WO2012099396A2 - A microorganism having enhanced l-amino acids productivity and process for producing l-amino acids using the same - Google Patents

A microorganism having enhanced l-amino acids productivity and process for producing l-amino acids using the same Download PDF

Info

Publication number
WO2012099396A2
WO2012099396A2 PCT/KR2012/000444 KR2012000444W WO2012099396A2 WO 2012099396 A2 WO2012099396 A2 WO 2012099396A2 KR 2012000444 W KR2012000444 W KR 2012000444W WO 2012099396 A2 WO2012099396 A2 WO 2012099396A2
Authority
WO
WIPO (PCT)
Prior art keywords
microorganism
gene
amino acid
coli
enhanced
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2012/000444
Other languages
French (fr)
Other versions
WO2012099396A3 (en
Inventor
Kwang Ho Lee
Keun Chul Lee
Seok Myung LEE
Young Bin Hwang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
CJ CheilJedang Corp
Original Assignee
CJ CheilJedang Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by CJ CheilJedang Corp filed Critical CJ CheilJedang Corp
Priority to BR112013018385-3A priority Critical patent/BR112013018385B1/en
Priority to ES12736463.6T priority patent/ES2664837T3/en
Priority to CN201280009090.XA priority patent/CN103443267B/en
Priority to US13/980,137 priority patent/US8835154B2/en
Priority to RU2013134401/10A priority patent/RU2549689C2/en
Priority to DK12736463.6T priority patent/DK2665809T3/en
Priority to PL12736463T priority patent/PL2665809T3/en
Priority to JP2013550399A priority patent/JP5740488B2/en
Priority to EP12736463.6A priority patent/EP2665809B1/en
Publication of WO2012099396A2 publication Critical patent/WO2012099396A2/en
Publication of WO2012099396A3 publication Critical patent/WO2012099396A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245Escherichia (G)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52Genes encoding for enzymes or proenzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1003Transferases (2.) transferring one-carbon groups (2.1)
    • C12N9/1007Methyltransferases (general) (2.1.1.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/04Alpha- or beta- amino acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/04Alpha- or beta- amino acids
    • C12P13/08Lysine; Diaminopimelic acid; Threonine; Valine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/04Alpha- or beta- amino acids
    • C12P13/22Tryptophan; Tyrosine; Phenylalanine; 3,4-Dihydroxyphenylalanine
    • C12P13/227Tryptophan
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y201/00Transferases transferring one-carbon groups (2.1)
    • C12Y201/01Methyltransferases (2.1.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y207/00Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/01023NAD+ kinase (2.7.1.23)

Definitions

  • the present invention relates to a microorganism having an enhanced productivity of useful amino acids through improved cell activity and shortened cell culture time due to increased reducing power, and a method for producing L-amino acids using the same.
  • Microorganisms that produce useful products through fermentation are known to require a great amount of energy such as ATP (Adenosine 5'-triphosphate) or reducing power such as NADPH (Nicotinamide Adenine Dinucleotide Phosphate) for enhancement of the biosynthetic pathway thereof.
  • ATP Addenosine 5'-triphosphate
  • NADPH Nicotinamide Adenine Dinucleotide Phosphate
  • NADH nicotinamide adenine dinucleotide
  • NADPH nicotinamide adenine dinucleotide phosphate
  • NAD kinase In E.coli, phosphorylation of NAD is known to be catalyzed by an enzyme called NAD kinase (EC 2.7.1.23) encoded by the nadK (or yfjB) gene. NAD kinase utilizes Mg 2+ as a cofactor of an enzymatic reaction, and is inhibited allosterically by NADPH and NADH. It is known that the Km value for NAD + is 2000 ⁇ M, and that for ATP is 2500 ⁇ M (Eur. J. Biochem., (2001) 268: 4359-4365).
  • NADP phosphatase has rarely been studied in spite of its central importance in the metabolic pathway. Although an NAD kinase homolog in the archaeon Methanococcus jannaschii was shown to have NADP phosphatase activity, genes encoding the enzyme having such activity are not yet identified in eukaryotic and eubacterial sources. In E. coli, the product of the cysQ gene showed high NADP and NADPH phosphatase activities, but kinetic studies of the purified enzyme suggested that it is not the true NADP phosphatase of this organism (Biochem J., (2007) 402:205-218, Biosci. Biotechnol. Biochem., (2008) 72 :919-930).
  • NAD kinase activities are found in many microorganisms, and the NAD-binding site and the active site of NAD kinase that are important for catalytic activity show highly conserved amino acid sequences between species.
  • various microorganisms including Gram-positive bacteria show a high level of homology in the tertiary structure prediction of helices 2, 4, and 5 (each of them is indicated by H2, H4, and H5) (Appl Microbiol Biotechnol (2010) 87:583-593).
  • NADP generated by NAD kinase finally supplies a reducing power, and in particular, NADP+/NADPH required for mass-production of useful products in E.coli, is an essential element for anabolic reactions (Biochem J., (2007) 402:205-218).
  • NADPH is mainly produced by 1) the oxidative pentose phosphate pathway, 2) NADP-dependent isocitrate dehydrogenase of the TCA cycle ( icd gene), and 3) transhydrogenase ( pntAB gene) (J Biol Chem., (2004) 279: 6613-6619).
  • a phosphate source such as ATP must also be increased in order to increase the reducing power via the increased NADPH level, resulting from the increased NADP level caused by high expression of NAD kinase.
  • ATP is mainly produced by an electron transport system or substrate level phosphorylation in microorganisms. Produced ATP is decomposed to supply energy to cells, and reproduced through glycolysis or oxidative phosphorylation. Based on this fact, a study of applying a bacterial ATP regeneration system to a production process has been made in order to supply energy during the mass production of useful products (Biosci Biotechnol Biochem., (1997) 61: 840-845).
  • the present inventors have made studies on the genes that are involved in various energy and reducing power metabolisms. As a result, they found that a microorganism having enhanced expression of NAD kinase encoded by nadK and the inactivation of an enzyme of an amino acid sequence of SEQ ID NO. 2 encoded by the tehB gene is able to effectively produce a high concentration of L-amino acids, and on this basis, a phosphate source ATP can be effectively increased, thereby completing the present invention.
  • the present invention relates to a method for increasing production of a desired amino acid by efficiently increasing the reducing power in a microorganism, in which ATP to be reduced during the NADP biosynthetic process is additionally supplied to increase the reducing power of the genus Escherichia having L-amino acid productivity.
  • an object of the present invention is to provide a microorganism of the genus Escherichia having enhanced L-amino acid productivity, in which the microorganism is transformed to have enhanced NAD kinase activity and an inactivated activity of an enzyme having an amino acid sequence of SEQ ID NO. 2 encoded by the tehB gene, thereby having enhanced reducing power.
  • Another object of the present invention is to provide a method for producing L-amino acids using the microorganism of the genus Escherichia .
  • the present invention provides a microorganism of the genus Escherichia having enhanced L-amino acid productivity, in which the microorganism is transformed to have an enhanced NAD kinase activity and an inactivated activity of an enzyme having an amino acid sequence of SEQ ID NO. 2 encoded by the tehB gene.
  • the present invention also provides a method for producing L-amino acids using the microorganism of the genus Escherichia .
  • an supplement of a reducing agent NADPH in intracellular energy metabolism of a microorganism having L-amino acid productivity is created by NADP enhancement, and the subsequent lack of ATP is supplied by the inactivation of an enzyme having an amino acid sequence of SEQ ID NO. 2 encoded by the tehB gene, and thus L-amino acid productivity can be improved by restoring energy metabolism balance and increasing cell activity, and a reduction of cultivation time.
  • FIG. 1 is a diagram showing a vector nadK -pINT17E for increasing the copy number of the nadK gene of E.coli.
  • the present invention provides a microorganism having enhanced L-amino acid productivity and a method for producing L-amino acids using the same.
  • the microorganism producing L-amino acids of the present invention comprises any prokaryotic or eukaryotic microorganism, and examples thereof include the microorganism strains belonging to the genus Escherichia , Erwinia , Serratia , Providencia , Corynebacterium , and Brevibacterium.
  • the microorganism of the present invention is preferably a microorganism belonging to the genus Escherichia , and more preferably E.coli.
  • the L-amino acid is preferably L-threonine or L-tryptophan.
  • the present invention provides a microorganism of the genus Escherichia having enhanced L-amino acid productivity, in which the microorganism is transformed to have an enhanced NAD kinase activity and an inactivated activity of an enzyme having an amino acid sequence of SEQ ID NO. 2 encoded by the tehB gene, thereby having enhanced reducing power.
  • the NAD kinase refers to an enzyme having an activity of converting NAD (nicotinamide adenine dinucleotide) into NADP (nicotinamide adenine dinucleotide phosphate) using a phosphate group derived from ATP or other compounds.
  • a sequence of the protein having the NAD kinase activity is specifically disclosed as an amino acid sequence of SEQ ID NO. 4, and the nadK gene encoding the NAD kinase is preferably a polynucleotide having a base sequence of SEQ ID NO. 3.
  • the method may include a method of inserting an NAD kinase-encoding base sequence itself or a polynucleotide including a foreign expression-regulatory region into a chromosome, a method of increasing the copy number by introducing it into a vector system, or a method of enhancing enzymatic activity by substitution of the gene expression-regulatory region with other regulatory sequence, modification of the entire or a part of the expression-regulatory sequence, or mutation of the gene itself, but is not limited thereto.
  • the present invention can use the method of increasing the copy number by introducing the NAD kinase-encoding base sequence into chromosomal DNA of a strain to enhance the NAD kinase activity of the microorganism belonging to the genus Escherichia that has L-amino acid productivity.
  • the increased copy number of NAD kinase within the chromosomal DNA shows the same effect as in the increased copy number of NAD kinase by an extrachromosomal vector, or as in the increased expression level by modification of the expression regulatory region of the NAD kinase-encoding nadK gene at the intra- or extra-chromosomal site or mutation of the gene itself.
  • the genus Escherichia having L-amino acid productivity is transformed with the base sequence-introduced recombinant vector, thereby preparing a microorganism of the genus Escherichia having enhanced NAD kinase activity.
  • the vector to be used in the present invention is not particularly limited, and any known expression vector may be used.
  • pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, or pMW118 vector may be used.
  • enhancement of the NAD kinase activity by transformation increases the intracellular NADP and NADPH levels in a strain.
  • the present inventors also applied a method of inactivating an activity of an enzyme encoded by the tehB gene.
  • the tehB gene (NCBI Gene ID: 945979) is known as a gene encoding a tellurite resistance protein or a predicted S-adenosyl-L-methionine-dependent methyltransferase, but its functions still remain unclear.
  • a sequence of the predicted S-adenosyl-L-methionine-dependent methyltransferase may be disclosed by an amino acid sequence of SEQ ID NO. 2.
  • the tehB gene encoding the enzyme is derived from E.coli, and preferably a polynucleotide having a base sequence of SEQ ID NO. 1.
  • the method of inactivating an activity of the enzyme encoded by the tehB gene encompasses all methods of modifying the corresponding gene to prevent production of the enzyme encoded by the gene having the base sequence of SEQ ID NO. 1.
  • the methods may be exemplified by deletion of a part or the entire of the gene by homologous recombination, suppression of enzyme expression by transposon insertion within the corresponding gene, suppression of enzyme expression by insertion of antibiotic resistance genes or the like, but are not limited thereto.
  • the term “transformation” means a method in which a gene is introduced into a host cell to be expressed in the host cell.
  • the transformed genes if they are in the state of being expressed in the host cell, comprise any of the genes inserted in the chromosome of the host cell or positioned in other parts of the chromosome.
  • the gene comprises DNA and RNA as a polynucleotide capable of encoding a polypeptide.
  • the gene is introduced in any type.
  • the gene can be introduced into the host cell in the type of expression cassette which is polynucleotide expressome comprising by itself whole elements for expressing the gene.
  • the expression cassette comprises a promoter which is operably connected to the gene, transcription termination signal, ribosome binding site and translation termination signal.
  • the expression cassette can be in the type of the expression vector capable of self cloning.
  • the gene also can be introduced into the host cell by itself or in the type of polynucleotide expressome to be operably connected to the sequence necessary for expression in the host cell.
  • the microorganism transformed by the method can be E. coli, and preferably E.coli CA03-448(KCCM11167P), CA03-449(KCCM11168P), or CA04-2001(KCCM11166P).
  • the present invention also provides a method for producing L-amino acids using the microorganism of the genus Escherichia .
  • the present invention provides the method for producing L-amino acids by culturing the recombinant microorganism of the genus Escherichia having an enhanced productivity of L-threonine or L-tryptophan in a medium comprising sucrose or glucose as a main carbon source.
  • the present invention provides a method for producing L-amino acids comprising the steps of inoculating and culturing the recombinant microorganism of the genus Escherichia in a culture medium that totally or partially contains sucrose or glucose as a carbon source; and separating the L-amino acids from the culture medium.
  • the culturing procedures of the present invention may be conducted in suitable media and under culture conditions known in the art. According to the strains used, the culturing procedures can be readily adjusted by those skilled in the art. Examples of the culturing procedures include batch type, continuous type and fed-batch type manners, but are not limited thereto.
  • the media used in the culture method should preferably meet the requirements of a specific strain.
  • the medium used in the present invention contains sucrose or glucose as a main carbon source.
  • molasses containing a high concentration of sucrose also may be used as a carbon source and the medium may contain a proper amount of various carbon sources without limitation.
  • a nitrogen source capable of being used include an organic nitrogen source such as peptone, yeast extract, meat extract, malt extract, corn steep liquor, and soy meal, and an inorganic nitrogen source such as urea, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate, and they can be used either singly or in any combination thereof.
  • phosphorus sources such as potassium dihydrogen phosphate, dipotassium hydrogen phosphate or corresponding sodium-containing salts may be added.
  • the medium may contain metal salts such as magnesium sulfate and ferrous sulfate.
  • the medium may be supplemented with amino acids, vitamins, and appropriate precursors. These media or precursors may be added to cultures by a batch type or continuous type method.
  • compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid may be properly added so as to adjust the pH of the cultures.
  • defoaming agents such as fatty acid polyglycol ester may be properly added so as to reduce the formation of foams in cultures.
  • oxygen or oxygen-containing gas may be injected into the cultures.
  • no gas may be injected or nitrogen, hydrogen, or carbon dioxide gas may be injected into the cultures.
  • the cultures are maintained at 27 to 37°C, and preferably at 30 to 35°C.
  • the cultivation may be continued until a desired amount of the desired material is obtained, and preferably for 10 to 100 hrs.
  • the method of collecting and recovering the amino acids produced in the cultivation step of the present invention may be performed by a proper method known in the art, depending on the culturing procedures, for example, batch type, continuous type or fed-batch type, so as to collect the desired amino acid from the culture medium.
  • Example 1 Preparation of L-threonine-producing strain having inactivation of enzyme encoded by E.coli-derived tehB gene
  • the E.coli KCCM10541 is a strain derived from an L-threonine-producing strain, E.coli KFCC10718 (Korean Patent Publication NO. 10-1992-0008365), and its parental strain, E.coli KFCC 10718 has a resistance to an L-methionine analogue, a methionine auxotroph phenotype, a resistance to an L-threonine analogue, a leaky isoleucine auxotroph phenotype, a resistance to an L-lysine analogue, and a resistance to ⁇ -aminobutyric acid, and is capable of producing L-threonine.
  • the tehB gene (NCBI Gene ID: 945979) to be deleted is known to encode a predicted S-adenosyl-L-methionine-dependent methyltransferase.
  • ATP used in the production of S-adenosyl methionine is not needed, and thus the tehB gene was selected as a target gene for reduction of energy consumption, and it has a base sequence of SEQ ID NO. 1.
  • inactivation For inactivation, one step inactivation, which is a technique of constructing a mutant using lambda Red recombinase developed by Datsenko KA et al. (Proc Natl Acad Sci USA., (2000) 97:6640 6645), was used.
  • a chloramphenicol resistant gene was used as a marker.
  • a Cre/loxP site-specific recombination system was used (BMC Biotechnology(2001) 1:7).
  • 'PCR' Polymerase chain reaction
  • the DNA fragment obtained by the PCR amplification was electrophoresed on a 0.8% agarose gel, and then eluted and used as a template for secondary PCR.
  • the secondary PCR was performed by using the eluted primary PCR product as a template and the following primer 3 and primer 4 having 20 bp of a complementary sequence to the 5' and 3' regions of the primary DNA fragment and further having the 5' and 3' regions of the tehB gene under the conditions: 30 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds and elongation at 72°C for 1 minute, resulting in the amplification of a gene fragment of approximately 1300 bp.
  • the DNA fragment obtained by the above procedure was electrophoresed on a 0.8% agarose gel, and then eluted, and used in recombination.
  • E.coli KCCM 10541 having threonine productivity which was transformed with a pKD46 plasmid according to the method developed by Datsenko KA et al. (Proc. Natl. Acad. Sci.(2000) 97:6640-6645, GenBank No. AY048746), was prepared as a competent strain, and transformation was performed by introducing the gene fragment of 1300 bp that was obtained by PCR. The obtained strains were selected on the LB medium supplemented with chloramphenicol. A deletion of the tehB gene was confirmed by a PCR product of approximately 2000 bp obtained by PCR using the following primer 5 and primer 6.
  • the primary recombinant E.coli strain having chloramphenicol resistance was introduced with a pJW168 plasmid so as to remove the chloramphenicol marker gene from the strain (Gene, (2000) 247,255-264).
  • PCR was performed using the primers 5 and 6 to obtain a PCR product of 832 bp, indicating that the strain finally obtained had the desired deletion.
  • Example 2 Construction of vector for increasing copy number of E.coli nadK gene in chromosome
  • the gene nadK was amplified by PCR using the chromosome of E.coli W3110 (GeneBank accession number: AC000091) strain purchased from American Type Culture Collection (ATCC) as a template.
  • PCR was performed using the following primers 7 and 8 under the conditions: 30 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and elongation at 72°C for 1 minute, resulting in the amplification of a gene fragment of 1407 bp (SEQ ID NO. 5).
  • the amplified sequence contains the coding sequence of nadK as well as 501 bp of the predicted self-promoter region.
  • the primer 7 has a restriction enzyme recognition site for EcoR I
  • the primer 8 has a restriction enzyme recognition site for Xba I.
  • the obtained polynucleotide was treated with restriction enzymes, Xba I and EcoR I, and cloned into the Xba I and EcoR I sites of the pINT17E vector, followed by transformation into E.coli BW25113. Then, the cells were spread on LB Cm solid medium (LB + chloramphenicol agar plate). The cloned vectors were obtained from the colonies using standard mini-prep procedures, and designated as nadK _pINT17E. The diagram of the vector is shown in FIG. 1.
  • Example 3 Preparation of L-threonine-producing strain having inactivation of enzyme encoded by E.coli-derived tehB gene and enhanced NAD kinase activity by increasing its copy number in chromosome
  • the tehB gene-deleted strain prepared according to the method described in Example 1 and the nadK _pINT17E vector prepared according to the method described in Example 2 were used to increase the copy number of NAD kinase.
  • the pKD46 plasmid was introduced into the tehB gene-deleted strain prepared according to the method described in Example 1, and prepared as a competent strain, and the strain was transformed with the nadK _pINT17E vector. Cultivation was performed at 37°C for 1 ⁇ 2 days to obtain colonies. PCR was performed using primers 8 and 9 to confirm whether the gene is inserted into the chromosome of the obtained colonies. PCR was performed under the following conditions: 30 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 45 seconds and elongation at 72°C for 2 minutes, resulting in the amplification of a gene fragment of approximately 2000 bp.
  • the pJW168 plasmid was introduced to remove the chloramphenicol marker gene from the strain (Gene, (2000) 247, 255-264). PCR was performed using primers 10 and 11 to obtain a PCR product of approximately 1500 bp, indicating that two consecutive copies of the nadK gene are desirably present in the chromosome.
  • the transformed E.coli was designated as KCCM10541 ⁇ tehB nadK 2copy (CA03-448).
  • Example 4 Preparation of L-tryptophan-producing strain having inactivation of enzyme encoded by E.coli-derived tehB gene and enhanced NAD kinase activity by increasing its copy number in chromosome
  • a transformed E.coli was prepared in the same manner as in Examples 1 to 3, except for using an L-tryptophan-producing strain, E.coli KCCM 10812.
  • E.coli KCCM 10812P is a strain derived from the mutant E.coli having L-phenylalanine productivity (KFCC 10066), and characterized in that tryptophan auxotrophy is released, pheA , trpR , mtr , and tnaAB genes are inactivated, and aroG and trpE genes are mutated on chromosome (Korean Patent NO. 10-0792095).
  • the transformed E.coli was designated as KCCM10812 ⁇ tehB nadK 2copy (CA04-2001).
  • Comparative Example 1 Preparation of L-threonine or L-tryptophan-producing strain having inactivation of enzyme encoded by tehB gene
  • E.coli KCCM10541 In order to delete the tehB gene, the threonine-producing strain, E.coli KCCM10541 and the tryptophan-producing strain, E.coli KCCM10812 were used as described in Example 1.
  • One step inactivation which is a technique of constructing a mutant using lambda Red recombinase developed by Datsenko KA et al. (Proc Natl Acad Sci USA., (2000) 97:6640-6645), and the Cre/loxP site-specific recombination system (BMC Biotechnology.(2001) 1:7) were used.
  • PCR was performed using primers 5 and 6 to obtain PCR products of 832 bp, indicating that the strains finally obtained had the desired deletion, and the strains were designated as KCCM10541 ⁇ tehB and KCCM10812P ⁇ tehB , respectively.
  • the copy number of the nadK gene was increased to two copies on the chromosome of the threonine and tryptophan-producing strains so as to prepare strains having enhanced NAD kinase activity.
  • the pKD46 plasmid was introduced into the threonine-producing strain, KCCM10541, and the tryptophan-producing strain, KCCM10812, and prepared as competent cells, and the strains were transformed with the nadK _pINT17E vector. Thereafter, cultivation was performed at 37°C for 1-2 days to obtain colonies. PCR was performed using primers 8 and 9 to confirm whether the gene is inserted into the chromosome of the obtained colonies.
  • the pJW168 plasmid was introduced to remove the chloramphenicol marker gene from the strain (Gene, (2000) 247, 255-264). PCR was performed using the primers 10 and 11 to obtain PCR products of approximately 1500 bp, indicating that two consecutive copies of the nadK gene are desirably present in the chromosome.
  • the prepared strains were designated as KCCM10541 nadK 2copy and KCCM10812 nadK 2copy, respectively.
  • pAcscBAR'-mak vector (Korean Patent Publication NO. 10-2010-0092765) (SEQ ID NO. 21) was constructed as follows:
  • pAcscBAR After construction of pAcscBAR, the mak gene was cloned into pAcscBAR.
  • primers 12 and 13 were used to amplify a polynucleotide of cscB region, where cscK was removed.
  • PCR was performed under the following conditions: after denaturation at 94°C for 3 minutes, followed by 25 cycles of denaturation at 94°C for 30 seconds, annealing at 56°C for 30 seconds, and elongation at 72°C for 1 minute and 30 seconds, and then elongation at 72°C for 7 minutes, resulting in the amplification of a polynucleotide of 1521 bp.
  • the obtained polynucleotide and pAcscBAR were treated with restriction enzymes, EcoRV and EagI, respectively, and cloned and transformed into E.coli DH5 ⁇ .
  • Colonies containing pAcscBAR were selected by PCR using the colonies grown on LB media, and plasmids were obtained using standard plasmid mini-prep procedures. No mutation was confirmed by sequence analysis of cscBAR linked at XbaI and EagI sites of the obtained pAcscBAR plasmid.
  • Primers 14 and 15, and the chromosome of E.coli W3110 as a template were used to amplify a polynucleotide containing the mak gene, and cloned into the restriction enzyme sites, PstI and EagI of pAcscBAR, so as to construct the pAcscBAR'-mak vector.
  • PCR was performed under the following conditions: after denaturation at 94°C for 3 minutes, followed by 25 cycles of denaturation at 94°C for 30 seconds, annealing at 56°C for 30 seconds, and elongation at 72°C for 1 minute and 30 seconds, and then elongation at 72°C for 7 minutes, resulting in the amplification of a polynucleotide of 1388 bp.
  • the obtained polynucleotide and pAcscBAR were treated with restriction enzymes, PstI and EagI, respectively, and cloned and transformed into E.coli DH5 ⁇ .
  • Colonies containing pAcscBAR'-mak were selected by PCR using the colonies grown on LB media, and plasmids were obtained using standard plasmid mini-prep procedures. No mutation was confirmed by sequence analysis of cscBAR-mak linked at XbaI and EagI sites of the obtained pAcscBAR'-mak plasmid.
  • the constructed pAcscBAR'-mak was introduced into the recombinant E.coli KCCM10541 ⁇ tehB nadK 2copy strain of Example 3, the parental strain E.coli KCCM10541, and the tehB gene-deleted KCCM10541 strain (designated as KCCM10541 ⁇ tehB ) and the KCCM10541 strain having increased copy number of nadK gene (designated as KCCM10541 nadK 2copy) prepared in Comparative Examples 1 and 2, respectively, and then titration was performed.
  • sucrose assimilation ability was similar to that of the parental strain. However, when the NAD kinase activity was enhanced, sucrose assimilation ability was increased to approximately 2 g, compared to the parental strain.
  • the cell density was reduced to approximately 6%, compared to the parental strain, but its threonine productivity was similar to that of the parental strain.
  • the cell density was reduced to approximately 8%, sucrose assimilation ability was increased to approximately 8%, and the threonine productivity was also increased to 9%, compared to the parental strain.
  • the recombinant E.coli KCCM10541 ⁇ tehB nadK 2copy strain of Example 3, the parental strain E.coli KCCM10541, and the KCCM10541 ⁇ tehB strain and the KCCM10541 nadK 2copy strain prepared in Comparative Examples 1 and 2 were tested by titration using glucose as a carbon source.
  • Each of the strains having different genetic traits was cultured on LB solid media in a 33°C incubator overnight. Thereafter, 1 platinum loop thereof was inoculated in 25 ml of titer medium containing glucose as shown in the following Table 11, and cultured in the incubator at 33°C and 200 rpm for 48 hours. The results are shown in Table 12. All results were represented by mean value obtained from three flasks.
  • the strain of KCCM10541 ⁇ tehB nadK 2copy was designated as CA03-448, and the strain of KCCM10541 ⁇ tehB nadK 2copy/pAcscBAR’-mak, the strain of KCCM10541 ⁇ tehB nadK 2copy provided with sucrose-assimilating ability, was designated as CA03-449.
  • Korean Culture Center of Microorganisms which is the Subsidiary Culture Collection of the Korean Federation of Culture Collections, (located at 361-221, Hongje-1-dong, Seodaemon-gu, Seoul, Korea) on Jan. 10, 2011, and assigned Deposit (accession) numbers KCCM11167P and KCCM11168P respectively.
  • E.coli KCCM10812 ⁇ tehB nadK 2copy strain of Example 4 The recombinant E.coli KCCM10812 ⁇ tehB nadK 2copy strain of Example 4, the parental strain E.coli KCCM10812, and the KCCM10812 ⁇ tehB strain and the KCCM10812 nadK 2copy strain prepared in Comparative Examples 1 and 2 were tested by titration using glucose as a carbon source.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention provides a microorganism of the genus Escherichia having enhanced L-amino acid productivity, wherein the microorganism is transformed to have an enhanced NAD kinase activity and an inactivated activity of an enzyme having an amino acid sequence of SEQ ID NO. 2 encoded by tehB gene and a method for producing L-amino acids using the microorganism of the genus Escherichia.

Description

A MICROORGANISM HAVING ENHANCED L-AMINO ACIDS PRODUCTIVITY AND PROCESS FOR PRODUCING L-AMINO ACIDS USING THE SAME
 The present invention relates to a microorganism having an enhanced productivity of useful amino acids through improved cell activity and shortened cell culture time due to increased reducing power, and a method for producing L-amino acids using the same.   
Microorganisms that produce useful products through fermentation are known to require a great amount of energy such as ATP (Adenosine 5'-triphosphate) or reducing power such as NADPH (Nicotinamide Adenine Dinucleotide Phosphate) for enhancement of the biosynthetic pathway thereof.
During the metabolism of microorganisms, the intracellular balance of NADH (nicotinamide adenine dinucleotide) used in catabolic reactions and NADPH (nicotinamide adenine dinucleotide phosphate) used in anabolic reactions are very important. The balance is controlled by phosphorylation of NAD or dephosphorylation of NADP as shown in the following formula.
NAD+ + ATP → NADP+ + ADP
NADP+ → NAD+ + phosphate
In E.coli, phosphorylation of NAD is known to be catalyzed by an enzyme called NAD kinase (EC 2.7.1.23) encoded by the nadK (or yfjB) gene. NAD kinase utilizes Mg2+ as a cofactor of an enzymatic reaction, and is inhibited allosterically by NADPH and NADH. It is known that the Km value for NAD+ is 2000 μM, and that for ATP is 2500 μM (Eur. J. Biochem., (2001) 268: 4359-4365).
Dephosphorylation of NADP has rarely been studied in spite of its central importance in the metabolic pathway. Although an NAD kinase homolog in the archaeon Methanococcus jannaschii was shown to have NADP phosphatase activity, genes encoding the enzyme having such activity are not yet identified in eukaryotic and eubacterial sources. In E. coli, the product of the cysQ gene showed high NADP and NADPH phosphatase activities, but kinetic studies of the purified enzyme suggested that it is not the true NADP phosphatase of this organism (Biochem J., (2007) 402:205-218, Biosci. Biotechnol. Biochem., (2008) 72 :919-930).
NAD kinase activities are found in many microorganisms, and the NAD-binding site and the active site of NAD kinase that are important for catalytic activity show highly conserved amino acid sequences between species. For example, various microorganisms including Gram-positive bacteria show a high level of homology in the tertiary structure prediction of helices 2, 4, and 5 (each of them is indicated by H2, H4, and H5) (Appl Microbiol Biotechnol (2010) 87:583-593).
NADP generated by NAD kinase finally supplies a reducing power, and in particular, NADP+/NADPH required for mass-production of useful products in E.coli, is an essential element for anabolic reactions (Biochem J., (2007) 402:205-218). In E.coli, NADPH is mainly produced by 1) the oxidative pentose phosphate pathway, 2) NADP-dependent isocitrate dehydrogenase of the TCA cycle (icd gene), and 3) transhydrogenase (pntAB gene) (J Biol Chem., (2004) 279: 6613-6619).
These reactions produce NADPH using NADP as a substrate, and thus the NADPH level can be increased by increasing the intracellular level of NADP. Therefore, many attempts have been made to increase the intracellular level of NADP for industrial production of various metabolites, for example, 1) NADPH and thymidine production increased by nadK overexpression in E.coli (Biotechnol Lett., (2009) 31:19291936), 2) The amount of NADPH and PHB (polyhydroxybutyrate) production increased by nadK overexpression in E.coli (Appl Microbiol Biotechnol., (2009) 83:939947), and 3) lysine production increased by ppnK overexpression in Corynebacterium, similar to nadK overexpression in E.coli. The key point in all of the above cases is to increase the expression of the nadK gene. However, in each of these cases, a phosphate source such as ATP must also be increased in order to increase the reducing power via the increased NADPH level, resulting from the increased NADP level caused by high expression of NAD kinase.
ATP is mainly produced by an electron transport system or substrate level phosphorylation in microorganisms. Produced ATP is decomposed to supply energy to cells, and reproduced through glycolysis or oxidative phosphorylation. Based on this fact, a study of applying a bacterial ATP regeneration system to a production process has been made in order to supply energy during the mass production of useful products (Biosci Biotechnol Biochem., (1997) 61: 840-845).
However, as described above, there are few studies on the method of increasing a phosphate source, which is required for an increase in the reducing power by high expression of NAD kinase and a subsequent increase of biosynthetic products. In addition, an increase in energy supply via high production of ATP has merely been studied in terms of energy supply to cells, and utilization of ATP as a phosphate source has not been studied in the related art.   
Accordingly, for the development of microorganisms producing high concentration of L-amino acids, the present inventors have made studies on the genes that are involved in various energy and reducing power metabolisms. As a result, they found that a microorganism having enhanced expression of NAD kinase encoded by nadK and the inactivation of an enzyme of an amino acid sequence of SEQ ID NO. 2 encoded by the tehB gene is able to effectively produce a high concentration of L-amino acids, and on this basis, a phosphate source ATP can be effectively increased, thereby completing the present invention.
That is, the present invention relates to a method for increasing production of a desired amino acid by efficiently increasing the reducing power in a microorganism, in which ATP to be reduced during the NADP biosynthetic process is additionally supplied to increase the reducing power of the genus Escherichia having L-amino acid productivity.
Therefore, an object of the present invention is to provide a microorganism of the genus Escherichia having enhanced L-amino acid productivity, in which the microorganism is transformed to have enhanced NAD kinase activity and an inactivated activity of an enzyme having an amino acid sequence of SEQ ID NO. 2 encoded by the tehB gene, thereby having enhanced reducing power.
Another object of the present invention is to provide a method for producing L-amino acids using the microorganism of the genus Escherichia.
To achieve the above objects, the present invention provides a microorganism of the genus Escherichia having enhanced L-amino acid productivity, in which the microorganism is transformed to have an enhanced NAD kinase activity and an inactivated activity of an enzyme having an amino acid sequence of SEQ ID NO. 2 encoded by the tehB gene.
The present invention also provides a method for producing L-amino acids using the microorganism of the genus Escherichia.
According to the present invention, an supplement of a reducing agent NADPH in intracellular energy metabolism of a microorganism having L-amino acid productivity is created by NADP enhancement, and the subsequent lack of ATP is supplied by the inactivation of an enzyme having an amino acid sequence of SEQ ID NO. 2 encoded by the tehB gene, and thus L-amino acid productivity can be improved by restoring energy metabolism balance and increasing cell activity, and a reduction of cultivation time.
FIG. 1 is a diagram showing a vector nadK-pINT17E for increasing the copy number of the nadK gene of E.coli.
The present invention provides a microorganism having enhanced L-amino acid productivity and a method for producing L-amino acids using the same.
The microorganism producing L-amino acids of the present invention comprises any prokaryotic or eukaryotic microorganism, and examples thereof include the microorganism strains belonging to the genus Escherichia, Erwinia, Serratia, Providencia, Corynebacterium, and Brevibacterium. The microorganism of the present invention is preferably a microorganism belonging to the genus Escherichia, and more preferably E.coli.
In the present invention, the L-amino acid is preferably L-threonine or L-tryptophan.
In the preferred embodiment of the present invention, the present invention provides a microorganism of the genus Escherichia having enhanced L-amino acid productivity, in which the microorganism is transformed to have an enhanced NAD kinase activity and an inactivated activity of an enzyme having an amino acid sequence of SEQ ID NO. 2 encoded by the tehB gene, thereby having enhanced reducing power.
In the present invention, the NAD kinase refers to an enzyme having an activity of converting NAD (nicotinamide adenine dinucleotide) into NADP (nicotinamide adenine dinucleotide phosphate) using a phosphate group derived from ATP or other compounds.
A sequence of the protein having the NAD kinase activity is specifically disclosed as an amino acid sequence of SEQ ID NO. 4, and the nadK gene encoding the NAD kinase is preferably a polynucleotide having a base sequence of SEQ ID NO. 3.
In the present invention, enhancement of the NAD kinase activity of the genus Escherichia having L-amino acid productivity can be performed by various methods well known in the art. For example, the method may include a method of inserting an NAD kinase-encoding base sequence itself or a polynucleotide including a foreign expression-regulatory region into a chromosome, a method of increasing the copy number by introducing it into a vector system, or a method of enhancing enzymatic activity by substitution of the gene expression-regulatory region with other regulatory sequence, modification of the entire or a part of the expression-regulatory sequence, or mutation of the gene itself, but is not limited thereto.
More preferably, the present invention can use the method of increasing the copy number by introducing the NAD kinase-encoding base sequence into chromosomal DNA of a strain to enhance the NAD kinase activity of the microorganism belonging to the genus Escherichia that has L-amino acid productivity.
It will be appreciated by those skilled in the art that the increased copy number of NAD kinase within the chromosomal DNA shows the same effect as in the increased copy number of NAD kinase by an extrachromosomal vector, or as in the increased expression level by modification of the expression regulatory region of the NAD kinase-encoding nadK gene at the intra- or extra-chromosomal site or mutation of the gene itself. If a vector is used, the genus Escherichia having L-amino acid productivity is transformed with the base sequence-introduced recombinant vector, thereby preparing a microorganism of the genus Escherichia having enhanced NAD kinase activity.
The vector to be used in the present invention is not particularly limited, and any known expression vector may be used. Preferably, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, or pMW118 vector may be used.
According to one embodiment of the present invention, enhancement of the NAD kinase activity by transformation increases the intracellular NADP and NADPH levels in a strain.
In order to increase ATP production, the present inventors also applied a method of inactivating an activity of an enzyme encoded by the tehB gene.
In the present invention, the tehB gene (NCBI Gene ID: 945979) is known as a gene encoding a tellurite resistance protein or a predicted S-adenosyl-L-methionine-dependent methyltransferase, but its functions still remain unclear.
However, recent studies have reported that a deletion of tehB gene in E.coli shows a 150% increase in ATP production, compared to a parental strain, and suggested that this result is attributed to a reduction in ATP required for biosynthesis of S-adenosyl methionine from methionine (FEMS Microbiol Lett., (2009) 297:217-224).
Specifically, a sequence of the predicted S-adenosyl-L-methionine-dependent methyltransferase may be disclosed by an amino acid sequence of SEQ ID NO. 2. In addition, the tehB gene encoding the enzyme is derived from E.coli, and preferably a polynucleotide having a base sequence of SEQ ID NO. 1.
The method of inactivating an activity of the enzyme encoded by the tehB gene encompasses all methods of modifying the corresponding gene to prevent production of the enzyme encoded by the gene having the base sequence of SEQ ID NO. 1. The methods may be exemplified by deletion of a part or the entire of the gene by homologous recombination, suppression of enzyme expression by transposon insertion within the corresponding gene, suppression of enzyme expression by insertion of antibiotic resistance genes or the like, but are not limited thereto.
As used herein, the term “transformation” means a method in which a gene is introduced into a host cell to be expressed in the host cell. The transformed genes, if they are in the state of being expressed in the host cell, comprise any of the genes inserted in the chromosome of the host cell or positioned in other parts of the chromosome. In addition, the gene comprises DNA and RNA as a polynucleotide capable of encoding a polypeptide. As long as the gene can be introduced in the host cell and expressed therein, the gene is introduced in any type. For example, the gene can be introduced into the host cell in the type of expression cassette which is polynucleotide expressome comprising by itself whole elements for expressing the gene. The expression cassette comprises a promoter which is operably connected to the gene, transcription termination signal, ribosome binding site and translation termination signal. The expression cassette can be in the type of the expression vector capable of self cloning. The gene also can be introduced into the host cell by itself or in the type of polynucleotide expressome to be operably connected to the sequence necessary for expression in the host cell.
In the preferred embodiment of the present invention, the microorganism transformed by the method can be E. coli, and preferably E.coli CA03-448(KCCM11167P), CA03-449(KCCM11168P), or CA04-2001(KCCM11166P).
The present invention also provides a method for producing L-amino acids using the microorganism of the genus Escherichia.
In the preferred embodiment of the present invention, the present invention provides the method for producing L-amino acids by culturing the recombinant microorganism of the genus Escherichia having an enhanced productivity of L-threonine or L-tryptophan in a medium comprising sucrose or glucose as a main carbon source.
Specifically, the present invention provides a method for producing L-amino acids comprising the steps of inoculating and culturing the recombinant microorganism of the genus Escherichia in a culture medium that totally or partially contains sucrose or glucose as a carbon source; and separating the L-amino acids from the culture medium.
The culturing procedures of the present invention may be conducted in suitable media and under culture conditions known in the art. According to the strains used, the culturing procedures can be readily adjusted by those skilled in the art. Examples of the culturing procedures include batch type, continuous type and fed-batch type manners, but are not limited thereto. The media used in the culture method should preferably meet the requirements of a specific strain.
The medium used in the present invention contains sucrose or glucose as a main carbon source. And molasses containing a high concentration of sucrose also may be used as a carbon source and the medium may contain a proper amount of various carbon sources without limitation. Examples of a nitrogen source capable of being used include an organic nitrogen source such as peptone, yeast extract, meat extract, malt extract, corn steep liquor, and soy meal, and an inorganic nitrogen source such as urea, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate, and they can be used either singly or in any combination thereof. To the medium, phosphorus sources such as potassium dihydrogen phosphate, dipotassium hydrogen phosphate or corresponding sodium-containing salts may be added. In addition, the medium may contain metal salts such as magnesium sulfate and ferrous sulfate. Further, the medium may be supplemented with amino acids, vitamins, and appropriate precursors. These media or precursors may be added to cultures by a batch type or continuous type method.
During cultivation, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid may be properly added so as to adjust the pH of the cultures. Further, during culture, defoaming agents such as fatty acid polyglycol ester may be properly added so as to reduce the formation of foams in cultures. To maintain the cultures in aerobic states, oxygen or oxygen-containing gas may be injected into the cultures. To maintain the cultures in anaerobic and microaerobic states, no gas may be injected or nitrogen, hydrogen, or carbon dioxide gas may be injected into the cultures.
The cultures are maintained at 27 to 37℃, and preferably at 30 to 35℃. The cultivation may be continued until a desired amount of the desired material is obtained, and preferably for 10 to 100 hrs.
The method of collecting and recovering the amino acids produced in the cultivation step of the present invention may be performed by a proper method known in the art, depending on the culturing procedures, for example, batch type, continuous type or fed-batch type, so as to collect the desired amino acid from the culture medium.
Hereinafter, the present invention will be described in more detail with reference to Examples. However, these Examples are for illustrative purposes only, and the invention is not intended to be limited by these Examples.
Example 1: Preparation of L-threonine-producing strain having inactivation of enzyme encoded by E.coli-derived tehB gene
The tehB gene of an L-threonine-producing strain, E.coli KCCM10541 (Korean Patent NO. 10-0576342) was deleted by homologous recombination.
The E.coli KCCM10541 is a strain derived from an L-threonine-producing strain, E.coli KFCC10718 (Korean Patent Publication NO. 10-1992-0008365), and its parental strain, E.coli KFCC 10718 has a resistance to an L-methionine analogue, a methionine auxotroph phenotype, a resistance to an L-threonine analogue, a leaky isoleucine auxotroph phenotype, a resistance to an L-lysine analogue, and a resistance to α-aminobutyric acid, and is capable of producing L-threonine.
The tehB gene (NCBI Gene ID: 945979) to be deleted is known to encode a predicted S-adenosyl-L-methionine-dependent methyltransferase. When the gene is deleted, ATP used in the production of S-adenosyl methionine is not needed, and thus the tehB gene was selected as a target gene for reduction of energy consumption, and it has a base sequence of SEQ ID NO. 1.
For inactivation, one step inactivation, which is a technique of constructing a mutant using lambda Red recombinase developed by Datsenko KA et al. (Proc Natl Acad Sci USA., (2000) 97:6640 6645), was used.
To confirm the insertion into the gene, a chloramphenicol resistant gene was used as a marker. For removal of the chloramphenicol resistant gene, a Cre/loxP site-specific recombination system was used (BMC Biotechnology(2001) 1:7).
Polymerase chain reaction (hereinbelow, referred to as 'PCR') was performed by using a pMloxCm vector as a template and the following primer 1 and primer 2 having a part of the tehB gene and a part of the sequence of chloramphenicol resistant gene under the conditions: 30 cycles of denaturation at 94℃ for 30 seconds, annealing at 55℃ for 30 seconds and elongation at 72℃ for 1 minute, resulting in the amplification of a gene fragment of approximately 1200 bp.
Table 1
Primer 1 5'-GCACACACTCTGAAGTACTGGAAGCGGTGAAAGTGGTTAAACCGGGTAAAACGCTGGATTAGGTGACACTATAGAACGCG - 3' (SEQ ID NO. 6)
Primer 2 5'-CACCCTCTCCCAGCCTTCGTAATATCGACGTAATTCTCCCTCTTTGAAGGCAAACGGGAATAGTGGATCTGATGGGTACC -3' (SEQ ID NO. 7)
In addition, the DNA fragment obtained by the PCR amplification was electrophoresed on a 0.8% agarose gel, and then eluted and used as a template for secondary PCR. The secondary PCR was performed by using the eluted primary PCR product as a template and the following primer 3 and primer 4 having 20 bp of a complementary sequence to the 5' and 3' regions of the primary DNA fragment and further having the 5' and 3' regions of the tehB gene under the conditions: 30 cycles of denaturation at 94℃ for 30 seconds, annealing at 55℃ for 30 seconds and elongation at 72℃ for 1 minute, resulting in the amplification of a gene fragment of approximately 1300 bp. The DNA fragment obtained by the above procedure was electrophoresed on a 0.8% agarose gel, and then eluted, and used in recombination.
Table 2
Primer 3 5'- GTGACGAAAACTATTTTACTGATAAATATGAATTAACCCGCACACACTCTGAAGTACTG -3' (SEQ ID NO. 8)
Primer 4 5'- GTCGGTGCGGTGCAGCTCGCCGACGTCTTCATTGTATTTCACCCTCTCCCAGCCTTCGTA -3' (SEQ ID NO. 9)
E.coli KCCM 10541 having threonine productivity, which was transformed with a pKD46 plasmid according to the method developed by Datsenko KA et al. (Proc. Natl. Acad. Sci.(2000) 97:6640-6645, GenBank No. AY048746), was prepared as a competent strain, and transformation was performed by introducing the gene fragment of 1300 bp that was obtained by PCR. The obtained strains were selected on the LB medium supplemented with chloramphenicol. A deletion of the tehB gene was confirmed by a PCR product of approximately 2000 bp obtained by PCR using the following primer 5 and primer 6.
Table 3
Primer 5 5'- TTTAGGCGCAGGCGTTTTCT -3' (SEQ ID NO. 10)
Primer 6 5'- TTTTACGTGCCAGCATCGTG -3' (SEQ ID NO. 11)
After removal of the pKD46 plasmid, the primary recombinant E.coli strain having chloramphenicol resistance was introduced with a pJW168 plasmid so as to remove the chloramphenicol marker gene from the strain (Gene, (2000) 247,255-264). PCR was performed using the primers 5 and 6 to obtain a PCR product of 832 bp, indicating that the strain finally obtained had the desired deletion.
Example 2: Construction of vector for increasing copy number of E.coli nadK gene in chromosome
The gene nadK was amplified by PCR using the chromosome of E.coli W3110 (GeneBank accession number: AC000091) strain purchased from American Type Culture Collection (ATCC) as a template.
Specifically, PCR was performed using the following primers 7 and 8 under the conditions: 30 cycles of denaturation at 94℃ for 30 seconds, annealing at 55℃ for 30 seconds, and elongation at 72℃ for 1 minute, resulting in the amplification of a gene fragment of 1407 bp (SEQ ID NO. 5).
The amplified sequence contains the coding sequence of nadK as well as 501 bp of the predicted self-promoter region. In addition, the primer 7 has a restriction enzyme recognition site for EcoR I, and the primer 8 has a restriction enzyme recognition site for Xba I.
Table 4
Primer 7 5'-CCCGAATTCGCGTCAGCTCAATGCCTTCA- 3' (SEQ ID NO. 12)
Primer 8 5'-GGGTCTAGAGCTGGCGTAAAATTAGAATA- 3' (SEQ ID NO. 13)
The obtained polynucleotide was treated with restriction enzymes, Xba I and EcoR I, and cloned into the Xba I and EcoR I sites of the pINT17E vector, followed by transformation into E.coli BW25113. Then, the cells were spread on LB Cm solid medium (LB + chloramphenicol agar plate). The cloned vectors were obtained from the colonies using standard mini-prep procedures, and designated as nadK_pINT17E. The diagram of the vector is shown in FIG. 1.
Example 3: Preparation of L-threonine-producing strain having inactivation of enzyme encoded by E.coli-derived tehB gene and enhanced NAD kinase activity by increasing its copy number in chromosome
The tehB gene-deleted strain prepared according to the method described in Example 1 and the nadK_pINT17E vector prepared according to the method described in Example 2 were used to increase the copy number of NAD kinase.
First, the pKD46 plasmid was introduced into the tehB gene-deleted strain prepared according to the method described in Example 1, and prepared as a competent strain, and the strain was transformed with the nadK_pINT17E vector. Cultivation was performed at 37℃ for 1~2 days to obtain colonies. PCR was performed using primers 8 and 9 to confirm whether the gene is inserted into the chromosome of the obtained colonies. PCR was performed under the following conditions: 30 cycles of denaturation at 94℃ for 30 seconds, annealing at 55℃ for 45 seconds and elongation at 72℃ for 2 minutes, resulting in the amplification of a gene fragment of approximately 2000 bp.
Table 5
Primer 9 5'-TGGTATTCACTCCAGAGCGA- 3' (SEQ ID NO. 14)
After the pKD46 plasmid was removed from the primary recombinant strain having the chloramphenicol resistance, the pJW168 plasmid was introduced to remove the chloramphenicol marker gene from the strain (Gene, (2000) 247, 255-264). PCR was performed using primers 10 and 11 to obtain a PCR product of approximately 1500 bp, indicating that two consecutive copies of the nadK gene are desirably present in the chromosome.
The transformed E.coli was designated as KCCM10541ΔtehB nadK 2copy (CA03-448).
Table 6
Primer 10 5'-GCATCAGCACCGCGATAAA- 3' (SEQ ID NO. 15)
Primer 11 5'-CATGTGTTGTCAGTGCAGT- 3' (SEQ ID NO. 16)
Example 4: Preparation of L-tryptophan-producing strain having inactivation of enzyme encoded by E.coli-derived tehB gene and enhanced NAD kinase activity by increasing its copy number in chromosome
A transformed E.coli was prepared in the same manner as in Examples 1 to 3, except for using an L-tryptophan-producing strain, E.coli KCCM 10812.
The parental strain used in this Example, E.coli KCCM 10812P, is a strain derived from the mutant E.coli having L-phenylalanine productivity (KFCC 10066), and characterized in that tryptophan auxotrophy is released, pheA, trpR, mtr, and tnaAB genes are inactivated, and aroG and trpE genes are mutated on chromosome (Korean Patent NO. 10-0792095).
The transformed E.coli was designated as KCCM10812ΔtehB nadK 2copy (CA04-2001).
Comparative Example 1: Preparation of L-threonine or L-tryptophan-producing strain having inactivation of enzyme encoded by tehB gene
In order to delete the tehB gene, the threonine-producing strain, E.coli KCCM10541 and the tryptophan-producing strain, E.coli KCCM10812 were used as described in Example 1. One step inactivation, which is a technique of constructing a mutant using lambda Red recombinase developed by Datsenko KA et al. (Proc Natl Acad Sci USA., (2000) 97:6640-6645), and the Cre/loxP site-specific recombination system (BMC Biotechnology.(2001) 1:7) were used.
PCR was performed using primers 5 and 6 to obtain PCR products of 832 bp, indicating that the strains finally obtained had the desired deletion, and the strains were designated as KCCM10541ΔtehB and KCCM10812PΔtehB, respectively.
Comparative Example 2: Preparation of L-threonine or L-tryptophan-producing strain having enhanced NAD kinase activity
According to the method described in Example 3, the copy number of the nadK gene was increased to two copies on the chromosome of the threonine and tryptophan-producing strains so as to prepare strains having enhanced NAD kinase activity.
The pKD46 plasmid was introduced into the threonine-producing strain, KCCM10541, and the tryptophan-producing strain, KCCM10812, and prepared as competent cells, and the strains were transformed with the nadK_pINT17E vector. Thereafter, cultivation was performed at 37℃ for 1-2 days to obtain colonies. PCR was performed using primers 8 and 9 to confirm whether the gene is inserted into the chromosome of the obtained colonies.
After the pKD46 plasmid was removed from the primary recombinant strain having the chloramphenicol resistance, the pJW168 plasmid was introduced to remove the chloramphenicol marker gene from the strain (Gene, (2000) 247, 255-264). PCR was performed using the primers 10 and 11 to obtain PCR products of approximately 1500 bp, indicating that two consecutive copies of the nadK gene are desirably present in the chromosome. The prepared strains were designated as KCCM10541 nadK 2copy and KCCM10812 nadK 2copy, respectively.
Experimental Example 1: Titration of L-threonine-producing strain having enhanced NAD kinase activity and inactivation of enzyme encoded by tehB gene
Firstly, to provide the L-threonine-producing strain with sucrose-assimilating ability, a pAcscBAR'-mak vector (Korean Patent Publication NO. 10-2010-0092765) (SEQ ID NO. 21) was constructed as follows:
After construction of pAcscBAR, the mak gene was cloned into pAcscBAR. For construction of pAcscBAR, primers 12 and 13 were used to amplify a polynucleotide of cscB region, where cscK was removed.
Table 7
Primer 12 5'-CGCGATATCTAGCATATGCCGGGTACCGCACTAGTTGAGAGTAAACGGCGAAGT- 3' (SEQ ID NO. 17)
Primer 13 5'- ATTCGGCCGGAGCCCTGCAGGTGCACGAGTACATTTGAGCGACTGT- 3' (SEQ ID NO. 18)
PCR was performed under the following conditions: after denaturation at 94℃ for 3 minutes, followed by 25 cycles of denaturation at 94℃ for 30 seconds, annealing at 56℃ for 30 seconds, and elongation at 72℃ for 1 minute and 30 seconds, and then elongation at 72℃ for 7 minutes, resulting in the amplification of a polynucleotide of 1521 bp. The obtained polynucleotide and pAcscBAR were treated with restriction enzymes, EcoRV and EagI, respectively, and cloned and transformed into E.coli DH5α. Colonies containing pAcscBAR were selected by PCR using the colonies grown on LB media, and plasmids were obtained using standard plasmid mini-prep procedures. No mutation was confirmed by sequence analysis of cscBAR linked at XbaI and EagI sites of the obtained pAcscBAR plasmid.
Primers 14 and 15, and the chromosome of E.coli W3110 as a template were used to amplify a polynucleotide containing the mak gene, and cloned into the restriction enzyme sites, PstI and EagI of pAcscBAR, so as to construct the pAcscBAR'-mak vector.
Table 8
Primer 14 5'- CACTGCAGTGGGGTAAATGCCATCG- 3' (SEQ ID NO. 19)
Primer 15 5'- AACGGCCGTCTCGGTGCTCATTACT- 3' (SEQ ID NO. 20)
PCR was performed under the following conditions: after denaturation at 94℃ for 3 minutes, followed by 25 cycles of denaturation at 94℃ for 30 seconds, annealing at 56℃ for 30 seconds, and elongation at 72℃ for 1 minute and 30 seconds, and then elongation at 72℃ for 7 minutes, resulting in the amplification of a polynucleotide of 1388 bp. The obtained polynucleotide and pAcscBAR were treated with restriction enzymes, PstI and EagI, respectively, and cloned and transformed into E.coli DH5α. Colonies containing pAcscBAR'-mak were selected by PCR using the colonies grown on LB media, and plasmids were obtained using standard plasmid mini-prep procedures. No mutation was confirmed by sequence analysis of cscBAR-mak linked at XbaI and EagI sites of the obtained pAcscBAR'-mak plasmid.
The constructed pAcscBAR'-mak was introduced into the recombinant E.coli KCCM10541ΔtehB nadK 2copy strain of Example 3, the parental strain E.coli KCCM10541, and the tehB gene-deleted KCCM10541 strain (designated as KCCM10541ΔtehB) and the KCCM10541 strain having increased copy number of nadK gene (designated as KCCM10541 nadK 2copy) prepared in Comparative Examples 1 and 2, respectively, and then titration was performed.
Each of the strains having different genetic traits was cultured on LB solid media in a 33℃ incubator overnight. Thereafter, 1 platinum loop thereof was inoculated in 25 ml of titer medium containing sucrose as shown in the following Table 9, and cultured in the incubator at 33℃ and 200 rpm for 48 hours. The results are shown in Table 10. All results were represented by mean value obtained from three flasks.
Table 9
Composition Concentration (per liter)
Sucrose 70 g
KH2PO4 2 g
(NH4)2SO4 25 g
MgSO47H2O 1 g
FeSO47H2O 5 mg
MnSO44H2O 5 mg
L-methionine 0.15 g
Yeast extract 2 g
Calcium carbonate 30 g
pH 6.8
Table 10
strain OD Sugar consumption(g/L)* L-threonine(g/L)**
KCCM10541/ pAcscBAR-mak 16.2 34.7 31.8
KCCM10541 tehB / pAcscBAR-mak 15.2 35.7 32.2
KCCM10541 nadK 2 copy/ pAcscBAR-mak 16.4 36.6 32.9
KCCM10541 tehB nadK 2copy/ pAcscBAR-mak 14.9 37.4 34.7
* 24-hr measured value
** 48-hr measured value
As shown in Table 10, when only the tehB gene was deleted, sucrose assimilation ability was similar to that of the parental strain. However, when the NAD kinase activity was enhanced, sucrose assimilation ability was increased to approximately 2 g, compared to the parental strain.
Further, when the tehB gene was deleted, the cell density was reduced to approximately 6%, compared to the parental strain, but its threonine productivity was similar to that of the parental strain. However, when the two mutations were introduced at the same time, the cell density was reduced to approximately 8%, sucrose assimilation ability was increased to approximately 8%, and the threonine productivity was also increased to 9%, compared to the parental strain.
Furthermore, the recombinant E.coli KCCM10541ΔtehB nadK 2copy strain of Example 3, the parental strain E.coli KCCM10541, and the KCCM10541ΔtehB strain and the KCCM10541 nadK 2copy strain prepared in Comparative Examples 1 and 2 were tested by titration using glucose as a carbon source. Each of the strains having different genetic traits was cultured on LB solid media in a 33℃ incubator overnight. Thereafter, 1 platinum loop thereof was inoculated in 25 ml of titer medium containing glucose as shown in the following Table 11, and cultured in the incubator at 33℃ and 200 rpm for 48 hours. The results are shown in Table 12. All results were represented by mean value obtained from three flasks.
Table 11
Composition Concentration (per liter)
Glucose 70 g
KH2PO4 1 g
(NH4)2SO4 28 g
MgSO47H2O 0.5 g
FeSO47H2O 5 mg
MnSO44H2O 5 mg
Yeast extract 2 g
L-methionine 0.15 g
Calcium carbonate 30 g
pH 6.8
Table 12
strain OD Sugar consumption(g/L)* L-threonine(g/L)**
KCCM10541 14.0 26.7 27.6
KCCM10541 tehB 13.2 26.9 28.7
KCCM10541 nadK 2 copy 13.8 28.9 28.4
KCCM10541 tehB nadK 2copy 12.5 30.3 30.1
* 24-hr measured value
** 48-hr measured value
The strain of KCCM10541 ΔtehB nadK 2copy, the L-threonine producing E. coli having deleted tehB gene and enhanced NAD kinase activity with glucose-assimilating ability, was designated as CA03-448, and the strain of KCCM10541 ΔtehB nadK 2copy/pAcscBAR’-mak, the strain of KCCM10541 ΔtehB nadK 2copy provided with sucrose-assimilating ability, was designated as CA03-449. And they were deposited in the international depository authority, Korean Culture Center of Microorganisms, which is the Subsidiary Culture Collection of the Korean Federation of Culture Collections, (located at 361-221, Hongje-1-dong, Seodaemon-gu, Seoul, Korea) on Jan. 10, 2011, and assigned Deposit (accession) numbers KCCM11167P and KCCM11168P respectively.
Experimental Example 2: Titration of L-tryptophan-producing strain having enhanced NAD kinase activity and inactivation of enzyme encoded by tehB gene
The recombinant E.coli KCCM10812ΔtehB nadK 2copy strain of Example 4, the parental strain E.coli KCCM10812, and the KCCM10812ΔtehB strain and the KCCM10812 nadK 2copy strain prepared in Comparative Examples 1 and 2 were tested by titration using glucose as a carbon source.
For the titration, 1 platinum loop of the strain was inoculated, and cultured on LB solid media overnight. Thereafter, 1 platinum loop thereof was inoculated in 25 ml of flask titer medium having the composition of the following Table 13, and then cultured at 37℃ and 200 rpm for 48 hours. The results are shown in Table 14. All results were represented by mean value obtained from three flasks.
Table 13
Composition Concentration (per liter)
Glucose 60 g
K2HPO4 1 g
(NH4)2SO4 10 g
NaCl 1 g
MgSO47H2O 1 g
Sodium citrate 5 g
Yeast extract 2 g
Calcium carbonate 40 g
Sodium citrate 5 g
Phenylalanine 0.15 g
Tyrosine 0.1 g
pH 6.8
Table 14
strain OD Sugar consumption (g/L)* L-tryptophan(g/L)**
KCCM10812P 13.0 54.8 6.8
KCCM10812P tehB 14.5 55.0 7.0
KCCM10812P nadK 2 copy 13.3 57.6 6.9
KCCM10812P tehB nadK 2copy 14.2 57.3 7.7
* 33-hr measured value
** 48-hr measured value
As shown in Table 14, when the tehB gene was deleted, the cell density was increased to approximately 10%, compared to the parental strain. When the NAD kinase activity was enhanced, glucose assimilation ability was improved, but there was no difference in the tryptophan productivity, compared to the parental strain.
However, when the two mutations were introduced at the same time, the cell density was increased, glucose assimilation ability was also improved, and the tryptophan productivity was increased to approximately 14%.
The strain of KCCM10812P ΔtehB nadK 2copy, the L- tryptophan producing E. coli having deleted tehB gene and enhanced NAD kinase activity, was designated as CA04-2001, and it was deposited in the international depository authority, Korean Culture Center of Microorganisms, which is the Subsidiary Culture Collection of the Korean Federation of Culture Collections, (located at 361-221, Hongje-1-dong, Seodaemon-gu, Seoul, Korea) on Jan. 10, 2011, and assigned accession number KCCM11166P.
It will be apparent to those skilled in the art that various modifications and changes may be made without departing from the scope and spirit of the invention. Therefore, it should be understood that the above embodiment is not limitative, but illustrative in all aspects. The scope of the invention is defined by the appended claims rather than by the description preceding them, and therefore all changes and modifications that fall within the metes and bounds of the claims, or equivalents of such metes and bounds, are therefore intended to be embraced by the claims.
Figure PCTKR2012000444-appb-I000001
Figure PCTKR2012000444-appb-I000002
Figure PCTKR2012000444-appb-I000003

Claims (11)

  1. A microorganism of the genus Escherichia having enhanced L-amino acid productivity, wherein the microorganism is transformed to have an enhanced NAD kinase activity and an inactivated activity of an enzyme having an amino acid sequence of SEQ ID NO. 2 encoded by tehB gene.
  2. The microorganism according to claim 1, wherein the NAD kinase is a protein having an amino acid sequence of SEQ ID NO. 4.
  3. The microorganism according to claim 1, wherein the NAD kinase activity is enhanced by one or more methods of increasing the copy number by chromosomal insertion or vector introduction, substitution or modification of the expression-regulatory region, and gene mutation.
  4. The microorganism according to claim 1, wherein the inactivation is performed by one or more methods of deletion of a part or the entire of the gene by homologous recombination, suppression of enzyme expression by transposon insertion within the corresponding gene, and suppression of enzyme expression by insertion of antibiotic resistance genes.
  5. The microorganism according to claim 1, wherein the microorganism of the genus Escherichia is E.coli.
  6. The microorganism according to claim 1, wherein the L-amino acid is L-threonine or L-tryptophan.
  7. The microorganism according to claim 6, wherein the microorganism of the genus Escherichia is provided with sucrose assimilation ability.
  8. The microorganism according to claim 1, wherein the microorganism of the genus Escherichia is an L-threonine-producing E.coli, CA03-448 having Deposit No. KCCM11167P or CA03-449 having Deposit No. KCCM11168P.
  9. The microorganism according to claim 1, wherein the microorganism of the genus Escherichia is an L-tryptophan-producing E.coli, CA04-2001 having Deposit No. KCCM11166P.
  10. A method for producing L-amino acids, comprising the steps of inoculating and culturing the microorganism of the genus Escherichia of any one of claims 1 to 9 in a culture medium that totally or partially contains sucrose or glucose as a carbon source; and separating the L-amino acid from the culture medium.
  11. The method according to claim 10, wherein the L-amino acid is L-threonine or L-tryptophan.
PCT/KR2012/000444 2011-01-18 2012-01-18 A microorganism having enhanced l-amino acids productivity and process for producing l-amino acids using the same Ceased WO2012099396A2 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
BR112013018385-3A BR112013018385B1 (en) 2011-01-18 2012-01-18 MICRO-ORGANISM WITH INCREASED L-AMINO ACIDS PRODUCTIVITY AND PROCESS FOR THE PRODUCTION OF L-AMINO ACIDS USING THE SAME
ES12736463.6T ES2664837T3 (en) 2011-01-18 2012-01-18 Microorganism with enhanced L-amino acid productivity and process to produce L-amino acids with its use
CN201280009090.XA CN103443267B (en) 2011-01-18 2012-01-18 The microorganism that L-amino acids production power strengthens and utilize it to produce L-amino acid whose method
US13/980,137 US8835154B2 (en) 2011-01-18 2012-01-18 Microorganism having enhanced L-amino acids productivity and process for producing L-amino acids using the same
RU2013134401/10A RU2549689C2 (en) 2011-01-18 2012-01-18 Microorganism with increased production of l-amino acids and method for obtaining l-amino acids with its application
DK12736463.6T DK2665809T3 (en) 2011-01-18 2012-01-18 Microorganism with increased L-amino acid productivity and method for producing L-amino acids using the same
PL12736463T PL2665809T3 (en) 2011-01-18 2012-01-18 A microorganism having enhanced l-amino acids productivity and process for producing l-amino acids using the same
JP2013550399A JP5740488B2 (en) 2011-01-18 2012-01-18 Microorganism having improved L-amino acid production ability, and method for producing L-amino acid using the same
EP12736463.6A EP2665809B1 (en) 2011-01-18 2012-01-18 A microorganism having enhanced l-amino acids productivity and process for producing l-amino acids using the same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020110005136A KR101261147B1 (en) 2011-01-18 2011-01-18 A microorganism having enhanced l-amino acids productivity and process for producing l-amino acids using the same
KR10-2011-0005136 2011-01-18

Publications (2)

Publication Number Publication Date
WO2012099396A2 true WO2012099396A2 (en) 2012-07-26
WO2012099396A3 WO2012099396A3 (en) 2012-12-06

Family

ID=46516233

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2012/000444 Ceased WO2012099396A2 (en) 2011-01-18 2012-01-18 A microorganism having enhanced l-amino acids productivity and process for producing l-amino acids using the same

Country Status (13)

Country Link
US (1) US8835154B2 (en)
EP (1) EP2665809B1 (en)
JP (1) JP5740488B2 (en)
KR (1) KR101261147B1 (en)
CN (1) CN103443267B (en)
BR (1) BR112013018385B1 (en)
DK (1) DK2665809T3 (en)
ES (1) ES2664837T3 (en)
HU (1) HUE036527T2 (en)
MY (1) MY170507A (en)
PL (1) PL2665809T3 (en)
RU (1) RU2549689C2 (en)
WO (1) WO2012099396A2 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2017504359A (en) * 2014-03-21 2017-02-09 シージェイ チェイルジェダン コーポレーション Microorganism producing L-amino acid and method for producing L-amino acid using the same
EP3119874A4 (en) * 2014-03-21 2017-11-15 CJ Cheiljedang Corporation Microorganisms having enhanced l-amino acids productivity and process for producing l-amino acids using the same
WO2017197887A1 (en) * 2016-05-17 2017-11-23 河南巨龙生物工程股份有限公司 Escherichia coli jltrp strain and application thereof in l-tryptophan synthesis

Families Citing this family (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BR112015026210B1 (en) 2013-04-16 2022-11-29 Cj Cheiljedang Corporation RECOMBINANT MICROORGANISM HAVING IMPROVED L-TRYPTOPHAN PRODUCTIVITY AND METHOD FOR PRODUCING L-TRYPTOPHAN
KR101646310B1 (en) 2013-06-24 2016-08-12 씨제이제일제당 (주) Microorganisms for production of l-threonine and process for producing l-threonine using the same
KR101499696B1 (en) * 2013-10-16 2015-03-09 한국식품연구원 Enterococcus sp. microorganisms from salted fish and mass production method of s-adenosyl-l-methionine using the same
KR101704198B1 (en) * 2015-05-14 2017-02-08 씨제이제일제당 (주) A microorganism of escherichia genus having l-tryptophan producing activity and method for producing l-tryptophan using the same
KR101704199B1 (en) 2015-05-14 2017-02-08 씨제이제일제당 (주) A microorganism of escherichia genus having l-tryptophan producing activity and method for producing l-tryptophan using the same
KR101755349B1 (en) * 2015-10-15 2017-07-07 씨제이제일제당 주식회사 Microorganism producing L-threonine and process for producing L-threonine using the same
WO2018151347A1 (en) * 2017-02-16 2018-08-23 씨제이제일제당(주) Microorganism having l-threonine production potential and method for producing l-threonine using same
KR101947945B1 (en) * 2018-01-25 2019-02-13 씨제이제일제당 (주) A microorganism of the genus Corynebacterium producing L-amino acids and method for producing L-amino acids using the same
KR101996767B1 (en) * 2018-11-29 2019-07-04 씨제이제일제당 (주) cAMP receptor protein variant and method for producing L-amino acid using the same
KR101991207B1 (en) * 2018-11-29 2019-06-19 씨제이제일제당 (주) cAMP receptor protein variant and method for producing L-amino acid using the same
KR101991206B1 (en) 2018-11-29 2019-06-19 씨제이제일제당 (주) cAMP receptor protein variant and method for producing L-amino acid using the same
CN110541014A (en) * 2019-10-06 2019-12-06 冯世红 method for producing tryptophan by using fed-batch culture solution through fermentation
CN110592154B (en) * 2019-10-16 2023-04-07 新疆阜丰生物科技有限公司 A process for producing and extracting tryptophan
WO2021081185A1 (en) * 2019-10-23 2021-04-29 Genomatica, Inc. Microorganisms and methods for increasing co-factors
CN114277013B (en) * 2020-09-27 2023-12-26 尚科生物医药(上海)有限公司 NAD kinase mutant and application thereof
WO2022129470A1 (en) 2020-12-18 2022-06-23 Inbiose N.V. Variant sucrose permease polypeptides
KR102314882B1 (en) * 2021-01-29 2021-10-19 씨제이제일제당 (주) Novel membrane protein TerC variant and a method for producing L-lysine using the same
KR102688095B1 (en) * 2021-04-28 2024-07-24 씨제이제일제당 주식회사 Modified SpoT protein and method for producing L-amino acid using the same
CN114717237B (en) * 2022-06-10 2022-08-19 北京中科伊品生物科技有限公司 EP6 promoter and related biological material and application thereof
CN117187275B (en) * 2023-11-08 2024-03-12 清华大学 Expression system, construction method and application thereof

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR920009598B1 (en) 1990-10-11 1992-10-21 주식회사삼성전자 Fastening Mechanism
JP4110641B2 (en) * 1998-11-17 2008-07-02 味の素株式会社 Method for producing L-methionine by fermentation
DE10144493A1 (en) * 2001-09-11 2003-07-03 Degussa Process for the fermentative production of L-amino acids using coyneform bacteria
KR100576342B1 (en) 2004-02-05 2006-05-03 씨제이 주식회사 L-Threonine-producing microorganisms in which the gαR gene is inactivated, a method for preparing the same, and a method for producing L-Threonine using the microorganisms
US8003367B2 (en) 2004-03-16 2011-08-23 Ajinomoto Co., Inc. Method for producing L-amino acids by fermentation using bacteria having enhanced expression of xylose utilization genes
US7300776B2 (en) * 2004-04-26 2007-11-27 Ajinomoto Co., Inc. L-amino acid-producing bacterium and a method for producing L-amino acid
AU2005308101A1 (en) * 2004-11-26 2006-06-01 Kyowa Hakko Kirin Co., Ltd. Industrially useful microorganism
RU2359029C2 (en) * 2006-06-01 2009-06-20 Закрытое акционерное общество "Научно-исследовательский институт Аджиномото-Генетика" (ЗАО АГРИ) METHOD FOR OBTAINING L-THREONINE USING BACTERIUM RELATING TO Escherichia, IN WHICH rcsA GENE IS INACTIVATED
KR100792095B1 (en) 2006-12-29 2008-01-04 씨제이 주식회사 Recombinant Escherichia coli strain having L-tryptophan production ability genetically engineered from E. coli mutant strain having L-phenylalanine production method and method for producing tryptophan using the same
KR101083136B1 (en) 2009-02-13 2011-11-11 씨제이제일제당 (주) Microorganisms for producing l-amino acids and process for producing l-amino acids using them
KR101058893B1 (en) 2009-03-03 2011-08-23 씨제이제일제당 (주) L-amino acid producing microorganisms and L-amino acid production method using the same
DE102009030342A1 (en) * 2009-06-25 2010-12-30 Evonik Degussa Gmbh Process for the fermentative production of organic chemical compounds

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BIOCHEM J., 2007
EUR. J. BIOCHEM., vol. 268, 2001, pages 4359 - 4365
FEMS MICROBIOL LETT., vol. 297, 2009, pages 217 - 224
See also references of EP2665809A4

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2017504359A (en) * 2014-03-21 2017-02-09 シージェイ チェイルジェダン コーポレーション Microorganism producing L-amino acid and method for producing L-amino acid using the same
EP3119874A4 (en) * 2014-03-21 2017-11-15 CJ Cheiljedang Corporation Microorganisms having enhanced l-amino acids productivity and process for producing l-amino acids using the same
US10113191B2 (en) 2014-03-21 2018-10-30 Cj Cheiljedang Corporation Microorganisms having enhanced L-amino acids productivity and process for producing L-amino acids using the same
US10202609B2 (en) 2014-03-21 2019-02-12 Cj Cheiljedang Corporation Microorganisms producing L-amino acids and process for producing L-amino acids using the same
WO2017197887A1 (en) * 2016-05-17 2017-11-23 河南巨龙生物工程股份有限公司 Escherichia coli jltrp strain and application thereof in l-tryptophan synthesis

Also Published As

Publication number Publication date
EP2665809B1 (en) 2018-01-10
JP2014504876A (en) 2014-02-27
RU2549689C2 (en) 2015-04-27
CN103443267A (en) 2013-12-11
KR101261147B1 (en) 2013-05-06
HUE036527T2 (en) 2018-07-30
EP2665809A2 (en) 2013-11-27
KR20120083795A (en) 2012-07-26
US8835154B2 (en) 2014-09-16
MY170507A (en) 2019-08-08
EP2665809A4 (en) 2015-05-06
JP5740488B2 (en) 2015-06-24
BR112013018385A2 (en) 2017-02-21
ES2664837T3 (en) 2018-04-23
RU2013134401A (en) 2015-02-27
PL2665809T3 (en) 2018-07-31
BR112013018385B1 (en) 2021-04-27
CN103443267B (en) 2015-11-25
DK2665809T3 (en) 2018-04-16
WO2012099396A3 (en) 2012-12-06
US20140024087A1 (en) 2014-01-23

Similar Documents

Publication Publication Date Title
US8835154B2 (en) Microorganism having enhanced L-amino acids productivity and process for producing L-amino acids using the same
WO2021187781A1 (en) Method for producing l-tryptophan through enhancement of prephenate dehydratase activity
WO2013103268A2 (en) Microorganism able to produce l-amino acid, and method for producing l-amino acid by using same
WO2013105800A2 (en) Microorganisms of escherichia coli having enhanced l-tryptophan production and method for producing l-tryptophan using same
WO2019027267A2 (en) Atp phosphoribosyltransferase mutant and l-histidine production method using same
WO2013105802A2 (en) Microorganisms of corynebacterium which can utilize xylose and method for producing l-lysine using same
WO2013105827A2 (en) Recombinant microorganism having improved putrescine producing ability and method for producing putrescine by using same
WO2016024771A1 (en) O-phosphoserine producing microorganism and method for producing o-phosphoserine or l-cysteine using same
WO2019190193A1 (en) Microorganism having enhanced glycine productivity and method for producing fermented composition by using same
WO2010093182A2 (en) Microorganism for producing l-amino acids and method for producing l-amino acids using same
WO2015186990A1 (en) Microorganism for producing o-acetyl-homoserine and method for producing o-acetyl-homoserine by using same
WO2019164346A1 (en) Recombinant coryneform microorganism for producing l-tryptophan and method for producing l-tryptophan by using same
WO2014175663A1 (en) Corynebacterium sp. microorganism having improved l-arginine productivity and method for producing l-arginine using same
WO2021112469A1 (en) Novel branched-chain amino acid aminotransferase mutant and leucine production method using same
WO2017069567A1 (en) Recombinant microorganism for producing l-threonine and method for producing l-threonine by using same
WO2014171747A1 (en) Microorganism having l-tryptophan productivity and method for production of l-tryptophan using same
WO2013103246A2 (en) Recombinant microorganism producing quinolinic acid and production method of quinolinic acid using same
WO2015199406A1 (en) Escherichia sp. microorganism having l-tryptophan production capacity and method for producing l-tryptophan using same
WO2015178586A1 (en) Microorganism having improved intracellular energy level and method for producing l-amino acid using same
WO2012134253A2 (en) Corynebacterium sp. transformed with a fructokinase gene derived from escherichia sp. and process for preparing l-amino acid using the same
EP3119875A1 (en) Microorganisms producing l-amino acids and process for producing l-amino acids using the same
WO2022270857A1 (en) Recombinant microorganism in which expression of nadh:quinone oxidoreductase is controlled, and method for producing o-phosphoserine, cysteine, and derivative thereof by using same
WO2016195439A1 (en) Microorganism producing o-acetyl-homoserine, and method for producing o-acetyl-homoserine by using same
WO2022225322A1 (en) Novel f0f1 atp synthase subunit alpha variant and method for producing xmp or gmp using same
WO2015142021A1 (en) Microorganisms having enhanced l-amino acids productivity and process for producing l-amino acids using the same

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12736463

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2013550399

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 1301004005

Country of ref document: TH

WWE Wipo information: entry into national phase

Ref document number: 2012736463

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2013134401

Country of ref document: RU

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 13980137

Country of ref document: US

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112013018385

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112013018385

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20130718