671T, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A, G3812A, C3827G, G3854A, C3952T, C4097T, G4261A, C4274T, G4276A or C4385G (SEQ ID NO: 3).
- the method further includes administering the selected therapy.
- the subject is further treated by administration of a second therapeutic agent, surgical removal of tumor tissue, radiation therapy, chemotherapy, or any combination of thereof.
- Also provided herein is a method of predicting the prognosis of a subject diagnosed with melanoma by detecting the presence or absence of at least one mutation in the TRRAP gene or the GRIN2A gene. The presence of the at least one mutation indicates the subject has a poor prognosis.
- the at least one mutation is selected from C2165T in human TRRAP (SEQ ID NO: 1), or G20A, C170T, T547A, G754A, C833T, G1028A, G1111A, G1116A, G1117A, G1346A, T1376C, A1784G, C1793T, G1959A, G2135A, G2218A, G2666A, C2671T, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A, G3812A, C3827G, G3854A, C3952T, C4097T, G4261A, C4274T, G4276A and C4385G in human GRIN2A (SEQ ID NO: 3).
- a poor prognosis refers to any negative clinical outcome.
- a poor prognosis is an increase in the likelihood of death.
- a poor prognosis is an increase in the likelihood of metastasis of the melanoma.
- a poor prognosis refers to failure to respond to therapy.
- the sample can be any appropriate sample from the patient, such as a tissue sample or bodily fluid sample.
- the sample is a melanoma tumor sample from the subject.
- the present disclosure contemplates the use of mutations in any of the genes identified herein as mutated in melanoma (see Tables 1-4, 6 and 7 for a list of genes).
- the method includes detecting at least one mutation selected from any one of the mutations listed in Table 1 or Table 3.
- nucleic acid can be isolated from a biological sample according to well-known methods.
- the biological sample is a tissue sample, such as a skin sample or a tumor tissue sample.
- the biological sample is a fluid sample, such as blood.
- nucleic acid can be isolated from cells obtained from a blood sample.
- the biological sample is obtained from a patient diagnosed with melanoma or at risk for developing melanoma.
- the biological sample is obtained from a control subject.
- TRRAP- or GRIN2A-specific primers can be used to amplify nucleic acid from a biological sample (such as a skin sample, tumor tissue sample or blood sample). The amplified molecule can then be sequenced and compared to a reference TRRAP sequence (such as SEQ ID NO: 1) or a reference GRIN2A sequence (such as SEQ ID NO: 3).
- the sequence of the amplified molecule can be compared with TRRAP or GRIN2A from a control sample such as a non-cancerous tissue sample.
- TRRAP and GRIN2A amplification primers and sequencing primers can be designed according to well- known methods. Examples of TRRAP and GRIN2A primers are shown in Table 6 and Table 7. Other suitable primers can be designed using publically available TRRAP or GRIN2A nucleic acid sequences, according to well-known procedures.
- oligonucleotides that specifically hybridize with a particular mutation.
- oligonucleotide with a detectable marker such as a fluorescent marker, enzymatic marker or radioisotope.
- a detectable marker such as a fluorescent marker, enzymatic marker or radioisotope.
- Appropriate output devices for obtaining nucleic acid sequence information or for detecting the presence of a fluorescent or radioactive signal are well known in the art.
- the nucleic acid molecule comprises a mutation selected from (i) C2165T in human TRRAP (SEQ ID NO: 1); and (ii) G20A, C170T, T547A, G754A, C833T, G1028A, G1111A, G1116A, G1117A, G1346A, T1376C, A1784G, C1793T, G1959A, G2135A, G2218A, G2666A, C2671T, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A, G3812A, C3827G, G3854A, C3952T, C4097T, G4261A, C4274T, G4276A
- the oligonucleotide can be any suitable length to allow for specific hybridization to a target nucleic acid molecule.
- the oligonucleotide is about 12 to about 50, about 15 to about 40, about 18 to about 30 or about 20 to about 25 nucleotides in length.
- the oligonucleotide is about 15 to about 40 nucleotides in length.
- the oligonucleotide includes a label, such as a fluorescent label, an enzymatic label or a radioisotope.
- an addressable array including an oligonucleotide that specifically hybridizes with a mutant TRRAP nucleic acid molecule disclosed herein or a mutant GRIN2A nucleic acid molecule disclosed herein.
- the array includes two or more oligonucleotides that specifically hybridize with a TRRAP nucleic acid comprising a C2165T mutation or with a GRIN2A nucleic acid molecule comprising a mutation selected from G20A, C170T, T547A, G754A, C833T, G1028A, Gl 111A, Gl 116A, Gl 117A, G1346A, T1376C, A1784G, C1793T, G1959A, G2135A, G2218A, G2666A, C2671T, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A, G3812A, C38
- the array is a microarray.
- Detecting mutations in GRIN2A and TRRAP can be accomplished using any technique known in the art.
- the presence or absence of a GRIN2A or TRRAP mutation can be determined by conventional methods such as gene or RNA detection methods (for example, DNA sequencing, oligonucleotide hybridization, polymerase chain reaction (PCR) amplification with primers specific to the mutation), or protein detection methods (for example, immunoassays or biochemical assays to identify a mutated GRIN2A or TRRAP protein.
- the nucleic acid sequence of the GRIN2A or TRRAP gene or RNA in a sample can be detected by any suitable method or technique of detecting gene sequence.
- Such methods include, but are not limited to, PCR, reverse transcriptase-PCR (RT-PCR), in situ PCR, in situ hybridization, Southern blot, Northern blot, sequence analysis, microarray analysis, or other DNA/RNA hybridization platforms.
- Detection of point mutations in target nucleic acids can be accomplished by molecular cloning of the target nucleic acid molecules and sequencing the nucleic acid molecules using techniques well known in the art. Alternatively, amplification techniques such as PCR can be used to amplify target nucleic acid sequences directly from a genomic DNA preparation from a tumor tissue or cell sample. The nucleic acid sequence of the amplified molecules can then be determined to identify mutations. Representative primer pairs that can be used to amplify GRIN2A or TRRAP nucleic acid from a biological sample are listed in Tables 6 and 7.
- Insertions and deletions of genes can also be detected by cloning, sequencing and amplification.
- restriction fragment length polymorphism probes for the gene or surrounding marker genes can be used to score alteration of an allele or an insertion in a polymorphic fragment.
- Single stranded conformation polymorphism analysis can also be used to detect base change variants of an allele (Orita et al, Proc. Natl. Acad. Sci. USA 86:2766-2770, 1989).
- Other known techniques for detecting insertions and deletions can also be used with the claimed methods.
- Mismatch detection can be used to detect point mutations in a target nucleic acid molecule, such as GRIN2A or TRRAP. Mismatches are hybridized nucleic acid duplexes which are not 100% complementary. The lack of total
- complementarity can be due to deletions, insertions, inversions, substitutions or frameshift mutations.
- An example of a mismatch cleavage technique is the RNase protection method, which is described in detail in Winter et al. (Proc. Natl. Acad. Sci. USA 82:7575-7579, 1985) and Myers et al. (Science 230: 1242-1246, 1985).
- detection of mutations in GRIN2A or TRRAP can involve the use of a labeled riboprobe that is complementary to wild-type GRIN2A or TRRAP.
- the riboprobe and nucleic acid molecule to be tested are annealed (hybridized) together and subsequently digested with the enzyme RNase A, which is able to detect mismatches in a duplex RNA structure. If a mismatch is detected by RNase A, it cleaves at the site of the mismatch. Thus, when the annealed RNA preparation is separated on an electrophoretic gel matrix, if a mismatch has been detected and cleaved by RNase A, an RNA product will be seen which is smaller than the full-length duplex RNA for the riboprobe and the mRNA or DNA.
- the riboprobe need not be the full length of the target nucleic acid mRNA or gene, but can a portion of the target nucleic acid, provided it encompasses the position suspected of being mutated. If the riboprobe comprises only a segment of the target nucleic acid mRNA or gene, it may be desirable to use a number of these probes to screen the whole target nucleic acid sequence for mismatches if desired.
- DNA probes can be used to detect mismatches, for example through enzymatic or chemical cleavage (Cotton et al. , Proc. Natl. Acad. Sci. USA 85: 4397, 1988; Shenk et al, Proc. Natl. Acad. Sci. USA 72:989, 1975).
- mismatches can be detected by shifts in the electrophoretic mobility of mismatched duplexes relative to matched duplexes (Cariello, Human Genetics 42:726, 1988).
- the target nucleic acid mRNA or DNA which may contain a mutation can be amplified before hybridization.
- Amplified nucleic acid sequences can also be screened using allele- specific probes. These probes are nucleic acid oligomers, each of which contains a region of the target nucleic acid gene harboring a known mutation. For example, one oligomer may be about 30 nucleotides in length, corresponding to a portion of the target gene sequence. By use of a battery of such allele- specific probes, target nucleic acid amplification products can be screened to identify the presence of a previously identified mutation in the target gene. Hybridization of allele- specific probes with amplified target nucleic acid sequences can be performed, for example, on a nylon filter. Hybridization to a particular probe under stringent hybridization conditions indicates the presence of the same mutation in the tumor tissue as in the allele- specific probe.
- Gene-specific primers are useful for determination of the nucleotide sequence of a target nucleic acid molecule using nucleic acid amplification techniques such as the polymerase chain reaction. Pairs of single stranded DNA primers can be annealed to sequences within or surrounding the target nucleic acid sequence in order to prime amplification of the target sequence. Allele- specific primers can also be used. Such primers anneal only to particular mutant target sequence, and thus will only amplify a product in the presence of the mutant target sequence as a template. In order to facilitate subsequent cloning of amplified sequences, primers may have restriction enzyme site sequences appended to their ends. Such enzymes and sites are well known in the art.
- primers themselves can be synthesized using techniques which are well known in the art. Generally, the primers can be made using oligonucleotide synthesizing machines which are commercially available. Design of particular primers is well within the skill of the art. In addition, exemplary GRIN2A and TRRAP primers are provided in Tables 6 and 7.
- Nucleic acid probes that hybridize with a GRIN2A or TRRAP nucleic acid molecule are useful for a number of purposes. They can be used in Southern hybridization to genomic DNA and in RNase protection assays for detecting point mutations. The probes can also be used to detect target nucleic acid amplification products. GRIN2A or TRRAP probes can also be used to detect mismatches with the wild type gene or mRNA using other techniques.
- Mismatches can be detected using either enzymes (e.g., SI nuclease), chemicals (e.g., hydroxylamine or osmium tetroxide and piperidine), or changes in electrophoretic mobility of mismatched hybrids as compared to totally matched hybrids (Novack et al, Proc. Natl. Acad. Sci. USA 83:586, 1986).
- enzymes e.g., SI nuclease
- chemicals e.g., hydroxylamine or osmium tetroxide and piperidine
- changes in electrophoretic mobility of mismatched hybrids as compared to totally matched hybrids (Novack et al, Proc. Natl. Acad. Sci. USA 83:586, 1986).
- Mutations in nucleic acid molecules can also be detected by screening for alterations of the corresponding protein.
- monoclonal antibodies immunoreactive with a target gene product can be used to screen a tissue, for example an antibody that is known to bind to a particular mutated position of the gene product (protein).
- a suitable antibody may be one that binds to a deleted exon or that binds to a conformational epitope comprising a deleted portion of the target protein. Lack of cognate antigen would indicate a mutation.
- Such immunological assays can be accomplished using any convenient format known in the art, such as Western blot, immunohistochemical assay and ELISA.
- the GRIN2A amino acid mutation is selected from W7*, P57L, F183I, D252N, S278F, W343*, E371K, W372*, E373K, G449E, F459S, H595R, S598F, M653I, G712E, G740W, G889E, Q891*, R920K, S929F, E962K, E1073K, P1074L, D1153N, E1175K, W1271*, A1276G, R1285K, R1318W, P1366L, D1421N, S1425L, E1426K and S1462C (SEQ ID NO: 4).
- the TRRAP amino acid mutation is S722F (SEQ ID NO: 2).
- Mutations in a gene or encoded protein can be evaluated using any technique described above, or any other method known in the art.
- mutations in a gene or corresponding mRNA can be detecting by direct sequencing of a nucleic acid molecule, detection of an amplification product, microarray analysis or any other DNA/RNA hybridization platform.
- an immunoassay, biochemical assay or microarray can be used.
- the output device can be a visual output device, such as a computer screen, a printed piece of paper or a written piece of paper.
- the output device can be an auditory output device, such as a speaker.
- the output device is a printer.
- the data is recorded in a patient's electronic medical record.
- the results of the test used to identify a mutation are provided to a user (such as a clinician or other health care worker, laboratory personnel, or patient) in a perceivable output that provides information about the results of the test.
- the output is communicated to the user, for example by providing an output via physical, audible or electronic means (for example, by mail, telephone, facsimile transmission, e-mail or communication to an electronic medical record).
- the output is accompanied by guidelines for interpreting the data, for example, an indication of the likelihood of diagnosis of melanoma.
- the guidelines need not specify whether melanoma is present or absent, although it may include such a diagnosis.
- the output can provide a recommended therapeutic regimen. For instance, based on the presence of a mutation in the
- the output can recommend treatment with a GRIN2A inhibitor, or a glutamate antagonist, alone or in combination with other standard cancer treatments, such as surgery, radiation therapy, chemotherapy, or any combination thereof.
- the output can recommend treatment with a TRRAP inhibitor, alone or in combination with any other type of treatment.
- the test may include determination of other clinical information (such as determining the presence or absence of mutations in other genes).
- oligonucleotides that specifically hybridize to a nucleic acid molecule encoding TRRAP or GRIN2A having one or more of the melanoma- associated mutations disclosed herein. Oligonucleotides that specifically hybridize with a TRRAP or GRIN2A nucleic acid comprising a mutation do not hybridize to wild-type (WT) TRRAP or GRIN2A, or hybridization of the oligonucleotide to WT TRRAP or GRIN2A is significantly weaker than hybridization to the mutant TRRAP or GRIN2A.
- WT wild-type
- the oligonucleotides described herein can be used, for example, as probes to identify the presence of a mutation in TRRAP or GRIN2A in a sample obtained from a subject suspected of having melanoma.
- oligonucleotide probes can further include one or more detectable labels, to permit detection of hybridization signals between the probe and target sequence (such as one of the mutant GRIN2A nucleic acid molecules).
- arrays comprising the mutation- specific oligonucleotides as described herein can be used to evaluate the presence or absence of mutations in GRIN2A or TRRAP (or other genes mutated in melanoma).
- the array comprises an oligonucleotide that specifically hybridizes with a TRRAP nucleic acid molecule comprising the C2165T mutation (SEQ ID NO: 1).
- the array comprises an oligonucleotide that specifically hybridizes with a GRIN2A nucleic acid molecule comprising a mutation selected from G20A, C170T, T547A, G754A, C833T, G1028A, G1111A, G1116A, Gl 117A, G1346A, T1376C, A1784G, C1793T, G1959A, G2135A, G2218A, G2666A, C2671T, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A, G3812A, C3827G, G3854A, C3952T, C4097T, G4261A, C4274T, G4276A
- the array comprises (or further comprises) oligonucleotides that specifically hybridize with additional mutations in GRIN2A or TRRAP.
- the array comprises oligonucleotides that specifically hybridize with mutations in other genes, including those listed in Tables 1-4, 6 and 7.
- the array contains oligonucleotides that specifically hybridize with each mutation in GRIN2A (G20A, C170T, T547A, G754A, C833T, G1028A, G1111A, G1116A, G1117A, G1346A, T1376C, A1784G, C1793T, G1959A, G2135A, G2218A, G2666A, C2671T, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A,
- the array comprises one or more oligonucleotides that specifically hybridize with a mutation in TRRAP and/or GRIN2A and further comprises at least one oligonucleotide that specifically hybridizes with another melanoma-associated gene identified herein, such as one or more of the genes listed in Tables 1-4, 6 and 7.
- the array may include one or more
- oligonucleotides to specifically hybridize to one or more of the mutations identified in Table 1 or Table 3.
- the array further comprises other oligonucleotides, such as control oligonucleotides or
- oligonucleotides that specifically hybridize with WT TRRAP or WT GRIN2A.
- exemplary control oligonucleotide probes include GAPDH, actin, and YWHAZ, or any probes specific for housekeeping genes.
- the solid support of the array can be formed from an organic polymer.
- Suitable materials for the solid support include, but are not limited to:
- polypropylene polyethylene, polybutylene, polyisobutylene, polybutadiene, polyisoprene, polyvinylpyrrolidine, polytetrafluroethylene, polyvinylidene difluroide, polyfluoroethylene-propylene, polyethylenevinyl alcohol, polymethylpentene, polycholorotrifluoroethylene, polysulfornes, hydroxylated biaxially oriented polypropylene, aminated biaxially oriented polypropylene, thiolated biaxially oriented polypropylene, ethyleneacrylic acid, thylene methacrylic acid, and blends of copolymers thereof (see U.S. Patent No. 5,985,567).
- suitable characteristics of the material that can be used to form the solid support surface include: being amenable to surface activation such that upon activation, the surface of the support is capable of covalently attaching a biomolecule such as an oligonucleotide thereto; amenability to "in situ" synthesis of biomolecules; being chemically inert such that the areas on the support not occupied by the oligonucleotides are not amenable to non-specific binding, or when nonspecific binding occurs, such materials can be readily removed from the surface without removing the oligonucleotides.
- the solid support surface is polypropylene.
- Polypropylene is chemically inert and hydrophobic. Non-specific binding is generally avoidable, and detection sensitivity is improved.
- Polypropylene has good chemical resistance to a variety of organic acids (such as formic acid), organic agents (such as acetone or ethanol), bases (such as sodium hydroxide), salts (such as sodium chloride), oxidizing agents (such as peracetic acid), and mineral acids (such as hydrochloric acid).
- Polypropylene also provides a low fluorescence background, which minimizes background interference and increases the sensitivity of the signal of interest.
- a surface activated organic polymer is used as the solid support surface.
- a surface activated organic polymer is a polypropylene material aminated via radio frequency plasma discharge. Such materials are easily utilized for the attachment of nucleotide molecules.
- the amine groups on the activated organic polymers are reactive with nucleotide molecules such that the nucleotide molecules can be bound to the polymers.
- Other reactive groups can also be used, such as carboxylated, hydroxylated, thiolated, or active ester groups.
- a wide variety of array formats can be employed in accordance with the present disclosure.
- One example includes a linear array of oligonucleotide bands, generally referred to in the art as a dipstick.
- Another suitable format includes a two- dimensional pattern of discrete cells (such as 4096 squares in a 64 by 64 array).
- other array formats including, but not limited to slot (rectangular) and circular arrays are equally suitable for use (see U.S. Patent No. 5,981,185).
- the array is a multi-well plate.
- the array is formed on a polymer medium, which is a thread, membrane or film.
- An example of an organic polymer medium is a polypropylene sheet having a thickness on the order of about 1 mil. (0.001 inch) to about 20 mil., although the thickness of the film is not critical and can be varied over a fairly broad range.
- the array can include biaxially oriented polypropylene (BOPP) films, which in addition to their durability, exhibit a low background fluorescence.
- BOPP biaxially oriented polypropylene
- a "format” includes any format to which the solid support can be affixed, such as micro titer plates (e.g. multi-well plates), test tubes, inorganic sheets, dipsticks, and the like.
- micro titer plates e.g. multi-well plates
- test tubes e.g. multi-well plates
- inorganic sheets e.g. multi-well plates
- dipsticks e.g. multi-well plates
- the solid support is a polypropylene thread
- one or more polypropylene threads can be affixed to a plastic dipstick-type device
- polypropylene membranes can be affixed to glass slides.
- the particular format is, in and of itself, unimportant.
- the solid support can be affixed thereto without affecting the functional behavior of the solid support or any biopolymer absorbed thereon, and that the format (such as the dipstick or slide) is stable to any materials into which the device is introduced (such as clinical samples and hybridization solutions).
- the arrays of the present disclosure can be prepared by a variety of approaches.
- oligonucleotide sequences are synthesized separately and then attached to a solid support (see U.S. Patent No. 6,013,789).
- sequences are synthesized directly onto the support to provide the desired array (see U.S. Patent No. 5,554,501).
- Suitable methods for covalently coupling oligonucleotides to a solid support and for directly synthesizing the oligonucleotides onto the support are known to those working in the field; a summary of suitable methods can be found in Matson et al. ⁇ Anal. Biochem. 217:306-10, 1994).
- the oligonucleotides are synthesized onto the support using conventional chemical techniques for preparing oligonucleotides on solid supports (such as see PCT publications WO 85/01051 and WO 89/10977, or U.S. Patent No. 5,554,501).
- a suitable array can be produced using automated means to synthesize oligonucleotides in the cells of the array by laying down the precursors for the four bases in a predetermined pattern.
- a multiple-channel automated chemical delivery system is employed to create oligonucleotide probe populations in parallel rows (corresponding in number to the number of channels in the delivery system) across the substrate.
- the substrate can then be rotated by 90° to permit synthesis to proceed within a second (2°) set of rows that are now perpendicular to the first set. This process creates a multiple-channel array whose intersection generates a plurality of discrete cells.
- the oligonucleotides can be bound to the polypropylene support by either the 3' end of the oligonucleotide or by the 5' end of the oligonucleotide. In one example, the oligonucleotides are bound to the solid support by the 3' end.
- the 3' end or the 5' end of the oligonucleotide is suitable for bonding to the solid support.
- the internal complementarity of an oligonucleotide probe in the region of the 3' end and the 5' end determines binding to the support.
- the oligonucleotide probes on the array include one or more labels, that permit detection of oligonucleotide probe:target sequence hybridization complexes.
- 68 genes were identified with an elevated frequency of somatic mutations in melanoma.
- nine genes were identified that exhibited recurring mutations in melanoma (see Table 1).
- the TRRAP gene was mutated at nucleotide 2165 (C2165T) in six different melanoma tumor samples.
- 16 genes were identified that were highly mutated in melanoma samples (see Table 3).
- the most highly mutated gene identified was GRIN2A, which was mutated in 34% of melanoma tumor samples.
- 34 different nonsynonymous somatic mutations in GRIN2A were identified (FIG. 3 A) among 36 melanoma tumor samples.
- a method of diagnosing melanoma in a subject by detecting one or more mutations in the TRRAP gene or the GRIN2A gene.
- the at least one mutation is selected from: (i) C2165T in the TRRAP gene (SEQ ID NO: 1); (ii) a mutation in a portion of the GRIN2A gene that encodes the PBP l_iGluR_NMDA_NR2 domain (nucleotides 94-1176 of SEQ ID NO: 3); (iii) a mutation in a portion of the GRIN2A gene that encodes the Lig_chan domain (nucleotides 1660-2484 of SEQ ID NO: 3); (iv) a mutation in a portion of the GRIN2A gene that encodes the NMDAR2_C domain (nucleotides
- the presence of the at least one mutation indicates the subject has melanoma or has increased susceptibility to developing melanoma as compared to the general population.
- the mutation in the portion of the GRIN2A gene that encodes the PBP l_iGluR_NMDA_NR2 domain is C170T, T547A, G754A, C833T, G1028A, Gl 111A, Gl 116A or Gl 117A (SEQ ID NO: 3).
- the mutation is a recurring mutation identified herein, such as C833T or Gl 111A (SEQ ID NO: 3).
- the mutation in the portion of the GRIN2A gene that encodes the Lig_chan domain is A1784G, C1793T, G1959A, G2135A or G2218A (SEQ ID NO: 3).
- the mutation in the portion of the GRIN2A gene that encodes the NMDAR2_C domain is G2666A, C267 IT, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A, G3812A, C3827G, G3854A, C3952T, C4097T, G4261A, C4274T, G4276A or C4385G (SEQ ID NO: 3).
- the mutation is a recurring mutation identified herein, such as G3523A or G3812A (SEQ ID NO: 3).
- the subject is further treated with an appropriate therapy, such as with a TRRAP inhibitor (if a mutation in TRRAP is identified), or a GRIN2A inhibitor or glutamate antagonist (if a mutation in GRIN2A is identified).
- an appropriate therapy such as with a TRRAP inhibitor (if a mutation in TRRAP is identified), or a GRIN2A inhibitor or glutamate antagonist (if a mutation in GRIN2A is identified).
- G3854A, C3952T, C4097T, G4261A, C4274T, G4276A and C4385G can be used as a clinical tool to diagnose a patient that has already developed melanoma, or who has an increased risk of developing melanoma. Detection of one or more of the above-listed mutations can also be used to determine the prognosis of a patient previously diagnosed with melanoma. The presence of one or more of the disclosed mutations indicates a subject has already developed melanoma or is susceptible to developing melanoma.
- Detection of one or more of the disclosed mutations in TRRAP and GRIN2A can also be used as a tool for determining an appropriate therapy for a subject with melanoma.
- the presence of one or mutations in GRIN2A indicates the subject is a candidate for treatment with a GRIN2A inhibitor or a glutamate antagonist.
- the presence of the C2165T mutation in TRRAP indicates the subject is a candidate for treatment with a TRRAP inhibitor.
- Subjects diagnosed with melanoma and treated with a TRRAP inhibitor, a GRIN2A inhibitor or glutamate antagonist can further be treated with a second therapeutic agent known to be effective for the treatment of melanoma.
- the subject with melanoma can be further treated by surgical removal of tumor tissue, chemotherapy, radiation therapy, or any combination thereof.
- Tissues used for Validation set 1 were fresh frozen melanoma tumors obtained from the University of Colorado Denver Skin Cancer Biorepository, Division of Medical Oncology. Tissue was collected at University of Colorado Hospital, Anschutz Medical Campus, under Institutional Review Board protocols. Macrodissection was conducted using a dissection microscope. Isolation of DNA from tumor enriched isolates has been previously described online at
- Tissue processing and storage were previously described by Morente et al. ⁇ Eur J Cancer 42:2684-2691, 2006).
- Tissues used for Validation set 2 were obtained from Optimum Cutting Temperature (OCT)- embedded frozen clinical specimens from the Melanoma Informatics, Tissue Resource, and Pathology Core (MelCore) at The University of Texas MD Anderson Cancer Center under Institutional Review Board-approved protocols. H&E-guided dissection and isolation of DNA from the tumor-enriched isolates has been described previously (Davies et al., Clin Cancer Res 15:7538-7546, 2009). The clinical information associated with the melanoma tumors used in this study is provided in Table 5.
- Exome capture was performed using the SureSelectTM Human All Exon System (Agilent Technologies, Santa Clara, CA). The manufacturer's protocol for SureSelectTM Human All Exon System (Illumina Paired-End Sequencing Library Prep) version 1.0.1 was used, with the modifications listed below. Bioanalyzer steps were either performed using agarose gel or omitted.
- sample preparation step 9 samples were purified using AMPureTM XP beads (Agencourt/Beckman Coulter Genomics, Danvers, MA) according to the manufacturer's protocols.
- samples were purified with the QIAquickTM MinEluteTM kit (Qiagen Inc., Valencia, CA).
- Bam2mpg was used to implement the Most Probable Genotype (MPG) algorithm, a Bayesian based method to determine the probability of each genotype given the data observed at that position.
- the quality score represents the difference of the log likelihoods of the most and second most probable genotype.
- the MPG was divided by the coverage at each position to calculate the MPG/coverage ratio.
- Type of Mutation definitions are as follows: synonymous: in a protein coding region, but does not change the amino acid; non- synonymous: in a protein coding region; missense variant: changes amino acid; nonsense variant, stop: introduces a stop codon; DIV-c: an in-frame
- DIV-fs a frameshifting deletion/insertion variant in a coding region.
- the first method considered the frequency of mutations in the Discovery Screen, which was calculated by dividing the total number of nonsynonymous mutations observed by the total number of base pairs sequenced.
- the second method fit a binomial distribution based on the number of base pairs sequenced for the gene of interest, the number of mutations observed, and the background rate of mutation. For the background rate, the observed rate in the exome screen was used, 11.2 mutations per megabase. Based on these methods, 16 genes were selected for validation. PCR, sequencing and mutational analysis of melanoma samples
- TRRAP expressing construct in C SBS vector was used. Mutant TRRAP was generated using an overlapping two-fragment PCR mediated strategy using PhusionTM High-Fidelity polymerase (New England Biolabs, Ipswich, MA).
- TRRAP-F(3+) - CAGATGGTGAAAGGAATGCTC (SEQ ID NO: 63) Mutation-R - GCAAAGAGGAAGACAGAGCCAAAG (SEQ ID NO: 64)
- PCR products purified by gel purification were used as a template for PCR using TRRAP-F and -R primer pairs to generate a TRRAP mutation bearing product.
- the TRRAP mutation bearing PCR product was cut with BbvCl and Kasl restriction enzymes and was inserted in the TRRAP-C SBS plasmid. Sequence verified mutant TRRAP was subsequently used in various experiments.
- HEK 293T cells were purchased from ATCC (Manassas, VA) and maintained in complete Dulbecco's Modified Eagles Medium supplemented with 10% fetal bovine serum (FBS), IX non-essential amino acids, 2 mM L-glutamine, and 0.75% sodium bicarbonate.
- Sk-Mel-28 and A375 cells were purchased from the National Cancer Institute, Division of Cancer Treatment, Developmental Therapeutics Program (Frederick, MD) and maintained in RPMI-1640 and supplemented with 10% FBS.
- Western blotting Western blotting
- Transfected cells or stable pooled clones were gently washed 3X in PBS and then lysed using 0.5-1.0 ml 1% NP-40 lysis buffer (1% NP-40, 50 mM Tris-HCl pH 7.5, 150 mM NaCl, complete protease inhibitor tablet, EDTA-free (Roche,
- TRCN0000005361 Construct Numbers TRCN0000005361, TRCN0000005362 were obtained from Open Biosystems (Huntsville, AL) and were confirmed to efficiently knockdown TRRAP at the protein level. Lentiviral stocks were prepared as previously described (Prickett et al, Nat Genet 41:1127-1132, 2009). Melanoma cell lines (63T, 17T, A375, and Sk-Mel-28) were infected with shRNA lentiviruses for each condition (vector and a TRRAP specific shRNA). Selection and growth were performed as described above. Hairpin sequence for TRCN0000005361 was
- GCCCTGTTCTTTCGCTTTGTA (SEQ ID NO: 71), mature antisense for
- TRCN0000005362 was TACAAAGCGAAAGAACAGGGC (SEQ ID NO: 72). Apoptosis measurement
- C SBS, C SBS -TRRAP (wt), C SBS -TRRAP (S722F), and Ras G12V 3 ⁇ g of plasmid was transfected using the calcium phosphate precipitation method into NIH 3T3 cells cultured in T25 flasks. Twenty-four hours after transfection, 1-5% of transfected cells were seeded into T25 flasks and cultured in normal growth medium containing 2.5% FBS for 14-20 days. The flasks were scored by visually scoring under a microscope for foci formation.
- the average number of nonsynonymous mutations observed for the mutated genes was examined by dividing the total number of nonsynonymous mutations into the total number of genes observed to be mutated.
- a binomial calculation was used. For each group of genes the total number of mutations observed and the number of base pairs that were successfully sequenced was determined. The P- value was calculated as the probability of a group having at least as many mutations as were observed, given the numbers of base pairs sequenced and the background passenger frequencies, using the binomial distribution in R (www.r-project.org).
- Example 2 Whole exome sequencing identifies TRRAP hotspot mutations and GRIN2A as frequently mutated in melanoma
- the quality score should rise with increasing amounts of sequence covering a given position. When the score does not rise with increasing depth of coverage, this suggests a false genotype call.
- all the confirmed alterations correlated with a MPG/coverage ratio of 0.5 or above in both the tumor and matched normal samples, with only one exception.
- 91% of the alterations that were not confirmed by Sanger sequencing had a MPG/coverage ratio below 0.5 in either the tumor or the normal or both.
- somatic mutations could either be 'driver' mutations that have a role in melanoma neoplasia or functionally inert 'passenger' changes.
- N/S ratio a ratio of nonsynonymous to synonymous changes
- TRRAP functions as part of a multiprotein co-activator complex possessing histone acetyltranferase activity that is central for the transcriptional activity of p53, c-Myc, E2F1 and other transcription factors (McMahon et al., Cell 94:363-374, 1998; Barlev et al., Mol Cell 8: 1243-1254, 2001).
- TRRAP knockout mice are embryonic lethal indicating that TRRAP is essential for cell survival (Herceg et al., Nat Genet 29:206-211, 2001).
- short hairpin RNA was used to stably knock-down TRRAP protein levels in melanoma cells harboring either wild-type TRRAP (SK-Mel28 and 17T) or mutant TRRAP (63T and A375). Specific targeting of TRRAP was confirmed by TRRAP immunoblotting of transiently transfected HEK293T cells as well as one of the melanoma cell lines (FIGS. 2C and 2D). The various cell clones were grown in 10% or 2.5% serum to test cell viability.
- the unique shRNA constructs targeting TRRAP had minimal effect on the survival of cells expressing wild-type TRRAP but substantially increased apoptosis rates of melanoma lines carrying mutant TRRAP, particularly when the clones were grown in low serum conditions (FIGS. 2E-2H and FIG. 10). These results were further corroborated by western blot analysis of cell lysates from the analyzed cells showing increased levels of cleaved PARP specifically in mutant cells that have been knocked down for TRRAP compared to vector control as well as TRRAP wild-type cells (FIGS. 21- 2J).
- mutant TRRAP is essential for melanoma cell survival which is consistent with previous results showing that TRRAP has a role in cell viability (Herceg et al, Nat Genet 29:206-211, 2001; Ard et al., Mol Cell Biol 22:5650-5661, 2002).
- genes were selected that had more mutations than expected using the observed mutation rate (binomial p-value ⁇ 0.05) and were mutated in more than two Discovery Screen samples. Sixteen such genes were identified and analyzed for mutations in an additional 38 melanoma samples using PCR amplification and Sanger sequencing. Gene coverage in the Prevalence Screen was 93% and above. This effort involved 9165 PCR and sequencing reactions encompassing 5.4 Mb of tumor DNA. A total of 65 putative changes were identified in the Prevalence Screen (Table 2).
- PLCB4 which encodes phosphoinositide phospholipase C-beta-4 that catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from
- phosphatidylinositol 4,5-bisphosphate using calcium as a cofactor is known to play an important role in the intracellular transduction of multiple extracellular signals in response to activation of G protein-coupled receptors (GPCRs) (Rebecchi and Pentyala, Physiol Rev 80: 1291-1335, 2000).
- GPCRs G protein-coupled receptors
- GRIN2A The most frequently mutated of the validated fourteen genes, GRIN2A, on chromosome 16pl3.2, encodes a glutamate [N-methyl-(D)-aspartic acid (NMD A)] receptor subunit epsilon-1 that is part of the class of ionotropic glutamate receptors.
- the NMD A receptor is a heterotrimeric channel composed of three different subunits, GRTN1 (NR1), GRTN2A or GRIN2B (NR2) and GRIN3 (NR3).
- GRIN2A bears the agonist binding site for glutamate (Johnson and Ascher, Nature 325:529- 531, 1987).
- NMDA receptors are permeable to cations including Ca 2+ , and at resting membrane potential, NMDA receptors are inactive due to a voltage-dependent blockade of the channel pore by Mg 2+ .
- NMDA receptor activation which requires binding of glutamate and glycine, leads to an influx of Ca 2+ and increased cAMP production.
- GRIN2A somatic mutations were searched for in two independent additional validation panel sets from untreated melanoma patients.
- Validation panel set 1 which included 39 melanomas, revealed 11 tumors with somatic mutations affecting 28.2% of the tumors examined and validation panel set 2, which included 32 melanomas, identified 7 GRIN2A somatic mutations affecting 15.6% of cases.
- GRIN2A sequencing in 12 commercially available cell lines revealed a mutation in 501Mel. In total, 34 distinct GRIN2A mutations were identified in 135 samples affecting 25.2% of melanoma cases (Table 3).
- FIG. 8 depicts the various genetic and analysis stages used in this whole exome study. The location of the discovered GRIN2A mutations is summarized in FIG. 3A.
- Clustering of somatic mutations is seen in regions of GRIN2A encoding various of its functional domains, and two particular clusters can be observed surrounding amino acids 371, 372, and 373 in the PBP1 iGluR NMDA NR2 domain and amino acids 1073, 1074 and 1076 in the NMDAR2 C domain.
- three recurrent alterations were observed (S278F, E371K and El 175K).
- E1175K occurred in the commercially available cell line 501Mel.
- the affected residues within these clusters are highly conserved evolutionarily and SIFT analysis of the different missense mutations on GRIN2A predicts that over 51% of the missense alterations would affect protein function (Table 4). In addition to these missense alterations, five nonsense mutations were identified, which would cause polypeptide truncation.
- somatic mutations in tumors may aid in classifying the identified genes to oncogenes or tumor suppressor genes (Vogelstein and Kinzler, Nat Med 10:789-799, 2004).
- oncogenes harbor adjacent recurrent mutations in different tumors; the mutations are nearly always missense and the mutations commonly affect only one allele.
- Tumor suppressor genes are generally mutated throughout the coding region of the gene, many of the mutations truncate the protein and the mutations generally affect both alleles.
- iGluRs ionotropic glutamate receptors
- mGlus metabotropic glutamate receptors
- iGluRs are ligand-gated ion channels that allow cations such as calcium and potassium to pass through the plasma membrane of the cell after binding of glutamate to the receptors.
- iGluRs are subdivided into three receptor types according to agonists response, one of which is N-methyl-D-aspartate (NMD A) (Hollmann and
- GRIN2A the most highly mutated gene in the screen encodes a glutamate receptor subunit which binds NMDA.
- PLCB4 which is a down-stream protein involved in metabotropic glutamate receptor-related signal transduction which leads to inositol phosphate production and protein kinase C (PKC) activation (Pin et al., Biochem Soc Trans 23:91-96, 1995) was also highly mutated in the screen.
- GRM3 which belongs to the metabotropic glutamate receptors and is also activated by glutamate, is mutated in 16% of melanoma cases.
- PLCB4 the GRM- signaling downstream-effector, PLCB4 is activated and hydrolyses phosphatidylinositol 4,5-bisphosphate and generates inositol 1,4,5- trisphosphate.
- ERBB4 and its ligand NRGl, Pyk2 as well as the Ephrins have been shown to play a crucial role in modulation of NMDA receptor signaling (Anton et al., Nat Neurosci 7: 1319-328, 2004; Rieff et al., J Neurosci 19: 10757-10766, 1999; Ozaki et al., Nature 390:691- 694, 1997; Dalva et al., Cell 103:945-956, 2000).
- NRG1-ERBB4 GRM3, Ephrin signaling and glutamate receptor functions.
- the study disclosed herein presents the most complete demonstration of melanoma exome alterations to date and provides a number of important genetic insights into melanoma.
- the comprehensive nature of the study allows one to: (1) identify TRRAP as an unexpected target of recurring genetic alterations, (2) reveal genes that were not previously connected with melanoma, one of which, GRIN2A is one of the most highly mutated in melanoma to date and (3) demonstrate that a majority of melanoma tumors had alterations in genes encoding members of the glutamate pathway.
- Example 3 Mutations in GRIN2A increase anchorage-independent growth and adversely affect receptor function
- melanoma cell lines (2359 and A375 cell lines) stably expressing both GRINI and a mutant GRIN2A (E371K, W372X, E373K, G889E, W1271X, Q891X, R9020K or El 175K) were generated. Expression of GRINI and mutant GRIN2A protein was confirmed by Western blot. To test the effect of stable expression of mutant GRIN2A on anchorage-independent growth, melanoma cell lines 2359 and A375 stably expressing GRINI and a mutant GRIN2A were seeded into soft agar in 10% serum and grown for 14 days before staining and counting. A375 colonies are shown in FIG. 11 A. As shown in FIG.
- mutant GRIN2A The effect of mutant GRIN2A on receptor function was also evaluated. As shown in FIG. 13 A, influx of calcium upon NMDA stimulation of transiently transfected HEK293T cells decreased calcium permeability in cells expressing mutant forms of GRIN2A. It was also demonstrated that mutant forms of GRIN2A bind GRIN1 with reduced affinity, thus causing decreased NMDAR complex formation (FIG. 13B). Thus, somatic mutations in GRIN2A have adverse effects on receptor function and formation.
- Validation set 1 samples were obtained from The Division of Medical Oncology, University of Colorado Denver School of
- A375 is a commercially available melanoma cell line.
- melanoma samples ⁇ Number of nonsynonymous, stop and splice site mutations observed and percent of tumors affected for each of the 16 genes in
- validation set 1 and validation set 2 respectively. * refers to stop codon. Samples used in exome capture and prevalance screen were obtained from The Surgery
- GRIN2A 501 Mel E1175K Nonsynonymous Heterozygous Commercial cell line NMDAR2_C E1175K 1 3.4
- AKR1 B10 7T splice site Heterozygous Prevalence screen No domain altered splice site N/A N/A
- PCDHB8 18T D238G Nonsynonymous Heterozygous Exome Capture No domain altered D238G 0 2.83
- GRIN2A_ 7 Exon 5 GTAAAACGACGGCCAGTGTCCTTGGGAAAGC 37
- GRIN2A_11 Exon 10 GTAAAACGACGGCCAGTAAAGTGTGGGATG 45 Forward CTTTCAGG
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Described herein is the identification of 68 genes with an elevated frequency of somatic mutations in melanoma. Nine genes were identified that exhibited recurring mutations in melanoma. In particular, the TRRAP gene was mutated at nucleotide 2165 (C2165T) in six different melanoma tumor samples. In addition, 16 genes were identified that were highly mutated in melanoma samples. The most highly mutated gene identified was GRIN2A, which was mutated in 34% of melanoma tumor samples. The study disclosed herein identified 34 different nonsynonymous somatic mutations in GRIN2A among 36 melanoma tumor samples. Thus, provided herein is a method of diagnosing a subject as having melanoma or susceptible to developing melanoma by detecting one or more mutations in the TRRAP or GRIN2A genes. Further provided is a method of selecting an appropriate therapy for a subject diagnosed with melanoma by detecting the presence or absence of a mutation in TRRAP or GRIN2A.
Description
TRRAP AND GRIN2A MUTATIONS AND USE THEREOF FOR THE DIAGNOSIS AND TREATMENT OF MELANOMA
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Application No.
61/462,471, filed February 2, 2011, which is herein incorporated by reference in its entirety.
FIELD
This disclosure concerns diagnostic markers for melanoma. In particular, this disclosure concerns identification of mutations in the
transformation/transcription domain- associated protein (TRRAP) and glutamate receptor, ionotropic, N-methyl D-aspartate 2A (GRIN2A) genes, and their use for the diagnosis and treatment of melanoma.
BACKGROUND
Melanoma is the most deadly form of skin cancer. Despite years of research, metastatic melanoma disease has a dismal prognosis and is often fatal (Jemal et al, CA Cancer J Clin 59:225-249, 2009). There are few therapeutic options for melanoma patients, demonstrating a need for new clinically relevant targets.
Although candidate gene analyses have been powerful in identifying melanoma driver mutations (Davies et al., Nature 417:949-954, 2002; Curtin et al., J Clin Oncol 24:4340-4346, 2006; Prickett et al, Nat Genet 41: 1127-1132, 2009), no comprehensive analysis of this tumor type has yet been performed.
Glutamate antagonists have previously been shown to inhibit proliferation of human tumor cells (Rzeski et al, Proc Natl Acad Sci USA 98(11):6372-6377, 2001). Glutamate is known to activate two different types of receptors - ionotropic glutamate receptors (iGluRs) and metabotropic glutamate receptors (mGlus).
iGluRs are ligand-gated ion channels that allow cations, such as calcium and potassium, to pass through the plasma membrane of the cell after being bound by glutamate. iGluRs are subdivided into three receptor types according to agonist
response, one of which is N-methyl-D-aspartate (NMD A) (Hollmann and
Heinemann, Annu Rev Neurosci 17:31-108, 1994). The glutamate receptor,
ionotropic, N-methyl D-aspartate 2A (GRIN2A) gene encodes a subunit of NMDA receptors; the GRIN2A subunit contains the agonist binding site for glutamate
(Johnson and Ascher, Nature 325:529-531, 1987).
Prior studies have suggested that transformation/transcription domain- associated protein (TRRAP) may function as an oncogene in pancreatic cancer (Loukopoulos et al., Cancer Sci 98(3):392-400, 2007; Bashyam et al, Neoplasia 7(6):556-562, 2005).
TRRAP is an adaptor protein found in various multiprotein chromatin complexes with histone acetyltransferase activity, which in turn is responsible for epigenetic transcription activation. TRRAP plays a central role in the transcriptional activity of p53, c-Myc, E2F1 and other transcription factors (McMahon et al, Cell 94:363-374, 1998; Barlev et al, Mol Cell 8: 1243-1254, 2001). TRRAP knockout mice are embryonic lethal suggesting that TRRAP is essential for cell survival (Herceg et al., Nat Genet 29:206- 211, 2001).
SUMMARY
Disclosed herein are 68 human genes with an elevated mutation frequency in melanoma. This disclosure specifically describes the identification of nine genes with recurring mutations in melanoma and 16 genes that are highly mutated in melanoma. In particular, disclosed herein is the identification of a recurrent
mutation in human TRRAP (C2165T) found in six different melanoma samples.
Also disclosed is the identification of 34 different nonsynonymous somatic
mutations of human GRIN2A in melanoma samples.
Provided herein is a method of diagnosing a subject as having melanoma, or having a greater susceptibility to developing melanoma, by detecting at least one mutation in the TRRAP gene or the GRIN2A gene. The presence of the at least one mutation indicates the subject has melanoma or is susceptible to developing
melanoma. In some embodiments, the TRRAP mutation is C2165T (numbered with reference to SEQ ID NO: 1). In some embodiments, the GRIN2A mutation is a mutation that occurs in the PBPl_iGluR_NMDA_NR2 domain, the Lig_chan
domain or the NMDAR2_C domain of GRIN2A. In particular examples, the GRIN2A mutation is selected from one or more of G20A, C170T, T547A, G754A, C833T, G1028A, G1111A, G1116A, G1117A, G1346A, T1376C, A1784G, C1793T, G1959A, G2135A, G2218A, G2666A, C2671T, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A, G3812A, C3827G, G3854A, C3952T, C4097T, G4261A, C4274T, G4276A and C4385G (numbered with reference to SEQ ID NO: 3). In some embodiments, the subject who has the detected mutation is further treated with an anti-melanoma therapy.
Further provided is a method of selecting a therapy for a subject diagnosed with melanoma by detecting the presence or absence of a C2165T mutation in the TRRAP gene (SEQ ID NO: 1). An inhibitor of TRRAP is selected if the C2165T mutation in the TRRAP gene is present. Also provided is a method of selecting a therapy for a subject diagnosed with melanoma, comprising detecting the presence or absence of at least one mutation in the GRIN2A gene disclosed herein. An inhibitor of GRIN2A or a glutamate antagonist is selected for therapy if at least one mutation in GRIN2A is identified.
The present disclosure further provides synthetic oligonucleotides as probes that specifically hybridize with a nucleic acid molecule encoding human TRRAP or human GRIN2A comprising at least one of the mutations disclosed herein. Also provided are arrays comprising a substrate to which are bound one or more of the oligonucleotides specific for mutant TRRAP or mutant GRIN2A. The
oligonucleotides may be located at addressable locations on the array.
The foregoing and other objects, features, and advantages of the invention will become more apparent from the following detailed description, which proceeds with reference to the accompanying figures.
BRIEF DESCRIPTION OF THE FIGURES FIG. 1 is a series of schematic illustrations showing the distribution of novel nonsynonymous recurrent mutations in melanoma in TRRAP, DCC, PLCHl, NOSl, LRRN3, ZNF831 and SLC17A5. Seven novel nonsynonymous recurrent mutations
identified in the study disclosed herein are presented on relevant protein schematics. Black arrows indicate locations of recurrent mutations and conserved protein functional domains are indicated as boxes (1: Immunoglobulin I-set domain; 2: Fibronectin type III domain; 3: Neogenin C-terminus; 4: Phosphoinositide-specific phospholipase C, efhand-like; 5: Phosphatidylinositol- specific phospholipase C, X domain; 6: Phosphatidylinositol- specific phospholipase C, Y domain; 7: C2 domain; 8: PDZ domain; 9: Nitric oxide synthase, oxygenase domain; 10: Flavodoxin; 11: FAD binding domain; 12: Oxidoreductase NAD-binding domain; 13: LRRNT: Leucine rich repeat N-terminal domain; 14: Leucine Rich Repeat; 15:
Immunoglobulin I-set domain; 16: Fibronectin type III domain; 17: Major Facilitator Superfamily).
FIGS. 2A-2J are a series of graphs and immunoblots showing the effect of mutant TRRAP on cell growth. FIG. 2A is a table showing mutant TRRAP induces cell transformation in NIH 3T3 cells. The table shows focus formation of NIH 3T3 cells transfected with the indicated constructs or empty vector control. KRas°12V was included as a positive control for cell transformation. FIG. 2B is an
immunoblot showing detection of TRRAP and KRas°12V protein expression in lysates of transiently transfected NIH 3T3 cells. FIG. 2C shows an immunoblot of cell lysates from HEK 293T cells transiently transfected with either control vector or shRNAs that target TRRAP. For normalization, lysates were analyzed in parallel by anti-a- tubulin immunoblotting. FIG. 2D is an anti-TRRAP immunoblot of melanoma cells transduced with shRNA targeting TRRAP. For normalization, lysates were analyzed in parallel by anti-a-tubulin immunoblotting. FIGS. 2E-2H are graphs showing TRRAP mutation confers resistance to apoptosis. The graphs show apoptosis quantification of melanoma cell lines transduced with shRNA control or shRNAs targeting TRRAP. Cells were grown in medium containing 2.5% serum for the indicated times. Apoptosis was assessed by fluorescence microscopy of Hoechst 33258-stained cells. FIGS. 21 and 2J are immunoblots of representative melanoma lines presented in E-H using the indicated antibodies to assess PARP cleavage. WT = wild-type.
FIG. 3A is a schematic illustration showing the locations of somatic mutations in GRIN2A. Human GRIN2A protein is presented with conserved functional domains indicated (SP: Signal peptide; PBP l_iGluR_NMDA_NR2: N- terminal leucine/isoleucine/valine-binding protein LIVBP-like domain of the NR2 subunit of NMDA receptor family; Lig_chan: Ligand-gated ion channel;
NMDAR2_C: N-methyl D-aspartate receptor 2B3 C-terminus). Somatic mutations are indicated with arrows and the amino acid changes are listed. Recurrent mutations in GRIN2A are S278F, E371K and El 175K. Nonsense mutations are indicated by black boxes.
FIG. 3B is a schematic illustration showing glutamate signaling pathway mutations in melanoma. The genes that function in glutamate signaling are specified. Circled genes have somatic mutations. The number of mutations in each gene is indicated by the number adjacent to the circle (PSD complex: post synaptic density complex; NMDAR: N-methyl-D-aspartic acid (NMDA) receptor; RTK: receptor tyrosine kinase) .
FIG. 4 is a graph showing mutation spectra of single base pair substitutions in melanoma whole exome sequencing. The number of each of the six classes of base substitutions resulting in nonsynonymous changes in the whole exome screen is shown.
FIG. 5 is a series of chromatograms showing a recurrent hotspot mutation in
TRRAP in representative melanoma tumor samples and the commercially available A375 cell line. In each case, the top sequence chromatogram was obtained from normal tissue and the lower sequence chromatogram from the indicated tumors. Arrows indicate the location of the missense mutations. The nucleotide and amino acid alterations are indicated below the chromatograms. The sequences shown in the chromatograms are TGTCTCCCTCT (SEQ ID NO: 5) for normal tissue;
TGTCTYCCTCT (SEQ ID NO: 6) for tumor samples; and TGTCTYYCTCT (SEQ ID NO: 7) for the A375 cell line.
FIG. 6 is a sequence comparison of conserved serine-722 of human TRRAP with its orthologs. The human TRRAP orthologs for 12 species were compared using the indicated NCBI accession numbers by COBALT algorithm (available
online at www.ncbi.nlm.nih.gov/tools/cobalt/colbat.cgi). The human TRRAP sequence (amino acids 697-747 of SEQ ID NO: 2) is compared with sequences from Canis familiaris (SEQ ID NO: 8), Pan troglodytes (SEQ ID NO: 9), Bos Taurus (SEQ ID NO: 10), Rattus norvegicus (SEQ ID NO: 11), Gallus gallus (SEQ ID NO: 12), Danio rerio (SEQ ID NO: 13), Mus musculus (SEQ ID NO: 14), D.
melanogaster (SEQ ID NO: 15), Anopheles gamiae (SEQ ID NO: 16), C. elegans (SEQ ID NO: 17) and S. cerevisiae (SEQ ID NO: 18). The conserved serine at amino acid 722 in humans is underlined and aligned with other species. This residue is not conserved in C. elegans or S. cerevisiae.
FIG. 7 is a graph showing mutation spectra of single base pair substitutions in GRIN2A. The number of each of the six classes of base substitutions resulting in nonsynonymous changes in GRIN2A is shown.
FIG. 8 is a schematic of the whole exome capture and sequencing analysis of 14 melanoma samples.
FIG. 9 is a table showing score cutoff for determination of melanoma somatic mutations.
FIGS. 10A-10D are a series of graphs showing the effect of mutant TRRAP on cell growth. Apoptosis was quantified for melanoma cell lines transduced with shRNA control or shRNAs targeting TRRAP. Cells were grown in medium containing 10% serum for the indicated times. Apoptosis was assessed by fluorescence microscopy of Hoechst 33258-stained cells.
FIGS. 11A-11B demonstrate that melanoma cells expressing mutant forms of GRIN2A have increased ability for anchorage-independent growth. Melanoma cells (A375 cells) stably expressing GRIN1 and GRIN2A mutants, or empty vector, were seeded into soft agar in 10% serum and grown for 14 days before staining and counting (A). Also shown is a quantitative graph of colony formation of A375 cells in soft agar (B). Error bars are representative of n=3 (s.d.).
FIGS. 12A-12B are a set of graphs showing GRIN2A functions as a tumor suppressor in melanoma cells. Endogenous GRIN2A was stably depleted in melanoma cells using shRNA specific for human GRIN2A. (A) Proliferation assay of mutant expressing GRIN2A cell lines depleted of endogenous GRIN2A. Knock-
down using GRIN2 A- specific shRNA (#1, #2 and #3) resulted in little to no change in proliferation for 125T or 501Mel melanoma cell lines. (B) Proliferation assay of wild-type expressing GRIN2A cell lines depleted of GRIN2A. Knock-down resulted in increased proliferation for both 3 IT and 39T compared to empty vector control (pLKO.l).
FIGS. 13A-13B demonstrate that somatic mutations in GRIN2A have adverse effects on receptor function and formation. (A) Influx of calcium upon NMDA stimulation of transiently transfected HEK293T cells shows decreased calcium permeability in cells expressing mutant forms of GRIN2A. (B) Mutant forms of GRIN2A bind GRIN1 with reduced affinity, thus causing decreased
NMDAR complex formation. HEK293T cells were transiently transfected with WT GRIN! and GRIN2A (WT or mutants) or empty vectors as control and
immunoprecipitated with anti-GRINl. Immunoprecipitates were probed with anti- GRIN2A and anti-GRINl to confirm binding. Lysates were probed with anti- GRIN2A and anti-GAPDH as a loading control.
SEQUENCE LISTING
The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. The Sequence Listing is submitted as an ASCII text file, created on January 18, 2012, 82.6 KB, which is incorporated by reference herein. In the accompanying sequence listing:
SEQ ID NO: 1 is the nucleotide sequence of human TRRAP (CCDS ID
5659.1).
SEQ ID NO: 2 is the amino acid sequence of human TRRAP (CCDS ID 5659.1).
SEQ ID NO: 3 is the nucleotide sequence of human GRIN2A (CCDS ID 10539.1).
SEQ ID NO: 4 is the amino acid sequence of human GRIN2A (CCDS ID 10539.1).
SEQ ID NOs: 5-7 are nucleotide sequences of the region surrounding the TRRAP hotspot mutation from a control sample, a tumor sample and A375 cells, respectively.
SEQ ID NOs: 8-18 are amino acid sequences of a segment of the TRRAP protein from several different species.
SEQ ID NOs: 19-24 are nucleotide sequences of TRRAP primers used for recurrent mutation confirmation.
SEQ ID NOs: 25-62 are nucleotide sequences of GRIN2A primers used for PCR and sequencing.
SEQ ID NOs: 63-66 are nucleotide sequences of TRRAP mutation primers.
SEQ ID NOs: 67-72 are TRRAP- specific shRNA sequences.
DETAILED DESCRIPTION
I. Abbreviations
FBS fetal bovine serum
GRIN2A glutamate receptor, ionotropic, N-methyl D-aspartate 2A
H&E hematoxylin and eosin
iGluR ionotropic glutamate receptor
mGlu metabotropic glutamate receptor
NMDA N-methyl-D-aspartate
PARP poly-ADP ribose polymerase
PCR polymerase chain reaction
RT-PCR reverse transcriptase polymerase chain reaction
shRNA short hairpin RNA
TRRAP transformation/transcription domain- associated protein
WT wild-type
II. Terms and Methods
Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology may be found in
Benjamin Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19- 854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology : a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).
In order to facilitate review of the various embodiments of the disclosure, the following explanations of specific terms are provided:
Administration: The introduction of a composition into a subject by a chosen route. For example, if the chosen route is intravenous, the composition is administered by introducing the composition into a vein of the subject.
Antagonist: A molecule or compound that blocks or inhibits the activity of another molecule or compound (such as a drug that inhibits the function of a protein).
Array: An arrangement of molecules, such as biological macromolecules (such as peptides or nucleic acid molecules) or biological samples (such as tissue sections), in addressable locations on or in a substrate. A "microarray" is an array that is miniaturized so as to require or be aided by microscopic examination for evaluation or analysis. Arrays are sometimes called DNA chips or biochips.
The array of molecules ("features") makes it possible to carry out a very large number of analyses on a sample at one time. In certain example arrays, one or more molecules (such as an oligonucleotide probe) will occur on the array a plurality of times (such as twice), for instance to provide internal controls. The number of addressable locations on the array can vary, for example from at least two, at least four, at least six, to at least 9, at least 10, at least 14, at least 15, at least 20, at least 30, at least 50, at least 75, at least 100, at least 150, at least 200, at least 300, at least 500, least 550, at least 600, at least 800, at least 1000, or more. In a particular example, an array includes 2-100 addressable locations, such as 4-20 addressable locations. In particular examples, an array consists essentially of
oligonucleotide probes specific for the somatic mutations in TRRAP and/or GRIN2A disclosed herein.
In particular examples, an array includes nucleic acid molecules, such as oligonucleotide sequences that are at least 15 nucleotides in length, such as about 15-40 nucleotides in length.
Within an array, each arrayed sample is addressable, in that its location can be reliably and consistently determined within at least two dimensions of the array. The feature application location on an array can assume different shapes. For example, the array can be regular (such as arranged in uniform rows and columns) or irregular. Thus, in ordered arrays the location of each sample is assigned to the sample at the time when it is applied to the array, and a key may be provided in order to correlate each location with the appropriate target or feature position.
Often, ordered arrays are arranged in a symmetrical grid pattern, but samples could be arranged in other patterns (such as in radially distributed lines, spiral lines, or ordered clusters). Addressable arrays usually are computer readable, in that a computer can be programmed to correlate a particular address on the array with information about the sample at that position (such as hybridization or binding data, including for instance signal intensity). In some examples of computer readable formats, the individual features in the array are arranged regularly, for instance in a Cartesian grid pattern, which can be correlated to address information by a computer.
Clinical outcome: Refers to the health status of a patient following treatment for a disease or disorder (such as melanoma), or in the absence of treatment. Clinical outcomes include, but are not limited to, an increase in the length of time until death, a decrease in the length of time until death, an increase in the chance of survival, an increase in the risk of death, survival, disease-free survival, chronic disease, metastasis, advanced or aggressive disease, disease recurrence, death, and favorable or poor response to therapy.
Decrease in survival: As used herein, "decrease in survival" refers to a decrease in the length of time before death of a patient, or an increase in the risk of death for the patient. A decrease in survival also can refer to a decrease in the
average time to death in a group, such as a group of patients diagnosed with melanoma.
Diagnosing: Refers to the process of identifying the nature or cause of a disease or disorder.
Glutamate antagonist: Refers to any compound that blocks glutamate function, such as glutamate function mediated through ionotropic glutamate receptors. Thus, suitable glutamate antagonists include, for example, compounds that bind ionotropic glutamate receptors (iGluRs), including NMDA receptors (e.g., GRIN2A). Compounds that bind ionotropic glutamate receptors include compounds which bind -amino-3-hydroxy-5-methyl-4-isoxazole-propionate (AMPA), NMDA, or kainate receptors in a competitive manner or interact with ionotropic glutamate receptor mediated signals in a non-competitive manner. Other suitable glutamate antagonists include, for example, glutathione promoting agents, GABA stimulating agents and certain neurotransmitters. Glutamate antagonists are known in the art (see, for example, U.S. Patent Application Publication Nos. 2007/0135413 and 2007/0248690). In particular examples, the glutamate antagonist is dizocilpine, GYKI52466, MK-801, AP-5 or CGS 19755 (selfotel).
GRIN2A (glutamate receptor, ionotropic, N-methyl D-aspartate 2A): A subunit of N-methyl-D-aspartate (NMDA) receptors. NMDA receptors are a class of ionotropic glutamate-gated ion channels. These receptors have been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromeric complexes composed of the key receptor subunit NMDARl (GRINl) and 1 or more of the 4 NMDAR2 subunits: NMDAR2A (GRIN2A), NMDAR2B (GRIN2B), NMDAR2C (GRIN2C) and NMDAR2D
(GRIN2D). GRIN2A, which is also known as NR2A and NMDAR2A, contains the antagonist binding site for glutamate.
GRIN2A sequences are publically available. For example, GenBank Accession Nos. NM_000833 and NP_000824 are the nucleotide and amino acid sequences, respectively, of human GRIN2A transcript variant 2. GenBank
Accession Nos. NM_001 134407 and NP_001127879 are the nucleotide and amino
acid sequences, respectively, of human GRIN2A transcript variant 1. The NCBI CCDS database also provides nucleotide and amino acid sequences for GRIN2A under CCDS ID 10539.1. The GenBank Accession numbers and CCDS ID numbers listed above and disclosed herein are incorporated by reference as they appear in the database as of December 3, 2010.
Disclosed herein are somatic mutations in GRIN2A identified in melanoma tumor samples. The disclosed mutations are referred to by the location of the GRIN2A mutation with reference to SEQ ID NO: 3 (nucleotide) and SEQ ID NO: 4 (amino acid). For example, the C833T mutation refers to a cytosine to thymidine substitution at nucleotide 833 (SEQ ID NO: 3), which results in a serine to phenylalanine change at amino acid 278 (S278F; SEQ ID NO: 4). Some somatic mutations result in the introduction of a stop codon (a nonsense mutation), for example, the G20A GRIN2A mutation. The corresponding amino acid change for the G20A mutation (which occurs at position 7 of SEQ ID NO: 4) is therefore designated W7*.
In some embodiments of the methods disclosed herein, the GRIN2A mutation occurs in a portion of the GRIN2A gene that encodes the
PBPl_iGluR_NMDA_NR2 domain; a portion of the GRIN2A gene that encodes the Lig_chan domain; or a portion of the GRIN2A gene that encodes the NMDAR2_C domain. As defined herein, the PBPl_iGluR_NMDA_NR2 domain is encoded by nucleotides 94-1176 of SEQ ID NO: 3 and the amino acid sequence of the
PBP l_iGluR_NMDA_NR2 domain corresponds to residues 32-392 of SEQ ID NO: 4; the Lig_chan domain is encoded by nucleotides 1660-2484 of SEQ ID NO: 3 and the amino acid sequence of the Lig_chan domain corresponds to residues 554-828 of SEQ ID NO: 4; and the NMDAR2_C domain is encoded by nucleotides 2515-4392 of SEQ ID NO: 3 and the amino acid sequence of the NMDAR2_C domain corresponds to residues 839-1464 of SEQ ID NO: 4. In some embodiments, the GRIN2A mutation is selected from G20A, C170T, T547A, G754A, C833T, G1028A, G1111A, G1116A, G1117A, G1346A, T1376C, A1784G, C1793T, G1959A, G2135A, G2218A, G2666A, C2671T, G2759A, C2786T, G2884A,
G3217A, C3221T, G3457A, G3523A, G3812A, C3827G, G3854A, C3952T, C4097T, G4261A, C4274T, G4276A and C4385G (SEQ ID NO: 3).
Inhibitor: As used herein, an "inhibitor" refers to any compound that is capable of reducing or altering the expression or activity of a target molecule (such as a nucleic acid molecule or a protein). In some embodiments, the inhibitor is an inhibitor of TRRAP or GRIN2A.
Label: An agent capable of detection, for example by enzyme-linked immunosorbent assay (ELISA), spectrophotometry, flow cytometry or microscopy. For example, a label can be attached to a nucleic acid molecule or protein, thereby permitting detection of the nucleic acid molecule or protein. Examples of labels include, but are not limited to, radioactive isotopes, enzyme substrates, co-factors, ligands, chemiluminescent agents, fluorophores, haptens, enzymes, and
combinations thereof. Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed for example in Sambrook et al.
(Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989) and Ausubel et al. (In Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1998).
In some embodiments, the label is a fluorophore ("fluorescent label").
Fluorophores are chemical compounds, which when excited by exposure to a particular wavelength of light, emits light {i.e., fluoresces), for example at a different wavelength. Fluorophores can be described in terms of their emission profile, or "color." Green fluorophores, for example Cy3, FITC, and Oregon Green™, are characterized by their emission at wavelengths generally in the range of 515-540 λ. Red fluorophores, for example Texas Red™, Cy5 and tetramethylrhodamine, are characterized by their emission at wavelengths generally in the range of 590-690 λ.
Examples of fluorophores that may be used are provided in U.S. Patent No. 5,866,366 to Nazarenko et al., and include for instance: 4-acetamido-4'- isothiocyanatostilbene-2,2'disulfonic acid, acridine and derivatives such as acridine and acridine isothiocyanate, 5-(2'-aminoethyl)aminonaphthalene-l-sulfonic acid (EDANS), 4-amino-N-[3-vinylsulfonyl)phenyl]naphthalimide-3,5 disulfonate
(Lucifer Yellow VS), N-(4-anilino-l-naphthyl)maleimide, anthranilamide, Brilliant
Yellow, coumarin and derivatives such as coumarin, 7-amino-4-methylcoumarin (AMC, Coumarin 120), 7-amino-4-trifluoromethylcouluarin (Coumarin 151);
cyanosine; 4',6-diaminidino-2-phenylindole (DAPI); 5', 5"-dibromopyrogallol- sulfonephthalein (Bromopyrogallol Red); 7-diethylamino-3-(4'- isothiocyanatophenyl)-4-methylcoumarin; diethylenetriamine pentaacetate; 4,4'- diisothiocyanatodihydro-stilbene-2,2'-disulfonic acid; 4,4'-diisothiocyanatostilbene- 2,2'-disulfonic acid; 5-[dimethylamino]naphthalene-l-sulfonyl chloride (DNS, dansyl chloride); 4-(4'-dimethylaminophenylazo)benzoic acid (DABCYL); 4- dimethylaminophenylazophenyl-4'-isothiocyanate (DABITC); eosin and derivatives such as eosin and eosin isothiocyanate; erythrosin and derivatives such as erythrosin B and erythrosin isothiocyanate; ethidium; fluorescein and derivatives such as 5- carboxyfluorescein (FAM), 5-(4,6-dichlorotriazin-2-yl)aminofluorescein (DTAF), 2'7'-dimethoxy-4'5'-dichloro-6-carboxyfluorescein (JOE), fluorescein, fluorescein isothiocyanate (FITC), and QFITC (XRITC); fluorescamine; IR144; IR1446;
Malachite Green isothiocyanate; 4-methylumbelliferone; ortho cresolphthalein; nitrotyrosine; pararosaniline; Phenol Red; B-phycoerythrin; o-phthaldialdehyde; pyrene and derivatives such as pyrene, pyrene butyrate and succinimidyl 1-pyrene butyrate; Reactive Red 4 (Cibacron™ Brilliant Red 3B-A); rhodamine and derivatives such as 6-carboxy-X-rhodamine (ROX), 6-carboxyrhodamine (R6G), lissamine rhodamine B sulfonyl chloride, rhodamine (Rhod), rhodamine B, rhodamine 123, rhodamine X isothiocyanate, sulforhodamine B, sulforhodamine 101 and sulfonyl chloride derivative of sulforhodamine 101 (Texas Red); Ν,Ν,Ν',Ν'- tetramethyl-6-carboxyrhodamine (TAMRA); tetramethyl rhodamine; tetramethyl rhodamine isothiocyanate (TRITC); riboflavin; rosolic acid and terbium chelate derivatives.
Other contemplated fluorophores include GFP (green fluorescent protein), Lissamine™, diethylaminocoumarin, fluorescein chlorotriazinyl,
naphthofluorescein, 4,7-dichlororhodamine and xanthene and derivatives thereof. Other fluorophores known to those skilled in the art may also be used.
Melanoma: A form of cancer that originates in melanocytes (cells that make the pigment melanin). Melanocytes are found primarily in the skin, but are
also present in the bowel and eye. As used herein, "melanoma" refers to any stage of melanoma, or any subtype of melanoma, such as superficial spreading melanoma, nodular melanoma, acral lentiginous melanoma, lentigo maligna, melanoma-in-situ, mucosal melanoma and uveal melanoma.
Metastasis: Refers to the spread of cancer cells from the original tumor to other sites in the body.
Mutation: Any change of the DNA sequence within a gene or chromosome. In some instances, a mutation will alter a characteristic or trait (phenotype), but this is not always the case. Types of mutations include base substitution point mutations (e.g. , transitions or transversions), deletions and insertions. Missense mutations are those that introduce a different amino acid into the sequence of the encoded protein; nonsense mutations are those that introduce a new stop codon. In the case of insertions or deletions, mutations can be in-frame (not changing the frame of the overall sequence) or frame shift mutations, which may result in the misreading of a large number of codons (and often leads to abnormal termination of the encoded product due to the presence of a stop codon in the alternative frame).
This term specifically encompasses variations that arise through somatic mutation, for instance those that are found only in disease cells (such as cancer cells), but not constitutionally, in a given individual. Examples of such somatically- acquired variations include the point mutations that frequently result in altered function of various genes that are involved in development of cancers. This term also encompasses DNA alterations that are present constitutionally, that alter the function of the encoded protein in a readily demonstrable manner, and that can be inherited by the children of an affected individual. In this respect, the term overlaps with "polymorphism," as discussed below, but generally refers to the subset of constitutional alterations that have arisen within the past few generations in a kindred and that are not widely disseminated in a population group.
In some embodiments, a mutation in TRRAP refers to a nucleotide substitution in the TRRAP gene or cDNA, or an amino acid substitution in the TRRAP protein. In some embodiments, a mutation in GRIN2A refers to a
nucleotide substitution in the GRIN2A gene or cDNA, or an amino acid substitution in the GRIN2A protein.
Oligonucleotide: A linear polynucleotide sequence of up to about 100 nucleotide bases in length. In some embodiments, the oligonucleotide is 15-40 nucleotides in length.
Patient: As used herein, the term "patient" includes human and non-human animals. The preferred patient for treatment is a human.
Pharmaceutically acceptable vehicles: The pharmaceutically acceptable carriers (vehicles) useful in this disclosure are conventional. Remington's
Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compounds, molecules or agents.
In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (for example, powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
Polymorphism: Variant in a sequence of a gene, or any genomic sequence, usually carried from one generation to another in a population. Polymorphisms can be those variations (nucleotide sequence differences) that, while having a different nucleotide sequence, produce functionally equivalent gene products, such as those variations generally found between individuals, different ethnic groups, and geographic locations. The term polymorphism also encompasses variations that produce gene products with altered function, i.e., variants in the gene sequence that lead to gene products that are not functionally equivalent. This term also
encompasses variations that produce no gene product, an inactive gene product, a truncated gene product, or increased or increased activity gene product.
Polymorphisms can be referred to, for instance, by the nucleotide position at which the variation exists, by the change in amino acid sequence caused by the nucleotide variation, or by a change in some other characteristic of the nucleic acid molecule or protein that is linked to the variation (e.g. , an alteration of a secondary structure such as a stem-loop, or an alteration of the binding affinity of the nucleic acid for associated molecules, such as polymerases, RNAses, a change in the availability of a site for cleavage by a restriction endonuclease, either the formation of a new site, or lose of a site, and so forth).
Polypeptide: A polymer in which the monomers are amino acid residues which are joined together through amide bonds. When the amino acids are alpha- amino acids, either the L-optical isomer or the D-optical isomer can be used. The terms "polypeptide" or "protein" as used herein are intended to encompass any amino acid sequence and include modified sequences such as glycoproteins. The term "polypeptide" is specifically intended to cover naturally occurring proteins, as well as those which are recombinantly or synthetically produced.
The term "residue" or "amino acid residue" includes reference to an amino acid that is incorporated into a protein, polypeptide, or peptide.
Conservative amino acid substitutions are those substitutions that, when made, least interfere with the properties of the original protein, that is, the structure and especially the function of the protein is conserved and not significantly changed by such substitutions. Examples of conservative substitutions are shown in the following table.
Original Residue Conservative Substitutions
Ala Ser
Arg Lys
Asn Gin, His
Asp Glu
Cys Ser
Gin Asn
Glu Asp
His Asn; Gin
He Leu, Val
Leu He; Val
Lys Arg; Gin; Glu
Met Leu; He
Phe Met; Leu; Tyr
Ser Thr
Thr Ser
Trp Tyr
Tyr Trp; Phe
Val He; Leu
Conservative substitutions generally maintain (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain.
The substitutions which in general are expected to produce the greatest changes in protein properties will be non-conservative, for instance changes in which (a) a hydrophilic residue, for example, seryl or threonyl, is substituted for (or by) a hydrophobic residue, for example, leucyl, isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, for example, lysyl, arginyl, or histadyl, is substituted for (or by) an electronegative residue, for example, glutamyl or aspartyl; or (d) a residue having a bulky side chain, for example, phenylalanine, is substituted for (or by) one not having a side chain, for example, glycine.
Preventing, treating or ameliorating a disease: "Preventing" or
"inhibiting" a disease (such as melanoma) refers to inhibiting the full development of a disease. "Treating" refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition after it has begun to develop. "Ameliorating" refers to the reduction in the number or severity of signs or symptoms of a disease.
Probes and primers: A probe comprises an isolated nucleic acid capable of hybridizing to a target nucleic acid. A detectable label or reporter molecule can be attached to a probe or primer. Typical labels include radioactive isotopes, enzyme substrates, co-factors, ligands, chemiluminescent or fluorescent agents, haptens, and enzymes. Methods for labeling and guidance in the choice of labels appropriate for
various purposes are discussed, for example in Sambrook et al. (In Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989) and Ausubel et al. (In Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1998). In some embodiments, an "oligonucleotide" is a probe or primer.
In a particular example, a probe includes at least one fluorophore, such as an acceptor fluorophore or donor fluorophore. For example, a fluorophore can be attached at the 5'- or 3'-end of the probe. In specific examples, the fluorophore is attached to the base at the 5'-end of the probe, the base at its 3'-end, the phosphate group at its 5'-end or a modified base, such as a T internal to the probe.
Probes are generally at least 15 nucleotides in length, such as at least 15, at least 16, at least 17, at least 18, at least 19, least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50 at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least 67, at least 68, at least 69, at least 70, or more contiguous nucleotides complementary to the target nucleic acid molecule, such as 15-70 nucleotides, 15-60 nucleotides, 15-50 nucleotides, 15-40 nucleotides, or 15-30 nucleotides.
Primers are short nucleic acid molecules, for instance DNA oligonucleotides 15 nucleotides or more in length, which can be annealed to a complementary target nucleic acid molecule by nucleic acid hybridization to form a hybrid between the primer and the target nucleic acid strand. A primer can be extended along the target nucleic acid molecule by a polymerase enzyme. Therefore, primers can be used to amplify a target nucleic acid molecule.
The specificity of a primer increases with its length. Thus, for example, a primer that includes 30 consecutive nucleotides will anneal to a target sequence with a higher specificity than a corresponding primer of only 15 nucleotides. Thus, to obtain greater specificity, probes and primers can be selected that include at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70 or more consecutive nucleotides. In particular
examples, a primer is at least 15 nucleotides in length, such as at least 15 contiguous nucleotides complementary to a target nucleic acid molecule. Particular lengths of primers that can be used to practice the methods of the present disclosure include primers having at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, or more contiguous nucleotides complementary to the target nucleic acid molecule to be amplified, such as a primer of 15-70 nucleotides, 15-60 nucleotides, 15-50 nucleotides, 15-40 nucleotides or 15-30 nucleotides.
Primer pairs can be used for amplification of a nucleic acid sequence, for example, by PCR, real-time PCR, or other nucleic-acid amplification methods known in the art. An "upstream" or "forward" primer is a primer 5' to a reference point on a nucleic acid sequence. A "downstream" or "reverse" primer is a primer 3' to a reference point on a nucleic acid sequence. In general, at least one forward and one reverse primer are included in an amplification reaction.
Nucleic acid probes and primers can be readily prepared based on the nucleic acid molecules provided herein. It is also appropriate to generate probes and primers based on fragments or portions of these disclosed nucleic acid molecules, for instance regions that encompass the identified mutations of interest. PCR primer pairs can be derived from a known sequence by using computer programs intended for that purpose such as Primer (Version 0.5, © 1991, Whitehead Institute for Biomedical Research, Cambridge, MA) or PRIMER EXPRESS® Software (Applied Biosystems, AB, Foster City, CA).
Prognosis: The likelihood of the clinical outcome for a subject afflicted with a specific disease or disorder. With regard to cancer, the prognosis is a representation of the likelihood (probability) that the subject will survive (such as for one, two, three, four or five years) and/or respond to anti-melanoma treatment, and/or the likelihood (probability) that the tumor will metastasize. A "poor prognosis" indicates a greater than 50% chance that the subject will not survive to a
specified time point (such as one, two, three, four or five years), and/or a greater than 50% chance that the tumor will metastasize. In several examples, a poor prognosis indicates that there is a greater than 60%, 70%, 80%, or 90% chance that the subject will not survive and/or a greater than 60%, 70%, 80% or 90% chance that the tumor will metastasize. Conversely, a "good prognosis" indicates a greater than 50% chance that the subject will survive to a specified time point (such as one, two, three, four or five years), and/or a greater than 50% chance that the tumor will not metastasize. In several examples, a good prognosis indicates that there is a greater than 60%, 70%, 80%, or 90% chance that the subject will survive and/or a greater than 60%, 70%, 80% or 90% chance that the tumor will not metastasize.
Sample: A biological specimen containing genomic DNA, RNA, protein, or combinations thereof, obtained from a subject. Examples include, but are not limited to, peripheral blood, urine, saliva, tissue biopsy (such as skin tissue), surgical specimen, and autopsy material. In one example, a sample includes a biopsy of a melanoma tumor or a sample of normal tissue, such as skin tissue (from a subject not afflicted with a known disease or disorder, such as a cancer-free subject).
Specific hybridization: Specific hybridization refers to the binding, duplexing, or hybridizing of a molecule only or substantially only to a particular nucleotide sequence when that sequence is present in a complex mixture (e.g. total cellular DNA or RNA). Specific hybridization may also occur under conditions of varying stringency.
Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing DNA used. Generally, the temperature of hybridization and the ionic strength (especially the Na+ concentration) of the hybridization buffer will determine the stringency of hybridization. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed by Sambrook et al. (In: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989 ch. 9 and 11). By way of illustration only, a hybridization experiment may be performed by hybridization of a DNA molecule to a target DNA molecule which has been electrophoresed in an agarose
gel and transferred to a nitrocellulose membrane by Southern blotting (Southern, J. Mol. Biol. 98:503, 1975), a technique well known in the art and described in Sambrook et al. {Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989).
Stringent conditions may be defined as those under which DNA molecules with more than 25%, 15%, 10%, 6% or 2% sequence variation (also termed "mismatch") will not hybridize. Stringent conditions are sequence dependent and are different in different circumstances. Longer sequences hybridize specifically at higher temperatures. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point Tm for the specific sequence at a defined ionic strength and pH. An example of stringent conditions is a salt concentration of at least about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and a temperature of at least about 30°C for short probes {e.g. 10 to 50 nucleotides). Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide. For example, conditions of 5 X SSPE (750 mM NaCl, 50 mM
Na Phosphate, 5 mM EDTA, pH 7.4) and a temperature of 25-30°C are suitable for allele- specific probe hybridizations.
The following is an exemplary set of hybridization conditions and is not meant to be limiting:
Very High Stringency (detects sequences that share 90% identity)
Hybridization: 5x SSC at 65°C for 16 hours
Wash twice: 2x SSC at room temperature (RT) for 15 minutes each
Wash twice: 0.5x SSC at 65°C for 20 minutes each High Stringency (detects sequences that share 80% identity or greater)
Hybridization: 5x-6x SSC at 65°C-70°C for 16-20 hours
Wash twice: 2x SSC at RT for 5-20 minutes each
Wash twice: lx SSC at 55°C-70°C for 30 minutes each Low Stringency (detects sequences that share greater than 50% identity)
Hybridization: 6x SSC at RT to 55°C for 16-20 hours
Wash at least twice: 2x-3x SSC at RT to 55°C for 20-30 minutes each.
A perfectly matched probe has a sequence perfectly complementary to a particular target sequence. The test probe is typically perfectly complementary to a
portion (subsequence) of the target sequence. The term "mismatch probe" refers to probes whose sequence is deliberately selected not to be perfectly complementary to a particular target sequence.
Somatic mutation: An acquired mutation that occurs in a somatic cell (as opposed to a germ cell).
Subject: Living multi-cellular vertebrate organisms, a category that includes both human and non-human mammals. In some embodiments, the subject is a human subject.
Therapeutic agent: A chemical compound, small molecule, or other composition, such as an antisense compound, antibody, peptide or nucleic acid molecule capable of inducing a desired therapeutic or prophylactic effect when properly administered to a subject. For example, therapeutic agents for melanoma include agents that prevent or inhibit development or metastasis of melanoma. In some embodiments, the therapeutic agent is an inhibitor of TRRAP, an inhibitor of GRTN2A or a glutamate antagonist.
Therapeutically effective amount: A quantity of a specific substance sufficient to achieve a desired effect in a subject being treated. For example, a therapeutically effective amount of a therapeutic agent to treat melanoma can refer to the amount necessary to inhibit tumor growth, decrease tumor volume, inhibit tumor metastasis, or prolong survival.
Therapy: The mode of treatment or care of a patient. In some cases, therapy refers to administration of a therapeutic agent. In some embodiments herein, therapy includes administration of an inhibitor of TRRAP, an inhibitor of GRIN2A or a glutamate antagonist. In other examples, therapy includes surgery, such as surgical resection of a melanoma tumor, chemotherapy, radiation therapy, administration of a second therapeutic agent, or any combination thereof.
TRRAP (transformation/transcription domain-associated protein): An adaptor protein found in various multiprotein chromatin complexes with histone acetyltransferase activity, which in turn is responsible for epigenetic transcription activation. TRRAP plays a central role in the transcriptional activity of p53, c-Myc, E2F1 and other transcription factors (McMahon et al, Cell 94:363-74, 1998; Barlev et
al, Mol Cell 8:1243-1254, 2001). TRRAP knockout mice are embryonic lethal suggesting that TRRAP is essential for cell survival (Herceg et al., Nat Genet 29:206-11, 2001). Prior studies have suggested that TRRAP may function as an oncogene in pancreatic cancer (Loukopoulos et al, Cancer Sci 98(3):392-400, 2007; Bashyam et al., Neoplasia 7(6):556-562, 2005).
TRRAP sequences are publically available. For example, GenBank
Accession Nos. NM_003496 and NP_003487 are the nucleotide and amino acid sequences, respectively, of human TRRAP. The NCBI CCDS database also
provides nucleotide and amino acid sequences for human TRRAP under CCDS ID 5659.1. The GenBank Accession numbers and CCDS ID numbers listed above and disclosed herein are incorporated by reference as they appear in the database as of December 3, 2010.
Disclosed herein is a recurrent somatic mutation in TRRAP identified in melanoma tumor samples. The disclosed mutation is referred to by the location of the TRRAP mutation with reference to SEQ ID NO: 1 (nucleotide) and SEQ ID NO: 2
(amino acid). Thus, the C2165T mutation refers to a cytosine to thymidine substitution at nucleotide 2165 (SEQ ID NO: 1), which results in a serine to phenylalanine change at amino acid 722 (S722F; SEQ ID NO: 2).
Tumor, neoplasia, malignancy or cancer: A neoplasm is an abnormal growth of tissue or cells that results from excessive cell division. Neoplastic growth can produce a tumor. The amount of a tumor in an individual is the "tumor
burden" which can be measured as the number, volume, or weight of the tumor. A tumor that does not metastasize is referred to as "benign." A tumor that invades the surrounding tissue and/or can metastasize is referred to as "malignant." A "non- cancerous tissue" is a tissue from the same organ wherein the malignant neoplasm formed, but does not have the characteristic pathology of the neoplasm. Generally, noncancerous tissue appears histologically normal. A "normal tissue" is tissue from an organ, wherein the organ is not affected by cancer or another disease or disorder of that organ. A "cancer-free" subject has not been diagnosed with a cancer of that organ and does not have detectable cancer.
Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. Hence "comprising A or B" means including A, or B, or A and B. It is further to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. All publications, patent applications, patents, GenBank Accession numbers and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
III. Overview of Several Embodiments
Described herein is the identification of 68 human genes with an elevated frequency of somatic mutations in melanoma. Nine genes were identified that exhibited recurring mutations in melanoma. In particular, the TRRAP gene was mutated at nucleotide 2165 (C2165T) in six different melanoma tumor samples. In addition, 16 genes were identified that were highly mutated in melanoma samples. The most highly mutated gene identified was GRIN2A, which was mutated in 34% of melanoma tumor samples. The study disclosed herein identified 34 different nonsynonymous somatic mutations in GRIN2A among 36 melanoma tumor samples.
Provided herein is a method of diagnosing a subject as having melanoma, or susceptible to developing melanoma, by detecting at least one mutation in the TRRAP gene or the GRIN2A gene. The presence of the at least one mutation indicates the subject has melanoma or is susceptible to developing melanoma.
In some embodiments, the at least one mutation is in the human TRRAP gene (SEQ ID NO: 1). In particular examples, the mutation is the C2165T mutation in human TRRAP.
In some embodiments, the at least one mutation is in the human GRIN2A gene (SEQ ID NO: 3). In some examples, the mutation occurs in a portion of the GRIN2A gene that encodes the PBP l_iGluR_NMDA_NR2 domain, the Lig_chan domain or the NMDAR2_C domain of human GRIN2A. In other examples, the at least one mutation is G20A, G1346A or T1376C in the GRIN2A gene (SEQ ID NO: 3). In particular examples, the mutation in the portion of the GRIN2A gene that encodes the PBP l_iGluR_NMDA_NR2 domain is C170T, T547A, G754A, C833T, G1028A, Gl 111A, Gl 116A or Gl 117A (SEQ ID NO: 3). In other particular examples, the mutation in the portion of the GRIN2A gene that encodes the
Lig_chan domain is A1784G, C1793T, G1959A, G2135A or G2218A (SEQ ID NO: 3). In yet other examples, the mutation in the portion of the GRIN2A gene that encodes the NMDAR2_C domain is G2666A, C2671T, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A, G3812A, C3827G, G3854A, C3952T, C4097T, G4261A, C4274T, G4276A or C4385G (SEQ ID NO: 3).
In some embodiments, the at least one mutation is selected from G20A, C170T, T547A, G754A, C833T, G1028A, G1111A, G1116A, G1117A, G1346A, T1376C, A1784G, C1793T, G1959A, G2135A, G2218A, G2666A, C2671T, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A, G3812A, C3827G, G3854A, C3952T, C4097T, G4261A, C4274T, G4276A and C4385G in human GRIN2A (SEQ ID NO: 3). In specific examples, the mutation is a recurring mutation in GRIN2A identified herein, such as C833T, Gl 111A, G3523A or G3812A (SEQ ID NO: 3).
In some embodiments of the diagnosis methods, detecting the presence or absence of the at least one mutation comprises detecting the presence or absence of the mutation in a skin sample obtained from the subject.
In some embodiments, the method further includes providing a test output (i.e., the result of the test to detect mutations in TRRAP or GRIN2A) to a user (such as a physician or health care worker, the patient or laboratory personnel). In
particular examples, the output includes the presence or absence of the at least one mutation, a diagnosis, a treatment recommendation, or any combination thereof. Examples of such output include a printout or display screen that reports the output by displaying it to a clinician to technician. Other examples are electronic medical record reports or other records that include the output in a form discernible to the clinician or technician.
In some embodiments, the subject is further treated with an appropriate therapy, such as with a TRRAP inhibitor (if a mutation in TRRAP is identified), or a GRIN2A inhibitor or glutamate antagonist (if a mutation in GRIN2A is identified). Alternatively or in addition, the appropriate therapy can include administration of a second therapeutic agent known to be effective for the treatment of melanoma, removal of tumor tissue, radiation therapy, chemotherapy, or any combination thereof.
Further provided is a method of selecting a therapy for a subject diagnosed with melanoma by detecting the presence or absence of a C2165T mutation in the TRRAP gene (SEQ ID NO: 1). An inhibitor of TRRAP is selected if the C2165T mutation in the TRRAP gene is present.
Also provided is a method of selecting a therapy for a subject diagnosed with melanoma by detecting the presence or absence of at least one mutation in the GRIN2A gene. An inhibitor of GRIN2A or a glutamate antagonist is selected for therapy if the at least one mutation in GRIN2A is present. In some embodiments, the at least one mutation is (i) a mutation in a portion of the GRIN2A gene that encodes the PBP l_iGluR_NMDA_NR2 domain (nucleotides 94-1176 of SEQ ID NO: 3); (ii) a mutation in a portion of the GRIN2A gene that encodes the Lig_chan domain (nucleotides 1660-2484 of SEQ ID NO: 3); (iii) a mutation in a portion of the GRIN2A gene that encodes the NMDAR2_C domain (nucleotides 2515-4392 of SEQ ID NO: 3); (iv) G20A in the GRIN2A gene (SEQ ID NO: 3); (v) G1346A in the GRIN2A gene (SEQ ID NO: 3); or (vi) T1376C in the GRIN2A gene (SEQ ID NO: 3). In some examples, the mutation in the portion of the GRIN2A gene that encodes the PBP l_iGluR_NMDA_NR2 domain is C170T, T547A, G754A, C833T, G1028A, Gl 111A, Gl 116A or Gl 117A (SEQ ID NO: 3). In some examples, the
mutation in the portion of the GRIN2A gene that encodes the Lig_chan domain is A1784G, C1793T, G1959A, G2135A or G2218A (SEQ ID NO: 3). In some examples, the mutation in the portion of the GRIN2A gene that encodes the NMDAR2_C domain is G2666A, C2671T, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A, G3812A, C3827G, G3854A, C3952T, C4097T, G4261A, C4274T, G4276A or C4385G (SEQ ID NO: 3).
In some embodiments, the method further includes administering the selected therapy. In some instances, the subject is further treated by administration of a second therapeutic agent, surgical removal of tumor tissue, radiation therapy, chemotherapy, or any combination of thereof.
Also provided herein is a method of predicting the prognosis of a subject diagnosed with melanoma by detecting the presence or absence of at least one mutation in the TRRAP gene or the GRIN2A gene. The presence of the at least one mutation indicates the subject has a poor prognosis. In some embodiments, the at least one mutation is selected from C2165T in human TRRAP (SEQ ID NO: 1), or G20A, C170T, T547A, G754A, C833T, G1028A, G1111A, G1116A, G1117A, G1346A, T1376C, A1784G, C1793T, G1959A, G2135A, G2218A, G2666A, C2671T, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A, G3812A, C3827G, G3854A, C3952T, C4097T, G4261A, C4274T, G4276A and C4385G in human GRIN2A (SEQ ID NO: 3). A poor prognosis refers to any negative clinical outcome. For example, in some embodiments, a poor prognosis is an increase in the likelihood of death. In some embodiments, a poor prognosis is an increase in the likelihood of metastasis of the melanoma. In other embodiments, a poor prognosis refers to failure to respond to therapy. The sample can be any appropriate sample from the patient, such as a tissue sample or bodily fluid sample. In particular examples, the sample is a melanoma tumor sample from the subject.
Although mutations in TRRAP and GRIN2A for the diagnosis, prognosis and treatment of melanoma are exemplified herein, the present disclosure contemplates the use of mutations in any of the genes identified herein as mutated in melanoma (see Tables 1-4, 6 and 7 for a list of genes). Thus, in some embodiments
of the methods disclosed herein, the method includes detecting at least one mutation selected from any one of the mutations listed in Table 1 or Table 3.
For detection of TRRAP or GRIN2A mutations (or mutations in any other gene mutated in melanoma), nucleic acid (such as DNA or RNA) can be isolated from a biological sample according to well-known methods. In some embodiments, the biological sample is a tissue sample, such as a skin sample or a tumor tissue sample. In other embodiments, the biological sample is a fluid sample, such as blood. For example, nucleic acid can be isolated from cells obtained from a blood sample. In some embodiments, the biological sample is obtained from a patient diagnosed with melanoma or at risk for developing melanoma. In some
embodiments, the biological sample is obtained from a control subject.
Methods of detecting mutations in a gene are well known in the art.
Detection of one or more mutations in the TRRAP or GRIN2A gene (or any other gene mutated in melanoma) can be accomplished using any suitable technique, such as those described in detail below. For example, TRRAP- or GRIN2A-specific primers can be used to amplify nucleic acid from a biological sample (such as a skin sample, tumor tissue sample or blood sample). The amplified molecule can then be sequenced and compared to a reference TRRAP sequence (such as SEQ ID NO: 1) or a reference GRIN2A sequence (such as SEQ ID NO: 3). Alternatively, the sequence of the amplified molecule can be compared with TRRAP or GRIN2A from a control sample such as a non-cancerous tissue sample. TRRAP and GRIN2A amplification primers and sequencing primers can be designed according to well- known methods. Examples of TRRAP and GRIN2A primers are shown in Table 6 and Table 7. Other suitable primers can be designed using publically available TRRAP or GRIN2A nucleic acid sequences, according to well-known procedures.
Mutations in TRRAP or GRIN2A can also be detected using
oligonucleotides that specifically hybridize with a particular mutation.
Hybridization of such oligonucleotides can be detected by labeling the
oligonucleotide with a detectable marker, such as a fluorescent marker, enzymatic marker or radioisotope. Appropriate output devices for obtaining nucleic acid
sequence information or for detecting the presence of a fluorescent or radioactive signal are well known in the art.
Thus, provided herein is an oligonucleotide that specifically hybridizes with a mutant TRRAP nucleic acid molecule or a mutant GRIN2A nucleic acid molecule. In some embodiments, the nucleic acid molecule comprises a mutation selected from (i) C2165T in human TRRAP (SEQ ID NO: 1); and (ii) G20A, C170T, T547A, G754A, C833T, G1028A, G1111A, G1116A, G1117A, G1346A, T1376C, A1784G, C1793T, G1959A, G2135A, G2218A, G2666A, C2671T, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A, G3812A, C3827G, G3854A, C3952T, C4097T, G4261A, C4274T, G4276A and C4385G in human GRIN2A (SEQ ID NO: 3).
The oligonucleotide can be any suitable length to allow for specific hybridization to a target nucleic acid molecule. In some embodiments, the oligonucleotide is about 12 to about 50, about 15 to about 40, about 18 to about 30 or about 20 to about 25 nucleotides in length. In particular examples, the oligonucleotide is about 15 to about 40 nucleotides in length. In some
embodiments, the oligonucleotide includes a label, such as a fluorescent label, an enzymatic label or a radioisotope.
Further provided is an addressable array including an oligonucleotide that specifically hybridizes with a mutant TRRAP nucleic acid molecule disclosed herein or a mutant GRIN2A nucleic acid molecule disclosed herein. In some embodiments, the array includes two or more oligonucleotides that specifically hybridize with a TRRAP nucleic acid comprising a C2165T mutation or with a GRIN2A nucleic acid molecule comprising a mutation selected from G20A, C170T, T547A, G754A, C833T, G1028A, Gl 111A, Gl 116A, Gl 117A, G1346A, T1376C, A1784G, C1793T, G1959A, G2135A, G2218A, G2666A, C2671T, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A, G3812A, C3827G, G3854A, C3952T, C4097T, G4261A, C4274T, G4276A and C4385G in human GRIN2A (SEQ ID NO: 3). In particular examples, the array comprises a plurality of oligonucleotides such that the array comprises at least one oligonucleotide that
specifically hybridizes to each of the above listed mutations in TRRAP and
GRIN2A. In some examples, the array is a microarray.
IV. Methods of Detecting GRIN2A and TRRAP Mutations
Methods of detecting mutations in genes of interest are known in the art and exemplary methods are described below. Although detection of mutations in the GRIN2A and TRRAP genes is exemplified herein, the techniques described can be applied to other genes and proteins, including other genes identified as mutated in melanoma and disclosed herein (such as those listed in Tables 1-4, 6 and 7).
Detecting mutations in GRIN2A and TRRAP can be accomplished using any technique known in the art. For example, the presence or absence of a GRIN2A or TRRAP mutation can be determined by conventional methods such as gene or RNA detection methods (for example, DNA sequencing, oligonucleotide hybridization, polymerase chain reaction (PCR) amplification with primers specific to the mutation), or protein detection methods (for example, immunoassays or biochemical assays to identify a mutated GRIN2A or TRRAP protein. Generally, the nucleic acid sequence of the GRIN2A or TRRAP gene or RNA in a sample can be detected by any suitable method or technique of detecting gene sequence. Such methods include, but are not limited to, PCR, reverse transcriptase-PCR (RT-PCR), in situ PCR, in situ hybridization, Southern blot, Northern blot, sequence analysis, microarray analysis, or other DNA/RNA hybridization platforms.
Detection of point mutations in target nucleic acids can be accomplished by molecular cloning of the target nucleic acid molecules and sequencing the nucleic acid molecules using techniques well known in the art. Alternatively, amplification techniques such as PCR can be used to amplify target nucleic acid sequences directly from a genomic DNA preparation from a tumor tissue or cell sample. The nucleic acid sequence of the amplified molecules can then be determined to identify mutations. Representative primer pairs that can be used to amplify GRIN2A or TRRAP nucleic acid from a biological sample are listed in Tables 6 and 7.
However, design and selection of appropriate primers is well within the abilities of one of ordinary skill in the art.
Ligase chain reaction (Wu et al., Genomics 4:560-569, 1989) and allele- specific PCR (Ruano and Kidd, Nucleic Acids Res. 17:8392, 1989) can also be used to amplify target nucleic acid sequences. Amplification by allele- specific PCR uses primers that hybridize at their 3' ends to a particular target nucleic acid mutation. If the particular mutation is not present, an amplification product is not observed. Amplification Refractory Mutation System can also be used to detect mutations in nucleic acid sequences (U.S. Patent No. 5,595,890; Newton et al., Nucleic Acids Res. 17:2503-2516, 1989). Insertions and deletions of genes can also be detected by cloning, sequencing and amplification. In addition, restriction fragment length polymorphism probes for the gene or surrounding marker genes can be used to score alteration of an allele or an insertion in a polymorphic fragment. Single stranded conformation polymorphism analysis can also be used to detect base change variants of an allele (Orita et al, Proc. Natl. Acad. Sci. USA 86:2766-2770, 1989). Other known techniques for detecting insertions and deletions can also be used with the claimed methods.
Mismatch detection can be used to detect point mutations in a target nucleic acid molecule, such as GRIN2A or TRRAP. Mismatches are hybridized nucleic acid duplexes which are not 100% complementary. The lack of total
complementarity can be due to deletions, insertions, inversions, substitutions or frameshift mutations. An example of a mismatch cleavage technique is the RNase protection method, which is described in detail in Winter et al. (Proc. Natl. Acad. Sci. USA 82:7575-7579, 1985) and Myers et al. (Science 230: 1242-1246, 1985). For example, detection of mutations in GRIN2A or TRRAP can involve the use of a labeled riboprobe that is complementary to wild-type GRIN2A or TRRAP. The riboprobe and nucleic acid molecule to be tested (for example, obtained from a tumor sample) are annealed (hybridized) together and subsequently digested with the enzyme RNase A, which is able to detect mismatches in a duplex RNA structure. If a mismatch is detected by RNase A, it cleaves at the site of the mismatch. Thus, when the annealed RNA preparation is separated on an electrophoretic gel matrix, if a mismatch has been detected and cleaved by RNase A, an RNA product will be seen which is smaller than the full-length duplex RNA for the riboprobe and the
mRNA or DNA. The riboprobe need not be the full length of the target nucleic acid mRNA or gene, but can a portion of the target nucleic acid, provided it encompasses the position suspected of being mutated. If the riboprobe comprises only a segment of the target nucleic acid mRNA or gene, it may be desirable to use a number of these probes to screen the whole target nucleic acid sequence for mismatches if desired.
In a similar manner, DNA probes can be used to detect mismatches, for example through enzymatic or chemical cleavage (Cotton et al. , Proc. Natl. Acad. Sci. USA 85: 4397, 1988; Shenk et al, Proc. Natl. Acad. Sci. USA 72:989, 1975). Alternatively, mismatches can be detected by shifts in the electrophoretic mobility of mismatched duplexes relative to matched duplexes (Cariello, Human Genetics 42:726, 1988). With riboprobes or DNA probes, the target nucleic acid mRNA or DNA which may contain a mutation can be amplified before hybridization.
Changes in target nucleic acid DNA can also be detected using Southern
hybridization, especially if the changes are gross rearrangements, such as deletions and insertions.
Amplified nucleic acid sequences can also be screened using allele- specific probes. These probes are nucleic acid oligomers, each of which contains a region of the target nucleic acid gene harboring a known mutation. For example, one oligomer may be about 30 nucleotides in length, corresponding to a portion of the target gene sequence. By use of a battery of such allele- specific probes, target nucleic acid amplification products can be screened to identify the presence of a previously identified mutation in the target gene. Hybridization of allele- specific probes with amplified target nucleic acid sequences can be performed, for example, on a nylon filter. Hybridization to a particular probe under stringent hybridization conditions indicates the presence of the same mutation in the tumor tissue as in the allele- specific probe.
Gene-specific primers are useful for determination of the nucleotide sequence of a target nucleic acid molecule using nucleic acid amplification techniques such as the polymerase chain reaction. Pairs of single stranded DNA primers can be annealed to sequences within or surrounding the target nucleic acid
sequence in order to prime amplification of the target sequence. Allele- specific primers can also be used. Such primers anneal only to particular mutant target sequence, and thus will only amplify a product in the presence of the mutant target sequence as a template. In order to facilitate subsequent cloning of amplified sequences, primers may have restriction enzyme site sequences appended to their ends. Such enzymes and sites are well known in the art. The primers themselves can be synthesized using techniques which are well known in the art. Generally, the primers can be made using oligonucleotide synthesizing machines which are commercially available. Design of particular primers is well within the skill of the art. In addition, exemplary GRIN2A and TRRAP primers are provided in Tables 6 and 7.
Nucleic acid probes that hybridize with a GRIN2A or TRRAP nucleic acid molecule, such as a wild-type GRIN2A or TRRAP nucleic acid molecule or a mutant GRIN2A or TRRAP nucleic acid molecule described herein, are useful for a number of purposes. They can be used in Southern hybridization to genomic DNA and in RNase protection assays for detecting point mutations. The probes can also be used to detect target nucleic acid amplification products. GRIN2A or TRRAP probes can also be used to detect mismatches with the wild type gene or mRNA using other techniques. Mismatches can be detected using either enzymes (e.g., SI nuclease), chemicals (e.g., hydroxylamine or osmium tetroxide and piperidine), or changes in electrophoretic mobility of mismatched hybrids as compared to totally matched hybrids (Novack et al, Proc. Natl. Acad. Sci. USA 83:586, 1986).
Mutations in nucleic acid molecules can also be detected by screening for alterations of the corresponding protein. For example, monoclonal antibodies immunoreactive with a target gene product can be used to screen a tissue, for example an antibody that is known to bind to a particular mutated position of the gene product (protein). For example, a suitable antibody may be one that binds to a deleted exon or that binds to a conformational epitope comprising a deleted portion of the target protein. Lack of cognate antigen would indicate a mutation. Such immunological assays can be accomplished using any convenient format known in the art, such as Western blot, immunohistochemical assay and ELISA. In some
embodiments, the GRIN2A amino acid mutation is selected from W7*, P57L, F183I, D252N, S278F, W343*, E371K, W372*, E373K, G449E, F459S, H595R, S598F, M653I, G712E, G740W, G889E, Q891*, R920K, S929F, E962K, E1073K, P1074L, D1153N, E1175K, W1271*, A1276G, R1285K, R1318W, P1366L, D1421N, S1425L, E1426K and S1462C (SEQ ID NO: 4). In some embodiments, the TRRAP amino acid mutation is S722F (SEQ ID NO: 2).
Mutations in a gene or encoded protein can be evaluated using any technique described above, or any other method known in the art. For example, mutations in a gene or corresponding mRNA can be detecting by direct sequencing of a nucleic acid molecule, detection of an amplification product, microarray analysis or any other DNA/RNA hybridization platform. For detection of mutant proteins, an immunoassay, biochemical assay or microarray can be used.
Any suitable output device or format can be used to transmit the information obtained from the technique used to detect gene or protein mutations. For example, the output device can be a visual output device, such as a computer screen, a printed piece of paper or a written piece of paper. In other examples, the output device can be an auditory output device, such as a speaker. In other examples, the output device is a printer. In some cases, the data is recorded in a patient's electronic medical record. In some embodiments, the results of the test used to identify a mutation are provided to a user (such as a clinician or other health care worker, laboratory personnel, or patient) in a perceivable output that provides information about the results of the test. In some examples, the output is communicated to the user, for example by providing an output via physical, audible or electronic means (for example, by mail, telephone, facsimile transmission, e-mail or communication to an electronic medical record).
In some examples, the output is accompanied by guidelines for interpreting the data, for example, an indication of the likelihood of diagnosis of melanoma. The guidelines need not specify whether melanoma is present or absent, although it may include such a diagnosis. In other examples, the output can provide a recommended therapeutic regimen. For instance, based on the presence of a mutation in the
GRIN2A gene, the output can recommend treatment with a GRIN2A inhibitor, or a
glutamate antagonist, alone or in combination with other standard cancer treatments, such as surgery, radiation therapy, chemotherapy, or any combination thereof.
Similarly, based on the presence of the C2165T mutation in TRRAP, the output can recommend treatment with a TRRAP inhibitor, alone or in combination with any other type of treatment. In some examples, the test may include determination of other clinical information (such as determining the presence or absence of mutations in other genes).
V. Oligonucleotides and Arrays
Provided herein are oligonucleotides that specifically hybridize to a nucleic acid molecule encoding TRRAP or GRIN2A having one or more of the melanoma- associated mutations disclosed herein. Oligonucleotides that specifically hybridize with a TRRAP or GRIN2A nucleic acid comprising a mutation do not hybridize to wild-type (WT) TRRAP or GRIN2A, or hybridization of the oligonucleotide to WT TRRAP or GRIN2A is significantly weaker than hybridization to the mutant TRRAP or GRIN2A. The oligonucleotides described herein can be used, for example, as probes to identify the presence of a mutation in TRRAP or GRIN2A in a sample obtained from a subject suspected of having melanoma. The
oligonucleotide probes can further include one or more detectable labels, to permit detection of hybridization signals between the probe and target sequence (such as one of the mutant GRIN2A nucleic acid molecules).
In particular embodiments provided herein, arrays comprising the mutation- specific oligonucleotides as described herein can be used to evaluate the presence or absence of mutations in GRIN2A or TRRAP (or other genes mutated in melanoma).
In some examples, the array comprises an oligonucleotide that specifically hybridizes with a TRRAP nucleic acid molecule comprising the C2165T mutation (SEQ ID NO: 1). In some examples, the array comprises an oligonucleotide that specifically hybridizes with a GRIN2A nucleic acid molecule comprising a mutation selected from G20A, C170T, T547A, G754A, C833T, G1028A, G1111A, G1116A, Gl 117A, G1346A, T1376C, A1784G, C1793T, G1959A, G2135A, G2218A, G2666A, C2671T, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A,
G3523A, G3812A, C3827G, G3854A, C3952T, C4097T, G4261A, C4274T, G4276A and C4385G in GRIN2A (SEQ ID NO: 3). In particular examples, the array comprises (or further comprises) oligonucleotides that specifically hybridize with additional mutations in GRIN2A or TRRAP. In further examples, the array comprises oligonucleotides that specifically hybridize with mutations in other genes, including those listed in Tables 1-4, 6 and 7. In particular examples, the array contains oligonucleotides that specifically hybridize with each mutation in GRIN2A (G20A, C170T, T547A, G754A, C833T, G1028A, G1111A, G1116A, G1117A, G1346A, T1376C, A1784G, C1793T, G1959A, G2135A, G2218A, G2666A, C2671T, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A,
G3812A, C3827G, G3854A, C3952T, C4097T, G4261A, C4274T, G4276A and C4385G), and may further contain at least one oligonucleotide that specifically hybridizes with the C2165T mutation in TRRAP.
In yet further examples, the array comprises one or more oligonucleotides that specifically hybridize with a mutation in TRRAP and/or GRIN2A and further comprises at least one oligonucleotide that specifically hybridizes with another melanoma-associated gene identified herein, such as one or more of the genes listed in Tables 1-4, 6 and 7. In particular, the array may include one or more
oligonucleotides to specifically hybridize to one or more of the mutations identified in Table 1 or Table 3.
In some embodiments of the arrays disclosed herein, the array further comprises other oligonucleotides, such as control oligonucleotides or
oligonucleotides that specifically hybridize with WT TRRAP or WT GRIN2A. Exemplary control oligonucleotide probes include GAPDH, actin, and YWHAZ, or any probes specific for housekeeping genes.
Array substrates
The solid support of the array can be formed from an organic polymer.
Suitable materials for the solid support include, but are not limited to:
polypropylene, polyethylene, polybutylene, polyisobutylene, polybutadiene, polyisoprene, polyvinylpyrrolidine, polytetrafluroethylene, polyvinylidene difluroide, polyfluoroethylene-propylene, polyethylenevinyl alcohol,
polymethylpentene, polycholorotrifluoroethylene, polysulfornes, hydroxylated biaxially oriented polypropylene, aminated biaxially oriented polypropylene, thiolated biaxially oriented polypropylene, ethyleneacrylic acid, thylene methacrylic acid, and blends of copolymers thereof (see U.S. Patent No. 5,985,567).
In general, suitable characteristics of the material that can be used to form the solid support surface include: being amenable to surface activation such that upon activation, the surface of the support is capable of covalently attaching a biomolecule such as an oligonucleotide thereto; amenability to "in situ" synthesis of biomolecules; being chemically inert such that the areas on the support not occupied by the oligonucleotides are not amenable to non-specific binding, or when nonspecific binding occurs, such materials can be readily removed from the surface without removing the oligonucleotides.
In one example, the solid support surface is polypropylene. Polypropylene is chemically inert and hydrophobic. Non-specific binding is generally avoidable, and detection sensitivity is improved. Polypropylene has good chemical resistance to a variety of organic acids (such as formic acid), organic agents (such as acetone or ethanol), bases (such as sodium hydroxide), salts (such as sodium chloride), oxidizing agents (such as peracetic acid), and mineral acids (such as hydrochloric acid). Polypropylene also provides a low fluorescence background, which minimizes background interference and increases the sensitivity of the signal of interest.
In another example, a surface activated organic polymer is used as the solid support surface. One example of a surface activated organic polymer is a polypropylene material aminated via radio frequency plasma discharge. Such materials are easily utilized for the attachment of nucleotide molecules. The amine groups on the activated organic polymers are reactive with nucleotide molecules such that the nucleotide molecules can be bound to the polymers. Other reactive groups can also be used, such as carboxylated, hydroxylated, thiolated, or active ester groups.
Array formats
A wide variety of array formats can be employed in accordance with the present disclosure. One example includes a linear array of oligonucleotide bands, generally referred to in the art as a dipstick. Another suitable format includes a two- dimensional pattern of discrete cells (such as 4096 squares in a 64 by 64 array). As is appreciated by those skilled in the art, other array formats including, but not limited to slot (rectangular) and circular arrays are equally suitable for use (see U.S. Patent No. 5,981,185). In some examples, the array is a multi-well plate. In one example, the array is formed on a polymer medium, which is a thread, membrane or film. An example of an organic polymer medium is a polypropylene sheet having a thickness on the order of about 1 mil. (0.001 inch) to about 20 mil., although the thickness of the film is not critical and can be varied over a fairly broad range. The array can include biaxially oriented polypropylene (BOPP) films, which in addition to their durability, exhibit a low background fluorescence.
The array formats of the present disclosure can be included in a variety of different types of formats. A "format" includes any format to which the solid support can be affixed, such as micro titer plates (e.g. multi-well plates), test tubes, inorganic sheets, dipsticks, and the like. For example, when the solid support is a polypropylene thread, one or more polypropylene threads can be affixed to a plastic dipstick-type device; polypropylene membranes can be affixed to glass slides. The particular format is, in and of itself, unimportant. All that is necessary is that the solid support can be affixed thereto without affecting the functional behavior of the solid support or any biopolymer absorbed thereon, and that the format (such as the dipstick or slide) is stable to any materials into which the device is introduced (such as clinical samples and hybridization solutions).
The arrays of the present disclosure can be prepared by a variety of approaches. In one example, oligonucleotide sequences are synthesized separately and then attached to a solid support (see U.S. Patent No. 6,013,789). In another example, sequences are synthesized directly onto the support to provide the desired array (see U.S. Patent No. 5,554,501). Suitable methods for covalently coupling oligonucleotides to a solid support and for directly synthesizing the oligonucleotides
onto the support are known to those working in the field; a summary of suitable methods can be found in Matson et al. {Anal. Biochem. 217:306-10, 1994). In one example, the oligonucleotides are synthesized onto the support using conventional chemical techniques for preparing oligonucleotides on solid supports (such as see PCT publications WO 85/01051 and WO 89/10977, or U.S. Patent No. 5,554,501).
A suitable array can be produced using automated means to synthesize oligonucleotides in the cells of the array by laying down the precursors for the four bases in a predetermined pattern. Briefly, a multiple-channel automated chemical delivery system is employed to create oligonucleotide probe populations in parallel rows (corresponding in number to the number of channels in the delivery system) across the substrate. Following completion of oligonucleotide synthesis in a first direction, the substrate can then be rotated by 90° to permit synthesis to proceed within a second (2°) set of rows that are now perpendicular to the first set. This process creates a multiple-channel array whose intersection generates a plurality of discrete cells.
The oligonucleotides can be bound to the polypropylene support by either the 3' end of the oligonucleotide or by the 5' end of the oligonucleotide. In one example, the oligonucleotides are bound to the solid support by the 3' end.
However, one of skill in the art can determine whether the use of the 3' end or the 5' end of the oligonucleotide is suitable for bonding to the solid support. In general, the internal complementarity of an oligonucleotide probe in the region of the 3' end and the 5' end determines binding to the support.
In particular examples, the oligonucleotide probes on the array include one or more labels, that permit detection of oligonucleotide probe:target sequence hybridization complexes.
VI. Use of GRIN2A and TRRAP for Diagnosis and Treatment of Melanoma
Using whole exome sequencing of melanoma tumor samples and matched controls, 68 genes were identified with an elevated frequency of somatic mutations in melanoma. In particular, nine genes were identified that exhibited recurring mutations in melanoma (see Table 1). For example, the TRRAP gene was mutated
at nucleotide 2165 (C2165T) in six different melanoma tumor samples. In another aspect of the study disclosed herein, 16 genes were identified that were highly mutated in melanoma samples (see Table 3). The most highly mutated gene identified was GRIN2A, which was mutated in 34% of melanoma tumor samples. In total, 34 different nonsynonymous somatic mutations in GRIN2A were identified (FIG. 3 A) among 36 melanoma tumor samples.
In light of these findings, disclosed herein is a method of diagnosing melanoma in a subject (or diagnosing a subject as susceptible to developing melanoma) by detecting one or more mutations in the TRRAP gene or the GRIN2A gene. In some embodiments, the at least one mutation is selected from: (i) C2165T in the TRRAP gene (SEQ ID NO: 1); (ii) a mutation in a portion of the GRIN2A gene that encodes the PBP l_iGluR_NMDA_NR2 domain (nucleotides 94-1176 of SEQ ID NO: 3); (iii) a mutation in a portion of the GRIN2A gene that encodes the Lig_chan domain (nucleotides 1660-2484 of SEQ ID NO: 3); (iv) a mutation in a portion of the GRIN2A gene that encodes the NMDAR2_C domain (nucleotides
2515-4392 of SEQ ID NO: 3); (v) G20A in the GRIN2A gene (SEQ ID NO: 3); (vi) G1346A in the GRIN2A gene (SEQ ID NO: 3); and (vii) T1376C in the GRIN2A gene (SEQ ID NO: 3). The presence of the at least one mutation indicates the subject has melanoma or has increased susceptibility to developing melanoma as compared to the general population.
In some examples, the mutation in the portion of the GRIN2A gene that encodes the PBP l_iGluR_NMDA_NR2 domain is C170T, T547A, G754A, C833T, G1028A, Gl 111A, Gl 116A or Gl 117A (SEQ ID NO: 3). In particular examples, the mutation is a recurring mutation identified herein, such as C833T or Gl 111A (SEQ ID NO: 3).
In other examples, the mutation in the portion of the GRIN2A gene that encodes the Lig_chan domain is A1784G, C1793T, G1959A, G2135A or G2218A (SEQ ID NO: 3).
In yet other examples, the mutation in the portion of the GRIN2A gene that encodes the NMDAR2_C domain is G2666A, C267 IT, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A, G3812A, C3827G, G3854A, C3952T,
C4097T, G4261A, C4274T, G4276A or C4385G (SEQ ID NO: 3). In particular examples, the mutation is a recurring mutation identified herein, such as G3523A or G3812A (SEQ ID NO: 3).
In some embodiments, the subject is further treated with an appropriate therapy, such as with a TRRAP inhibitor (if a mutation in TRRAP is identified), or a GRIN2A inhibitor or glutamate antagonist (if a mutation in GRIN2A is identified).
Also provided are a method of treating a subject with melanoma harboring a mutation in the TRRAP gene by administering an inhibitor of TRRAP, and a method of treating a subject with melanoma harboring a mutation in the GRIN2A gene by administering an inhibitor of GRIN2A or a glutamate antagonist. Further provided is a method of selecting a patient with melanoma as a candidate for treatment with a TRRAP inhibitor by detecting the C2165T mutation in the patient. Also provided is a method of selecting a patient with melanoma as a candidate for treatment with a GRIN2A inhibitor or glutamate antagonist by detecting the G20A, C170T, T547A, G754A, C833T, G1028A, Gl 111A, Gl 116A, Gl 117A, G1346A, T1376C, A1784G, C1793T, G1959A, G2135A, G2218A, G2666A, C2671T, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A, G3812A, C3827G, G3854A, C3952T, C4097T, G4261A, C4274T, G4276A or C4385G GRIN2A mutation in the patient. A method of predicting the prognosis of a subject with melanoma by detecting one or more mutations in GRIN2A or TRRAP is also provided.
In some embodiments disclosed herein, the detection of the C2165T TRRAP mutation and/or one or more GRIN2A mutations selected from G20A, C170T, T547A, G754A, C833T, G1028A, Gl l l lA, G1116A, G1117A, G1346A, T1376C, A1784G, C1793T, G1959A, G2135A, G2218A, G2666A, C2671T, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A, G3812A, C3827G,
G3854A, C3952T, C4097T, G4261A, C4274T, G4276A and C4385G (SEQ ID NO: 3) can be used as a clinical tool to diagnose a patient that has already developed melanoma, or who has an increased risk of developing melanoma. Detection of one or more of the above-listed mutations can also be used to determine the prognosis of a patient previously diagnosed with melanoma. The presence of one or more of the
disclosed mutations indicates a subject has already developed melanoma or is susceptible to developing melanoma.
Detection of one or more of the disclosed mutations in TRRAP and GRIN2A can also be used as a tool for determining an appropriate therapy for a subject with melanoma. The presence of one or mutations in GRIN2A indicates the subject is a candidate for treatment with a GRIN2A inhibitor or a glutamate antagonist. The presence of the C2165T mutation in TRRAP indicates the subject is a candidate for treatment with a TRRAP inhibitor.
Subjects diagnosed with melanoma and treated with a TRRAP inhibitor, a GRIN2A inhibitor or glutamate antagonist can further be treated with a second therapeutic agent known to be effective for the treatment of melanoma.
Alternatively, or in addition, the subject with melanoma can be further treated by surgical removal of tumor tissue, chemotherapy, radiation therapy, or any combination thereof.
The following examples are provided to illustrate certain particular features and/or embodiments. These examples should not be construed to limit the disclosure to the particular features or embodiments described.
EXAMPLES
Example 1: Materials and Methods
This example describes the experimental procedures for the studies described in Example 2.
Tumor tissues
The tissue and melanoma cell lines used for the Discovery and Prevalence Screen in this study were described previously (Palavalli et ah, Nat Genet 41:518- 520, 2009). Tissues used for Validation set 1 were fresh frozen melanoma tumors obtained from the University of Colorado Denver Skin Cancer Biorepository, Division of Medical Oncology. Tissue was collected at University of Colorado
Hospital, Anschutz Medical Campus, under Institutional Review Board protocols. Macrodissection was conducted using a dissection microscope. Isolation of DNA from tumor enriched isolates has been previously described online at
http:www.riedlab.nci.nih.gov. Tissue processing and storage were previously described by Morente et al. {Eur J Cancer 42:2684-2691, 2006). Tissues used for Validation set 2 were obtained from Optimum Cutting Temperature (OCT)- embedded frozen clinical specimens from the Melanoma Informatics, Tissue Resource, and Pathology Core (MelCore) at The University of Texas MD Anderson Cancer Center under Institutional Review Board-approved protocols. H&E-guided dissection and isolation of DNA from the tumor-enriched isolates has been described previously (Davies et al., Clin Cancer Res 15:7538-7546, 2009). The clinical information associated with the melanoma tumors used in this study is provided in Table 5. Exome Capture
Exome capture was performed using the SureSelect™ Human All Exon System (Agilent Technologies, Santa Clara, CA). The manufacturer's protocol for SureSelect™ Human All Exon System (Illumina Paired-End Sequencing Library Prep) version 1.0.1 was used, with the modifications listed below. Bioanalyzer steps were either performed using agarose gel or omitted. In the sample preparation step 9, samples were purified using AMPure™ XP beads (Agencourt/Beckman Coulter Genomics, Danvers, MA) according to the manufacturer's protocols. In step 12, samples were purified with the QIAquick™ MinElute™ kit (Qiagen Inc., Valencia, CA). One column was used for each sample - the four 250μί post- amplification aliquots were pooled, and passed over the column in several spin steps. Samples were eluted in 12 buffer EB, and quantitated using the QUBIT™ dsDNA BR Assay kit (Invitrogen Corp, Carlsbad, CA). In the post-hybridization amplification step 2, samples were purified with AMPure™ XP beads as described above.
Samples were then eluted in 30 \L buffer EB.
Illumina Sequencing
Sequencing was performed on the Illumina GAIIx platform according to the manufacturer's instructions. 76 base paired-end reads were generated. Read mapping and variant analysis
Reads were initially aligned using ELAND (Illumina Inc, San Diego, CA). ELAND alignments were used to place reads in bins of about 5 million base pairs. Unmapped reads were placed in the bin of the mate pair if the mate was mapped. Cross_match (a general purpose program for comparing any two DNA sequence sets; see www.phrap.org) was utilized to align the reads assigned to each bin to the corresponding ~5Mb of genomic sequence. Cross_match alignments were converted to the SamTools bam format, and then genotypes were called using bam2mpg (Teer et al., Genome Res 20(10): 1420-1431, 2010; see website research.nhgri.nih.gov/software/bam2mpg). Bam2mpg was used to implement the Most Probable Genotype (MPG) algorithm, a Bayesian based method to determine the probability of each genotype given the data observed at that position. The quality score represents the difference of the log likelihoods of the most and second most probable genotype. The MPG was divided by the coverage at each position to calculate the MPG/coverage ratio.
To eliminate common germline mutations from consideration, alterations observed in dbSNP130 or in a high quality set of common variants from the 1000 genomes 11_2010 data release project were removed. To perform the 1000 genomes project filtering, low coverage genome data from 629 individuals was obtained from the November 2010 data release of the 1000 genomes project (ftp://ftp
trace.ncbi.nih.gov/1000genomes/ftp/release/2010_l l/ALL.2of4intersection.2010080 4.sites.vcf.gz). From this list of variants, those positions called by at least 3 of the 4 analysis methods used by the project were included. The list was further limited to those variants above 5% minor allele frequency. Polymorphisms were further removed by examination of the sequence of the gene in genomic DNA from matched normal tissue. Genotypes were annotated as described in Biesecker et al.
(Genome Res 19: 1665-1674, 2009). "Type of Mutation" definitions are as follows: synonymous: in a protein coding region, but does not change the amino acid; non- synonymous: in a protein coding region; missense variant: changes amino acid; nonsense variant, stop: introduces a stop codon; DIV-c: an in-frame
deletion/insertion variant in a coding region; and DIV-fs: a frameshifting deletion/insertion variant in a coding region.
Statistical analysis of mutated genes
To determine which of the genes in the Discovery Screen were more likely to be drivers, two metrics were calculated to assess the frequency and probability of mutations. The first method considered the frequency of mutations in the Discovery Screen, which was calculated by dividing the total number of nonsynonymous mutations observed by the total number of base pairs sequenced. The second method fit a binomial distribution based on the number of base pairs sequenced for the gene of interest, the number of mutations observed, and the background rate of mutation. For the background rate, the observed rate in the exome screen was used, 11.2 mutations per megabase. Based on these methods, 16 genes were selected for validation. PCR, sequencing and mutational analysis of melanoma samples
Genes identified to harbor recurrent mutations were confirmed and further screened using two primer sets listed in Table 6 in an additional 153 melanoma samples. A subset of 16 genes which were mutated in the Discovery Screen was selected for analysis in the Prevalence Screen using criteria described herein. These genes were amplified and sequenced in an additional 38 melanoma samples using the primers listed in Table 6 and Table 7. BRAF was only evaluated for the V600E alteration. Mutational analysis, confirmation and determination of somatic status were carried out as previously described (Prickett et al., Nat Genet 41: 1127-1132, 2009; Palavalli et al, Nat Genet 41:518-520, 2009; Viloria et al., Cancer Res 69:4926-4934, 2009). Sequence traces of the Validation Screen were analyzed
using the Mutation Surveyor software package and all genes had 93% coverage or above (SoftGenetics, State College, PA).
Plasmid cloning
A TRRAP expressing construct in C SBS vector was used. Mutant TRRAP was generated using an overlapping two-fragment PCR mediated strategy using Phusion™ High-Fidelity polymerase (New England Biolabs, Ipswich, MA).
Forward and reverse CDS mutation-containing oligonucleotides of 21-26 bp in length were designed with the corresponding mutation centrally located within the oligonucleotide. These primer pairs were used in two independent PCR reactions with wild- type TRRAP plasmid as a template as follows:
(1) TRRAP-F(3+) - CAGATGGTGAAAGGAATGCTC (SEQ ID NO: 63) Mutation-R - GCAAAGAGGAAGACAGAGCCAAAG (SEQ ID NO: 64)
(2) Mutation-F - CTTTGGCTCTGTCTTCCTCTTTGC (SEQ ID NO: 65) TRRAP-R(7-) - GTTCATAACAACATGCACACAG (SEQ ID NO: 66)
PCR products purified by gel purification were used as a template for PCR using TRRAP-F and -R primer pairs to generate a TRRAP mutation bearing product. The TRRAP mutation bearing PCR product was cut with BbvCl and Kasl restriction enzymes and was inserted in the TRRAP-C SBS plasmid. Sequence verified mutant TRRAP was subsequently used in various experiments.
Cell culture and transient expression
Metastatic melanoma tumor lines were maintained as previously described. HEK 293T cells were purchased from ATCC (Manassas, VA) and maintained in complete Dulbecco's Modified Eagles Medium supplemented with 10% fetal bovine serum (FBS), IX non-essential amino acids, 2 mM L-glutamine, and 0.75% sodium bicarbonate. Sk-Mel-28 and A375 cells were purchased from the National Cancer Institute, Division of Cancer Treatment, Developmental Therapeutics Program (Frederick, MD) and maintained in RPMI-1640 and supplemented with 10% FBS.
Western blotting
Transfected cells or stable pooled clones were gently washed 3X in PBS and then lysed using 0.5-1.0 ml 1% NP-40 lysis buffer (1% NP-40, 50 mM Tris-HCl pH 7.5, 150 mM NaCl, complete protease inhibitor tablet, EDTA-free (Roche,
Indianapolis, IN), 1 μΜ sodium orthovanadate, 1 mM sodium fluoride, and 0.1% β- mercaptoethanol) per T-75 flask for 20 minutes on ice. Lysed cells were scraped and transferred into a 1.5 mL microcentrifuge tube followed by brief sonication. Whole cell extracts lysed with 2X SDS sample buffer were subjected to SDS-PAGE and western blotted for TRRAP expression. Primary antibodies used in the analysis were anti-TRRAP antibody (Cell Signaling, Cat. No. 3966S), anti-PARP antibody (Cell Signaling, Cat. No. 9542) and anti-alpha-tubulin antibody (Calbiochem-EMD Biosciences, Cat. No. 555627).
Lentiviral shRNA
Constructs for stable depletion of TRRAP (Catalog Number RHS4533,
Construct Numbers TRCN0000005361, TRCN0000005362) were obtained from Open Biosystems (Huntsville, AL) and were confirmed to efficiently knockdown TRRAP at the protein level. Lentiviral stocks were prepared as previously described (Prickett et al, Nat Genet 41:1127-1132, 2009). Melanoma cell lines (63T, 17T, A375, and Sk-Mel-28) were infected with shRNA lentiviruses for each condition (vector and a TRRAP specific shRNA). Selection and growth were performed as described above. Hairpin sequence for TRCN0000005361 was
CCGGCGTGTAAGAAAGGGAGAATATCTCGAGATATTCTCCCTTTCTTACA CGTTTTT (SEQ ID NO: 67), mature sense for TRCN0000005361 was
CGTGTAAGAAAGGGAGAATAT (SEQ ID NO: 68), mature antisense for TRCN0000005361 was ATATTCTCCCTTTCTTACACG (SEQ ID NO: 69);
hairpin sequence for TRCN0000005362 was
CCGGGCCCTGTTCTTTCGCTTTGTACTCGAGTACAAAGCGAAAGAACAG GGCTTTTT (SEQ ID NO: 70), mature sense for TRCN0000005362 was
GCCCTGTTCTTTCGCTTTGTA (SEQ ID NO: 71), mature antisense for
TRCN0000005362 was TACAAAGCGAAAGAACAGGGC (SEQ ID NO: 72).
Apoptosis measurement
Cells were collected by incubation in trypsin/EDTA followed by
centrifugation and were fixed in a solution containing 3.7% formaldehyde, 0.5% NP40, and 10 μg/ml Hoechst 33258 in PBS. Apoptotic indices were determined by visual scoring of at least 300 nuclei.
NIH 3T3 transformation assay
For each plasmid (C SBS, C SBS -TRRAP (wt), C SBS -TRRAP (S722F), and RasG12V), 3 μg of plasmid was transfected using the calcium phosphate precipitation method into NIH 3T3 cells cultured in T25 flasks. Twenty-four hours after transfection, 1-5% of transfected cells were seeded into T25 flasks and cultured in normal growth medium containing 2.5% FBS for 14-20 days. The flasks were scored by visually scoring under a microscope for foci formation.
Pathway analysis
In order to explore the combined effects of groups of genes that were mutated in the melanoma exome analysis, group and pathways analysis was performed on different sets of genes. Three sources of gene sets were selected, including Gene Ontology (www.geneontology.org), Kyoto Encyclopedia of Genes and Genomes (www.genome.jp/kegg), and MSigDB
(www.broadinstitute.org/gsea/msigdb), containing 10147, 214, and 1892 groups respectively, when these studies were performed. The sets included groups based on molecular function, cellular localization, biological processes, and signaling pathways. For each of the group of genes, the respective genes in the exome analysis were examined and it was assessed whether mutations were observed. Several different statistics were then calculated to accentuate different aspects of the analysis. First, the number of genes that were successfully sequenced in the study was compared to the number that was mutated. This proportion was then compared to the background rate of 3308 genes mutated in the total of 16,768 genes using a hypergeometric distribution. As the purpose was for ranking, no multiple
comparison correction was implemented. Second, the average number of nonsynonymous mutations observed for the mutated genes was examined by dividing the total number of nonsynonymous mutations into the total number of genes observed to be mutated. Third, a binomial calculation was used. For each group of genes the total number of mutations observed and the number of base pairs that were successfully sequenced was determined. The P- value was calculated as the probability of a group having at least as many mutations as were observed, given the numbers of base pairs sequenced and the background passenger frequencies, using the binomial distribution in R (www.r-project.org). The background passenger frequencies were conservatively estimated as the total numbers of mutations observed the whole exome study divided by the total number of base pairs sequenced in the study (i.e., assuming that all of the mutations observed were passengers). Example 2: Whole exome sequencing identifies TRRAP hotspot mutations and GRIN2A as frequently mutated in melanoma
An exome re-sequencing was conducted of 14 matched normal and metastatic tumor DNAs from untreated melanoma patients. Exonic sequences were enriched with Agilent's SureSelect™ technology for targeted exon capture (Gnirke et ah, Nat Biotechnol 27:182-189, 2009), targeting 37Mb of sequence from exons and flanking regions in nearly 20,000 genes. Sequencing was performed with the Illumina GAii platform, and reads were aligned by using ELAND (Illumina, Inc. San Diego CA) followed by cross_match (www.phrap.org) to the reference human genome (Build 36.1). On average, 12 Gb of sequence was generated per sample to a mean depth of 180X or greater to achieve exome builds with at least 90% of the exons covered by high quality genotype calls. To eliminate common germline mutations from consideration, any potential somatic mutation that was observed in dbSNP130, or in a high quality set of common variants from the 1000 genomes project, was removed. To determine which of these alterations were somatic (i.e. tumor-specific), the particular gene in the whole exome sequence derived from genomic DNA from the matched normal tissue was examined. From these putative
alterations, 5161 potential somatic mutations in 3568 different genes were identified in the fourteen samples sequenced.
A major challenge of such studies is discriminating true mutations from the large number of possible sequence alterations identified. Several bioinformatic and experimental steps were used to discriminate between these possibilities. A previously described Bayesian genotype caller, MPG, was used to call genotypes (available online at research.nhgri.nih.gov/software/bam2mpg) (Teer et al., Genome Res 20(10): 1420-1431, 2010). Empirical testing against Sanger-based sequencing was employed to set a score cutoff above which the alterations could be trusted. A total of 91 regions were amplified by PCR from the relevant melanoma genomic DNA sample using specific primers and directly sequenced with dye-terminator chemistry. It was determined whether a mutation was somatic by examining the sequence of the gene in genomic DNA from matched normal tissue. From the 91 sequences obtained, 47 were confirmed and 44 were not. Looking for differences between matched tissue samples will select for both somatic variants, and sequencing errors, resulting in a higher non-confirmation rate.
The analysis was further refined by examining the relationship between the MPG quality score and depth of coverage at each position. The quality score should rise with increasing amounts of sequence covering a given position. When the score does not rise with increasing depth of coverage, this suggests a false genotype call. As indicated in FIG. 9, all the confirmed alterations correlated with a MPG/coverage ratio of 0.5 or above in both the tumor and matched normal samples, with only one exception. In contrast, 91% of the alterations that were not confirmed by Sanger sequencing, had a MPG/coverage ratio below 0.5 in either the tumor or the normal or both. Thus, of the 91 assessed alterations, using 0.5 as a cutoff, 46 somatic mutations out of 47 were identified by conventional sequencing, indicating a 97.9% coverage rate and a 2.4% false negative rate. All of the future analyses therefore relate to alterations that obtained a MPG/coverage ratio of 0.5 or above in both the tumor and normal samples. Using the 0.5 ratio cutoff, of 47 somatic substitutions that were discovered prior to this study in these samples, 38 were present in the whole exome study, giving a sensitivity of 81%.
The analysis tools described above removed -18% of the alterations, leaving 4228 somatic base substitutions for further scrutiny. A total of 3872 were heterozygous alterations and 356 changes were loss of heterozygosity. Of these alterations, 2813 caused amino acid changes (nonsynonymous), including 2589 that were missense, 175 nonsense and 49 occurred at splice sites. There were 1387 silent (synonymous) substitutions. A total of 19 small deletions and 9 insertions were observed.
The observed somatic mutations could either be 'driver' mutations that have a role in melanoma neoplasia or functionally inert 'passenger' changes. In this whole exome screen, 2813 nonsynonymous and 1387 synonymous mutations were identified, yielding a ratio of nonsynonymous to synonymous changes (N/S ratio) of 2.0: 1; which is not higher than the N/S ratio of 2.5: 1 predicted for nonselected passenger mutations (Sjoblom et ah, Science 314:268-274, 2006), suggesting that most of these alterations are likely to be 'passenger' mutations. The number of C>T mutations was significantly greater than the numbers of other nucleotide
substitutions, resulting in a high prevalence of C>T/G>A transitions (P < 0.001; FIG. 9). Finally, a total of 116 dinucleotide substitutions were observed, of these, 59 were CC>TT/GG>AA changes, all consistent with the previously documented ultraviolet light exposure signature (Greenman et ah, Nature 446: 153-158, 2007).
To search for novel recurrent mutations, alterations that occurred in two or more of the fourteen samples subjected to whole exome sequencing were examined. From this analysis, as expected, the BRAF V600E alteration was captured in 7 out of the fourteen samples. In addition to BRAF, nine more genes were found to harbor a recurrent mutation. Seven of the novel recurrent mutations were
nonsynonymous and two were synonymous (Table 1). Further screening of the novel hotspot mutations in an additional 153 melanomas identified DCC and ZNF831 to have a third recurring mutation each. Strikingly, TRRAP, encoding the transformation/transcription domain- associated protein, contained four additional cases that harbored the recurrent mutation (FIG. 1 and FIG. 5), one of which was found in the commercially available cell line, A375. All 6 nonsynonymous alterations in TRRAP had the same point mutation, a change of a cytosine to a
thymine at position 2165 of the TRRAP transcript (uc003upp.l), leading to the replacement of a serine with a phenylalanine at amino acid residue 722 of the protein (S722F).
Subsequent sequence analysis of all coding exons of TRRAP in 25 additional melanomas revealed no additional nonsynonymous alterations. The positions of the mutations in TRRAP imply that they are likely to be oncogenic as no truncating mutations were observed and 100% of the alterations occurred in one location. In addition, the affected residue is highly conserved evolutionarily (FIG. 6) and SIFT (sorting intolerant from tolerant) analysis (Ng and Henikoff, Nucleic Acids Res 31:3812-3814, 2003) of the TRRAP mutation gave it a score of 0.00 (median information content 2.71), predicting that the mutation alters protein function. The clustering of somatic missense mutations is similar to that observed for activating mutations, such as RAS (Bos et al., Nature 327:293-297, 1987), BRAF (Davies et al., Nature 417:949-954, 2002), and PIK3CA (Samuels et al., Science 304:554, 2004), suggesting that TRRAP may be a novel oncogene.
TRRAP functions as part of a multiprotein co-activator complex possessing histone acetyltranferase activity that is central for the transcriptional activity of p53, c-Myc, E2F1 and other transcription factors (McMahon et al., Cell 94:363-374, 1998; Barlev et al., Mol Cell 8: 1243-1254, 2001). TRRAP knockout mice are embryonic lethal indicating that TRRAP is essential for cell survival (Herceg et al., Nat Genet 29:206-211, 2001).
To asses if melanoma cells harboring endogenous TRRAP mutations are dependent on TRRAP for survival, short hairpin RNA (shRNA) was used to stably knock-down TRRAP protein levels in melanoma cells harboring either wild-type TRRAP (SK-Mel28 and 17T) or mutant TRRAP (63T and A375). Specific targeting of TRRAP was confirmed by TRRAP immunoblotting of transiently transfected HEK293T cells as well as one of the melanoma cell lines (FIGS. 2C and 2D). The various cell clones were grown in 10% or 2.5% serum to test cell viability. The unique shRNA constructs targeting TRRAP had minimal effect on the survival of cells expressing wild-type TRRAP but substantially increased apoptosis rates of melanoma lines carrying mutant TRRAP, particularly when the clones were grown in
low serum conditions (FIGS. 2E-2H and FIG. 10). These results were further corroborated by western blot analysis of cell lysates from the analyzed cells showing increased levels of cleaved PARP specifically in mutant cells that have been knocked down for TRRAP compared to vector control as well as TRRAP wild-type cells (FIGS. 21- 2J). Thus, mutant TRRAP is essential for melanoma cell survival which is consistent with previous results showing that TRRAP has a role in cell viability (Herceg et al, Nat Genet 29:206-211, 2001; Ard et al., Mol Cell Biol 22:5650-5661, 2002).
To further demonstrate the prevalence and spectrum of somatic mutations in genes identified in the whole exome Discovery Screen, genes were selected that had more mutations than expected using the observed mutation rate (binomial p-value < 0.05) and were mutated in more than two Discovery Screen samples. Sixteen such genes were identified and analyzed for mutations in an additional 38 melanoma samples using PCR amplification and Sanger sequencing. Gene coverage in the Prevalence Screen was 93% and above. This effort involved 9165 PCR and sequencing reactions encompassing 5.4 Mb of tumor DNA. A total of 65 putative changes were identified in the Prevalence Screen (Table 2).
This list of sixteen genes, which, except for BRAF, had not previously been identified as playing a role in melanoma, was found to scale up and harbor an increasing number of somatic mutations in the Prevalence Screen which correlated with the initial frequency identified in the Discovery Screen (Table 2 and Table 3).
The most highly mutated genes out the 16 validated genes were GRIN2A (33%), TMEM132B (17.3%), ZNF831 (17.3%) and PLCB4 (15.4%). The transmembrane protein TMEM132B, as well as the Zinc Finger protein ZNF831 whose functions have as yet not been determined, contained only heterozygous mutations and harbored recurrent mutations G822E and S1474F, respectively.
PLCB4, which encodes phosphoinositide phospholipase C-beta-4 that catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from
phosphatidylinositol 4,5-bisphosphate using calcium as a cofactor, is known to play an important role in the intracellular transduction of multiple extracellular signals in response to activation of G protein-coupled receptors (GPCRs) (Rebecchi and
Pentyala, Physiol Rev 80: 1291-1335, 2000). SIFT analysis of the different missense mutations identified in the novel highly mutated genes, predicts that a large fraction of the alterations would affect protein function (Table 4).
The most frequently mutated of the validated fourteen genes, GRIN2A, on chromosome 16pl3.2, encodes a glutamate [N-methyl-(D)-aspartic acid (NMD A)] receptor subunit epsilon-1 that is part of the class of ionotropic glutamate receptors. The NMD A receptor is a heterotrimeric channel composed of three different subunits, GRTN1 (NR1), GRTN2A or GRIN2B (NR2) and GRIN3 (NR3). GRIN2A bears the agonist binding site for glutamate (Johnson and Ascher, Nature 325:529- 531, 1987). The ligand-gated channel is permeable to cations including Ca2+, and at resting membrane potential, NMDA receptors are inactive due to a voltage- dependent blockade of the channel pore by Mg2+. NMDA receptor activation, which requires binding of glutamate and glycine, leads to an influx of Ca2+ and increased cAMP production.
GRIN2A, which was found to be mutated in 6 of the 14 melanomas in the
Discovery Screen, was found to harbor an additional 11 somatic mutations in the Prevalence Screen. In addition to the Discovery and Prevalence Screen samples, GRIN2A somatic mutations were searched for in two independent additional validation panel sets from untreated melanoma patients. Validation panel set 1, which included 39 melanomas, revealed 11 tumors with somatic mutations affecting 28.2% of the tumors examined and validation panel set 2, which included 32 melanomas, identified 7 GRIN2A somatic mutations affecting 15.6% of cases. Lastly, GRIN2A sequencing in 12 commercially available cell lines revealed a mutation in 501Mel. In total, 34 distinct GRIN2A mutations were identified in 135 samples affecting 25.2% of melanoma cases (Table 3). The number of C>T mutations identified in GRIN2A was significantly greater than the numbers of other nucleotide substitutions, resulting in a high prevalence of C>T/G>A transitions (P < 1 x 0.001; FIG. 7), reproducing previously reported mutation signatures in melanoma (Greenman et ah, Nature 446: 153-158, 2007). FIG. 8 depicts the various genetic and analysis stages used in this whole exome study.
The location of the discovered GRIN2A mutations is summarized in FIG. 3A. Clustering of somatic mutations is seen in regions of GRIN2A encoding various of its functional domains, and two particular clusters can be observed surrounding amino acids 371, 372, and 373 in the PBP1 iGluR NMDA NR2 domain and amino acids 1073, 1074 and 1076 in the NMDAR2 C domain. In addition, three recurrent alterations were observed (S278F, E371K and El 175K). One of these recurrent mutations (E1175K) occurred in the commercially available cell line 501Mel. The affected residues within these clusters are highly conserved evolutionarily and SIFT analysis of the different missense mutations on GRIN2A predicts that over 51% of the missense alterations would affect protein function (Table 4). In addition to these missense alterations, five nonsense mutations were identified, which would cause polypeptide truncation.
The nature of somatic mutations in tumors may aid in classifying the identified genes to oncogenes or tumor suppressor genes (Vogelstein and Kinzler, Nat Med 10:789-799, 2004). Generally, oncogenes harbor adjacent recurrent mutations in different tumors; the mutations are nearly always missense and the mutations commonly affect only one allele. Tumor suppressor genes are generally mutated throughout the coding region of the gene, many of the mutations truncate the protein and the mutations generally affect both alleles. Based on this classification the mechanism by which somatic mutations in GRIN2A have a tumorigenic effect is unclear; however, the frequency and nature of the discovered alterations strongly suggest that mutations in GRIN2A play a major role in melanoma tumorigenesis.
The comprehensive nature of the acquired data in this study provided an opportunity to determine whether any particular novel gene pathways and functional groups have a significant role in melanoma. Using pathways from Gene Ontology (www.geneontology.org), Kyoto Encyclopedia of Genes and Genomes
(www.genome.jp/kegg), and MSigDB (www.broadinstitute.org/gsea/msigdb), different statistical metrics were recalculated based on the total number of mutations from all genes within each group, the number of different genes mutated, the combined sizes of the genes in each group, and the total number of tumors examined
(see methods in Example 1). From this analysis, one particular pathway was highly significant - the glutamate signaling pathway.
Glutamate is known to activate two different types of receptors: ionotropic glutamate receptors (iGluRs) and metabotropic glutamate receptors (mGlus). iGluRs are ligand-gated ion channels that allow cations such as calcium and potassium to pass through the plasma membrane of the cell after binding of glutamate to the receptors. iGluRs are subdivided into three receptor types according to agonists response, one of which is N-methyl-D-aspartate (NMD A) (Hollmann and
Heinemann, Annu Rev Neurosci 17:31-108, 1994). Thus, GRIN2A, the most highly mutated gene in the screen encodes a glutamate receptor subunit which binds NMDA. In addition, PLCB4, which is a down-stream protein involved in metabotropic glutamate receptor-related signal transduction which leads to inositol phosphate production and protein kinase C (PKC) activation (Pin et al., Biochem Soc Trans 23:91-96, 1995) was also highly mutated in the screen.
Genetic analysis of the G protein coupled receptor family in melanoma determined that GRM3, which belongs to the metabotropic glutamate receptors and is also activated by glutamate, is mutated in 16% of melanoma cases. In this study as well, the GRM- signaling downstream-effector, PLCB4 is activated and hydrolyses phosphatidylinositol 4,5-bisphosphate and generates inositol 1,4,5- trisphosphate. Finally, a recent survey of genetic alteration of the tyrosine kinome in melanoma has pointed to ERBB4, Pyk2 and the Ephrin receptors to be highly mutated in melanoma (Prickett et al., Nat Genet 41: 1127-1132, 2009). ERBB4 and its ligand NRGl, Pyk2 as well as the Ephrins, have been shown to play a crucial role in modulation of NMDA receptor signaling (Anton et al., Nat Neurosci 7: 1319-328, 2004; Rieff et al., J Neurosci 19: 10757-10766, 1999; Ozaki et al., Nature 390:691- 694, 1997; Dalva et al., Cell 103:945-956, 2000). Thus, molecular and genetic studies have implicated cross-talk between NRG1-ERBB4, GRM3, Ephrin signaling and glutamate receptor functions. Interestingly, a link between the glutamate pathway and tumor genesis has been seen in neuronal tumors, where glioma cells releasing an excess of glutamate, showed more aggressive growth than parental glioma cells (Takano et al., Nat Med 7: 1010-1015, 2001). Furthermore, previous
reports showing that ectopic expression of the metabotropic glutamate receptor GRM1 results in melanocytes transformation in mice (Pollock et ah, Nat Genet 34: 108-112, 2003) and that expression of GRM1 is sufficient to induce full transformation of immortalized melanocytes (Shin et ah, Pigment Cell Melanoma Res 21:368-378, 2008) also implicate glutamate signaling in melanoma. A pathway schematic summarizing these various components in the glutamate pathway is depicted in FIG. 3B.
The study disclosed herein presents the most complete demonstration of melanoma exome alterations to date and provides a number of important genetic insights into melanoma. The comprehensive nature of the study allows one to: (1) identify TRRAP as an unexpected target of recurring genetic alterations, (2) reveal genes that were not previously connected with melanoma, one of which, GRIN2A is one of the most highly mutated in melanoma to date and (3) demonstrate that a majority of melanoma tumors had alterations in genes encoding members of the glutamate pathway.
Example 3: Mutations in GRIN2A increase anchorage-independent growth and adversely affect receptor function
This example describes studies to evaluate the functional effect of somatic mutations in GRIN2A.
Melanoma cell lines (2359 and A375 cell lines) stably expressing both GRINI and a mutant GRIN2A (E371K, W372X, E373K, G889E, W1271X, Q891X, R9020K or El 175K) were generated. Expression of GRINI and mutant GRIN2A protein was confirmed by Western blot. To test the effect of stable expression of mutant GRIN2A on anchorage-independent growth, melanoma cell lines 2359 and A375 stably expressing GRINI and a mutant GRIN2A were seeded into soft agar in 10% serum and grown for 14 days before staining and counting. A375 colonies are shown in FIG. 11 A. As shown in FIG. 11B, colony formation significantly increased in A375 melanoma cells expressing mutant GRIN2A, compared with cells expressing empty vector. Similar results were obtained for 2359 melanoma cells.
To test if melanoma cell lines are dependent on GRTN2A for survival, endogenous GRIN2A message was stably depleted using several different specific shRNA for human GRIN2A. Depletion of message was confirmed by qRT-PCR. Lentiviral stocks were prepared as previously described (Prickett et ah, Nat Genet 41: 1127-1132, 2009). Melanoma cell lines (501Mel and 125T) were infected with control (pLKO.l) and GRIN2A specific shRNA lentiviruses (#1, #2 and #3).
Selection and growth were carried out as previously described (Palavalli et al. , Nat Genet 41:518-520, 2009). Knock-down of endogenous GRIN2A in cells expressing mutant forms of GRIN2A had little to no effect on proliferation (FIG. 12A).
However, depletion of GRIN2A in cells expressing endogenous wild- type GRIN2A resulted in increased cell proliferation (FIG. 12B). These results demonstrate that GRIN2A functions as a tumor suppressor in melanoma cells.
The effect of mutant GRIN2A on receptor function was also evaluated. As shown in FIG. 13 A, influx of calcium upon NMDA stimulation of transiently transfected HEK293T cells decreased calcium permeability in cells expressing mutant forms of GRIN2A. It was also demonstrated that mutant forms of GRIN2A bind GRIN1 with reduced affinity, thus causing decreased NMDAR complex formation (FIG. 13B). Thus, somatic mutations in GRIN2A have adverse effects on receptor function and formation.
Table 1. Recurrent mutations identified in melanoma whole exome sequencing
# of Tumors Nucleotide Amino Acid Synonymous or
Gene Name Tumor Name Tumor Panel
Affected Change Change Non_Synonymous
BRAF 7 T1799A V600E Nonsynonymous 1 T Exome Capture
5T Exome Capture 9T Exome Capture 22T Exome Capture 35T Exome Capture 51T Exome Capture 91T Exome Capture
CPT1A 2 C1638T F546F Synonymous 5T Exome Capture
43T Exome Capture
DCC 3 G164A G55E Nonsynonymous 12T Exome Capture
18T Exome Capture MB1160 T Validation set 1
FCRL1 3 C741 T I247I Synonymous 91 T Exome Capture
96T Exome Capture 63T Prevalence screen
LRRN3 2 G1084A E362K Nonsynonymous 12T Exome Capture
24T Exome Capture
NOS1 2 C2312T S771 L Nonsynonymous 24T Exome Capture
60T Exome Capture
PLCH1 2 C907T Q303X Nonsynonymous 1 T Exome Capture
24T Exome Capture
SLC17A5 2 C1090T R364C Nonsynonymous Exome Capture
Exome Capture
TRRAP 6 C2165T S722F Nonsynonymous 63T Exome Capture
91 T Exome Capture 96T Prevalence screen 106 h-T Prevalence screen 119T Prevalence screen A375 Commercial cell line
ZNF831 3 C4421T S1474F Nonsynonymous 43T Exome Capture
91T Exome Capture MB1160 T Validation set 1
Samples used in exome capture and prevalance screen were obtained from The Surgery Branch, National Cancer Institute.
Validation set 1 samples were obtained from The Division of Medical Oncology, University of Colorado Denver School of
Medicine. A375 is a commercially available melanoma cell line.
Table 2. Sixteen highly mutated genes in melanoma
No. of
mutations (%of
tumors
Gene Name CCDS number affected) Tumor Name Nucleotide Change Amino Acid Change Syn/NonSyn Hete/Homo Sample Panel
AKR1B10 CCDS5832.1 4(7.5%)" 91 T G400A G134R Nonsynonymous Homozygous Exome Capture
01 T G691A D231N Nonsynonymous Heterozygous Exome Capture
24T A730C T244P Nonsynonymous Heterozygous Exome Capture
7T Exon 2 (-8) CAT N/A splice site Heterozygous Prevalence screen
TAS2R60 CCDS5885.1 5(9.4%)" 92T C272T P91L Nonsynonymous Homozygous Prevalence screen
60T G429A W143* Stop Heterozygous Exome Capture
9T G449A G150E Nonsynonymous Heterozygous Exome Capture
17T G639A M213I Nonsynonymous Heterozygous Prevalence screen
43T G639A M213I Nonsynonymous Heterozygous Exome Capture
KHDRBS2 CCDS4963.1 5(9.4%)* 119T T82A L28M Nonsynonymous Heterozygous Prevalence screen
60T C178T L60F Nonsynonymous Heterozygous Exome Capture
91 T C556T R186C Nonsynonymous Heterozygous Exome Capture
05T C299T R224W Nonsynonymous Homozygous Exome Capture
109T C733T P245S Nonsynonymous Heterozygous Prevalence screen
PTPRO CCDS8675.1 4(7.5%)" 12T G127A E43K Nonsynonymous Heterozygous Exome Capture
24T T297G F99L Nonsynonymous Heterozygous Exome Capture
95T C838A S280Y Nonsynonymous Heterozygous Prevalence screen
60T C847T R283* Stop Heterozygous Exome Capture
SYT4 CCDS11922.1 4(7.5%)* 43T G37A E13K Nonsynonymous Heterozygous Exome Capture
22T G119A R40K Nonsynonymous Heterozygous Exome Capture
12T G388A E130K Nonsynonymous Homozygous Exome Capture
119T G1151A R384Q Nonsynonymous Heterozygous Prevalence screen
UGT2B10 N/A 4(7.5%)" 12T C1177T P393S Nonsynonymous Heterozygous Exome Capture
96T G1412A G471E Nonsynonymous Heterozygous Exome Capture
60T A1586G *529W Nonsynonymous Heterozygous Exome Capture
116T Exon 4 (-1) N/A Splice site Heterozygous Prevalence screen
SLC6A11 CCDS2602.1 3(5.7%)* 05T C660A H220Q Nonsynonymous Heterozygous Exome Capture
12T G1084A E362K Nonsynonymous Heterozygous Exome Capture
51 T G1435A V479M Nonsynonymous Homozygous Exome Capture
SLC17A5 CCDS4981.1 4(5.7%)" 24T G776A S259F Nonsynonymous Heterozygous Exome Capture
24T G862A S288P Nonsynonymous Heterozygous Exome Capture
12T C1090T R364C Nonsynonymous Heterozygous Exome Capture
18T C1090T R364C Nonsynonymous Heterozygous Exome Capture
C12orf63 CCDS9062.1 6(9.4%)" 32T C62T S21F Nonsynonymous Heterozygous Prevalence screen
91T C700T P234S Nonsynonymous Heterozygous Exome Capture
12T G848A R283Q Nonsynonymous Heterozygous Exome Capture
125T G2857K E953K Nonsynonymous Homozygous Prevalence screen
93T T3104C L1035P Nonsynonymous Heterozygous Exome Capture
93T A3110G Q1037R Nonsynonymous Heterozygous Exome Capture
PCDHB8 CCDS4250.1 4(7.5%)" 12T G385A D129N Nonsynonymous Heterozygous Exome Capture
18T A713G D238G Nonsynonymous Heterozygous Exome Capture
56T G931A E311K Nonsynonymous Heterozygous Prevalence screen
22T G931A E311K Nonsynonymous Homozygous Exome Capture
"Number of nonsynonymous, stop and splice site mutations observed and percent of tumors affected for each of the 16 genes in the panel of 53 untreated
melanoma samples. ~† Number of nonsynonymous, stop and splice site mutations observed and percent of tumors affected for each of the 16 genes in
validation set 1 and validation set 2 respectively. * refers to stop codon. Samples used in exome capture and prevalance screen were obtained from The Surgery
Branch, National Cancer Institute. Validation set 1 samples were obtained from The Division of Medical Oncology, University of Colorado Denver School of
Medicine. Validation set 2 samples were obtained from The University of Texas MD Anderson Cancer Center.501 Mel is a commercially available melanoma cell line.
Table 4. SIFT analysis of somatic mutations identified in highly mutated genes
Amino
Tumor Acid SIFT SIR
Gene Name Name Change Syn/NonSyn Hete/Homo Sample Panel Functional Domain change score median
BRAF N/A V600E Nonsynonymous Heterozygous N/A Pkinase V600E 0 2.81
GRIN2A B12 W7* Stop Heterozygous Validation set 2 Signal Peptide Stop N/A N/A
GRIN2A 17T P57L Nonsynonymous Heterozygous Prevalence screen PBP1_iGluR_NMDA_NR2 P57L 0.26 3.14
GRIN2A MB1227 F183I Nonsynonymous Heterozygous Validation set 1 PBP1JGIuR_NMDA_NR2 F183I 0.11 2.78
GRIN2A 83T D252N Nonsynonymous Heterozygous Prevalence screen PBP1_iGluR_NMDA_NR2 D252N 0.31 2.78
GRIN2A MD_13 S278F Nonsynonymous Heterozygous Validation set 2 PBP1_iGluR_NMDA_NR2 S278F ϋ.θ; 2.85
GRIN2A 96T S278F Nonsynonymous Heterozygous Exome Capture PBP1 iGluR NMDA NR2 S278F 0 i:'i 2.85
GRIN2A 9T W343* Stop Heterozygous Exome Capture PBP1_iGluR_NMDA_NR2 Stop N/A N/A
GRIN2A MB487 E371K Nonsynonymous Heterozygous Validation set 1 PBP1_iGluR_NMDA_NR2 E371K 1 2.8
GRIN2A 18T E371K Nonsynonymous Heterozygous Exome Capture PBP1_iGluR_NMDA_NR2 E371K 1 2.8
GRIN2A B01x W372* Stop Heterozygous Validation set 2 PBP1_iGluR_NMDA_NR2 Stop N/A N/A
GRIN2A 123T E373K Nonsynonymous Heterozygous Prevalence screen PBP1_iGluR_NMDA_NR2 E373K 0.05 2.79
GRIN2A 24T G449E Nonsynonymous Heterozygous Exome Capture N/A G449E 0.3 2.79
GRIN2A 110T F459S Nonsynonymous Heterozygous Prevalence screen PBPb F459S C 2.79
GRIN2A MD_09 H595R Nonsynonymous Heterozygous Validation set 2 Lig_chan H595R 0.61 2.79
GRIN2A 114T S598F Nonsynonymous Heterozygous Prevalence screen Lig_chan S598F 0.01 2.79
GRIN2A MB490 M653I Nonsynonymous Heterozygous Validation set 1 Lig_chan M653I 0.11 2.79
GRIN2A 91T G712E Nonsynonymous Heterozygous Exome Capture Lig_chan/PBPb G712E 0.01 2.79
GRIN2A MB532 G740W Nonsynonymous Heterozygous Validation set 1 Lig_chan/PBPb G740W 2.88
GRIN2A MB669 G889E Nonsynonymous Heterozygous Validation set 1 NMDAR2_C G889E 0.26 2.81
GRIN2A MB1337 Q891* Stop Heterozygous Validation set 1 NMDAR2_C Stop N/A N/A
GRIN2A MD_13 R920K Nonsynonymous Heterozygous Validation set 2 NMDAR2_C R920K 0.54 2.98
GRIN2A MB1113 S929F Nonsynonymous Heterozygous Validation set 1 NMDAR2 C S929F 0.0: 3.37
GRIN2A 119T E962K Nonsynonymous Heterozygous Prevalence screen NMDAR2_C E962K '·) fil 3.42
GRIN2A MB490 E1073K Nonsynonymous Heterozygous Validation set 1 NMDAR2_C E1073K 0.05 3.37
GRIN2A MB1160 P1074L Nonsynonymous Heterozygous Validation set 1 NMDAR2_C P1074L 1 3.37
GRIN2A 88T D1153N Nonsynonymous Heterozygous Prevalence screen NMDAR2_C D1153N 0.32 3.37
GRIN2A 501 Mel E1175K Nonsynonymous Heterozygous Commercial cell line NMDAR2_C E1175K 1 3.4
GRIN2A 125T E1175K Nonsynonymous Heterozygous Prevalence screen NMDAR2_C E1175K 1 3.4
GRIN2A 98T W1271* Stop Heterozygous Prevalence screen NMDAR2_C Stop N/A N/A
GRIN2A MB706 A1276G Nonsynonymous Heterozygous Validation set 1 NMDAR2_C A1276G 0.34 3.37
GRIN2A MB929 R1285K Nonsynonymous Heterozygous Validation set 1 NMDAR2 C R1285K 0.19 3.37
GRIN2A 95T R1318W Nonsynonymous Heterozygous Prevalence screen NMDAR2_C R1318W ϋ 3.37
GRIN2A 86T P1366L Nonsynonymous Heterozygous Prevalence screen NMDAR2_C P1366L 3.37
GRIN2A B12 D1421N Nonsynonymous Heterozygous Validation set 2 NMDAR2_C D1421N 0.15 3.37
GRIN2A MB1335 S1425L Nonsynonymous Heterozygous Validation set 1 NMDAR2_C S1425L 0.04 3.36
GRIN2A 43T E1426K Nonsynonymous Heterozygous Exome Capture NMDAR2_C E1426K 0.26 3.36
GRIN2A D03x S1462C Nonsynonymous Heterozygous Validation set 2 NMDAR2_C S1462C Q 3.37
CCDC63 91T S47F Nonsynonymous Heterozygous Exome Capture No domain altered S47F 0.0: 2.8
CCDC63 93T R148Q Nonsynonymous Heterozygous Exome Capture No domain altered R148Q 0.36 2.8
CCDC63 29T E284K Nonsynonymous Heterozygous Prevalence screen Filament E284K 0.24 2.8
CCDC63 81T R356Q Nonsynonymous Heterozygous Prevalence screen Filament R356Q 0.46 2.8
CCDC63 43T E360K Nonsynonymous Homozygous Exome Capture Filament E360K 0.12 2.8
CCDC63 01T D456N Nonsynonymous Heterozygous Exome Capture Filament D456N 0,03 2.93
TMEM132B 60T S285L Nonsynonymous Heterozygous Exome Capture DUF59 S285L 0.46 2.85
TMEM132B 05T M403V Nonsynonymous Heterozygous Exome Capture No domain altered M403V 0.36 2.8
TMEM132B 119T G533S Nonsynonymous Heterozygous Prevalence screen No domain altered G533S C 2.78
TMEM132B 20T S636L Nonsynonymous Heterozygous Prevalence screen No domain altered S636L ; 2.79
TMEM132B 51T E659V Nonsynonymous Heterozygous Exome Capture No domain altered E659V 0.03 2.79
TMEM132B 05T G752S Nonsynonymous Heterozygous Exome Capture No domain altered G752S 0.31 2.78
TMEM132B 83T S817F Nonsynonymous Heterozygous Prevalence screen No domain altered S817F 0.05 2.94
TMEM132B 116T G822E Nonsynonymous Heterozygous Prevalence screen No domain altered G822E 1 2.97
TMEM132B 12T G822E Nonsynonymous Heterozygous Exome Capture No domain altered G822E 1 2.97
TMEM132B 108T P964S Nonsynonymous Heterozygous Prevalence screen No domain altered P964S 0.45 2.96
Table 4 (continued)
Ammo
Tumor Acid SIFT SIFT
Gene Name Name Change Syn/NonSyn Hete/Homo Sample Panel Functional Domain change score median
ZNF831 91T H453Y Nonsynonymous Heterozygous Exome Capture No domain altered H453Y 0.04 2.3
ZNF831 96T T475M Nonsynonymous Heterozygous Exome Capture No domain altered T475M 0 2.19
ZNF831 86T T713R Nonsynonymous Heterozygous Prevalence screen No domain altered T713R 0.61 2.04
ZNF831 64T R1077C Nonsynonymous Heterozygous Prevalence screen No domain altered R1077C 0.22 2.12
ZNF831 90T S1319N Nonsynonymous Heterozygous Prevalence screen No domain altered S1319N 0.36 2.35
ZNF831 81T S1357L Nonsynonymous Heterozygous Prevalence screen No domain altered S1357L 0.17 2.53
ZNF831 43T S1474F Nonsynonymous Heterozygous Exome Capture No domain altered S1474F 0.74 2.48
ZNF831 91T S1474F Nonsynonymous Heterozygous Exome Capture No domain altered S1474F 0.74 2.48
ZNF831 119T A1505V Nonsynonymous Heterozygous Prevalence screen No domain altered A1505V 0.2 2.33
ZNF831 05T E1563K Nonsynonymous Heterozygous Exome Capture No domain altered E1563K 0.87 2.42
PLCB4 12T L83P Nonsynonymous Heterozygous Exome Capture No domain altered L83P 0.02 2.79
PLCB4 91T P165L Nonsynonymous Heterozygous Exome Capture No domain altered P165L 0 2.79
PLCB4 83T R251Q Nonsynonymous Heterozygous Prevalence screen No domain altered R251 Q 0 2.79
PLCB4 119T S342L Nonsynonymous Heterozygous Prevalence screen PI-PLC-X S342L o 2.79
PLCB4 84T D496N Nonsynonymous Heterozygous Prevalence screen No domain altered D496N 0.28 2.77
PLCB4 8T E737K Nonsynonymous Heterozygous Prevalence screen C2 E737K 0.85 2.77
PLCB4 01T R772W Nonsynonymous Heterozygous Exome Capture No domain altered R772W 0.09 2.12
PLCB4 9T E1098K Nonsynonymous Heterozygous Exome Capture No domain altered E1098K 0.33 2.4
AKR1 B10 91T G134R Nonsynonymous Homozygous Exome Capture Aldo_ket_red G134R 0.01 2.84
AKR1 B10 01T D231 N Nonsynonymous Heterozygous Exome Capture Aldo_ket_red D231 N 0.08 2.84
AKR1 B10 24T T244P Nonsynonymous Heterozygous Exome Capture Aldo_ket_red T244P 0 2.84
AKR1 B10 7T splice site Heterozygous Prevalence screen No domain altered splice site N/A N/A
TAS2R60 92T P91 L Nonsynonymous Homozygous Prevalence screen 7tm_1 P91 L 1 2.89
TAS2R60 60T Stop Heterozygous Exome Capture No domain altered Stop N/A N/A
TAS2R60 9T G150E Nonsynonymous Heterozygous Exome Capture 7tm_1 G150E 0.02 2.86
TAS2R60 17T M213I Nonsynonymous Heterozygous Prevalence screen 7tm_1 M213I 1 2.86
TAS2R60 43T M213I Nonsynonymous Heterozygous Exome Capture 7tm_1 M213I 1 2.86
KHDRBS2 119T L28M Nonsynonymous Heterozygous Prevalence screen No domain altered L28M ϋ 01 2.8
KHDRBS2 60T L60F Nonsynonymous Heterozygous Exome Capture No domain altered L60F 0.01 2.78
KHDRBS2 91T R186C Nonsynonymous Heterozygous Exome Capture No domain altered R186C 0.12 2.85
KHDRBS2 05T R224W Nonsynonymous Homozygous Exome Capture No domain altered R224W Ο.ϋΐ 2.91
KHDRBS2 109T P245S Nonsynonymous Heterozygous Prevalence screen No domain altered P245S 0.03 2.91
PTPRO 12T E854K Nonsynonymous Heterozygous Exome Capture No domain altered E854K 0.57 2.27
PTPRO 24T F938L Nonsynonymous Heterozygous Exome Capture No domain altered F938L 0.1 1.96
PTPRO 95T S280Y Nonsynonymous Heterozygous Prevalence screen No domain altered S280Y 0 3.32
PTPRO 60T Stop Heterozygous Exome Capture No domain altered Stop N/A N/A
SYT4 43T E13K Nonsynonymous Heterozygous Exome Capture No domain altered E13K ϋ 05 3.37
SYT4 22T R40K Nonsynonymous Heterozygous Exome Capture No domain altered R40K 0.04 3.11
SYT4 12T E130K Nonsynonymous Homozygous Exome Capture No domain altered E130K 0.3 2.84
SYT4 119T R384Q Nonsynonymous Heterozygous Prevalence screen C2 R384Q o.os 2.78
UGT2B10 12T P393S Nonsynonymous Heterozygous Exome Capture UDPGT P393S 0 2.73
UGT2B10 96T G471 E Nonsynonymous Heterozygous Exome Capture UDPGT G471 E o 2.73
UGT2B10 60T *529W Nonsynonymous Heterozygous Exome Capture No domain altered N/A N/A
UGT2B10 116T Splice site Heterozygous Prevalence screen No domain altered Splice site N/A N/A
SLC6A11 05T H220Q Nonsynonymous Heterozygous Exome Capture SNF H220Q 0.16 2.74
SLC6A11 12T E362K Nonsynonymous Heterozygous Exome Capture SNF E362K 0.35 2.74
SLC6A11 51T V479M Nonsynonymous Homozygous Exome Capture SNF V479M 0.16 2.74
C12orf63 32T S21 F Nonsynonymous Heterozygous Prevalence screen No domain altered S21 F 0.07 3.09
C12orf63 91T P234S Nonsynonymous Heterozygous Exome Capture No domain altered P234S 0.8 3.36
C12orf63 12T R283Q Nonsynonymous Heterozygous Exome Capture No domain altered R283Q 0.29 3.12
C12orf63 125T E953K Nonsynonymous Homozygous Prevalence screen No domain altered E953K 0.13 2.72
C12orf63 93T L1035P Nonsynonymous Heterozygous Exome Capture No domain altered L1035P Q 4.32
C12orf63 93T Q1037R Nonsynonymous Heterozygous Exome Capture No domain altered Q1037R 0.33 3.12
PCDHB8 12T D129N Nonsynonymous Heterozygous Exome Capture No domain altered D129N 0 2.83
PCDHB8 18T D238G Nonsynonymous Heterozygous Exome Capture No domain altered D238G 0 2.83
PCDHB8 56T E311 K Nonsynonymous Heterozygous Prevalence screen Cadherin E311 K o 2.83
PCDHB8 22T E311 K Nonsynonymous Homozygous Exome Capture Cadherin E311 K 0 2.83
SLC17A5 24T S259F Nonsynonymous Heterozygous Exome Capture MFSJ S259F 0 2.76
SLC17A5 24T S288P Nonsynonymous Heterozygous Exome Capture Sugarjr S288P 0 2.77
SLC17A5 12T R364C Nonsynonymous Heterozygous Exome Capture MFSJ R364C o 2.76
SLC17A5 18T R364C Nonsynonymous Heterozygous Exome Capture MFS 1 R364C 0 2.76
Alterations with a SIFT score highlighted in red are predicted to be deleterious to protein function.
N/A, not applicable
Table 5. Characteristics of melanoma patient samples used in this study
Patient Age Patient MetastaticTumor Site Matched normal
(years)* Gender source
Patient Age Patient MetastaticTumor Site Matched normal ears * Gender source
* Patient's age when tumor was surgically removed.
** Cell line generated from 2 metastatic melanoma tumors mixed after resection during the same operation.
Table 6. TRRAP primers used for recurrent mutation confirmation
Primer Hotspot SEQ ID
Primer set # Sequence
Type Change NO:
TRRAP #1 Forward C2165T GTAAAACGACGGCCAGTTAAAA 19
CTGCTTTGGGGAAGG
TRRAP #1 Reverse C2165T GAGTGCCTATAGTCCCAAAAA 20
TRRAP #1 Sequencing C2165T GTAAAACGACGGCCAGT 21
TRRAP #2 Forward C2165T GTAAAACGACGGCCAGTTTGCTA 22
CGATTCTGGTGGAA
Primer Hotspot SEQ ID
Primer set # Sequence
Type Change NO:
TRRAP #2 Reverse C2165T CGTGAGGCCCTGTCTCTAAC 23
TRRAP #2 Sequencing C2165T GTAAAACGACGGCCAGT 24
Table 7. GRIN2A primers used for PCR and sequencing
Primer SEQ ID
Coverage Sequence
Name NO:
GRIN2A_ _1 Exon 1 GTAAAACGACGGCCAGTCCTATCCTGCTGCT 25
Forward GAGTTCC
GRIN2A_ _1 Exon 1 AGTTTCCGGCCTTACCTTGTC 26
Reverse
GRIN2A_ _2 Exon 1 GTAAAACGACGGCCAGTAGAGTGGGCTATTG 27
Forward GACCCTG
GRIN2A_ _2 Exon 1 GAGGCAAGACCTGGTTCTCAC 28
Reverse
GRIN2A_ _3 Exon 2 GTAAAACGACGGCCAGTCTAGGACGCAGTTT 29
Forward GTGCTTC
GRIN2A_ _3 Exon 2 GAACAGCCTCGTCTTTGGAAC 30
Reverse
GRIN2A_ _4 Exon 2 GTAAAACGACGGCCAGTGGCTACAGGGAAT 31
Forward TCATCAGC
GRIN2A_ _4 Exon 2 TCAGTGCGTATTTCCAACAATG 32
Reverse
GRIN2A_ _5 Exon 3 GTAAAACGACGGCCAGTGCAGAGAGGCTTCT 33
Forward TGTGATG
GRIN2A_ _5 Exon 3 AGAAAGAAGCACTGTGAGCCC 34
Reverse
GRIN2A_ _6 Exon 4 GTAAAACGACGGCCAGTGGAAAGGATTTGC 35
Forward CTCTCCAG
GRIN2A_ _6 Exon 4 GCAAGTGTGGCACATCTCTAGG 36
Reverse
GRIN2A_ 7 Exon 5 GTAAAACGACGGCCAGTGTCCTTGGGAAAGC 37
Forward CACTTC
GRIN2A_ 7 Exon 5 CGTTGATAGACCACCTGGATG 38
Reverse
GRIN2A_ _8 Exon 7 GTAAAACGACGGCCAGT ATGTCTGGGCTTCC 39
Forward TGCTG
GRIN2A_ _8 Exon 7 TCCTGACCTCATGATCCACC 40
Reverse
GRIN2A_ _9 Exon 8 GTAAAACGACGGCCAGTTTCCATCTTCTGGC 41
Forward AACCTTC
GRIN2A_ _9 Exon 8 TCAATGAGAGGCACCTGAATC 42
Reverse
GRIN2A_ .10 Exon 9 GTAAAACGACGGCCAGTTTGTCATCCTGCCC 43
Forward TAATGC
GRIN2A_ .10 Exon 9 CATGCCGAGAGTCAATTTCTG 44
Reverse
Primer SEQ ID
Coverage Sequence
Name NO:
GRIN2A_11 Exon 10 GTAAAACGACGGCCAGTAAAGTGTGGGATG 45 Forward CTTTCAGG
GRIN2A_11 Exon 10 ATGCAAAGATCCACTGGGAAG 46 Reverse
GRIN2A_12 Exon 11 GTAAAACGACGGCCAGTGTCTGTTCCAAACC 47 Forward CAGAAGC
GRIN2A_12 Exon 11 TGAGACATCAAGAACCCAAGC 48 Reverse
GRIN2A_13 Exon 12 GTAAAACGACGGCCAGTCCCTATGCTTTGCA 49 Forward ACTTGTC
GRIN2A_13 Exon 12 GAAACCATGTCCATGATGAGG 50 Reverse
GRIN2A_14 Exon 12 GTAAAACGACGGCCAGTCAGGCATCTACAGC 51 Forward TGCATTC
GRIN2A_14 Exon 12 GGAGTGGGTCCTATTCTCTGC 52 Reverse
GRIN2A_15 Exon 12 GTAAAACGACGGCCAGTAGACAACAGGTCC 53 Forward TTTCAGGG
GRIN2A_15 Exon 12 TGTTGTCAGGTTCCCTGTGG 54 Reverse
GRIN2A_16 Exon 12 GTAAAACGACGGCCAGTATTCCATACGCCAG 55 Forward GATTCAC
GRIN2A_16 Exon 12 GTATCGCTCGCTGGTCTCAC 56 Reverse
GRIN2A_17 Exon 12 GTAAAACGACGGCCAGTAACGTGGACTTCCC 57 Forward GGAC
GRIN2A_17 Exon 12 GCCCAGTCCTGCTGGTAGAC 58 Reverse
GRIN2A_18 Exon 12 GTAAAACGACGGCCAGTGTGAGACCAGCGA 59 Forward GCGATAC
GRIN2A_18 Exon 12 GAAAGGGTTATCGGAGGTGTG 60 Reverse
GRIN2A_19 Exon 12 GTAAAACGACGGCCAGTGCTAGACCTTAGCA 61 Forward GGCCCTC
GRIN2A_19 Exon 12 TTTACCCTCCAGAACATTGGC 62 Reverse
In view of the many possible embodiments to which the principles of the disclosed invention may be applied, it should be recognized that the illustrated embodiments are only preferred examples of the invention and should not be taken as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.
Claims
1. A method of diagnosing a subject as having melanoma, or susceptible to developing melanoma, comprising detecting the presence or absence of at least one mutation in the glutamate receptor, ionotropic, N-methyl D-aspartate 2 A
(GRIN2A) gene or the transformation/transcription domain- associated protein (TRRAP) gene, wherein the at least one mutation comprises:
(i) a mutation in a portion of the GRIN2A gene that encodes the
PBP l_iGluR_NMDA_NR2 domain (nucleotides 94-1176 of SEQ ID NO: 3);
(ii) a mutation in a portion of the GRIN2A gene that encodes the
NMDAR2_C domain (nucleotides 2515-4392 of SEQ ID NO: 3);
(iii) a mutation in a portion of the GRIN2A gene that encodes the
Lig_chan domain (nucleotides 1660-2484 of SEQ ID NO: 3);
(iv) G20A in the GRIN2A gene (SEQ ID NO: 3);
(v) G1346A in the GRIN2A gene (SEQ ID NO: 3);
(vi) T1376C in the GRIN2A gene (SEQ ID NO: 3); or
(vii) C2165T in the TRRAP gene (SEQ ID NO: 1),
wherein the presence of the at least one mutation indicates the subject has melanoma or is susceptible to developing melanoma.
2. The method of claim 1, wherein the mutation in the portion of the GRIN2A gene that encodes the PBP l_iGluR_NMDA_NR2 domain is C170T, T547A, G754A, C833T, G1028A, Gl 111A, Gl 116A or Gl 117A (SEQ ID NO: 3).
3. The method of claim 2, wherein the mutation in the portion of the GRIN2A gene that encodes the PBP l_iGluR_NMDA_NR2 domain is C833T or G1111A (SEQ ID N0: 3).
4. The method of claim 1, wherein the mutation in the portion of the GRIN2A gene that encodes the NMDAR2_C domain is G2666A, C2671T, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A, G3812A, C3827G, G3854A, C3952T, C4097T, G4261A, C4274T, G4276A or C4385G (SEQ ID NO: 3).
5. The method of claim 4, wherein the mutation in the portion of the GRIN2A gene that encodes the NMDAR2_C domain is G3523A or G3812A (SEQ ID NO: 3).
6. The method of claim 1, wherein the mutation in the portion of the GRIN2A gene that encodes the Lig_chan domain is A1784G, C1793T, G1959A, G2135A or G2218A (SEQ ID NO: 3).
7. The method of claim 1, wherein the mutation is C2165T in the TRRAP gene (SEQ ID NO: 1).
8. The method of any one of claims 1-7, wherein detecting the presence or absence of the at least one mutation comprises detecting the presence or absence of the mutation in a skin sample obtained from the subject.
9. The method of any one of claims 1-8, further comprising providing a test output to a user.
10. The method of claim 9, wherein the output comprises the presence or absence of the at least one mutation, a diagnosis, a treatment recommendation, or any combination thereof.
11. The method of any one of claims 1-10, further comprising providing an appropriate therapy to the subject.
12. The method of claim 11, wherein the appropriate therapy is surgical removal of tumor tissue, radiation therapy, chemotherapy, administration of a TRRAP inhibitor, administration of a GRIN2A inhibitor, administration of a glutamate antagonist, or any combination of two or more thereof.
13. A method of selecting a therapy for a subject diagnosed with melanoma, comprising detecting the presence or absence of at least one mutation in the GRIN2A gene, wherein the at least one mutation comprises:
(i) a mutation in a portion of the GRIN2A gene that encodes the
PBP l_iGluR_NMDA_NR2 domain (nucleotides 94-1176 of SEQ ID NO: 3);
(ii) a mutation in a portion of the GRIN2A gene that encodes the
NMDAR2_C domain (nucleotides 2515-4392 of SEQ ID NO: 3);
(iii) a mutation in a portion of the GRIN2A gene that encodes the
Lig_chan domain (nucleotides 1660-2484 of SEQ ID NO: 3);
(iv) G20A in the GRIN2A gene (SEQ ID NO: 3);
(v) G1346A in the GRIN2A gene (SEQ ID NO: 3); or
(vi) T1376C in the GRIN2A gene (SEQ ID NO: 3),
wherein an inhibitor of GRIN2A or a glutamate antagonist is selected for therapy if the at least one mutation in GRIN2A is present.
14. The method of claim 13, wherein the mutation in the portion of the GRIN2A gene that encodes the PBP l_iGluR_NMDA_NR2 domain is C170T,
T547A, G754A, C833T, G1028A, Gl 111A, Gl 116A or Gl 117A (SEQ ID NO: 3).
15. The method of claim 13, wherein the mutation in the portion of the GRIN2A gene that encodes the NMDAR2_C domain is G2666A, C2671T, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A, G3812A, C3827G,
G3854A, C3952T, C4097T, G4261A, C4274T, G4276A or C4385G (SEQ ID NO: 3).
16. The method of claim 13, wherein the mutation in the portion of the GRIN2A gene that encodes the Lig_chan domain is A1784G, C1793T, G1959A,
G2135A or G2218A (SEQ ID NO: 3).
17. A method of selecting a therapy for a subject diagnosed with melanoma, comprising detecting the presence or absence of a C2165T mutation in the TRRAP gene (SEQ ID NO: 1), wherein an inhibitor of TRRAP is selected if the C2165T mutation in the TRRAP gene is present.
18. The method of any one of claims 13-17, further comprising administering the selected therapy.
19. The method of claim 18, wherein the subject is further treated by administration of a second therapeutic agent, surgical removal of tumor tissue, radiation therapy, chemotherapy, or any combination of thereof.
20. An oligonucleotide that specifically hybridizes with a nucleic acid molecule encoding GRIN2A or TRRAP, wherein the nucleic acid molecule comprises:
(i) G20A, C170T, T547A, G754A, C833T, G1028A, Gl 111A, Gl 116A, G1117A, G1346A, T1376C, A1784G, C1793T, G1959A, G2135A, G2218A, G2666A, C2671T, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A, G3812A, C3827G, G3854A, C3952T, C4097T, G4261A, C4274T, G4276A and C4385G in GRIN2A (SEQ ID NO: 3); or
(ii) C2165T in TRRAP (SEQ ID NO: 1).
21. The oligonucleotide of claim 20, wherein the oligonucleotide is about 15 to about 40 nucleotides in length.
22. The oligonucleotide of claim 20 or claim 21, wherein the
oligonucleotide comprises a label.
23. The oligonucleotide of claim 22, wherein the label is a fluorescent label, an enzymatic label or a radioisotope.
24. An array comprising one or more of the oligonucleotides of any one of claims 20-23.
25. The array of claim 24, comprising at least one oligonucleotide that specifically hybridizes with each of the mutations selected from:
(i) G20A, C170T, T547A, G754A, C833T, G1028A, Gl 111A, Gl 116A, G1117A, G1346A, T1376C, A1784G, C1793T, G1959A, G2135A, G2218A, G2666A, C2671T, G2759A, C2786T, G2884A, G3217A, C3221T, G3457A, G3523A, G3812A, C3827G, G3854A, C3952T, C4097T, G4261A, C4274T, G4276A and C4385G in GRJN2A (SEQ ID NO: 3); and
(ii) C2165T in TRRAP (SEQ ID NO: 1).
The array of claim 24 or claim 25, which is a microarray.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US13/982,392 US9157125B2 (en) | 2011-02-02 | 2012-01-26 | GRIN2A mutations and use thereof for the diagnosis of melanoma |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161462471P | 2011-02-02 | 2011-02-02 | |
| US61/462,471 | 2011-02-02 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2012106175A1 true WO2012106175A1 (en) | 2012-08-09 |
Family
ID=46603041
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/022687 Ceased WO2012106175A1 (en) | 2011-02-02 | 2012-01-26 | Trrap and grin2a mutations and use thereof for the diagnosis and treatment of melanoma |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US9157125B2 (en) |
| WO (1) | WO2012106175A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109476731A (en) * | 2016-02-29 | 2019-03-15 | 基础医药有限公司 | Methods of treating cancer |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP6821693B2 (en) | 2016-02-29 | 2021-01-27 | ジェネンテック, インコーポレイテッド | Treatment and diagnosis for cancer |
| CA3038712A1 (en) | 2016-10-06 | 2018-04-12 | Genentech, Inc. | Therapeutic and diagnostic methods for cancer |
| JP7760242B2 (en) | 2017-07-21 | 2025-10-27 | ジェネンテック, インコーポレイテッド | Cancer treatment and diagnosis methods |
| WO2021062124A2 (en) * | 2019-09-25 | 2021-04-01 | Brown University | Methods and compositions for treating, preventing or reversing obesity and obesity-related disorders by opsin 3 regulation of hypothalamic melanocortin receptors |
| US20230044407A1 (en) * | 2019-12-02 | 2023-02-09 | The Trustees Of Dartmouth College | Targeting mb2 of the myc oncogene and its interaction with trrap in cancer |
Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6333152B1 (en) * | 1997-05-21 | 2001-12-25 | The Johnshopkins University | Gene expression profiles in normal and cancer cells |
| US20040241651A1 (en) * | 2000-04-07 | 2004-12-02 | Alexander Olek | Detection of single nucleotide polymorphisms (snp's) and cytosine-methylations |
| US20050255487A1 (en) * | 2002-11-14 | 2005-11-17 | Dharmacon, Inc. | Methods and compositions for selecting siRNA of improved functionality |
| US20070031843A1 (en) * | 2004-04-02 | 2007-02-08 | Rosetta Genomics | Bioinformatically detectable group of novel regulatory bacterial and bacterial associated oligonucleotides and uses thereof |
| US20070042381A1 (en) * | 2002-12-05 | 2007-02-22 | Rosetta Genomics | Bioinformatically detectable group of novel regulatory viral and viral associated oligonucleotides and uses thereof |
| WO2008021290A2 (en) * | 2006-08-09 | 2008-02-21 | Homestead Clinical Corporation | Organ-specific proteins and methods of their use |
| US7655785B1 (en) * | 2002-11-14 | 2010-02-02 | Rosetta Genomics Ltd. | Bioinformatically detectable group of novel regulatory oligonucleotides and uses thereof |
| US7687616B1 (en) * | 2004-05-14 | 2010-03-30 | Rosetta Genomics Ltd | Small molecules modulating activity of micro RNA oligonucleotides and micro RNA targets and uses thereof |
| US20110178283A1 (en) * | 2006-03-03 | 2011-07-21 | International Business Machines Corporation | Ribonucleic acid interference molecules and binding sites derived by analyzing intergenic and intronic regions of genomes |
| US20110191912A1 (en) * | 2000-04-26 | 2011-08-04 | Nickolai Alexandrov | Promoter, promoter control elements, and combinations, and uses thereof |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6582908B2 (en) * | 1990-12-06 | 2003-06-24 | Affymetrix, Inc. | Oligonucleotides |
| GB9805918D0 (en) * | 1998-03-19 | 1998-05-13 | Nycomed Amersham Plc | Sequencing by hybridisation |
| JP2007530017A (en) | 2004-03-02 | 2007-11-01 | ザ ジョンズ ホプキンス ユニバーシティ | Mutation of PIK3CA gene in human cancer |
| US20080312093A1 (en) | 2005-11-04 | 2008-12-18 | Johji Inazawa | Method for detecting cancer and a method for suppressing cancer |
| WO2007150071A1 (en) | 2006-06-23 | 2007-12-27 | Myriad Genetics, Inc. | Gene amplifications and deletions |
-
2012
- 2012-01-26 WO PCT/US2012/022687 patent/WO2012106175A1/en not_active Ceased
- 2012-01-26 US US13/982,392 patent/US9157125B2/en active Active
Patent Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6333152B1 (en) * | 1997-05-21 | 2001-12-25 | The Johnshopkins University | Gene expression profiles in normal and cancer cells |
| US20040241651A1 (en) * | 2000-04-07 | 2004-12-02 | Alexander Olek | Detection of single nucleotide polymorphisms (snp's) and cytosine-methylations |
| US20110191912A1 (en) * | 2000-04-26 | 2011-08-04 | Nickolai Alexandrov | Promoter, promoter control elements, and combinations, and uses thereof |
| US20050255487A1 (en) * | 2002-11-14 | 2005-11-17 | Dharmacon, Inc. | Methods and compositions for selecting siRNA of improved functionality |
| US7655785B1 (en) * | 2002-11-14 | 2010-02-02 | Rosetta Genomics Ltd. | Bioinformatically detectable group of novel regulatory oligonucleotides and uses thereof |
| US20070042381A1 (en) * | 2002-12-05 | 2007-02-22 | Rosetta Genomics | Bioinformatically detectable group of novel regulatory viral and viral associated oligonucleotides and uses thereof |
| US20070031843A1 (en) * | 2004-04-02 | 2007-02-08 | Rosetta Genomics | Bioinformatically detectable group of novel regulatory bacterial and bacterial associated oligonucleotides and uses thereof |
| US7687616B1 (en) * | 2004-05-14 | 2010-03-30 | Rosetta Genomics Ltd | Small molecules modulating activity of micro RNA oligonucleotides and micro RNA targets and uses thereof |
| US20110178283A1 (en) * | 2006-03-03 | 2011-07-21 | International Business Machines Corporation | Ribonucleic acid interference molecules and binding sites derived by analyzing intergenic and intronic regions of genomes |
| WO2008021290A2 (en) * | 2006-08-09 | 2008-02-21 | Homestead Clinical Corporation | Organ-specific proteins and methods of their use |
Non-Patent Citations (1)
| Title |
|---|
| WEI, X. ET AL.: "Exome sequencing identifies GRIN2A as frequently mutated in melanoma", NATURE GENETICS, vol. 43, no. 5, May 2011 (2011-05-01), pages 442 - 446 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109476731A (en) * | 2016-02-29 | 2019-03-15 | 基础医药有限公司 | Methods of treating cancer |
Also Published As
| Publication number | Publication date |
|---|---|
| US9157125B2 (en) | 2015-10-13 |
| US20130309254A1 (en) | 2013-11-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20230016456A1 (en) | ncRNA AND USES THEREOF | |
| Wieben et al. | Trinucleotide repeat expansion in the transcription factor 4 (TCF4) gene leads to widespread mRNA splicing changes in Fuchs' endothelial corneal dystrophy | |
| US20120214163A1 (en) | Disease-associated genetic variations and methods for obtaining and using same | |
| US9982304B2 (en) | ARID1A and PPP2R1A mutations in cancer | |
| Antonescu et al. | Promiscuous genes involved in recurrent chromosomal translocations in soft tissue tumours | |
| Shibata et al. | DEK oncoprotein regulates transcriptional modifiers and sustains tumor initiation activity in high-grade neuroendocrine carcinoma of the lung | |
| US9157125B2 (en) | GRIN2A mutations and use thereof for the diagnosis of melanoma | |
| JP2017508442A (en) | Gene signatures associated with susceptibility to MDM2 inhibitors | |
| Bhanushali et al. | Status of TMPRSS2–ERG fusion in prostate cancer patients from India: correlation with clinico-pathological details and TMPRSS2 Met160Val polymorphism | |
| Peluso et al. | Lymph node fine-needle cytology: beyond flow cytometry | |
| CN113646443A (en) | Compositions for diagnosing gliomas or predicting prognosis and methods of providing information about the same | |
| JP2009050189A (en) | Method for predicting effectiveness of anti-cancer agent | |
| CN107208148B (en) | Method and kit for pathological grading of breast tumors | |
| WO2009103061A2 (en) | Methods and compositions for identifying, diagnosing, and treating neuroblastoma | |
| US10519507B2 (en) | Method for detecting T-cell lymphoma | |
| AU2005201935A1 (en) | Prognostic for hematological malignancy | |
| AU2012284100B2 (en) | Oligodendroglioma driver genes | |
| WO2014190927A1 (en) | Pancreatic neuroendocrine tumour susceptibility gene loci and detection methods and kits | |
| EP2716767A1 (en) | Method for determining the prognosis of pancreatic cancer | |
| AU2017280210A1 (en) | Method and kit for detecting fusion transcripts | |
| US8795964B2 (en) | GRM3 mutations and use thereof for the diagnosis and treatment of melanoma | |
| WO2021055528A1 (en) | Methods and kit for analyzing responsiveness of patients to cd19 immunotherapy | |
| WO2010072608A1 (en) | Pcsk1 single nucleotide polymorphism in type 2 diabetes | |
| WO2013151983A1 (en) | Methods for predicting the prognosis of a subject with a myeloid malignancy | |
| US8652787B2 (en) | Use of ERBB4 as a prognostic and therapeutic marker for melanoma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12742705 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13982392 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 12742705 Country of ref document: EP Kind code of ref document: A1 |





