WO2012100931A1

WO2012100931A1 - New medical uses of tgf beta 1- specific irna

Info

Publication number: WO2012100931A1
Application number: PCT/EP2012/000281
Authority: WO
Inventors: Jonathan Hall; Afzal DOGAR; Harry Towbin
Original assignee: Eth Zurich
Priority date: 2011-01-24
Filing date: 2012-01-23
Publication date: 2012-08-02

Abstract

This invention is directed to the use of TGFβ1 (transforming growth factor β1 ) mRNA- specific inhibitory RNA (iRNA) for preparing a medicament for treating and/or preventing cancer comprising iRNA-responsive cancer cells, corresponding ΤGFβΙ mRNA-specific iRNAs, vectors, cells and pharmaceutical compositions comprising said iRNA as well as a method of treating and/or preventing cancer by administering TGFβ1 mRNA-specific iRNA.

Description

NEW MEDICAL USES OF TGF BETA 1 - SPECIFIC IRNA

This invention is directed to the use of ΤΘΡβΙ (transforming growth factor β1 ) mRNA- specific inhibitory RNA (iRNA) for preparing a medicament for treating and/or preventing cancer comprising iRNA-responsive cancer cells, corresponding TGFU1 mRNA-specific iRNAs, vectors, cells and pharmaceutical compositions comprising said iRNA as well as a method of treating and/or preventing cancer by administering TGFR1 mRNA-specific iRNA.

Background of the invention

Transforming growth factor-β (TGF3) polypeptides are cytokines belonging to a large family of ligands and receptors which regulate epithelial, neuronal and immune cells by controling proliferation, differentiation and survival processes with intricate complexity. The three isoforms of TGF are expressed in excess and the rate-limiting complex mechanism of activation is regulated in a cell-type and stimulation-specific manner. TGFft is transcribed as a pro-peptide precursor comprising the mature form and a latency associated peptide (LAP). The pro-peptide dimerizes and is nicked by furin-like proteases but remains self-associated . Secretion is promoted after conjugation of a latent TGF& binding protein (LTBP) to the LAP forming a large latent complex (LLC) which associates with the extracellular matrix. In vitro, mature TGF& can be released from the LLC by heating or acidification but in vivo release requires cell-surface furin proteases as well as extracellular matrix proteins such as TSP1 (THBS1) and integrins that induce conformational changes in the complex to promote dissociation of mature ligand. The mechanisms of activation and also possibly the type of intracellular signaling may depend on the

complex bound to the cell surface. By maintaining a source of latent TGF close to its site of action, cells can initiate rapid signaling without the need for new protein synthesis. Once activated, IGFfi binds a membrane-bound serine/threonine receptor complex (T RI/TpRII) which phosphorylates various substrates. These include transcription factors SMAD 2/3 which accumulate in nuclear complexes with co-activators and co-repressors, or molecules from numerous non- SMAD pathways. The cellular response to TGF is thus a balanced activation of SMAD and/or non-SMAD signaling pathways determined by cellular "context" as well as signaling thresholds and signaling duration. The term TGFft encompasses all three TGF& isoforms, TGFft mRNA, latent, un-nicked TGFft protein, nicked TGFi protein, TGFfJ-linked to its binding proteins, mature TGF& cytokine, TGFB signaling, etc. In summary, TGFft is widely acknowledged to involve an extremely complex and

heterogeneous biology much of which is poorly understood.

TGF > signaling is antiproliferative or pro-proliferative depending on the cell type: JGF& signaling causes growth inhibition of normal epithelial cells. In vivo TGFIJ is secreted by tumor cells as well as by non-tumor cells. TGFft signaling is cancer-protective as well as cancer-promoting depending on the cell type (Derynck et al., 1987; Teicher, 2007).

Resistance to growth inhibitory (cancer protective) TGF signaling is an important and common event in tumorigenesis (Pardali and Moustakas, 2007). Some tumor cells acquire somatic changes in TGFQ> signaling components (e.g. SMADs or TGF&

receptors) including for example frameshifts which may lead to truncated proteins, or missense mutations which may cause inactivation of a receptor kinase domain.

Inactivation of GFf signaling components may also occur at the epigenetic level through decreased expression of TGFQ> signaling components. Other tumor cells become resistant to the (cancer protective) antiproliferative response pathway while maintaining the ability to signal and initiate other pathway responses. Here, TGF^ becomes an oncogenic (cancer promoting) factor inducing proliferation, angiogenesis and metastasis.

Inhibitory RNA specific for TGF¾1 mRNA (either JGFM RNAi or antisense RNA) has been reported to kill some transfected cancer cell types. For example, WO 2004/005552 A1 teaches antisense modulation of ΤΰΡ 2 expression and WO 2007/109097A1 teaches the reduction of TGFIJ mRNA by administration of antisense iRNA. For example, Ran et al. (2006) showed that expression of TGF i was blocked by TGFB1 RNAi transfection in non-HPV infected colon carcinoma cells leading to cell growth arrest. Colon cancer cells are very often mutated in the receptor for TGF& TftRII (Yashiro et al, 2010) and therefore all TGF signaling pathways would be shut off. Jachimczak et al. (1 996) showed that antisense inhibition of TGFR1 inhibited cell growth of gliomas. On the other hand, it has been documented that TGFB1 mRNA targeting (by antisense RNA) induces some cancer cells to grow faster. Moore et al. (2008) showed that inhibition of TGF i expression in breast cancer MDA-MB-435 cells decreased migration and invasion in vitro, but increased cancer cell proliferation. Also, Wu et al. (1993) showed that repression of TGFM in CBS colon carcinoma cells leads to progression of tumorigenic properties. Also, Massague (2008), in reviewing the huge literature on the roles of JGFfl in cancer, has suggested that drugs which inhibit TGFB signaling may enhance the progression of pre-malignant lesions. Contradictory studies which demonstrate opposite effects in cells mediated by the TGFft cytokine are in abundance in the literature. This is because the signaling output of the TGFft response is highly contextual in development, in different tissues and cells and also in cancer. In view of the complex biology of TGFft and the abundance of inconsistent and often even contradictory reports on its effects in cancer and non-cancer cells, it is accepted in the field that one cannot rationally predict the effects of TGFR1 targeting by drugs for cancer treatment. One cancer cell-specific ΤΰΡβΙ -targeted approach cannot be generalized nor predictably transferred to other cancer cell types.

Cervical cancer is a major cause of cancer-related deaths in women of reproductive age in the developed world. Members of the human papilloma virus (HPV) family represent important carcinogens (Zur Hausen, 2009). Either HPV 16 or HPV18 are found in most cervical cancers suggesting that they are an etiological cause of the cancers (Bouallaga et al., 2000). In addition to cervical cancers, HPV may cause some anogenital cancers such as vulvar squamous cell carcinomas, penile carcinomas, anal and perianal cancers. They are also linked to oral squamous cell carcinomas and oropharyngeal cancers.

Finally, some squamous cell carcinomas of the skin are caused by or progressed by HPV infections. HPV vaccines are effective preventives for cervical cancer, however, it will take many years before such vaccines have achieved a broad protection of the population and therefore effective treatments for such cancers are still required.

HPV viral proteins include oncogenes E6 and E7. E7 inhibits Rb activity thereby removing a cellular checkpoint and leading to uncontrolled cell growth. E6 interacts with P53 tumour suppressor and abolishes the apoptotic response to this stress. In addition to these mechanisms, E6 and E7 modulate transcription of cellular genes. Specifically, E6 has been reported to stimulate the promotor activity of TGF 1 leading to increased production of latent TGF¾1 in HPV-positive versus HPV-negative cervical cancer cell lines (Peralta-Zaragoza et al., 2006).

A number of RNAi-based therapies for the treatment of HPV-associated cervical cancer have been proposed (e.g. reviewed in Chen et al., 2007). The RNAi mechanism was recently shown for the first time to be operable in man with an account of cancer patients being treated with an siRNA targeting the M2 subunit of ribonucleotide reductase:

analysis of biopsy material showed a cleavage of the target mRNA at the expected position (Davis et al., 2010). HPV oncogenes E6 and E7 represent prime targets for an mRNA targeting strategy for treatment of cervical cancer. Targeting viral mRNAs however is prone to viral resistance mechanisms. Indeed, resistance to E7-specific RNAi in several HPV-infected cervical carcinoma cell lines has been previously reported (see refs in Chen et al., 2007).

It is the objective of the present invention to provide means for predictably treating and/or preventing cancer.

The objective has been solved by the provision of JGFM (transforming growth factor β1 ) mRNA-specific inhibitory RNA (iRNA) for preparing a medicament for treating and/or preventing cancer, characterized in that at least some of the cancer cells (i) express high levels of latent TGFB1 , (ii) have a functional TGF pathway and (iii) secrete active TSP1.

It was surprisingly found that cells expressing high levels of latent JGF(l , but which do not have an antiproliferative (cancer protective) response to mature TGFIil , are responsive to TGFB1 -specific iRNA. These cells do not only undergo apoptosis themselves - as demonstrated below by the detection of an increase in caspase 3/7 activity of the treated cancer cells - but also induce apoptosis in cells located adjacent to said responsive cells, even when these adjacent cells are left untransfected by TGFR1- specific iRNA.

It is well-known in the art that human cells, including cancer cells, in vitro and in vivo take up mRNA-targeting oligonucleotide reagents such as iRNAs with rather poor efficiency. Indeed, efficient delivery of iRNAs to cancer cells into a tumor mass can be problematic.

Therefore, the present invention also provides a solution to the iRNA efficiency problem because it allows for the killing of cancer cells that cannot be killed directly due to inefficient transfection by ΤΰΡβΙ -specific iRNA but are still killed because of their location adjacent to responsive cells.

The term "cancer cells located adjacent to responsive cells" in the above context indicates cells in the vicinity of transfected responsive cells which can be physically contacted by proteins secreted by the transfected responsive cells. Preferably, it is meant to indicate a distance of unresponsive cells to responsive cells of about 0.1 to 10 mm, more preferably 0.2 to 5 mm. On the other hand, it is preferred that the apoptotic action of responsive cells is eventually spread to all cancer cells in direct or indirect contact with the responsive cancer cells.

The term "at least some of the cancer cells" as used in the description and claims indicates that it is sufficient for therapeutic efficacy that only some of the treated cancer cells are responsive because the apoptotic response is transferred, i.e. spread to unresponsive and/or iRNA-untransfected adjacent cells. It is preferred that at least about 1 , 2, 5, 10, 20 or 50 % of the treated cancer cells are responsive. Most preferred all treated cancer cells are responsive.

The term "responsive cells", as used herein is meant to indicate that all three of the above conditions (i) to (iii) are met to the extent that responsive cells become apoptotic.

The term "cancer cells that express high levels of latent TGFB1" as used herein describes cancer cells which secrete more latent ΤΰΡβΙ than mature TGFM , as preferably determined by an ELISA assay, for example the ELISA assay described in Example 4, the results of which are illustrated for glioblastoma cells in Fig 3D.

Hence, the skilled person can routinely measure latent TGFftl and mature TGF 1 and compare the amounts relative to each other. In other words, the term "cancer cells that express high levels of latent ΤΰΡβΙ " is preferably interpreted as ""cancer cells that express higher levels of latent ΤβΡβΙ compared to the levels of mature TGF l ".

The term "latent Τ6Ρβ1 " as used herein is defined as ΤΰΡβΙ cytokine in a form bound covalently or non-covalently to the latency associated peptide (LAP) (e.g. see Annes et al., 2003). The LAP part of latent TGFM physically inhibits the mature part of TGFM from binding to its cognate receptors and triggering a signal transduction cascade.

The term "functional JGF > pathway" relates to the TGFfl signal transduction pathway in which treatment of cells with recombinant mature TGFB (1 , 2 and/or 3) leads to phosphorylation of SMADs and subsequent transcription of genes bearing SMAD response elements (SBE) in their promotors. There are numerous examples of such SMAD-mediated response genes (see Table 1 in Verrechia et al. (2001a). Thus the feature can be verified, for example, by assaying mRNA levels of genes such as plasminogen activator inhibitor-1 , beta-catenin hTcf-4, and fibronectin using quantitative RT-PCR after treatment of cells with mature recombinant ΤΰΡ Ι . Most preferably, a standard luciferase reporter construct containing SMAD binding elements as described in Verrecchia et al. (2001 b) is used.

The term "secretion of active TSP1 " means the expression and secretion of a fully functional TSP1 protein capable of detectably processing latent ΤΰΡβΙ into mature

ΤΰΡβΙ (see e.g. Schultz-Cherry et al. (1994)). TSP1 is one of a small number of proteins that have been reported to process latent TGFbl to its mature form. In this regard the assessment of high levels of latent JGF^ and the identification of mature TGFB1 is possibly indicative of TSP1 activity, if presence of TSP1 can be verified, e.g. by ELISA. Alternatively, the processing of latent ΤΘΡ Ι to mature TGFftl in vitro or in cells in vivo can be assayed to verify TSP1 activity and secretion. This can be done as described, for example, in Schultz-Cherry et al. (1994).

In a preferred embodiment the cancer cells to be treated by administration of TGF 1 mRNA-specific iRNA according to the invention are selected from the group consisting of glioblastoma and HPV-infected cancer cells, more preferably HPV-infected anogenital cancers cells, vulvar squamous cell carcinoma cells, penile carcinoma cells, anal and perianal cancer cells, oral squamous cell carcinoma cells and oropharyngeal cancers, most preferably HPV-infected cancer cervical cells. Preferably the HPV-infected cancer cells are HPV16- or HPV18-infected .

The efficacy of TGFB1 mRNA-specific iRNA for use in the present invention is shown for exemplary HPV-infected cervical Hela, Siha and Caski cells below in the examples and in Figs. 1A and 1 D. It was also demonstrated that ΤΰΡβΙ iRNA responsive cells that were transferred to non-transfected recipient cancer cells will impart apoptosis on the recipient cells (Fig. 2B). Hence, it is the responsive cells by way of their secreted apoptotic factor in the supernatant that kills cells located adjacent to responsive cells. Therefore, the present invention also allows for killing untransfected cancer cells by mechanically placing transfected responsive cells in the vicinity of untransfected cancer cells. It follows that the present invention also relates to a method of killing cancer cells by implanting transfected responsive cancer cells into the direct vicinity of untransfected cancer cells. The risk of new cancer cells is low because the transfected responsive cells will undergo apoptosis within reasonable time and impart apoptosis among its neighbouring cells while doing so.

The TGFi 'l mRNA-specific iRNA for practicing the present invention is any type of iRNA that disrupts TGF 1 mRNA expression to an extent that leads to apoptosis in the iRNA responsive cell. The term includes unmodified RNA, modified RNA, RNA mimetics or nucleoside surrogates, e.g. RNA having a 2^'sugar modification, a modification in a single strand overhang such as a 3^'single strand overhang, or particularly if single stranded, a 5 ^'modification which includes one or more phosphate groups or one or more analogs of a phosphate group. Preferred specific embodiments of modifications to the iRNA for practicing the present invention are described in WO 2004/005552 A1 on page 21 , last para to p. 29 as well as in WO 2007/109097 A2 on 36 to 49, the specific disclosure of which is incorporated herein by reference. Particularly preferred embodiments include TGFB1 mRNA-specific iRNA containing modified backbones or non-natural internu- cleoside linkages, mimetics featuring both modified sugar and internucleoside linkages, iRNA with one or more substituted sugar moieties, iRNA with modified or substituted bases, Locked Nucleic Acids (LNAs), iRNA conjugates, chimeric iRNA, i.e. composite structures of two or more iRNA types as described above, etc. Preferably the iRNA is one having greater resistance to nuclease degradation. Preferably the iRNA is double stranded. Both, sense and antisense strand can be interconnected by hybridisation and/or covalently, e.g. by a linker such as polyethylene glycol (PEG).

In mammalian cells, long iRNA cells can induce the interferon response. Preferred iRNA of the invention silence expression of ΤΘΡβΙ to induce apoptosis and are short enough not to trigger the interferon response. These are termed siRNA (small interfering RNA). Preferably the siRNA is a double stranded iRNA, preferably an siRNA having a duplex region, preferably of less than 60, more preferably less than 50, 40 or 30 nucleotide pairs, also more preferably 12 to 30, 15 to 25 or 17 to 23 nucleotide pairs, most preferred 19 to 21 nucleotide pairs. In a preferred embodiment the TGFR1 iRNA for practicing the invention comprises at least one siRNA.

The degree of inhibition due to administration of TGF 1 iRNA, preferably in the form of double stranded siRNA, for practicing the invention is preferably at least about 20, 25, 35 or 50, more preferably 60, 70 or 80, most preferably 85, 90 to 95 %.

In a preferred embodiment the at least one TGFB1 mRNA-specific iRNA for practicing the present invention, preferably double stranded iRNA, preferably siRNA, more preferably double-stranded siRNA

(i) has the nucleic acid sequence of any of SEQ ID NOs: 1 to 4,

(ii) has a nucleic acid sequence having at least 80, preferably 90, more preferably 95 % nucleic acid sequence identity to the nucleic acid sequence of any of SEQ ID NOs: 1 to 4,

(iii) has a nucleic acid sequence having at least 80, preferably 90, more preferably 95 % nucleic acid sequence identity to at least 12 to 30, preferably 15 to 20, more preferably 17 to 23, most preferably 19 to 21 consecutive nucleotides of the nucleic acid sequence of SEQ ID NO: 5 and/or

(iv) hybridizes to an RNA having the nucleic acid sequence of any one of SEQ ID NOs:

1 to 5, preferably of any one of SEQ ID NOs: 1 to 4, preferably under stringent conditions, and wherein said iRNA inhibits expression of TGF¾1.

The most preferred είΤΰΡβΙ mRNA-specific iRNAs include siTGF&1(1 ) CCAACUAUUGCUUCAGCUC (SEQ ID NO: 1 , nucleotides 1712 - 1730 in

SEQ ID NO: 5), siTGF (2) CGUGGAGCUGUACCAGAAA (SEQ ID NO: 2, nucleotides 1368-1386 in

SEQ ID NO: 5), siTGFB1(3) GGUGGAAACCCACAACGAA (SEQ ID NO: 3, nucleotides 1206 -1224 in

SEQ ID NO: 5), siTGFBI (4) GCCGAGCCCUGGACACCAA(SEQ ID NO: 4, nucleotides 1697 to 1715 in

SEQ ID NO: 5) and are preferably double stranded.

SEQ ID NO: 5 (nucleotide sequence of human TGFB1 mRNA) is shown below. ccttcgcgcc ctgggccatc tccctcccac ctccctccgc ggagcagcca gacagcgagg 61 gccccggccg ggggcagggg ggacgccccg tccggggcac ccccccggct ctgagccgcc 121 cgcggggccg gcctcggccc ggagcggagg aaggagtcgc cgaggagcag cctgaggccc 181 cagagtctga gacgagccgc cgccgccccc gccactgcgg ggaggagggg gaggaggagc 241 gggaggaggg acgagctggt cgggagaaga ggaaaaaaac ttttgagact tttccgttgc

301 cgctgggagc cggaggcgcg gggacctctt ggcgcgacgc tgccccgcga ggaggcagga 361 cttggggacc ccagaccgcc tccctttgcc gccggggacg cttgctccct ccctgccccc

421 tacacggcgt ccctcaggcg cccccattcc ggaccagccc tcgggagtcg ccgacccggc

481 ctcccgcaaa gacttttccc cagacctcgg gcgcaccccc tgcacgccgc cttcatcccc

541 ggcctgtctc ctgagccccc gcgcatccta gaccctttct cctccaggag acggatctct

601 ctccgacctg ccacagatcc cctattcaag accacccacc ttctggtacc agatcgcgcc

661 catctaggtt atttccgtgg gatactgaga cacccccggt ccaagcctcc cctccaccac

721 tgcgcccttc tccctgagga cctcagcttt ccctcgaggc cctcctacct tttgccggga

781 gacccccagc ccctgcaggg gcggggcctc cccaccacac cagccctgtt cgcgctctcg

841 gcagtgccgg ggggcgccgc ctcccccatg ccgccctccg ggctgcggct gctgccgctg

901 ctgctaccgc tgctgtggct actggtgctg acgcctggcc ggccggccgc gggactatcc

961 acctgcaaga ctatcgacat ggagctggtg aagcggaagc gcatcgaggc catccgcggc

1021 cagatcctgt ccaagctgcg gctcgccagc cccccgagcc agggggaggt gccgcccggc 1081 ccgctgcccg aggccgtgct cgccctgtac aacagcaccc gcgaccgggt ggccggggag 1141 agtgcagaac cggagcccga gcctgaggcc gactactacg ccaaggaggt cacccgcgtg 1201 ctaatggtgg aaacccacaa cgaaatctat gacaagttca agcagagtac acacagcata 1261 tatatgttct tcaacacatc agagctccga gaagcggtac ctgaacccgt gttgctctcc 1321 cgggcagagc tgcgtctgct gaggctcaag ttaaaagtgg agcagcacgt ggagctgtac

1381 cagaaataca gcaacaattc ctggcgatac ctcagcaacc ggctgctggc acccagcgac

1441 tcgccagagt ggttatcttt tgatgtcacc ggagttgtgc ggcagtggtt gagccgtgga

1501 ggggaaattg agggctttcg ccttagcgcc cactgctcct gtgacagcag ggataacaca

1561 ctgcaagtgg acatcaacgg gttcactacc ggccgccgag gtgacctggc caccattcat

1621 ggcatgaacc ggcctttcct gcttctcatg gccaccccgc tggagagggc ccagcatctg

1681 caaagctccc ggcaccgccg agccctggac accaactatt gcttcagctc cacggagaag

1741 aactgctgcg tgcggcagct gtacattgac ttccgcaagg acctcggctg gaagtggatc

1801 cacgagccca agggctacca tgccaacttc tgcctcgggc cctgccccta catttggagc

1861 ctggacacgc agtacagcaa ggtcctggcc ctgtacaacc agcataaccc gggcgcctcg

1921 gcggcgccgt gctgcgtgcc gcaggcgctg gagccgctgc ccatcgtgta ctacgtgggc

1981 cgcaagccca aggtggagca gctgtccaac atgatcgtgc gctcctgcaa gtgcagctga

2041 ggtcccgccc cgccccgccc cgccccggca ggcccggccc caccccgccc cgcccccgct 2101 gccttgccca tgggggctgt atttaaggac acccgtgccc caagcccacc tggggcccca

2161 ttaaagatgg agagaggact gcggatctct gtgtcattgg gcgcctgcct ggggtctcca

2221 tccctgacgt tcccccactc ccactccctc tctctccctc tctgcctcct cctgcctgtc

2281 tgcactattc ctttgcccgg catcaaggca caggggacca gtggggaaca ctactgtagt

2341 tagatc

In a preferred embodiment iRNA, preferably double stranded iRNA, more preferably siRNA, most preferably double stranded siRNA suitable for practicing the present invention is defined by its ability to hybridize to the nucleic acid sequence of SEQ ID NO: 5, preferably under physiological conditions.

Next to common and/or standard protocols in the prior art for determining the ability to hybridize to a specifically referenced nucleic acid sequence under stringent conditions (e.g. Sambrook and Russell, Molecular cloning: A laboratory manual (3 volumes), 2001), it is preferred to analyze and determine the ability to hybridize to a specifically referenced nucleic acid sequence under stringent conditions by comparing the nucleotide sequences, which may be found in gene databases (e.g. http://www.ensembl.org/index.html) with alignment tools, such as e.g. the above-mentioned BLASTN (Altschul et al., J. Mol. Biol., 215, 403-410,1990) and LALIGN alignment tools.

Most preferably the ability of a nucleic acid for practicing the present invention to hybridize to a nucleic acid featuring any of SEQ ID NOs: 1 to 5 is confirmed in a Southern blot assay under the following conditions: 6x sodium chloride/sodium citrate (SSC) at 45°C followed by a wash in 0.2x SSC, 0.1% SDS at 65°C.

In a further preferred embodiment iRNA, preferably siRNA for practicing the invention is defined by % sequence identity to any one of SEQ ID NOs: 1 to 5. The term "% (percent) identity" as known to the skilled artisan and used herein indicates the degree of related- ness among two or more nucleic acid molecules that is determined by agreement among the sequences. The percentage of "identity" is the result of the percentage of identical regions in two or more sequences while taking into consideration the gaps and other sequence peculiarities. The identity of related nucleic acid molecules can be determined with the assistance of known methods. In general, special computer programs are employed that use algorithms adapted to accommodate the specific needs of this task. Preferred methods for determining identity begin with the generation of the largest degree of identity among the sequences to be compared. Preferred computer programs for determining the identity among two nucleic acid sequences comprise, but are not limited to, BLASTN (Altschul et al., J. Mol. Biol., 215, 403-410,1990) and LALIGN (Huang and Miller, Adv. Appl. Math., 12, 337-357, 1991 ). The BLAST programs can be obtained from the National Center for Biotechnology Information (NCBI) and from other sources (BLAST handbook, Altschul et al., NCB NLM NIH Bethesda, MD 20894).

Further preferred ΤΰΡ Ι mRNA-specific iRNAs for use in the present invention are selected from the group of iRNAs described in detail in WO 2007/109097 A2, more preferably those designated AL-DP-6837 to AL-DP-6864, AL-DP-6140 to AL-DP-6151 , AL-DP-6262-6277 and AD-14419 to AD-14638 in WO 2007/109097 A2 on pages 7-9, 76-84.

The nucleic acid molecules for practicing the invention may be prepared synthetically by methods well-known to the skilled person, e.g. by solid phase synthesis. Equipment for such synthesis is available, e.g. from BioAutomation, Piano, Texas, USA Also, said iRNA may be isolated from suitable imRNA and DNA libraries and other publicly available sources of nucleic acids and subsequently may optionally be mutated or otherwise modified. The preparation of such libraries or mutations/modifications is well-known to the person skilled in the art.

The nucleic acids for practicing the present invention are preferably modified to have enhanced resistance to degradation, for example, the sense or antisense strands of the iRNA can include 2 '-modified ribose units and/or phophorothioate linkages or the 2 - hydroxyl group can be modified or replaced with a number of "oxy" or deoxy" substi- tutents (see also above for further details on modifications). Preferred resistance- enhancing modifications of iRNA for practicing the invention are taught in Morrissey et al (2005) on page on page 1352 and on pages 36 to 41 of WO 2007/109097, which are included herein by specific reference. It is also preferred that the iRNA for practicing the present invention comprises backbone modifications, i.e. containing modified backbones or non-natural internucleoside linkages. These backbone modifications include iRNA retaining a phosphorous atom in the backbone as well as those that do not. It is not necessary for all positions in a given iRNA compound to be uniformly modified. More than one modification may be incorporated in a single nucleotide of the iRNA. Preferred backbone modifications are detailed on pages 48 to 50 of WO 2007/109097 A2, the disclosure of which is incorporated herein by specific reference.

In a further preferred embodiment the iRNA for use in the present invention is a ligand conjugate, wherein the ligand modifies the pharmacological properties of the iRNA, for example facilitates uptake by cells, e.g. is a cell permeating agent, targets specific cancer cells, modifies distribution in the target tissue, modifies immune recognition, reduces degradation, improves transport, hybridization or specificity or provides for a further pharmaceutical effect, i.e. is a pharmaceutical active agent of its own. More preferably, the iRNA includes tethered ligands. Preferred tethered IRNA ligands are detailed on pages 44 to 47 of WO 2007/109097 A2, the disclosure of which is

incorporated herein by specific reference.

The iRNA for use in the present invention can be administered to a patient either as naked iRNA agent, in conjunction with a delivery agent, as a recombinant plasmid or viral vector or a cell which expresses the viral iRNA agent. Preferably the iRNA is administered as naked iRNA. Preferred embodiments for formulation as naked iRNA are described below in the context of pharmaceutical compositions.

In a preferred embodiment the iRNA for use in the present invention is comprised in a vector, preferably an attenuated virus, preferably a virus selected from the group consisting of adenovirus, retrovirus, adeno-associated virus, non-integrating adeno- associated virus, 3^rd generation self-inactivating HIV (Human Immundeficiency Virus) alphavirus, HSV (Herpes Simplex Virus) and HPV (Human Papilloma Virus) (see

Heilbronn and Weger, 2010; Couto and High, 2010). In a further aspect the invention relates to a vector comprising TGFB1 mRNA-specific iRNA for treating and/or preventing cancer according to the invention.

The iRNA for use in the present invention can be expressed by vectors, i.e. transcription units (see for example Couture et al. Trends in Genetics, 12:510, 1996). Preferred vectors are plasmids and viruses, preferably attenuated viruses. iRNA expressing viral vectors can be constructed based on, but not limited to adenovirus, retrovirus, adeno- associated virus, non-integrating adeno-associated virus, 3^rd generation self-inactivating HIV, alphavirus, HSV and HPV. For details and citations in this respect, reference is made to p. 57, st para of WO 2007/109097 A2, the disclosure of which is included herein by specific reference.

Naturally, for medical use most of these vectors need to be attenuated in order not to harm the patient. HPV and HSV can provide for target specificity, for example, HSV regularly targets neuronal cells and HPV targets epithelial cells, in particular cervical cells, anogenital cells, vulvar squamous cells, penile cells, anal and perianal cells, oral squamous cells and oropharyngeal cells. Furthermore, HPV infection of cells can lead to expression of high levels of latent TGF 1 , however, in the present case the TGFIil mRNA-specific iRNA will induce apoptosis in the infected cells. Thus, HPV-infected and ΤϋΡ Ι mRNA-specific iRNA producing cells are likely to undergo apoptosis and can spread the apoptotic message to cells located adjacently. Consequently, administration of vectors comprising TGFftl mRNA-specific iRNA or cells comprising said vectors is a suitable way of killing cancer cells. For example, said vectors can be administered, e.g. injected directly into a tumor, and infect at least some cancer cells and kill the infected as well as the neighbouring cancer cells. Alternatively, cells comprising TGF 1 mRNA- specific iRNA, either directly or indirectly by comprising said vector, can be administered, e.g. injected directly into a tumor. These cells can spread the vector to kill neighboring cancer cells or they can die by apoptosis and kill the neighboring cells by spreading the apoptotic message.

In a further aspect the present invention is directed to a cell comprising TGFB1 mRNA- specific iRNA and/or a vector comprising said iRNA for treating and/or preventing cancer according to the invention.

For example, iRNA for practicing the present invention can be expressed within cells from eukaryotic promoters. As commonly known in the field of genetic engineering, any nucleic acid can be expressed in eukaryotic cells from the appropriate DNA/RNA vector. For details and citations teaching iRNA expression from eukaryotic promoters reference is made to p. 56, 2^nd para of WO 2007/109097 A2, the disclosure of which is included herein by specific reference.

The above iRNA, corresponding vectors and cells are preferably formulated to give a pharmaceutical formulation. Therefore, another aspect of the present invention is directed to a pharmaceutical composition comprising a TGFB1 mRNA-specific iRNA and/or a vector and/or a cell according to the invention for treating and/or preventing cancer.

The compounds and pharmaceutical compositions for use in the invention are preferably for the therapeutic and/or prophylactic treatment of mammals, more preferably cattle, sheep, non-human primates and humans, most preferably for the therapeutic and/or prophylactic treatment of humans.

Pharmaceutical compositions for use in the invention may be manufactured in any conventional manner. In effecting cancer treatment at least one TGFftl mRNA-specific iRNA, either naked, modified, unmodified, comprised in a vector and/or a cell for use in the present invention can be administered in any form or mode which makes the therapeutic TGF 1 mRNA-specific iRNA bioavailable in an effective amount, including oral or parenteral routes. For example, compositions of the present invention can be administered topically (including ophthalmic and mucous membranes including vaginal and rectal delivery), pulmonary, e.g. by inhalation or insufflation or powders or aerosols including by nebulizer, intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion, or intracranial, e.g. intrathecal or intraventricular injection or infusion. iRNA with at least one 2^'-0-methoxyethyl modify- cation is believed to be particularly useful for oral administration. One skilled in the art in the field of preparing pharmaceutical formulations can readily select the proper form and mode of administration depending upon the particular characteristics of the product selected, the type, stage, location and other relevant circumstances of the cancer to be treated (see. e.g. Remington^'s Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, USA (1990) and The Science and Parctice of Pharmacy, 2003, Gennero et al.). It is preferred that the TGFIJ1 mRNA-specific iRNA, corresponding vectors or cells are administered directly to the cancer cells to be treated, e.g. applied to the surface and/or injected into the cancer tissue. A suitable carrier or excipient may be a solid or liquid material which can serve as a vehicle or medium for the active ingredient. Suitable carriers and excipients are well known in the art and include, for example, stabilizers, antioxidants, pH-regulating substances, controlled-release excipients, chelators, surfactants, a penetration enhancer, emulsifiers, osmolality regulating agents, carriers, drug enhancers, liposomes, etc. A composition according to the invention is preferably provided in lyophilized form. For immediate administration it is dissolved in a suitable aqueous carrier, for example sterile water for injection or sterile buffered physiological saline. It is noted that TGFIi-specific iRNAs belong to the state of the art and that the person skilled in the art of therapeutic uses of iRNA is well aware how to formulate TGFR-specific iRNAs. Specific and detailed information for the pharmaceutical formulation of TGFft-specific iRNAs is provided, for example, in WO 2004/005552 A1 on pages 30 to 55 and in WO 2007/109097 A2 on pages 52 to 56, which are incorporated herein by specific reference. It is particularly preferred that the formulation of iRNA for use in the present invention features a delivery vehicle, e.g. a liposome, a microparticle, an emulsion, in particular a microemulsion, in particular a nanoparticle.

In a further aspect the present invention is directed to a method of treating and/or preventing cancer characterized in that at least some of the cancer cells (i) express high levels of latent ΤΟΡ Ι , (ii) have a functional TGF pathway and (iii) secrete active TSP1 , comprising the step of administering a mammal, preferably a human in need of such treatment a pharmaceutically effective amount of TGFftl mRNA-specific iRNA. The term "treating and/or preventing cancer" as used herein relates to the prophylactic and/or therapeutic treatment of cancer.

The amount and mode of administration of the iRNA for use in the invention, i.e. naked iRNA, modified iRNA, iRNA vectors, iRNA cells, etc. for treating and/or preventing a cancer, preferably a cancer mentioned above, more preferably cervical cancer, most preferably HPV-related cervical cancer will, of course, vary depending upon the particular iRNA type, its formulation, the individual patient group or patient, the presence of further medically active compounds and the nature, in particular responsiveness, location and severity of the cancer to be treated. Treatment can last from several days to several months. In general, dosage is from 0.01 pg to 100 mg, more preferably from 0,01 to 10 mg, most preferably from 0,01 to 5 mg per kg body weight and may be given once or more daily, weekly or monthly. It is preferred to administer the iRNA directly to the cancer cells, e.g. by direct contact to the surface of the cancer and/or by injection into the cancer. In a preferred embodiment the method is practiced on cancer cells selected from the group consisting of glioblastoma and HPV-infected cancer cells, more preferably HPV- infected anogenital cancers cells, vulvar squamous cell carcinoma cells, penile carcinoma cells, anal and perianal cancer cells, oral squamous cell carcinoma cells and oropharyngeal cancers, most preferably HPV-infected cancer cervical cells.

In a further preferred embodiment the method of treatment is one, wherein the ΤΘΡ Ι mRNA-specific iRNA used for administration is a TGFil' mRNA-specific iRNA and/or a vector and/or a cell for use according to the invention as described above and in the claims.

The invention is further described by way of illustration in the following examples, none of which are to be interpreted as limiting the scope of the invention as outlined in the appended claims.

Figures

Fig. 1 TGFB1 activity in HPV-infected cervical cancer cells.

A: TGF31 mRNA after transfection with siRNAs targeting TGF (siTGFb1 (1 ) and siTGFb1 (2) and an unrelated control siRNA (siCon). Total RNA was isolated 48h post-transfection. Relative expression of TGFpi mRNA is displayed (mean of PCR triplicates; single RNA samples ±SD).

B: Cell-associated latent un-nicked TGFpi after siRNA treatment. Proteins from cells 24h post-transfection were analyzed using a pan anti-TGF antibody and were quantified by densitometry.

C: Caspase 3/7 activity was measured 48h and 72h post-transfection (mean of

triplicate transfections ±SD).

D: Caski and Siha cells were treated with increasing doses of siTGF i .

E: HeLa cells were treated with increasing doses of recombinant mature TGFpi .

Fig. 2 Downregulation of latent ΤΰΡβΙ by iRNA in HeLa cells leads to secretion of TSP1 and apoptosis in untransfected cells.

A: Induction of TGFfi processing factors upon TGF 1 RNAi. Cells cultured in media containing 1 % FBS were treated with siTGFpi . Lysates and concentrated supernatants were analyzed by western blotting 24h post-transfection. B: Caspase 3/7 induction in different cell lines by conditioned media of siTGF31- treated Hela cells. Cells were treated with siRNAs for 24h. The conditioned media were transferred to recipient cells and caspase 3/7 activity was measured 72h later (mean of triplicate transfections ±SD). Recipient cervical carcinoma cells illustrated from left to right are HPV-infected, high latent ΤΘΡβΙ -expressing HeLa cells; HPV-infected, high latent TGF&1 -expressing Siha cells; HPV-infected, high latent TGF 1 -expressing Caski cells; and C33A cells.

FIG. 3 Downregulation of latent TGF i by siTGFpi (1 ) in glioblastoma LN-18 cells.

A: Cells grown in 5% FBS media were treated with siRNAs. Caspase 3/7 activity was measured from lysates 72h post-transfection (mean of triplicate transfections ±SD).

B: Cells grown in media containing 1% FBS were treated with siTGF 1. Protein was isolated from lysates after 24h and western blots of latent TGF 1 are displayed.

C: Cells grown in media containing 1% FBS were treated with siTGF i . Protein was isolated from concentrated media after 24h. Western blots of TSP1 from concentrated media are displayed.

D: Supernatants from cells grown in 5% FBS media were collected after 3 days and mature TGF-βΙ measured by ELISA with acidification (left panel) and without acidification (right panel) (mean of triplicate transfections ±SD).

In the following the present invention is illustrated by way of examples, none of which are meant to be interpreted as restricting the scope of the present invention as presented in the appended claims.

Examples

Example 1 - Cell culture and transfections

Hela (ATCC, #CCL-2) and LN-18 (ATCC , #CRL-2610) cells were purchased from LGC (Molsheim, FR). Cells were maintained in Dulbecco's Modified Eagle's medium (Gibco, USA) supplemented with 10% fetal bovine serum (FBS; Sigma, Buchs, CH). SiTGF i targeting human TGF l mRNA (NM_000660) is CCAACUAUUGCUUCAGCUC (1712 - 1730); siTGF 1(s) is CGUGGAGCUGUACCAGAAA (1368 - 1386). SiRNAs were from Dharmacon (Chicago, USA) and contain 2 overhanging dT groups on the 3'-termini of the guide and passenger strands; non-targeting negative control siRNAs were from Ambion (Austin, USA: #AM4640). SiRNAs were transfected using Oligofectamine reagent (#12252-01 1 , Invitrogen: Basel, CH) according to the manufacturer's

instructions. Recombinant human mature TGF i (100/B) and TGF neutralizing antibody (MAB1835; Clone 1 D1 1 ) were from R&D Systems (Minneapolis, USA). Cells were mock-treated or treated with 10 nM mature TGF31 .

Example 2 - RNA real-time RT-PCR

Total RNA was extracted using mirVana™ miRNA Isolation Kit (AM1560; Ambion). For mRNA analysis 1 mg total RNA was reverse transcribed using the M-MLV reverse transcriptase kit (# 28025-013; Invitrogen) according to manufacturer's instructions.

Quantitative analyses of expression levels were performed using Power SYBR® Green PCR Master Mix (#4367659; Applied Biosystems: Austin, USA) using a Lightcycler 480 (Roche). PCR cycling conditions were 95°C for 10 min and 40 cycles of (95°C 15 s; 60°C/1 min). Values were normalized using GAPDH or mean average of all measured mRNAs. Sequences of RT-PCR primers for TGFfi (NM_000660.3) are: JGFM forward primer GCAGGGATAACACACTGCAA; TGFil reverse primer:

GGCCATGAGAAGCAGGAA.

The data are means of triplicate PCR measurements from single RNA samples. The error bars represent ± SD of triplicates.

Example 3 - Immunoblot assay

For western blots, cells were lysed with RIPA lysis buffer (#R 0278; Sigma). Protein concentrations were determined using a BCA assay (Thermo Fisher Scientific #23225), 10-20 gg of protein was mixed with an equal amount of SDS loading buffer (100 mM Tris-HCI, 4% SDS, 20% glycerol, 0.2% bromophenol blue). Samples were heated at 99°C for 5 min and separated on SDS gels followed by transfer to polyvinylidene difluoride membranes. Non-specific binding to the membrane was blocked for 1 h at room temperature with 5% BSA (or milk) in phosphate-buffered saline containing 0.05% Tween 20. The membranes were incubated overnight at 4°C with primary antibodies from Santa Cruz Biotech (TSP1 ). After washing the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies for 1-2 h at room temperature in blocking buffer. Signals generated by the chemiluminescent substrate ECL(+)

(Amersham, Piscataway, USA) were captured by a cooled CCD camera system (BioRad: Reinach, CH). Protein bands were quantified by densitometry using the gel analysis software ImageJ (rsbweb.nih.gov/ij/). Example 4 - ELISA

TGF-βΙ levels in cultured cells were analyzed quantitatively by human TGF-βΙ DuoSet ELISA (DY240; R&D Systems) according to the manufacturer's instructions. Briefly, cells were grown in 96-well plates in 1 % FBS-containing media and were untreated or transfected with siRNAs. Cell supernatants were acidified with 1 N HCI and neutralized with 1 .2 N NaOH/0.5 M HEPES prior to assay for total (sum of latent and active) TGF-βΙ (the acid treatment converts latent TGF to mature TGF).The concentrations of active TGF-βΙ were analyzed on samples that were not acidified. Therefore, performance of the ELISA separately in the presence or absence of acid allows determination of the quantities of mature TGF and latent TGF secreted by cancer cells into the media. The TGF-βΙ in the FBS was 180 pg/ml for the 1 % FCS concentration used in these experiments. The data are means of triplicate transfection samples and the error bars represent ± SD.

Example 5 - Apoptosis assay

Caspase-3/7 activity was measured both in supernatants and lysates of transfected cells using a chemiluminescent substrate (Caspase-Glo 3/7 substrate, #G8090, Promega: Madison, USA). Briefly, cells were grown in 96-well plates, and transfected with described doses of siRNAs. For time course experiments, 5 μΙ of cell supernatants were transferred from the same wells at 24, 48 and 72 h time points to white 384 well plates and mixed with equal volumes of substrate. Chemiluminescence was measured in sealed plates after 30 min at room temperature in a microtiter plate reader. For measurements of caspase 3/7 activity cells were lysed in PBS containing 1 % Triton- X100 and 5ul of lysates were mixed with equal volumes of substrate and otherwise assayed as above. The data are means of triplicate transfection samples and the error bars represent ± SD.

Example 6 - Inhibition of TGF31 synthesis causes apoptosis in cervical carcinoma cells

Like most cervical carcinoma cell lines HeLa express high levels of ΤΰΡβΙ . They respond to exogenously-delivered ΤΰΡβΙ but they do not undergo growth arrest (Figure 1 E). Independent treatment of HeLa cells with two siRNAs specific to the JGF^ sequence (siTGFpi targeting human TGFfil mRNA (NM_000660),

CCAACUAUUGCUUCAGCUC (1712 - 1730); and siTGFpl (s),

CGUGGAGCUGUACCAGAAA (1368 - 1386)) led to a dose-dependent down regulation of TGF^ mRNA by greater than 80% at 15 nM by both siRNAs (Figure 1A). Loss of TGF i mRNA caused a rapid (24h) reduction of intracellular un-nicked latent TGFpi protein which was detected by a pan anti-TGFp antibody (Figure 1 B). Cells undergoing TGF l RNAi showed signs of increasing caspase 3/7 activity on day 2 post-transfection, which increased dramatically on day 3 (Figure 1 C) and was associated with massive cell death. Similar results were obtained after the transfection of siTGF i into Caski and Siha cell lines (Figure 1 D). It was concluded that high levels of latent TGFftl are essential for the survival of the cells and provides a resistance to the cell-killing activity of mature TGFR1. TGF i RNAi causes suppression of latent TGFB1 but also mediates secretion of factors that are capable of processing protective latent JGF to cancer killing mature TGF i and that this was likely the source of apoptosis. In order to determine whether increased secretion of factors contributed to apoptosis during TGFp RNAi, un-treated "indicator" recipient cells were used, as previously described (Solovyan et al., 2006). Supernatants from HeLa cells treated with escalating doses of siTGFpi or siCon were transferred after 24h to four cervical carcinoma cell cultures (HeLa, Caski, Siha, C33-A) and caspase 3/7 activity was assayed after a further 72h (Figure 2B). The transferred supernatants contained no detectable caspase 3/7 activity prior to transfer to indicator cultures. Dose-dependent induction of caspase 3/7 activity was observed in HeLa, Caski and Siha indicator cells. RNA isolated from the Hela indicator culture at 24h post-transfer showed no downregulation of TGFpi mRNA indicating that the apoptosis in these cells likely did not result from RNAi caused by transfer of siTGFpl from the primary

transfection. C33-A is a non-HPV infected cervical carcinoma cell line which does not express T RII. No caspase 3/7 activation was observed after media transfer to C33-A recipient cultures, suggesting that apoptosis in HeLa, Caski and Siha indicator cells and also, presumably, in the primary transfected cells required functional 7BR//.

Example 7 - TGFB1 RNAi uprequlates TSP1 and FURIN

An antibody to TSP1 showed a strong induction on siTGFpl treatment (Figure 2A). In summary, this data demonstrates that TGF i RNAi activates secretion of latent TGF processing factor TSP1.

Example 8 - TGFB1 RNAi activates TGFB processing in LN-18 glioblastoma cells

It was investigated whether TGFpi RNAi activates TGF processing in cell types other than HeLa. TGF plays an important role in malignant glioblastoma. LN-18 cells derived from a malignant glioma carry a non-functional (heterozygous) TP53 gene and express high levels of TGF i . LN-18 cells do not undergo caspase 3/7 induction upon treatment with human recombinant mature TGFpl . LN-18 cells transfected with increasing concentrations of siTGF i yielded a dose-dependent downregulation of latent TGFpi protein (Figure 3B). After 3 days LN-18 cells underwent apoptosis as shown by induction of caspase 3/7 activity (Figure 3A). Isolation of protein from concentrated media enabled probing for the regulation of TSP1 and showed a strong dose-dependent upregulation (Figure 3C). The results in LN-18 cells partially replicate the results from HeLa cells. Inhibition of latent TGF l by RNAi leads to increased TSP1 increased processing of latent TGF 1 and caspase 3/7 induction.

Citations

Annes et al. (2003) J. Cell. Sci. 116, 217-224

Bouallaga et al. (2000) E BO Rep. 15, 1 , 422^27.

Couto & High (2010) Arch. Immunol. Ther. Exp. 58, 107-119.

Chen et al. (2007) Future Virology 2, 587-595.

Couture et al. (1987) Cancer Res. 47, 707-712.

Davis et al. (2010) Nature 464, 1067-1070.

Heilbronn & Weger (2010) Drug Delivery 143-170.

Jachimczak et al. (1996), Int. J. Cancer, 65, 332-337.

J. Massague, (2008) Cell 134, 215-229.

Moore et al. (2008) Clinical Cancer Research 14(15), 4961-4970.

Morrissey et al. Hepatology 2005, 41 , 1349-1356.

Pardali & Moustakas (2007) Biochim. Biophys. Acta 1775, 21-62.

Peralta-Zaragoza (2006) Viral Immunology 19(3), 468-480,.

B. A. Teicher, (2007) Clin. Cancer Res. 13, 6247-6251.

Ran et al. (2006), Zhonghua Xiaohua Zazhi 26, 167-170.

Schultz-Cherry et al. (1994) J. Biol. Chem. 269, 26775-26782.

Solovyan & Keski-Oja (2006) J. Cell. Physiol. 207, 445-453.

Verrecchia et al. (2001a) J. Cell Biol. 20, 17058-17062.

Verrecchia et al. (2001b) Oncogene 20, 2205 - 2211.

Wu et al. (1993) Cell Growth Differ 4: 115-123.

Yashiro et al. (2010) BMC Cancer 10:303: doi: 10.1 86/1471 -2407-10-303.

H. Zur Hausen (2009) Virology 384, 260-265.

Claims

1. TGFB1 (transforming growth factor 1 ) mRNA-specific inhibitory RNA (iRNA) for treating and/or preventing cancer, characterized in that at least some of the cancer cells (i) express high levels of latent TGFR1 , (ii) have a functional TGFft pathway and (iii) secrete active TSP1 .

2. ΤΘΡβ1 mRNA-specific iRNA according to claim 1 , wherein the cancer cells are selected from the group consisting of glioblastoma and HPV-infected cancer cells, more preferably HPV-infected cervical cancer cells, anogenital cancers cells, vulvar squamous cell carcinoma cells, penile carcinoma cells, anal and perianal cancer cells, oral squamous cell carcinoma cells and oropharyngeal cancers, most preferably HPV-infected cancer cervical cells.

3. ΤϋΡβΙ mRNA-specific iRNA according to any of claims 1 or 2, wherein the iRNA comprises at least one small interfering RNA (siRNA).

4. TGFB1 mRNA-specific iRNA according to any one of claims 1 to 3, wherein the at least one iRNA, preferably siRNA, more preferably double-stranded siRNA

(i) has the nucleic acid sequence of any of SEQ ID NOs: 1 to 4,

(iv) hybridizes to an RNA having the nucleic acid sequence of any one of SEQ ID NOs: 1 to 5, preferably of any one of SEQ ID NOs: 1 to 4, preferably under stringent conditions,

and wherein said iRNA inhibits expression of TGFB1.

5. ΤΰΡβΙ mRNA-specific iRNA according to one of claims 1 to 4, wherein the iRNA is comprised in a vector, preferably an attenuated virus, preferably a virus selected from the group consisting of adenovirus, retrovirus, adeno-associated virus, alphavirus, HSV (Herpes Simplex Virus) and HPV (Human Papilloma Virus).

6. Vector comprising ΤΘΡβΙ mRNA-specific iRNA for treating and/or preventing

cancer according to any one of claims 1 to 5.

7. Cell comprising ΤΘΡβΙ mRNA-specific iRNA and/or a vector according to claim 6 for treating and/or preventing cancer according to any one of claims 1 to 5.

8. Pharmaceutical composition comprising a TGFB1 mRNA-specific iRNA according to any one of claims 1 to 5 and/or a vector according to claim 6 and/or a cell according to claim 7.

9. Method of treating and/or preventing cancer characterized in that at least some of the cancer cells (i) express high levels of latent TGFftl , (ii) have a functional TGFB pathway and (iii) secrete active TSP1 , comprising the step of administering to a mammal, preferably a human in need of such treatment a pharmaceutically effective amount of TGF&1 mRNA-specific iRNA.

10. Method according to claim 9, wherein the cancer cells are selected from the group consisting of glioblastoma and HPV-infected cancer cells, preferably HPV-infected cervical cancer cells, anogenital cancer cells, vulvar squamous cell carcinoma cells, penile carcinoma cells, anal and perianal cancer cells, oral squamous cell carcinoma cells and oropharyngeal cancers, most preferably HPV-infected cervical cancer cells.

1 1. Method according to claim 9 or 10, wherein said TGFftl mRNA-specific iRNA is a TGF&1 mRNA-specific iRNA according to any one of claims 1 to 5 and/or a vector according to claim 6 and/or a cell according to claim 7.