WO2007150071A1

WO2007150071A1 - Gene amplifications and deletions

Info

Publication number: WO2007150071A1
Application number: PCT/US2007/072048
Authority: WO
Inventors: Kirsten Timms; Victor Abkevich; Alexander Gutin; Srikanth Jammulapati; Jerry Lanchbury
Original assignee: Myriad Genetics, Inc.
Priority date: 2006-06-23
Filing date: 2007-06-25
Publication date: 2007-12-27

Abstract

The invention relates to gene amplifications and deletions in cancer and their use in assessing cancers.

Description

Attorney Docket No. 3300-01-lWO PATENT

APPLICATION FOR LETTERS PATENT

for

GENE AMPLIFICATIONS AND DELETIONS

Inventor(s):

Kirsten Timms

Victor Abkevich

Alexander Gutin

Srikanth Jammulapati

Jerry Lanchbury

Jonathan Baker Ph.D. Registration No. 49,022 Intellectual Property Department Myriad Genetics, Inc. (Customer No. 26698) 320 Wakara Way Salt Lake City, UT 84108 Telephone: 801-584-3600 Fax: 801-883-3871 Attorney Docket No. 3300-01-lWO

GENE AMPLIFICATIONS AND DELETIONS

[0001]

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims priority to U.S. provisional application Serial No. 60/816,070, filed June 23, 2006, which is hereby incorporated by reference in its entirety.

FIELD OF THE INVENTION

[0002] The invention relates to amplified and deleted genes and their use.

BACKGROUND OF THE INVENTION

[0003] Cancer is prevalent: In the United States, the probability of developing invasive cancer is 38% for females and 46% for males that live to be 70 years older and older. There will be about 1.4 million new cases of cancer in 2006. Although the five year survival rate for cancer is now 65%, up from about 50% in the mid-nineteen seventies, cancer is deadly. It is estimated that 565,000 people in the United States will die from cancer in 2006. (American Cancer Society, Surveillance Research, 2006).

[0004] Cancer is characterized by abnormal and uncontrolled cell growth. This aberrant cell growth causes cancer cells to invade adjacent tissues and metastasize to other locations in the body. Underpinning the change of normal cell into cancerous cells are acquired and inherited genetic changes. Some cancers are known to be associated with whole chromosomal duplications and/or deletions (Friedlander et al. J Clin Pathol.19%4; 37: 961-974). As a result of genomic instability, cancer cells accumulate both random and causal alterations at multiple levels from point mutations to whole-chromosome aberrations. DNA copy number changes are one type of genomic change frequently associated with cancer and include loss of heterozygosity (LOH) and homozygous deletions, which sometimes can result in the loss of tumor suppressor genes, and gene amplification events, which can result in cellular proto- Attorney Docket No. 3300-01-lWO

oncogene activation. These changes, in aggregate, tend to give the cancer cell a proliferative advantage.

[0005] Mutations in certain genes can induce or contribute to oncogenesis. Tumors can carry several different independently mutated genes, including activated oncogenes and inactivated tumor suppressor genes. These mutations impart some of the traits that, in aggregate, represent the full neoplastic phenotype (Land et al., Science, 222:771 , 1983; Ruley, Nature, 4:602, 1983; Hunter, Cell, 64:249, 1991)

[0006] One particular mutation results in gene amplification. Gene amplification involves replication of a chromosomal region, bearing specific genes, to produce a relative increase in DNA copy number (normally 2 in diploid cells). Gene amplification often results in increased levels of transcription and translation of the amplified genes which can produce higher amounts of the corresponding mRNAs and proteins. Amplification of genes can cause deleterious effects via a number of mechanisms, which contribute to cancer formation and proliferation (Lengauer et al. Nature, 396:643-649, 1999). Well-known gene amplifications in cancer include erbb (EGFR), erbb2 (HER2), and PIK3CA, which are thought to make major contributions to the neoplastic phenotype of a large number of cancers and served as the basis for the development of targeted therapies to the amplified gene product protein. These new targeted therapies include Herceptin™ (HER2), Erbitux™(EGFR), Iressa™(EGFR) and Tarceva™(EGFR) which have had a profound clinical impact in several cancers. Gene amplification is established as an important genetic alteration in solid tumors (Popescu et al. J Cell MoI Med. (2): 151 -9 (2002); Culig et al. Endocr Relat Cancer. Sep;9(3): 155-70, 2002; Knuutila et al., Am. J. Pathol., 152(5): 1107-23, 1998; Knuutila et al., Cancer Genet. Cytogenet., 100(l):25-30, 1998).

[0007] Genetic deletions are also a common event that occurs in cancer. Tumor suppressors such as BRCA, PTEN, pi 6, and p53 are commonly deleted (or altered) in many cancers.

[0008] Given the role of DNA copy number changes in oncogenesis, there is a need to identify copy numbers changes in cancer cells and tissue. DNA copy number changes can be used to provide prognostic and diagnostic information. Additionally, DNA copy number changes can be used to identify novel tumor suppressors and Attorney Docket No. 3300-01-lWO

oncogenes. Characterization of copy number changes can also be used to select an appropriate therapeutic approach for a patient with cancer or a predisposition to develop cancer.

BRIEF SUMMARY OF THE INVENTION

[0009] The present invention relates to discovery of amplified and deleted genes in cancer cells. The invention provides methods and compositions for use in the diagnosis, prognosis, prevention, and treatment of cancer.

[0010] The invention is based on the discovery of alterations in copy number of a number of genes in cancer cell lines and tumors.

[0011] The inventors have discovered that the regions and genes listed in Tables 1-7 have been amplified or deleted in certain cancers. According to this discovery, the amplified genes (and regions) listed in Tables 1-7 and their expressed protein products can be used in molecular medicine applications. These genes and proteins can also be used as a target for cancer therapy. Additionally, the deleted genes (and regions) listed in Tables 1-7 can be used in molecular medicine applications and as targets for therapeutic application (e.g., preventing the loss of the gene can be protective against a disease). As a result of the invention, the genes listed in Tables 1- 7 as well as their expressed protein products can be analyzed in samples for cancer diagnosis and prognosis. Another use of the genes (and regions) in Tables 1-7 is for the selection of therapeutic treatments based on the status of the genes and expressed protein products in Tables 1-7. The amplified genes/regions (and expressed protein products) listed in Tables 1-7 can also now be used as a drug target for cancer therapeutics. The deleted genes listed in Tables 1-7 can also be used for therapeutic intervention, e.g, gene therapy. The targets listed in Tables 1-7 can also be used for cancer screening. For example, blood or serum can be monitored for one or more of the targets listed in the Tables to determine if the patient has cancer.

[0012] The present invention provides methods for diagnosis, prognosis and prediction of cancer.

[0013] The invention, in some embodiments, relates to characterizing one or more biomarkers (targets) from a cancer sample (e.g., tumor, cancer cell, sample Attorney Docket No. 3300-01-lWO

suspected of being cancer) and/or from a "normal" cell, representative of the germline, from an individual. Alternatively, the biomarkers from the patient sample can be compared to a control value. The biomarkers for use in the invention are those listed in Tables 1-7, including the regions, fragments of the regions, specific genes in the regions, proteins expressed by genes in the regions, DNA markers in the region, etc. The invention is useful for a number of applications including diagnosing cancer, predicting predisposition to cancer, staging cancer, determining prognosis, determining therapy, and characterizing the cancer. Critical treatment decisions are made based on accurate staging. Accurate staging can be difficult in a number of cancers based on currently used techniques.

[0014] In some aspects of these embodiments, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , or 22 or more chromosomes are profiled. In some aspects of this embodiment, the resolution of the copy number profiling is 500, 400, 300, 250, 200, 250, 200, 150, 100, 75, 50, 40, 30, 20, or 10 Kb or less.

[0015] In some aspects of these embodiments, the copy number profile analysis involves amplification of whole genome DNA by a whole genome amplification method. In a more specific aspect, the whole genome amplification method uses a strand displacing polymerase and random primers.

[0016] In some aspects of these embodiments, the copy number profile analysis involves hybridization of whole genome amplified DNA with a high density array. In a more specific aspect, the high density array has 5,000 or more different probes. In another specific aspect, the high density array has 5,000, 10,000, 20,000, 50,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, or 1 ,000,000 or more different probes. In another specific aspect, each of the different probes on the array is an oligonucleotide having from about 15 to 200 bases in length. In another specific aspect, each of the different probes on the array is an oligonucleotide having from about 15 to 200, 15 to 150, 15 to 100, 15 to 75, 15 to 60, or 20 to 55 bases in length.

[0017] In some aspects of these embodiments, the copy number profile of 2 or more genes (or loci) are determined. In another aspect of this embodiment, the copy number profile of 2, 5, 10, 20, 50, 100, 200, 500, 1000, 2000, 3000, 4000, 5000, 7000, Attorney Docket No. 3300-01-lWO

9000, 12,000, 15,000, 20,000, 25,000, 30,000, or 40,000 or more genes (or loci) are determined.

[0018] In some aspects of these embodiments, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 30, 40, 50, 60, 70, 80, 90, or 100 or more targets are profiled. In some aspects of these embodiments, the target is chosen from the DNA copy number, mRNA expression level, and protein expression level of targets chosen from Tables 1-7.

[0019] In some aspects of these embodiments, the copy number profile analysis involves hybridization of nucleic acid with a high density array. In a more specific aspect, the high density array has 5,000 or more different probes. In another specific aspect, the high density array has 5,000, 10,000, 20,000, 50,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, or 1 ,000,000 or more different probes. In another specific aspect, each of the different probes on the array is an oligonucleotide having from about 15 to 200 bases in length. In another specific aspect, each of the different probes on the array is an oligonucleotide having from about 15 to 200, 15 to 150, 15 to 100, 15 to 75, 15 to 60, or 20 to 55 bases in length.

[0020] In some aspects of these embodiments, the level of 2 or more targets (e.g., gene, loci, region, mRNA, protein, and/or fragments thereof) is determined. In another aspect of this embodiment, the profile or fingerprint of 2, 5, 10, 20, 50, 100, 200, 500, 1000, 2000, 3000, 4000, 5000, 7000, 9000, 12,000, 15,000, 20,000, 25,000, 30,000, or 40,000 or more targets (e.g., gene, loci, region, mRNA, protein, and/or fragments thereof) is determined.

[0021] In some aspects of the invention, the targets that are analyzed correspond to at least 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and 95% those listed in Tables 1-7.

[0022] In some aspects of the invention, the targets that are analyzed correspond to at least 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and 95% those listed in Tables 1. Attorney Docket No. 3300-01-lWO

[0023] In some aspects of the invention, the targets that are analyzed correspond to at least 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and 95% those listed in Tables 2.

[0024] In some aspects of the invention, the targets that are analyzed correspond to at least 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and 95% those listed in Table 3.

[0025] In some aspects of the invention, the targets that are analyzed correspond to at least 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and 95% those listed in Tables 4.

[0026] In some aspects of the invention, the targets that are analyzed correspond to at least 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and 95% those listed in Tables 5.

[0027] In some aspects of the invention, the targets that are analyzed correspond to at least 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and 95% those listed in Table 6.

[0028] In some aspects of the invention, the targets that are analyzed correspond to at least 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and 95% those listed in Tables 7.

[0029] In some aspects of these embodiments, one or more auxiliary genes are examined for alterations in the suspected cancer. In a more specific aspect, one or more auxiliary genes are chosen from p53, PTEN, pl6, c20orfl33, TGF-β2, ctnnal , ctnnbl , KRAS, BRAF, and pik3ca. In another aspect, the one or more auxiliary genes are analyzed for alterations in the cancer and from a normal cell (or compared to the wild-type sequence). In a specific aspect, the DNA sequence of a nucleic acid corresponding to the one or more auxiliary genes is analyzed.

[0030] In some aspects of these embodiments, the cancer is suspected of being one or more cancers are independently chosen from Hodgkin's disease, non-Hodgkin's lymphoma, acute lymphocytic leukemia, chronic lymphocytic leukemia, multiple myeloma, neuroblastoma, breast carcinoma, ovarian carcinoma, lung carcinoma, Wilms' tumor, cervical carcinoma, testicular carcinoma, soft-tissue sarcoma, macroglobulinemia, bladder carcinoma, chronic granulocytic leukemia, brain Attorney Docket No. 3300-01-lWO

carcinoma, malignant melanoma, small-cell lung carcinoma, stomach carcinoma, colon carcinoma, malignant pancreatic insulinoma, malignant carcinoid carcinoma, choriocarcinoma, mycosis fungoides, head or neck carcinoma, osteogenic sarcoma, pancreatic carcinoma, acute granulocytic leukemia, hairy cell leukemia, neuroblastoma, rhabdomyosarcoma, Kaposi's sarcoma, genitourinary carcinoma, thyroid carcinoma, esophageal carcinoma, malignant hypercalcemia, cervical hyperplasia, renal cell carcinoma, endometrial carcinoma, polycythemia vera, essential thrombocytosis, adrenal cortex carcinoma, skin cancer, ovarian carcinoma, endometrial carcinoma, prostatic carcinoma, and a cancer of unknown origin.

[0031] In some aspects of these embodiments, the genomic DNA from the suspected tumor or cancer cells are obtained from one or more tissues independently chosen from brain, lung, liver, spleen, kidney, lymph node, small intestine, pancreas, colon, stomach, breast, endometrial, prostate, testicle, ovary, skin, head and neck, esophagus, and bone marrow.

[0032] In some aspects of these embodiments, the genomic DNA from the suspected tumor or cancer cells are obtained from one or more organs independently chosen from brain, lung, liver, spleen, kidney, lymph node, small intestine, pancreas, colon, stomach, breast, endometrial, prostate, testicle, ovary, skin, head and neck, esophagus, and bone marrow.

[0033] In some aspects of these embodiments, the genomic DNA from the suspected tumor or cancer cells are obtained from one or more anatomical regions independently chosen from brain, lung, liver, spleen, kidney, lymph node, small intestine, pancreas, blood cells, colon, stomach, breast, endometrial, prostate, testicle, ovary, skin, head and neck, esophagus, and bone marrow.

[0034] In one embodiment, the invention provides a method for determining a treatment regimen. The method of this embodiment involves identifying a patient having cancer. According to this embodiment, genomic DNA is obtained from a suspected tumor and profiled for copy number changes for 2 or more chromosomes, at 500 Kb or greater resolution. The copy number profile of the genomic DNA from the suspected tumor is compared to a control or normal tissue. A substantially different Attorney Docket No. 3300-01-lWO

copy number profile between the suspected tumor and the control "normal" indicates that the tumor may be more advanced, and treated more aggressively.

[0035] In one embodiment, the invention provides methods useful for diagnosing cancer, predicting predisposition to cancer, characterizing cancer, prognosis of cancer, selection of therapy, predicting response to therapy, and staging cancer. The methods involve detecting the level (e.g., copy number, mRNA expression level, protein expression level, etc.) of the one or more targets identified in Tables 1-7. The targets can be genomic regions, fragments of genomic regions, mRNAs, proteins, fragments of mRNAs, fragments of proteins, etc.

[0036] In one aspect of this embodiment, the method comprises, obtaining a test sample from cells or tissue; determining the number of gene copies of one or more amplified or deleted genes chosen from Tables 1-7, per cell and comparing the number of gene copies per cell (for example, quantitatively and/or qualitatively) in the sample to a control sample or a known value, thereby determining whether one or more genes chosen from Tables 1-7 are amplified or deleted in the test sample. Amplification of one or more amplified genes and or deletion of one or more deleted genes chosen from Tables 1-7 can for example, indicate a cancer, a precancerous condition in the tissue, prognosis information, staging information, and information related to determining therapy. In one aspect of this embodiment, the method involves identifying a patient in need of analysis of one or more genes chosen from Tables 1-7 (e.g., a patient suspected of having a cancer in which the one or more amplified/deleted genes is amplified or deleted).

[0037] In another aspect of this embodiment, the present invention provides methods for characterizing a cancer. The method of this aspect can comprise (1) obtaining a test sample from cells or tissue, (2) obtaining a control sample from cells or tissue that is normal, and (3) detecting or measuring in both the test sample and the control sample the level of one or more mRNA transcripts corresponding to one or more genes listed in Tables 1-7. If the level of the one or more the target transcripts is higher in the test sample than that in the control sample, this gives important characterizing information regarding the test sample cells or tissue if the one or more target mRNAs correspond to those that are listed as amplified in Tables 1-7. If the Attorney Docket No. 3300-01-lWO

level of the one or more transcripts is lower in the test sample than that in the control sample, this gives important characterizing information regarding the test sample cells or tissue if the one or more target transcripts (mRNAs) correspond to those that are listed as deleted in Tables 1-7. In another aspect the control sample may be obtained from a different individual or be a normalized value based on baseline data obtained from a population. In one aspect of this embodiment, the method involves identifying a patient in need of analysis of one or more genes from Tables 1-7.

[0038] In yet another aspect of this embodiment, the method comprises, obtaining a test sample from cells or tissue; detecting the number of DNA copies of one or more genes from Tables 1-7 (e.g., per cell) in the sample; and comparing the number of DNA copies detected (for example, quantitatively and/or qualitatively) in the sample to a control sample or a known value, thereby determining whether the one or more genes is amplified and/or deleted in the test sample. In one aspect of this embodiment, the method involves identifying a patient in need of analysis of one or more genes from Tables 1 -7.

[0039] In yet another aspect of this embodiment, the method comprises (1) obtaining a test sample from cells or tissue; contacting the sample with an antibody to one or more expression products of one or more genes chosen from Tables 1-7, and detecting in the test sample, the level of expression of one or more genes from Tables 1-7, wherein an increased level (for amplified genes in Tables 1-7) or decreased level (for deleted genes in Tables 1-7) of the expression of one or more genes from Tables 1- 7 in the test sample, as compared to a control sample or a known value indicates a precancerous or a cancerous condition in the cells or tissue. In another aspect, the control sample may be obtained from a different individual or be a normalized value based on baseline data obtained from a population. Alternatively, a given level of one or more genes from Tables 1-7, representative of the cancer-free population, that has been previously established based on measurements from normal, cancer-free patients, can be used as a control. A control data point from a reference database, based on data obtained from control samples representative of a cancer-free population, also can be used as a control. In one aspect of this embodiment, the method involves identifying a patient in need of analysis of one or more genes from Tables 1-7. Attorney Docket No. 3300-01-lWO

[0040] In one embodiment of the invention, the amplified genes (and expressed protein products) listed in Tables 1-7 are drug targets. According to one aspect of this embodiment, one or more genes chosen from those listed in Tables 1-7 are targets in gene therapy, development of small molecule inhibitors, small interfering RNAs (siRNAs), microRNAs (miRNAs), and antisense nucleic acids.

[0041] The present invention also includes the production and use of antibodies, for example, monoclonal, polyclonal, single-chain and engineered antibodies (including humanized antibodies) and fragments, which specifically bind a protein chosen from those listed in Tables 1-7, particularly those that are amplified.

[0042] The invention also includes antagonists and inhibitors of one or more amplified proteins listed in Tables 1-7, that can inhibit one or more of the functions or activities of the protein. Suitable antagonists can include small molecules (molecular weight below about 500 Daltons), large molecules (molecular weight above about 500 Daltons), and antibodies (including fragments and single chain antibodies) that bind and interfere or neutralize the protein, polypeptides which compete with a native form of the protein for binding to another protein that naturally interacts with the protein, and nucleic acid molecules that interfere with transcription and/or translation of one or more genes listed in Tables 1-7 (for example, antisense nucleic acid molecules, triple helix forming molecules, ribozymes, microRNAs, and small interfering RNAs). The present invention also includes useful compounds that influence or attenuate one or more activities of one or more of the genes listed in Tables 1-7.

[0043] In addition, the present invention provides inhibitors of the activity of a protein expressed by one or more amplified genes listed in Tables 1-7, such as antibodies, that block the oncogenic function or anti-apoptotic activity of the protein.

[0044] Other inhibitors include antibodies that bind to a cell overexpressing a protein expressed by one or more amplified genes listed in Tables 1-7, thereby resulting in suppression or death of the cell.

[0045] The present invention further provides molecules that can decrease the expression of one or more amplified genes listed in Tables 1-7 by affecting transcription or translation. Small molecules (molecular weight below about 500 Daltons), large molecules (molecular weight above about 500 Daltons), and nucleic acid Attorney Docket No. 3300-01-lWO

molecules, for example, ribozymes, miRNAs, siRNAs and antisense molecules, including antisense RNA, antisense DNA or decoy molecules (e.g., Morishita et al., Ann. N Y Acad. Sci., 947:294-301 , 2001 ; Andratschke et al., Anticancer Res., 21 :(5)3541-3550, 2001), may all be utilized to inhibit the expression or amplification.

[0046] As mentioned above, the nucleic acid sequences of the amplified genes listed in Tables 1-7 also can be employed in an RNA interference context. The phenomenon of RNA interference is described and discussed in Bass, Nature, 411 :428- 29 (2001); Elbashir et al., Nature 41 1 : 494-98 (2001); and Fire et al., Nature, 391 :806- 11 (1998), where methods of making interfering RNA also are discussed. See the Examples.

[0047] In another aspect of this embodiment, the present invention provides methods for preventing, controlling, reversing, or suppressing cancer growth in cells or tissue. The method of this aspect can comprise administering an inhibitor of a protein {e.g., selected from those expressed by an amplified gene listed in Tables 1-7) to the tissue, thereby inhibiting protein activity. Such inhibitors can be, e.g., an antibody to one or more proteins listed in Tables 1-7 or polypeptide portions thereof or an antagonist of the protein.

[0048] In yet another aspect of this embodiment, the present invention provides a method for preventing, controlling, reversing, or suppressing cancer growth. The method of this embodiment of the invention can comprise administering to a tissue a nucleotide molecule that is capable of interacting with the DNA and/or RNA of one or more of the amplified genes listed in Tables 1-7, thereby blocking or interfering with the gene's function(s). Such nucleotide molecules can be an antisense nucleotide, a ribozyme, a small interfering RNA (siRNA), a microRNA (miRNA), or it may be a molecule capable of forming a triple helix with the gene.

[0049] In yet another embodiment, the present invention provides a method for modulating the activity of one or more proteins expressed by an amplified gene listed in Tables 1-7 by administering to a patient suspected of having cancer or at risk for developing cancer, a modulator of the protein, where the modulator is, for example, a small molecule. Attorney Docket No. 3300-01-lWO

[0050] In still another embodiment, the present invention provides a method for modulating the activity of a protein (or protein encoded by a gene) listed in Tables 1-7 by administering, to a patient suspected of having cancer or at risk for developing cancer, a modulator of the protein, wherein the modulator partially or completely inhibits transcription of the gene corresponding to the protein.

[0051] Another embodiment of the invention relates to a method of making a pharmaceutical composition comprising: identifying a compound which is an inhibitor of the activity of one or more amplified genes (and/or proteins) listed in Tables 1-7, including the oncogenic function or anti-apoptotic activity of gene (and/or protein); producing the compound; and optionally mixing the compound with suitable additives or other active agents.

[0052] Still another embodiment of the invention is to provide a pharmaceutical composition obtainable by the methods described herein, wherein the composition comprises an antibody that blocks the oncogenic function or anti-apoptotic activity of one or more genes (or their expression products) listed in Tables 1-7.

[0053] In another embodiment, the invention provides a pharmaceutical composition wherein the composition comprises an antibody that binds to a cell over- expressing one or more proteins listed in Tables 1-7 (e.g., protein expression product of an amplified gene), thereby resulting in death or silencing of the cell.

[0054] In yet another embodiment, the invention provides a pharmaceutical composition wherein the composition comprises a polypeptide or a fragment or a mutant thereof derived from one or more proteins in Tables 1-7, where the polypeptide has inhibitory activity that blocks or inhibits the oncogenic function or anti-apoptotic activity of the protein.

[0055] In still a further embodiment, the invention provides methods for inducing an immune response in a mammal comprising contacting the mammal with a polypeptide or polynucleotide (e.g., from Tables 1-7), or a fragment thereof, where the immune response produces antibodies and/or T cell immune response to protect the mammal from cancers.

[0056] Another embodiment of the invention is to provide methods of administering siRNA to a patient in need thereof, where the siRNA molecule is Attorney Docket No. 3300-01-lWO

delivered in the form of a naked oligonucleotide, sense molecule, antisense molecule, and/or in a vector, where the siRNA interacts with an amplified gene from Tables 1-7 or its transcripts, wherein the vector is a plasmid, cosmid, bacteriophage, or a virus, where the virus is, for example, a retrovirus, an adenovirus, or other suitable viral vector.

[0057] Another embodiment of the invention is to provide methods of administering miRNA to a patient in need thereof, wherein the miRNA molecule is delivered in the form of a naked oligonucleotide, sense molecule, antisense molecule, and/or in a vector, where the miRNA interacts with an amplified gene from Tables 1-7 or their transcripts, where the vector is a plasmid, cosmid, bacteriophage, or a virus, wherein the virus is for example, a retrovirus, an adenovirus, or other suitable viral vector.

[0058] Still in another embodiment, the invention provides methods of administering a decoy molecule to a patient in need thereof, wherein the molecule is delivered in the form of a naked oligonucleotide, sense molecule, antisense molecule, a decoy DNA molecule, and/or in a vector, wherein the molecule interacts with a gene from Tables 1-7, where the vector is a plasmid, cosmid, bacteriophage, or a virus, where the virus is for example, a retrovirus, an adenovirus, or other suitable viral vector.

[0059] In still a further embodiment of the invention, decoys, antisense, triple helix forming molecules, and ribozymes directed to one or more amplified genes listed in Tables 1-7 can be administered concurrently or consecutively in any proportion; for example, two of the above can be administered concurrently or consecutively in any proportion; or they can be administered singly (that is, decoys, triple helix forming molecules, antisense or ribozymes). Additionally, decoys, triple helix forming molecules, antisense, and ribozymes having different sequences but directed against a given target (that is, an amplified gene from Tables 1-7) can be administered concurrently or consecutively in any proportion, including equimolar proportions. Thus, as is apparent to the skilled person in view of the teachings herein, one could choose to administer one decoy molecule, triple helix forming molecule, antisense and/or ribozyme, and/or two different decoys, triple helix forming molecules, antisense and/or ribozymes, and/or three different decoys, triple helix forming molecules, Attorney Docket No. 3300-01-lWO

antisense and/or ribozymes in any proportion, including equimolar proportions, for example. Of course, other permutations and proportions can be employed by the person skilled in the art.

[0060] Still in another embodiment, the invention provides methods of administering siRNA and/or shRNA and/or miRNA targeted to one or more of the amplified genes listed in Tables 1-7, to a patient in need thereof, where one or more of the above siRNA and/or shRNA and/or miRNA molecules are delivered in the form of a naked oligonucleotide, sense molecule, antisense molecule or a vector, wherein the siRNA(s) and/or shRNA(s) and/or miRNA(s) interact(s) with the activity of the gene, wherein the vector is a plasmid, cosmid, bacteriophage or a virus, wherein the virus is, for example, a retrovirus, an adenovirus, a poxvirus, a herpes virus or other suitable viral vector. In other words, siRNAs and/or shRNAs and/or miRNAs can be administered concurrently or consecutively in any proportion; only two of the above can be administered concurrently or consecutively in any proportion; or they can be administered singly (that is, siRNAs or shRNAs or miRNAs targeting one or more of the amplified genes listed in Tables 1-7). Additionally, siRNAs or shRNAs or miRNAs having different sequences but directed against a given target (that is, one or more genes in Tables 1-7) can be administered concurrently or consecutively in any proportion, including equimolar proportions. Thus, as is apparent to the skilled person in view of the teachings herein, one could choose to administer one siRNA or shRNA or miRNA and/or two different siRNAs or shRNAs or miRNAs and/or three or more different siRNAs or shRNAs or miRNAs in any proportion, including equimolar proportions, for example. Of course, other permutations and proportions can be employed by the person skilled in the art. Additionally, siRNAs or shRNAs or miRNAs can be employed together with one or more of decoys, triple helix forming molecules, antisense, ribozymes, and other functional molecules.

[0061] In another embodiment, the present invention provides methods of blocking in vivo expression of a gene by administering a vector containing siRNA or shRNA or miRNA, directed to one or more of the amplified genes in Tables 1-7, wherein the siRNA and/or shRNA and/or miRNA interacts with the activity of the gene and wherein the siRNA and/or shRNA and/or miRNA causes post-transcriptional Attorney Docket No. 3300-01-lWO

silencing of the gene, or inhibits translation of RNA into protein, in a mammalian cell, for example, a human cell.

[0062] Yet, in another embodiment, the present invention provides methods of treating cells ex vivo by administering a vector as described herein, wherein the vector is a plasmid, cosmid, bacteriophage, or a virus, such as a retrovirus or an adenovirus.

[0063] In its in vivo or ex vivo therapeutic applications, it is appropriate to administer siRNA and/or shRNA and/or miRNA using a viral or retroviral vector which enters the cell by transfection or infection. In particular, as a therapeutic product according to the invention, a vector can be a defective viral vector such as an adenovirus or a defective retroviral vector such as a murine retrovirus.

[0064] Another embodiment of the invention provides methods of screening or validating the potency of a molecule for antagonist activity of one or more amplified genes in Tables 1-7, comprising the steps of: contacting or exposing a cell (e.g., cancer cell) with the molecule; determining the level of the one or more genes in the cell, thereby generating data for a test level; and comparing the test level to the level of gene in the cell prior to contacting or exposing the molecule (initial or pre-exposed level), wherein a decrease in the one or more genes in the test level indicates antagonist activity of the molecule. The gene level can be determined by any method available to the skilled artisan. In one aspect, the level of the gene can be determined by, reverse transcription and polymerase chain reaction (RT-PCR), Northern hybridization, or microarray analysis.

[0065] In another embodiment, the invention provides methods of screening for a molecule with antagonist activity against one or more of the amplified genes listed in Tables 1-7 comprising the steps of: contacting or exposing the molecule to one or more genes (and/or proteins) in Tables 1-7 and determining the effect of the molecule on the gene. The gene level can be determined by any method available to the skilled artisan. The effect of the molecule on gene can be determined via a binding assay or other appropriate assays, including RT-PCR, quantitative PCR, Northern hybridization, microarray analysis, two-hybrid assays (such as GAL4 DNA binding domain based assays), EIA, blot assays, sandwich assays, and the like. Attorney Docket No. 3300-01-lWO

[0066] In another embodiment, the invention provides methods of determining whether a molecule has antagonist activity against one or more of the amplified genes listed in Tables 1-7. The method can comprise (1) determining the level of the gene in a test sample to generate data for an initial level, (2) contacting a molecule (test compound) with the test sample to obtain a test level; and comparing the initial level to the test level. A statistically significant decrease in the gene in the test level compared to the initial level indicates the molecule has antagonist activity against that gene.

[0067] In another embodiment, the invention provides methods for selecting a molecule having antagonist activity against one or more amplified genes in Tables 1-7. The method can comprise (1) determining the level of the gene in a test sample to give an initial level; contacting the molecule with the test sample to obtain a test level; comparing the initial level to the test level. A statistically significant decrease in the gene in the test level compared to the initial level indicates the molecule has antagonist activity against the gene.

[0068] In another aspect, the invention provides a method for screening for a molecule having antagonist activity against a gene. The method can comprise contacting a test sample with a molecule; determining the level of mRNA transcripts corresponding to the gene per cell (e.g., by determining the overall level divided by the number of cells present in the sample) thereby generating data for a test level; and comparing the test level to the expression level of the gene's mRNA transcripts per cell, for example, prior to contacting the molecule (initial level), wherein a decrease in expression of the gene in the test level indicates antagonist activity of the molecule. The expression level of the gene can be determined by, e.g., binding assays or other appropriate assays, including RT-PCR, quantitative PCR, Northern hybridization, microarray analysis, two-hybrid assays such as GAL4 DNA binding domain based assays, EIA, blot assays, sandwich assays, and the like.

[0069] In another aspect, the invention provides a method for determining antagonist activity against one or more of the amplified genes in Tables 1-7, comprising (1) determining the mRNA expression level of the gene in a test sample, thereby giving an initial or a pre-test level expression of mRNA; (2) contacting the test sample with a test compound; determining the level of mRNA transcripts corresponding to the gene Attorney Docket No. 3300-01-lWO

per cell (e.g., by determining the overall level divided by the number of cells present in the sample) giving a test level; and (3) comparing the test level to the initial or pre-test level expression of mRNA transcripts per cell. A decrease in expression of mRNA corresponding to the gene in the test level indicates antagonist activity of the molecule. The gene level can be determined by any method available to the skilled artisan. In a particular aspect, the expression level of the gene can be determined by, for example, binding assays or other appropriate assays, including RT-PCR, quantitative PCR, Northern hybridization, microarray analysis, two-hybrid assays such as GAL4 DNA binding domain based assays, blot assays, sandwich assays, and the like.

[0070] In one aspect of this embodiment, the present invention relates to methods for comparing and compiling data wherein the data is stored in electronic or paper format. Electronic format can be selected from the group consisting of electronic mail, disk, compact disk (CD), digital versatile disk (DVD), memory card, memory chip, ROM or RAM, magnetic optical disk, tape, video, video clip, microfilm, internet, shared network, shared server and the like; wherein data is displayed, transmitted or analyzed via electronic transmission, video display, telecommunication, or by using any of the above stored formats; wherein data is compared and compiled at the site of sampling specimens or at a location where the data is transported following a process as described above. The data of this embodiment is information regarding the results of the analysis of one or more genes from Tables 1-7.

[0071] In one embodiment of the invention, the present invention provides methods for determining the efficacy (e.g., potency) of a therapeutic treatment regimen. The method of this embodiment can comprise obtaining a first sample from the patient to obtain a pre-treatment level; administering the treatment regimen to the patient; obtaining a second sample from the patient after a time period to obtain a test level; and detecting in both the first and the second samples the level of mRNA transcripts corresponding to one or more amplified genes from Tables 1 -7, wherein a level of the transcripts that is lower in the second sample (test level) than that in the first sample (pre-treatment level) indicates that the treatment regimen is effective in the patient.

[0072] In another aspect of this embodiment, the present invention provides methods for determining the efficacy, such as potency, of a compound to suppress a Attorney Docket No. 3300-01-lWO

cancer. The method of this aspect can comprise obtaining a first sample from the patient to obtain a pre-treatment level; administering the treatment regimen to the patient; obtaining a second sample from the patient after a time period to obtain a test level; and detecting in both the first and the second samples the level of mRNA transcripts corresponding to one or more amplified genes from Tables 1-7, wherein a level of the transcripts that is lower in the second sample (test level) than that in the first sample (pre-treatment level) indicates that the compound is effective to suppress such a cancer or a precancerous condition.

[0073] In another aspect of this embodiment, the present invention provides methods for determining the efficacy (e.g., potency) of a therapeutic treatment regimen for treating a cancer. The method of this aspect can comprise obtaining a first sample from the patient to obtain a pre-treatment level; administering the treatment regimen to the patient; obtaining a second sample from the patient after a time period to obtain a test level; and detecting in both the first and the second samples the number of DNA copies corresponding to one or more amplified genes from Tables 1-7 per cell, for example, thereby determining the overall or average gene amplification state (corresponding to one or more genes from Tables 1-7) in the first and second samples. A lower number of DNA copies per cell (corresponding to one or more genes from Tables 1-7), or average, for example, in the second sample (test level) compared to that in the first sample (pre-treatment level) indicates that the treatment regimen is effective.

[0074] In yet another aspect of this embodiment, the present invention provides methods for determining the efficacy, (e.g., potency), of a therapeutic treatment regimen for treating a cancer. The method of this aspect can comprise obtaining a first sample from the patient to obtain a pre-treatment level; administering the treatment regimen to the patient; obtaining a second sample from the patient after a time period to obtain a test level; contacting the samples with an antibody to the expression product of one or more amplified genes from Tables 1-7, and detecting the level of expression (of one or more genes from Tables 1-7) in both the first and the second samples. A lower level of expression in the second sample (test level) Attorney Docket No. 3300-01-lWO

compared to the level in the first sample (pre-treatment level) indicates that the treatment regimen is effective in the patient.

[0075] In another aspect of this embodiment, the invention provides methods for determining the efficacy of a therapeutic treatment regimen for treating a cancer. The method of this aspect comprises the steps of: obtaining a first sample from the patient to obtain a pre-treatment level; administering the treatment regimen to the patient; obtaining a second sample from the patient after a time period to obtain a test level; determining the expression level of one or more amplified genes from Tables 1-7, in both the first and the second samples, by determining the overall expression divided by the number of cells present in each sample; and comparing the expression level of one or more genes from Tables 1-7 in the first and the second samples. A lower level of expression in the second sample (test level) as compared to that in the first sample (pre-treatment level) indicates that the treatment regimen is effective in the patient. In one aspect of this embodiment the expression level is determined by a method chosen from a binding assay, reverse transcription and polymerase chain reaction (RT-PCR), quantitative PCR, Northern hybridization, microarray analysis, enzyme immunoassay (EIA), two-hybrid assay, blot assay, and sandwich assay.

[0076] In still another aspect of this embodiment, the present invention provides methods for determining the efficacy of a compound to suppress a cancer. The method of this aspect can comprise obtaining a first sample from the patient to obtain a pre-treatment level; administering the treatment regimen to the patient; obtaining a second sample from the patient after a time period to obtain a test level; and detecting in both the first and the second samples the number (e.g., average) of DNA copies of one or more amplified genes from Tables 1-7 per cell, for example, thereby determining the gene amplification state in the first and second samples. A lower number of DNA copies per cell (or average) in the second sample (test level) as compared to the level in the first sample (pre-treatment level) indicates that the compound is effective.

[0077] In another aspect of this embodiment, the method can comprise obtaining a first sample from the patient to obtain a pre-treatment level; administering the treatment regimen to the patient; obtaining a second sample from the patient after a Attorney Docket No. 3300-01-lWO

time period to obtain a test level; and detecting in both the first and the second samples the level of mRNA transcripts corresponding to one or more amplified genes from Tables 1-7. A level of the transcripts that is lower in the second sample (test level) as compared to the level in the first sample (pre-treatment level) indicates that the treatment regimen is effective in the patient.

[0078] In another aspect of this embodiment, the method can comprise obtaining a first sample from a patient to obtain a pre-treatment level; administering the treatment regimen to the patient; obtaining a second sample from the patient after a time period to obtain a test level; determining in both the first and the second samples the level of mRNA transcripts corresponding to one or more amplified genes from Tables 1-7, (e.g., by determining the overall level divided by the number of cells present in each sample); and comparing the level of mRNA transcripts corresponding to one or more genes from Tables 1-7 in the first and the second samples. A lower level of the mRNA transcripts in the second sample (test level) than that in the first sample (pre-treatment level) indicates that the treatment regimen is effective in the patient. In some aspects, the levels of one or more genes from Tables 1-7 can be determined by a method chosen from a binding assay, RT-PCR, quantitative PCR, Northern hybridization, microarray analysis, two-hybrid assay, blot assay, and sandwich assay.

[0079] In another aspect of this embodiment, the method can comprise obtaining a first sample from the patient to obtain a pre-treatment level; administering the treatment regimen to the patient; obtaining a second sample from the patient after a time period to obtain a test level; and detecting in both the first and the second samples the level of transcripts corresponding to one or more amplified genes from Tables 1-7. A level of transcripts that is lower in the second sample (test level) than the level in the first sample (pre-treatment level) indicates that the compound is effective to suppress such a cancer or a precancerous condition.

[0080] In another aspect, the method can comprise obtaining a first sample from the patient to obtain a pre-treatment level; administering the treatment regimen to the patient; obtaining a second sample from the patient after a time period to obtain a test level; and detecting in both the first and the second samples the number (e.g., average) of DNA copies per cell (corresponding to one or more genes from Tables 1-7), Attorney Docket No. 3300-01-lWO

thereby determining the overall or average gene amplification state (of one or more genes from Tables 1-7) in the first and second samples. A lower number of DNA copies per cell (or average) in the second sample (test level) as compared to that in the first sample (pre-treatment level) indicates that the treatment regimen is effective.

[0081] In yet another aspect, the method can comprise obtaining a first sample from the patient to obtain a pre-treatment level; administering the treatment regimen to the patient; obtaining a second sample from the patient after a time period to obtain a test level; contacting the samples with one or more antibodies to one or more expression products of the amplified genes listed in Tables 1-7, and detecting the level of expression in both the first and the second samples. A lower level of expression in the second sample (test level) as compared to the level in the first sample (pre-treatment level) indicates that the treatment regimen is effective in the patient.

[0082] In another aspect, the method can comprise the steps of: obtaining a first sample from the patient to obtain a pre-treatment level; administering the treatment regimen to the patient; obtaining a second sample from the patient after a time period to obtain a test level; determining the level of expression of one or more amplified genes from Tables 1-7 in both the first and the second samples by determining the overall expression divided by the number of cells present in each sample; and comparing the expression level of in the first and the second samples. A lower level of the expression in the second sample (test level) as compared to that in the first sample (pre-treatment level) indicates that the treatment regimen is effective in the patient. The expression level can be determined by a method chosen from a binding assay, RT-PCR, quantitative PCR, Northern hybridization, microarray analysis, two-hybrid assay, EIA, blot assay, and sandwich assay.

[0083] In still another aspect, the method of can comprise obtaining a first sample from the patient to obtain a pre-treatment level; administering the treatment regimen to the patient; obtaining a second sample from the patient after a time period to obtain a test level; and detecting in both the first and the second samples the number (e.g., average) copies of one or more amplified genes from Tables 1-7 per cell, thereby determining the gene amplification state in the first and second samples. A lower number of DNA copies (corresponding to one or more genes from Tables 1-7) per cell Attorney Docket No. 3300-01-lWO

(or average) for example, in the second sample (test level) as compared to that in the first sample (pre-treatment level) indicates that the compound is effective.

[0084] One aspect of the invention provides methods for diagnosing or predicting cancer or cancer potential and/or monitoring the efficacy, such as potency, of a cancer therapy by using an isolated gene amplicon corresponding to a gene chosen from those listed in Tables 1 -7. The method of this aspect comprises obtaining a test sample from cells or tissue; obtaining a control sample from cells or tissue that is normal; and detecting in both the test sample and the control sample the presence and extent of gene amplicons corresponding to one or more amplified genes from Tables 1- 7. A level of amplification higher in the test sample than that in the control sample indicates a precancerous or cancerous condition in the tissue. In one aspect, a control sample can be obtained from a biological subject representative of healthy, cancer-free animals. In another aspect, the control may be obtained from a different individual or be a normalized value based on baseline data obtained from a population.

[0085] Another embodiment of the invention provides an isolated gene amplicon of one or more genes from Tables 1-7, wherein the amplicon comprises a completely or partially amplified product of one or more genes from Tables 1-7, including a polynucleotide having at least about 90% sequence identity to the gene.

[0086] In another embodiment, the invention provides methods for determining the level of one or more genes from Tables 1-7 in a test sample for diagnosis of a cancer. The method can comprise obtaining a control sample; obtaining a test sample from the patient; contacting both the control and the test samples with one or more antibodies to one or more expression products of one or more genes chosen from Tables 1-7; determining the level the one or more genes from Tables 1-7 in both the control and the test samples (by, e.g., determining the overall level of the gene divided by the number of cells present in each sample); and comparing the level of one or more genes from Tables 1-7 in the control and the test samples. A higher level (for amplified genes) and/or lower level (for deleted genes) in the test sample obtained from the patient than that in the control sample indicates a cancer or a precancerous condition. The gene levels can be determined via binding assays or other appropriate assays, including RT-PCR, quantitative PCR, Northern hybridization, microarray Attorney Docket No. 3300-01-lWO

analysis, two-hybrid assays such as GAL4 DNA binding domain based assays, EIA, blot assays, sandwich assays, and the like. Alternatively, a given level of one or more genes, representative of the cancer-free population, that has been previously established based on measurements from normal, cancer-free individuals, can be used as a control. A control data point from a reference database, based on data obtained from control samples representative of a cancer-free population, also can be used as a control.

[0087] In another embodiment, the invention provides a method for determining the efficacy of a therapeutic treatment regimen in a patient. The method can comprise measuring at least one of mRNA or protein expression levels of one or more amplified genes from Tables 1-7, in a first sample obtained from the patient, thereby giving a pre-treatment level; administering the treatment regimen to the patient; measuring at least one of mRNA or protein expression levels of one or more amplified genes from Tables 1-7 in a second sample from the patient at a time following administration of the treatment regimen (test level); and comparing at least one of mRNA or protein expression levels of one or more genes from Tables 1-7 in the first and the second samples. No statistically significant decrease in the levels in the second sample relative to the first sample indicates that the treatment regimen is not effective in the patient.

[0088] In another embodiment, the invention provides methods for selecting a test molecule that has a therapeutic effect in a patient. The method can comprise measuring at least one of mRNA or protein expression levels of one or more amplified genes from Tables 1-7 in a first sample obtained from a patient to give a pre-treatment level; administering the test molecule to the patient; measuring at least one of mRNA or protein expression levels of one or more amplified genes from Tables 1-7 in a second sample from the patient at a time following administration of the test molecule, thereby giving a test level; and comparing at least one of mRNA or protein expression level of one or more genes from Tables 1-7 in the first and the second samples. No statistically significant decrease in the level in the second sample (test level) relative to the first sample (pre-treatment level) indicates that the test molecule is not effective in the patient. Attorney Docket No. 3300-01-lWO

[0089] In one embodiment the invention provides a method of selecting a therapeutic treatment based on the status of one or more genes listed in Tables 1-7. The method of this embodiment involves identifying a patient in need of treatment, determining in a cancer cell or cancerous tissue the status of one or more genes from Tables 1-7, and selecting a therapeutic based, at-least in part, on the status (amplification and/or deletion) of the one or more genes from Tables 1-7.

[0090] Samples can be obtained from the same region or a different region of a subject. Typically, samples are taken in regions that are similar in terms of organ or tissue type and location in order to minimize variables.

[0091] The compounds, targets, assays, tests, inquiries and methodologies described herein can be employed in a variety of contexts, including diagnostic and therapeutic discovery, diagnostic and therapeutic development, safety and efficacy monitoring, compound and treatment regimen potency determination and validation, treatment assessment, comparative studies, marketing and the like. The information provided by the invention can be communicated to regulators, physicians and other healthcare providers, manufacturers, owners, investors, patients, and/or the general public. This information and the like can be used in exploratory research, pre-clinical and clinical settings, labeling, production, advertising, and sales, for example.

[0092] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0093] Other features and advantages of the invention will be apparent from the following detailed description, and from the claims. Attorney Docket No. 3300-01-lWO

DETAILED DESCRIPTION OF THE INVENTION

[0094] The present invention is based on the discovery of a number of amplified and deleted in genes (and/or genomic regions) in cancers particularly those summarized in Tables 1-7 below.

[0095] In one aspect, the present invention provides a method for characterizing a patient's cancer for prognostic, diagnostic and/or pharmacogenomic uses. Characterization of the patient's cancer according to analysis of one or more targets described in Tables 1-7 below can be used to provide information regarding disease progression, cancer predisposition, staging, diagnosis of cancer type (and/or subtype), and selection of an appropriate therapeutic treatment. The individual to be tested can be a healthy person or an individual diagnosed with cancer. The method comprises the step of determining the DNA copy number at one or more of the targets identified in the present invention (e.g., Tables 1-7). Alternative methods for determining alterations in the biomarker targets of the invention can be used including, but not limited to, immunohistochemistry (IHC), mRNA expression, and protein expression analysis.

[0096] Definitions

[0097] A "cancer" in an animal refers to the presence of cells possessing characteristics typical of cancer-causing cells, for example, uncontrolled proliferation, loss of specialized functions, immortality, significant metastatic potential, significant increase in anti-apoptotic activity, rapid growth and proliferation rate, and certain characteristic morphology and cellular markers. In some-circumstances, cancer cells will be in the form of a tumor; such cells may exist locally within an animal, or circulate in the blood stream as independent cells, for example, leukemic cells.

[0098] The phrase "detecting a cancer" or "diagnosing a cancer" refers to determining the presence or absence of cancer or a precancerous condition in an animal. "Detecting a cancer" also can refer to obtaining indirect evidence regarding the likelihood of the presence of precancerous or cancerous cells in the animal or assessing the predisposition of a patient to the development of a cancer. Detecting a cancer can Attorney Docket No. 3300-01-lWO

be accomplished using the methods of this invention alone, in combination with other methods, or in light of other information regarding the state of health of the animal.

[0099] A "tumor," as used herein, refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all precancerous and cancerous cells and tissues.

[00100] The term "precancerous" refers to cells or tissues having characteristics relating to changes that may lead to malignancy or cancer. Examples include adenomatous growths in breast, colon, lung, brain, or ovarian, tissues, or conditions, for example, dysplastic nevus syndrome, a precursor to malignant melanoma of the skin. Examples also include, abnormal neoplastic, in addition to dysplastic nevus syndromes, polyposis syndromes, prostatic dysplasia, and other such neoplasms, whether the precancerous lesions are clinically identifiable or not.

[00101] A "differentially expressed gene transcript", as used herein, refers to a gene, including an oncogene, transcript that is found in different numbers of copies in different cell or tissue types of an organism having a tumor or cancer, for example, a breast cancer, a colon cancer, a prostate cancer, a lung cancer, a brain cancer, or an ovarian cancer, compared to the numbers of copies or state of the gene transcript found in the cells of the same tissue in a healthy organism, or in the cells of the same tissue in the same organism. Multiple copies of gene transcripts may be found in an organism having the tumor or cancer, while fewer copies of the same gene transcript are found in a healthy organism or healthy cells of the same tissue in the same organism, or vice- versa.

[00102] A "differentially expressed gene," can be a target (amplified or deleted gene), fingerprint, or pathway gene. For example, a "fingerprint gene", as used herein, refers to a differentially expressed gene whose expression pattern can be used as a prognostic or diagnostic marker for the evaluation of tumors and cancers, or which can be used to identify compounds useful for the treatment of tumors and cancers, for example, breast cancer, colon cancer, lung cancer, brain cancer, or ovarian cancer. For example, the effect of a compound on the fingerprint gene expression pattern normally displayed in connection with tumors and cancers can be used to evaluate the efficacy of the compound as a tumor and cancer treatment, or can be used to monitor patients Attorney Docket No. 3300-01-lWO

undergoing clinical evaluation for the treatment of tumors and cancer. Fingerprint genes can be one or more of those listed in Tables 1-7.

[00103] A "fingerprint pattern" or "profile", as used herein, refers to a pattern generated when the copy number or expression pattern of a series of targets (which can range from two up to all the fingerprint targets that exist for a given state) is determined. A fingerprint pattern also may be referred to as a "profile". A fingerprint pattern or profile can be used in the same diagnostic, prognostic, and compound identification methods as the expression of a single fingerprint target. In some aspects, the fingerprint pattern comprises five or more targets. In other aspects the fingerprint pattern comprises 10 or more, 20 or more, 30 or more, 40 or more, 50 or more, 60 or more, 70 or more, 80 or more, 90 or more, or 100 or more targets.

[00104] A "target", as used herein, refers to any direct or indirect biomarker corresponding to those regions, genes, mRNAs and proteins listed in Tables 1-7.

[00105] In general, a "gene" is a region on the genome that is capable of being transcribed to an RNA that either has a regulatory function, a catalytic function, and/or encodes a protein. An eukaryotic gene typically has introns and exons, which may organize to produce different RNA splice variants that encode alternative versions of a mature protein. The skilled artisan will appreciate that the present invention encompasses all encoding transcripts that may be found, including splice variants, allelic variants and transcripts that occur because of alternative promoter sites or alternative poly-adenylation sites of the gene listed in Tables 1-7. A "full-length" gene or RNA therefore encompasses any naturally occurring splice variants, allelic variants, other alternative transcripts, splice variants generated by recombinant technologies which bear the same function as the naturally occurring variants, and the resulting RNA molecules. A "fragment" of a gene, including an oncogene, can be any portion from the gene, which may or may not represent a functional domain, for example, a catalytic domain, a DNA binding domain, etc. A fragment may preferably include nucleotide sequences that encode for at least 25 contiguous amino acids, and preferably at least about 30, 40, 50, 60, 65, 70, 75 or more contiguous amino acids or any integer thereabout or therebetween. In some aspects of the invention, the skilled artisan recognizes that the term gene is used interchangeably with the term "locus", which Attorney Docket No. 3300-01-lWO

refers more generically to a region of genomic DNA regardless if it codes for RNA, protein, or a regulatory element. For example, some of the amplified and deleted regions listed in Tables 1-7 encompass a locus rather than genes.

[00106] "Pathway genes", as used herein, are genes that encode proteins or polypeptides that interact with other gene products involved in tumors and cancers. Pathway genes also can exhibit target gene and/or fingerprint gene characteristics.

[00107] A "detectable" RNA expression level, as used herein, means a level that is detectable by standard techniques currently known in the art or those that become standard at some future time, and include for example, differential display, RT (reverse transcriptase)-coupled polymerase chain reaction (PCR), Northern Blot, and/or RNase protection analyses. The degree of differences in expression levels need only be large enough to be visualized or measured via standard characterization techniques.

[00108] As used herein, the term "transformed cell" means a cell into which (or into predecessor or an ancestor of which) a nucleic acid molecule encoding a polypeptide of the invention has been introduced, by means of, for example, recombinant DNA techniques or viruses.

[00109] The nucleic acid molecules of the invention, for example, those listed in Tables 1-7, and their subsequences, can be inserted into a vector, as described below, which will facilitate expression of the insert. The nucleic acid molecules and the polypeptides they encode can be used directly as diagnostic or therapeutic agents, or can be used (directly in the case of the polypeptide or indirectly in the case of a nucleic acid molecule) to generate antibodies that, in turn, are clinically useful as a therapeutic or diagnostic agent. Accordingly, vectors containing the nucleic acids of the invention, cells transfected with these vectors, the polypeptides expressed, and antibodies generated against either the entire polypeptide or an antigenic fragment thereof, are among the aspects of the invention.

[00110] A "structural gene" is a DNA sequence that is transcribed into messenger RNA (mRNA) which is then translated into a sequence of amino acids characteristic of a specific polypeptide.

[00111] An "isolated DNA molecule" is a fragment of DNA that has been separated from the chromosomal or genomic DNA of an organism. Isolation also is Attorney Docket No. 3300-01-lWO

defined to connote a degree of separation from original source or surroundings. For example, a cloned DNA molecule encoding an avidin gene is an isolated DNA molecule. Another example of an isolated DNA molecule is a chemically-synthesized DNA molecule, or enzymatically-produced cDNA, that is not integrated in the genomic DNA of an organism. Isolated DNA molecules can be subjected to procedures known in the art to remove contaminants such that the DNA molecule is considered purified, that is, towards a more homogeneous state.

[00112] "Complementary DNA" (cDNA), often referred to as "copy DNA", is a single-stranded DNA molecule that is formed from an mRNA template by the enzyme reverse transcriptase. Typically, a primer complementary to portions of the mRNA is employed for the initiation of reverse transcription. Those skilled in the art also use the term "cDNA" to refer to a double-stranded DNA molecule that comprises such a single-stranded DNA molecule and its complement DNA strand.

[00113] The term "expression" refers to the biosynthesis of a gene product. For example, in the case of a structural gene, expression involves transcription of the structural gene into mRNA and the translation of mRNA into one or more polypeptides.

[00114] The term "amplification" refers to amplification, duplication, multiplication, or multiple expression of nucleic acids or a gene, in vivo, ex-vivo, or in vitro, yielding about 2.5 fold or more copies. For example, amplification, a particular gene resulting in a copy number greater than or equal to 2.5 is deemed to have been amplified. However, an increase in gene copy number less than 2.5 fold can still be considered as an amplification of the gene.

[00115] The term "amplicon" refers to an amplification product containing one or more genes, which can be isolated from a precancerous or a cancerous cell or a tissue. "Amplicon", as defined herein, also includes a completely or partially amplified gene (or genes) as listed in Tables 1-7.

[00116] A "cloning vector" is a nucleic acid molecule, for example, a plasmid, cosmid or bacteriophage that has the capability of replicating autonomously in a host cell. Cloning vectors typically contain (i) one or a small number of restriction endonuclease recognition sites at which foreign DNA sequences can be inserted in a determinable fashion without loss of an essential biological function of the vector, and Attorney Docket No. 3300-01-lWO

(ii) a marker gene that is suitable for use in the identification and selection of cells transformed or transfected with the cloning vector. Marker genes include genes that provide tetracycline resistance or ampicillin resistance, for example.

[00117] An "expression vector" is a nucleic acid construct, generated recombinantly or synthetically, bearing a series of specified nucleic acid elements that enable transcription of a particular gene in a host cell. Typically, gene expression is placed under the control of certain regulatory elements, including constitutive or inducible promoters, tissue-preferred regulatory elements, and enhancers.

[00118] A "recombinant host" may be any prokaryotic or eukaryotic cell that contains either a cloning vector or expression vector. This term also includes those prokaryotic or eukaryotic cells that have been genetically engineered to contain the cloned gene(s) in the chromosome or genome of the host cell.

[00119] "Antisense RNA" - in eukaryotes, RNA polymerase catalyzes the transcription of a structural gene to produce mRNA. A DNA molecule can be designed to contain an RNA polymerase template in which the RNA transcript has a sequence that is complementary to that of a preferred mRNA. The RNA transcript is termed an "antisense RNA". Antisense RNA molecules can inhibit mRNA expression (for example, Rylova et al., Cancer Res, 62(3):801-8, 2002; Shim et al., Int. J. Cancer, 94(l):6-15,2001).

[00120] "Antisense DNA" or "DNA decoy" or "decoy molecule" - with respect to a first nucleic acid molecule, a second DNA molecule or a second chimeric nucleic acid molecule that is created with a sequence which is a complementary sequence or homologous to the complementary sequence of the first molecule or portions thereof, is referred to as the "antisense DNA" or "DNA decoy" or "decoy molecule" of the first molecule. The term "decoy molecule" also includes a nucleic acid molecule, which may be single or double stranded, that comprises DNA or PNA (peptide nucleic acid) (Mischiati et al., Int. J MoI. Med., 9(6):633-9, 2002), and that contains a sequence of a protein binding site, preferably a binding site for a regulatory protein and more preferably a binding site for a transcription factor. Applications of antisense nucleic acid molecules, including antisense DNA and decoy DNA molecules are known in the art, for example, Morishita et al., Ann. NY Acad. Sci., 947:294-301 , 2001 ; Andratschke Attorney Docket No. 3300-01-lWO

et al., Anticancer Res, 21 :(5)3541-3550, 2001. Antisense DNA or PNA molecules can inhibit, block, or regulate function and/or expression of a target gene. Antisense and decoys can have different sequences, but can be directed against a target gene and can be administered concurrently or consecutively in any proportion, including equimolar proportions.

[00121] The term "operably linked" is used to describe the connection between regulatory elements and a gene or its coding region. That is, gene expression is typically placed under the control of certain regulatory elements, including constitutive or inducible promoters, tissue-specific regulatory elements, and enhancers. Such a gene or coding region is said to be "operably linked to" or "operatively linked to" or "operably associated with" the regulatory elements, meaning that the gene or coding region is controlled or influenced by the regulatory element.

[00122] "Sequence homology" is used to describe the sequence relationships between two or more nucleic acids, polynucleotides, proteins, or polypeptides, and is understood in the context of and in conjunction with the terms including: (a) reference sequence, (b) comparison window, (c) sequence identity, (d) percentage of sequence identity, and (e) substantial identity or "homologous."

[00123] A "reference sequence" is a defined sequence used as a basis for sequence comparison. A reference sequence may be a subset of or the entirety of a specified sequence; for example, a segment of a full-length cDNA or gene sequence, or the complete cDNA or gene sequence. For polypeptides, the length of the reference polypeptide sequence will generally be at least about 16 amino acids, preferably at least about 20 amino acids, more preferably at least about 25 amino acids, and even more preferably about 35 amino acids, about 50 amino acids, or about 100 amino acids. For nucleic acids, the length of the reference nucleic acid sequence will generally be at least about 50 nucleotides, preferably at least about 60 nucleotides, more preferably at least about 75 nucleotides, and even more preferably about 100 nucleotides or about 300 nucleotides or any integer thereabout or therebetween.

[00124] A "comparison window" includes reference to a contiguous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence may be compared to a reference sequence and wherein the portion of the polynucleotide Attorney Docket No. 3300-01-lWO

sequence in the comparison window may comprise additions, substitutions, or deletions (i.e., gaps) compared to the reference sequence (which does not comprise additions, substitutions, or deletions) for optimal alignment of the two sequences. Generally, the comparison window is at least 20 contiguous nucleotides in length, and optionally can be 30, 40, 50, 100, or longer. Those of skill in the art understand that to avoid a misleadingly high similarity to a reference sequence due to inclusion of gaps in the polynucleotide sequence a gap penalty is typically introduced and is subtracted from the number of matches.

[00125] Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman, Adv. Appl. Math., 2: 482, 1981 ; by the homology alignment algorithm of Needleman and Wunsch, J. MoI. Biol., 48: 443, 1970; by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci. USA, 8: 2444, 1988; by computerized implementations of these algorithms, including, but not limited to: CLUSTAL in the PC/Gene program by Intelligenetics, Mountain View, Calif., GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 7 Science Dr., Madison, Wise, USA; the CLUSTAL program is well described by Higgins and Sharp, Gene, 73 : 237- 244, 1988; Corpet, et al., Nucleic Acids Research, 16:881-90, 1988; Huang, et al., Computer Applications in the Biosciences, 8: 1-6, 1992; and Pearson, et al., Methods in Molecular Biology, 24:7-331 , 1994. The BLAST family of programs which can be used for database similarity searches includes: BLASTN for nucleotide query sequences against nucleotide database sequences; BLASTX for nucleotide query sequences against protein database sequences; BLASTP for protein query sequences against protein database sequences; TBLASTN for protein query sequences against nucleotide database sequences; and TBLASTX for nucleotide query sequences against nucleotide database sequences. See, Current Protocols in Molecular Biology, Chapter 19, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York, 1995. New versions of the above programs or new programs altogether will undoubtedly become available in the future, and can be used with the present invention. Attorney Docket No. 3300-01-lWO

[00126] Unless otherwise stated, sequence identity/similarity values provided herein refer to the value obtained using the BLAST 2.0 suite of programs, or their successors, using default parameters. Altschul et al., Nucleic Acids Res, 2:3389-3402, 1997. It is to be understood that default settings of these parameters can be readily changed as needed in the future.

[00127] As those ordinary skilled in the art will understand, BLAST searches assume that proteins can be modeled as random sequences. However, many real proteins comprise regions of nonrandom sequences which may be homopolymeric tracts, short-period repeats, or regions enriched in one or more amino acids. Such low- complexity regions may be aligned between unrelated proteins even though other regions of the protein are entirely dissimilar. A number of low-complexity filter programs can be employed to reduce such low-complexity alignments. For example, the SEG (Wooten and Federhen, Comput. Chem., 17: 149-163, 1993) and XNU (Claverie and States, Comput. Chem., 17: 191-1 , 1993) low-complexity filters can be employed alone or in combination.

[00128] "Sequence identity" or "identity" in the context of two nucleic acid or polypeptide sequences includes reference to the residues in the two sequences which are the same when aligned for maximum correspondence over a specified comparison window, and can take into consideration additions, deletions and substitutions. When percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (for example, charge or hydrophobicity) and therefore do not deleteriously change the functional properties of the molecule. Where sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences which differ by such conservative substitutions are said to have sequence similarity. Approaches for making this adjustment are well-known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution Attorney Docket No. 3300-01-lWO

is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, for example, according to the algorithm of Meyers and Miller, Computer Applic. Biol. Sci., 4: 11-17, 1988, for example, as implemented in the program PC/GENE (Intelligenetics, Mountain View, Calif., USA).

[00129] "Percentage of sequence identity" means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions, substitutions, or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions, substitutions, or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.

[00130] The term "substantial identity" or "homologous" in their various grammatical forms in the context of polynucleotides means that a polynucleotide comprises a sequence that has a desired identity, for example, at least 60% identity, preferably at least 70% sequence identity, more preferably at least 80%, still more preferably at least 90% and even more preferably at least 95%, compared to a reference sequence using one of the alignment programs described using standard parameters. One of skill will recognize that these values can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning and the like. Substantial identity of amino acid sequences for these purposes n normally means sequence identity of at least 60%, more preferably at least 70%, 80%, 90%, and even more preferably at least 95%.

[00131] Another indication that nucleotide sequences are substantially identical is if two molecules hybridize to each other under stringent conditions. However, nucleic acids which do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides which they encode are substantially identical. Attorney Docket No. 3300-01-lWO

This may occur, for example, when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. One indication that two nucleic acid sequences are substantially identical is that the polypeptide which the first nucleic acid encodes is immunologically cross reactive with the polypeptide encoded by the second nucleic acid, although such cross-reactivity is not required for two polypeptides to be deemed substantially identical.

[00132] The term "substantial identity" or "homologous" in their various grammatical forms in the context of peptides indicates that a peptide comprises a sequence that has a desired identity, for example, at least 60% identity, preferably at least 70% sequence identity to a reference sequence, more preferably 80%, still more preferably 85%, even more preferably at least 90% or 95% sequence identity to the reference sequence over a specified comparison window. Preferably, optimal alignment is conducted using the homology alignment algorithm of Needleman and Wunsch, J. MoI. Biol. , 48:443, 1970. An indication that two peptide sequences are substantially identical is that one peptide is immunologically reactive with antibodies raised against the second peptide, although such cross-reactivity is not required for two polypeptides to be deemed substantially identical. Thus, a peptide is substantially identical to a second peptide, for example, where the two peptides differ only by a conservative substitution. Peptides which are "substantially similar" share sequences as noted above except that residue positions which are not identical may differ by conservative amino acid changes. Conservative substitutions typically include, but are not limited to, substitutions within the following groups: glycine and alanine; valine, isoleucine, and leucine; aspartic acid and glutamic acid; asparagine and glutamine; serine and threonine; lysine and arginine; and phenylalanine and tyrosine, and others as known to the skilled person.

[00133] "Biological subject" as used herein refers to a target biological object obtained, reached, or collected in vivo, ex-vivo, or in situ, that contains or is suspected of containing nucleic acids or polypeptides that are amplified or deleted as described in Tables 1-7. A biological subject is typically of eukaryotic nature, for example, insects, protozoa, birds, fish, reptiles, and preferably a mammal, for example, rat, mouse, cow, dog, guinea pig, or rabbit, and more preferably a primate, for example, chimpanzees, or Attorney Docket No. 3300-01-lWO

humans such as a patient in need of diagnostic review, treatment and/or monitoring of therapy.

[00134] "Biological sample" as used herein refers to a sample obtained from a biological subject, including sample of biological tissue or fluid origin, obtained, reached, or collected in vivo, ex-vivo, or in situ, that contains or is suspected of containing nucleic acids or polypeptides that are amplified or deleted as described in Tables 1-7. A biological sample also includes samples from a region of a biological subject containing precancerous or cancer cells or tissues. Such samples can be, but are not limited to, organs, tissues, fractions and cells isolated from mammals including, humans such as a patient, mice, and rats. Biological samples also may include sections of the biological sample including tissues, for example, frozen sections taken for histologic purposes. A biological sample is typically of an eukaryotic origin, for example, insects, protozoa, birds, fish, reptiles, and preferably a mammal, for example, rat, mouse, cow, dog, guinea pig, or rabbit, and more preferably a primate, for example, chimpanzees or humans. A biological sample, as described herein, can be: a "control" or a "control sample" or a "test sample".

[00135] A "control" refers to a representative of healthy, cancer-free biological subject or information obtained from a different individual or a normalized value, which can be based on baseline data obtained from a population or other acceptable sources. A control also can refer to a given level (or copy number) of one or more genes (or proteins) listed in Tables 1-7, representative of the cancer- free population, that has been previously established based on measurements from normal, cancer-free animals. A control also can be a reference data point in a database based on data obtained from control samples representative of a cancer-free population. Further, a control can be established by a specific age, sex, ethnicity or other demographic parameters. In some situations, the control is implicit in the particular measurement. A typical control level for a gene is two copies per cell. An example of an implicit control is where a detection method can only detect of the genes listed in Tables 1-7, or the corresponding gene copy number, when a level higher than that typical of a normal, cancer-free animal is present. Another example is in the context of an Attorney Docket No. 3300-01-lWO

immunohistochemical assay where the control level for the assay is known. Other instances of such controls are within the knowledge of the skilled person.

[00136] A "control sample" refers to a sample of biological material representative of healthy, cancer-free animals or a normal biological subject obtained from a cancer-free population. The level of one or more genes (e.g., mRNAs and proteins) listed in Tables 1 -7, in a control sample, or the corresponding gene copy number, is desirably typical of the general population of normal, cancer-free animals of the same species. This sample either can be collected from an animal for the purpose of being used in the methods described in the present invention or it can be any biological material representative of normal, cancer-free animals suitable for use in the methods of this invention. A control sample also can be obtained from normal tissue from the animal that has cancer or is suspected of having cancer.

[00137] As used herein, the term "p53" refers to the p53 tumor suppressor having the GeneID no. 1151.

[00138] As used herein, the term "PTEN" refers to the PTEN tumor suppressor having the GeneID no. 5728.

[00139] As used herein, the term "pi 6" refers to the pl6 tumor suppressor having the GeneID no. 1029.

[00140] As used herein, the term "c20orfl33" refers to the c20orfl33 tumor suppressor having the GeneID no. 140733.

[00141] As used herein, the term "TGF-β2" refers to the TGF-β2 tumor suppressor having the GeneID no. 7042.

[00142] As used herein, the term "ctnnal" refers to the ctnnal tumor suppressor having the GeneID no. 7157.

[00143] As used herein, the term "ctnnbl " refers to the ctnnbl tumor suppressor having the GeneID no. 1495.

[00144] As used herein, the term "KRAS" refers to the KRAS tumor suppressor having the GeneID no. 3845.

[00145] As used herein, the term "BRAF" refers to the BRAF tumor suppressor having the GeneID no. 673. Attorney Docket No. 3300-01-lWO

[00146] As used herein, the term "pik3ca" refers to the pik3ca tumor suppressor having the GeneID no. 5290.

[00147] These sequences are representative of one particular individual in the population of humans. Humans vary from one to another in their gene sequences. These variations are very minimal, sometimes occurring at a frequency of about 1 to 10 nucleotides per gene. Different forms of any particular gene exist within the human population. These different forms are called allelic variants. Allelic variants often do not change the amino acid sequence of the encoded protein; such variants are termed synonymous. Even if they do change the encoded amino acid (non-synonymous), the function of the protein is not typically affected. Such changes are evolutionarily or functionally neutral. When human gene is referred to in the present application all allelic variants are intended to be encompassed by the term. The Entrez GeneID numbers for the gene are provided merely as representative examples of a wild-type human sequence. The invention is not limited to this single allelic form of these genes or the proteins they encode.

[00148] A "test sample" as used herein refers to a biological sample, including sample of biological tissue or fluid origin, obtained, reached, or collected in vivo, ex- vivo, or in situ, that contains or is suspected of containing nucleic acids or polypeptides as described in Tables 1-7. A test sample also includes biological samples containing precancerous or cancer cells or tissues. Such test samples can be, but are not limited to, organs, tissues, fractions and cells isolated from mammals including, humans such as a patient, mice, and rats. A test sample also may include sections of the biological sample including tissues, for example, frozen sections taken for histologic purposes.

[00149] "Providing a biological subject, a biological sample, or a test sample" means to obtain a biological subject in vivo, ex-vivo, or in situ, including tissue or cell sample for use in the methods described in the present invention. Most often, this will be done by removing a sample of cells from an animal, but also can be accomplished in vivo, ex-vivo, or in situ, or by using previously isolated cells (for example, isolated from another person, at another time, and/or for another purpose).

[00150] "Data" includes, but is not limited to, information obtained that relates to "biological sample", "test sample", "control sample", and/or "control", as described Attorney Docket No. 3300-01-lWO

above, wherein the information is applied in generating a test level for diagnostics, prevention, monitoring or therapeutic use. The present invention relates to methods for comparing and compiling data wherein the data is stored in electronic or paper formats. Electronic format can be selected from the group consisting of electronic mail, disk, compact disk (CD), digital versatile disk (DVD), memory card, memory chip, ROM or RAM, magnetic optical disk; tape, video, video clip, microfilm, internet, shared network, shared server and the like; wherein data is displayed, transmitted or analyzed via electronic transmission, video display, telecommunication, or by using any of the above stored formats; wherein data is compared and compiled at the site of sampling specimens or at a location where the data is transported following a process as: described above.

[00151] "Overexpression" of a gene or an "increased," or "elevated," level of a ribonucleotide or protein refers to a level of the gene, ribonucleotide or polypeptide that, in comparison with a control level of gene, ribonucleotides or polypeptide, is detectably higher. Comparison may be carried out by statistical analyses on numeric measurements of the expression; or, it may be done through visual examination of experimental results by qualified researchers.

[00152] A level of ribonucleotide or polypeptide, that is "expected" in a control sample refers to a level that represents a typical, cancer-free sample, and from which an elevated, or diagnostic, presence of the polypeptide or polynucleotide, can be distinguished. Preferably, an "expected" level will be controlled for such factors as the age, sex, medical history, etc. of the mammal, as well as for the particular biological subject being tested.

[00153] The phrase "functional effects" in the context of an assay or assays for testing compounds that modulate a particular gene's activity includes the determination of any parameter that is indirectly or directly under the influence of the gene, for example, a functional, physical, or chemical effect, for example, of the genes activity, the ability to induce gene amplification or overexpression in cancer cells, and to aggravate cancer cell proliferation. "Functional effects" include in vitro, in vivo, and ex vivo activities. Attorney Docket No. 3300-01-lWO

[00154] "Determining the functional effect" refers to assaying for a compound that increases or decreases a parameter that is indirectly or directly under the influence of the gene, for example, functional, physical, and chemical effects. Such functional effects can be measured by any means known to those skilled in the art, for example, changes in spectroscopic characteristics (for example, fluorescence, absorbance, refractive index), hydrodynamic (for example, shape), chromatographic, or solubility properties for the protein, measuring inducible markers or transcriptional activation of the gene; measuring binding activity or binding assays, for example, substrate binding, and measuring cellular proliferation; measuring signal transduction; or measuring cellular transformation.

[00155] "Inhibitors," "activators," "modulators," and "regulators" refer to molecules that activate, inhibit, modulate, regulate and/or block an identified function. Any molecule having potential to activate, inhibit, modulate, regulate and/or block an identified function can be a "test molecule," as described herein. For example, referring to oncogenic function or anti-apoptotic activity of the gene, such molecules may be identified using in vitro and in vivo assays of gene. Inhibitors are compounds that partially or totally block the genes activity, respectively, decrease, prevent, or delay their activation, or desensitize their cellular response. This may be accomplished by binding to protein expressed by the gene directly or via other intermediate molecules. An antagonist or an antibody that blocks the activity of the genes expression product, including inhibition of oncogenic function or anti-apoptotic activity of gene's expression product, respectively, is considered to be such an inhibitor. Activators are compounds that bind to a gene's protein expression product directly or via other intermediate molecules, thereby increasing or enhancing their activity, stimulating or accelerating their activation, or sensitizing their cellular response. An agonist of a genes expression product is considered to be such an activator. A modulator can be an inhibitor or activator. A modulator may or may not bind the gene or its protein expression product directly; it affects or changes the activity or activation of gene's expression product or the cellular sensitivity to the gene or its expression product, respectively. A modulator also may be a compound, for example, a small molecule, that inhibits transcription of the gene's mRNA. A regulator of a gene Attorney Docket No. 3300-01-lWO

includes any element, for example, nucleic acid, peptide, polypeptide, protein, peptide nucleic acid or the like, that influences and/or controls the transcription/expression of the gene or its coding region.

[00156] The group of inhibitors, activators, modulators and regulators of this invention also includes genetically modified versions of one or more genes listed in Tables 1-7, for example, versions with altered activity. Thus, unless otherwise indicated, the group is inclusive of the naturally occurring protein as well as synthetic ligands, antagonists, agonists, antibodies, small chemical molecules and the like.

[00157] "Assays for inhibitors, activators, modulators, or regulators" refer to experimental procedures including, for example, expressing a gene listed in Tables 1-7, in vitro, in cells, applying putative inhibitor, activator, modulator, or regulator compounds, and then determining the functional effects on the gene's (or its expressed protein product) activity or transcription, as described above. Samples that contain or are suspected of containing the gene (or its expressed protein product) are treated with a potential activator, inhibitor, or modulator. The extent of activation, inhibition, or change is examined by comparing the activity measurement from the samples of interest to control samples. A threshold level is established to assess activation or inhibition. For example, inhibition of a polypeptide is considered achieved when the activity value relative to the control is 80% or lower. Similarly, activation of a polypeptide is considered achieved when the activity value relative to the control is two or more fold higher.

[00158] The terms "isolated," "purified," or "biologically pure" refer to material that is free to varying degrees from components which normally accompany it as found in its native state. "Isolate" denotes a degree of separation from original source or surroundings. "Purify" denotes a degree of separation that is higher than isolation. A "purified" or "biologically pure" protein is sufficiently free of other materials such that any impurities do not materially affect the biological properties of the protein or cause other adverse consequences. That is, a nucleic acid or peptide of this invention is purified if it is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. Purity and homogeneity Attorney Docket No. 3300-01-lWO

are typically determined using analytical chemistry techniques, for example, polyacrylamide gel electrophoresis or high performance liquid chromatography. The term "purified" can denote that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. For a protein that can be subjected to modifications, for example, phosphorylation or glycosylation, different modifications may give rise to different isolated proteins, which can be separately purified. Various levels of purity may be applied as needed according to this invention in the different methodologies set forth herein; the customary purity standards known in the art may be used if no standard is otherwise specified.

[00159] An "isolated nucleic acid molecule" can refer to a nucleic acid molecule, depending upon the circumstance, that is separated from the 5' and 3' coding sequences of genes or gene fragments contiguous in the naturally occurring genome of an organism. The term "isolated nucleic acid molecule" also includes nucleic acid molecules which are not naturally occurring, for example, nucleic acid molecules created-by recombinant DNA techniques.

[00160] "Nucleic acid" refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form. The term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides. Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral methyl phosphonates, 2-O-methyl ribonucleotides, and peptide-nucleic acids (PNAs).

[00161] Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively, modified variants thereof (for example, degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with suitable mixed base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res, 19:081 , 1991 ; Ohtsuka et al., J. Biol. Chem., 260:2600-2608, 1985; Attorney Docket No. 3300-01-lWO

Rossolini et al., MoI. Cell Probes, 8:91-98, 1994). The term nucleic acid can be used interchangeably with gene, cDNA, mRNA, oligonucleotide, and polynucleotide.

[00162] A "host cell" is a naturally occurring cell or a transformed cell or a transfected cell that contains an expression vector and supports the replication or expression of the expression vector. Host cells may be cultured cells, explants, cells in vivo, and the like. Host cells may be prokaryotic cells, for example, E. coli, or eukaryotic cells, for example, yeast, insect, amphibian, or mammalian cells, for example, Vero, CHO, HeLa, and others.

[00163] The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, for example, hydroxyproline, γ-carboxyglutamate, and O-phosphoserine, phosphothreonine. "Amino acid analogs" refer to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, for example, homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (for example, norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. "Amino acid mimetics" refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that function in a manner similar to a naturally occurring amino acid. Amino acids and analogs are well known in the art.

[00164] Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC- IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.

[00165] "Conservatively modified variants" apply to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refers to those nucleic acids which encode identical or similar amino acid sequences and include degenerate sequences. For example, the codons GCA, GCC, GCG and GCU all encode alanine. Thus, at every amino acid Attorney Docket No. 3300-01-lWO

position where an alanine is specified, any of these codons can be used interchangeably in constructing a corresponding nucleotide sequence. The resulting nucleic acid variants are conservatively modified variants, since they encode the same protein (assuming that is the only alternation in the sequence). One skilled in the art recognizes that each codon in a nucleic acid, except for AUG (sole codon for methionine) and UGG (tryptophan), can be modified conservatively to yield a functionally-identical peptide or protein molecule.

[00166] As to, amino acid sequences, one skilled in the art will recognize that substitutions, deletions, or additions to a polypeptide or protein sequence which alter, add or delete a single amino acid or a small number (typically less than about ten) of amino acids is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitutions are well known in the art and include, for example, the changes of: alanine to serine; arginine to lysine; asparigine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glutamine to asparigine; glutamate to aspartate; glycine to proline; histidine to asparigine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine, glutamine, or glutamate; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; valine to isoleucine or leucine. Other conservative and semi-conservative substitutions are known in the art and can be employed in practice of the present invention.

[00167] The terms "protein", "peptide" and "polypeptide" are used herein to describe any chain of amino acids, regardless of length or post-translational modification (for example, glycosylation or phosphorylation). Thus, the terms can be used interchangeably herein to refer to a polymer of amino acid residues. The terms also apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid. Thus, the term "polypeptide" includes full-length, naturally occurring proteins as well as recombinantly or synthetically produced polypeptides that correspond to a full-length naturally occurring protein or to particular domains or portions of a naturally occurring Attorney Docket No. 3300-01-lWO

protein. The term also encompasses mature proteins which have an added amino- terminal methionine to facilitate expression in prokaryotic cells.

[00168] The polypeptides of the invention can be chemically synthesized or synthesized by recombinant DNA methods; or, they can be purified from tissues in which they are naturally expressed, according to standard biochemical methods of purification.

[00169] Also included in the invention are "functional polypeptides," which possess one or more of the biological functions or activities of a protein or polypeptide of the invention. These functions or activities include the ability to bind some or all of the proteins which normally bind to the protein.

[00170] The functional polypeptides may contain a primary amino acid sequence that has been modified from that considered to be the standard sequence of the proteins described herein. Preferably these modifications are conservative amino acid substitutions, as described herein.

[00171] A "label" or a "detectable moiety" is a composition that when linked with the nucleic acid or protein molecule of interest renders the latter detectable, via spectroscopic, photochemical, biochemical, immunochemical, or chemical means. For example, useful labels include radioactive isotopes, magnetic beads, metallic beads, colloidal particles, fluorescent dyes, electron-dense reagents, enzymes (for example, as commonly used in an ELISA), biotin, digoxigenin, or haptens. A "labeled nucleic acid or oligonucleotide probe" is one that is bound, either covalently, through a linker or a chemical bond, or noncovalently, through ionic bonds, van der Waals forces, electrostatic attractions, hydrophobic interactions, or hydrogen bonds, to a label such that the presence of the nucleic acid or probe may be detected by detecting the presence of the label bound to the nucleic acid or probe.

[00172] As used herein a "nucleic acid or oligonucleotide probe" is defined as a nucleic acid capable of binding to a target nucleic acid of complementary sequence through one or more types of chemical bonds, usually through complementary base pairing, usually through hydrogen bond formation. As used herein, a probe may include natural (i.e., A, G, C, or T) or modified bases (7-deazaguanosine, inosine, etc.). In addition, the bases in a probe may be joined by a linkage other than a phosphodiester Attorney Docket No. 3300-01-lWO

bond, so long as it does not unduly interfere with hybridization. It will be understood by one of skill in the art that probes may bind target sequences lacking complete complementarity with the probe sequence depending upon the stringency of the hybridization conditions. The probes are preferably directly labeled with isotopes, for example, chromophores, lumiphores, chromogens, or indirectly labeled with biotin to which a streptavidin complex may later bind. By assaying for the presence or absence of the probe, one can detect the presence or absence of a target gene of interest.

[00173] The phrase "selectively (or specifically) hybridizes to" refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent hybridization conditions when that sequence is present in a complex mixture (for example, total cellular or library DNA or RNA).

[00174] The phrase "stringent hybridization conditions" refers to conditions under which a probe will hybridize to its target complementary sequence, typically in a complex mixture of nucleic acids, but to no other sequences. Stringent conditions are sequence-dependent and circumstance-dependent; for example, longer sequences can hybridize with specificity at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acid assays" (1993). In the context of the present invention, as used herein, the term "hybridizes under stringent conditions" is intended to describe conditions for hybridization and washing under which nucleotide sequences at least 60% homologous to each other typically remain hybridized to each other. Preferably, the conditions are such that sequences at least about 65%, more preferably at least about 70%, and even more preferably at least about 75% or more homologous to each other typically remain hybridized to each other.

[00175] Generally, stringent conditions are selected to be about 5 to 10 C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH. The Tm is the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Stringent conditions will be those in Attorney Docket No. 3300-01-lWO

which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 C for short probes (for example, 10 to 50 nucleotides) and at least about 60 C for long probes (for example, greater than 50 nucleotides). Stringent conditions also may be achieved with the addition of destabilizing agents, for example, formamide. For selective or specific hybridization, a positive signal is at least two times background, preferably 10 times background hybridization.

[00176] Exemplary stringent hybridization conditions can be as following, for example: 50% formamide, 5xSSC and 1% SDS, incubating at 42 C, or 5xSSC and 1% SDS, incubating at 65 C, with wash in 0.2xSSC and 0.1% SDS at 65 C. Alternative conditions include, for example, conditions at least as stringent as hybridization at 68 C for 20 hours, followed by washing in 2xSSC, 0.1 % SDS, twice for 30 minutes at 55 C and three times for 15 minutes at 60 C. Another alternative set of conditions is hybridization in 6xSSC at about 45 C, followed by one or more washes in 0.2xSSC, 0.1% SDS at 50-65 C. For PCR, a temperature of about 36 C is typical for low stringency amplification, although annealing temperatures may vary between about 32 C and 48 C depending on primer length. For high stringency PCR amplification, a temperature of about 62 C is typical, although high stringency annealing temperatures can range from about 50 C to about 65 C, depending on the primer length and specificity. Typical cycle conditions for both high and low stringency amplifications include a denaturation phase of 90 C to 95 C for 30 sec. to 2 min., an annealing phase lasting 30 sec. to 2 min., and an extension phase of about 72 C for 1 to 2 min.

[00177] Nucleic acids that do not hybridize to each other under stringent conditions can still be substantially identical if the polypeptides which they encode are substantially identical. This occurs, for example, when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. In such cases, the nucleic acids typically hybridize under moderately stringent hybridization conditions. Exemplary "moderately stringent hybridization conditions" include a hybridization in a buffer of 40% formamide, 1 M NaCl, 1% SDS at 37 C, and a wash in IxSSC at 45 C. A positive hybridization is at least twice background. Those of Attorney Docket No. 3300-01-lWO

ordinary skill will readily recognize that alternative hybridization and wash conditions can be utilized to provide conditions of similar stringency.

[00178] The terms "about" or "approximately" in the context of numerical values and ranges refers to values or ranges that approximate or are close to the recited values or ranges such that the invention can perform as intended, such as having a desired amount of nucleic acids or polypeptides in a reaction mixture, as is apparent to the skilled person from the teachings contained herein. This is due, at least in part, to the varying properties of nucleic acid compositions, age, race, gender, anatomical and physiological variations and the inexactitude of biological systems. Thus, these terms encompass values beyond those resulting from systematic error.

[00179] "Antibody" refers to a polypeptide comprising a framework region encoded by an immunoglobulin gene or fragments thereof that specifically binds and recognizes an antigen. The recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon, and mu constant region genes, as well as the myriad immunoglobulin variable region genes. Light chains are classified as either kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively. An exemplary immunoglobulin (antibody) structural unit comprises a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light" (about 2 kDa) and one "heavy" chain (up to about 70 kDa). Antibodies exist, for example, as intact immunoglobulins or as a number of well- characterized fragments produced by digestion with various peptidases. While various antibody fragments are defined in terms of the digestion of an intact antibody, one of skill in the art will appreciate that such fragments may be synthesized de novo chemically or via recombinant DNA methodologies. Thus, the term antibody, as used herein, also includes antibody fragments produced by the modification of whole antibodies, those synthesized de novo using recombinant DNA methodologies (for example, single chain Fv), humanized antibodies, and those identified using phage display libraries (see, for example, Knappik et al., J. MoI. Biol., 296:57-86, 2000; McCafferty et al., Nature, 348:2-4, 1990), for example. For preparation of antibodies, recombinant, monoclonal, or polyclonal antibodies, any technique known in the art can Attorney Docket No. 3300-01-lWO

be used with this invention (see, e.g., Kohler & Milstein, Nature, 256(5517):495-497, 1975; Kozbor et al., Immunology Today, 4:72, 1983; Cole et al., pp. 77-96 in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., 1998).

[00180] Techniques for the production of single chain antibodies (See U.S. Pat. No. 4,946,778) can be adapted to produce antibodies to polypeptides of this invention. Transgenic mice, or other organisms, for example, other mammals, may be used to express humanized antibodies. Phage display technology also can be used to identify antibodies and heteromeric Fab fragments that specifically bind to selected antigens (see, e.g., McCafferty et al., Nature, 348:2-4, 1990; Marks et al., Biotechnology, 10(7) :779-783, 1992).

[00181] The term antibody is used in the broadest sense including agonist, antagonist, and blocking or neutralizing antibodies.

[00182] "Blocking antibody" is a type of antibody, as described above, that refers to a polypeptide comprising variable and framework regions encoded by an immunoglobulin gene or fragments, homologues, analogs or mimetics thereof that specifically binds and blocks biological activities of an antigen; for example, a blocking antibody to a protein blocks the oncogenic function or anti-apoptotic activity of protein or gene. A blocking antibody binds to critical regions of a polypeptide and thereby inhibits its function. Critical regions include protein-protein interaction sites, such as active sites, functional domains, ligand binding sites, and recognition sites. Blocking antibodies may be induced in mammals, for example in human, by repeated small injections of antigen, too small to produce strong hypersensitivity reactions. See Bellanti J A, Immunology, WB Saunders Co., p.131-368 (1971). Blocking antibodies can play an important role in blocking the function of a marker protein and inhibiting tumorigenic growth. See, e.g.,. Jopling et al., J. Biol. Chem., 277(9):6864-73 (2002); Drebin et al., Cell, 41(3):697-706 (1985); Drebin et al., Proc. Natl. Acad. Sci. USA, 83(23):9129-33 (1986).

[00183] The term "tumor-cell killing" by antibody to a particular protein by blocking antibodies herein is meant any inhibition of tumor cell proliferation by means of blocking a function or binding to block a pathway related to tumor-cell proliferation. For example, anti-epidermal growth factor receptor monoclonal antibodies inhibit A431 Attorney Docket No. 3300-01-lWO

tumor cell proliferation by blocking an autocrine pathway. See Mendelsohn et al., Trans Assoc Am Physicians, 100: 173-8 (1987); Masui et al., Cancer Res, 44(3): 1002-7 (1984).

[00184] The term "oncogenic function-blocking antibody" herein is meant an anti-human antibody whose interaction with the protein inhibits the oncogenic function or anti-apoptotic activity of the protein mediates tumor-cell killing mechanisms, or inhibits tumor-cell proliferation. In contrast to antibodies that merely bind to tumor cells expressing the protein, blocking antibodies against target gene product protein (or a fragment thereof) mediate tumor-cell killing by mechanisms related to the oncogenic function or anti-apoptotic activity of the protein. See Drebin et al., Proc. Natl. Acad. Sci. USA, 83(23):9129-33 (1986) for inhibition of tumorigenic growth; and Mendelsohn et al., Trans Assoc Am Physicians, 100: 173-8 (1987), for an example of antibody- mediated anti-proliferative activity.

[00185] An "anti-target protein" antibody is an antibody or antibody fragment that specifically binds a polypeptide encoded by a gene, mRNA, cDNA, or a subsequence thereof as listed in Tables 1-7. Anti-target protein antibodies also includes a blocking antibody that inhibits oncogenic function or anti-apoptotic activity of one or more genes (or expressed protein product) listed in Tables 1-7. These antibodies can mediate anti-proliferative activity on tumor cell growth.

[00186] "Cancer Vaccines" are substances that are designed to stimulate the immune system to launch an immune response against a specific target associated with a cancer. For a general overview on immunotherapy and vaccines for cancers, see Old L. J., Scientific American, September, 1996.

[00187] Vaccines may be preventative or therapeutic. Typically, preventative vaccines (for example, the flu vaccine) generally contain parts of polypeptides that stimulate the immune system to generate cells and/or other substances (for example, antibodies) that fight the target of Io the vaccines. Preventative vaccines must be given before exposure, concurrent with exposure, or shortly thereafter to the target (for example, the flu virus) in order to provide the immune system with enough time to activate and make the immune cells and substances that can attack the target. Attorney Docket No. 3300-01-lWO

Preventative vaccines stimulate an immune response that can last for years or even an individual's lifetime.

[00188] Therapeutic vaccines are used to combat existing disease. Thus, the goal of a therapeutic cancer vaccine is not just to prevent disease, but rather to stimulate the immune system to attack existing cancerous cells. Because of the many types of cancers and because it is often unpredictable who might get cancer, among other reasons, the cancer vaccines currently being developed are therapeutic. As discussed further below, due to the difficulties associated with fighting an established cancer, most vaccines are used in combination with cytokines or adjuvants that help stimulate the immune response and/or are used in conjunction with conventional cancer therapies.

[00189] The immune system must be able to tolerate normal cells and to recognize and attack abnormal cells. To the immune system, a cancer cell may be different in very small ways from a normal cell. Therefore, the immune system often tolerates cancer cells rather than attacking them, which allows the cancer to grow and spread. Therefore, cancer vaccines must not only provoke an immune response, but also stimulate the immune system strongly enough to: overcome this tolerance. The most effective anti-tumor immune responses are achieved by stimulating T cells, which can recognize and kill tumor cells directly. Therefore, most current cancer vaccines try to activate T cells directly, try to enlist antigen presenting cells (APCs) to activate T cells, or both. By way of example, researchers are attempting to enhance T cell activation by altering tumor cells so molecules that are normally only on APCs are now on the tumor cell, thus enabling the molecules to give T cells a stronger activating signal than the original tumor cells, and by evaluating cytokines and adjuvants to determine which are best at calling APCs to areas they are needed.

[00190] Cancer vaccines can be made from whole tumor cells or from substances contained by the tumor (for example, antigens). For a whole cell vaccine, tumor cells are removed from a patient(s), grown in the laboratory, and treated to ensure that they can no longer multiply and are incapable of infecting the patient. When whole tumor cells are injected into a person, an immune response against the antigens on the tumor cells is generated. There are two types of whole cell cancer Attorney Docket No. 3300-01-lWO

vaccines: 1) autologous whole cell vaccines made with a patient's own whole, inactivated tumor cells; and 2) allogenic whole cell vaccines made with another individual's whole, inactivated tumor cells (or the tumor cells from several individuals). Antigen vaccines are not made of whole cells, but of one or more antigens contained by the tumor. Some antigens are common to all cancers of a particular type, while some are unique to an individual. A few antigens are shared between tumors of different types of cancer.

[00191] Antigens in an antigen vaccine may be delivered in several ways. For example, proteins or fragments thereof from the tumor cells can be given directly as the vaccine. Nucleic acids coding for those proteins can be given (for example, RNA or DNA vaccines). Furthermore, viral vectors can be engineered so that when they infect a human cell and the cell will make and display the tumor antigen on its surface. The viral vector should be capable of infecting only a small number of human cells in order to start an immune response, but not enough to make a person sick. Viruses also can be engineered to make cytokines or to display proteins on their surface that help activate immune cells. These can be given alone or with a vaccine to help the immune response. Finally, antibodies themselves may be used as antigens in a vaccine (antiidiotype vaccines). In this way, an antibody to a tumor antigen is administered, then the B cells make antibodies to that antibody that also recognize the tumor cells.

[00192] Cancer vaccines frequently contain components to help boost the immune response. Cytokines (for example, IL-2), which are chemical messengers that recruit other immune cells to the site of attack and help killer T cells perform their function, are frequently employed. Similarly, adjuvants, substances derived from a wide variety of sources, including bacteria, have been shown to elicit immune cells-to an area where they are needed. In some cases, cytokines and adjuvants are added to the cancer vaccine mixture, in other cases they are given separately.

[00193] Cancer vaccines are most frequently developed to target tumor antigens normally expressed on the cell surface (for example, membrane-bound receptors or subparts thereof). However, cancer vaccines also may be effective against intracellular antigens that are, in a tumor-specific manner, exposed on the cell surface. Many tumor antigens are intracellular proteins that are degraded and expressed on the Attorney Docket No. 3300-01-lWO

cell surface complexed with, for example, HLA. Frequently, it is difficult to attack these antigens with antibody therapy because they are sparsely dispersed on the cell surface. However, cancer vaccines are a viable alternative therapeutic approach.

[00194] Cancer vaccines may prove most useful in preventing cancer recurrence after surgery, radiation or chemotherapy has reduced or eliminated the primary tumor.

[00195] The term "immunoassay" is an assay that utilizes the binding interaction between an antibody and an antigen. Typically, an immunoassay uses the specific binding properties of a particular antibody to isolate, target, and/or quantify the antigen.

[00196] The phrase "specifically (or selectively) binds" to an antibody or "specifically (or selectively) immunoreactive with," when referring to a protein or peptide, refers to a binding reaction that is determinative of the presence of the protein in a heterogeneous population of proteins and other biologies. Thus, under designated immunoassay conditions, the specified antibodies bind to a particular protein at a level at least two times the background and do not substantially bind in a significant amount to other proteins present in the sample. Specific binding to an antibody under such conditions may require an antibody that is selected for its specificity for a particular protein. For example, antibodies raised to a particular polypeptide can be selected to obtain only those antibodies that are specifically immunoreactive with the polypeptide, respectively, and not with other proteins, except for polymorphic variants, orthologs, and alleles of the specific polypeptide. In addition, antibodies raised to a particular polypeptide ortholog can be selected to obtain only those antibodies that are specifically immunoreactive with the polypeptide ortholog, respectively, and not with other orthologous proteins, except for polymorphic variants, mutants, and alleles of the polypeptide ortholog. This selection may be achieved by subtracting out antibodies that cross-react with desired molecules, as appropriate. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein. For example, solid-phase ELISA immunoassays are routinely used to select antibodies specifically immunoreactive with a protein. See, for example, Harlow & Attorney Docket No. 3300-01-lWO

Lane, Antibodies, A Laboratory Manual, 1988, for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity.

[00197] The phrase "selectively associates with" refers to the ability of a nucleic acid to "selectively-hybridize" with another as defined supra, or the ability of an antibody to "selectively (or specifically) bind" to a protein, as defined supra.

[00198] "siRNA" refers to small interfering RNAs, which also include short hairpin RNA (shRNA) (Paddison et al., Genes & Dev. 16: 948-958, 2002) that are capable of causing interference and can cause post-transcriptional silencing of specific genes in cells, for example, mammalian cells (including human cells) and in the body, for example, mammalian bodies (including humans). The phenomenon of RNA interference is described and discussed in Bass, Nature, 411 :428-29, 2001 ; Elbashir et al. , Nature, 411 :494-98, 2001 ; and Fire et al., Nature, 391 :806-11 , 1998, wherein methods of making interfering RNA also are discussed. The siRNAs based upon the sequences disclosed herein are typically less than 100 base pairs ("bps") in length and constituency and preferably are about 30 bps or shorter, and can be made by approaches known in the art, including the use of complementary DNA strands or synthetic approaches. The siRNAs are capable of causing interference and can cause post- transcriptional silencing of specific genes in cells, for example, mammalian cells (including human cells) and in the body, for example, mammalian bodies (including humans). Exemplary siRNAs according to the invention could have up to 30 bps, 29 bps, 25 bps, 22 bps, 21 bps, 20 bps, 15 bps, 10 bps, 5 bps or any integer thereabout or therebetween. According to the invention, siRNA having different sequences but directed against the gene can be administered concurrently or consecutively in any proportion, including equimolar proportions.

[00199] The term "miRNA" refers to microRNA, a class of small RNA molecules or a small noncoding RNA molecules, that are capable of causing interference, inhibition of RNA translation into protein, and can cause post- transcriptional silencing of specific genes in cells, for example, mammalian cells (including human cells) and in the body, for example, mammalian bodies (including humans) (see, Zeng and Cullen, RNA, 9(1): 112-123, 2003; Kidner and Martienssen Trends Genet, 19(l): 13-6, 2003; Dennis C, Nature, 420(6917):732, 2002; Couzin J, Attorney Docket No. 3300-01-lWO

Science 298(5602):2296-7, 2002). Previously, the miRNAs were known as small temporal RNAs (stRNAs) and belonged to a class of non-coding microRNAs, which have been shown to control gene expression either by repressing translation or by degrading the targeted mRNAs (see Couzin J, Science 298(5602):2296-7, 2002), which are generally 20-28 nt in length (see Finnegan et al., Curr Biol, 13(3):236-40, 2003; Ambros et al., RNA 9(3):277-279, 2003; Couzin J, Science 298(5602):2296-7, 2002). Unlike other RNAs (for example, siRNAs or shRNAs), miRNAs or stRNAs are not encoded by any microgenes, but are generated from aberrant (probably double-stranded) RNAs by an enzyme called Dicer, which cleaves double-stranded RNA into smaller pieces (see Couzin J, Science 298(5602):2296-7, 2002). According to the invention, miRNA having different sequences but directed against a gene can be administered concurrently or consecutively in any proportion, including equimolar proportions.

[00200] The term "transgene" refers to a nucleic acid sequence encoding, for example, one of the specific polypeptides, or an antisense transcript thereto, which is partly or entirely heterologous, i.e., foreign, to the transgenic organism or cell into which it is introduced, or, is homologous to an endogenous gene of the transgenic animal or cell into which it is introduced, but which is designed to be inserted, or is inserted, into the animal's genome in such a way as to alter the genome of the cell into which it is inserted (for example, it is inserted at a location which differs from that of the natural gene or its insertion results in a knockout). A transgene can include one or more transcriptional regulatory sequences and any other nucleic acid, (for example, an intron), that may be necessary for optimal expression of a selected nucleic acid.

[00201] By "transgenic" is meant any organism that includes a nucleic acid sequence, which is inserted into a cell and becomes a part of the genome of the animal that develops from that cell. Such a transgene may be partly or entirely heterologous to the transgenic animal.

[00202] Thus, for example, substitution of the naturally occurring gene for a gene from a second species results in an animal that produces the protein of the second species. Substitution of the naturally occurring gene for a gene having a mutation results in an animal that produces the mutated protein. A transgenic mouse expressing the human protein can be generated by direct replacement of the mouse gene with the Attorney Docket No. 3300-01-lWO

human gene. These transgenic animals can be critical for drug antagonist studies on animal models for human diseases, and for eventual treatment of disorders or diseases associated with the respective genes. Transgenic mice carrying these mutations will be extremely useful in studying this disease.

[00203] A "transgenic animal" refers to any animal, preferably a non-human mammal, that is chimeric, and is achievable with most vertebrate species. Such species include, but are not limited to, non-human mammals, including rodents, for example, mice and rats; rabbits; birds or amphibians; ovines, for example, sheep and goats; porcines, for example, pigs; and bovines, for example, cattle and buffalo; in which one or more of the cells of the animal contains heterologous nucleic acid introduced by way of human intervention, for example, by transgenic techniques well known in the art. The nucleic acid is introduced into the cell, directly or indirectly by introduction into a precursor of the cell, by way of deliberate genetic manipulation, for example, by microinjection or by infection with a recombinant virus. The term genetic manipulation does not include classical cross-breeding, or sexual fertilization, but rather is directed to the introduction of a recombinant DNA molecule. This molecule may be integrated within a chromosome, or it may be extrachromosomally replicating DNA. In the typical transgenic animals described herein, the transgene causes cells to express a recombinant form of one of the proteins, for example, either agonistic or antagonistic forms. However, transgenic animals in which the recombinant gene is silent also are contemplated. Moreover, "transgenic animal" also includes those recombinant animals in which gene disruption of one or more genes is caused by human intervention, including both recombination and antisense techniques. The transgene can be limited to somatic cells or be placed into the germline.

[00204] Methods of obtaining transgenic animals are described in, for example, Puhler, A., Ed., Genetic Engineering of Animals, VCH Pub., 1993; Murphy and Carter, Eds., Transgenesis Techniques: Principles and Protocols (Methods in Molecular Biology, Vol. 18), 1993; and Pinkert, C A, Ed., Transgenic Animal Technology: A Laboratory Handbook, Academic Press, 1994.

[00205] The term "knockout construct" refers to a nucleotide sequence that is designed to decrease or suppress expression of a polypeptide encoded by an endogenous Attorney Docket No. 3300-01-lWO

gene in one or more cells of a mammal. The nucleotide sequence used as the knockout construct is typically comprised of (1) DNA from some portion of the endogenous gene (one or more exon sequences, intron sequences, and/or promoter sequences) to be suppressed and (2) a marker sequence used to detect the presence of the knockout construct in the cell. The knockout construct can be inserted into a cell containing the endogenous gene to be knocked out. The knockout construct can then integrate with one or both alleles of an endogenous gene, for example, and such integration of the knockout construct can prevent or interrupt transcription of the full-length endogenous gene. Integration of the knockout construct into the cellular chromosomal DNA is typically accomplished via homologous recombination (i.e., regions of the knockout construct that are homologous or complementary to endogenous DNA sequences can hybridize to each other when the knockout construct is inserted into the cell; these regions can then recombine so that the knockout construct is incorporated into the corresponding position of the endogenous DNA).

[00206] "Aptamers": An aptamer is a peptide, a peptide-like, a nucleic acid, or a nucleic acid-like molecule that is capable of binding to a specific molecule (for example, one or more genes and/or proteins listed in Tables 1-7) of interest with high affinity and specificity. An aptamer also can be a peptide or a nucleic acid molecule that mimics the three dimensional structure of active portions of the peptides or the nucleic acid molecules of the invention (see, e.g., James W., Current Opinion in Pharmacology, 1 :540-546 (2001); Colas et al., Nature 380:548-550 (1996); Tuerk and Gold, Science 249:505 (1990); Ellington and Szostak, Nature 346:818 (1990)). The specific binding molecule of the invention may be a chemical mimetic; for example, a synthetic peptide aptamer or peptidomimetic. It is preferably a short oligomer selected for binding affinity and bioavailability (for example, passage across the plasma and nuclear membranes, resistance to hydrolysis of oligomeric linkages, adsorbance into cellular tissue, and resistance to metabolic breakdown). The chemical mimetic may be chemically synthesized with at least one non-natural analog of a nucleoside or amino acid (for example, modified base or ribose, designer or non-classical amino acid, D or L optical isomer). Modification also may take the form of acylation, glycosylation, methylation, phosphorylation, sulfation, or combinations thereof. Oligomeric linkages Attorney Docket No. 3300-01-lWO

may be phosphodiester or peptide bonds; linkages comprised of a phosphorus, nitrogen, sulfur, oxygen, or carbon atom (e.g., phosphorothionate, disulfide, lactam, or lactone bond); or combinations thereof. The chemical mimetic may have significant secondary structure (e.g., a ribozyme) or be constrained (e.g., a cyclic peptide).

[00207] "Peptide Aptamer": A peptide aptamer is a polypeptide or a polypeptide-like molecule that is capable of binding to a specific molecule (e.g., those in Tables 1-7) of interest with high affinity and specificity. A peptide aptamer also can be a polypeptide molecule that mimics the three dimensional structure of active portions of the polypeptide molecules of the invention. A peptide-aptamer can be designed to mimic the recognition function of complementarity determining regions of immunoglobulins, for example. The aptamer can recognize different epitopes on the protein surface (e.g., those listed in Tables 1 -7) with dissociation equilibrium constants in the nanomolar range; those inhibit the protein (e.g., those listed in Tables 1-7) activity. Peptide aptamers are analogous to monoclonal antibodies, with the advantages that they can be isolated together with their coding genes, that their small size facilitates solution of their structures, and that they can be designed to function inside cells.

[00208] A peptide aptamer is typically between about 3 and about 100 amino acids or the like in length. More commonly, an aptamer is between about 10 and about 35 amino acids or the like in length. Peptide-aptamers may be prepared by any known method, including synthetic, recombinant, and purification methods (James W., Current Opinion in Pharmacology, 1 :540-546 (2001); Colas et αl., Nature 380:548-550 (1996)).

[00209] The instant invention also provides aptamers of the peptides derived from those listed in Tables 1-7. In one aspect, the invention provides aptamers of isolated polypeptides comprising at least one active fragment having substantially homologous sequence of a peptide derived from a protein listed in Tables 1-7. The instant aptamers are peptide molecules that are capable of binding to a protein or other molecule, or mimic the three dimensional structure of the active portion of the peptides of the invention.

[00210] "Nucleic Acid Aptamer" : A nucleic acid aptamer is a nucleic acid or a nucleic acid-like molecule that is capable of binding to a specific molecule (e.g., those Attorney Docket No. 3300-01-lWO

listed in Tables 1-7) of interest with high affinity and specificity. A nucleic acid aptamer also can be a nucleic acid molecule that mimics the three dimensional structure of active portions of the nucleic acid molecules of the invention. A nucleic acid- aptamer is typically between about 9 and about 300 nucleotides or the like in length. More commonly, an aptamer is between about 30 and about 100 nucleotides or the like in length. Nucleic acid-aptamers may be prepared by any known method, including synthetic, recombinant, and purification methods (James W., Current Opinion in Pharmacology, 1 :540-546 (2001); Colas et al., Nature 380:548-550 (1996)).

[00211] According to one aspect of the invention, aptamers of the instant invention include non-modified or chemically modified RNA, DNA, PNA or polynucleotides. The method of selection may be by, but is not limited to, affinity chromatography and the method of amplification by reverse transcription (RT) or polymerase chain reaction (PCR). Aptamers have specific binding regions which are capable of forming complexes with an intended target molecule in an environment wherein other substances in the same environment are not complexed to the nucleic acid.

[00212] The instant invention also provides aptamers of the polynucleotides derived from those listed in Tables 1-7. In another aspect, the invention provides aptamers of isolated polynucleotides comprising at least one active fragment having substantially homologous sequence of the polynucleotides. The instant aptamers are nucleic acid molecules that are capable of binding to a nucleic acid or other molecule, or mimic the three dimensional structure of the active portion of the nucleic acids of the invention.

[00213] The invention also provides nucleic acids (e.g., mRNA molecules) that include an aptamer as well as a coding region for a regulatory polypeptide. The aptamer is positioned in the nucleic acid molecule such that binding of a ligand to the aptamer prevents translation of the regulatory polypeptide.

The term "target gene" can refer to a target nucleic acid (DNA and RNA) or protein (or polypeptide), and can include their polymorphic variants, alleles, mutants, and interspecies homologs that have (i) substantial nucleotide sequence homology (for example, at least 60% identity, preferably at least 70% sequence identity, more Attorney Docket No. 3300-01-lWO

preferably at least 80%, still more preferably at least 90% and even more preferably at least 95%) with the nucleotide sequence indicated in Entrez database for the indicated ID number; or (ii) at least 65% sequence homology with the amino acid sequence as indicated in the Entrez record; or (iii) substantial nucleotide sequence homology (for example, at least 60% identity, preferably at least 70% sequence identity, more preferably at least 80%, still more preferably at least 90% and even more preferably at least 95%) with the nucleotide sequence as set forth in the Entrez gene id or (iv) substantial sequence homology with the encoded amino acid sequence. The skilled artisan recognizes that the target genes can have numerous splice forms and variants. When referring to a specific target gene or locus by an Entrez gene ID number (e.g., in as Tables 1-7), all splices forms and variant which are included in the various embodiments of the invention. The target gene can also be a regulatory element. These sequences are representative of one particular individual in the population of humans. Humans vary from one to another in their gene sequences. These variations are very minimal, sometimes occurring at a frequency of about 1 to 10 nucleotides per gene. Different forms of any particular gene exist within the human population. These different forms are called allelic variants. Allelic variants often do not change the amino acid sequence of the encoded protein; such variants are termed synonymous. Even if they do change the encoded amino acid (non-synonymous), the function of the protein is not typically affected. Such changes are evolutionarily or functionally neutral. When a human Entrez gene ID is referred to in the present application all allelic variants are intended to be encompassed by the term. The Entrez gene ID sequences given in Tables 1-7 are provided merely as representative examples of a wild-type human sequence. The invention is not limited to a single allelic form of the amplified genes or regions (and proteins they encode).

[00214] Target polynucleotides or polypeptides are typically from a mammal including, but not limited to, human, rat, mouse, hamster, cow, pig, horse, sheep, or any mammal. A "target polynucleotide" and a "target polypeptide," may be either naturally occurring, recombinant, or synthetic (for example, via chemical synthesis). Overexpression, Amplification, and/or Deletion of the Target Genes: Attorney Docket No. 3300-01-lWO

[00215] The target genes and their expressed gene products can be used for diagnosis, prognosis, rational drug design, and other therapeutic intervention of tumors and cancers (for example, breast, colon, lung, ovarian, and prostate cancer).

[00216] Detection and measurement of amplification and/or overexpression of one or more targets (e.g., those amplified in Tables 1-7) or deleted (e.g., those deleted in Tables 1-7) in a test sample taken from a patient indicates that the patient may have developed a tumor or cancer (or may give important information regarding stage, prognosis, selection of therapy, etc.). Particularly, the presence of amplified target gene DNA that is listed as amplified in Tables 1-7 or the absence of a target gene that is listed as deleted in Tables 1-7, can lead to important characteristic information regarding the cancer, with high probability of accuracy. The present invention therefore provides, in one aspect, methods for diagnosing or characterizing a cancer or tumor in a mammalian tissue by measuring the levels of the target gene's mRNA expression in samples taken from the tissue of suspicion, and determining whether the target gene is overexpressed (or deleted) in the tissue. The various techniques, including hybridization based and amplification based methods, for measuring and evaluating mRNA levels are provided herein as discussed supra. The present invention also provides, in other aspects, methods for diagnosing a cancer or tumor in a mammalian tissue by measuring the numbers of the target gene's DNA copy number in samples taken from the tissue of suspicion, and determining whether the target gene is amplified (or deleted) in the tissue. The various techniques, including hybridization based and amplification based methods, for measuring and evaluating DNA copy numbers are provided herein as discussed supra. The present invention thus provides methods for detecting amplified (and/or deleted) genes at the DNA level and increased (or decrease) expression at the RNA level or protein level, wherein both the results can indicative of tumor (and cancer) progression.

[00217] Amplification and Deletions of Genes in Tumors and Cancer Cells [00218] The presence of a target gene that has undergone amplification in tumors (and cancer cells) can be evaluated by determining the copy number of the target genes, i.e., the number of DNA sequences in a cell encoding the target protein. Attorney Docket No. 3300-01-lWO

Generally, a normal diploid cell has two copies of a given autosomal gene. The copy number can be increased, however, by gene amplification or duplication, for example, in cancer cells, or reduced by deletion. Methods of evaluating the copy number of a particular gene are well known in the art, and include, inter alia, hybridization and amplification based assays.

[00219] Any of a number of hybridization based assays can be used to detect the copy number of the target genes in the cells of a biological subject. One such method is Southern blot (see Ausubel et al., or Sambrook et al., supra), where the genomic DNA is typically fragmented, separated electrophoretically, transferred to a membrane, and subsequently hybridized to a target gene specific probe. Comparison of the intensity of the hybridization signal from the probe for the target region with a signal from a control probe from a region of normal nonamplified, single-copied genomic DNA in the same genome provides an estimate of the relative target gene copy number, corresponding to the specific probe used. An increased signal compared to control represents the presence of amplification.

[00220] A methodology for determining the copy number of a target gene in a sample is in situ hybridization, for example, fluorescence in situ hybridization (FISH) (see Angerer, 1987 Meth. Enzymol., 152: 649). Generally, in situ hybridization comprises the following major steps: (1) fixation of tissue or biological structure to be analyzed; (2) prehybridization treatment of the biological structure to increase accessibility of target DNA, and to reduce nonspecific binding; (3) hybridization of the mixture of nucleic acids to the nucleic acid in the biological structure or tissue; (4) post-hybridization washes to remove nucleic acid fragments not bound in the hybridization, and (5) detection of the hybridized nucleic acid fragments. The probes used in such applications are typically labeled, for example, with radioisotopes or fluorescent reporters. Preferred probes are sufficiently long, for example, from about 50, 100, or 200 nucleotides to about 1000 or more nucleotides, to enable specific hybridization with the target nucleic acid(s) under stringent conditions.

[00221] Another alternative methodology for determining number of DNA copies is comparative genomic hybridization (CGH). In comparative genomic hybridization methods, a "test" collection of nucleic acids is labeled with a first label, Attorney Docket No. 3300-01-lWO

while a second collection (for example, from a normal cell or tissue) is labeled with a second label. The ratio of hybridization of the nucleic acids is determined by the ratio of the first and second labels binding to each fiber in an array. Differences in the ratio of the signals from the two labels, for example, due to gene amplification in the test collection, is detected and the ratio provides a measure of the target gene copy number, corresponding to the specific probe used. A cytogenetic representation of DNA copy- number variation can be generated by CGH, which provides fluorescence ratios along the length of chromosomes from differentially labeled test and reference genomic DNAs.

[00222] Hybridization protocols suitable for use with the methods of the invention are described, for example, in Albertson (1984) EMBO J. 3 : 1227-1234; Pinkel (1988) Proc. Natl. Acad. Sci. USA, 85 :9138-9142; EPO Pub. No. 430,402; Methods in Molecular Biology, Vol. 33 : In Situ Hybridization Protocols, Choo, ed., Humana Press, Totowa, N.J. (1994).

[00223] Amplification-based assays also can be used to measure the copy number-of the target gene. In such assays, the corresponding target gene nucleic acid sequence act as a template in an amplification reaction (e.g., Polymerase Chain Reaction or PCR). In a quantitative, amplification, the amount of amplification product will be proportional to the amount of template in the original sample. Comparison to appropriate controls provides a measure of the copy-number of the target gene, corresponding to the specific probe used, according to the principles discussed above. Methods of real-time quantitative PCR using TaqMan probes are well known in the art. Detailed protocols for real-time quantitative PCR are provided, for example, for RNA in: Gibson et al., 1996, Genome Res., 10:995-1001 ; and for DNA in: Heid et al., 1996, Genome Res., 10:986-994.

[00224] A TaqMan-based assay also can be used to quantify target gene polynucleotides. TaqMan based assays use a fluorogenic oligonucleotide probe that contains a 5' fluorescent dye and a 3' quenching agent. The probe hybridizes to a PCR product, but cannot itself be, extended due to a blocking agent at the 3' end. When the PCR product is amplified in subsequent cycles, the 5' nuclease activity of the polymerase, for example, AmpliTaq, results in the cleavage of the TaqMan probe. This Attorney Docket No. 3300-01-lWO

cleavage separates the 5' fluorescent dye and the 3' quenching agent, thereby resulting in an increase in fluorescence as a function of amplification (e.g., for example, http://www2.perkin-elmer.com).

[00225] Other suitable amplification methods include, but are not limited to, ligase chain reaction (LCR) (see, Wu and Wallace, Genomics, 4: 560, 1989; Landegren et al., Science, 241 : 1077, 1988; and Barringer et al., Gene, 89: 117, 1990), transcription amplification (Kwoh et al., Proc. Natl. Acad. Sci. USA, 86: 1173, 1989), self-sustained sequence replication (Guatelli et al., Proc Nat Acad Sci, USA 87: 1874, 1990), dot PCR, and linker adapter PCR, for example.

[00226] One method for determining DNA copy numbers uses microarray- based platforms. Microarray technology may be used because it offers high resolution. For example, the traditional CGH generally has a 20 Mb limited mapping resolution; whereas in microarray-based CGH, the fluorescence ratios of the differentially labeled test and reference genomic DNAs provide a locus-by-locus measure of DNA copy- number variation, thereby achieving increased mapping resolution. Details of various microarray methods can be found in the literature. See, e.g., U.S. Pat. No. 6,232,068; Pollack et al., Nat. Genet., 23(l):41-6, (1999).

[00227] As demonstrated in the Examples set forth herein, a number of target genes are frequently amplified (or deleted) in certain cancers, particularly breast, ovarian, colon, bladder, lung, pancreatic, uterus, testicular, prostate, skin, uterine, blood, leukemia, kidney, liver, and brain cancer. The results showing DNA copy number increase of specific target genes can also demonstrate mRNA overexpression. The target genes having characteristic features of overexpression and amplification can indicate a role in oncogenesis. These features are shared with other well-studied oncogenes (Yoshimoto et al., JPN J Cancer Res, 77(6):540-5, 1986; Knuutila et al., Am. J. Pathol, 152(5): 1107-23, 1998). The amplified target genes and the encoded polypeptides are accordingly used in the present invention as targets for cancer diagnosis, prevention, and treatment.

[00228] Overexpression of Target Genes in Tumors Attorney Docket No. 3300-01-lWO

[00229] The expression levels of target genes in tumors cells can be examined. The target gene can correspond to any gene within any amplified or deleted region as well as the specific genes listed in the Tables below. Without wishing to be bound by theory, the target genes are believed to be overexpressed (or underexpressed) in cancers, including breast, colon, lung, ovarian, and prostate cancer. Detection and quantification of target gene expression may be carried out through direct hybridization based assays or amplification based assays. The hybridization based techniques for measuring gene transcript are known to those skilled in the art (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d Ed. vol. 1-3, Cold Spring Harbor Press, NY, 1989). For example, one method for evaluating the presence, absence, or quantity of a target gene is by Northern blot. Isolated mRNAs from a given biological subject are electrophoresed to separate the mRNA species, and transferred from the gel to a membrane, for example, a nitrocellulose or nylon filter. Labeled target gene probes are then hybridized to the membrane to identify and quantify the respective mRNAs. An example of amplification based assays is RT-PCR, which is well known in the art (Ausubel et al., Current Protocols in Molecular Biology, eds. 1995 supplement). Quantitative RT-PCR is used preferably to allow the numerical comparison of the level of the target gene mRNAs in different samples.

[00230] Detection of Target Genes Protein Expression Product [00231] According to the present invention, the detection of increased (or decreased) protein level corresponding to the target gene in a test sample also can indicate the presence of a precancerous or cancerous condition in the tissue source of the sample. The target protein levels can also give important stage, prognostic information as well as information important for making treatment decisions. Protein detection for tumor and cancer diagnostics and prognostics can be carried out by immunoassays, for example, using antibodies directed against a target gene expression product. The target gene expression product can correspond to any gene within any amplified or deleted region as well as the specific genes listed in the Tables below. Any methods that are known in the art for protein detection and quantitation can be used in the methods of this invention, including, inter alia, electrophoresis, capillary Attorney Docket No. 3300-01-lWO

electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, immunoelectrophoresis, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immuno- flouorescent assays, Western Blot, etc. Protein from the tissue or cell type to be, analyzed may be isolated using standard techniques, for example, as described in Harlow and Lane, Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y. 1988). The skilled artisan readily appreciates that these methods can be employed to detect deletions also.

[00232] The antibodies (or fragments thereof) useful in the present invention can, additionally, be employed histologically, as in immunofluorescence or immunoelectron microscopy, for in situ detection of target gene peptides. In situ detection can be accomplished by removing a histological specimen from a patient, and applying thereto a labeled antibody of the present invention. The antibody (or its fragment) is preferably applied by overlaying the labeled antibody (or fragment) onto a biological sample. Through the use of such a procedure, it is possible to determine not only the presence of the target gene product, but also its distribution in the examined tissue. Using the present invention, a skilled artisan will readily perceive that any of a wide variety of histological methods (for example, staining procedures) can be modified to achieve such in situ detection.

[00233] The biological sample that is subjected to protein detection can be brought in contact with and immobilized on a solid phase support or carrier, for example, nitrocellulose, or other solid support which is capable of immobilizing cells, cell particles, or soluble proteins. The support can then be washed with suitable buffers followed by treatment with the detectably labeled fingerprint gene specific antibody. The solid phase-support can then be washed with the buffer a second time to remove unbound antibody. The amount of bound label on the solid support can then be detected by conventional means.

[00234] A target gene product-specific antibody can be detectably labeled, in one aspect, by linking the same to an enzyme, for example, horseradish peroxidase, alkaline phosphatase, or glucoamylase, and using it in an enzyme inmunoassay (EIA) (see, e.g., Voller, A., 1978, The Enzyme Linked Immunosorbent Assay (ELISA), Attorney Docket No. 3300-01-lWO

Diagnostic Horizons, l: \-l; Voller et al., J. Clin. Pathol., 31 :507-520, 1978; Butler, J. E., Meth. Enzymol., 73 :482-523, 1981 ; Maggio, E. (ed.), Enzyme Immunoassay, CRC Press, Boca Raton, FIa., 1980; and Ishikawa et al (eds), .Enzyme Immunoassay, Kgaku Shoin, Tokyo, 1981). The enzyme bound to the antibody reacts with an appropriate substrate, preferably a chromogenic substrate, in such a manner as to produce a chemical moiety that can be detected, for example, by spectrophotometric or fluorimetric means, or by visual inspection.

[00235] In a related aspect, therefore, the present invention provides the use of target gene product antibodies in cancer diagnosis and intervention. Antibodies that specifically bind to the target gene protein and polypeptides can be produced by a variety of methods. Such antibodies may include, but are not limited to, polyclonal antibodies, monoclonal antibodies (mAbs), humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab')2 fragments, fragments produced by a Fab expression library, anti-idiotypic (anti-Id) antibodies, and epitope-binding fragments of any of the above.

[00236] Such antibodies can be used, for example, in the detection of the target gene, or its fingerprint or pathway genes involved in a particular biological pathway, which may be of physiological or pathological importance. These potential pathways or fingerprint genes, for example, may interact with the target gene's activity and be involved in tumorigenesis. The target gene product antibodies also can be used in a method for the inhibition of the target gene product activity. Thus, such antibodies can be used in treating tumors and cancers (e.g., breast cancer and ovarian cancer) they also may be used in diagnostic procedures whereby patients are tested for abnormal levels of the target gene product protein, and/or fingerprint or pathway gene product associated with the target gene, and for the presence of abnormal forms of such protein.

[00237] To produce antibodies to the target gene product protein, a host animal is immunized with the protein, or a portion thereof. Such host animals can include, but are not limited to, rabbits, mice, and rats. Various adjuvants can be used to increase the immunological response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels, for example, aluminum hydroxide, surface active substances, for example, lysolecithin, pluronic polyols, polyanions, Attorney Docket No. 3300-01-lWO

peptides, oil emulsions, keyhole limpet hemocyanin (KLH), dinitrophenol (DNP), and potentially useful human adjuvants, for example, BCG (Bacille Calmette-Guerin) and Corynebacterium parvum.

[00238] Monoclonal antibodies, which are homogeneous populations of antibodies to a particular antigen {e.g., the target gene product) as in the present invention, can be obtained by any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to the hybridoma technique of Kohler and Milstein, {Nature, 256:495-497, 1975; and U.S. Pat. No. 4,376, 110), the human B-cell hybridoma technique (Kosbor et al., Immunology Today, 4:72, 1983; Cole et al., Proc. Natl. Acad. Sci. USA, 80:2026- 2030, 1983), and the BV-hybridoma technique (Cole et al., Monoclonal Antibodies And Cancer Therapy (Alan R. Liss, Inc. 1985), pp. 77-96. Such antibodies can be of any immunoglobulin class including IgG, IgM, IgE, IgA, IgD and any subclass thereof. The hybridoma producing the mAb of this invention can be cultivated in vitro or in vivo. Production of high titers of mAbs in vivo makes this the presently preferred method of production.

[00239] In addition, techniques developed for the production of "chimeric antibodies" can be made by splicing the genes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity (see, Morrison et al., Proc. Natl. Acad. Sci. USA, 81 :6851-6855, 1984; Neuberger et al., Nature, 312:604-608, 1984; Takeda et al., Nature, 314:452-454, 1985; and U.S. Pat. No. 4,816,567). A chimeric antibody is a molecule in which different portions are derived from different animal species, for example, those having a variable region derived from a murine mAb and a container region derived from human immunoglobulin.

[00240] Alternatively, techniques described for the production of single chain antibodies (for example, U.S. Pat. No. 4,946,778; Bird, Science, 242:423-426, 1988; Huston et al., Proc. Natl. Acad. Sci. USA, 85 :5879-5883, 1988; and Ward et al, Nature, 334:544-546, 1989), and for making humanized monoclonal antibodies (U.S. Pat. No. 5,225,539), can be used to produce anti-differentially expressed or anti-pathway gene product antibodies. Attorney Docket No. 3300-01-lWO

[00241] Knappik et al. (see U.S. Pat. No. 6,300,064) describe methods for generating antibody libraries of human-derived antibody genes, which cover the antibodies encoded in the human genome. The methods disclosed also enable creation of useful libraries of (poly)peptides in general.

[00242] Antibody fragments that recognize specific epitopes can be generated by known techniques. For example, such fragments include but are not limited to: the F(ab')2 fragments that can be produced by pepsin digestion of the antibody molecule, and the Fab fragments that can be generated by reducing the disulfide bridges of the F(ab')2 fragments. Alternatively, Fab expression libraries can be constructed (Huse et al. , Science, 246: 1275-1281 , 1989) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity.

[00243] Use of Target Gene Modulators in Cancer Diagnostics [00244] In addition to antibodies, the present invention provides, in another aspect, the diagnostic and therapeutic utilities of other molecules and compounds that interact with the target gene product protein. Specifically, such compounds can include, but are not limited to proteins or peptides, comprising extracellular portions of transmembrane proteins of the target, if they exist. Exemplary peptides include soluble peptides, for example, Ig-tailed fusion peptides. Such compounds also can be obtained through the generation and screening of random peptide libraries (see, e.g., Lam et al., Nature, 354:82-84, 1991 ; Houghton et al., Nature, 354:84-86, 1991), made of D- and/or L-configuration amino acids, phosphopeptides (including, but not limited to, members of random or partially degenerate phosphopeptide libraries; see, e.g. , Songyang et al., Cell, 12:161-11%, 1993), and small organic or inorganic molecules. In this aspect, the present invention provides a number of methods and procedures to assay or identify compounds that bind to a target protein, or to any cellular protein that may interact with the target, and compounds that may interfere with the interaction of the target with other cellular proteins.

[00245] In vitro assay systems are provided that are capable of identifying compounds that specifically bind to the target gene product. The assays involve, for example, preparation of a reaction mixture of the target gene product and a test Attorney Docket No. 3300-01-lWO

compound under conditions and for a time sufficient to allow the two components to interact and bind, thus forming a complex that can be removed and/or detected in the reaction mixture. These assays can be conducted in a variety of ways. For example, one method involves anchoring the target protein or the test substance to a solid phase, and detecting target protein-test compound complexes anchored to the solid phase at the end of the reaction. In one aspect of such a method, the target protein can be anchored onto a solid surface, and the test compound, which is not anchored, can be labeled, either directly or indirectly. In practice, microtiter plates can be used as the solid phase. The anchored component can be immobilized by non-covalent or covalent attachments. Non-covalent attachment can be accomplished by simply coating the solid surface with a solution of the protein and drying. Alternatively, an immobilized antibody, preferably a monoclonal antibody, specific for the protein to be immobilized can- be used to anchor the protein to the solid surface. The surfaces can be prepared in advance and stored.

[00246] To conduct the assay, the non-immobilized component is added to the coated surface containing the anchored component. After the reaction is complete, unreacted components are removed, for example, by washing, and complexes anchored on the solid surface are detected. Where the previously immobilized component is pre- labeled, the detection of label immobilized on the surface indicates that complexes were formed. Where the previously non-immobilized component is not pre-labeled, an indirect label can be used to detect complexes anchored on the surface; for example, using a labeled antibody specific for the immobilized component (the antibody, in turn, can be directly labeled or indirectly labeled with a labeled anti-Ig antibody). Alternatively, the reaction can be conducted in a liquid phase, the reaction products separated from unreacted components, and complexes detected, for example, using an immobilized antibody specific for a target gene or the test compound to anchor any complexes formed in solution, and a labeled antibody specific for the other component of the possible complex to detect anchored complexes.

[00247] Assays also are provided for identifying any cellular protein that may interact with the target protein. Any method suitable for detecting protein-protein interactions can be used to identify novel interactions between target protein and Attorney Docket No. 3300-01-lWO

cellular or extracellular proteins. Those cellular or extracellular proteins may be involved in certain cancers, for example, breast, colon, lung, ovarian, and prostate cancer, and represent certain tumorigenic pathways including the target. They may thus be denoted as pathway genes.

[00248] Methods, for example, co-immunoprecipitation and co-purification through gradients or chromatographic columns, can be used to identify protein-protein interactions engaged by the target protein. The amino acid sequence of the target protein or a portion thereof, is useful in identifying the pathway gene products or other proteins that interact with the target protein. The amino acid sequence of pathway gene products or other proteins can be derived from the nucleotide sequence, or from published database records (SWISS-PROT, PIR, EMBL); it also can be ascertained using techniques well known to a skilled artisan, for example, the Edman degradation technique (see e.g., Creighton, Proteins: Structures and Molecular Principles, 1983, W. H. Freeman & Co;, N. Y., 34-49). The nucleotide subsequences of the target gene can be used in a reaction mixture to screen for pathway gene sequences. Screening can be accomplished, for example, by standard hybridization or PCR techniques. Techniques for the generation of oligonucleotide mixtures and the screening are well known (see, e.g., Ausubel, supra, and Innis et ah, (eds.), PCR Protocols: A Guide to Methods and Applications, 1990, Academic Press, Inc., New York).

[00249] By way of example, the yeast two-hybrid system which is often used in detecting protein interactions in vivo is discussed herein. Chien et al. has reported the use of a version of the yeast two-hybrid system (Proc. Natl. Acad. Sci. USA, 1991 , 88:9578-9582); it is commercially available from Clontech (Palo Alto, Calif.). Briefly, utilizing such a system, plasmids are constructed that encode two hybrid proteins: the first hybrid protein comprises the DNA-binding domain of a transcription factor, for example, activation protein, fused to a known protein, in this case, a protein known to be involved in a tumor or cancer, and the second hybrid protein comprises the transcription factor's activation domain fused to an unknown protein that is encoded by a cDNA which has been recombined into this plasmid as part of a cDNA library. The plasmids are transformed into a strain of the yeast Saccharomyces cerevisiae that contains a reporter gene, for example, lacZ, whose expression is regulated by the Attorney Docket No. 3300-01-lWO

transcription factor's binding site. Either hybrid protein alone cannot activate transcription of the reporter gene. The DNA binding hybrid protein cannot activate transcription because it does not provide the activation domain function, and the activation domain hybrid protein cannot activate transcription because it lacks the domain required for binding to its target site, i.e. , it cannot localize to the transcription activator protein's binding site. Interaction between the DNA binding hybrid protein and the library encoded protein reconstitutes the functional transcription factor and results in expression of the reporter gene, which is detected by an assay for the reporter gene product.

[00250] The two-hybrid system or similar methods can be used to screen activation domain libraries for proteins that interact with a known "bait" gene product. The target gene product, involved in a number of tumors and cancers, is such a bait according to the present invention. Total genomic or cDNA sequences are fused to the DNA encoding an activation domain. This library and a plasmid encoding a hybrid of the bait gene product, i.e., target protein or polypeptides, fused to the DNA-binding domain are co-transformed into a yeast reporter strain, and the resulting transformants are screened for those that express the reporter gene. For example, the bait target gene can be cloned into a vector such that it is translationally fused to the DNA encoding the DNA-binding domain of the GAL4 protein. The colonies are purified and the plasmids responsible for reporter gene expression are isolated. The inserts in the plasmids are sequenced to identify the proteins encoded by the cDNA or genomic DNA.

[00251] A cDNA library of a, cell or tissue source that expresses proteins predicted to interact with the bait gene product, can be made using methods routinely practiced in the art. According to the particular system described herein, the library is generated by inserting the cDNA fragments into a vector such that they are translationally fused to the activation domain of GAL4. This library can be cotransformed along with the bait gene-GAL4 fusion plasmid into a yeast strain which contains a lacZ gene whose expression is controlled by a promoter which contains a GAL4 activation sequence. A cDNA encoded protein, fused to GAL4 activation domain, that interacts with the bait gene product will reconstitute an active GAL4 transcription factor and thereby drive expression of the lacZ gene. Colonies that Attorney Docket No. 3300-01-lWO

express lacZ can be detected by their blue color in the presence of X-gal. Plasmids from such a blue colony can then be purified and used to produce and isolate the target gene-interacting protein using techniques routinely practiced in the art.

[00252] The assay systems involve, for example, preparation of a reaction mixture containing the target gene product protein, and the binding partner under conditions and for a time sufficient to allow the two products to interact and bind, thus forming a complex. To test a compound for inhibitory activity, the reaction mixture is prepared in the presence and absence of the test compound. The test compound can be initially included in the reaction mixture, or can be added at a time subsequent to the addition of a target gene product and its cellular or extracellular binding partner. Control reaction mixtures are incubated without the test compound or with a placebo. The formation of complexes between the target gene product protein and the cellular or extracellular binding partner is then detected. The formation of a complex in the control reaction, but not in the reaction mixture containing the test compound, indicates that the compound interferes with the interaction of the target gene product protein and the interactive binding partner. Additionally, complex formation within reaction mixtures containing the test compound and normal target gene product can be compared to complex formation within reaction mixtures containing the test compound and mutant target gene product. This comparison can be important in the situation where it is desirable to identify compounds that disrupt interactions of mutant but not normal target gene product.

[00253] The assays can be conducted in a heterogeneous or homogeneous format. Heterogeneous assays involve anchoring either the target gene product protein or the binding partner to a solid phase and detecting complexes anchored to the solid phase at the end of the reaction, as described above. In homogeneous assays, the entire reaction is carried out in a liquid phase, as described below. In either approach, the order of addition of reactants can be varied to obtain different information about the compounds being tested. For example, test compounds that interfere with the interaction between the target gene product protein and the binding partners, for example, by competition, can be identified by conducting the reaction in the presence of the test substance; i.e., by adding the test substance to the reaction mixture prior to or Attorney Docket No. 3300-01-lWO

simultaneously with the target gene product protein and interactive cellular or extracellular binding partner. Alternatively, test compounds that disrupt preformed complexes, for example, compounds with higher binding constants that displace one of the components from the complex, can be tested by adding the test compound to the reaction mixture after complexes have been formed.

[00254] In a homogeneous assay, a preformed complex of the target gene product and the interactive cellular or extracellular binding partner product is prepared in which either the target gene products or their binding partners are labeled, but the signal generated by the label is quenched due to complex formation (see e.g., Rubenstein, U.S. Pat. No. 4,109,496). The addition of a test substance that competes with and displaces one of the species from the preformed complex will result in the generation of a signal above background. The test substances that disrupt the interaction between the target gene product protein and cellular or extracellular binding partners can thus be identified.

[00255] In one aspect, the target gene product protein can be prepared for immobilization using recombinant DNA techniques. For example, the target gene product protein (or fragment thereof) coding region can be fused to a glutathione-S- transferase (GST) gene using a fusion vector, for example, pGEX-5X-l , in such a manner that its binding activity is maintained in the resulting fusion product. The interactive cellular or extracellular binding partner product is purified and used to raise a monoclonal antibody, using methods routinely practiced in the art. This antibody can be labeled with the radioactive isotope ¹²⁵I, for example, by methods-routinely practiced in the art.

[00256] In a heterogeneous assay, the GST-Target gene fusion product is anchored, for example, to glutathione-agarose beads. The interactive cellular or extracellular binding partner is then added in the presence or absence of the test compound in a manner that allows interaction and binding to occur. At the end of the reaction period, unbound material is washed away, and the labeled monoclonal antibody can be added to the system and allowed to bind to the complexed components. The interaction between the target gene product protein and the interactive cellular or extracellular binding partner is detected by measuring the corresponding amount of Attorney Docket No. 3300-01-lWO

radioactivity that remains associated with the glutathione-agarose beads. A successful inhibition of the interaction by the test compound will result in a decrease in measured radioactivity. Alternatively, the GST-target gene fusion product and the interactive cellular or extracellular binding partner can be mixed together in liquid in the absence of the solid glutathione-agarose beads. The test compound is added either during or after the binding partners are allowed to interact. This mixture is then added to the glutathione-agarose beads and unbound material is washed away. Again, the extent of inhibition of the binding partner interaction can be detected by adding the labeled antibody and measuring the radioactivity associated with the beads.

[00257] In other aspects of the invention, these same techniques are employed using peptide fragments that correspond to the binding domains of the target gene product and the interactive cellular or extracellular binding partner (where the binding partner is a product), in place of one or both of the full-length products. Any number of methods routinely practiced in the art can be used to identify and isolate the protein's binding site. These methods include, but are not limited to, mutagenesis of one of the genes encoding one of the products and screening for disruption of binding in a co- immunoprecipitation assay.

[00258] Additionally, compensating mutations in the gene encoding the second species in the complex can be selected. Sequence analysis of the genes encoding the respective products will reveal mutations that correspond to the region of the product involved in interactive binding. Alternatively, one product can be anchored to a solid surface using methods described above, and allowed to interact with and bind to its labeled binding partner, which has been treated with a proteolytic enzyme, for example, trypsin. After washing, a short, labeled peptide comprising the binding domain can remain associated with the solid material, which can be isolated and identified by amino acid sequencing. Also, once the gene coding for the cellular or extracellular binding partner product is obtained, short gene segments can be engineered to express peptide fragments of the product, which can then be tested for binding activity and purified or synthesized.

[00259] Methods for Cancer Treatment Using Target Gene Modulators Attorney Docket No. 3300-01-lWO

[00260] In another aspect, the present invention provides methods for treating or controlling a cancer or tumor and the symptoms associated therewith. Any compounds, for example, those identified in the aforementioned assay systems, can be tested for the ability to prevent and/or ameliorate symptoms of tumors and cancers (e.g., breast, colon, lung, ovarian, and prostate cancer). As used herein, inhibit, control, ameliorate, prevent, treat, and suppress collectively and interchangeably mean stopping or slowing cancer formation, development, or growth and/or eliminating or reducing cancer symptoms. Cell-based and animal model-based trial systems for evaluating the ability of the tested compounds to prevent and/of ameliorate tumors and cancer symptoms are used according to the present invention.

[00261] For example, cell based systems can be exposed to a compound suspected of ameliorating cancer symptoms, at a sufficient concentration and for a time sufficient to elicit such an amelioration in the exposed populations of cells. After exposure, the populations of cells are examined to determine whether one or more tumor/cancer phenotypes represented in the populations has been altered to resemble a more normal or more wild-type, non-cancerous phenotype. Further, the levels of target gene mRNA expression and DNA amplification within these cells may be determined, according to the methods provided herein. A decrease in the observed level of expression and amplification would indicate the successful intervention of tumors and cancers (e.g., breast, colon, lung, ovarian, and prostate cancer).

[00262] In addition, animal models can be used to identify compounds for use as drugs and pharmaceuticals that are capable of treating or suppressing symptoms of tumors and cancers. For example, animal models can be exposed to a test compound at a sufficient concentration and for a time sufficient to elicit such an amelioration in the exposed animals. The response of the animals to the exposure can be monitored by assessing the reversal of symptoms associated with the tumor or cancer, or by evaluating the changes in DNA copy number in cell populations and levels of mRNA expression of the target gene. Any treatments which reverse any symptom of tumors and cancers, and/or which reduce overexpression and amplification of the target gene may be considered as candidates for therapy in humans. Dosages of test agents can be determined-by deriving dose-response curves. Attorney Docket No. 3300-01-lWO

[00263] Moreover, fingerprint patterns or gene expression profiles can be characterized for known cell states, for example, normal or known pre-neoplastic, neoplastic, or metastatic states, within the cell- and/or animal-based model systems. Subsequently, these known fingerprint patterns can be compared to ascertain the ability of a test compound to modify such fingerprint patterns, and to cause the pattern to more closely resemble that of a normal fingerprint pattern. For example, administration of a compound which interacts with and affects target gene expression and amplification or cells overexpressing or having amplification may cause the fingerprint pattern of a precancerous or cancerous model system to more closely resemble a control, normal system; such a compound thus will have therapeutic utilities in treating the cancer. In other situations, administration of a compound may cause the fingerprint pattern of a control system to begin to mimic tumors and cancers (e.g. , breast cancer and ovarian cancer); such a compound therefore acts as a tumorigenic agent, which in turn can serve as a target for therapeutic interventions of the cancer and its diagnosis.

[00264] In another aspect, the present invention also provides assays for compounds that interfere with gene and cellular protein interactions involving the target gene. The target gene product protein, may interact in vivo with one or more cellular or extracellular macromolecules, for example, proteins and nucleic acid molecules. Such cellular and extracellular macromolecules are referred to as "binding partners." Compounds that disrupt such interactions can be used to regulate the activity of the target gene product protein, especially mutant target gene product. Such compounds can include, but are not limited to, molecules, for example, antibodies, peptides and other chemical compounds.

[00265] Methods for Identifying Small Molecules That Can be Used as Target Gene Modulator

[00266] As described herein, the modulators contemplated by the present invention can be small organic compounds. Such modulators can be identified by assays (e.g., in microtiter formats on microtiter plates in robotic assays) used to screen large numbers of compounds. There are many suppliers of chemical compounds, Attorney Docket No. 3300-01-lWO

including Sigma (St. Louis, Mo.), Aldrich (St. Louis, Mo.), Sigma-Aldrich (St. Louis, Mo.), Fluka Chemika-Biochemica Analytika (Buchs Switzerland) and the like.

[00267] In particular, modulators displaying a desired activity can be identified from combinatorial libraries (i.e., collections of diverse chemical compounds generated by either chemical synthesis or biological synthesis by combining a number of "building, blocks"). Preparation and screening of combinatorial libraries is well known to those of skill in the art. Such combinatorial libraries include, but are not limited to, peptide libraries (see e.g., U.S. Pat. 5,010, 175, Furka, Int. J. Pept. Prot. Res. 37:487- 493 (1991) and Houghton et al., Nature 354:84-88 (1991)). Other chemistries for generating chemical diversity libraries also can be used. Such chemistries include, but are not limited to: peptoids (see, for example, PCT Publication No. WO 91/19735), encoded peptides (e.g., PCT Publication WO 93/20242), random bio-oligomers (e.g., PCT Publication No. WO 92/00091), benzodiazepines (see, for example, U.S. Pat. No. 5,288,514), diversomers such as hydantoins, benzodiazepines and dipeptides (Hobbs et al., Proc. Nat. Acad. Sci. USA 90:6909-6913 (1993)), vinylogous polypeptides (Hagihara et al., J. Amer. Chem. Soc. 114:6568 (1992)), nonpeptidal peptidomimetics with glucose scaffolding (Hirschmann et al., J. Amer. Chem. Soc. 114:9217-9218 (1992)), analogous organic syntheses of small compound libraries (Chen et al., J. Amer. Chem. Soc. 116:2661 (1994)), oligocarbamates (Cho et al., Science 261 : 1303 (1993)), and/or peptidyl phosphonates (Campbell et al., J. Org. Chem. 59:658 (1994)), nucleic acid libraries (see e.g., Ausubel; Berger and Sambrook, all supra), peptide nucleic acid libraries (see e.g., U.S. Pat. No. 5,539,083), antibody libraries (see e.g., Vaughn et al. , Nature Biotechnology, 14(3):309-314 (1996) and PCT/US96/10287), carbohydrate libraries (see e.g., Liang et al., Science, 274: 1520-1522 (1996) and U.S. Pat. No. 5,593,853), small organic molecule libraries (see, for example, benzodiazepines, Baum C&EN, Jan 18, page 33 (1993); isoprenoids, U.S. Pat. No. 5,569,588; thiazolidinones and metathiazanones, U.S. Pat. No. 5,549,974; pyrrolidines, U.S. Pat. Nos. 5,525,735 and 5,519,134; morpholino compounds, U.S. Pat. No. 5,506,337; benzodiazepines, U.S. Pat. No. 5,288,514, and the like).

[00268] Devices for the preparation of combinatorial libraries are commercially available (see e.g., 357 MPS, 390 MPS, Advanced Chem Tech, Louisville Attorney Docket No. 3300-01-lWO

Ky., Symphony, Rainin, Woburn, Mass., 433A Applied Biosystems, Foster City, Calif., 9050 Plus, Millipore, Bedford, Mass.). In addition, numerous combinatorial libraries are commercially available (see e.g., ComGenex, Princeton, N.J., Tripos, Inc., St. Louis, Mo., 3D Pharmaceuticals, Exton, Pa., Martek Biosciences, Columbia, Md., etc.).

[00269] High-throughput assays also can be used to identify the modulators. Using the high-throughput assays, it is possible to screen thousands of potential modulators in a single day. For example, each well of a microtiter plate can be used to run a separate assay against a selected potential modulator, or, if concentration or incubation time effects are to be observed, every 5-10 wells can test a single modulator. Thus, a single standard microtiter plate can assay about 100 (for example, 96) modulators. If 1536 well plates are used, then a single plate easily can assay from about 100- about 1500 different compounds.

[00270] Methods for Monitoring Efficacy of Cancer Treatment [00271] In one aspect, the present invention provides methods for monitoring the efficacy of a therapeutic treatment regimen of cancer and methods for monitoring the efficacy of a compound in clinical trials or other research studies for inhibition of tumors. The monitoring can be accomplished by detecting and measuring, in the biological samples taken from a patient at various time points during the course of the application of a treatment regimen for treating a cancer or a clinical trial or other research studies, the changed levels of expression or amplification of the target gene in the cell population or sample. A level of expression and/or amplification that is lower in samples taken at the later time of the treatment or trial or a research study than those at the earlier time indicates that the treatment regimen is effective to control the cancer in the patient, or the compound is effective in inhibiting the tumor. In contrast, samples taken at the later time of the treatment or trial or a research study showing no statistically significant decrease in level of expression and/or amplification than those at the earlier time indicates that the treatment regimen is not effective to control the cancer in the patient, or the compound is not effective in inhibiting the tumor. Of course, the time course studies should be so designed that sufficient time is allowed for the treatment regimen or the compound to exert any effect it may have. Attorney Docket No. 3300-01-lWO

[00272] Therefore, the influence of compounds on tumors and cancers can be monitored both in a clinical trial or other research studies and in a basic drug screening. In a clinical trial or other research studies, for example, tumor cells can be isolated from e.g. , breast, colon, lung, ovarian, and prostate cancer tumor removed by surgery, and RNA prepared and analyzed by Northern blot analysis or TaqMan RT-PCR as described herein, or alternatively by measuring the amount of protein produced. The fingerprint expression profiles thus generated can serve as putative biomarkers for breast, colon, lung, brain, or ovarian tumor or cancer. Particularly, the expression of one or more target genes serves as such a biomarker. Thus, by monitoring the level of expression of the differentially or over-expressed genes, an effective treatment protocol can be developed using suitable chemotherapeutic anticancer drugs.

[00273] Use of Additional Modulators to Target Nucleotides in Cancer Treatment

[00274] In another further aspect of this, invention, additional compounds and methods for treatment of tumors are provided. Symptoms of tumors and cancers can be controlled by, for example, target gene modulation, and/or by a depletion of the precancerous or cancerous cells. Target gene modulation can be of a negative or positive nature, depending on whether the target resembles a gene (e.g., tumorigenic) or a tumor suppressor gene (e.g., tumor suppressive). That is, inhibition, i.e., a negative modulation, of an oncogene-like target gene or stimulation, i.e., a positive modulation, of a tumor suppressor-like target gene will control or ameliorate the tumor or cancer in which the target gene is involved. More precisely, "negative modulation" refers to a reduction in the level and/or activity of target gene or its product, relative to the level and/or activity of the target gene or its product in the absence of the modulatory treatment. "Positive modulation" refers to an increase in the level and/or activity of target gene or its product, relative to the level and/or activity of target gene or its product in the absence of modulatory treatment. Particularly because the target genes share many features with well known oncogenes as discussed supra, inhibition of a target gene, its protein or activity will control or ameliorate precancerous or cancerous conditions, for example, breast, colon, lung, ovarian, and prostate cancer. Attorney Docket No. 3300-01-lWO

[00275] The techniques to inhibit or suppress a target gene that is involved in cancer are provided in the present invention. Such approaches include negative modulatory techniques. For example, compounds that exhibit negative modulatory activity on target gene can be used in accordance with the invention to prevent and/or ameliorate symptoms of tumors and cancers (e.g., breast, colon, lung, ovarian, and prostate cancer). Such molecules can include, but are not limited to, peptides, phosphopeptides, small molecules (molecular weight below about 500 Daltons), large molecules (molecular weight above about 500 Daltons), or antibodies (including, for example, polyclonal, monoclonal, humanized, anti-idiotypic, chimeric or single chain antibodies, and Fab, F(ab')₂ and Fab expression library fragments, and epitope-binding fragments thereof), and nucleic acid molecules that interfere with replication, transcription, or translation of the target gene (e.g., antisense RNA, Antisense DNA, DNA decoy or decoy molecule, siRNAs, miRNA, triple helix forming molecules, and ribozymes, which can be administered in any combination).

[00276] Antisense, siRNAs, miRNAs, and ribozyme molecules that inhibit expression of a target gene, can be used to reduce the level of the functional activities of the target gene and its product, for example, reduce the catalytic potency the target gene product protein. Triple helix forming molecules can be used in reducing the level of target gene activity. These molecules can be designed to reduce or inhibit either wild type, or if appropriate, mutant target gene activity.

[00277] For example, anti-sense RNA and DNA molecules act to directly block the translation of mRNA by hybridizing to targeted mRNA and preventing protein translation. With respect to antisense DNA or DNA decoy, oligodeoxyribonucleotides derived from the translation initiation site, for example, between the -10 and +10 regions of the target gene nucleotide sequence of interest, are preferred.

[00278] Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. A review is provided in Rossi, Current Biology, 4:469-471 (1994). The mechanism of ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by an endonucleolytic cleavage. A composition of ribozyme molecules must include one or more sequences complementary to the target gene mRNA, and must include a well- Attorney Docket No. 3300-01-lWO

known catalytic sequence responsible for mRNA cleavage (U.S. Pat. No. 5,093,246). Engineered hammerhead motif ribozyme molecules that may specifically and efficiently catalyze internal cleavage of RNA sequences encoding target protein may be used according to this invention in cancer intervention.

[00279] Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the molecule of interest, for example, target gene RNA, for ribozyme cleavage sites which include the following sequences, GUA, GUU and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site can be evaluated for predicted structural features, for example, secondary structure, that can render an oligonucleotide sequence unsuitable. The suitability of candidate sequences also can be evaluated by testing their accessibility to hybridization with complementary oligonucleotides, using ribonuclease protection assays.

[00280] The target gene sequences also can be employed in an RNA interference context. The phenomenon of RNA interference is described and discussed in Bass, Nature, 411 :. 428-29 (2001); Elbashir et al , Nature, 41 1 : 494-98 (2001); and Fire et al., Nature, 391 : 806-11 (1998), where methods of making interfering RNA also are discussed. The double-stranded RNA based upon the target gene sequences disclosed herein is typically less than 100 base pairs ("bps") in length and constituency and preferably is about 30 bps or shorter, and can be made by approaches known in the art, including the use of complementary DNA strands or synthetic approaches. The RNAs that are capable of causing interference can be referred to as small interfering RNAs (siRNAs), small hairpin RNAs (shRNAs), or microRNAs (miRNAs), and can cause post-transcriptional silencing of specific genes in cells, for example, mammalian cells (including human cells) and in the body, for example, mammalian bodies (including humans). Exemplary siRNAs according to the invention could have up to 30 bps, 29 bps, 25 bps, 22 bps, 21 bps, 20 bps, 15 bps, 10 bps, 5 bps or any number thereabout or therebetween.

[00281] Nucleic acid molecules that can associate together in a triple-stranded conformation (triple helix) and that thereby can be used to inhibit transcription of a target gene, should be single helices composed of deoxynucleotides. The base Attorney Docket No. 3300-01-lWO

composition of these oligonucleotides must be designed to promote triple helix formation via Hoogsteen base pairing rules, which generally require sizeable stretches of either purines or pyrimidines on one strand of a duplex. Nucleotide sequences can be pyrimidine-based, which will result in TAT and CGC triplets across the three associated strands of the resulting triple helix. The pyrimidine-rich molecules provide bases complementary to a purine-rich region of a single strand of the duplex in a parallel orientation to that strand. In addition, nucleic acid molecules can be chosen that are purine-rich, for example, those that contain a stretch of G residues. These molecules will form a triple helix with a DNA duplex that is rich in GC pairs, in which the majority of the purine residues are located on a single strand of the targeted duplex, resulting in GGC triplets across the three strands in the triplex. Alternatively, the potential sequences that can be targeted for triple helix formation can be increased by creating a so-called "switchback" nucleic acid molecule. Switchback molecules are synthesized in an alternating 5 '-3', 3 '-5' manner, such that they base pair first with one strand of a duplex and then the other, eliminating the necessity for a sizeable stretch of either purines or pyrimidines on one strand of a duplex.

[00282] In instances wherein the antisense, ribozyme, siRNA, miRNA, and triple helix molecules described herein are used to reduce or inhibit mutant gene expression, it is possible that they also can effectively reduce or inhibit the transcription (for example, using a triple helix) and/or translation (for example, using antisense or ribozyme molecules) of mRNA produced by the normal target gene allele. These situations are pertinent to tumor suppressor genes whose normal levels in the cell or tissue need to be maintained while a mutant is being inhibited. To do this, nucleic acid molecules which are resistant to inhibition by any antisense, ribozyme or triple helix molecules used, and which encode and express target gene polypeptides that exhibit normal target gene activity, can be introduced into cells via gene therapy methods. Alternatively, when the target gene encodes an extracellular protein, it may be preferable to co-administer normal target gene protein into the cell or tissue to maintain the requisite level of cellular or tissue target gene activity. By contrast, in the case of oncogene-like target genes, it is the respective normal wild-type gene and its protein that need to be suppressed. Thus, any mutant or variants that are defective in Attorney Docket No. 3300-01-lWO

target gene function or that interferes or completely abolishes its normal function would be desirable for cancer treatment. Therefore, the same methodologies described above to safeguard normal gene alleles may be used in the present invention to safeguard the mutants of the target gene in the application of antisense, ribozyme, and triple helix treatment.

[00283] Antisense RNA and DNA or DNA decoy, ribozyme, and triple helix molecules of the invention can be prepared by standard methods known in the art for the synthesis of DNA and RNA molecules. These include techniques for chemically synthesizing oligodeoxyribonucleotides and oligoribonucleotides well known in the art, for example, solid phase phosphoramidite chemical synthesis. Alternatively, RNA molecules can be generated by in vitro and in vivo transcription of DNA sequences encoding the antisense RNA molecule. Such DNA sequences can be incorporated into a wide variety of vectors which also include suitable RNA polymerase promoters, for example, the T7 or SP6 polymerase promoters. Alternatively, antisense cDNA constructs that synthesize antisense RNA constitutively or inducibly, depending on the promoter used, can be introduced stably into cell lines. Various well-known modifications to the DNA molecules can be introduced as a means for increasing intracellular stability and half-life. Possible modifications include, but are not limited to, the addition of flanking sequences of ribo- or deoxy-nucleotides to the 5' and/or 3' ends of the molecule, or the use of phosphorothioate or T O-methyl rather than phosphodiesterase linkages within the oligodeoxyribonucleotide backbone.

[00284] In this aspect, the present invention also provides negative modulatory techniques using antibodies. Antibodies can be generated which are both specific for a target gene product and which reduce target gene product activity; they can be administered when negative modulatory techniques are appropriate for the treatment of tumors and cancers.

[00285] In instances where the target gene protein to which the antibody is directed is intracellular, and whole antibodies are used, internalizing antibodies are preferred. However, lipofectin or liposomes can be used to deliver the antibody, or a fragment of the Fab region which binds to the target gene epitope, into cells. Where fragments of an antibody are used, the smallest inhibitory fragment which specifically Attorney Docket No. 3300-01-lWO

binds to the binding domain of the protein is preferred. For example, peptides having an amino acid sequence corresponding to the domain of the variable region of the antibody that specifically binds to the target gene protein can be used. Such peptides can be synthesized chemically or produced by recombinant DNA technology using methods well known in the art (for example, see Creighton, 1983, supra; and Sambrook et al., 1989, supra). Alternatively, single chain neutralizing antibodies that bind to intracellular target gene product epitopes also can be administered. Such single chain antibodies can be administered, for example, by expressing nucleotide sequences encoding single-chain antibodies within the target cell population by using, for example, techniques, for example, those described in Marasco et al. , Proc. Natl. Acad. Sci. USA, 90:7889-7893 (1993). When the target gene protein is extracellular, or is a transmembrane protein, any of the administration techniques known in the art which are appropriate for peptide administration can be used to effectively administer inhibitory target gene antibodies to their site of action. The methods of administration and pharmaceutical preparations are discussed below.

[00286]

[00287] Cancer Vaccines Using Target Genes and Proteins

[00288] One aspect of the invention relates to methods for inducing an immunological response in a mammal which comprises inoculating the mammal with target gene product polypeptide, or a fragment thereof, adequate to produce antibody and/or T cell immune response to protect the mammal from cancers, including breast, colon, lung, ovarian, and prostate cancer.

[00289] In another aspect, the invention relates to peptides derived from the target amino acid sequence where those skilled in the art would be aware that the peptides of the present invention, or analogs thereof, can be synthesized by automated instruments sold by a variety of manufacturers, can be commercially custom ordered and prepared, or can be expressed from suitable expression vectors as described above. The term amino acid analogs has been previously described in the specification and for purposes of describing peptides of the present invention, analogs can further include branched or non-linear peptides. Attorney Docket No. 3300-01-lWO

[00290] The present invention therefore provides pharmaceutical compositions comprising target proteins or peptides derived therefrom for use in vaccines and in immunotherapy methods. When used as vaccines to protect mammals against cancer, the pharmaceutical composition can comprise as an immunogen cell lysate from cells transfected with a recombinant expression vector or a culture supernatant containing the expressed protein. Alternatively, the immunogen is a partially or substantially purified recombinant protein or a synthetic peptide.

[00291] Vaccination can be conducted by conventional methods. For example, the immunogen can be used in a suitable diluent such as saline or water, or complete or incomplete adjuvants. Further, the immunogen may or may not be bound to a carrier to make the protein immunogenic. Examples of such carrier molecules include but are not limited to bovine serum albumin (BSA), keyhole limpet hemocyanin (KLH), tetanus toxoid, and the like. The immunogen can be administered by any route appropriate for antibody production such as intravenous, intraperitoneal, intramuscular, subcutaneous, and the like. The immunogen may be administered once or at periodic intervals until a significant titer of anti -target protein antibody is produced. The antibody may be detected in the serum using an immunoassay.

[00292] In another aspect, the present invention provides pharmaceutical compositions comprising nucleic acid sequence capable of directing host organism synthesis of a target protein or of a peptide derived from the target protein sequence. Such nucleic acid sequence may be inserted into a suitable expression vector by methods known to those skilled in the art. Expression vectors suitable for producing high efficiency gene transfer in vivo include, but are not limited to, retroviral, adenoviral and vaccinia viral vectors. Operational elements of such expression vectors are disclosed previously in the present specification and are known to one skilled in the art. Such expression vectors can be administered, for example, intravenously, intramuscularly, subcutaneously, intraperitoneally or orally.

[00293] Another aspect of the invention relates to methods for inducing an immunological response in a mammal which comprises inoculating the mammal with naked target gene nucleic acids, or a fragment thereof, adequate to produce an immunogenic polypeptide, which in turn would induce antibodies and/or a T cell Attorney Docket No. 3300-01-lWO

immune response to protect the mammal from cancers, including breast, colon, lung, ovarian, and prostate cancer.

[00294] Naked target gene nucleic acids, as described herein, can be administered as a vaccine via various routes, including, intramuscular, intravenous, intraperitoneal, intranasal (via mucosa), intradermal, subcutaneous (see, for example, Fynan et al. Proc Natl Acad Sci USA 90: 1147811482 (1993); Moiling K., JMoI Med 75 :242-246 (1997)). For example, naked DNA, when injected intramuscularly, is taken up by cells, transcribed into mRNA, and expressed as protein. This protein is the actual vaccine, and it is produced by the vaccine recipient, which gives a higher chance of natural modifications and correct folding. It is presented to the immune system and induces both humoral and cellular immune responses (see e.g., Tang et al. Nature 356: 152154 (1992); Moiling K., J MoI Med 75 :242-246 (1997)).

[00295] According to the invention, liposome encapsulating target gene nucleic acids also can be administered. For example, clinical trials or other research studies with liposome encapsulated DNA in treating melanoma illustrated that the approach is effective in gene therapy (see e.g., Nabel, J., G., et al., Proc. Nat. Acad. Sci. U.S.A., 90: 11307-11311 (1993)).

[00296] Whether the immunogen is a protein, a peptide derived therefrom or a nucleic acid sequence capable of directing host organism synthesis of target protein or peptides derived therefrom, the immunogen may be administered for either a prophylactic or therapeutic purposes. Such prophylactic use may be appropriate for, for example, individuals with a genetic predisposition to a particular cancer. When provided prophylactically, the immunogen is provided in advance of the cancer or any symptom due to the cancer. The prophylactic administration of the immunogen serves to prevent or attenuate any subsequent onset of cancer. When provided therapeutically, the immunogen is provided at, or shortly after, the onset of cancer or any symptom associated with the cancer.

[00297] The present invention further relates to a vaccine for immunizing a mammal, for example, humans, against cancer comprising target protein or an expression vector capable of directing host organism synthesis of target protein in a pharmaceutically acceptable carrier. Attorney Docket No. 3300-01-lWO

[00298] In addition to use as vaccines and in immunotherapy, the above compositions can be used to prepare antibodies to target protein. To prepare antibodies, a host animal is immunized using the target protein or peptides derived therefrom or aforementioned expression vectors capable of expressing target protein or peptides derived therefrom. The host serum or plasma is collected following an appropriate time interval to provide a composition comprising antibodies reactive with the virus particle. The gamma globulin fraction or the IgG antibodies can be obtained, for example, by use of saturated ammonium sulfate or DEAE Sephadex, or other techniques known to those skilled in the art. The antibodies are substantially free of many of the adverse side effects which may be associated with other drugs.

[00299] The antibody compositions can be made even more compatible with the host system by minimizing potential adverse immune system responses. This is accomplished by removing all or a portion of the Fc portion of a foreign species antibody or using an antibody of the same species as the host animal, for example, the use of antibodies from human/human hybridomas. Humanized antibodies (i.e., nonimmunogenic in a human) may be produced, for example, by replacing an immunogenic portion of a non-human antibody with a corresponding, but nonimmunogenic portion (i.e., chimeric antibodies). Such chimeric antibodies may contain the reactive or antigen binding portion of an antibody from one species and the Fc portion of an antibody (nonimmunogenic) from a different species. Examples of chimeric antibodies, include but are not limited to, non-human mammal-human chimeras, such as rodent-human chimeras, murine-human and rat-human chimeras (Cabilly et al, Proc. Natl. Acad. Sci. USA, 84:3439, 1987; Nishimura et al. , Cancer Res. , 47:999, 1987; Wood et al , Nature, 314:446, 1985; Shaw et al, J. Natl Cancer Inst. , 80: 15553, 1988). General reviews of "humanized" chimeric antibodies are provided by Morrison S., Science, 229: 1202, 1985 and by Oi et al, BioTechniques, 4:214, 1986.

[00300] Alternatively, anti-target protein antibodies can be induced by administering anti-idiotype antibodies as immunogen. Conveniently, a purified anti- target protein preparation prepared as described above is used to induce anti-idiotype antibody in a host animal. The composition is administered to the host animal in a Attorney Docket No. 3300-01-lWO

suitable diluent. Following administration, usually repeated administration, the host produces anti-idiotype antibody. To eliminate an immunogenic response to the Fc region, antibodies produced by the same species as the host animal can be used or the Fc region of the administered antibodies can be removed. Following induction of antiidiotype antibody in the host animal, serum or plasma is removed to provide an antibody composition. The composition can be purified as described above for anti- anti-target protein antibodies, or by affinity chromatography using anti-target protein antibodies bound to the affinity matrix. The anti-idiotype antibodies produced are similar in conformation to the authentic target protein antigen and may be used to prepare vaccine rather than using a target protein.

[00301] To induce anti-target antibodies in an animal, the method of administering the target protein antigen can be the same as used in the case of vaccination, for example, intramuscularly, intraperitoneally, subcutaneously or the like in an effective concentration in a physiologically suitable diluent with or without adjuvant. One or more booster injections may be desirable.

[00302] For both in vivo use of antibodies to target proteins and anti-idiotype antibodies and for diagnostic use, it may be preferable to use monoclonal antibodies. Monoclonal anti-target protein antibodies, or anti-idiotype antibodies can be produced by methods known to those skilled in the art. (Goding, J. W. 1983. Monoclonal Antibodies: Principles and Practice, Pladermic Press, Inc., New York, N. Y., pp., 56-97). To produce a human-human hybridoma, a human lymphocyte donor is selected. A donor known to have the target antigen may serve as a suitable lymphocyte donor. Lymphocytes can be isolated from a peripheral blood sample or spleen cells may be used if the donor is subject to splenectomy. Epstein-Barr virus (EBV) can be used to immortalize human lymphocytes or a human fusion partner can be used to produce human-human hybridomas. Primary in vitro immunization with peptides also can be used in the generation of human monoclonal antibodies.

[00303] Pharmaceutical Applications of Compounds

[00304] The identified compounds that inhibit the expression, synthesis, and/or activity of the target gene can be administered to a patient at therapeutically effective Attorney Docket No. 3300-01-lWO

doses to prevent, treat, or control a tumor or cancer. A therapeutically effective dose refers to an amount of the compound that is sufficient to result in a measurable reduction or elimination of cancer or its symptoms.

[00305] Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, for example, for determining the LD₅₀ (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and can be expressed as the ratio, LD50/ED50. Compounds that exhibit large therapeutic indices are preferred. While compounds that exhibit toxic side effects can be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue to minimize potential damage to normal cells and, thereby, reduce side effects.

[00306] The data obtained from the cell culture assays and animal studies can be used to formulate a dosage range for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (the concentration of the test compound that achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma can be measured, for example, by high performance liquid chromatography (HPLC).

[00307] Pharmaceutical compositions for use in the present invention can be formulated by standard techniques using one or more physiologically acceptable carriers or excipients. The compounds and their physiologically acceptable salts and solvates can be formulated and administered, for example, orally, intraorally, rectally, parenterally, epicutaneously, topically, transdermally, subcutaneously, intramuscularly, intranasally, sublingually, intradurally, intraocularly, intrarespiratorally, intravenously, Attorney Docket No. 3300-01-lWO

intraperitoneally, intrathecal, mucosally, by oral inhalation, nasal inhalation, or rectal administration.

[00308] For oral administration, the pharmaceutical compositions can take the form of tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients, for example, binding agents, for example, pregelatinised maize starch, polyvinylpyrrolidone, or hydroxypropyl methylcellulose; fillers, for example, lactose, microcrystalline cellulose, or calcium hydrogen phosphate; lubricants, for example, magnesium stearate, talc, or silica; disintegrants, for example, potato starch or sodium starch glycolate; or wetting agents, for example, sodium lauryl sulphate. The tablets can be coated by methods well known in the art. Liquid preparations for oral administration can take the form of solutions, syrups, or suspensions, or they can be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations can be prepared by conventional means with pharmaceutically acceptable additives, for example, suspending agents, for example, sorbitol syrup, cellulose derivatives, or hydrogenated edible fats; emulsifying agents, for example, lecithin or acacia; non-aqueous vehicles, for example, almond oil, oily esters, ethyl alcohol, or fractionated vegetable oils; and preservatives, for example, methyl or propyl-p-hydroxybenzoates or sorbic acid. The preparations also can contain buffer salts, flavoring, coloring, and/or sweetening agents as appropriate. Preparations for oral administration can be suitably formulated to give controlled release of the active compound.

[00309] For administration by inhalation, the compounds are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, for example, dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or other suitable gas. In the case of a pressurized aerosol, the dosage unit can be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, for example, gelatin for use in an inhaler or insufflator can be formulated containing a powder mix of the compound and a suitable powder base, for example, lactose or starch.

[00310] The compounds can be formulated for parenteral administration by injection, for example, by bolus injection or continuous infusion. Formulations for Attorney Docket No. 3300-01-lWO

injection can be presented in unit dosage form, for example, in ampoules or in multi- dose containers, with an added preservative. The compositions can take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and can contain formulatory agents, for example, suspending, stabilizing, and/or dispersing agents. Alternatively, the active ingredient can be in powder form for constitution with a suitable vehicle, for example, sterile pyrogen-free water, before use. The compounds also can be formulated in rectal compositions, for example, suppositories or retention enemas, for example, containing conventional suppository bases, for example, cocoa butter or other glycerides.

[00311] Furthermore, the compounds also can be formulated as a depot preparation. Such long acting formulations can be administered by implantation (for example, subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the compounds can be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.

[00312] The compositions can, if desired, be presented in a pack or dispenser device which can contain one or more unit dosage forms containing the active ingredient. The pack can for example comprise metal or plastic foil, for example, a blister pack. The pack or dispenser device can be accompanied by instructions for administration.

[00313] Administration of siRNA/shRNA/miRNA

[00314] The invention includes methods of administering siRNA, shRNA, and miRNA, to a patient in need thereof, wherein the siRNA, shRNA, or miRNA molecule is delivered in the form of a naked oligonucleotide or via an expression vector as described herein.

[00315] The present invention provides methods of blocking the in vivo expression of gene by administering a naked DNA or a vector containing siRNA, shRNA, or miRNA as set forth herein, which interacts with the target gene and causes post-transcriptional silencing of specific genes in cells, for example, mammalian cells Attorney Docket No. 3300-01-lWO

(including human cells) and in the body, for example, mammalian bodies (including humans).

[00316] The invention also provides methods for the treatment of cells ex vivo by administering a naked DNA or a vector according to the invention.

[00317] In its in vivo or ex vivo therapeutic applications, it is appropriate to administer siRNA, shRNA, or miRNAs using a viral or retroviral vector, which enters the cell by transfection or infection. In particular, as a therapeutic product according to the invention, a vector can be a defective viral vector, such as an adenovirus, or a defective retroviral vector, such as a murine retrovirus.

[00318] The vector used to convey the gene construct according to the invention to its target can be a retroviral vector, which will transport the recombinant construct by a borrower capsid, and insert the genetic material into the DNA of the host cell.

[00319] Techniques that use vectors, in particular viral vectors (retroviruses, adenoviruses, adeno-associated viruses), to transport genetic material to target cells can be used to introduce genetic modifications into various somatic tissues, for example, breast, colon, lung, brain, or ovarian cells.

[00320] The use of retroviral vectors to transport genetic material necessitates, on the one hand, carrying out the genetic construction of the recombinant retrovirus, and on the other hand having a cell system available which provides for the function of encapsidation of the genetic material to be transported:

[00321] In a first stage, genetic engineering techniques enable the genome of a murine retrovirus, such as Moloney virus (murine retrovirus belonging to the murine leukemia virus group (Reddy et al., Science, 214:445-450 (1981)). The retroviral genome is cloned into a plasmid vector, from which all the viral sequences coding for the structural proteins (genes:. Gag, Env) as well as the sequence coding for the enzymatic activities (gene: Pol) are then deleted. As a result, only the necessary sequences "in cis" for replication, transcription and integration are retained (sequences corresponding to the two LTR regions, encapsidation signal and primer binding signal). The deleted genetic sequences may be replaced by non-viral genes such as the gene for Attorney Docket No. 3300-01-lWO

resistance to neomycin (selection antibiotic for eukaryotic cells) and by the gene to be transported by the retroviral vector, for example, target siRNA as set forth herein.

[00322] In a second stage, the plasmid construct thereby obtained is introduced by transfection into the encapsidation cells. These cells constitutively express the Gag, Pol and Env viral proteins, but the RNA coding for these proteins lacks the signals needed for its encapsidation. As a result, the RNA cannot be encapsidated to enable viral particles to be formed. Only the recombinant RNA emanating from the transfected retroviral construction is equipped with the encapsidation signal and is encapsidated. The retroviral particles produced by this system contain all the elements needed for the infection of the target cells (such as CD34+ cells) and for the permanent integration of the gene of interest into these cells target gene siRNA as set forth herein. The absence of the Gag, Pol and Env genes prevents the system from continuing to propagate.

[00323] DNA viruses such as adenoviruses also can be suited to this approach although, in this case, maintenance of the DNA in the episomal state in the form of an autonomous replicon is the most likely situation.

[00324] Adenoviruses possess some advantageous properties. In particular, they have a fairly broad host range, are capable of infecting quiescent cells and do not integrate into the genome of the infected cell. For these reasons, adenoviruses have already been used for the transfer of genes in vivo. To this end, various vectors derived from adenoviruses have been prepared, incorporating different genes (beta-gal, OTC, alpha- IAt, cytokines, etc.). To limit the risks of multiplication and the formation of infectious particles in vivo, the adenoviruses used are generally modified so as to render them incapable of replication in the infected cell. Thus, the adenoviruses used generally have the El (EIa and/or EIb) and possibly E3 regions deleted.

[00325] The defective recombinant adenoviruses according to the invention may be prepared by any technique known to persons skilled in the art (Levrero et al., Gene, 101 : 195 (1991), EP 185 573; Graham, EMBO J. 3 :2917 (1984)). In particular, they may be prepared by homologous recombination between an adenovirus and a plasmid in a suitable cell line. Attorney Docket No. 3300-01-lWO

[00326] According to the present invention, an exogenous DNA sequence, for example a siRNA to a target gene as set forth herein, is inserted into the genome of the defective recombinant adenovirus.

[00327] Pharmaceutical compositions comprising one or more viral vectors, such as defective recombinants as described above, may be formulated for the purpose of topical, oral, parenteral, intranasal, intravenous, intramuscular, subcutaneous, intraocular, and the like, administration. Preferably, these compositions contain vehicles which are pharmaceutically acceptable for an administrable formulation. These can be, in particular, isotonic, sterile saline solutions (of monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride, and the like, or mixtures of such salts), or dry, in particular lyophilized, compositions which, on addition, as appropriate, of sterilized water or of physiological saline, enable particular injectable solutions to be made up.

[00328] The doses of defective recombinant virus used for the injection may be adapted in accordance with various parameters, and in particular in accordance with the mode of administration used, the pathology in question, the gene to be expressed or the desired duration of treatment. Generally speaking, the recombinant adenoviruses according to the invention may be formulated and administered in the form of doses of between 10⁴ and 10¹⁴ pfu/ml, and preferably 10⁶ to 10¹⁰ pfu/ml. The term pfu ("plaque forming unit") corresponds to the infectious power of a solution of virus, and is determined by infection of a suitable cell culture and measurement, generally after 48 hours, of the number of plaques of infected cells. The techniques of determination of the pfu titer of a viral solution are well documented in the literature.

[00329] The use of genetically modified viruses as a shuttle, system for transporting the modified genetic material not only permits the genetic material to enter the recipient cell by the expedient of using a borrower viral capsid, but also allows a large number of cells to be treated simultaneously and over a short period of time, which permits therapeutic treatment applied to the whole body.

[00330] Examples

[00331] Example 1 : Copy Number Analysis in Cancer Cell Lines and Tumors Attorney Docket No. 3300-01-lWO

[00332] The goal of copy number analysis is to identify cancer related genes. It is well know that tumor suppressor genes are often deleted in tumors and cancer cell lines. Similarly, oncogenes are often amplified so that is their copy number is above two. One way to detect copy number changes in a sample is to utilize SNP microarrays. These microarrays contain oligonucleotide probes hybridizing to alleles of a large number of SNPs (typically, in the range of 100,000 to 500,000). The sum of hybridization intensities of two alleles of a SNP is proportional to the numbers of copies of the SNP, and therefore, after appropriate normalization can be used to estimate copy number.

[00333] For this experiment, cancer cell lines from a variety of different cancers were assessed for concentration and level of degradation by nanodrop spectrophotometry and agarose gel electrophoresis. High quality samples were randomly selected for analysis by Affymetrix GeneChip Mapping 500K Array (Santa Clara, CA). The samples were prepared for hybridization to the SNP array as described by the manufacturer (P/N 701930 Rev. 2). Briefly, each 500ng of gDNA is halved and separately digested with Sty or Nsp restriction endonucleases. Resulting DNA fragments are then ligated to corresponding adaptors to provide for common PCR priming locations. Whole genome amplification is complete within 30 cycles and resulting PCR products are purified on a DNA binding membrane under a vacuum. Purified PCR products are then fragmented to less than 200bp, and subsequently, end labeled with biotin. These products are then hybridized to the corresponding GeneChip Arrays for 16 hours at 49 C. Post hybridization, the samples are recovered from the chips for archiving. The hybridized chips are robotically washed and stained on a fluidics station in preparation for scanning and analysis. After scanning, the intensity signal from each SNP was normalized. The normalization was done by running microarrays on a number of normal, non-cancerous cells, which are expected to have two copies of every gene on chromosomes 1 to 22. The normalization for X and Y chromosomes is dependant of the sex of a person from whom the sample is derived. Unfortunately, the estimate of the copy number derived from one SNP is not precise and cannot be used alone. To overcome this problem, we combined the estimates from multiple SNPs from the same region of genome. We have implemented the combining Attorney Docket No. 3300-01-lWO

estimates in a computer program using Hidden Markov Model (HMM) algorithm. The program processes samples individually. The output of the program is a list of copy number changes. Each copy number change has coordinates of its start and end as well as estimated copy number. Based on the coordinates corresponding to the May 2004 NCBI human genome build (number 35) we identified genes and loci involved in the corresponding copy number change. These genomic regions include DNA that codes for protein as well as regulatory regions that do not code for protein. As the skilled artisan readily recognizes some regulatory regions can control the expression of genes that are not physically contained within the amplified DNA. Genes coding for proteins in the amplified regions can now be used for therapeutic targeting and molecular medicine applications as described in the various aspects and embodiments of the invention.

[00334] A number of amplifications and deletions were identified in experiments with a variety of cancer cell lines. The amplifications identified in Tables 1-7 were found in at least two different cancer cell lines. The amplifications in Tables 1-7 have a copy number of about 10 or greater in each cell line or alternatively a copy number of about greater than about 5 in about 3 or more cell lines. As the skilled artisan will readily recognize, the amplified and deleted regions listed below are now implicated in cancer and particularly the cancer type in which then were identified. Some of the amplified and delete regions may or may not contain regulatory regions that do not specifically code for protein but me be involved in regulation of gene expression. Some of the amplified and deleted regions contain genes that code for protein. These genes are identified by Entrez ID numbers (see the www URL ncbi.nlm.nih.gov/). The identified one or more amplified and deleted regions (or a fragment thereof) listed below can now be used as e.g., biomarkers, probes for the diagnosis and prognosis of cancers, targets for inhibition (amplified genes), targets for gene therapy (deleted genes), alone or in combination with other biomarkers, as described in this specification.

[00335] In this experiment we identified following copy number changes in the table below (Tables 1-7). Attorney Docket No. 3300-01-lWO

Tables 1-7

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No.3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No.3300-01-lWO

Example 2: 3 breast and 1 bladder cancer cancer cell lines were found to have amplification at chromosome 11 ql 3.2 corresponding to positions 67739858-67934284 of the human genome and having copy numbers of 6, 7, 6, and 15-, respectively. Cl 1ORF24 having an Entrez ID no. of 53838 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:1 5'-cctcgtgcccccatccaacc-3' SEQ ID NO:2 5'-tcgtgcccccatccaaccct-3' SEQ ID NO:3 5'-gtgcccccatccaaccctcc-3'

siRNA

SEQIDNO:4 5'- GUGGGGCGGGCAGGACCCCdTdT-3'

SEQIDNO:5 3'-dTdTCACCCCGCCCGUCCUGGGG -5'

SEQIDNO:6 5'- CACAUCCCAGGCACCGGAGdTdT-3'

SEQIDNO:7 3'-dTdTGUGUAGGGUCCGUGGCCUC -5'

SEQIDNO:8 5'- GAGGAUGU AACCAUGGCAGdTdT-3'

SEQIDNO:9 3'-dTdTCUCCUACAUUGGUACCGTC -5'

SEQIDNO:10 5'- GACCGCCCAGCCUUGCUCCdTdT-3'

SEQIDNO:11 3'-dTdTCUGGCGGGUCGGAACGAGG -5' Attorney Docket No.3300-01-lWO

SEQIDNO:12 5'- GCGGGAGGCCUGGCCCCUUdTdT-3'

SEQIDNO:13 3'-dTdTCGCCCUCCGGACCGGGGAA -5'

Example 3: 5 breast, 1 colon, and 1 salivary gland cancer cancer cell lines were found to have amplification at 11 ql 3.3 corresponding to positions 68824460-69198344 of the human genome and having copy numbers of 25, 20, 16, 7, 11, 19, and 8 respectively. CCNDl having an Entrez ID no. of 595 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules. Aliases: BCLl; PRADl; U21B31; D11S287E.

Antisense

SEQ ID NO: 14 5'-aggaggttggcatcggggt-3' SEQ ID NO:15 5'-gaggttggcatcggggtac-3' SEQ ID NO:16 5'-ggttggcatcggggtacgc-3'

siRNA

SEQIDNO:16 5'- CGGAGGAGAACAAACAGAUdTdT-3'

SEQ ID NO : 17 3 ' -dTdTGCCUCCUCUUGUUUGUCUA -5 '

SEQIDNO:18 5'- GCUCCUGUGCUGCGAAGUGdTdT-3'

SEQIDNO:19 3'-dTdTCGAGGACACGACGCUUCAC -5'

SEQIDNO:20 5'- AGCGGGGAGCGUGGUGGCCdTdT-3'

SEQIDNO:21 3'-dTdTUCGCCCCUCGCACCACCGG -5' Attorney Docket No.3300-01-lWO

SEQIDNO:22 5'- CGCCAGGCAGGCGGGCGCCdTdT-3'

SEQIDNO:23 3'-dTdTGCGGUCCGUCCGCCCGCGG -5'

SEQIDNO:24 5'- GGAGACCAUCCCCCUGACGdTdT-3'

SEQIDNO:25 3'-dTdTCCUCUGGUAGGGGGACUGC -5'

Example 4: 5 breast, 1 colon, and 1 salivary gland cancer cancer cell lines were found to have amplification at 11 ql 3.3 corresponding to positions 68824460-69198344 of the human genome and having copy numbers of 25, 20, 16, 7, 11, 19, and 8, respectively. FLJ42258 having an Entrez ID no. of 440049 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:26 5'-ggctaccctgcatgcagcgt-3' SEQ ID NO:27 5'-ctaccctgcatgcagcgtga-3' SEQ ID NO:28 5'-accctgcatgcagcgtgacc-3'

siRNA

SEQIDNO:29 5'- GGAUGUAUGCCACUGCCACdTdT-3'

SEQIDNO:30 3'-dTdTCCUACAUACGGUGACGGUG -5'

SEQIDNO:31 5'- CCCAUGGGCAGUGCACCACdTdT-3 '

SEQIDNO:32 3'-dTdTGGGUACCCGUCACGUGGUG -5' Attorney Docket No.3300-01-lWO

SEQIDNO:33 5'- GGGGAGACGGAGGCAGAGAdTdT-S'

SEQIDNO:34 3'-dTdTCCCCUCUGCCUCCGUCUCU -5'

SEQIDNO:35 5'- CGAGGCGGUGGGCCAAGCGdTdT-3'

SEQIDNO:36 3'-dTdTGCUCCGCCACCCGGUUCGC -5'

SEQIDNO:37 5'- AGAGAUGGGGCUGAGUCCCdTdT-3'

SEQIDNO:38 3'-dTdTUCUCUACCCCGACUCAGGG -5'

Example 5: 2 breast, 1 ovary, and 1 bladder cancer cell lines were found to have amplification at 11 ql 3.5 corresponding to positions 75534579-76092857 of the human genome and having copy numbers of 6, 8, 10, and 15 respectively. C11ORF30 having an Entrez ID no. of 56946 is contained within this amplified region can be modulated with the following antisense and siRNA molecules (also known as EMSY, GL002, and FLJ90741).

Antisense

SEQ ID NO:39 5'-tttcggggctcatctaaaag-3' SEQ ID NO:40 5'-tcggggctcatctaaaaggc-3' SEQ ID NO:41 5'-ggggctcatctaaaaggctc-3'

siRNA

SEQIDNO:42 5'- GGCACAGGGGGAUCUCACCdTdT-3' Attorney Docket No.3300-01-lWO

SEQIDNO:43 3'-dTdTCCGUGUCCCCCUAGAGUGG -5'

SEQIDNO:44 5'- GUACCACUGAUGCCCCGGCdTdT-3 '

SEQIDNO:45 3'-dTdTCAUGGUGACUACGGGGCCG -5'

SEQIDNO:46 5'- GUCUCCUAAGCAGCAGUUAdTdT-3'

SEQIDNO:47 3'-dTdTCAGAGGAUUCGUCGUCAAU -5'

SEQIDNO:48 5'- GCCCUUCUCAGAGCUCUGCdTdT-3'

SEQIDNO:49 3'-dTdTCGGGAAGAGUCUCGAGACG -5'

SEQIDNO:50 5'- GAUGGCGAAUUCCACUCCCdTdT-3'

SEQIDNO:51 3'-dTdTCUACCGCUUAAGGUGAGGG -5'

Example 6: 2 breast, 1 ovary, and 1 bladder cancer cell lines were found to have amplification at Ilql3.5 corresponding to positions 75534579-76092857 of the human genome and having copy numbers of 6, 8, 10, and 15, respectively. LOC387790 having an Entrez ID no. of 387790 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules..

Antisense

SEQ ID NO:52 5'-agaagagatgcatcggtgat-3' SEQ ID NO:53 5'-aagagatgcatcggtgatgt-3' SEQ ID NO:54 5'-gagatgcatcggtgatgtaa-3' Attorney Docket No.3300-01-lWO

siRNA

SEQIDNO:55 5'- AAGUGAGACCCACCAUCUUdTdT-3'

SEQIDNO:56 3'-CITdTUUCACUCUGGGUGGUAGAA -5'

SEQIDNO:57 5'- GAAGUCAUGUCAAGGGCCAdTdT-3 '

SEQIDNO:58 3'-dTdTCUUCAGUACAGUUCCCGGU -5'

SEQIDNO:59 5'- AAGUGGGCGUCCAGUCACCdTdT-3'

SEQIDNO:60 3'-dTdTUUCACCCGCAGGUCAGUGG -5'

SEQIDNO:61 5'- UUCGGGUGUUUUGAAGGAGdTdT-3'

SEQIDNO:62 3'-dTdTAAGCCCACAAAACUUCCUC -5'

SEQIDNO:63 5'- AUUAGGGAGGGCUGCCUCUdTdT-3'

SEQIDNO:64 3'-dTdTUAAUCCCUCCCGACGGAGA -5'

Example 7: 2 breast/1 ovary/1 bladder cancer cancer cell lines were found to have amplification at 1 IqI 3.5 corresponding to positions 75534579-76092857 of the human genome and having copy numbers of 6, 8, 10, and 15 respectively. LRRC32 having an Entrez ID no. of 2615 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense Attorney Docket No.3300-01-lWO

SEQ ID NO:65 5'-tctggggtctcatggctcca-3' SEQ ID NO:66 5'-tggggtctcatggctccaaa-3' SEQ ID NO:67 5'-gggtctcatggctccaaagt-3'

siRNA

SEQIDNO:68 5'- CCUGCUCCAGGUCCCCUCGGdTdT-3'

SEQIDNO:69 3'-dTdTGGAGCAGGUCCAGGGGAGCC -5'

SEQ ID NO:70 5 '- GUGCUGGUGGCCUGGGCCCCdTdT-3 '

SEQIDNO:71 3'-dTdTCACGACCACCGGACCCGGGG -5'

SEQIDNO:72 5'- CCUCCCAGCCCCAGGCUGAGdTdT-3'

SEQIDNO:73 3'-dTdTGGAGGGUCGGGGUCCGACUC -5'

SEQIDNO:74 5'- GCUGGUCAGCCCUGCCCCUCdTdT-3'

SEQIDNO:75 3'-dTdTCGACCAGUCGGGACGGGGAG -5'

SEQIDNO:76 5'- GAAGGGGGGACUGAAGAACAdTdT-S'

SEQIDNO:77 3'-dTdTCUUCCCCCCUGACUUCUUGU -5'

Example 8: 2 breast/1 ovary/1 bladder cancer cell lines were found to have amplification at Ilql3.5 corresponding to positions 75534579-76092857 of the human genome and having copy numbers of 6, 8, 10, and 15 respectively. PRKRIR having an Attorney Docket No.3300-01-lWO

Entrez ID no. of 5612 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:78 5'- gcagcgcagaagttcggcat-3'

siRNA

SEQIDNO:79 5'- CCCCAACUGCACGCGGAAGdTdT-3'

SEQIDNO:80 3'-dTdTGGGGUUGACGUGCGCCUUC -5'

SEQIDNO:81 5'- AGGGUUGAAGGGCAAGAUGAdTdT-3 '

SEQIDNO:82 3'-dTdTUCCCACUUCCCGUUCUACU -5'

SEQIDNO:83 5'- GCCUU AUGAAGCCGAUGCAdTdT-3'

SEQIDNO:84 3'-dTdTCGGAAUACUUCGGCUACGU -5'

SEQIDNO:85 5'- GCCGGUAGCUUGACUGCAUdTdT-3'

SEQIDNO:86 3'-dTdTCGGCCAUCGAACUGACGUA -5'

SEQIDNO:87 5'- UUUGAGGAACACUUUGACAdTdT-3'

SEQIDNO:88 3'-dTdTAAACUCCUUGUGAAACUGU -5' Attorney Docket No.3300-01-lWO

Example 9: 2 breast/ 1 ovary/ 1 bladder cancer cell lines were found to have amplification at Ilql3.5 corresponding to positions 75534579-76092857 of the human genome and having copy numbers of 6, 8, 10, and 15 respectively. WNTl 1 having an Entrez ID no. of 7481 is contained within this amplified region and is also known as HWNTl 1 and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:89 5'-gccgcgccctcatcgtcgcg-3' SEQ ID NO:90 5'-cgcgccctcatcgtcgcgcg-3' SEQ ID NO:91 5'-cgccctcatcgtcgcgcggc-3'

siRNA

SEQIDNO:92 5'- CGCGGCCGCAGGUCUGCGAdTdT-3'

SEQIDNO:93 3'-dTdTGCGCCGGCGUCCAGACGCU -5'

SEQ ID NO:94 5 '- GCCACCCGGGCCCGGGAACdTdT-3 '

SEQIDNO:95 3'-dTdTCGGUGGGCCCGGGCCCUUG -5'

SEQIDNO:96 5'- GCUGGAAGGGGCUGCAGGAdTdT-3'

SEQIDNO:97 3'-dTdTCGACCUUCCCCGACGUCCU -5'

SEQIDNO:98 5'- CCAACGGAAGCGACAGCUGdTdT-3'

SEQIDNO:99 3'-dTdTGGUGCCUUCGCUGUCGAC -5'

SEQIDNO:100 5'- UGAGAAGGUGGGCUCCCACdTdT-3' Attorney Docket No.3300-01-lWO

SEQIDNO:101 3'-dTdTACUCUUCCACCCGAGGGUG -5'

Example 10:2 breast/ 1 ovary/ 1 bladder cancer cell lines was found to have amplification at 1 IqI 3.5 corresponding to positions 76828870-77374899 of the human genome and having copy numbers of 6, 8, 13, and 17 respectively. AQPIl having an Entrez ID no. of 282679 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:102 5'-gcagcggcgacatggctccg-3' SEQ ID NO:103 5'-agcggcgacatggctccgtc-3' SEQ ID NO:104 5'-cggcgacatggctccgtcgc-3'

siRNA

SEQIDNO:105 5'- GUCGCCGCUGCUGGGGCUCdTdT-3'

SEQIDNO:106 3'-dTdTCAGCGGCGACGACCCCGAG -5'

SEQIDNO:107 5'- GCGAACAGCACCCCGCGCAdTdT-3 '

SEQIDNO:108 3'-dTdTCGCUUGUCGUGGGGCGCGU -5'

SEQIDNO:109 5'- UGCUGGGGGGCAUGUCCCCdTdT-3'

SEQ ID NO: 110 3 '-dTdTACGACCCCCCGUAC AGGGG -5 '

SEQIDNO:111 5'- CUGCUGGCUGC ACUC AUC AdTdT-3' Attorney Docket No.3300-01-lWO

SEQIDNO:112 3'-dTdTGACGACCGACGUGAGUAGU -5'

SEQIDNO:113 5'- UUGAUGAAGCAUUCCCUCAdTdT-3'

SEQ ID NO : 114 3 ' -dTdT AACUACUUCGU AAGGG AGU -5 '

Example 11:2 breast/1 ovary/1 bladder cancer cell lines were found to have amplification at 1 IqI 3.5 corresponding to positions 76828870-77374899 of the human genome and having copy numbers of 6, 8, 13, and 17, respectively. C11ORF67 having an Entrez ID no. of 28971 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:115 5'-gcagcggcgacatggctccg-3' SEQ ID NO:116 5'-agcggcgacatggctccgtc-3' SEQ ID NO:117 5'-cggcgacatggctccgtcgc-3'

siRNA

SEQIDNO:118 5'- GACUUCCCCUGAAAUUGCUdTdT-3'

SEQIDNO:119 3'-dTdTCUGAAGGGGACUUUAACGA -5'

SEQ ID NO: 120 5 ' - AACCUATAAGGACUGCAAAdTdT-3 '

SEQIDNO:121 3'-dTdTUUGGAUAUUCCUGACGUUU -5'

SEQIDNO:122 5'- AGGAACUGAGCAUUCUCCUdTdT-3'

SEQ ID NO: 123 3 ' -dTdTUCCUUGACUCGUAAGAGGA -5 ' Attorney Docket No.3300-01-lWO

SEQIDNO:124 5'- GGTCAGGGUGGGAGGUGUCdTdT-S'

SEQIDNO:125 3'-dTdTCCAGUCCCACCCUCCACAG -5'

SEQ ID NO : 126 5 ' - GGAGA AUAAAUC ACUAAGUdTdT-3 '

SEQ ID NO : 127 3 ' -dTdTCCUCUUAUUUAGTGAUUC A -5 '

Example 12:2 breast/ 1 ovary/ 1 bladder cell lines were found to have amplification at 1 IqI 3.5 corresponding to positions 76828870-77374899 of the human genome and having copy numbers of 6, 8, 13, and 17 respectively. CLNSlA having an Entrez ID no. of 1207 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO: 128 5'-tgaggaagctcatagcagca-3' SEQ ID NO: 129 5'-aggaagctcatagcagcaga-3' SEQ ID NO:130 5'-gaagctcatagcagcagagt-3'

siRNA

SEQIDNO:131 5'- GCCAGCGGAGGGGCUCCUGdTdT-3'

SEQIDNO:132 3'-dTdTCGGUCGCCUCCCCGAGGAC -5'

SEQ ID NO: 133 5 ' - GCAUUAUCC AGGGACCGAAdTdT-3 '

SEQIDNO:134 3'-dTdTCGUAAUAGGUCCCUGGCUU -5' Attorney Docket No.3300-01-lWO

SEQIDNO:135 5'- ACAAGGAC AGGGGGACAUCdTdT-3'

SEQ ID NO: 136 3'-dTdTUGUUCCUGUCCCCCUGUAG -5'

SEQIDNO:137 5'- GGAUGCAGAUGUUGAUCACdTdT-S'

SEQIDNO:138 3 '-dTdTCCUACGUCUAC AACUAGUG -5'

SEQIDNO:139 5'- GUUGGAGGCAAUGUUCACUdTdT-S'

SEQ ID NO : 140 3 ' -dTdTC A ACCUAAGUUAC AAGUGA -5 '

Example 13:2 breast/ 1 ovary/ 1 bladder cancer cell lines were found to have amplification at 1 IqI 3.5 corresponding to positions 76828870-7374899 of the human genome and having copy numbers of 6, 8, 13, and 17, respectively. HBXAP having an Entrez ID no. of 51773 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:141 5'-ccgccgtcgccattttgaac-3' SEQ ID NO: 142 5'-gccgtcgccattttgaactg-3' SEQ ID NO: 143 5'-cgtcgccattttgaactgga-3'

siRNA

SEQIDNO:144 5'- GCCAGCGGAGGGGCUCCUGdTdT-3'

SEQIDNO:145 3'-dTdTCGGuCGCCuCCCCGAGGAC -5'

SEQIDNO:146 5'- UCACUGGAAUACCCCACCAdTdT-3 ' Attorney Docket No.3300-01-lWO

SEQIDNO:147 3 '-dTdT AGUG ACCUU AUGGGGUGGU -5'

SEQIDNO:148 5'- CAGUGAUGAUGAUGUUGAAdTdT-S'

SEQ ID NO: 149 3 ' -dTdTGUCACUACUACUAC AACUU -5 '

SEQIDNO:150 5'- AACAAGGACAGGGGGACAUdTdT-S'

SEQIDNO:151 3'-dTdTUUGUUCCUGUCCCCCUGUA -5'

SEQIDNO:152 5'- UAAGAUUCUGCUCCUAAGUdTdT-3'

SEQIDNO:153 3 '-dTdT AUUCUAAG ACGAGGAUUC A -5'

Example 14: ovary /bladder was found to have amplification at 1 Iq22.1 corresponding to positions 99985811-100660082 of the human genome and having copy numbers of 12 and 10, respectively. PGR (also known as PR and NR3C3) having an Entrez ID no. of 5241 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:154 5'-tcagctcagtcatgacgact-3' SEQ ID NO:155 5'-agctcagtcatgacgactgg-3' SEQ ID NO:156 5'-ctcagtcatgacgactggac-3'

siRNA

SEQIDNO:157 5'- GAGCUGAAGGCAAAGGGUCdTdT-3' Attorney Docket No.3300-01-lWO

SEQIDNO:158 3'-dTdTCUCGACUUCCGUUUCCCAG -5'

SEQIDNO:159 5'- GGCGCCCUCAGGUCCCGGGdTdT-3 '

SEQIDNO:160 3'-dTdTCCGCGGGAGUCCAGGGCCC -5'

SEQIDNO:161 5'- GGGGCCACCGCCCCCGCUGdTdT-3'

SEQ ID NO: 162 3'-dTdTCCCCGGUGGCGGGGGCGAC -5'

SEQIDNO:163 5'- GGCUGGC AUGGUCCUUGGAdTdT-3'

SEQIDNO:164 3'-dTdTCCGACCGUACCAGGAACCU -5'

SEQIDNO:165 5'- GUUGUGUCGAGCUCACAGCdTdT-3'

SEQIDNO:166 3'-dTdTCAACACAGCUCGAGUGUCG -5'

Example 15: An Ovary and bladder cancer cell line was found to have amplification at Ilq22.1 corresponding to positions 99985811-100660082 of the human genome and having copy numbers of 12 and 10, respectively. TMEM133 having an Entrez ID no. of 83935 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:167 5'-gatgtgaggtcatgctaaca-3' SEQ ID NO:168 5'-tgtgaggtcatgctaacagc-3' SEQ ID NO:169 5'-tgaggtcatgctaacagctg-3' Attorney Docket No.3300-01-lWO

siRNA

SEQIDNO:170 5'- UCACUGCGUAGGACCCGGAdTdT-3'

SEQIDNO:171 3'-dTdTAGUGACGCAUCCUGGGCCU -5'

SEQ ID NO: 172 5 ' - UGACUAUUGUCCAGAAGUUdTdT-S '

SEQ ID NO : 173 3 ' -dTdT ACUGAUAAC AGGUCUUC AA -5 '

SEQIDNO:174 5'- GCUAUUU AACUUUGCCUCCdTdT-3'

SEQ ID NO: 175 3 ' -dTdTCGAUAAAUUGAAACGGAGG -5 '

SEQIDNO:176 5'- UUUCCUGAACACAUUCACUdTdT-3'

SEQ ID NO : 177 3 ' -dTdT AAAGGACUUGUGUAAGUG A -5 '

SEQIDNO:178 5'- UGUCACCGUUAUCCCCCUGdTdT-3'

SEQIDNO:179 3 '-dTdT AC AGUGGC AAUAGGGGGAC -5'

Example 16: 4 ovary/bladder was found to have amplification at Ilq22.1-22.2 corresponding to positions 101190963-101593545 of the human genome and having copy numbers of 10 and 10 respectively. ANGPTL5 having an Entrez ID no. of 253935 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO: 180 5'-atggagacatcatatttttct-3' Attorney Docket No.3300-01-lWO

SEQ ID NO : 181 5 ' -ggagacatcatatttttcttg-3 ' SEQ ID NO: 182 5'-agacatcatatttttcttgga-3'

siRNA

SEQIDNO:183 5'- AUCCCAAGCCUCACUCUUAdTdT-3'

SEQIDNO:184 3'-dTdTUAGGGUUCGGAGUGAGAAU -5'

SEQIDNO:185 5'- GUGAGGAAUCAUGUGAUGUdTdT-S'

SEQIDNO:186 3'-dTdTCACUCCUUAGUACACUACA -5'

SEQIDNO:187 5'- CUGAUAUUAAGGAUACCAUdTdT-S'

SEQIDNO:188 S'-dTdTGACUAUAAUUCCUAUGGUA -5'

SEQIDNO:189 5'- GAGAAUUUUGGCUAGGACUdTdT-3'

SEQIDNO:190 3'-dTdTCTCAAAAAACCGAUCCUGA -5'

SEQIDNO:191 5'- UGGC AUC AUCACUCUCUdTdT-3'

SEQIDNO:192 3'-dTdTACCGUAAGUAGUGAAGAGA -5'

Example 17: An ovary and bladder cancer cell line was found to have amplification at Ilq22.1-22.2 corresponding to positions 101190963-101593545 of the human genome and having copy numbers of 10 and 10 respectively. Cl 1ORF70 having an Entrez ID no. of 85016 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules. Attorney Docket No.3300-01-lWO

Antisense

SEQ ID NO:193 5'-ttctgcccagcatggacctg-3' SEQ ID NO:194 5'-ctgcccagcatggacctggg-3' SEQ ID NO:195 5'-gcccagcatggacctggggc-3'

siRNA

SEQIDNO:196 5'- CGCAGGCGUUCGGCUUUGAdTdT-3'

SEQIDNO:197 3'-dTdTGCGUCCGCAAGCCGAAACU -5'

SEQIDNO:198 5'- GUCAUUUUUUCAUCGGUUAdTdT-S '

SEQ ID NO : 199 3 ' -dTdTC AGUAAA AAAGUAGCC AAU -5 '

SEQIDNO:200 5'- GAUAGAGAAGAGUUCCUGUdTdT-S'

SEQIDNO:201 3'-dTdTCUAUCUCUUCUCAAGGACA -5'

SEQIDNO:202 5'- UCCUAUCAGGCGUCACCUUdTdT-3'

SEQIDNO:203 3 '-dTdTAGGAUAGUCCGC AGUGGAA -5'

SEQIDNO:204 5'- GGUGUGGGAGACAUGUCUUdTdT-S'

SEQIDNO:205 3'-dTdTCCACACCCUCUGUACAGAA -5'

Example 18: ovary/bladder was found to have amplification at Ilq22.1-22.2 corresponding to positions 101190963-101593545 of the human genome and having copy numbers of 10, 10 respectively. KIAA1377 having an Entrez ID no. of 57562 is Attorney Docket No.3300-01-lWO

contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:206 5'-tccccgccagcatccttcac-3' SEQ ID NO:207 5'-cccgccagcatccttcactt-3' SEQ ID NO:208 5'-cgccagcatccttcacttca-3'

siRNA

SEQIDNO:209 5'- CGGGGAGGCCCGGAACCCGdTdT-3'

SEQIDNO:210 3'-dTdTGCCCCUCCGGGCCUUGGGC -5'

SEQIDNO:211 5'- UUAGAAGAGGCCCUCAAACdTdT-3 '

SEQIDNO:212 3'-dTdTAAUCUUCUCCGGGAGUUUG -5'

SEQIDNO:213 5'- CCACAUCCAUCCAGCGGAAdTdT-3'

SEQ ID NO:214 3 ' -dTdTGGUGUAGGUAGGUCGCCUU -5 '

SEQIDNO:215 5'- UCUAACCCAGGAAGUGGCTdTdT-3'

SEQIDNO:216 3'-dTdTAGAUUGGGUCCUUCACCGA -5' Attorney Docket No.3300-01-lWO

Example 19: 6 colon was found to have amplification at 13ql2.2 corresponding to positions 27279356-27460901 of the human genome and having copy numbers of 6, 6, 7, 8, 8, 24 respectively. CDX2 (also known as CDX3 and CDX-3) having an Entrez ID no. of 1045 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:217 5'-agctcacgtacatggtggcg-3' SEQ ID NO:218 5'-ctcacgtacatggtggcgag-3' SEQ ID NO:219 5'-cacgtacatggtggcgaggg-3'

siRNA

SEQIDNO:220 5'- GUGAGCUACCUCCUGGACAdTdT-3'

SEQIDNO:221 3'-dTdTCACUCGAUGGAGGACCUGU -5'

SEQ ID NO:222 5 ' - CUCCGGGAGGACUGGAAUGdTdT-3 '

SEQIDNO:223 3'-dTdTGAGGCCCUCCUGACCUUAC -5'

SEQIDNO:224 5'- GGCCCGCCGCCACCGCTGCdTdT-3'

SEQIDNO:225 3'-dTdTCCGGGCGGCGGUGGCGACG -5'

SEQIDNO:226 5'- GAGGAGCGUGGACUCUGCUdTdT-3'

SEQIDNO:227 3'-dTdTCUCCUCGCACCUGAGACGA -5'

SEQIDNO:228 5'- CCAGCUGGGCCUCCUGCCUdTdT-3' Attorney Docket No.3300-01-lWO

SEQIDNO:229 3'-dTdTGGUCGACCCGGAGGACGGA -5'

Example 20: 6 colon cell lines were found to have amplification at 13ql2.2 corresponding to positions 27279356-27460901 of the human genome and having copy numbers of 6, 6, 7, 8, 8, and 24, respectively. PFl having an Entrez ID no. of 3651 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:230 5'-cctcgccgttcatggctgcg-3' SEQ ID NO:231 5'-tcgccgttcatggctgcggc-3' SEQ ID NO:232 5'-gccgttcatggctgcggccc-3'

siRNA

SEQIDNO:233 5'- CGCAGCUUUACAAGGACCCdTdT-3'

SEQIDNO:234 3'-dTdTGCGUCGAAAUGUUCCUGGG -5'

SEQIDNO:235 5'- CUGGCGCCCUGGGCGCGCUdTdT-3 '

SEQIDNO:236 3'-dTdTGACCGCGGGACCCGCGCGA -5'

SEQIDNO:237 5'- CGGAGGGAGCCGAGCCGGGdTdT-3'

SEQIDNO:238 3'-dTdTGCCUCCCUCGGCUCGGCCC -5'

SEQIDNO:239 5'- CGGCCUACACGCGCGCACAdTdT-3' Attorney Docket No. 3300-01-lWO

SEQ ID NO:240 3 '-dTdTGCCGGAUGUGCGCGCGUG -5 '

SEQ ID NO:241 5 '- CGCGCCUCGGCGGCCGCAGdTdT-3 '

SEQ ID NO:242 3 '-dTdTGCGCGGAGCCGCCGGCGUC -5 '

Example 21 : 1 breast and 1 retina cancer line was found to have a homozygous deletion at 13ql4.2 corresponding to positions 47843150-48333505. CYSLTR2 having an Entrez ID no. of 57105 is contained within this deleted region.

Example 22: 1 breast and 1 retina cancer cell line was found to have a homozygous deletion at 13ql4.2 corresponding to positions 47843150-48333505. P2RY5 having an Entrez ID no. of 10161 is contained within this deleted region.

Example 23 : 1 breast and 1 retina cancer cell line was found to have a homozygous deletion at 13ql4.2 corresponding to positions 47843150-48333505. RBl having an Entrez ID no. of 5925 is contained within this deleted region and is also known as RB and OSRC.

Example 24: 1 breast and 1 retina cancer cell line was found to have a homozygous deletion at 13ql4.2 corresponding to positions 47843150-48333505. RCBTB2 having an Entrez ID no. of 1102 is contained within this deleted region and is also known as CHClL.

Example 25 : 4 colon and 1 breast cancer cell line was found to have amplification at 13q22.2 corresponding to positions 74589465-75857025 of the human genome and having copy numbers of 6, 7, 8, 6, and 15 respectively. C0MMD6 having an Entrez ID no. of 170622 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules. Attorney Docket No.3300-01-lWO

Antisense

SEQ ID NO:243 5'-tggacgcctccatgggcagc-3' SEQ ID NO:244 5'-gacgcctccatgggcagcgt-3' SEQ ID NO:245 5'-cgcctccatgggcagcgtct-3'

siRNA

SEQIDNO:246 5'- CAGUGGAAACUGGGUAUGGdTdT-S'

SEQIDNO:247 3'-dTdTGUCACCUUUGACCCAUACC -5'

SEQIDNO:248 5'- GCGUCCAGCGAGCCGCCGCdTdT-3 '

SEQIDNO:249 3'-dTdTCGCAGGUCGCUCGGCGGCG -5'

SEQIDNO:250 5'- GACACUUGCAGAUCUCUUAdTdT-3'

SEQ ID NO:251 3 ' -dTdTCUGUGAACGUCUAGAGAAU -5 '

SEQIDNO:252 5'- GGCAGAUC AUUCAGGCCAAdTdT-3'

SEQIDNO:253 3 '-dTdTCCGUCUAGU AA GUCCGGUU -5'

SEQIDNO:254 5'- UGC AGUU AUUGAAACGGUGdTdT-3'

SEQIDNO:255 3'-dTdTACGUCAAUAACUUUGCCAC -5'

Example 26: 4 colon and 1 breast cancer cell line was found to have amplification at 13q22.2 corresponding to positions 74589465-75857025 of the human Attorney Docket No.3300-01-lWO

genome and having copy numbers of 6, 7, 8, 6, and 15, respectively. LM07 having an Entrez ID no. of 4008 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:256 5'-taattttcttcatagcagtt-3' SEQ ID NO:257 5'-attttcttcatagcagttgt-3' SEQ ID NO:258 5'-tttcttcatagcagttgtaa-3'

siRNA

SEQIDNO:259 5'- GTTGGATGTCCTATGATGTdTdT-3'

SEQIDNO:260 3 '-dTdTCAACCTACAGGA TACTACA -5'

SEQ ID NO:261 5 ' - GCTGTATCTC AGGGAC AGAdTdT-3 '

SEQIDNO:262 3'-dTdTCGACATAGAGTCCCTGTCT -5'

SEQIDNO:263 5'- GACTCTTTGGGCTCGAGGTdTdT-3'

SEQIDNO:264 3'-dTdTCTGAGAAACCCGAGCTCCA -5'

SEQIDNO:265 5'- GAGGA GACAGCC ACAAGAGdTdT-3'

SEQIDNO:266 3'-dTdTCTCCTCTGTCGGTGTTCTC -5'

SEQIDNO:267 5'- GGCCACCACACAGTCCCCCdTdT-3'

SEQIDNO:268 3'-dTdTCCGGTGGTGTGTCAGGGGG -5' Attorney Docket No.3300-01-lWO

Example 27: 4 colon and 1 breast cancer cell line was found to have amplification at 13q22.2 corresponding to positions 74589465-75857025 of the human genome and having copy numbers of 6, 7, 8, 6, and 15 respectively. TBC 1D4 having an Entrez ID no. of 9882 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:269 5'-tgggcggctccataactctc-3' SEQ ID NO:270 5'-ggcggctccataactctcgc-3' SEQ ID NO:271 5'-cggctccataactctcgcct-3'

siRNA

SEQIDNO:272 5'- GGATGAGCCGTTCCCGCACdTdT-3'

SEQIDNO:273 3'-dTdTCCTACTCGGCAAGGGCGTG -5'

SEQIDNO:274 5'- GGCCACGCAGCCCAACCCGdTdT-3 '

SEQIDNO:275 3'-dTdTCCGGTGCGTCGGGTTGGGC -5'

SEQIDNO:276 5'- CTTCCAGGTTGGGCGATTTdTdT-3'

SEQIDNO:277 3 '-dTdTGAAGGTCC AACCCGCT AAA -5'

SEQIDNO:278 5'- AAGTGTGGGAGGAACCTCTdTdT-3'

SEQIDNO:279 3'-dTdTTTCACACCCTCCTTGGAGA -5' Attorney Docket No.3300-01-lWO

SEQIDNO:280 5'- GGAATCTTCATATTCCTGTdTdT-3'

SEQIDNO:281 3'-(1TdTCCTTAGAAGTATAAGGACA -5'

Example 28: 4 colon/1 breast was found to have amplification at 13q22.2 corresponding to positions 74589465-75857025 of the human genome and having copy numbers of 6, 7, 8, 6, and 15 respectively. UCHL3 having an Entrez ID no. of 7347 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:282 5'-gttgaccctccatggccgcg-3' SEQ ID NO:283 5'-tgaccctccatggccgcggt-3' SEQ ID NO:284 5'-accctccatggccgcggtgc-3'

siRNA

SEQIDNO:285 5'- AACGCTGGCTGCCGCTGGAdTdT-3'

SEQIDNO:286 3'-dTdTTTGCGACCGACGGCGACCT -5'

SEQIDNO:287 5'- GGATCCTGAACTCCTTAGCdTdT-3'

SEQIDNO:288 S'-dTdTGGTAGGACTTGAGGAATCG -5'

SEQIDNO:289 5'- CCTGTGGAACAATTGGACTdTdT-3'

SEQIDNO:290 3'-dTdTGGACACCTTGTTAACCTGA -5'

SEQIDNO:291 5'- ATGGGCGGAAGCCATTTCCdTdT-3' Attorney Docket No.3300-01-lWO

SEQIDNO:292 3'-dTdTTACCCGCCTTCGGTAAAGG -5'

SEQIDNO:293 5'- AGCGCGACCCTGATGAACTdTdT-3'

SEQIDNO:294 3'-dTdTTCGCGCTGGGACTACTTGA -5'

Example 29: 4 colon/1 breast was found to have amplification at 13q22.2-22.3 corresponding to positions 76043504-76512348 of the human genome and having copy numbers of 6, 7, 8, 7, 6, 6, and 15, respectively. CLN5 having an Entrez ID no. of 1203 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:295 5'-ggttccggcgcatgacacct-3' SEQ ID NO:296 5'-ttccggcgcatgacacctcc-3' SEQ ID NO:297 5'-ccggcgcatgacacctcccc-3'

siRNA

SEQIDNO:298 5'- GAACCTGCGCTTGGGGCCAdTdT-3'

SEQIDNO:299 3'-dTdTCTTGGACGCGAACCCCGGT -5'

SEQIDNO:300 5'- CTCGGGCATCCCCTCCCGGdTdT-3 '

SEQIDNO:301 3'-dTdTGAGCCCGTAGGGGAGGGCC -5'

SEQIDNO:302 5'- CTTCAAACCACATTTGCCAdTdT-3' Attorney Docket No.3300-01-lWO

SEQIDNO:303 3'-dTdTGAAGTTTGGTGTAAACGGT -5'

SEQIDNO:304 5'- ATTTGGAGC AGAGTTCAAGdTdT-3'

SEQIDNO:305 3'-dTdTTAAACCTCGTCTCAAGTTC -5'

SEQIDNO:306 5'- TGCCCCTTTCTGGTGTAATdTdT-3'

SEQIDNO:307 3'-dTdTACGGGGAAAGACCACATTA -5'

Example 30: 4 colon and 1 breast cancer cell line was found to have amplification at 13q22.2-22.3 corresponding to positions 76043504-76512348 of the human genome and having copy numbers of 6, 7, 8, 7, 6, 6, and 15 respectively. FBXL3 having an Entrez ID no. of 26224 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:308 5'-ctcctcgtttcatcctgctg-3' SEQ ID NO:309 5'-cctcgtttcatcctgctgcc-3' SEQ ID NO:310 5'-tcgtttcatcctgctgccgg-3'

siRNA

SEQIDNO:311 5'- GGACTACAAATGAGCATTCdTdT-3'

SEQIDNO:312 3'-dTdTCCTCATGTTTACTCGTAAG -5'

SEQIDNO:313 5'- ACTGGAACCAGGTATTTCAdTdT-3 ' Attorney Docket No.3300-01-lWO

SEQIDNO:314 3'-dTdTTGACCTTGGTCCATAAAGT -5'

SEQIDNO:315 5'- CGTAAACTCCAAATCCCTGdTdT-3'

SEQIDNO:316 3'-(1TdTGCATTTGAGGTTTAGGGAC -5'

SEQIDNO:317 5'- CCTAGACTGGTTGAACTAGdTdT-3'

SEQIDNO:318 3'-dTdTGGATCTGACCAACTTGATC -5'

SEQIDNO:319 5'- GCCGCCTATCTCAATTATCdTdT-3'

SEQIDNO:320 3'-dTdTCGGCGGATAGAGTTAATAG -5'

Example 31:4 colon and 1 breast was found to have amplification at 13q22.2- 22.3 corresponding to positions 76043504-76512348 of the human genome and having copy numbers of 6, 7, 8, 7, 6, 6, and 15 respectively. KCTD12 having an Entrez ID no. of 115207 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:321 5'-ccgccagagccatgacagag-3' SEQ ID NO:322 5'-gccagagccatgacagagag-3' SEQ ID NO:323 5'-cagagccatgacagagaggt-3'

siRNA

SEQIDNO:324 5'- GGCGGACAGCACACGUGGAdTdT-3' Attorney Docket No.3300-01-lWO

SEQIDNO:325 3'-dTdTCCGCCUGUCGUGUGCACCU -5'

SEQIDNO:326 5'- CAGCAGCCGCAGGAGCUGGdTdT-3 '

SEQIDNO:327 3'-dTdTGUCGUCGGCGUCCUCGACC -5'

SEQIDNO:328 5'- CGCCGCCUCGGGGCGCCCCAdTdT-3'

SEQIDNO:329 3'-dTdTGCGGCGGAGCCCCGCGGGGU -5'

SEQIDNO:330 5'- GAACGAAAGCCGGGACCCCdTdT-3'

SEQIDNO:331 3'-dTdTCUUGCUUUCGGCCCUGGGG -5'

SEQIDNO:332 5'- GCGCCUUUGCCAGCAGCACdTdT-3'

SEQIDNO:333 3'-dTdTCGCGGAAACGGUCGUCGUG -5'

Example 32: 4 colon and 1 breast cancer cell line was found to have amplification at 13q22.3 corresponding to positions 76959167-77328080 of the human genome and having copy numbers of 6, 7, 7, 6, and 15, respectively. FLJ30046 having an Entrez ID no. of 122060 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:334 5'-tcgctgcttccatctcagga-3' SEQ ID NO:335 5'-gctgcttccatctcaggagt-3' SEQ ID NO:336 5'-tgcttccatctcaggagttg-3'

siRNA Attorney Docket No.3300-01-lWO

SEQIDNO:337 5'- AGCGAGACGTTCCCTGTGCdTdT-3'

SEQIDNO:338 3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

SEQIDNO:339 5'- AUGUAGUGAUCAAGAAUAUdTdT-S'

SEQIDNO:340 3'-dTdTUACAUCACUAGUUCUUAUA -5'

SEQIDNO:341 5'- CAAACUCCAGAUCAGCAACdTdT-3'

SEQIDNO:342 3'-(ITdTGUUUGAGGUCUAGUCGUUG -5'

SEQIDNO:343 5'- GGGUCCACAGCGUGGGGCAdTdT-3'

SEQIDNO:344 3'-dTdTCCCAGGUGUCGCACCCCGU -5'

SEQIDNO:345 5'- AAGCUGCAGCUUCUGGGAUdTdT-3'

SEQIDNO:346 3 '-dTdTUUCGACGUCGAA GACCCUA -5'

Example 33: 4 colon and 1 breast cancer cell lines were found to have amplification at 13q22.3 corresponding to positions 76959167-77328080 of the human genome and having copy numbers of 6, 7, 7, 6, and 15, respectively. SCEL having an Entrez ID no. of 8796 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:347 5'-taacattggacatgctgcct-3' SEQ ID NO:348 5'-acattggacatgctgccttc-3' Attorney Docket No.3300-01-lWO

SEQ ID NO:349 5'-attggacatgctgccttcca-3'

siRNA

SEQIDNO:350 5'- CAUCACUAACAACGAUGUUdTdT-3'

SEQIDNO:351 3'-CITdTGUAGUGAUUGUUGCUACAA -5'

SEQIDNO:352 5'- GAAUGGACUACACUGCGCCdTdT-3 '

SEQIDNO:353 3'-dTdTCUUACCUGAUGUGACGCGG -5'

SEQIDNO:354 5'- GCCCCAAUGUCAAGCACGGdTdT-3'

SEQIDNO:355 3'-dTdTCGGGGUUACAGUUCGUGCC -5'

SEQIDNO:356 5'- CGUCGCGCAUCAUAUCGCCdTdT-3'

SEQIDNO:357 3 '-dTdTGCAGCGCGUAGU AUAGCGG -5'

SEQIDNO:358 5'- CUCCAUCGGGACAAGGCCAdTdT-3'

SEQIDNO:359 3'-dTdTGAGGUAGCCCUGUUCCGGU -5'

Example 34: 7 colon and 1 bladder cancer cell lines were found to have a homozygous deletion at 16p 13-13.2 corresponding to positions 6151277-7111949 of the human genome. A2BP1 having an Entrez ID no. of 54715 is contained within this deleted region.

Example 35: 6 colon, 2 pancreas, 1 salivary gland, and 1 lung cancer cell lines were found to have a homozygous deletion at 6q23.1 corresponding to positions Attorney Docket No.3300-01-lWO

76828148-77626627 of the human genome. WWOX having an Entrez ID no. of 51741 is contained within this deleted region and is also known as FOR, WOXl, FRA 16D, HHCMA56, PRO0128; WWOX v8, and D16S432E.

Example 36: 3 breast, 2 colon, and 1 lung cancer cell lines were found to have amplification at 17qll.2 corresponding to positions 23719960-23799557 of the human genome and having copy numbers of 7, 6, 6, 7, 21, and 10, respectively. HCPl having an Entrez ID no. of 3276 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:360 5'-caaaattctccatgatgcag-3' SEQ ID NO:361 5'-aaattctccatgatgcagtt-3' SEQ ID NO:362 5'-attctccatgatgcagttcg-3'

siRNA

SEQIDNO:363 5'- GUAGCCACCUUGGCUAAUGdTdT-3'

SEQIDNO:364 3'-dTdTCAUCGGUGGAACCGAUUAC -5'

SEQIDNO:365 5'- GCCCAACGCUGAGGACAUGdTdT-3 '

SEQIDNO:366 3'-dTdTCGGGUUGCGACUCCUGUAC -5'

SEQIDNO:367 5'- CUGGCGCCCGAUGGCCUCAdTdT-3'

SEQIDNO:368 3'-dTdTGACCGCGGGCUACCGGAGU -5'

SEQIDNO:369 5'- CCUCCCCGUUCUGCCUGCAdTdT-3' Attorney Docket No.3300-01-lWO

SEQIDNO:370 3'-dTdTGGAGGGGCAAGACGGACGU -5'

SEQIDNO:371 5'- CGACCUGGACUUCAAGGGCdTdT-3'

SEQIDNO:372 3'-dTdTGCUGGACCUGAAGUUCCCG -5'

Example 37:3 breast, 2 colon, and 1 lung cancer cell lines were found to have amplification at 17qll.2 corresponding to positions 23719960-23799557 of the human genome and having copy numbers of 7, 6, 6, 7, 21, and 10 respectively. SARMl having an Entrez ID no. of 23098 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:373 5'-ccaccgcccccatctggccc-3' SEQ ID NO:374 5'-accgcccccatctggcccag-3' SEQ ID NO:375 5'-cgcccccatctggcccaggc-3'

siRNA

SEQIDNO:376 5'- GGGGGCGGUGGCACGGGCCdTdT-3'

SEQIDNO:377 3'-dTdTCCCCCGCCACCGUGCCCGG -5'

SEQIDNO:378 5'- GCCGGAGUUGGAGACGCGUdTdT-3 '

SEQIDNO:379 3'-dTdTCGGCCUCAACCUCUGCGCA -5'

SEQIDNO:380 5'- GCUUCCGGGAGCAGCAGGUdTdT-3' Attorney Docket No.3300-01-lWO

SEQIDNO:381 3'-dTdTCGAAGGCCCUCGUCGUCCA -5'

SEQIDNO:382 5'- GGCCUGGACCGCUCCCUGCdTdT-3'

SEQIDNO:383 3'-dTdTCCGGACCUGGCGAGGGACG -5'

SEQIDNO:384 5'- GAGGCCACCAUUGAGAAGAdTdT-3'

SEQIDNO:385 3'-dTdTCUCCGGUGGUAACUCUUCU -5'

Example 38: ovary was found to have a homozygous deletion at 17q21.2 corresponding to positions 36463670-36481510. KRTAP2-4 having an Entrez ID no. of 85294 is contained within this deleted region.

Example 39: 3 pancreas/1 ovary/1 colon/2 breast was found to have a homozygous deletion at 17q21.31 corresponding to positions 40872186-41012163. PLEKHMl having an Entrez ID no. of 9842 is contained within this deleted region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:386 5'-ccactgaaagcatctccact-3' SEQ ID NO:387 5'-actgaaagcatctccactca-3' SEQ ID NO:388 5'-tgaaagcatctccactcacg-3'

siRNA

SEQIDNO:389 5'- GUGGGAUCCGUGAAGGCCUdTdT-3'

SEQIDNO:390 3'-dTdTCACCCUAGGCACUUCCGGA -5' Attorney Docket No.3300-01-lWO

SEQIDNO:391 5'- GCAGGAGCAGGCCCGCUUGdTdT-3 '

SEQIDNO:392 3'-dTdTCGUCCUCGUCCGGGCGAAC -5'

SEQIDNO:393 5'- GGCUCAUGACGGAGCUGGUdTdT-3'

SEQIDNO:394 3'-dTdTCCGAGUACUGCCUCGACCA -5'

SEQIDNO:395 5'- CAGCCUGAGGAACCCCCCGdTdT-3'

SEQIDNO:396 3'-dTdTGUCGGACUCCUUGGGGGGC -5'

SEQIDNO:397 5'- CAUCUGCCAGAUCUGCCAGdTdT-3'

SEQIDNO:398 3'-dTdTGUAGACGGUCUAGACGGUC -5'

Example 40: 4 breast/ 1 pancreas/ 1 uterus was found to have amplification at 17q21.32 corresponding to positions 43840603-43965937 of the human genome and having copy numbers of 6, 7, 30, 9, 23, and 8, respectively. HOXBl having an Entrez ID no. of 3211 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:399 5'-ctattatagtccatgcgtca-3' SEQ ID NO:400 5'-tcctattatagtccatgcgt-3' SEQ ID NO:401 5'-catcctattatagtccatgc-3'

siRNA Attorney Docket No.3300-01-lWO

SEQIDNO:402 5'- ACCCACUCTGUAACCGGGGdTdT-3'

SEQIDNO:403 3'-dTdTUGGGUGAGACAUUGGCCCC -5'

SEQIDNO:404 5'- GCUAUCCCGCCCAGCAGCCdTdT-3 '

SEQIDNO:405 3'-dTdTCGAUAGGGCGGGUCGUCGG -5'

SEQIDNO:406 5'- CAGCUAGGGGGCUUGUCCGdTdT-3'

SEQIDNO:407 3'-dTdTGUCGAUCCCCCGAACAGGC -5'

SEQIDNO:408 5'- CCUCCGCACCAACUUCACCdTdT-3'

SEQIDNO:409 S'-dTdTGGAGGCGUGGUUGAAGUGG -5'

SEQIDNO:410 5'- GAACUGAACCUAGCCACCAdTdT-3'

SEQIDNO:411 3'-dTdTCUUGACUUGGAUCGGUGGU -5'

Example 41:4 breast, 1 pancreas, and 1 uterus cancer cell lines were found to have amplification at 17q21.32 corresponding to positions 44360196-44483246 of the human genome and having copy numbers of 8, 7, 15, 9, 11, 12, and 6, respectively. GIP having Entrez Gene ID no.2695 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:412 5'-tcgtggccaccatcttcca-3' SEQ ID NO:413 5'-gtggccaccatcttccaag-3' Attorney Docket No.3300-01-lWO

SEQ ID NO:414 5'-ggccaccatcttccaaggt-3'

siRNA

SEQIDNO:415 5'- GGUGGCCACGAAGACCUUUdTdT-3'

SEQIDNO:416 3'-dTdTCCACCGGUGCUUCUGGAAA -5'

SEQ ID NO:417 5 ' - GCUGUCCCUGUUCCUGGCAdTdT-3 '

SEQIDNO:418 3'-dTdTCGACAGGGACAAGGACCGU -5'

SEQIDNO:419 5'- GCAGGCUCAGGUCUCGGUGdTdT-3'

SEQ ID NO:420 3 ' -dTdTCGUCCGAGUCCAGAGCCAC -5 '

SEQIDNO:421 5'- GUACGCGGAAGGGACUUUCdTdT-3'

SEQIDNO:422 3'-dTdTCAUGCGCCUUCCCUGAAAG -5'

SEQIDNO:423 5'- CAAGAGCUGUUGGCCUGCUdTdT-3'

SEQIDNO:424 3'-dTdTGUUCUCGACAACCGGACGA -5'

Example 42: 4 breast, 1 pancreas, and 1 uterus cell lines were found to have amplification at 17q21.32 corresponding to positions 44360196-44483246 of the human genome and having copy numbers of 8, 7, 15, 9, 11, 12, and 6 respectively. IGF2BP1 (also known as IMPl, ZBPl, CRDBP, IMP-I, CRD-BP, and VICKZl) having an Entrez ID no. of 10642 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules. Attorney Docket No.3300-01-lWO

Antisense

SEQ ID NO:425 5'-aaagcttgttcatggtggcg-3' SEQ ID NO:426 5'-agcttgttcatggtggcggt-3' SEQ ID NO:427 5'-cttgttcatggtggcggtct-3'

siRNA

SEQIDNO:428 5'- CAACGAGAGCGUGACCCCCdTdT-3'

SEQIDNO:429 3'-dTdTGUUGCUCUCGCACUGGGGG -5'

SEQIDNO:430 5'- GGCAGUGGUGAAUGUCACCdTdT-3 '

SEQIDNO:431 3'-dTdTCCGUCACCACUUACAGUGG -5'

SEQIDNO:432 5'- CUGCCAUGAGCCUGCAGUCdTdT-3'

SEQ ID NO:433 3 ' -dTdTGACGGUACUCGGACGUCAG -5 '

SEQIDNO:434 5'- CAGUGGGCGCCAUCAUCGGdTdT-3'

SEQIDNO:435 3 '-dTdTGUCACCCGCGGUA GUAGCC -5'

SEQIDNO:436 5'- CGUGUGCC AGC AUC AGCAGdTdT-3'

SEQIDNO:437 3'-dTdTGCACACGGUCGUAGUCGUC -5'

Example 43: 4 breast, 1 pancreas, and 1 uterus cancer cell ines were found to have amplification at 17q21.32 corresponding to positions 44360196-44483246 of the human genome and having copy numbers of 8, 7, 15, 9, 11, 12, and 6 respectively. Attorney Docket No.3300-01-lWO

SNF8 having an Entrez ID no. of 11267 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:438 5'-cgcggcggtgcatccccacc-3' SEQ ID NO:439 5'-cggcggtgcatccccaccct-3' SEQ ID NO:440 5'-gcggtgcatccccaccctgg-3'

siRNA

SEQIDNO:441 5'- gcaccgccgcggggugggadTdT-3'

SEQIDNO:442 3'-dTdTcguggcggcgccccacccu -5'

SEQIDNO:443 5'- cagcaaacacaagcaggagdTdT-3 '

SEQIDNO:444 3'-dTdTgtcgtttgtgttcgtcctc -5'

SEQ ID NO:445 5'- gggcgugggggacuucuaudTdT-3'

SEQIDNO:446 3'-dTdTcccgcacccccugaagaua -5'

SEQIDNO:447 5'- ggcacuuaccucauucagudTdT-3'

SEQIDNO:448 3'-dTdTccgugaauggaguaaguca -5'

SEQIDNO:449 5'- ggaggccagagaagcccucdTdT-3'

SEQ ID NO:450 3'-dTdTccuccggucucuucgggag -5' Attorney Docket No.3300-01-lWO

Example 44: 4 breast, 2 pancreas, and 1 uterus cancer cell lines were found to have amplification at 17q21.32 corresponding to positions 44547776-44634761 of the human genome and having copy numbers of 6, 7, 15, 9, 11, 9, and 6 respectively. B4GALNT2 having an Entrez ID no. of 124872 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:451 5'- cagcgctccccattcctggg-3' SEQ ID NO:452 5'- gcgctccccattcctggggg-3' SEQ ID NO:453 5'- gctccccattcctgggggtg-3'

siRNA

SEQIDNO:454 5'- gtgggaaaauuccacguggdTdT-3'

SEQ ID NO:455 3'-dTdTcacccuuuuaaggugcacc -5'

SEQIDNO:456 5'- ggggacgcccgagugugggdTdT-3 '

SEQIDNO:457 3'-dTdTccccugcgggcucacaccc -5'

SEQIDNO:458 5'- gucucaggaaccucuuuucdTdT-3'

SEQIDNO:459 3'-dTdTcagaguccuuggagaaaag -5'

SEQ ID NO:460 5'- ggcugaugacagccagaagdTdT-3'

SEQIDNO:461 3'-dTdTccgacuacugucggucuuc -5' Attorney Docket No.3300-01-lWO

SEQ ID NO:462 5'- gcguggucaacuucuuccudTdT-3'

SEQ ID NO:463 3'-dTdTcgcaccaguugaagaagga -5'

Example 45: 3 breast and 1 pancreas cell lines were found to have amplification at 17q21.33 corresponding to positions 45152515-45373334 of the human genome and having copy numbers of 6, 7, 11, and 15 respectively. MYST2 having an Entrez ID no. of 11143 is contained within this amplified region.

Antisense

SEQ ID NO:464 5'-ttccttcgcggcattgccggc-3' SEQ ID NO:465 5'-ccttcgcggcattgccggcgg-3' SEQ ID NO:466 5'-ttcgcggcattgccggcggct-3'

siRNA

SEQ ID NO:467 5'- gaggaaugcaggcaguagudTdT-3'

SEQIDNO:468 3'-dTdTcuccuuacguccgucauca -5'

SEQIDNO:469 5'- gccucgaacuccaacuggadTdT-3'

SEQIDNO:470 3'-dTdTcggagcuugagguugaccu -5'

SEQIDNO:471 5'- gcugcaaggccaaaucacadTdT-3'

SEQIDNO:472 3'-dTdTcgacguuccgguuuagugu -5'

SEQ ID NO:473 5'- ugagacagggcuauggcaadTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTacucugucccgauaccguu -5'

5'- caaauacuggaagggaaaadTdT-3'

3'-dTdTguuuaugaccuucccuuuu -5'

Example 46: 3 breast and 1 pancreas cell lines were found to have amplification at 17q21.33 corresponding to positions 45152515-45373334 of the human genome and having copy numbers of 6, 7, 11, and 15 respectively. TAC4 having an Entrez ID no. of 255061 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'- agggcgaggcaaggcagcat-3'

siRNA

5'- gccucgcccugcuucuccudTdT-3'

3'-dTdTcggagcgggacgaagagga -5'

5'- ccgugugcacuguggcaggdTdT-3 '

3'-dTdTggcacacgugacaccgucc -5'

5'- acucagcacugaagcagagdTdT-3'

3'-dTdTugagucgugacuucgucuc -5'

5'- gaggaaggcgcuggccccadTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTcuccuuccgcgaccggggu -5'

5'- ggggaagcgagtgggaggudTdT-3'

3'-dTdTccccuucgcucacccucca -5'

Example 47: 2 colon and 1 breast cancer cell lines were found to have amplification at 17q22 corresponding to positions 49179832-49366410 of the human genome and having copy numbers of 10, 8, and 8 respectively. KIF2B having an Entrez ID no. of 84643 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-actggctggccatggtgagt-3' SEQ ID NO:163 5'-tggctggccatggtgagtga-3' SEQ ID NO:162 5'-gctggccatggtgagtgatg-3'

siRNA

5'- gccaguucugccucccugadTdT-3'

3'-dTdTcggucaagacggagggacu -5'

5'- gccaguucugccucccugadTdT-3 '

3'-dTdTcggucaagacggagggacu -5'

5'- ggcagacgggaagugggaadTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTccgucugcccuucacccuu -5'

5'- ccaggagccaugcaguguudTdT-3'

3'-dTdTgguccucgguacgucacaa -5'

5'- ttgcattgcccggtctttgdTdT-3'

3'-dTdTaacgtaacgggccagaaac -5'

Example 48: 2 breast cancer cell lines were found to have amplification at 17q23.2 corresponding to positions 55698602-56267490 of the human genome and having copy numbers of 14 and 24 respectively. APPBP2 (PATl; HS.84084; KIAA0228) having an Entrez ID no. of 10513 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-ccacggccgccatcttcctt-3' SEQ ID NO:163 5'-acggccgccatcttccttcc-3' SEQ ID NO:162 5'-ggccgccatcttccttccct-3'

siRNA

5'- ucuccgcugucguggacaadTdT-3'

3'-dTdTagaggcgacagcaccuguu -5'

5'- gcuuugauggaucauggugdTdT-3 ' Attorney Docket No.3300-01-lWO

3'-dTdTcgaaacuaccuaguaccac -5'

5'- ggugcaucgaggcaaugaadTdT-3'

3'-dTdTccacguagcuccguuacuu -5'

5'- cuauggaaaccuuggaagadTdT-3'

3'-dTdTgauaccuuuggaaccuucu -5'

5'- agaaugucgagggaccgagdTdT-3'

3'-dTdTucuuacagcucccuggcuc -5'

Example 49: 2 breast cancer cell lines were found to have amplification at 17q23.2 corresponding to positions 55698602-56267490 corresponding to positions of the human genome and having copy numbers of 14and 24, respectively. C17ORF64 having an Entrez GeneID No. of 124773 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-accgccagagcatctttctc-3' SEQ ID NO:163 5'-cgccagagcatctttctcca-3' SEQ ID NO: 162 5'-ccagagcatctttctccagt-3'

siRNA

5'- cgguucaucucccucuucudTdT-3'

3'-dTdTgccaaguagagggagaaga -5' Attorney Docket No.3300-01-lWO

5'- cgguucaucucccucuucudTdT-3'

3'-dTdTgccucgaacuccaacugga -5'

5'- gcgccucggaugcgccggadTdT-3'

3 ' -dTdTcggagcuugagguugaccu -5 '

5'- gaaggagcggcuguccaacdTdT-3'

3'-dTdTcuuccucgccgacagguug -5'

5'- aggauaaaggaagccccagdTdT-3'

3'-dTdTuccuauuuccuucgggguc -5'

Example 50: 2 breast cancer cell lines were found to have amplification at 17q23.2 corresponding to positions 55698602-56267490 of the human genome and having copy numbers of 14 and 24, respectively. PPMlD (WIPl; PP2C-DELTA) having an Entrez ID no. of 8493 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-acagccccgccatggccggc-3' SEQ ID NO:163 5'-agccccgccatggccggctg-3' SEQ ID NO:162 5'-ccccgccatggccggctggc-3'

siRNA Attorney Docket No.3300-01-lWO

5'- cugggagugagcgucuucudTdT-3'

3'-dTdTgacccucacucgcagaaga -5'

5'- gucgccggccgcccuucccdTdT-3 '

3'-dTdTcagcggccggcgggaaggg -5'

5'- gacacaggaccauaagccadTdT-3'

3'-dTdTcuguguccugguauucggu -5'

5'- cgcuggaggcagcguaugcdTdT-3'

3'-dTdTgcgaccuccgucgcauacg -5'

5'- cccacaaccucacagcgaadTdT-3'

3'-dTdTggguguuggagugucgcuu -5'

Example 51:2 breast cancer cell lines were found to have amplification at was found to have amplification at 17q24.1 corresponding to positions 59931469-60385760 of the human genome and having copy numbers of 13 and 18, respectively. CCDC45 having Entrez ID no.90799 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-ccgagcctgccatgtttcaga-3' SEQ ID NO:163 5'-gagcctgccatgtttcagagg-3' Attorney Docket No.3300-01-lWO

SEQ ID NO:162 5'-gcctgccatgtttcagaggca-3'

siRNA

5'- ggguaaccauugccaauaadTdT-3'

3'-dTdTcccauugguaacgguuauu -5'

5'- ccucuugggauggagaugadTdT-3 '

3'-dTdTggagaacccuaccucuacu -5'

5'- ggaaguauauccagcucagdTdT-3'

3'-dTdTccuucauauaggucgaguc -5'

5'- ggcaaagguugacccaaucdTdT-3'

3'-dTdTccguuuccaacuggguuag -5'

5'- gcagcugcaggacaugauadTdT-3'

3'-dTdTcgucgacguccuguacuau -5'

Example 52: 2 breast cancer cell lines were found to have amplification at 17q24.1 corresponding to positions 59931469-60385760 of the human genome and having copy numbers of 13 and 18, respectively. DDX5 (p68; HLRl; G17P1; HUMP68; DKFZp686J01190) having an Entrez ID no. of 1655 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules. Attorney Docket No.3300-01-lWO

Antisense

SEQ ID NO:162 5'-aataacccgacatggcgtca-3' SEQ ID NO:163 5'-taacccgacatggcgtcaat-3' SEQ ID NO:162 5'-acccgacatggcgtcaatgg-3'

siRNA

5'- ccgagaccgcggccgggacdTdT-3'

3'-dTdTggcucuggcgccggcccug -5'

5'- ccugccauuguccacaucadTdT-3'

3'-dTdTggacgguaacagguguagu -5'

5'- gagugcaaaccacaacauudTdT-3'

3'-dTdTcucacguuugguguuguaa -5'

5'- cagaaugguguuuacagugdTdT-3'

3'-dTdTgucuuaccacaaaugucac -5'

5'- cauauccugcuacugcagcdTdT-3'

3'-dTdTguauaggacgaugacgucg -5'

Example 53: 2 breast cancer cell lines were found to have amplification at 17q24.1 corresponding to positions 59931469-60385760 of the human genome and having copy numbers of 13 and 18 respectively. SMURF2 having an Entrez ID no. of Attorney Docket No.3300-01-lWO

64750 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-cggggttagacatgtccccg-3' SEQ ID NO:163 5'-gggttagacatgtccccggc-3' SEQ ID NO:162 5'-gttagacatgtccccggcgg-3'

siRNA

5'- ggaggccggaggaacgggcdTdT-3'

3'-dTdTccuccggccuccuugcccg -5'

5'- gucuucuuuccaaugccaudTdT-3 '

3'-dTdTgucuucuuuccaaugccau -5'

5'- cagaagaaagguuacgguadTdT-3'

3'-dTdTgucuucuuuccaaugccau -5'

5'- cauggaguuaguagauccgdTdT-3'

3'-dTdTguaccucaaucaucuaggc -5'

5'- ccucucgagugccucugcadTdT-3'

3'-dTdTggagagcucacggagacgu -5' Attorney Docket No.3300-01-lWO

Example 54: 4 breast, 1 testes, and 1 lung cancer cell lines were found to have amplification at 17q24.1 corresponding to positions 60168065-60385760 of the human genome and having copy numbers of 6, 6, 13, 18, 6, and 7, respectively. LJ34306 having an Entrez ID no. of 374819 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-gagcggaagtcattctggca-3' SEQ ID NO:163 5'-gcggaagtcattctggcagc-3' SEQ ID NO:162 5'-ggaagtcattctggcagctc-3'

siRNA

5'- ggcaacuauuguggcuacudTdT-3'

3'-dTdTggcaacuauuguggcuacu -5'

5'- caguccucuucacuccagcdTdT-3 '

3'-dTdTgucaggagaagugaggucg -5'

5'- cugagucuucuagggaggudTdT-3'

3'-dTdTgacucagaagaucccucca -5'

5'- cugucugcaagacagucaadTdT-3'

3'-dTdTgacagacguucugucaguu -5'

5'- gcagcaggaaguaaaggcadTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTcgucguccuucauuuccgu -5'

Example 55: 2 breast caner cell lines were found to have ampli fication at 17q24.1 corresponding to positions 60168065-60861940 of the human genome and having copy numbers of 7 & 13 respectively. GNA13 having an Entrez ID no. of 10672 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-ggaagtccgccatcttgccg-3' SEQ ID NO:163 5'-aagtccgccatcttgccgcc-3' SEQ ID NO:162 5'-gtccgccatcttgccgccgc-3'

siRNA

5'- cgucgcgguccgugcugucdTdT-3'

3'-dTdTgcagcgccaggcacgacag -5'

5'- gcagcgccaggcacgacagdTdT-3 '

3'-dTdTcgtcgcggtccgtgctgtc -5'

5'- ugggcagacagcggcauacdTdT-3'

3'-dTdTacccgucugucgccguaug -5'

5'- cuuaaacaagacagacuugdTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTgaauuuguucugucugaac -5'

5'- caaccucaagcagcuuaugdTdT-3'

3'-dTdTguuggaguucgucgaauac -5'

Example 56: 2 breast cancer cell lines were found to have amplification at 17q24.1 corresponding to positions 60168065-60861940 of the human genome and having copy numbers of 7 & 13, respectively. RGS9 having an Entrez ID no. of 8787 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-gttggtaatacatgatctct-3' SEQ ID NO: 163 S'-tggtaatacatgatctcttt-S' SEQID NO : 162 5 ' -gtaatacatgatctcttttt-3 '

siRNA

5'- gugucccugggagggauugdTdT-3'

3'-dTdTcacagggacccucccuaac -5'

5'- cugggaagccugcgaggaudTdT-3 '

3'-dTdTgacccuucggacgcuccua -5'

5'- gcuggaagaggaagccaagdTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTcgaccuucuccuucgguuc -5'

5'- cgcagccggcccagggcccdTdT-3'

3'-dTdTgcgucggccgggucccggg -5'

5'- ccacggggagcgggaccugdTdT-3'

3'-dTdTggugccccucgcccuggac -5'

Example 57: 1 retina and 1 colon cancer cell lines were found to have amplification at 18q21.1 corresponding to positions 41836891-42147253 of the human genome and having copy numbers of 8 and 21, respectively. ATP5A1 having an Entrez ID no. of 498 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-gcacggacagcatctttgca-3' SEQ ID NO:163 5'-acggacagcatctttgcagt-3' SEQ ID NO : 162 5 ' -ggacagcatctttgcagtta-3 '

siRNA

5'- guugcugcggccgugguccdTdT-3'

3'-dTdTcaacgacgccggcaccagg -5'

5'- caauguugguguugucgugdTdT-3 '

3'-dTdTguuacaaccacaacagcac -5' Attorney Docket No.3300-01-lWO

5'- ccucaauugcuauugacacdTdT-3'

3'-dTdTggaguuaacgauaacugug -5'

5'- cgugucggauccgcugcccdTdT-3'

3'-dTdTgcacagccuaggcgacggg -5'

5'- gucucaugucgucagccagdTdT-3'

3'-dTdTcagaguacagcagucgguc -5'

Example 58: 1 retina and 1 colon cancer cell lines were found to have amplification at 18q21.1 corresponding to positions 41836891-42147253 of the human genome and having copy numbers of 8 and 21 respectively. C18ORF25 having an Entrez ID no. of 147339 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-cctccatcttcatttcag-3' SEQ ID NO:163 5'-tccatcttcatttcagaa-3' SEQ ID NO:162 5'-catcttcatttcagaatt-3'

siRNA

5'- ggaggaagauggaucuguadTdT-3'

3'-dTdTccuccuucuaccuagacau -5' Attorney Docket No.3300-01-lWO

5'- gugacaagccuacaacuggdTdT-3 '

3'-dTdTcacuguucggauguugacc -5'

5'- gagacccuucaggagugucdTdT-3'

3'-dTdTcucugggaaguccucacag -5'

5'- gcuggcaaugcgccacucadTdT-3'

3'-dTdTcgaccguuacgcggugagu -5'

5'- uggacugcugugacuccccdTdT-3'

3'-dTdTaccugacgacacugagggg -5'

Example 59: 1 retina and 1 colon cancer cell lines were found to have amplification at 18q21.1 corresponding to positions 41836891-42147253 of the human genome and having copy numbers of 8 and 21 respectively. CCDC5 having an Entrez ID no. of 115106 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO: 162 5'-cctgcggctccatagctgcg-3' SEQ ID NO:163 5'-tgcggctccatagctgcggc-3' SEQ ID NO:162 5'-cggctccatagctgcggctc-3'

siRNA Attorney Docket No.3300-01-lWO

5'- cgcaggaggagagagaaacdTdT-3'

3'-dTdTgcgtcctcctctctctttg -5'

5'- ccgggacagggaugtcuacdTdT-3'

3'-dTdTggcccugucccuacagaug -5'

5'- ccucugaucucuuucguadTdT-3'

3 ' -dTdTggagacuagagaaagcau -5 '

5'- caaggcugcagaggagcaadTdT-3'

3'-dTdTguuccgacgucuccucguu -5'

5'- gaauccgucucuugcucaadTdT-3'

3'-dTdTcuuaggcagagaacgaguu -5'

Example 60: 1 retina and 1 colon cancer cell lines were found to have amplification at 18q21.1 corresponding to positions 43881632-44195025 of the human genome and having copy numbers of 10 and 17, respectively. C18ORF12 having an Entrez ID no. of 84322 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-caatgcactattctctccat-3' Attorney Docket No.3300-01-lWO

siRNA

5'- gugaguugggacaacuugudTdT-3'

3'-dTdTcacucaacccuguugaaca -5'

5'- uucucccucuugccacugadTdT-3 '

3'-dTdTaagagggagaacggugacu -5'

5'- uggggcauggcuccucucudTdT-3'

3'-dTdTaccccguaccgaggagaga -5'

5'- gucucccucucuuuccuccdTdT-3'

3'-dTdTcagagggagagaaaggagg -5'

5'- gccauuccccucccaccaadTdT-3'

3'-dTdTcgguaaggggagggugguu -5'

Example 61: 1 colon/ 1 retina was found to have amplification at 18q21.1 corresponding to positions 45413089-46054419 of the human genome and having copy numbers of 10 and 19 respectively. ACAA2 having an Entrez ID no. of 10449 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense Attorney Docket No.3300-01-lWO

SEQ ID NO:162 5'-ggagcagacgcatggcggct-3' SEQ ID NO:163 5'-agcagacgcatggcggctgc-3' SEQ ID NO:162 5'-cagacgcatggcggctgctg-3'

siRNA

5'- gagcuuacggaggccuucudTdT-3'

3'-dTdTcucgaaugccuccggaaga -5'

5'- gaaucccaaaggagaccccdTdT-3 '

3'-dTdTcuuaggguuuccucugggg -5'

5'- ccccaaaccacccuggaacdTdT-3'

3'-dTdTgggguuuggugggaccuug -5'

5'- gguccugucccugcuaucadTdT-3'

3'-dTdTccaggacagggacgauagu -5'

5'- cugguucacgaauuaaggcdTdT-3'

3'-dTdTgaccaagugcuuaauuccg -5'

Example 62: 1 colon and 1 retina cancer cell lines were found to have amplification at 18q21.1 corresponding to positions 45413089-46054419 of the human genome and having copy numbers of 10 and 19, respectively. CCDCl 1 having an Attorney Docket No.3300-01-lWO

Entrez ID no. of 220136 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO: 162 5'-gctggctgtacattttcgag-3' SEQ ID NO : 163 5 ' -tggctgtacattttcgagtc-3 ' SEQ ID NO:162 5'-gctgtacattttcgagtccc-3'

siRNA

5'- gcgggagguuaagggccccdTdT-3'

3'-dTdTcgcccuccaauucccgggg -5'

5'- ucagggaacgcugugaggadTdT-3 '

3'-dTdTagucccuugcgacacuccu -5'

5'- cccaagaggcgaggagacadTdT-3'

3'-dTdTggguucuccgcuccucugu -5'

5'- gaggcaaggagacagcuugdTdT-3'

3'-dTdTcuccguuccucugucgaac -5'

5'- ccuguccacccaucaagugdTdT-3'

3'-dTdTggacagguggguaguucac -5' Attorney Docket No. 3300-01-lWO

Example 63 : 3 colon cancer cell lines were found to have a homozygous deletion at 18q21.1 corresponding to positions 46781416-46822269. SMAD4 having an Entrez ID no. of 4089 is contained within this deleted region and is also known as JIP, DPC4, and MADH4.

Example 64: 1 pancreas and 1 retina cancer cell line was found to have amplification at 18q23 corresponding to positions 72198777-72561380 of the human genome and having copy numbers of 6 and 23 respectively. FLJ44881 having an Entrez ID no. of 400661 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO: 162 5 '-tcagagcacccatcttccat-3 ' SEQ ID NO: 163 5 '-agagcacccatcttccatcc-3 ' SEQ ID NO: 162 5 '-agcacccatcttccatccct-3 '

siRNA

5 '- ugcucugaauuccauuuccdTdT-3 '

3 '-dTdTacgagacuuaagguaaagg -5 '

5'- gcaccgcaaggacacuccgdTdT-3 '

3 '-dTdTcguggcguuccugugaggc -5 '

5 '- cugugacacuguuugucccdTdT-3 '

3'-dTdTgacacugugacaaacaggg -5' Attorney Docket No.3300-01-lWO

5'- auuggcugccuccacuccadTdT-3'

3'-dTdTuaaccgacggaggugaggu -5'

5'- gccgugcucugaucugcagdTdT-3'

3'-dTdTcggcacgagacuagacguc -5'

Example 65: 1 pancreas and 1 retina cancer cell lines were found to have amplification at 18q23corresponding to positions 72198777-72561380 of the human genome and having copy numbers of 6 and 2,3 respectively. FLJ44313 having an Entrez ID no. of 400658 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-gcgggacccgcatcccgagc-3' SEQ ID NO:163 5'-gggacccgcatcccgagcac-3' SEQ ID NO: 162 5'-gacccgcatcccgagcacgt-3'

siRNA

5'- gcgggucccgccggcgggudTdT-3'

3'-dTdTcgcccagggcggccgccca -5'

5'- uggggacaccccuucggggdTdT-3 '

3'-dTdTaccccuguggggaagcccc -5' Attorney Docket No.3300-01-lWO

5'- agacgcccaacguggcuccdTdT-3'

3'-dTdTucugcggguugcaccgagg -5'

5'- aucagacggggggggcauudTdT-3'

3'-dTdTaucagacggggggggcauu -5'

5'- gacaaccuccgcuaugaagdTdT-3'

3'-dTdTcuguuggaggcgauacuuc -5'

Example 66: 2 glioblastoma was found to have a homozygous deletion at Ip32.3 corresponding to positions 51011619-51180573. CDKN2C having an Entrez ID no. of 1031 is contained within this deleted region (also know as pi 8, INK4C, and pi 8- INK4C) and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-aaggctcggccattctttag-3' SEQ ID NO:163 5'-ggctcggccattctttaggg-3' SEQ ID NO: 162 5'-ctcggccattctttagggtc-3'

siRNA

5'- gggggaccuagagcaacuudTdT-3'

3'-dTdTcccccuggaucucguugaa -5'

5'- aggacugcgcugcagguuadTdT-3 ' Attorney Docket No. 3300-01-lWO

3 '-dTdTuccugacgcgacguccaau -5 '

5 '- gcccuugcacuuggcugccdTdT-3 '

3'-dTdTcgggaacgugaaccgacgg -5'

5 '- uaagggggacaccgccugudTdT-3 '

3 '-dTdTauucccccuguggcggaca -5 '

5 '- aacggggcugggggagccadTdT-3 '

3 '-dTdTuugccccgacccccucggu -5 '

Example 67: 2 glioblastoma cell lines were found to have a homozygous deletion at Ip32.3 corresponding to positions of 51011619-51180573 of the human genome. FAFl having an Entrez ID no. of 11124 is contained within this deleted region.

Example 68: 1 pancreas, 1 breast, and 1 skin cancer cell lines were found to have a homozygous deletion at 1 q21.1 corresponding to positions 145938657-146474013 of the human genome. LOC388692 having an Entrez ID no. of 388692 is contained within this deleted region.

Example 69: 1 pancreas, 1 breast, and 1 skin cancer cell lines were found to have a homozygous deletion at 1 q21.1 corresponding to positions 145938657-146474013 of the human genome. LOC440686 having an Entrez ID no. of 440686 is contained within this deleted region Attorney Docket No. 3300-01-lWO

Example 70: 1 pancreas, 1 breast, and 1 skin cancer cell lines were found to have a homozygous deletion at 1 q21.1 corresponding to positions 145938657-146474013 of the human genome. PPIAL4 (COAS2 ; cyclophilin homolog overexpressed in liver cancer) having an Entrez ID no. of 164022 is contained within this region.

Example 71 : 4 breast, 1 colon, 1 ovary, and 1 retina cancer cell lines were found to have an amplification at Iq21.2 corresponding to positions 147215687-147408610 of the human genome and having copy numbers of 6,7,6,8,7,6, and 15, respectively. ADAMTSL4 having an Entrez ID no. of 54507 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO: 162 5 '-tccagttctccatcgctcc-3 ' SEQ ID NO: 163 5 '-cagttctccatcgctcccc-3 ' SEQ ID NO: 162 5 '-gttctccatcgctccccct-3 '

siRNA

5 '- uggcaggcccuggcuguaudTdT-3 '

3 '-dTdTaccguccgggaccgacaua -5 '

5'- ugggggugcagcgcaggagdTdT-3'

3 '-dTdTacccccacgucgcguccuc -5 '

5 '- gacaucuguguggcuggacdTdT-3 '

3'-dTdTcuguagacacaccgaccug -5' Attorney Docket No.3300-01-lWO

5'- gggaggagggcaaaggggadTdT-3'

3'-dTdTcccuccucccguuuccccu -5'

5'- ggaacgcagacacgggaggdTdT-3'

3'-dTdTccuugcgucugugcccucc -5'

Example 72: 4 breast, 1 colon, 1 ovary, and 1 retina cancer cell lines were found to have amplification at Iq21.2corresponding to positions 147215687-147408610 of the human genome and having copy numbers of 6, 7, 6, 8, 7, 6, and 15 respectively. C10ORF138 having an Entrez ID no. of 414234 is contained within this region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-tggacgcctccatgggcagc-3' SEQ ID NO:163 5'-gacgcctccatgggcagcgt-3' SEQ ID NO:162 5'-cgcctccatgggcagcgtct-3'

siRNA

5'- AAAGGCUCCUAAACAUUUAdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5 ' - AUUGCUAGGUAGUC AA AUAdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5' Attorney Docket No.3300-01-lWO

5'- AGAAGCCGAUUGUU AACUAdTdT-3'

3 ' -dTdTUCUUCGGCUAAC AAUUGAU -5 '

5'- UGAUC AAAUUACCGGAUUAdTdT-3'

3 '-dTdT ACUAGUUU AAUGGCCUAAU -5'

5'- UCGUGGACAUGAAAUUAUAdTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 73: 4 breast/1 colon/1 ovary/1 retina was found to have amplification at Iq21.2corresponding to positions 147215687-147408610 and havin is contained within this amplified region. g copy numbers of 6, 7, 6, 8, 7, 6, and 15, respectively. ECMl having an Entrez ID no. of 1893 is contained within this region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-ctgtggtccccatcctgggg-3' SEQ ID NO:163 5'-gtggtccccatcctggggca-3' SEQ ID NO:162 5'-ggtccccatcctggggcaac-3'

siRNA

5'- gucuugaccuauuuggcugdTdT-3'

3'-dTdTcagaacuggauaaaccgac -5'

5'- gagggacagagucaagugcdTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTcucccugucucaguucacg -5'

5'- ccaaacuugugugggaggadTdT-3'

3 ' -dTdTgguuugaacacacccuccu -5 '

5'- gggagcugcuggcacugaudTdT-3'

3'-dTdTcccucgacgaccgugacua -5'

5'- ugcccgcugcugugaccugdTdT-3'

3'-dTdTacgggcgacgacacuggac -5'

Example 74: 4 breast, 1 colon, 1 ovary, and 1 retina cancer cell lines were found to have amplification at q21.2 corresponding to positions 147215687-147408610 of the human genome and having copy numbers of 6, 7, 6, 8, 7, 6, and 15, respectively. MCLl (TM; EAT; MCLlL; MCLlS; MGC1839; MGC104264) having an Entrez ID no. of 4170 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-tgaggccaaacattgccagt-3' SEQ ID NO:163 5'-aggccaaacattgccagtcg-3' SEQ ID NO:162 5'-gccaaacattgccagtcgcc-3'

siRNA

5'- cgcgguaaucggacucaacdTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTgcgccauuagccugaguug -5'

5'- uggcggaagcgccggcgcadTdT-3 '

3'-dTdTaccgccuucgcggccgcgu -5'

5'- gcgcggcgccgcuugaggadTdT-3'

3'-dTdTcgcgccgcggcgaacuccu -5'

5'- cguaacaaacuggggcaggdTdT-3'

3'-dTdTgcauuguuugaccccgucc -5'

5'- uguugcuggaguaggagcudTdT-3'

3'-dTdTccguugauaacaccgauga -5'

Example 75: 4 breast/1 colon/1 ovary/1 retina was found to have amplification at Iq21.2corresponding to positions 147215687-147408610 of the human genome and having copy numbers of 6, 7, 6, 8, 7, 6, and 15, respectively. TARSLl having an Entrez ID no. of 80222 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO: 162 5'-gatacagggccatgttcctt-3' SEQ ID NO:163 5'-ctgatacagggccatgttcc-3' SEQ ID NO:162 5'-ctctgatacagggccatgtt-3' Attorney Docket No. 3300-01-lWO

siRNA

5 '- gccctgtatcagaggtggcdTdT-3 '

3 '-dTdTcgggacatagtctccaccg -5 '

5'- cgggatcagcttcgccagtdTdT-3 '

3 '-dTdTgccctagtcgaagcggtca -5 '

5 '- ggagcattatcaggaagacdTdT-3 '

3'-dTdTcctcgtaatagtccttctg -5'

5 '- ctgggggacccttgcctttdTdT-3 '

3 '-dTdTgaccccctgggaacggaaa -5 '

5 '- tcgtcgccttggggagtggdTdT-3 '

3 '-dTdTagcagcggaacccctcacc -5 '

Example 76: 4 breast and 1 ovary cancer cell lines were found to have amplification at Iq25.3 corresponding to positions 180415407-181205071 of the human genome and having copy numbers of 6, 7, 6, 6, and 15, respectively. Cl ORF 19 having an Entrez ID no. of 116461 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense Attorney Docket No.3300-01-lWO

SEQ ID NO:162 5'-cgcgctcctccatgccggcc-3' SEQ ID NO:163 5'-cgctcctccatgccggccgg-3' SEQ ID NO:162 5'-ctcctccatgccggccggtg-3'

siRNA

5'- cgagccgacccccggctgcdTdT-3'

3'-dTdTgctcggctgggggccgacg -5'

5'- ccttcgtgggcccctgaggdTdT-3 '

3'-dTdTggaagcacccggggactcc -5'

5'- cctggacctcatggaaagcdTdT-3'

3'-dTdTggacctggagtacctttcg -5'

5'- ggtgatccagatttgccgadTdT-3'

3'-dTdTccactaggtctaaacggct -5'

5'- tggatttatgctgccagacdTdT-3'

3'-dTdTacctaaatacgacggtctg -5'

Example 77: 4 breast and 1 ovary cancer cell lines were found to have amplification at Iq25.3 corresponding to positions 180415407-181205071 of the human genome and having copy numbers of 6,7,6,6, and 15, respectively. C1ORF21 having an Entrez ID no. of 81563 is contained within this amplified region. Attorney Docket No.3300-01-lWO

Antisense

SEQ ID NO:162 5'-aggcacagcccatagtctca-3' SEQ ID NO:163 5'-gcacagcccatagtctcatt-3' SEQ ID NO:162 5'-acagcccatagtctcattcg-3'

siRNA

5'- ggctgtgcctccgccaagcdTdT-3'

3'-dTdTccgacacggaggcggttcg -5'

5'- gatgagtataggatcaaacdTdT-3 '

3'-dTdTctactcatatcctagtttg -5'

5'- ggcagaagaagagcagaaadTdT-3'

3'-dTdTccgtcttcttctcgtcttt -5'

5'- aacccagagcaaacatgcadTdT-3'

3'-dTdTttgggtctcgtttgtacgt -5'

5'- cggaagaagaggatatcacdTdT-3'

3'-dTdTgccttcttctcctatagtg -5'

Example 78: 4 breast and 1 ovary cancer cell lines were found to have amplification at Iq25.3 corresponding to positions 180415407-181205071 of the human Attorney Docket No.3300-01-lWO

genome and having copy numbers of 6, 7, 6, 6, and 15, respectively. GLT25D2 having an Entrez ID no. of 23127 is contained within this amplified region.

Antisense

SEQ ID NO:162 5'-ggcgcgcagccatgttccgg-3' SEQ ID NO:163 5'-cgcgcagccatgttccgggc-3' SEQ ID NO:162 5'-gcagccatgttccgggccg-3'

siRNA

5'- gcgcgcuucgucgccgagcdTdT-3'

3'-dTdTcgcgcgaagcagcggcutcg -5'

5'- ccacugaucacaauguggadTdT-3 '

3'-dTdTggugacuaguguuacaccu -5'

5'- auggaagaggacaggcugcdTdT-3'

3'-dTdTuaccuucuccuguccgacg -5'

5'- aggccagccgggguaccugdTdT-3'

3'-dTdTuccggucggccccauggac -5'

5'- caggaaggaggccucggacdTdT-3'

3'-dTdTguccuuccuccggagccug -5' Attorney Docket No.3300-01-lWO

Example 79: 4 breast and 1 ovary cancer cell lines were found to have amplification at Iq25.3 corresponding to positions 180415407-181205071 of the human genome and having copy numbers of 6, 7, 6, 6, and 15, respectively. RGLl having an Entrez ID no. of 23179 is contained within this amplified region.

Antisense

SEQ ID NO:162 5'-gtttcacctccatcttgaaa-3' SEQ ID NO:163 5'-ttcacctccatcttgaaaga-3' SEQ ID NO:162 5'-cacctccatcttgaaagagg-3'

siRNA

5'- gggugaagagguagaggaadTdT-3'

3'-dTdTcccacuucuccaucuccuu -5'

5'- gcccaaacugugaagaagadTdT-3 '

3'-dTdTcggguuugacacuucuucu -5'

5'- gaacuggaggguggagagudTdT-3'

3'-dTdTcuugaccucccaccucuca -5'

5'- ggcagcagcuccugacagadTdT-3'

3'-dTdTccgucgucgaggacugucu -5'

5'- gacacagcaaaaucacccudTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTcugugucguuuuaguggga -5'

Example 80: 3 breast and 1 ovary cancer cell lines were found to have amplification at Iq25.3-31.1 corresponding to positions 181684771-182814289 having 6, 7, 6, and 16, respectively. C1ORF25 having an Entrez ID no. of 81627 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-ccatattctccatagttacc-3' SEQ ID NO:163 5'-atattctccatagttaccgc-3' SEQ ID NO:162 5'-attctccatagttaccgcct-3'

siRNA

5'- gagcugcugccccuggagadTdT-3'

3'-dTdTcucgacgacggggaccucu -5'

5'- uuacaggaugugcaucugudTdT-3 '

3'-dTdTaauguccuacacguagaca -5'

5'- cuguacauuggcugcuuugdTdT-3'

3'-dTdTgacauguaaccgacgaaac -5'

5'- guuuugaggggaccuacuudTdT-S'

3'-dTdTcaaaacuccccuggaugaa -5' Attorney Docket No.3300-01-lWO

5'- caccuacacuggaggacagdTdT-3'

3'-dTdTguggaugugaccuccuguc -5'

Example 81:3 breast and 1 ovary cancer cell lines were found to have amplification at Iq25.3-31.1 corresponding to positions 181684771-182814289 of the human genome and having copy numbers of 6,7,6, and 16, respectively. C1ORF26 having an Entrez ID no. of 54823 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO: 162 5'-ctttgctggacatcctgaaa-3' SEQ ID NO:163 5'-ttgctggacatcctgaaaag-3' SEQ ID NO:162 5'-gctggacatcctgaaaagct-3'

siRNA

5'- ggaaagacaccaccaccucdTdT-3'

3'-dTdTccuuucuguggugguggag -5'

5'- ugggaucuaggagacagaadTdT-3 '

3'-dTdTacccuagauccucugucuu -5'

5'- caacaguugaaagcagaaadTdT-3'

3'-dTdTguugucaacuuucgucuuu -5' Attorney Docket No.3300-01-lWO

5'- caacaguugaaagcagaaadTdT-3'

3'-dTdTguugucaacuuucgucuuu -5'

5'- caggggauggugugaagacdTdT-3'

3'-dTdTguccccuaccacacuucug -5'

Example 82: 3 breast and 1 ovary cancer cell lines were found to have amplification at Iq25.3-31.1 corresponding to positions 181684771-182814289 of the human genome and having copy numbers of 6,7,6,16 respectively. IVNSlABP having an Entrez ID no. of 10625 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO: 162 5'-cattgggaatcatttttcct-3' SEQ ID NO : 163 5 ' -ttgggaatcatttttcctta-3 ' SEQ ID NO: 162 S'-gggaatcatttttccttata-S'

siRNA

5'- gaaaaguggccaguucugudTdT-3'

3'-dTdTcuuuucaccggucaagaca -5'

5'- gauggaagagguucaaaccdTdT-3 '

3'-dTdTcuaccuucuccaaguuugg -5'

5'- ggucugggaacagcagagadTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTccagacccuugucgucucu -5'

5'- caagcugugccccucuuaadTdT-3'

3'-dTdTguucgacacggggagaauu -5'

5'- cuguagggaacaccauuuadTdT-3'

3'-dTdTgacaucccuugugguaaau -5'

Example 83: 3 breast and 1 ovary cancer cell lines were found to have amplification at Iq25.3-31.1 corresponding to positions 181684771-182814289 of the human genome and having copy numbers of 6, 7, 6, and 16, respectively. RNF2 (BAPl; DING; BAP- 1; HIPI3; RING2; RINGlB) having an Entrez ID no. of 6045 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-cagcctgagacattgcggct-3' SEQ ID NO:163 5'-gcctgagacattgcggctcc-3' SEQ ID NO:162 5'-ctgagacattgcggctcctg-3'

siRNA

5'- gacaaacggaacucaaccadTdT-3'

3'-dTdTcuguuugccuugaguuggu -5' Attorney Docket No.3300-01-lWO

5'- cagacugcaucaucacagcdTdT-3 '

3'-dTdTgucugacguaguagugucg -5'

5'- aggacugaagauacaggccdTdT-3'

3'-dTdTuccugacuucuauguccgg -5'

5'- uucaggccucaucccacacdTdT-3'

3'-dTdTaaguccggaguagggugug -5'

5'- cagugagaagcaguauaccdTdT-3'

3'-dTdTgucacucuucgucauaugg -5'

Example 84: 3 breast, 2 prostate, 1 ovary, and 1 retina cancer cell lines were found to have amplification at Iq32.1 corresponding to positions 197438748-197663962 of the human genome and having copy numbers of 6, 7, 6, 6, 15, and 6, respectively. Cl ORF 106 having an Entrez ID no. of 55765 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-aacttcggcatttgcagcat-3'

siRNA

5'- cggggggagggaagauggcdTdT-3'

3'-dTdTgccccccucccuucuaccg -5' Attorney Docket No.3300-01-lWO

5'- gacgggcaccuugccagcgdTdT-3 '

3'-dTdTcugcccguggaacggucgc -5'

5'- cugauggggccccugugcadTdT-3'

3'-dTdTgacuaccccggggacacgu -5'

5'- gucuccagccccaccuucudTdT-3'

3'-dTdTcagaggucgggguggaaga -5'

5'- ggaggagggcacuccccugdTdT-3'

3'-dTdTccuccucccgugaggggac -5'

Example 85: 3 breast, 2 prostate, 1 ovary, and 1 retina cancer cell lines were found to have amplification at Iq32.1 corresponding to positions 197438748-197663962 of the human genome and having copy numbers of 6, 7, 6, 6, 15, and 6 respectively. CAMSAPlLl having an Entrez ID no. of 23271 is contained within this amplified region.

Antisense

SEQ ID NO:162 5'-cagcatcccccatctttcac-3' SEQ ID NO:163 5'-gcatcccccatctttcaccg-3' SEQ ID NO:162 5'-atcccccatctttcaccgcg-3'

siRNA Attorney Docket No.3300-01-lWO

5'- AAAGGCUCCUAAACAUUUAdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5 ' - AUUGCUAGGUAGUC AA AUAdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- AGAAGCCGAUUGUU AACUAdTdT-3'

3 ' -dTdTUCUUCGGCUAAC AAUUGAU -5 '

5'- UGAUC AAAUUACCGGAUUAdTdT-3'

3 '-dTdT ACUAGUUU AAUGGCCUAAU -5'

5'- UCGUGGACAUGAAAUUAUAdTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 86: 3 breast, 2 prostate, 1 ovary, and 1 retina cancer cell lines were found to have amplification at Iq32.1 corresponding to positions 197438748-197663962 of the human genome and having copy numbers of 6, 7, 6, 6, 15, and 6, respectively. GPR25 having an Entrez ID no. of 2848 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-tggacgcctccatgggcagc-3' SEQ ID NO:163 5'-gacgcctccatgggcagcgt-3' SEQ ID NO:162 5'-cgcctccatgggcagcgtct-3' Attorney Docket No.3300-01-lWO

siRNA

5'- cuggcugguggccaaagccdTdT-3'

3'-dTdTgaccgaccaccgguuucgg -5'

5'- cuucuagguauucacguccdTdT-3 '

3'-dTdTgaagauccauaagugcagg -5'

5'- ccagaagaaacagggcuucdTdT-3'

3'-dTdTggucuucuuugucccgaag -5'

5'- ctcagauuugaaacccccudTdT-3'

3'-dTdTgagucuaaacuuuggggga -5'

5'- caggaugccaguucagaucdTdT-3'

3'-dTdTguccuacggucaagucuag -5'

Example 87: 8 colon and 2 breast cancer cell lines were found to have a homozygous deletion at 20pl2.1 corresponding to positions 14275900-15138181 of the human genome. C20ORF133 having an Entrez ID no. of 140733 is contained within this region.

Example 88: Breast cancer cell lines were found to have amplification at 20ql3.12corresponding to positions 45274460-46061573 of the human genome and having copy numbers of 10-16. NCOA3 (ACTR; AIBl; RAC3; SRC3; pCIP; CTG26; Attorney Docket No.3300-01-lWO

CAGH16; TNRC14; TNRC16; TRAM-I) having an Entrez ID no. of 8202 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-ctaatccactcatcttgaat-3' SEQ ID NO:163 5'-aatccactcatcttgaatat-3' SEQ ID NO:162 5'-tccactcatcttgaatatac-3'

siRNA

5'- cggagacgggagcaggaaadTdT-3'

3'-dTdTgcctctgccctcgtccttt -5'

5'- cauuuccaucaaacccugadTdT-3 '

3'-dTdTguaaagguaguuugggacu -5'

5'- cuguugcaggugugcacucdTdT-3'

3'-dTdTgacaacguccacacgugag -5'

5'- gaucuuguugggccaccuudTdT-3'

3'-dTdTcuagaacaacccgguggaa -5'

5'- cccagaaucccaugaugcadTdT-3'

3'-dTdTgggucuuaggguacuacgu -5' Attorney Docket No.3300-01-lWO

Example 89: 5 breast, 4 colon, 2 skin, and 1 lung cancer cell lines were found to have amplification at 20ql 3.32 corresponding to positions 55465401-56285043 of the human genome and having copy numbers of 6, 6, 6, 6, 7, 6, 7, 13, 13, 6, 7, 10, and 21, respectively. C20ORF85 having an Entrez ID no. of 128602 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-gtttctgcgccatgaggcct-3' SEQ ID NO:163 5'-ttctgcgccatgaggcctgg-3' SEQ ID NO:162 5'-ctgcgccatgaggcctgggg-3'

siRNA

5'- ccgcggcggcugaacgcaudTdT-3'

3'-dTdTggcgccgccgacuugcgua -5'

5'- cccagaacuggggguuuuudTdT-3 '

3'-dTdTgggucuugacccccaaaaa -5'

5'- cccacagaccacccagggcdTdT-3'

3 ' -dTdTgggugucuggugggucccg -5 '

5'- ugaacaagugccuagagcudTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTacuuguucacggaucucga -5'

5'- gcccaagcagggcgugcacdTdT-3'

3'-dTdTcggguucgucccgcacgug -5'

Example 90: 5 breast, 4 colon, 2 skin, and 1 lung cancer cell lines were found to have amplification at 20ql 3.32 corresponding to positions 55465401-56285043 of the human genome and having copy numbers of 6, 6, 6, 6, 7, 6, 7, 13, 13, 6, 7, 10, and 21, respectively. C20ORF86 having an Entrez ID no. of 140731 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-CCCgCCgCCgCCCgCCgCaI-S¹

siRNA

5'- gcgcgggcggcggggccaadTdT-3'

3'-dTdTcgcgcccgccgccccgguu -5'

5'- gcucgucugugacccgaagdTdT-3 '

3'-dTdTcgagcagacacugggcuuc -5'

5'- gcggcuguggaaggggaucdTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTcgccgacaccuuccccuag -5'

5'- cggggccuccauccacgacdTdT-3'

3'-dTdTgccccggagguaggugcug -5'

5'- uaggucugagaagaugacgdTdT-3'

3'-dTdTauccagacucuucuacugc -5'

Example 91:5 breast, 4 colon, 2 skin, and 1 lung cancer cell lines were found to have amplification at 20ql 3.32 corresponding to positions 55465401-56285043 of the human genome and having copy numbers of 6, 6, 6, 6, 7, 6, 7, 13, 13, 6, 7, 10, and 21, respectively. CTCFL (BORIS; CTCF-T; dJ579F20.2) having an Entrez ID no. of 140690 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules. Antisense

SEQ ID NO:162 5'-cagtggctgccataatgact-3' SEQ ID NO:163 5'-gtggctgccataatgacttg-3' SEQ ID NO:162 5'-ggctgccataatgacttggc-3'

siRNA

5'- cggagugugcagagagaaadTdT-3'

3'-dTdTgccucacacgucucucuuu -5'

5'- ggaagggccccggcagagcdTdT-3'

3'-dTdTccttcccggggccgtctcg -5' Attorney Docket No.3300-01-lWO

5'- caccaguggagaacucgucdTdT-3'

3'-dTdTguggucaccucuugagcag -5'

5'- acccacacuggagagaaacdTdT-3'

3'-dTdTugggugugaccucucuuug -5'

5'- acccacacuggagagaaacdTdT-3'

3'-dTdTugggugugaccucucuuug -5'

Example 92: 5 breast/4 colon/2 skin/1 lung was found to have amplification at20ql3.32 corresponding to positions 55465401-56285043 of the human genome and having copy numbers of 6, 6, 6, 6, 7, 6, 7, 13, 13, 6, 7, 10, and 21, respectively. HMGlLl having an Entrez ID no. of 10357 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-ttaggatctcctttgcccat-3'

siRNA

5'- gagatcctaagaagccgagdTdT-3'

3'-dTdTctctaggattcttcggctc -5'

5'- caaaggcggacaagacccadTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTgtttccgcctgttctgggt -5'

5'- gagatgtggaataacactgdTdT-3'

3'-dTdTctctacaccttattgtgac -5'

5'- gcctgaggcagcaaaaaagdTdT-3'

3'-dTdTcggactccgtcgttttttc -5'

5'- aagaggatgaggaggaggadTdT-3'

3'-dTdTttctcctactcctcctcct -5'

Example 93: 5 breast, 4 colon, 2 skin, and 1 lung cancer cell lines were found to have amplification at 20ql 3.32 corresponding to positions 55465401-56285043 of the human genome and having copy numbers of 6, 6, 6, 6, 7, 6, 7, 13, 13, 6, 7, 10, and 21 respectively. PCKl having an Entrez ID no. of 5105 is contained within this region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-gctgaggaggcatttctgca-3^: SEQ ID NO:163 5'-tgaggaggcatttctgcaga-3^: SEQ ID NO:162 5'-aggaggcatttctgcagagt-3^:

siRNA

5'- ccagggaagccuggacagcdTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTggucccuucggaccugucg -5'

5'- ucggucgcuggaugucagadTdT-3 '

3'-dTdTagccagcgaccutacagucu -5'

5'- cuggcggccgcauuucccadTdT-3'

3'-dTdTagccagcgaccuacagucu -5'

5'- uuggaggccguagaccugcdTdT-3'

3'-dTdTaaccuccggcaucuggacg -5'

5'- gggcacaucaacaugauggdTdT-3'

3'-dTdTcccguguaguuguacuacc -5'

Example 94: 5 breast, 4 colon, 2 skin, and 1 lung cancer cell lines were found to have amplification at 20ql 3.32 corresponding to positions 55465401-56285043 of the human genome and having copy numbers of 6, 6, 6, 6, 7, 6, 7, 13, 13, 6, 7, 10, and 21, respectively. TMEPAI having an Entrez ID no. of 56937 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA

5'- gcauggagaucacggagcudTdT-3'

3'-dTdTcguaccucuagugccucga -5'

5'- gagcacagugucaggcaacdTdT-3 '

3'-dTdTcucgugucacaguccguug -5'

5'- cccuaccagggccccugcadTdT-3'

3'-dTdTgggauggucccggggacgu -5'

5'- gcgaggucatcggccactadTdT-3'

3'-dTdTcgcuccaguagccggugau -5'

5'- aaggacacccucucuagggdTdT-3'

3'-dTdTuuccugugggagagauccc -5'

Example 95: 1 breast, 4 colon, 2 skin, and 1 lung cancer cell lines were found to have amplification at 20ql 3.32 corresponding to positions 55465401-56285043 of the human genome and having copy numbers of 6, 6, 6, 6, 7, 6, 7, 13, 13, 6, 7, 10, and 21, respectively. ZBPl having an Entrez ID no. of 81030 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense Attorney Docket No.3300-01-lWO

SEQ ID NO:162 5'-gagcctgggccatgctgaca-3' SEQ ID NO:163 5'-gcctgggccatgctgacagc-3' SEQ ID NO:162 5'-ctgggccatgctgacagcag-3'

siRNA

5'- cgggcagagaaggccacctdTdT-3'

3'-dTdTgcccgtctcttccggtgga -5'

5'- gagttgaaagtctccctcadTdT-3 '

3'-dTdTctcaactttcagagggagt -5'

5'- aacgggaggaagacatctadTdT-3'

3'-dTdTttgccctccttctgtagat -5'

5'- tccgccggtccacgccaccdTdT-3'

3'-dTdTaggcggccaggtgcggtgg -5'

5'- ttctcgaggacgccaccatdTdT-3'

3'-dTdTaagagctcctgcggtggta -5'

Example 96: 1 bone marrow and colon was found to have amplification at 22qll.22-11.23 corresponding to positions 21405413-21960478 of the human genome and having copy numbers of 15 and 11, respectively. GNAZ having an Entrez ID no. of Attorney Docket No.3300-01-lWO

2781 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-gccgacatcccatggtctgg-3' SEQ ID NO:163 5'-cgacatcccatggtctggca-3' SEQ ID NO:162 5'-acatcccatggtctggcagc-3'

siRNA

5'- gcagcccggcggucccggadTdT-3'

3'-dTdTcgucgggccgccagggccu -5'

5'- acaaugccaucgacucgcudTdT-3 '

S'-dTdTuguuacgguagcugagcga -5'

5'- gucgaggacauccugcgcudTdT-3'

3'-dTdTcagcuccuguaggacgcga -5'

5'- gcgccucuuugacuccaucdTdT-3'

3'-dTdTcgcggagaaacugagguag -5'

5'- auuggccuuugcugaggagdTdT-3'

3'-dTdTuaaccggaaacgacuccuc -5' Attorney Docket No.3300-01-lWO

Example 97: 1 bone marrow and 1 colon cancer cell lines were found to have amplification at 22qll.22-11.23 corresponding to positions 21405413-21960478 of the human genome and having copy numbers of 15 and 11, respectively. RAB36 having an Entrez ID no. of 9609 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-cggcgatcaccatagcaacg-3' SEQ ID NO: 163 5'-gcgatcaccatagcaacgag-3' SEQ ID NO:162 5'-gatcaccatagcaacgagaa-3'

siRNA

5'- cuggaugcuuggacgcgccdTdT-3'

3'-dTdTgaccuacgaaccugcgcgg -5'

5'- uucacagccaucgcuggacdTdT-3 '

3'-dTdTaagugucgguagcgaccug -5'

5'- tggggaagaccagcctcatdTdT-3'

3'-dTdTaccccttctggtcggagta -5'

5'- ggtgatcatcacggcctttdTdT-3'

3'-dTdTccactagtagtgccggaaa -5'

5'- tccgcccgagacccaggagdTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTaggcgggctctgggtcctc -5'

Example 98: 1 bone marrow and 1 colon cancer cell lines were found to have amplification at 22ql 1.22-11.23 corresponding to positions 21405413 -21960478 of the human genome and having copy numbers of 15 and 11, respectively. RTDRl (MGC 16968) having an Entrez ID no. of 27156 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-gggaatgggccatctttccc-3' SEQ ID NO:163 5'-gaatgggccatctttcccca-3' SEQ ID NO:162 5'-atgggccatctttccccaac-3'

siRNA

5'- tggagcttcccattaacatdTdT-3'

3'-dTdTacctcgaagggtaattgta -5'

5'- cctgaaagctttgctgaagdTdT-3 '

3'-dTdTggactttcgaaacgacttc -5'

5'- tgcaggtggaggtggaggadTdT-3'

3'-dTdTacgtccacctccacctcct -5'

5'- ccgtgcgctccttaatgtcdTdT-3' Attorney Docket No. 3300-01-lWO

3 '-dTdTggcacgcgaggaattacag -5 '

5 '- ccatggaggtggagacttadTdT-3 '

3 '-dTdTggtacctccacctctgaat -5 '

Example 99: 13 colon, 1 pancreas, 1 ovary cancer cell lines were found to have a homozygous deletion at 3pl4.2 corresponding to positions 60147184-60712366.

FHIT (FRA3B; AP3Aase) having an Entrez ID no. of 2272 is contained within this region.

Example 100: 1 bladder and 1 breast cancer cell lines were found to have amplification at 3p25.2-25.1 corresponding to positions 12994302-14036612 of the human genome and having copy numbers of 12 and 6, respectively. FBLN2 having an Entrez ID no. of 2199 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO: 162 5 '-agagcagcaccatggtccag-3 ' SEQ ID NO: 163 5 '-agcagcaccatggtccaggc-3 ' SEQ ID NO: 162 5 '-cagcaccatggtccaggcca-3 '

siRNA

5 '- gaggaggcgcuggagccggdTdT-3 '

3 '-dTdTcuccuccgcgaccucggcc -5 '

5'- guggaagcagcaacagcccdTdT-3 ' Attorney Docket No.3300-01-lWO

3'-dTdTcaccuucgucguugucggg -5'

5'- ccagucgugugaguccaaudTdT-3'

3'-dTdTggucagcacacucagguua -5'

5'- gagccaugucggccaggcudTdT-3'

3'-dTdTcucgguacagccgguccga -5'

5'- gcugagaccugccacaacadTdT-3'

3'-dTdTcgacucuggacgguguugu -5'

Example 101: 1 bladder and 1 breast cancer cell lines were found to have amplification at 3p25.2-25.1 corresponding to positions 12994302-14036612 of the human genome and having copy numbers of 12 and 6, respectively. HDACl 1 having an Entrez ID no. of 79885 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-ttgtgtgtagcatcccgggg-3' SEQ ID NO:163 5'-gtgtgtagcatcccggggcc-3' SEQ ID NO:162 5'-gtgtagcatcccggggccgg-3'

siRNA

5'- guacucgccgcgcuacaacdTdT-3'

3'-dTdTcaugagcggcgcgauguug -5' Attorney Docket No.3300-01-lWO

5'- ugcagaggaaggugcugagdTdT-3 '

3'-dTdTacgucuccuuccacgacuc -5'

5'- cggacaucacgcucgccaudTdT-3'

3'-dTdTgccuguagugcgagcggua -5'

5'- ggguaccagaagcgcacagdTdT-3'

3'-dTdTcccauggucuucgcguguc -5'

5'- accgcugcuucccccugcadTdT-3'

3'-dTdTuggcgacgaagggggacgu -5'

Example 102:1 bladder and 1 breast cancer cell lines were found to have amplification at p25.2-25.1 corresponding to positions 12994302-14036612 of the human genome and having copy numbers of 12 and 6, respectively. NUP210 having an Entrez ID no. of 23225 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-cccgcgccgccatcctcgcc-3' SEQ ID NO:163 5'-cgcgccgccatcctcgccgc-3' SEQ ID NO: 162 5'-cgccgccatcctcgccgcgc-3'

siRNA Attorney Docket No.3300-01-lWO

5'- cggccggagguggccagcadTdT-3'

3'-dTdTgccggccuccaccggucgu -5'

5'- gccacaggaguauucgcaudTdT-3 '

3'-dTdTcgguguccucauaagcgua -5'

5'- gccaggggugucgccauggdTdT-3'

3'-dTdTcgguccccacagcgguacc -5'

5'- caggugggggccgaggugcdTdT-3'

3'-dTdTguccacccccggcuccacg -5'

5'- uggagcccagccuaugccudTdT-3'

3'-dTdTaccucgggucggauacgga -5'

Example 103: 1 bladder and 1 breast cancer cell lines were found to have amplification at 3p25.2-25.1 corresponding to positions 12994302-14036612 of the human genome and having copy numbers of 12 and 6 respectively. WNT7A having an Entrez ID no. of 7476is contained within this amplified region.

Antisense

SEQ ID NO:162 5'-ctttccggttcatagtccc-3' SEQ ID NO:163 5'-ttccggttcatagtcccga-3' SEQ ID NO:162 5'-ccggttcatagtcccgatt-3' Attorney Docket No.3300-01-lWO

siRNA

5'- ugggccaccucuuucucagdTdT-3'

3'-dTdTacccgguggagaaagaguc -5'

5'- aggccuggcucccagacagdTdT-3 '

3'-dTdTuccggaccgagggucuguc -5'

5'- ccaucauugccgccggcgudTdT-3'

3'-dTdTgguaguaacggcggccgca -5'

5'- uacgugcucaaggacaagudTdT-3'

3'-dTdTaugcacgaguuccuguuca -5'

5'- cccgcguguggcagugcaadTdT-3'

3'-dTdTgggcgcacaccgucacguu -5'

Example 104: 2 prostate and 1 colon cancer cell lines were found to have a homozygous deletion at 5q31.2 corresponding to positions 138264655-138347714 of the human genome. CTNNAl (CAP102; FLJ36832) having an Entrez ID no. of 1495 is contained within this region and can be modulated with the following antisense and siRNA molecules.

Antisense Attorney Docket No.3300-01-lWO

SEQ ID NO: 162 5'-atgttgcctgcatggacagc-3' SEQ ID NO:163 5'-gttgcctgcatggacagcag-3' SEQ ID NO:162 5'-tgcctgcatggacagcagtc-3'

siRNA

5'- ucuggcaguugagagacugdTdT-3'

3'-dTdTagaccgucaacucucugac -5'

5'- cucugcuguuacccgguugdTdT-3 '

3'-dTdTgagacgacaaugggccaac -5'

5'- gggcaaugcuggacguaaadTdT-3'

3'-dTdTcccguuacgaccugcauuu -5'

5'- gucaccucagagauggacadTdT-3'

3'-dTdTcaguggagucucuaccugu -5'

5'- gcugugucauggaagaugadTdT-3'

3'-dTdTcgacacaguaccuucuacu -5'

Example 105: 2 prostate and 1 colon cancer cell lines were found to have a homozygous deletion at 5q31.2 corresponding to positions 138264655-138347714 of the human genome. SILl having an Entrez ID no. of 64374 is contained within this region. Attorney Docket No. 3300-01-lWO

Example 106: 1 skin cancer cell line was found to have a homozygous deletion at 5q34-35.1 corresponding to positions 168378928-167907410 0 of the human genome. SLIT3 having an Entrez ID no. of 6586 is contained in this region.

Example 107: 2 bladder and 1 breast cancer cell lines were found to have amplification at 6p22.3 corresponding to positions 20455650-21565929 of the human genome and having copy numbers of 6, 11 , and 21 , respectively. CDKALl having an Entrez ID no. of 54901 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO: 162 5 '-atgcagaaggcatattctct-3 ' SEQ ID NO: 163 5 '-gcagaaggcatattctctac-3 ' SEQ ID NO: 162 5 '-agaaggcatattctctacca-3 '

siRNA

5 '- acuggaugacaucgaagaudTdT-3 '

3 '-dTdTugaccuacuguagcuucua -5 '

5'- auggcuggacagcuagcugdTdT-3 '

3 '-dTdTuaccgaccugucgaucgac -5 '

5 '- ccagugaagacacgggggcdTdT-3 '

3'-dTdTggucacuucugugcccccg -5' Attorney Docket No.3300-01-lWO

5'- agaacccugcguucaugggdTdT-3'

3'-dTdTucuugggacgcaaguaccc -5'

5'- gcacgaucucaggucacugdTdT-3'

3'-dTdTcgugcuagaguccagugac -5'

Example 108: 2 bladder and 1 breast cancer cell lines were found to have amplification at 6p22.3 corresponding to positions 20455650-21565929 of the human genome and having copy numbers of 6, 11, and 21 respectively. E2F3 (2F-3; KIAA0075; MGC104598; DKFZp686C18211) having an Entrez ID no. of 1871 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO: 162 5'-tccctttctcatctctcgc-3' SEQ ID NO:163 5'-cctttctcatctctcgctc-3' SEQ ID NO:162 5'-tttctcatctctcgctcct-3'

siRNA

5'- cgccgccgccgccgcugccdTdT-3'

3'-dTdTgcggcggcggcggcgacgg -5'

5'- caaagcgaaggcuggagcudTdT-3 '

3'-dTdTguuucgcuuccgaccucga -5' Attorney Docket No.3300-01-lWO

5'- ggaaggcauccaccucauudTdT-3'

3'-dTdTccuuccguagguggaguaa -5'

5'- cccaagggcccauugaggudTdT-3'

3'-dTdTggguucccggguaacucca -5'

5'- ggggaggaggaaggcaucadTdT-3'

3'-dTdTccccuccuccuuccguagu -5'

Example 109: 2 bladder and 1 breast cancer cell lines were found to have amplification at 6p22.3 corresponding to positions 22407026-22967414 of the human genome and having copy numbers of 6,9, and 24, respectively. HDGFLl having an Entrez ID no. of 154150 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-cgtaggccgacatagctggt-3' SEQ ID NO:163 5'-taggccgacatagctggttc-3' SEQ ID NO:162 5'-ggccgacatagctggttctg-3'

siRNA

5'- ucggccuacggcaugcccadTdT-3'

3'-dTdTagccggaugccguacgggu -5'

5'- ucggccuacggcaugcccadTdT-3 ' Attorney Docket No.3300-01-lWO

3'-dTdTagccggaugccguacgggu -5'

5'- gacugcccauuagccucagdTdT-3'

3'-dTdTcugacggguaaucggaguc -5'

5'- gcugguggcggcggcgacgdTdT-3'

3'-dTdTcgaccaccgccgccgcugc -5'

5'- gaggagcuccgggaggaagdTdT-3'

3'-dTdTcuccucgaggcccuccuuc -5'

Example 110:2 colon cancer cell lines were found to have amplification at 6ql2 corresponding to positions 64161993-68336677 of the human genome and having copy numbers of 11 and 8, respectively. EGFLIl having an Entrez ID no. of 346007 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 S'-atttgtcagtcattttcggg-S' SEQ ID NO : 163 5 ' -ttgtcagtcattttcgggta-3 ' SEQ ID NO : 162 5 ' -gtcagtcattttcgggtagc-3 '

siRNA

5'- gguggaagaauggcauccadTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTccaccuucuuaccguaggu -5'

5'- cacaacggaagaucaguuadTdT-3 '

3'-dTdTguguugccuucuagucaau -5'

5'- ccagugucaaccacaugucdTdT-3'

3'-dTdTggucacaguugguguacag -5'

5'- cagaaugguacugacugcadTdT-3'

3'-dTdTgucuuaccaugacugacgu -5'

5'- ggguuauugaugccuauuudTdT-3'

3'-dTdTcccaauaacuacggauaaa -5'

Example 111: 2 colon cancer cell lines were found to have amplification at 6ql2 corresponding to positions 64161993-68336677 of the human genome and having copy numbers of 11/8 respectively. PHF3 having an Entrez ID no. of 23469 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA Attorney Docket No.3300-01-lWO

5'- cgacagagcacuauugccadTdT-3'

3'-dTdTgcugucucgugauaacggu -5'

5'- cauaggccagucaaagucadTdT-3 '

3'-dTdTguauccggucaguuucagu -5'

5'- cucccagcaagcaguguggdTdT-3'

3'-dTdTgagggucguucgucacacc -5'

5'- cagacaguuugggauuaugdTdT-3'

3'-dTdTgucugucaaacccuaauac -5'

5'- gcacgguuaucacauggugdTdT-3'

3'-dTdTcgugccaauaguguaccac -5'

Example 112:2 colon cancer cell lines were found to have amplification at 6ql2 corresponding to positions 64161993-68336677 of the human genome and having copy numbers of 11 and 8, respectively. PTP4A having an Entrez ID no. of 17803 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO: 162 5'-tcattcgagccatgttaatt-3' SEQ ID NO : 163 5 ' -attcgagccatgttaattta-3 ' Attorney Docket No.3300-01-lWO

SEQ ID NO:162 S'-tcgagccatgttaatttagt-β'

siRNA

5'- auggcucgaaugaaccgccdTdT-3'

3'-dTdTuaccgagcuuacuuggcgg -5'

5'- auccaaccaaugcgaccuudTdT-3 '

3'-dTdTuagguugguuacgcuggaa -5'

5'- uguggagaaagaagguaucdTdT-3'

3'-dTdTacaccucuuucuuccauag -5'

5'- gcguugcaggccuugggagdTdT-3'

3'-dTdTcgcaacguccggaacccuc -5'

5'- gacaaaagcggcguggagcdTdT-3'

3'-dTdTcuguuuucgccgcaccucg -5'

Example 113:2 colon and 1 skin can cell lines were found to have amplification at 6q23.3corresponding to positions 133449733-134632188 of the human genome and having copy numbers of 7, 17, and 16, respectively. EY A4 having an Entrez ID no. of 2070 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense Attorney Docket No.3300-01-lWO

SEQ ID NO: 162 5'-gggagtcttccatgtggttt-3' SEQ ID NO:163 5'-gagtcttccatgtggttttc-3' SEQ ID NO:162 5'-gtcttccatgtggttttctc-3'

siRNA

5'- ggucuauggaaaugcaggadTdT-3'

3'-dTdTccagauaccuuuacguccu -5'

5'- cagcagacugguugcugagdTdT-3 '

3'-dTdTgucgucugaccaacgacuc -5'

5'- cagaggaagaggccggaaadTdT-3'

3'-dTdTgtctccttctccggccttt -5'

5'- aagaggagggguugacuggdTdT-3'

3'-dTdTuucuccuccccaacugacc -5'

5'- ucuggaggauauccagucadTdT-3'

3'-dTdTagaccuccuauaggucagu -5'

Example 114: 2 colon and 1 skin cancer cell lines were found to have amplification at 6q23.3 corresponding to positions 133449733-134632188 of the human genome and having copy numbers of 7, 17, and 16, respectively. SGK (SGKl) having an Entrez ID no. of Attorney Docket No.3300-01-lWO

6446 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-ttttcaccgtcatcaccacc-3' SEQ ID NO:163 5'-ttcaccgtcatcaccaccgc-3' SEQ ID NO:162 5'-caccgtcatcaccaccgcgg-3'

siRNA

5'- cugaggcugcuaagggcacdTdT-3'

3'-dTdTgacuccgacgauucccgug -5'

5'- ccugaaguucaguccaucudTdT-3 '

3'-dTdTggacuucaagucagguaga -5'

5'- ggagaguuguucuaccaucdTdT-3'

3'-dTdTccucucaacaagaugguag -5'

5'- cagccuuaugacaggacugdTdT-3'

3'-dTdTgucggaauacuguccugac -5'

5'- uccucgucacagccagcgudTdT-3'

3'-dTdTaggagcagugucggucgca -5' Attorney Docket No.3300-01-lWO

Example 115:2 colon and 1 skin cancer cell lines were found to have amplification at 6q23.3 corresponding to positions 133449733-134632188 of the human genome and having copy numbers of 7, 17, and 16, respectively. SLC2A12 having an Entrez ID no. of 154091 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-caacaggtaccatggtcacg-3' SEQ ID NO:163 5'-acaggtaccatggtcacgta-3' SEQ ID NO:162 5'-aggtaccatggtcacgtaga-3'

siRNA

5'- ccgagggccccagucugcudTdT-3'

3'-dTdTggcucccggggucagacga -5'

5'- cuggugaugaaaggacaagdTdT-3 '

3'-dTdTgaccacuacuuuccuguuc -5'

5'- cuccucugugauggcagcudTdT-3'

3'-dTdTgaggagacacuaccgucga -5'

5'- cuuuccuggugggaucagadTdT-3'

3'-dTdTgaaaggaccacccuagucu -5'

5'- ggggccaauccaggcagcudTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTccccgguuagguccgucga -5'

Example 116: 2 colon and 1 skin cancer cell lines were found to have amplification at 6q23.3corresponding to positions 133449733-134632188 of the human genome and having copy numbers of 7, 17, and 16, respectively. TBPLl having an Entrez ID no. of 9519 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-tgtctgcatccattggggtg-3' SEQ ID NO:163 5'-tctgcatccattggggtggt-3' SEQ ID NO: 162 5'-tgcatccattggggtggttt-3'

siRNA

5'- caccccaauggaugcagacdTdT-3'

3'-dTdTgugggguuaccuacgucug -5'

5'- aggaagauugcuuuggaagdTdT-3 '

3'-dTdTuccuucuaacgaaaccuuc -5'

5'- ccugaacuucauccugcugdTdT-3'

3'-dTdTggacuugaaguaggacgac -5'

5'- gcagaaacuagguuuucagdTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTcgucuuugauccaaaaguc -5'

5'- aggcuguugcuacugcugudTdT-3'

3'-dTdTuccgacaacgaugacgaca -5'

Example 117: 2 colon and 1 skin cancer cell lines were found to have amplification at 6q23.3 corresponding to positions 133449733-134632188 of the human genome and having copy numbers of 7, 17, 16 respectively. TCF21 (PODl) having an Entrez ID no. of 6943 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 S'-agccggtggacatgtttggg-S' SEQ ID NO:163 S'-ccggtggacatgtttggggg-S' SEQ ID NO:162 5'-ggtggacatgtttgggggag-3'

siRNA

5'- cucccucagcgauguggagdTdT-3'

3'-dTdTgagggagucgcuacaccuc -5'

5'- accgaggagagcuccaacudTdT-3 '

3'-dTdTuggcuccucucgagguuga -5'

5'- gacucaagaccacccugccdTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTcugaguucuggugggacgg -5'

5'- cauucacccggucaaccugdTdT-3'

3'-dTdTguaagugggccaguuggac -5'

5'- gugaccgcgagccgcuuaudTdT-3'

3'-dTdTcacuggcgcucggcgaaua -5'

Example 118:2 colon and 1 skin cancer cell lines were found to have amplification at 6q23.3 corresponding to positions 135432530-135585620 of the human genome and having copy numbers of 7,14, and 19, respectively. MYB (efg; c-myb; c- myb CDS) having an Entrez ID no. of 4602 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-gtcttcgggccatggcgcgg-3' SEQ ID NO:163 5'-cttcgggccatggcgcggcg-3' SEQ ID NO:162 5'-tcgggccatggcgcggcggg-3'

siRNA

5'- gggcugcuucccaagucugdTdT-3'

3'-dTdTcccgacgaaggguucagac -5'

5'- gcacacaagagacuggggadTdT-3 ' Attorney Docket No. 3300-01-lWO

3 '-dTdTcguguguucucugaccccu -5 '

5 '- ccacaccagaccucauggadTdT-3 '

3'-dTdTgguguggucuggaguaccu -5'

5 '- ccaccccccucauuggucadTdT-3 '

3 '-dTdTgguggggggaguaaccag -5 '

5 '- gcgagccccuugcagccuudTdT-3 '

3 '-dTdTcgcucggggaacgucggaa -5 '

Example 119: 2 colon cancer cell lines were found to have a homozygous deletion at 6q26 corresponding to positions 162643461-162748116 0 of the human genome. PARK2 (PDJ; PRKN; AR-JP) having an Entrez ID no. of 5071 is contained within this region.

Example 120: 2 leukemia and 1 skin cell cancer line were found to have a homozygous deletion at 7pl4.1 corresponding to positions 38084339 -38108760 of the human genome. TARP having an Entrez ID no. of 445347 is contained within this region.

Example 121 : 3 pancreas, 1 breast, 1 colon, and 1 skin cancer cell lines were found to have amplification at 7q22.1 corresponding to positions 97938020-98643122 of the human genome and having copy numbers of 7, 6, 6, 8, 9, and 17, respectively.

ARPC lA having an Entrez ID no. of 10552 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules. Attorney Docket No.3300-01-lWO

Antisense

SEQ ID NO:162 S'-gatgcagtgacattattctt-S' SEQ ID NO : 163 5 ' -tgcagtgacattattcttag-S ' SEQ ID NO:162 5'-cagtgacattattcttagtg-3'

siRNA

5'- accugucaugccuggaacadTdT-3'

3'-dTdTuggacaguacggaccuugu -5'

5'- ugacugggcucccaagagcdTdT-3 '

3'-dTdTacugacccgaggguucucg -5'

5'- agcacgcccuggggcagcadTdT-3'

3 ' -dTdTucgugcgggaccccgucgu -5 '

5'- cagcgucguggcugcuggcdTdT-3'

3'-dTdTgucgcagcaccgacgaccg -5'

5'- cuacuggcaucgauggagcdTdT-3'

3'-dTdTgaugaccguagcuaccucg -5'

Example 122: 3 pancreas, 1 breast, 1 colon, and 1 skin cancer cell lines were found to have amplification at 7q22.1 corresponding to positions 97938020-98643122 of the human genome and having copy numbers of 7, 6, 6, 8, 9, and 17, respectively. Attorney Docket No.3300-01-lWO

ARPClB (ARC41; p40-ARC; p41-ARC) having an Entrez ID no. of 10095 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-tgtggtaggccatggcggct-3' SEQ ID NO:163 5'-tggtaggccatggcggcttg-3' SEQ ID NO:162 5'-gtaggccatggcggcttggc-3'

siRNA

5'- cgccuggaacaaggaccgcdTdT-3'

3'-dTdTgucgccgagagcacacuag -5'

5'- cagcggcucucgugugaucdTdT-3 '

3'-dTdTgucgccgagagcacacuag -5'

5'- gagccgcguggccuggguadTdT-3'

3'-dTdTcucggcgcaccggacccau -5'

5'- augcugagcucggcgggcgdTdT-3'

3'-dTdTuacgacucgagccgcccgc -5'

5'- gaugugaagagcuuggagudTdT-3'

3'-dTdTcuacacuucucgaaccuca -5' Attorney Docket No.3300-01-lWO

Example 123: 3 pancreas, 1 breast, 1 colon, and 1 skin cancer cell lines were found to have amplification at 7q22.1 corresponding to positions 97938020-98643122 of the human genome and having copy numbers of 7, 6, 6, 8, 9, and 17, respectively. SMURFl having an Entrez ID no. of 57154 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-cggggttcgacatctcccgc-3' SEQ ID NO:163 5'-gggttcgacatctcccgcca-3' SEQ ID NO:162 5'-gttcgacatctcccgccaac-3'

siRNA

5'- caggaacggcuccagcaucdTdT-3'

3'-dTdTguccuugccgaggucguag -5'

5'- ugugcggcugcucuccaaudTdT-3 '

3'-dTdTacacgccgacgagagguua -5'

5'- acugccgccaggcugggaadTdT-3'

3'-dTdTugacggcgguccgacccuu -5'

5'- ggaucauggggcuggcugudTdT-3'

3'-dTdTccuaguaccccgaccgaca -5' Attorney Docket No.3300-01-lWO

5'- ggaucauggggcuggcugudTdT-3'

3'-dTdTccuaguaccccgaccgaca -5'

Example 124: 3 pancreas, 1 breast, 1 colon, and 1 skin cancer cell lines were found to have amplification at 7q22.1 corresponding to positions 97938020-98643122 of the human genome and having copy numbers of 7, 6, 6, 8, 9, and 17, respectively. TMEM130 having an Entrez ID no. of 222865 is contained within this amplified region.

Antisense

SEQ ID NO:162 5'-ctgcctgggccattgcgggg-3' SEQ ID NO:163 5'-gcctgggccattgcggggcc-3' SEQ ID NO:162 5'-ctgggccattgcggggcccg-3'

siRNA

5'- gccucggccgcauccucugdTdT-3'

3'-dTdTcggagccggcguaggagac -5'

5'- guggucggccacgugcccgdTdT-3 '

3'-dTdTcaccagccggugcacgggc -5'

5'- gcugggacuucggggacggdTdT-3'

3'-dTdTcgacccugaagccccugcc -5'

5'- cagcaagacacaucaguacdTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTgucguucuguguagucaug -5'

5'- gagacuccaucugaguaccdTdT-3'

3'-dTdTcucugagguagacucaugg -5'

Example 125: 3 pancreas, 1 breast, 1 colon, and 1 skin cancer cell lines were found to have amplification at 7q22.1 corresponding to positions 97938020-98643122 of the human genome and having copy numbers of 7, 6, 6, 8, 9, and 17, respectively.

TRRAP (Tral; TR-AP; PAF400; FLJ10671) having an Entrez ID no. of 8295 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-caacaaacgccatttttctt-3' SEQ ID NO:163 5'-acaaacgccatttttctttt-3' SEQ ID NO:162 5'-aaacgccatttttcttttgg-3'

siRNA

5'- ugcaacacagggggccacgdTdT-3'

3'-dTdTacguugugucccccggugc -5'

5'- cccauggagaaggccauugdTdT-3 '

3'-dTdTggguaccucuuccgguaac -5'

5'- gggagauuaccggagcuugdTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTcccucuaauggccucgaac -5'

5'- gccaugcucccguccaucadTdT-3'

3'-dTdTcgguacgagggcagguagu -5'

5'- gcguguguugcagcugcugdTdT-3'

3'-dTdTcgcacacaacgucgacgac -5'

Example 126: 1 breast, 1 colon, and 1 skin cell lines were found to have amplification at 7q31.1-31.2 corresponding to positions 113448160-114283377 of the human genome and having copy numbers of 6, 6, and 17, respectively. FOXP2 having an Entrex ID no. of 93986 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-attcctgcatcatgacttaa-3' SEQ ID NO:163 5'-tcctgcatcatgacttaata-3' SEQ ID NO:162 5'-ctgcatcatgacttaatacc-3'

siRNA

5'- uggugacaccagcucugaadTdT-3'

3'-dTdTaccacuguggucgagacuu -5'

5'- gcgucagggacucaucuccdTdT-3 ' Attorney Docket No. 3300-01-lWO

3 '-dTdTcgcagucccugaguagagg -5 '

5 '- ggcaggcuaucauggagucdTdT-3 '

3'-dTdTccguccgauaguaccucag -5'

5 '- ccaguggccuacugcaggcdTdT-3 '

3 '-dTdTggucaccggaugacguccg -5 '

5 '- agcaacaacagcagcagcadTdT-3 '

3 '-dTdTucguuguugucgucgucgu -5 '

Example 127: 1 breast, 1 colon, and 1 skin cancer cell lines were found to have amplification at 7q31.1-31.2 corresponding to positions 113448160-114283377 of the human genome and having copy numbers of 6, 6, and 17, respectively. MDFIC having an Entrez ID no. of 29969 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO: 162 5'-tggacgcctccatgggcagc-3' SEQ ID NO: 163 5'-gacgcctccatgggcagcgt-3' SEQ ID NO: 162 5'-cgcctccatgggcagcgtct-3'

Coding sequence starts at AGT?? WHA?! ! siRNA

5 '- ggcgucugggcugagccggdTdT-3 ' Attorney Docket No.3300-01-lWO

3'-dTdTccgcagacccgacucggcc -5'

5'- gcggccgcugccggaggcudTdT-3 '

3'-dTdTcgccggcgacggccuccga -5'

5'- ccucgcucccgggcccgugdTdT-3'

3'-dTdTggagcgagggcccgggcac -5'

5'- cacggggccaaacacggaudTdT-3'

3'-dTdTgugccccgguuugugccua -5'

5'- guggugacgagaugggggadTdT-3'

3'-dTdTcaccacugcucuacccccu -5'

Example 128: 3 breast cancer celllines were found to have amplification at 8pll.21 corresponding to positions 39950805-40699795 of the human genome and having copy numbers of 6, 7, and 17, respectively. C8ORF4 (TCl; TC-I; hTC-1) having an Entrez ID no. of 56892 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-gctttgctttcatcgatgtg-3' SEQ ID NO : 163 5 ' -tttgctttcatcgatgtggg-3 ' SEQ ID NO:162 5'-gctttgctttcatcgatgtg-3' Attorney Docket No.3300-01-lWO

siRNA

5'- caagccaucaucauguccadTdT-3'

3'-dTdTguucgguaguaguacaggu -5'

5'- ccauccauggcuaccacuudTdT-3'

3'-dTdTgguagguaccgauggugaa -5'

5'- ccaagaaucacuagaaaggdTdT-3'

3'-dTdTgguucuuagugaucuuucc -5'

5'- aggagagagccaagaucaudTdT-3'

3'-dTdTuccucucucgguucuagua -5'

5'- cugcggaaauauuccaucadTdT-3'

3'-dTdTgacgccuuuauaagguagu -5'

Example 129: 3 breast cancer cell lines were found to have amplification at 8p 11.21 corresponding to positions 41651414-42121063 of the human genome and having copy numbers of 6, 10, and 15, respectively. MYST3 having an Entrez ID no. of 7994 is contained with this region and can be modulated with the following antisense and siRNA molecules

Antisense

SEQ ID NO:162 5'-cgagttttaccatggtgaa-3' Attorney Docket No.3300-01-lWO

SEQ ID NO:163 5'-agttttaccatggtgaagg-3' SEQ ID NO:162 5'-ttttaccatggtgaaggat-3'

siRNA

5'- cccatggcttggatcgtaadTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- gcagggtctccagagaaacdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- tgtactcaggtgtcagtccdTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- tggtggagaggcctcccagdTdT-3'

3 '-dTdT ACUAGUUU AAUGGCCUAAU -5'

5'- gaccttacatgagaagatgdTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 130: colon brain was found to have a homozygous deletion at 8pl 1.23- 11.22 corresponding to positions 39400099-39523051 of the human genome. AK128178 naving an NCBI accession AK128178 is contained within this region. Attorney Docket No.3300-01-lWO

Example 131:2 breast, 1 pancreas, and 1 bladder cancer cell lines were found to have amplification at 8ql 1.21 corresponding to positions 48892105-49419805 of the human genome and having copy numbers of 6, 8, 6, and 15, respectively. MCM4 having an Entrez ID no. of 4173 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-ccggggacgacatagtgctc-3' SEQ ID NO:163 5'-ccggggacgacatagtgctc-3' SEQ ID NO:162 5'-ggacgacatagtgctcggag-3'

siRNA

5'- cggcguggaagggccacccdTdT-3'

3'-dTdTgccgcaccuucccgguggg -5'

5'- gggaaccccaagaaguggudTdT-3 '

3'-dTdTcccuugggguucuucacca -5'

5'- ucugggaagggcuccagugdTdT-3'

3'-dTdTagacccuucccgaggucac -5'

5'- uggcaguagccggggaaugdTdT-3'

3'-dTdTaccgucaucggccccuuac -5'

5'- gagugccaccucucguaaadTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTcucacgguggagagcauuu -5'

Example 132: 2 breast, 1 pancreas, and 1 bladder cancer cell lines were found to have amplification at 8ql 1.21 corresponding to positions 48892105-49419805 of the human genome and having copy numbers of 6, 8, 6, and 15, respectively. UBE2V2 having an Entrez ID no. of 7336 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-tggagaccgccatcttctcc-3' SEQ ID NO:163 5'-gagaccgccatcttctcctg-3' SEQ ID NO:162 5'-gaccgccatcttctcctgca-3'

siRNA

5'- gcgacgguacaguuagcugdTdT-3'

3'-dTdTcgcugccaugucaaucgac -5'

5'- gccugaaaguagaauguggdTdT-3 '

3'-dTdTcggacuuucaucuuacacc -5'

5'- ccggagcauaccaguguuadTdT-3'

3'-dTdTggccucguauggucacaau -5'

5'- cuuccacagccaccagaagdTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTgaaggugucgguggucuuc -5'

5'- ccagaagcuccuccgucagdTdT-3'

3'-dTdTggucuucgaggaggcaguc -5'

Example 133: 2 breast cancer cell lines were found to have amplification at 8ql3.3 corresponding to positions 71627536-72232578 of the human genome and having copy numbers of 6 and 30, respectively. LACTB2 having an Entrez ID no. of 51110 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-gtacagcagccattcccgcc-3' SEQ ID NO:163 5'-acagcagccattcccgcctc-3' SEQ ID NO:162 5'-agcagccattcccgcctcag-3'

siRNA

5'- caaucgagucgugcgugugdTdT-3'

3'-dTdTguuagcucagcacgcacac -5'

5'- uucuggaggcauaggagaudTdT-3 '

3'-dTdTaagaccuccguauccucua -5'

5'- uggagauugcauccuagggdTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTaccucuaacguaggauccc -5'

5'- cuccugagaauuuacaugadTdT-3'

3'-dTdTgaggacucuuaaauguacu -5'

5'- agcaacacagauccugacadTdT-3'

3'-dTdTucguugugucuaggacugu -5'

Example 134: 2 breast cancer cell lines were found to have amplification at 8ql3.3 corresponding to positions 71627536-72232578 of the human genome and having copy numbers of 6 and 30, respectively. TRAMl having an Entrez ID no. of 23471 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-gcggccccaccatggcgatt-3' SEQ ID NO:163 5'-ggccccaccatggcgattcg-3' SEQ ID NO:162 5'-ccccaccatggcgattcgca-3'

siRNA

5'- gcugagccacgaauucgucdTdT-3'

3'-dTdTcgacucggugcuuaagcag -5'

5'- ucaugccguaauucaagagdTdT-3 '

3'-dTdTaguacggcauuaaguucuc -5' Attorney Docket No.3300-01-lWO

5'- gagggcuuauccccauaacdTdT-3'

3'-dTdTcucccgaauagggguauug -5'

5'- ccacauuucccgccuguuudTdT-3'

3'-dTdTgguguaaagggcggacaaa -5'

5'- ggcaccagcugugaagaagdTdT-3'

3'-dTdTccguggucgacacuucuuc -5'

Example 135: 2 breast cancer cell lines were found to have amplification at 8ql3.3 corresponding to positions 71627536-72232578 of the human genome and having copy numbers of 6 and 30, respectively. XKR9 having an Entrez ID no. of 389668 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO: 162 5'-tagtatatttcattacgaat-3' SEQ ID NO:163 5'-gtatatttcattacgaatga-3' SEQ ID NO:162 5'-atatttcattacgaatgact-3'

siRNA

5'- gaugucaguucuuggcauudTdT-3'

3'-dTdTcuacagucaagaaccguaa -5' Attorney Docket No.3300-01-lWO

5'- cuaccuggaaggcugcccadTdT-3 '

3'-dTdTgauggaccuuccgacgggu -5'

5'- cuugccugacaaaaagcuudTdT-3'

3'-dTdTgaacggacuguuuuucgaa -5'

5'- guuaggguacugggcacuudTdT-3'

3'-dTdTcaaucccaugacccgugaa -5'

5'- uugauggaaaaccaguucudTdT-3'

3'-dTdTaacuaccuuuuggucaaga -5'

Example 136: 3 breast cancer cell lines were found to have amplification at 8ql3.3 corresponding to positions 73006889-73522480 of the human genome and having copy numbers of 6, 18, 20, and 13, respectively. TRPAl having an Entrez ID no. of 8989 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-ggctgcacttcattgacccc-3' SEQ ID NO:163 5'-ctgcacttcattgaccccac-3' SEQ ID NO:162 5'-gcacttcattgaccccaccc-3'

siRNA

5'- ggguggggucaaugaagugdTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTcccaccccaguuacuucac -5'

5'- cuccaccuggcugugcaaadTdT-3 '

3'-dTdTgagguggaccgacacguuu -5'

5'- cuccaccuggcugugcaaadTdT-3'

3 ' -dTdTgagguggaccgacacguuu -5 '

5'- cagaagacaaguccugccgdTdT-3'

3'-dTdTgucuucuguucaggacggc -5'

5'- aucccaacaaacccagaucdTdT-3'

3'-dTdTuaggguuguuugggucuag -5'

Example 137: 2 breast cancer cell lines were found to have amplification at 8q21.11 corresponding to positions 75332492-75889733 of the human genome and having copy numbers of 6 and 19, respectively. GDAPl having an Entrez ID no. of 54332 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-agttcaaacgcataaaccaa-3' SEQ ID NO:163 5'-ttcaaacgcataaaccaagg-3' SEQ ID NO:162 5'-caaacgcataaaccaaggct-3' Attorney Docket No.3300-01-lWO

siRNA

5'- aagugcctguccuuauccadTdT-3'

3'-dTdTuucacggacaggaauaggu -5'

5'- gagggccagcaaccuuggcdTdT-3 '

3'-dTdTcucccggucguuggaaccg -5'

5'- cauccugaguuaacuguggdTdT-3'

3'-dTdTguaggacucaauugacacc -5'

5'- gcagugcugccaacagcaudTdT-3'

3'-dTdTcgucacgacgguugucgua -5'

5'- aggcuuggcagcaugauaudTdT-3'

3'-dTdTuccgaaccgucguacuaua -5'

Example 138:2 breast cancer cell lines were found to have amplification at 8q21.11-21.12 corresponding to positions 76156201-78618611 of the human genome and having copy numbers of 6 and 22, respectively. HNF4G having an Entrez ID no. of 3174 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense Attorney Docket No.3300-01-lWO

SEQ ID NO:162 5'-tgtggtattcatacttgtc-3' SEQ ID NO:163 5'-tggtattcatacttgtctc-3' SEQ ID NO:162 5'-gtattcatacttgtctctg-3'

siRNA

5'- ggcauccagcugugaugggdTdT-3'

3'-dTdTccguaggucgacacuaccc -5'

5'- agguucagucggcaaugugdTdT-3 '

3'-dTdTuccaagucagccguuacac -5'

5'- ccagaucucagucucaagcdTdT-3'

3'-dTdTggucuagagucagaguucg -5'

5'- ggagaguugcuucugcuccdTdT-3'

3'-dTdTccucucaacgaagacgagg -5'

5'- ccacaaggcucugggcaagdTdT-3'

3'-dTdTgguguuccgagacccguuc -5'

Example 139: 2 breast cancer cell lines were found to have amplification at 8q21.11-21.12 corresponding to positions 76156201-78618611 of the human genome and having copy numbers of 6 and 22 respectively. PXMP3 5 having an Attorney Docket No.3300-01-lWO

Entrez ID no. of 5828 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-ccacggcgtccatgcttggt-3' SEQ ID NO:163 5'-acggcgtccatgcttggtct-3' SEQ ID NO:162 5'-ggcgtccatgcttggtctgg-3'

siRNA

5'- ggccucgggcauccagggcdTdT-3'

3'-dTdTccggagcccguaggucccg -5'

5'- cucgggcuggugcuggaccdTdT-3 '

3'-dTdTgagcccgaccacgaccugg -5'

5'- ggaccgcaauggcagcgggdTdT-3'

3'-dTdTccuggcguuaccgucgccc -5'

5'- gccaagcuggaccgcagugdTdT-3'

3'-dTdTcgguucgaccuggcgucac -5'

5'- caggacuacuacagcggcgdTdT-3'

3'-dTdTguccugaugaugucgccgc -5' Attorney Docket No.3300-01-lWO

Example 140: 2 breast cancer cell lines were found to have amplification at 8q21.11-21.12 corresponding to positions 76156201-78618611 of the human genome and having copy numbers of 6 and 22, respectively. ZFHX4 having an Entrez ID no. of 79776 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'- cacaggtttccatggcaatt-3' SEQ ID NO:163 5'- caggtttccatggcaattgc-3' SEQ ID NO:162 5'- ggtttccatggcaattgcta-3'

siRNA

5'- cucaaggcaggaaaaugggdTdT-3'

3'-dTdTgaguuccguccuuuuaccc -5'

5'- cucgccccggcggaagcagdTdT-3 '

3'-dTdTgaguuccguccuuuuaccc -5'

5'- ccuccuccaccuucugcucdTdT-3'

3'-dTdTggaggagguggaagacgag -5'

5'- caacgccgaccgcagcgaadTdT-3'

3'-dTdTguugcggcuggcgucgcuu -5' Attorney Docket No.3300-01-lWO

5'- accugcaggagucccugcadTdT-3'

3'-dTdTuggacguccucagggacgu -5'

Example 141: 3 breast cancer cell lines were found to have amplification at 8q21.3 corresponding to positions 87858743-88557354 of the human genome and having copy numbers of 6, 7, and 15, respectively. CNBDl having an Entrez ID no. of 168975 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-gaagagaagacatcggcatc-3' SEQ ID NO:163 5'-agagaagacatcggcatctt-3' SEQ ID NO:162 5'-agaagacatcggcatcttga-3'

siRNA

5'- ccacuucacaguauaccaadTdT-3'

3'-dTdTggugaagugucauaugguu -5'

5'- ggaggaacaaagggaacucdTdT-3'

3'-dTdTccuccuuguuucccuugag -5'

5'- gguugaaaggcagcacagudTdT-3'

3'-dTdTccaacuuuccgucguguca -5'

5'- cacagaugucucgguggugdTdT-3 ' Attorney Docket No.3300-01-lWO

3'-dTdTgugucuacagagccaccac -5'

5'- acgugcacaaucauuaccadTdT-3'

3'-dTdTugcacguguuaguaauggu -5'

Example 142: 3 breast cancer cells had amplification at 8q21.3 corresponding to positions 88715966 -89508726 of the human genome and having copy numbers of 6, 7, and 30, respectively. MMP16 (MMP-X2; MT-MMP2;

MT-MMP3; MT3-MMP) having an Entrez ID no. of 4325 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-tggacgcctccatgggcagc-3' SEQ ID NO:163 5'-gacgcctccatgggcagcgt-3' SEQ ID NO:162 5'-cgcctccatgggcagcgtct-3' cacagttcactatgatcttactca

siRNA

5'- gatttcgtgcatcattcggdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- gatttcgtgcatcattcggdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- cctccggctgacccaaggadTdT-3' Attorney Docket No.3300-01-lWO

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- caatcacagtctggaaaggdTdT-3'

3 '-dTdT ACUAGUUU AAUGGCCUAAU -5'

5'- ctgtgttccagttcaagagdTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 143: 3 breast cancer cell lines were found to have amplification at 8q21.3 corresponding to positions 88715966-89508726of the human genome and having copy numbers of 6, 7, and 30, respectively. WDR21C having an Entrez ID no. of

28998 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-tggacgcctccatgggcagc-3' SEQ ID NO:163 5'-gacgcctccatgggcagcgt-3' SEQ ID NO:162 5'-cgcctccatgggcagcgtct-3' agtagaggaatatgtcgagtttct

siRNA

5'- ggcgccccagcaatgggccdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- gtaccatgcactgagtgacdTdT-3 ' Attorney Docket No.3300-01-lWO

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- ctgagtgactgtggggatcdTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- cctgagggatccagtggcadTdT-3'

3 '-dTdT ACUAGUUU AAUGGCCUAAU -5'

5'- cccaagattgtggactccadTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 144: 3 breast cancer cell lines were found to have amplification at 8q22.3 corresponding to positions 101695418-102135434 of the human genome and having copy numbers of 6, 6, and 16, respectively. PABPCl (PABl; PABP; PABPl; PABPC2; PABPLl) having an Entrez ID no. of 26986 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

ccagctaccccatggcctcgctct siRNA

5'- gggacctccaccccgacgtdTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- gatgcacagaaagctgtggdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- gaattgtggccacaaagccdTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- cctgctgtccgcaccgttcdTdT-3'

3'-dTdTACUAGUUUAAUGGCCUAAU -5'

5'- gtactacaagcccaccaagdTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 145: 3 breast cancer cell lines were found to have amplification at 8q22.3 corresponding to positions 101695418-102135434 of the human genome and having copy numbers of 6, 6, and 16, respectively. YWHAZ having an Entrez ID no. of 7534 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA

5'- ggttcagaaggccaaactgdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- ggtcatcttggagggtcgtdTdT-3'

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- agggattgtcgatcagtcadTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- caaggagacgaagctgaagdTdT-3'

3 '-dTdT ACUAGUUU AAUGGCCUAAU -5'

5'- ttgatgaagccattgctgadTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 146: 3 breast cancer cell lines were found to have amplification at 8q23.1 corresponding to positions 109834059-110114908 of the human genome and having copy numbers of 6, 21, and 10, respectively. TMEM74 having an Entrez ID no. of 157753 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules. Antisense

SEQ ID NO:162 5'-tggacgcctccatgggcagc-3' SEQ ID NO:163 5'-gacgcctccatgggcagcgt-3' Attorney Docket No.3300-01-lWO

SEQ ID NO:162 5'-cgcctccatgggcagcgtct-3'

siRNA

5'- agagcaaccaggcagacctdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5 ' - gagtggtcccaagaggctgdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- actgtccttggtagaggaadTdT-3'

3 ' -dTdTUCUUCGGCUAAC AAUUGAU -5 '

5'- gcctcttccaaagagtctgdTdT-3'

3'-dTdTACUAGUUUAAUGGCCUAAU -5'

5'- aggagagtgcgaggctgggdTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 147: 2 colon and 2 breast cancer cell lines were found to have amplification at 8q23.3 corresponding to positions 115227193-117370882 of the human genome and having copy numbers of 6, 14, 11, and 9, respectively. TRPSl having an Entrez ID no. of 7227 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules. Attorney Docket No.3300-01-lWO

Antisense

siRNA

5'- aaggcgagggccagatcctdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- accccctcaggggactcacdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- gtagtggggccacttctccdTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- ctgctcagcagccagtcctdTdT-3'

3'-dTdTACUAGUUUAAUGGCCUAAU -5'

5'- aactgcaaacggtgcctccdTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 148: 1 breast and 2 ovary cancer cell lines were found to have amplification at 8q24.11 corresponding to positions 118484263-119005983 of the human genome and having copy numbers of 22 & 7/12 respectively. THRAP6 Attorney Docket No.3300-01-lWO

having an Entrez ID no. of 90390 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA

5'- gttggccgcgtcggggatgdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- cgctgtgccgcatcgggcadTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- caggataatcttcgccaacdTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- gctcaaagaatgatgatcgdTdT-3'

3 '-dTdT ACUAGUUU AAUGGCCUAAU -5'

5'- ctttgatggggtttgtattdTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5' Attorney Docket No.3300-01-lWO

Example 149: 1 ovary and 1 breast cancer cell lines were found to have amplification at 8q24.11 corresponding to positions 118888068-119005983 of the human genome and having copy numbers of 12 and 22, respectively. EXTl having an Entrez ID no. of 2131 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA

5'- ctgctctcagctggctcttdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- ggcagaagcgagatgccaadTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- caaggggaagaggtacctgdTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- cctgccactgctgtgcctgdTdT-3'

3'-dTdTACUAGUUUAAUGGCCUAAU -5'

5'- ggctcgaccccgtcctcttdTdT-3' Attorney Docket No.3300-01-lWO

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 150: 3 breast, 3 colon, 1 leukemia cancer cell lines were found to have amplification at 8q24.12 corresponding to positions 120101441-120668668 of the human genome and having copy numbers of 6, 14, 9, 10, 6, 6, and 28, respectively. COLEClO having an Entrez ID no. of 10584 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA

5'- ctggtactatttcttttgcdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- gggagatcggggcaatattdTdT-3'

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- gcccggctcaagacatctadTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- gctagccatgcccaaggatdTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTACUAGUUUAAUGGCCUAAU -5'

5'- gagggggaacccagcgaccdTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 151:3 breast, 3 colon, and 1 leukemia cancer cell lines were found to have amplification at 8q24.12 corresponding to positions 120101441-120668668 of the human genome and having copy numbers of 6, 14, 9, 10, 6, 6, and 28, respectively. MAL2 having an Entrez ID no. of 114569 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA

5'- cgccccgggtcaccctgcdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- ggttgcctcctccaatgttdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- ctctctggcatggtggctcdTdT-3' Attorney Docket No.3300-01-lWO

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- atggcgaccgtaacactccdTdT-3'

3 '-dTdT ACUAGUUU AAUGGCCUAAU -5'

5'- gggcagccactcctgagtgdTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 152: 3 breast, 3 colon, and 1 leukemia cancer cell lines were found to have amplification at 8q24.12 corresponding to positions 120101441-120668668 of the human genome and having copy numbers of 6, 14, 9, 10, 6, 6, and 28, respectively.

NOV (CCN3; NOVH; IGFBP9) having an Entrez ID no. of 4856 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA

5'- gtctccgaaagcagtgcctdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- agtgcacctgcagagatggdTdT-3 ' Attorney Docket No.3300-01-lWO

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- ggttctgtggggtctgcagdTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- gagctggagctgaagactadTdT-3'

3 '-dTdT ACUAGUUU AAUGGCCUAAU -5'

5'- gcctggagagtgctgtgaadTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 153: 4 colon, 3 breast, 1 pancreas, and 1 leukemia cancer cell lines were found to have amplification at 8q24.12 corresponding to positions 121045534- 121538867 of the human genome and having copy numbers of 6, 21, 9, 10, 6, 6, 30, and 30, respectively. COL14A1 having an Entrez ID no. of 7373 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA Attorney Docket No.3300-01-lWO

5'- cgcaagatgcggtactggtdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- gttgtggagagtctgaccadTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- cttgacacctctcacagagdTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- agaatccctccaggataggdTdT-3'

3'-dTdTACUAGUUUAAUGGCCUAAU -5'

5'- ccgggaaaggatggatcctdTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 154: 4 colon, 3 breast, 1 pancreas, and 1 leukemia cancer cell lines were found to have amplification at 8q24.12 corresponding to positions 121045534- 121538867 of the human genome and having copy numbers of 6, 21, 9, 10, 6, 6, 30, and 30, respectively. MRPL13 having an Entrez ID no. of 28998 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-tggacgcctccatgggcagc-3'

SEQ ID NO:163 5'-gacgcctccatgggcagcgt-3'

SEQ ID NO:162 5'-cgcctccatgggcagcgtct-3' Attorney Docket No. 3300-01-lWO

siRNA

5 '- ggcgccccagcaatgggccdTdT-3 '

3 '-dTdTUUUCCGAGGAUUUGUAAAU -5 '

5'- gtaccatgcactgagtgacdTdT-3 '

3 '-dTdTUAACGAUCCAUCAGUUUAU -5 '

5 '- ctgagtgactgtggggatcdTdT-3 '

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5 '- cctgagggatccagtggcadTdT-3 '

3 '-dTdT ACUAGUUU AAUGGCCUAAU -5 '

5 '- cccaagattgtggactccadTdT-3 '

3 '-dTdT AGC ACCUGUACUUUA AU AU -5 '

Example 155 : 3 colon, 2 breast, and 1 pancreas cancer cell lines were found to have amplification at 8q24.22 corresponding to positions 133795811-134384423 of the human genome and having copy numbers of 6, 9, 10, 6, 8, and 23, respectively. NDRGl (GC4; RTP; DRGl ; NDRl ; NMSL; TDD5; CAP43; CMT4D; HMSNL; RIT42; TARGl ; PROXYl) having an Entrez ID no. of 10397 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules. Antisense Attorney Docket No.3300-01-lWO

SEQ ID NO:162 5'-tggacgcctccatgggcagc-3' SEQ ID NO:163 5'-gacgcctccatgggcagcgt-3' SEQ ID NO:162 5'-cgcctccatgggcagcgtct-3' acagcagggacatgtctcgggaga

siRNA

5'- tgtagacctcgctgaggtgdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- gcactttgccgtctgccacdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- ctccaagatctcaggatggdTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- ggactgtggcggcctcccgdTdT-3'

3'-dTdTACUAGUUUAAUGGCCUAAU -5'

5'- gcgccgggcccaagtccatdTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 156: 3 colon, 2 breast, and 1 pancreas cancer cell lines were found to have amplification at 8q24.22 corresponding to positions 133795811-134384423 of the human genome and having copy numbers of 6, 9, 10, 6, 8, and 23, respectively. Attorney Docket No.3300-01-lWO

PHF20L1 having an Entrez ID no. of 51105 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA

5'- ggattggatagctttagtcdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- taaacctcgaaccagcgctdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- gccacaccagacgtagagadTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- gatggtctttccacagccadTdT-3'

3 '-dTdT ACUAGUUU AAUGGCCUAAU -5'

5'- gaaacagctccaatgctggdTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5' Attorney Docket No.3300-01-lWO

Example 157: 3 colon, 2 breast, and 1 pancreas cancer cell lines were found to have amplification at 8q24.22 corresponding to positions 133795811-134384423 of the human genome and having copy numbers of 6, 9, 10, 6, 8, and 23, respectively. TG (AITD3) having an Entrez ID no. of 7038 is contained within this amplified region.

Antisense

siRNA

5'- gacggcctgtggcttgtctdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- ccgagggctggctcgtcttdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- gagttgcggcctggctcgadTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- ctctgtgcaggtgggttgtdTdT-3'

3'-dTdTACUAGUUUAAUGGCCUAAU -5'

5'- tgccttggggcttcccttcdTdT-3' Attorney Docket No.3300-01-lWO

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 158:3 colon, 2 breast, and 1 pancreas cancer cell lines were found to have amplification at 8q24.22 corresponding to positions 133795811-134384423 of the human genome and having copy numbers of 6, 9, 10, 6, 8, and 23, respectively. TMEM71 having an Entrez ID no. of 137835 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA

5'- actgatgtcaacaccagtadTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- ctggagagctgtctcccacdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- ctcccactatacctgtcgcdTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- ctgatgactgggagtcaggdTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTACUAGUUUAAUGGCCUAAU -5'

5'- gccagtgtcttcacatgctdTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 159: 3 colon, 2 breast, and 1 pancreas cancer cell lines were found to have amplification at 8q24.22 corresponding to positions 133795811-134384423 of the human genome and having copy numbers of 6, 9, 10, 6, 8, and 23, respectively. WISPl (CCN4; WISPIc; WISPIi; WISPltc) having an Entrez ID no. of 8840 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

gacgtccaggcatgaggtggttcc siRNA

5'- gccctggacgctggcagcadTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- ccaccggggcctctactgtdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- ccttcgatgctgtgggtgadTdT-3' Attorney Docket No.3300-01-lWO

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- ccagaggcatccatgaactdTdT-3'

3 '-dTdT ACUAGUUU AAUGGCCUAAU -5'

5'- gcctgcttctgtaacctgadTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 160: 3 colon and 2 breast cancer cell lines were found to have amplification at 8q24.3 corresponding to positions 140458177-141174956 of the human genome and having copy numbers of 6, 10, 6, 8, and 18, respectively. C8ORF17 (MOST-I) having an Entrez ID no. of 56988 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-tggacgcctccatgggcagc-3' SEQ ID NO:163 5'-gacgcctccatgggcagcgt-3' SEQ ID NO:162 5'-cgcctccatgggcagcgtct-3' accatgggagaatgtccccacctc

siRNA

5'- gaatgtccccacctcgtggdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5' Attorney Docket No.3300-01-lWO

5'- gaatgtccccacctcgtggdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- ggccacaggtccttggccadTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- gtacaagatgttggctgacdTdT-3'

3 '-dTdT ACUAGUUU AAUGGCCUAAU -5'

5'- gtgaaacccgtctctactadTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 161:3 colon and 2 breast cancer cell lines were found to have amplification at 8q24.3 corresponding to positions 140458177-141174956 of the human genome and having copy numbers of 6, 10, 6, 8, and 18, respectively. KCNK9 (KT3.2; TASK3; TASK-3; MGC138268; MGC138270) having an Entrez ID no. of 51305 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA Attorney Docket No.3300-01-lWO

5'- cgagtcggaccacgagatgdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- ggaaccgcaccgcgccggcdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- gtcatgttccagagcctggdTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- ggtggggctgacggtcatcdTdT-3'

3'-dTdTACUAGUUUAAUGGCCUAAU -5'

5'- gcaccgcagaactccttcadTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 162: 3 colon and 2 breast cancer cell lines were found to have amplification at 8q24.3 corresponding to positions 142110977-142726810 of the human genome and having copy numbers of 6, 10, 6, 8, 17 respectively. DENND3 having an Entrez ID no. of 22898 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-tggacgcctccatgggcagc-3' SEQ ID NO:163 5'-gacgcctccatgggcagcgt-3' SEQ ID NO:162 5'-cgcctccatgggcagcgtct-3' Attorney Docket No. 3300-01-lWO

siRNA

5 '- gagagaagcccagaccagadTdT-3 '

3 '-dTdTUUUCCGAGGAUUUGUAAAU -5 '

5'- gccatctcgaccacttcgadTdT-3 '

3 '-dTdTUAACGAUCCAUCAGUUUAU -5 '

5 '- agacggaagcagaagcccadTdT-3 '

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5 '- ggtgatggccgaccagaacdTdT-3 '

3 '-dTdT ACUAGUUU AAUGGCCUAAU -5 '

5 '- ccgtggagaaggagctggtdTdT-3 '

3 '-dTdT AGC ACCUGUACUUUA AU AU -5 '

Example 163 : 3 colon and 2 breast cancer cell lines were found to have amplification at 8q24.3 corresponding to positions 142110977-142726810 of the human genome and having copy numbers of 6, 10, 6, 8, and 17, respectively.

GPR20 having an Entrez ID no. of 2843 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense Attorney Docket No.3300-01-lWO

tggctgccgtcatgccctctgtgt siRNA

5'- gtctccagcggggccctcgdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- gcctgtggctggcgctgatdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- ggctgcctgcgctgtgcctdTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- agggtcgccagcgccgcgtdTdT-3'

3'-dTdTACUAGUUUAAUGGCCUAAU -5'

5'- ctcatctgggcatgccagcdTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 164: 3 colon and 2 breast cancer cell lines were found to have amplification at 8q24.3 corresponding to positions 142110977-142726810 of the human genome and having copy numbers of 6, 10, 6, 8, and 17, respectively. PTP4A3 (PRL3; PPvL-3; PRL-R) having an Entrez ID no. of 11156 is contained within this Attorney Docket No.3300-01-lWO

amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA

5'- cgccatggctcggatgaacdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- gctcagcaccttcattgagdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- AGAAGCCGAUUGUU AACUAdTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- cgcccggcaaggtagtggadTdT-3'

3 '-dTdT ACUAGUUU AAUGGCCUAAU -5'

5'- aagacccacacacgcacaadTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5' Attorney Docket No. 3300-01-lWO

Example 165 : 1 bladder and lung cancer cell lines were found to have a homozygous deletion at 9q33.2 corresponding to positions 122636273-122715159 of the humaqn genome. ORlKl having an Entrez ID no. of 392392 is contained within this region.

Example 166: 1 bladder and 1 lung cancer cell lines were found to have a homozygous deletion at 9q33.2 corresponding to positions 122636273-122715159 of the human genome. PDCL having an Entrez ID no. of 5082 is contained within this region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO: 162 5 '-tggacgcctccatgggcagc-3 ' SEQ ID NO: 163 5 '-gacgcctccatgggcagcgt-3 ' SEQ ID NO: 162 5 '-cgcctccatgggcagcgtct-3 '

siRNA

5 '- ctgggggagaaactgcagtdTdT-3 '

3 '-dTdTUUUCCGAGGAUUUGUAAAU -5 '

5'- caggtcccatctggatgaadTdT-3 '

3 '-dTdTUAACGAUCCAUCAGUUUAU -5 '

5 '- cggcagcagcttcacaaggdTdT-3 '

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5' Attorney Docket No. 3300-01-lWO

5 '- cccttcctgccctgctgatdTdT-3 '

3'-dTdTACUAGUUUAAUGGCCUAAU -5'

5 '- gccacgtgtcacagtgaggdTdT-3 '

3 '-dTdT AGC ACCUGUACUUUA AU AU -5 '

Example 167: 1 bladder and lung cancer cell lines were found to have a homozygous deletion at 9q33.2 corresponding to positions 122636273-122715159. MNAB having an Entrez ID no. of 54542 is contained within this region.

Example 168: 1 leukemia and 1 brain cancer cell lines were found to have a homozygous deletion at 10q21.1 corresponding to positions 59623053-59682237 of the human genome. IPMK having an Entrez ID no. of 253430 is contained within this region.

Example 169: 1 skin and 1 testes cancer cell lines found to have amplification at 12pl2.3 corresponding to positions 15947490-16672153 of the human genome and having copy numbers of 10 and 10, respectively. DERA having an Entrez ID no. of 51071 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA Attorney Docket No.3300-01-lWO

5'- ctaccacgcggcagctccgdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- cggcagttctgaggcgtgcdTdT-3'

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- tcagattggctgtggaagadTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- aatgccaccttcccggtagdTdT-3'

3'-dTdTACUAGUUUAAUGGCCUAAU -5'

5'- gcagcttatcatgatcttcdTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 170: 1 skin and 1 testes cancer cell lines were found to have amplification at 12pl2.3 corresponding to positions 15947490-16672153 of the human genome and having copy numbers of 10 and 10, respectively. MGSTl having an Entrez ID no. of 4257 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-cgcctccatgggcagcgtct-3'

aaattgaaaaaatggttgacctca

siRNA

5'- ggttgacctcacccaggtadTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- gcttttgcatcctatgcaadTdT-3'

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- ccatttcttggaattggccdTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- cggagcacggatctaccacdTdT-3'

3'-dTdTACUAGUUUAAUGGCCUAAU -5'

5'- gcttacaggttgctgaaaadTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 171: 1 skin and testes cancer cell lines were found to have amplification at 12pl2.3 corresponding to positions 15947490-16672153 of the human genome and having copy numbers of 10 and 10, respectively. LM03 having an Entrez ID no. of 55885 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules. Attorney Docket No.3300-01-lWO

Antisense

siRNA

5'- caaatgctctcagtccagcdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5 ' - ccgaaaggttgtgctggctdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- ctgcgctgcctgtagtaagdTdT-3'

3 ' -dTdTUCUUCGGCUAAC AAUUGAU -5 '

5'- cagagattttgtgttggagdTdT-3'

3'-dTdTACUAGUUUAAUGGCCUAAU -5'

5'- atgcaccccaggttcgctgdTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 172: 1 ovary and 1 leukemia cancer cell lines were found to have a homozygous deletion at 16p 13.11 corresponding to positions 16164269-16171338 of Attorney Docket No. 3300-01-lWO

the human genome. ABCC6 having an Entrez ID no. of 368 is contained within this region.

Example 173 : 1 unknown origin and 1 skin cancer cell lines were found to have a homozygous deletion at 16pl3.13 corresponding to positions 11033405-11294665 of the human genome. KIAA0350 having an Entrez ID no. of 23274 is contained within this region.

Example 174: 1 lung and 1 breast cancer cell lines were found to have a homozygous deletion at 17pl 1.2-11.1 corresponding to positions 21641573-22367498 of the human genome. FAM27L having an Entrez ID no. of 284123 is contained within this region.

Example 175 : 2 colon, 2 lung, 1 breast, and 1 pancreas cell lines were found to have a homozygous deletiotion at 17pl2 corresponding to positions 11912343- 11931404 of the human genome. MAP2K4 (JNKK; MEK4; MKK4; SEKl ; JNKKl ; SERKl ; MAPKK4; PRKMK4) having an Entrez ID no. of 6416 is contained within this region.

Example 176: 2 breast cancer cell lines were found to have amplification at 17ql l .2 corresponding to positions 24437530-24891441 of the human genome and having copy numbers of 10 and 10, respectively. CRYBAl having an Entrez ID no. of 1411 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO: 162 5 '-tggacgcctccatgggcagc-3 ' SEQ ID NO: 163 5 '-gacgcctccatgggcagcgt-3 ' Attorney Docket No.3300-01-lWO

SEQ ID NO:162 5'-cgcctccatgggcagcgtct-3'

gtaccagatggagacccaggctgagcagca siRNA

5'- ggagctggaaacccttccadTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- caccagctcctgtccaaatdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- gcgtctcatgtccttccgcdTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- gtggggcctgggtttgctadTdT-3'

3 '-dTdT ACUAGUUU AAUGGCCUAAU -5'

5'- gcccagacttcgcagatccdTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 177: 2 breast cancer cell lines were found to have amplification at 17qll.2 corresponding to positions 24437530-24891441 of the human genome and having copy numbers of 10 and 10, respectively. NUFIP2 having an Entrez ID no. of 57532 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules. Attorney Docket No.3300-01-lWO

Antisense

siRNA

5'- acagccaccaccatccgcadTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- ggtagtggatctgagagcgdTdT-3'

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- catcatctaccggggaaacdTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- ccctctcagacagatcagcdTdT-3'

3'-dTdTACUAGUUUAAUGGCCUAAU -5'

5'- cagagataccagagaggccdTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 178: 2 ovary cancer cell lines were found to have a homozygous deletion at 17q21.2 corresponding to positions 36463670-36481510. KRTAP2-4 having an Entrez ID no. of 85294 is contained within this region. Attorney Docket No.3300-01-lWO

Example 179: 2 breast cancer cell lines were found to have amplification at 17q23.2 corresponding to positions 54107123-54564851 of the human genome and having copy numbers of 14 and 14, respectively. PPMlE having an Entrez ID no. of 22843 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA

5'- cgtgcggcggcggcgagccdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- ggcgaaagcctggacctgtdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- ccctgtgcagggccttccgdTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- gctcgtgatgctgggtcaadTdT-3'

3 '-dTdT ACUAGUUU AAUGGCCUAAU -5' Attorney Docket No.3300-01-lWO

5'- cctcacttactggaagtggdTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 180: 2 breast cancer cell lines were found to have amplification at 17q23.2 corresponding to positions 54107123-54564851 of the human genome and having copy numbers of 14 and 14, respectively. TRIM3 having an Entrez ID no. of 74591 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA

5'- ctggaggaagagacaggaadTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- gagcacccaagttccagaadTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- cgcatggagtgatgatgatdTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- cctggaacaggcattgcaadTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTACUAGUUUAAUGGCCUAAU -5'

5'- ggcctgtgatttgggccttdTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 181:2 breast cancer cell lines were found to have amplification at 17q23.2 corresponding to positions 54107123-54564851 of the human genome and having copy numbers of 14 and 14, respectively. RAD51C having an Entrez ID no. of 5889 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA

5'- cgatgcgcgggaagacgttdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- gactgctgaggaactcctadTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- ggagcatacccagggcttcdTdT-3' Attorney Docket No.3300-01-lWO

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- tctccttttaagggtgggtdTdT-3'

3 '-dTdT ACUAGUUU AAUGGCCUAAU -5'

5'- gtgtatgtgcattaaacaadTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 182: 1 breast and 1 uterus cancer cell lines were found to have amplification at 17q25.1 corresponding to positions 70045729-70061352 of the human genome and having copy numbers of 12 and 11, respectively. CD300C having an Entrez ID no. of 10871 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA

5'- gtcttcagctctgctcctcdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- aggaacacaggaccctcaadTdT-3' Attorney Docket No. 3300-01-lWO

3 '-dTdTUAACGAUCCAUCAGUUUAU -5 '

5 '- ttgaggtgtccgtgttcccdTdT-3 '

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5 '- ggagctgcccctgctcctgdTdT-3 '

3 '-dTdT ACUAGUUU AAUGGCCUAAU -5 '

5 '- agcaggcagaattggcccadTdT-3 '

3 '-dTdT AGC ACCUGUACUUUA AU AU -5 '

Example 183 : 1 breast and 1 colon cancer cell lines were found to have a homozygous deletion at

18ql2.2 corresponding to positions 32164601-32204994 of the human genome. FHOD3 having an Entrez ID no. of 80206 is contained within this region.

Example 184: 1 prostate and breast cancer cell lines were found to have a homozygous deletion at 18q23 corresponding to positions 75504077-75530689 of the human genome. FLJ25715 having an Entrez ID no. of 284241 is contained within this region.

Example 185 : 3 breast cancer cell lines were found to have an amplification at 20ql3.13 corresponding to positions 48712419-48867933 of the human genome and having copy numbers of 10, 21 , and 12, respectively. PARD6B having an Entrez ID no. of 84612 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules. Attorney Docket No.3300-01-lWO

Antisense

siRNA

5'- ggcagcggctgcctgggcadTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- gtaggctatgcagacatccdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- ttgcgtcctgacaaccatadTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- ggaggtctggctcaaagtadTdT-3'

3'-dTdTACUAGUUUAAUGGCCUAAU -5'

5'- gtgagcttagcagccatagdTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 186: 3 breast and 1 skin cancer cell lines were found to have amplification at 20ql 3.31 corresponding to positions 55098369-55291318 of the human Attorney Docket No.3300-01-lWO

genome and having copy numbers of 13, 19, 16, and 10, respectively. BMP7 having an Entrez ID no. of 655 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA

5'- cgccgcacagcttcgtggcdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- gcttcatccaccggcgcctdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- gctaccaccatcgagagttdTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- cacttccgcagcatccggtdTdT-3'

3 '-dTdT ACUAGUUU AAUGGCCUAAU -5'

5'- ggtggtccgggcctgtggcdTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5' Attorney Docket No.3300-01-lWO

Example 187: 1 brain, 1 retina, and 1 lung cancer cell lines were found to have an amplification at 2p24.3 corresponding to positions 15981727-16078520 of the human genome and having copy numbers of 30, 22, 21, and 18, respectively. MYCN (NMYC; ODED; MODED; N-myc) having an Entrez ID no. of 4613 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA

5'- caccatgccgggcatgatcdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5 ' - ggacatctggaagaagtttdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- agccggccgcgccggggccdTdT-3'

3 ' -dTdTUCUUCGGCUAAC AAUUGAU -5 '

5'- ccagcggcggcgaccacaadTdT-3'

3 '-dTdT ACUAGUUU AAUGGCCUAAU -5' Attorney Docket No. 3300-01-lWO

5 '- cactccctccaggccgaggdTdT-3 '

3 '-dTdT AGC ACCUGUACUUUA AU AU -5 '

Example 188: 2 colon cancer cell lines were found to have a homozygous deletion at 2q21.2 corresponding to positions 133976342-134156587 0 of the human genome. FLJ34870 having an Entrez ID no. of 401013 is contained within this region.

Example 189: 1 lung and 1 ovary cancer cell lines were found to have a homozygous deletion at 2q22.1 corresponding to positions 141796559-141883867. LRPlB having an Entrez ID no. of 53353 is contained within this region.

Example 190: 1 lymph and 1 breast cancer cell lines were found to have a homozygous deletion at 2q37.3.

Example 191 : 3 colon cancer cell lines were found to have a homozygous deletion at 4q22.1 corresponding to positions 92004225-92228940 of the human genome. MGC48628 having an Entrez ID no. of 401145 is contained within this region.

Example 192: 3 colon cancer cell lines were found to have a homozygous deletion at 4q22.1 corresponding to positions 92004225-92228940 of the human genome. TMSL3 having an Entrez ID no. of 7117 is contained within this region and can be modulated with the following antisense and siRNA molecules.

Example 193 : 1 lung and 1 breast cancer cell lines were found to have a homozygous deletion at 5q33.1 corresponding to positions 151751380-151765505 of Attorney Docket No.3300-01-lWO

the human genome. NMUR2 having an Entrez ID no. of 56923 is contained within this region.

Example 194: 2 colon cancer cell lines were found to have a homozygous deletion at 6p21.2 corresponding to positions 37921262-38086150 of the human genome and having copy numbers of 21 and 23, respectively. ZFAND3 having an Entrez ID no. of 60685 is contained within this region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA

5'- tgggagcgagcgcagcaaadTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- gccgcctcgctgtccctgcdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- gccagcagccgcttccgacdTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- acgactacttgagaatacgdTdT-3' Attorney Docket No. 3300-01-lWO

3'-dTdTACUAGUUUAAUGGCCUAAU -5'

5 '- tcctgccagcgcatcggggdTdT-3 '

3 '-dTdT AGC ACCUGUACUUUA AU AU -5 '

Example 195 : 2 colon cancer cell lines were found to have a homozygous deletion at 6q22.1 corresponding to positions 116263487-116504892 of the human genome. FRK having an Entrez ID no. of 2444 is contained within this region.

Example 196: 2 colon cancer cell lines were found to have a homozygous deletion at 6q23.2 corresponding to positions 133449733-134632188 of the human genome and having copy numbers of 17 and 16, respectively. LOC285735 having an Entrez ID no. of 285735 is contained within this region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA

5 '- atgtgctcagtaagaatcadTdT-3 '

3 '-dTdTUUUCCGAGGAUUUGUAAAU -5 '

5'- atcagtcttccactataggdTdT-3 '

3 '-dTdTUAACGAUCCAUCAGUUUAU -5 ' Attorney Docket No. 3300-01-lWO

5 '- cagaagacagttgggagcadTdT-3 '

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5 '- aatgagcagaacactcaacdTdT-3 '

3 '-dTdT ACUAGUUU AAUGGCCUAAU -5 '

5 '- tcactgcagcgtggcagtgdTdT-3 '

3 '-dTdT AGC ACCUGUACUUUA AU AU -5 '

Example 197: 3 leukemia, 1 lymph, and 1 skin cancer cell lines were found to have a homozygous deletion at 7q34 corresponding to positions 141907711- 142017309 of the human genome. TRBC l having an Entrez ID no. of 91010 is contained within this region.

Example 198: 3 leukemia, 1 lymph, and 1 skin cancer cell lines were found to have a homozygous deletion at 7q34 corresponding to positions 141907711-142017309 of the human genome. PRSSl (TRPl ; TRYl ; TRY4; TRYPl ; MGC120175) having an Entrez ID no. of 5644 is contained within this region.

Example 199: 3 leukemia, 1 lymph, and 1 skin cancer cell lines were found to have a homozygous deletion at 7q34 corresponding to positions 141907711-142017309 of the human genome. PRSS2 having an Entrez ID no. of 5645 is contained within this region. Attorney Docket No.3300-01-lWO

Example 200: 2 breast cancer cell lines were found to have amplification at 8p 11.21 corresponding to positions 41651414-42121063 of the human genome and having copy numbers of 15 and 10, respectively. ANKl having an Entrez ID no. of

286 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA

5'- gcttccgcgaagccgatgcdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- tctgcacgtggcggccaagdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- tgccctacatggccaaattdTdT-3'

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- caccgaccgcgactactcgdTdT-3'

3'-dTdTACUAGUUUAAUGGCCUAAU -5'

5'- tgcaggaggccaagaacacdTdT-3' Attorney Docket No.3300-01-lWO

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 201: 2 breast cancer cell lines were found to have amplification at 8p 11.21 corresponding to positions 41651414-42121063 of the human genome and having copy numbers of 15 and 10, respectively. MYST3 having an Entrez ID no. of 7994 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

SEQ ID NO:162 5'-ttccttcgcggcattgccggc-3' SEQ ID NO:163 5'-ccttcgcggcattgccggcgg-3' SEQ ID NO:162 5'-ttcgcggcattgccggcggct-3'

siRNA

5'- gaggaaugcaggcaguagudTdT-3'

3'-dTdTcuccuuacguccgucauca -5'

5'- gccucgaacuccaacuggadTdT-3 '

3'-dTdTcggagcuugagguugaccu -5'

5'- gcugcaaggccaaaucacadTdT-3'

3'-dTdTcgacguuccgguuuagugu -5'

5'- ugagacagggcuauggcaadTdT-3' Attorney Docket No.3300-01-lWO

3'-dTdTacucugucccgauaccguu -5'

5'- caaauacuggaagggaaaadTdT-3'

3'-dTdTguuuaugaccuucccuuuu -5'

Example 202: 1 kidney, 1 colon, 1 bone marrow, 1 salivary gland, 1 skin, and 1 breast cancer cell lines were found to have amplification at 8p23.2 corresponding to positions 3439671-3469284 of the human gneome. CSMDl having an Entrez ID no. of 64478 is contained within this region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA

5'- ggaggagattccagtcgctdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- ctttctcgcggtcaaggatdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5'

5'- gtctggcttctccatccagdTdT-3' Attorney Docket No.3300-01-lWO

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5'- cgtgaggatatgcctgcaadTdT-3'

3 '-dTdT ACUAGUUU AAUGGCCUAAU -5'

5'- taagtgcagcggggatctcdTdT-3'

3 '-dTdT AGC ACCUGUACUUUA AU AU -5'

Example 203: 2 breast and 1 ovary cancer cell lines were found to have amplification at 8q23.1 corresponding to positions 108305180-108347792 of the human genome and having copy numbers of 10, 13, and 12, respectively. ANGPTl having an Entrez ID no. of 284 is contained within this amplified region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA

5'- ctttcctcgctgccattctdTdT-3'

3'-dTdTUUUCCGAGGAUUUGUAAAU -5'

5'- gatggcccagatacagcagdTdT-3 '

3'-dTdTUAACGAUCCAUCAGUUUAU -5' Attorney Docket No. 3300-01-lWO

5 '- tgcaatatggatgtcaatgdTdT-3 '

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5'

5 '- cagagcagcctgatcttacdTdT-3 '

3 '-dTdT ACUAGUUU AAUGGCCUAAU -5 '

5 '- gatgattcgacctttagatdTdT-3 '

3 '-dTdT AGC ACCUGUACUUUA AU AU -5 '

Example 204: 1 skin and 1 unknown origin cancer cell lines were found to have a homozygous deletion at 9p23 corresponding to positions 12766841-12904345 of the human genome. C9ORF150 having an Entrez ID no. of 286343 is contained within this region.

Example 205 : 1 skin and 1 unknown origin cancer cell lines were found to have a homozygous deletion at 9p23-22.3 corresponding to positions 13950310-14119060 of the human genome. NFIB having an Entrez ID no. of 4781 is contained within this region.

Example 206: 1 colon, 1 skin, and 1 unknown origin cancer cell lines were found to have a homozygous deletion at 9p24.1-23corresponding to positions 8125122- 10004143 of the human genome. PTPRD having an Entrez ID no. of 5789 is contained within this region.

Example 207: 1 breast and 1 unknown origin cancer cell lines were found to have a homozygous deletion at 9p24.3 corresponding to positions 251856-442926 of the Attorney Docket No. 3300-01-lWO

human genome. DOCK8 having an Entrez ID no. of 81704 is contained within this region.

Example 208: 2 colon cancer cell lines were found to have a homozygous deletion at 9q21.11 corresponding to positions 69647298-70020088. LOC 138255 having an Entrez ID no. of 138255 is contained within this region.

Example 209: 2 colon cancer cell lines were found to have a homozygous deletion at 9q21.11 corresponding to positions 69647298-70020088 of the human genome. MAMDC2 having an Entrez ID no. of 256691 is contained within this region.

Example 210: 2 colon cancer cell lines were found to have a homozygous deletion at 9q21.11 corresponding to positions 70353728-70810828 of the human genome. TRPM3 having an Entrez ID no. of 80036 is contained within this region.

Example 211 : 2 colon cancer cell lines were found to have a homozygous deletion at 9q21.11 corresponding to positions 78989801-79746726 of the human genome. TLE4 having an Entrez ID no. of 7091 is contained within this region.

Example 212: 1 leukemia, 1 breast and 1 unknown origin cancer cell lines were found to have a homozygous deletion at 9q24.3corresponding to positions 625501- 708872 of the human genome. ANKRD 15 having an Entrez ID no. of 23189 is contained within this region.

Example 213 : 1 brain, 1 unknown origin, and 1 skin cancer cell lines were found to have a homozygous deletion at XpI 1.4 corresponding to positions 41490460- 41577381 0 of the human genome. CASK having an Entrez ID no. of 8573 is contained within this region. Attorney Docket No. 3300-01-lWO

Example 214: 3 breast and 1 colon cancer cell lines were found to have a homozygous deletion at Xp21.2 corresponding to positions 29296205-29794396 of the human gneome. ILlRAPLl having an Entrez ID no. of 11141 is contained within this region.

Example 215 : 3 breast, 1 prostate, and 1 leukemia cancer cell lines were found to have a homozygous deletion at Xp21.2-21.1 corresponding to positions 31189090- 32794338. DMD (BMD; DXS 142; DXS 164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272; dystrophin) having an Entrez ID no. of 1756 is contained within this region.

Example 216: 2 breast and 1 lymph cancer cell lines were found to have a homozygous deletion at Xp22.12 corresponding to positions 19359522-19392822 of the human genome. SH3KBP1 having an Entrez ID no. of 30011 is contained within this region.

Example 217: 2 breast and 1 brain cancer cell lines were found to have a homozygous deletion at Xp22.13 corresponding to positions 17606410-18345167 of the human genome. CXORF20 having an Entrez ID no. of 139105 is contained within this region.

Example 218: 2 breast and 1 brain cancer cell lines were found to have a homozygous deletion at Xp22.13 corresponding to positions 17606410-18345167 of the human genome. SCML2 having an Entrez ID no. of 10389 is contained within this region.

Example 219: 2 breast and 1 brain cancer cell line were found to have a homozygous deletion at Xp22.13 corresponding to positions 17606410-18345167 of the human genome. CDKL5 having an Entrez ID no. of 6792 is contained within this region. Attorney Docket No. 3300-01-lWO

Example 220: 2 breast and 1 prostate cancer cell lines were found to a homozygous deletion at Xp22.2corresponding to positions 14106785-14527783 of the human genome. GLRA2 having an Entrez ID no. of 2742 is contained within this region.

Example 221 : 3 breast and 3 colon cancer cell lines were found to have amplification at Xp22.31 corresponding to positions 6953453-7072013 of the human genome and having copy numbers of , respectively. STS (ES; ASC; ARSC; SSDD; ARSC l) having an Entrez ID no. of 412 is contained within this region and can be modulated with the following antisense and siRNA molecules.

Antisense

siRNA

5 '- gatccctttcctcctactgdTdT-3 '

3 '-dTdTUUUCCGAGGAUUUGUAAAU -5 '

5'- tgggatgagctgtcacagcdTdT-3 '

3 '-dTdTUAACGAUCCAUCAGUUUAU -5 '

5 '- gagtgtggggcagatcttgdTdT-3 '

3 '-dTdTUCUUCGGCUAAC AAUUGAU -5' Attorney Docket No. 3300-01-lWO

5 '- gatacaggctggccagaagdTdT-3 '

3'-dTdTACUAGUUUAAUGGCCUAAU -5'

5 '- ctgagccgctagcagcgccdTdT-3 '

3 '-dTdT AGC ACCUGUACUUUA AU AU -5 '

Example 222: Alterations/Targets in All Cancers

Using the method described in Example 1 , the following targets were found to have the specified copy number alterations. Now these regions, targets, proteins, and/or genes can be used in the methods of the invention. Specific antisense and siRNA molecules can be found in the tables below.

Table 2: All Cancers

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Example 223 : Deletions

Using the method described in Example 1 , the following targets were found to have the specific deletions. Now these regions, targets, proteins, and/or genes can be used in the methods of the invention. Specific antisense and siRNA molecules can be found in the tables below.

Table 3 : Deletions

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Example 224: Breast Cancer Alterations

Table 4: Breast Cancer Alterations/Targets

Attorney Docket No. 3300-01-lWO

Attorney Docket No.3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No.3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Example 225 : Ovarian Cancer Alterations/Targets

Table 5 : Ovarian Alterations

Attorney Docket No. 3300-01-lWO

Table 5 : Ovarian Targets continued

Attorney Docket No. 3300-01-lWO

Example 226: Prostate cancer alterations and targets

Example 227: Colon Cancer Alterations/Targets Attorney Docket No. 3300-01-lWO

Table 7: Colon Cancer Alterations/Targets

Example 229: Effects of Antisense or siRNA Inhibitors on Protein Expression

The effects of antisense inhibitors on target protein expression can be measured by a variety of methods known in the art. A preferred method is to measure mRNA levels using real-time quantitative polymerase chain reaction (PCR) methods. Realtime PCR can be performed using the ABI PRISM™ 7700 Sequence Detection System according to the manufacturer's instructions. The ABI PRISM™ 7700 Sequence Detection System is available from PE-APPLIED Biosystems, Foster City, California.

Other methods of measuring mRNA levels may also be used to determine the effects of antisense (or siRNA) inhibitors on proteins. For example competitive PCR Attorney Docket No. 3300-01-lWO

and Northern blot analysis are well known in the art and may be performed to determine mRNA levels. Specifically, methods of RNA isolation and Northern blot analysis may be performed according to Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 1 , pp. 4.1.1-4.2.9 and 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993.

The effects of antisense (or siRNA) inhibitors on protein expression may also be determined by measuring protein levels of the proteins of interest. Various methods known in the art may be used, such as immunoprecipitation, Western blot analysis, ELISA, or fluorescence-activated cell sorting (FACS). Antibodies to the proteins of interest are often commercially available, and may be found by such sources as the MSRS catalogue of antibodies (Aerie Corporation, Birmingham, Mich.). Antibodies can also be prepared through conventional antibody generation methods, such as found in Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.12.1-1 1.12.9 and 11.4.1-1 1.11.5 John Wiley & Sons, Inc., 1997. Furthermore, immunoprecipitation analysis can be performed according to Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.16.1-10.16.11 , John Wiley & Sons, Inc., 1997, and ELISA can be performed according to Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 1 1.1.1-11.2.22, John Wiley & Sons, Inc., 1997.

Table 8: Antisense Molecules to Targets in Tables 1-7

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

5'-ggccgcccgcatgccgggtg-3'

5'-ccgcccgcatgccgggtgcc-3'

NM 001018001 5'-aacatctccttcatctgccg-3'

5'-catctccttcatctgccgga-3'

5'-tctccttcatctgccggaga-3'

NM 001018056 5'-gcggacgtgcccatggtgcc-3'

5'-ggacgtgcccatggtgcccg-3'

5'-acgtgcccatggtgcccgcc-3'

NM 001024682 5'-caaaatgcgtgcatggattc-3'

5'-aaatgcgtgcatggattccc-3'

5'-atgcgtgcatggattcccgg-3'

NM 001026 5'-acggtgtcgttcatgatggc-3'

5'-ggtgtcgttcatgatggcga-3'

5'-tgtcgttcatgatggcgatc-3'

NM 001029939 5'-caacatttacacataaagat-3'

5'-acatttacacataaagatgg-3'

5'-atttacacataaagatggcc-3'

NM 001030055 5'-ttttttgccatcataactct-3'

5'-ttttgccatcataactctct-3'

5'-ttgccatcataactctcttc-3'

NM 001031803 5'-aggaaccgcctcattttgct-3'

5'-gaaccgcctcattttgctta-3'

5'-accgcctcattttgcttagt-3'

NM 001037234 5'-gctgttggtctcatttgttg-3'

5'-tgttggtctcatttgttgaa-3'

5'-ttggtctcatttgttgaaat-3'

NM 001037675 5'-gctgataccaccatgctgac-3'

5'-tgataccaccatgctgacgt-3'

5'-ataccaccatgctgacgttt-3'

NM 001037732 5'-agaaccagaaacagcttcat-3'

5'-gagaaccagaaacagcttca-3'

5'-tgagaaccagaaacagcttc-3'

NM 001040057 5'-gctattgggttcatataggc-3'

5'-tattgggttcatataggcct-3'

5'-ttgggttcatataggccttt-3'

NM 001040069 5'-cctgccgcgcccatcctcgc-3'

5'-tgccgcgcccatcctcgcga-3'

5'-ccgcgcccatcctcgcgact-3'

NM 001040084 5'-ttccaccaggccatctcttt-3'

5'-ccaccaggccatctctttca-3'

5'-accaggccatctctttcacc-3'

NM 001042555 5'-caacagctacccatggcttc-3'

5'-acagctacccatggcttctt-3'

5'-agctacccatggcttcttca-3'

NM 001077503 5'-agggcgaggcaaggcagcat-3'

5'-cagggcgaggcaaggcagca-3' 5'-gcagggcgaggcaaggcagc-3' Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Table 9: siRNA molecules to Targets in Tables 1-7

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Table 9 continued

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No. 3300-01-lWO

Attorney Docket No.3300-01-lWO

NM 207491 CAGAACGGGCAGGAAGCUC

NM 207491 CUCCCCAAGGAAACUUGGA

NM 213606 ACGGCAUGGAUCCAUUCCA

NM 213606 UCUCUGUGUAUGUGGUGCC

NM 213606 GUCUCCCUCUGCUCGUGCC

NM 213606 CCAUUUAUCCUGUCAAGUG

NM 213606 GCAUCUCUACCUCACUCUG

NM 213633 GUUUCUGAGGGGAAGGAUG

NM 213633 AGCAUAGUGGGCUCUAUGC

NM 213633 ACUUCUGGAAUCCGCCCAC

NM 213633 GUCACGAUUGAAGCCCAGC

NM _213633 UUUGCCCCAGAAUCUUGCU

Attorney Docket No. 3300-01-lWO

[00336] All publications and patent applications mentioned in the specification are indicative of the level of those skilled in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. The mere mentioning of the publications and patent applications does not necessarily constitute an admission that they are prior art to the instant application.

[00337] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the appended claims.

Claims

Attorney Docket No. 3300-01-lWOCLAIMSWhat is claimed is:

1. A method for detecting an amplified or deleted nucleic acid in a sample comprising, obtaining a sample and determining the presence or absence of a gene amplification greater than 2.5 or a gene deletion of a nucleic acid corresponding to one or more of the gene amplifications or deletions in Tables 1-7.

2. The method claim 1 wherein said sample is a cancer sample.

3. The method of claim 2 wherein said cancer sample is chosen from brain, lung, liver, skin, spleen, kidney, lymph node, small intestine, pancreas, blood cells, colon, stomach, breast, endometrial, prostate, testicle, ovary, skin, head and neck, esophagus, and bone marrow cancer sample.

4. The method of claim 2 wherein said cancer sample is a lung cancer sample.

5. The method of claim 2 wherein said cancer sample is a breast cancer sample.

6. The method of claim 2 wherein said cancer sample is an ovary cancer sample.

7. The method of claim 2 wherein said cancer sample is a prostate cancer sample.

8. The method of claim 2 wherein said cancer sample is a skin cancer sample. Attorney Docket No. 3300-01-lWO

9. An isolated nucleic acid corresponding to an amplified region in Tables 1- 7, a gene or locus contained with said amplified region, a fragment of the amplified region, a fragment of said gene or locus contained within said amplified region, wherein said isolated nucleic said is useful for performing the method of claim 1.