WO2012097786A1 - Method for predicting the therapeutic efficacy of egfr inhibitors - Google Patents

Abstract

The invention relates to a method for predicting the therapeutic efficacy of EGFR inhibitors. In order to make a simple method available which can be rapidly carried out and which allows the prediction of the success of antitumor therapies that focus on the EGF receptor or are associated therewith, a sample of tumor tissue, premalign tissue or body fluids is taken from a patient, the number of copies of one or more DNA sections in the region of chromosome 7p is multiplied by quantitative real-time PCR and is quantitatively assayed, and the quantitative measurement value obtained this way is used as a measure for the therapeutic efficacy to be expected.

Description

 Method for predicting the therapeutic efficacy of EGFR inhibitors

The invention relates to a method for the prediction of the therapeutic

 Effectiveness of EGFR inhibitors.

Cancer is the second most common after cardiovascular disease

 disease-related cause of death in Western countries. Most

 Deaths are due to malignant tumors of the lung, the female breast, the intestine, the male prostate gland, the stomach, the ovaries, the

 Attributed to the oral cavity and the bladder. These carcinomas arise from the epithelial cells of said organs. They cause no symptoms for a long time and are therefore often recognized in an advanced, then often untreatable stage. Phenotypically, a malignant tumor is defined by its ability to grow uncontrollably and invasively, and to develop metastases in other tissues or organs. These phenotypic characteristics are the result of genetic alterations of the tumor cells, which in many cases can be detected as chromosome aberrations and DNA sequence mutations.

Genes have been identified, so-called oncogenes, whose function is directly linked to the transformation of a cell into a malignant tumor cell

Related. Tumorigenesis and metastasis is due to a disorder or alteration of these genes important for signal transduction, which leads to unregulated growth, invasions (invasions) into other tissues via the basement membranes and formation of secondary tumors (metastases). This may be present in all signaling pathways that model or alter cells, as well as interfere with the delicate balance between cell division and growth versus apoptosis, that is, programmed cell death. Among the most important signaling proteins whose coding genes are susceptible to oncogenic mutations include the receptor tyrosine kinases (RTKs). RTKs are

Cell surface proteins that are characterized by a single transmembrane domain, a intracellular domain with protein kinase activity and extracellular

 ligand-binding domain are characterized. Ligand binding leads to homo- or heterodimerization of the RTKs. Due to the sterically more favorable position of the two intracellular domains to each other is an activation of the tyrosine kinase domains with the resulting activation of Autobzw. Transphosphorylation of the carboxy-terminal region. It triggers various intracellular signal cascades that control cell division, apoptosis, angiogenesis, cell adhesion, and cell motility.

The best-characterized proteins associated with the development and development of breast cancer are the so-called ErbB family, which consists of ErbB-1, ErbB-2, ErbB-3 and ErbB-4. ErbB is the abbreviation for "erythroblastic leukemia viral oncogene." ErbB-1 is also referred to as HER1, ErbB-2 as HER2, ErbB-3 as HER3 and ErbB-4 as HER4, the abbreviation HER being used for "human epidermal growth factor

 ErbB-1 or HER1 is also referred to as "Epidermal Growth Factor Receptor" and abbreviated as "EGF Receptor" or "EGFR". For EGFR, numerous studies on different tumor entities have identified one

 Overexpression detected. Since overexpression of EGFR leads to an increase in cell proliferation, angiogenesis and rate of metastasis in the reduction of apoptosis, EGFR provides a target for inhibiting EGFR oncogenic signaling and thus tumor growth through targeted therapy. This can be done in several ways: For example, the dimerization can be blocked, the extracellular receptor binding sites can be occupied or the

Tyrosine kinase activity can be inhibited intracellularly. Already approved for therapy low molecular weight substances include gefitinib and lapatinib. In addition, therapeutic monoclonal antibodies such as cetuximab and panitumumab have been developed.

However, it has been shown that only a small proportion of patients (about <10%) respond very well to the drugs mentioned, while they show virtually no clinical effect in other patients. On the one hand the therapy is on the one hand expensive and on the other hand in some patients undesirable effects like For example, skin acne shows, it makes sense to treat only those patients who also respond to the therapy. There is therefore a great need for a method for individually predicting therapeutic success for a patient.

In addition, the expression of EGFR in clinical trials has been shown to be predictive of response to chemotherapeutic agents. Thus, decreased sensitivity of EGFR-expressing tumor cells to anthracyclines, platinum-containing therapeutics and taxanes is observed. In addition, breast cancers with an EGFR expression do not respond to the

 Hormone therapy and colon carcinoma only diminished to 5-fluorouracil.

It is known that the coding gene ErbB-1 for the human EGF receptor is located on chromosome 7p11.2 and comprises 177 kbp. By aligning the EGFR cDNA ("complementary DNA" or "cDNA" for short is a DNA that is synthesized from RNA by means of the reverse transcriptase) with the genomic sequence, it has been possible to show that the EGF cDNA All exons are flanked by GT-AG consensus splice sites as described by Callaghan and co-workers in 1993 ("A complete description of the EGF receptor exon structure: implication in oncogenic activation and domain evolution." Oncogene 1993 Nov; 8 (11): 2939-48, PMID: 8414496), the human exon 1 comprises a 5 ^'

untranslated region and sequences encoding the signal peptide and the first five amino acids of the mature EGF receptor. The extracellular region is encoded by exons 2 to 16, with the two cysteine-rich regions being encoded by exons 5 to 7 and 13 to 16. Exon 17 encodes the transmembrane region, exons 18 to 24 intracellular

Tyrosine kinase domain and exons 25 to 28 for intracellular

carboxy-terminal region of the receptor. For EGFR, an increase in expression was observed in various carcinomas, as shown in the following table. Table 1: Increase in EGFR expression. in. human tumors.

EGF as a ligand of the EGFR protein is used by many cancer cells as a growth factor to stimulate proliferation. In addition to the

 Receptor expression and activation causes mutations in the EGFR gene in many tumors. The mutations include increased gene copy numbers

 (Amplifications) of the entire EGFR gene, as found mainly in

 Glioblastomas are to be found. In mamma, oral mucosa and

 Bladder carcinomas are the much more common amplifications in intron 1 of the EGFR gene. In addition, there are deletions that result in the loss of the ligand binding domain (exons 2 to 7) and a constitutively active receptor. The constitutive activation of the EGFR kinase by point mutation in exons 18 to 21 leads to an increased sensitivity of the receptor to the tyrosine kinase inhibitors gefitinib and erlotinib

Lung carcinoma and there provide a therapy predictor for a small

Subgroup of lung carcinoma (about 6%).

An increased EGFR expression rate due to an increased gene copy number is often also based on complex changes of the chromosome 7p and the DNA sequence in this region. In the telomeric region of the EGFR amplicon of breast cancer cells there is an HERV-K segment. "HERV-K" is the abbreviation for "human endogenous retrovirus K". HERV are a subfamily of endogenous retroviruses (ERV) that have long since entered the human germline but are unable to form intact retroviruses. In the telomerwärtigen starting region of the amplicon were in the range of HERV-K retroviral section determined by quantitative PCR (qPCR) copy numbers, which were increased by factor .2-16, relative to the average gene copy number ("Average Gene Copy Number" or "AGCN") of EGFR (Mayer J, Meese EU, The human endogenous retrovirus family HERV-K (HML-3), Genomics 2002, 80: 331-43, PMID: 12213204; Sauter G et al., Patterns of epidermal growth factor receptor amplification in malignant gliomas. Am J Pathol 1996, 148 (4): 1047-53, PMID: 8644846).

The object of the invention is a simple and fast to be performed

 Propose a method by which the success of anti-tumor therapies targeting the EGF receptor can be predicted. These therapies include in particular low molecular weight tyrosine kinase inhibitors (TKIs), therapeutic anti-EGFR antibodies, ie antibodies directed against EGFR, or

 Chemotherapies with anthracyclines, platinum-containing substances, taxanes or 5-fluorouracil.

This object is achieved by taking a cell sample from a patient, amplifying one or more DNA segments in the region of the EGFR gene by means of quantitative real-time PCR and quantifying them, and the copy number thus obtained as a measure of the therapeutic to be expected Effectiveness is used. This is easy, routine, reliable and quick to carry out with the invention. According to the invention was this

demonstrated that the gene copy number of the EGF receptor correlates with the response of a cancer therapy targeting the EGFR. Efficient clinical diagnosis thus requires the reliable quantification of the gene copy number of the EGF receptor. However, determining the gene copy number of the entire EGFR gene is very expensive. Surprisingly, it has been shown that the copy number of one or more located on the p-arm of chromosome 7 DNA sections correlated with the gene copy number of the entire EGFR gene. Therefore, a prediction of the response of a therapy can be made by determining the copy number of a suitable DNA segment.

The method is preferably for prediction of the probable

Therapeutic success of therapeutic antibodies directed against EGFR or chemotherapeutic agents, in particular carboplatin and / or paclitaxel suitable. It is furthermore for the prediction of the probable therapeutic success of

 Combination therapies with anti-EGFR antibodies and chemotherapeutic agents.

Since the EGFR amplicon is dynamically regulated, it is advantageous to use different, individual DNA sections for quantitation in order to perform efficient predictive diagnostics for therapy with EGFR inhibitors. It has been shown that the exons 3, 4, 5, 7, 9, 14, 15, 16, 17, 18, 19, 20 and 21 of the EGFR gene or the HERV K1 section or HERV K2 Section of the EGFR amplicon are particularly suitable DNA sections for quantitative real-time PCR. Their copy number can be determined individually or in combination quantitatively. So far, quantifications of HERV K segments in the EGFR amplicon have not been performed in conjunction with amplifications of the EGFR gene. For example, the copy number of the DNA sequence of exon 7 and the copy number of the DNA sequence of the HERV K1 segment can be determined in each case. The measured values then become one

 Mean value formed, whereby the measurement accuracy of the method is improved.

For the duplication of the mentioned exons of the EGFR gene by means of

 quantitative real-time PCR primers are used with the sequences according to claim 3. The primers are also listed in Table 7.

For the amplification of the HERV K1 segment or the HERV K2 segment, primer pairs having the sequences according to claim 4 are used. The primers are also listed in Table 8.

Therapeutic efficacy of inhibitors against the EGF receptor is likely when the measured copy number of the particular DNA segments is greater than 1.35 individually or on average. This means that when the level is greater than 1.35, a therapeutic response of the EGF receptor inhibitors is expected and therefore therapy is recommended.

In the method according to the invention, preference is given to using a few to single cell cells which have been detached from a primary tumor or its biopsy. It is also possible to single cells, which have been detached from a primary tumor and are found in body fluids, for example in the blood, too use. This increases the accuracy, sensitivity and specificity of

 quantitative determination. The identification of the tumor cells is carried out by antibody labels. For this purpose, single or few cells are analyzed, either as circulating tumor cells from the blood, in the ascites, the

 Pleural fluid or lymph nodes, hereafter abbreviated as scattered

 Tumor cells (English term: STC for spread tumor cells). In the STC, a very early stage of metastasis is seen, with less than 0.001% of the tumor cells released from a solid tumor having the ability to form metastases. The occurrence of tumor-distant, individual STC is in contrast to the manifest metastasis reversible and therefore therapeutically treatable. Another advantage is that an analysis can be carried out even after removal of the solid primary tumor. The invasion of individual tumor cells into non-tumor tissues or organs without the formation of solid metastases is referred to as "minimal residual cancer." The present invention implies that the method shown herein may be used to diagnose the possible formation of metastases and to predict the success of a tumor Antitumor therapy can also be carried out after an already completed removal of a secondary tumor, tertiary tumor and possibly further.

It has been shown that as a sample cells from primary tumors of the breast, ovaries, oral mucosa, urinary bladder, lung and intestine, as well as lymph nodes, bone marrow, tumor cells from the blood, and / or biopsies of the above tumors, and their metastases, especially liver metastases of colorectal cancer, ascites, pleural fluid, breast aspirate (English term: "Nipple Aspirate Fluid") or smears are suitable.

By determining the number of copies of chromosome 7p and the number of copies of the EGFR gene by quantitative PCR through the use of sequences of chromosomes 2 and 10 and the LINE1 repetitive sequence, the accuracy of the method can be further improved.

The invention also includes a kit for prognosis of the therapeutic

Effectiveness of inhibitors against the EGF receptor and / or

Chemotherapeutic agents, in particular carboplatin and / or paclitaxel, wherein the kit Reagents and / or reaction vessel and / or other means for performing the method described.

The invention has been validated using the breast cancer cell line MDA-MB-468. This has the phenotype of an invasive breast carcinoma. The cell line MDA-MB-468 carries a distinct amplification in the region of chromosome 7p11-14, which includes the EGFR gene. The MDA-MB-468 cell line had an average EGCN of about 30 for EGFR, with the value 1 defined as a diploid set. By flow cytometry and anti-EGFR antibody subpopulations were isolated in a population of MDA-MB-468 cells, which showed an increased or decreased EGFR expression. The subsequent investigation by comparative genomic hybridization (English

 Technical term: Comparative Genomic Hybridization or CGH for short),

 Fluorescence in situ hybridization (abbreviated to FISH) and quantitative real-time PCR (abbreviated q PCR) showed that MDA-MB-468 was heterogeneous for the EGFR locus and the AGCN. There was a positive correlation between the AGCN for EGFR and its expression.

Three subcell lines of MDA-MB-468 were produced which differ in the average AGCN of the EGFR. By permanent EGF stimulation, MDA-MB-468 sub-cell lines with descending AGCN were generated for the EGFR gene (MDA (+): 2 to 3 gene copies; MDA0107: 3 to 7 gene copies; MDA0106 14 to 17 gene copies). They were able to confirm the association between gene copy increase and increase in mRNA expression level (Agelopoulos et al., Selective Regain of gene gene copies in CD44 + / CD24- / low breast cancer cellular model MDA-MB-468, BMC Cancer, 2010, 10 : 78. PMID: 20199686).

For the MDA-MB-468 subcell line, a multistep amplification pattern could be described, with the length of the amplicon increasing with increasing AGCN for EGFR. The amplicon of the subcell line MDA (+) formed the central element of the main amplicon. The main amplicon has been assigned two more regions telomere and centromeric of the central element. These regions showed gains in DNA from the amplicon of subcell line MDA0107. A low amplified region closed centromeric to the Main amplicon from subclone MDA0106 and MDA-WT. In the

 The telomeric starting region of the amplicon was detected in the region of a retroviral HERVK element (Mayer and Meese, The human endogenous retrovirus family HERV-K (HML-3), Genomics 2002 Sep; 80 (3): 331-43. PMID: 12213204; Sauter et al., Patterns of Epidermal Growth Factor Receptor Amplification in Malignant Gliomas., J Pathol, 1996 Apr; 148 (4): 1047-53., PMID: 8644846) determined by qPCR copy numbers relative to the AGCN of EGFR Factor 2 to 16 were increased.

In cells with the lowest AGCN for EGFR, a central element of 561,146 bp (base pairs) could be identified in the corresponding amplicon of the EGFR gene. In cells with higher AGCN this central element is extended to the telomeric side with 147.444 bp. Further extensions were found in cells with the highest AGCN. In this case, the amplified region shows a small additional portion of the centromere side of the central element of 623,560 bp. The entire amplified region extends from heading 54.475.287 to heading 55.807.437. This included, in each case, the full-length EGFR gene, with the exception of the MDA-MB-468 sub-cell line with near diploid EGFR gene copy number. The amplicon of subcell line MDA (+) showed no increased AGCN for EGFR after exons 4 to 7.

Figure 1 a shows the structure of an EGFR amplicon S1 with a high EGFR gene copy number on chromosome 7p. Each nucleotide of the amplicon is represented as a dot, the abscissa showing the position in the sequence. The ordinate shows, as a logarithmic ratio, the DNA copy number of normal DNA for varying the tumor DNA copy number. The amplicon consists of three main parts, with the boundaries of the amplicon shown with the vertical lines 1 and 3. Line 1 shows the border of the amplicon to the telomeric side, line 3 to the centromeric side. The position of the EGFR gene is indicated by the middle line 2. The three parts of the amplicon are thus the actual EGFR gene and its two extensions to the telomeric side or

centromere side. To the left of line 1 or the telomeric extension of the amplicon, the baseline of the logarithmic ratio of the DNA copy number, which is marked with 4. The logarithmic ratio is here at about 0, ie there is the same copy number of DNA in tumor cells and normal cells. In contrast, the logarithmic ratio of the DNA copy number of the amplicon from tumor cells to normal cells is between -2 and -4, ie there are several copies of this sequence section.

FIG. 1b shows the structure of an EGFR analog S3.2 with a low EGFR gene copy number on chromosome 7p. It also consists of the three main parts, whose boundaries are represented by vertical lines. The position of the EGFR gene is indicated by the middle line 2. The left line 1 shows the border of the telomeric extension, and the right line 3 the border of the centromeric extension of the EGFR amplicon. For the amplicon in cells with low EGFR gene copy number, the centromeric extension is significantly shorter compared to cells with high EGFR gene copy number.

Figure 2 shows the structure of the amplicon at different copy numbers of the EGFR gene. The abscissa shows the position in the sequence. The ordinate shows the logarithmic ratio of the DNA copy number of normal DNA to the variation of the tumor DNA copy number. Here, the left part towards the telomeric, the right part towards the centromeric side. Curve 1 1 shows the amplicon with 2 to 4 EGFR gene copies; Curve 12 the amplicon with 6 copies; Curve 13 the amplicon with 8 copies; Curve 14 the amplicon with 12 copies and curve 15 the amplicon with 30 copies. The vertical black lines indicate the positions of the EGFR exons.

The EGCF gene of single or few cells was determined by qPCR assays (quantitative PCR assays). The qPCR assays were performed from the 5 ^' end of the EGFR amplicon and for the EGFR gene with its exons 4 to 21. The qPCR was optimized by a SYBR green assay with 58 sequences for the determination of EGFR amplification. The

The significance of the qPCR assays was between 98.07% and 99.02%, the average being 98.78% and the standard deviation being 0.36.

Table 2: AGCN for various MDA-MB-468 subcell lines.

Exon 4 exon 7 exon 9 exon 15 exon 21 MDA low 2.18 2.37 2.55 1, 68 2.03

MDA-Re1 6,41 5,67 5,21 5,44 6,33

MDA-Re2 28.51 20.33 22.56 25.99 21, 97

MDA-WT 45.57 36.59 40.50 50.80 42.42

Table 2 shows the results of quantitative PCR assays of exons 4, 7, 9, 15 and 21 of the EGFR gene for various MDA-MB-468 subcell lines. Here, "MDA-WT" refers to the wild-type, "MDA-low" cells with low amplification of the EGFR gene and "MDA-Re1" and "MDA-Re2" cell clones with two different amplifications of the EGFR gene. The AGCN of the EGFR gene determined via the various exons (exons 4, 7, 9, 15 or 21) were in a comparable framework (Table 2).

Table 3: Quantitative single-cell PCR of exons 7 and 9 from bone marrow and blood samples. H, strong, relative amplifications of the EGFR gene; L, weak, relative amplifications; SD, standard deviation.

Table 3 shows the results of qPCR analyzes for exon 7 and 9 in individual tumor cells from blood or bone marrow samples from patients with metastatic breast cancer. Measurements of the relative EGFR gene copy number of individual tumor cells are shown. Strong, relative amplifications of the EGFR gene are associated with an "H", weak, relative Amplifications marked with an "L".

The comparison of the median numbers of relative EGFR gene copies of non-tumor cells and tumor cells measured via exons 7 or 9 showed, for example, that the median was at least 1.35 for tumor cells. It is to be assumed that also in the other exons 3, 4, 5, 14 to 17 and 19 to 21 of the EGFR gene and the HERV K1 and HERV K2 DNA segment, the median tumor cells have at least 1.35 amounted to.

Table 4: In vitro therapy resistance of breast cancer cells to gefitinib (abbreviated as Ge) and lapatinib (abbreviated to La).

Table 4 shows the in vitro therapy resistance of breast cancer cells derived from the same cell line. Cells with high AGCN of the EGFR gene, namely with 30 copies, were wild-type cells designated "WT." Cells with medium AGCN, 10 copies, are "reamplified" and cells with suppressed AGCN, viz 2 to 4 copies are designated as "suppressed." For each cell line, an approach was used in each case in the presence or absence of the

 Growth factor EGF is cultivated, which is able to activate EGFR and thus, inter alia, stimulates cell proliferation. The cell lines labeled with the suffix "- EGF" were cultured in the absence of the EGF growth factor Absence of EGF in EGF-dependent tumor cells, among other things, reduces proliferation compared to EGF-dependent tumor cells cultured in the presence of EGF comparison of

Cell culture approaches with or without EGF in the cell culture medium can be shown in how far the investigated tumor cells actually depend on EGFR as

Growth factor receptor were. The cells were treated with the EGFR inhibitors gefitinib, in the columns referred to as "Ge", and lapatinib, referred to in the columns as "La", at different concentrations. The columns each show the measured values for the inhibitor at a specific concentration. The column Ge 5 thus displays the measured values for gefitinib at a concentration of 5, the column Ge 10 the measured values for gefitinib at a concentration of 10 and so on. Both

 Measured values are normalized proliferation rates of the respective breast cancer cells.

The breast cancer cell line MDA-MB-468, which is considered to be a cell model of metastatic breast cancer cells, and three subcell lines of MDA-MB-468 revealed differences in both the structure of the amplicon and the average copy number of the EGF gene (AGCN). Detect receptor. The treatment of these cell lines showed resistance to treatment with the low-molecular EGF inhibitors gefintinib and lapatinib, respectively, when their EGFR gene copy number was relatively low.

In accordance with the present invention, for routine clinical diagnostics and prognosis, the copy number for HERV-K of the EGFR amplicon or exons 7 and 9 of the EGFR gene is determined. Here can depending on the desired

Accuracy of one of the three gene sections mentioned or two or all together are determined in terms of their copy number. As shown above, the median of readings in non-tumor cells is approximately 0.9. All medians above 1, 35 of exons 7 or 9 represent a multiplication of the EGFR gene. For readings greater than 1.35, response to EGFR inhibitors is likely.

embodiments

The methodical embodiments described here were listed on the one hand for the validation of the invention, on the other hand for the application part of the invention. The applications essential to the invention include the processing and detection of disseminated tumor cells and the qPCR using the specific primer pairs.

1.1. Quantitative Real-Time PCR Quantitative Real-Time PCR (qPCR) is a method of amplifying DNA based on the principle of conventional polymerase chain reaction (PCR), which additionally allows the quantification of the formed DNA in real time. The quantification is carried out at the end of each PCR cycle via the fluorescence of a reporter molecule, which increases in proportion to the amount of DNA formed. The method is based on the assumption that the first significantly measurable increase in fluorescence is proportional to the amount of starting material used. This requires a maximum efficiency of the reaction, which corresponds to a doubling per PCR cycle. The correct quantification can therefore only be carried out in the exponential part of the PCR reaction, which often lasts only a few cycles. As reporter molecules mainly the DNA intercalating dye SYBR green as well as double labeled hydrolyzing probes (TaqMan probes) were used.

The quantitative real-time PCR was performed in the Mastercycler S Realplex (obtained from Eppendorf, Hamburg) using either the QuantiTect SYBR green master mix (obtained from Qiagen, Hilden) or the qPCR MasterMix Plus, No ROX (supplied by Eurogentec, Liege, Belgium ) for TaqMan sample assays. In a qPCR, unlike in a conventional PCR, the number of DNA molecules formed is measured with the help of fluorescent dyes at the end of each cycle.

Subsequently, a melting curve analysis was carried out for SYBR green assays, by means of which the fragment length (s) and the specificity could be determined indirectly via their melting temperature. By continuously raising the temperature from 60 ° C to 90 ° C, the DNA was melted to form single-stranded DNA. The dye SYBR green was released, which was registered as a fluorescence decrease. Since non-specific primer dimers had a lower melting point than the double-stranded DNA of specific PCR products, a distinction became possible. The height of the peak of the melting curve, ie the peak, also gave information about the amount of the fragment formed and thus about the initial concentration of the DNA or cDNA (Ferre F., Quantitative or semi-quantitative PCR: Reality versus Myth. PCR Methods Applications 1992; 2: 1-9, PMID: 1490169). Due to the sensitivity of the method, all samples were measured in triplicate to to be able to identify deviating measured values. For the absolute quantification, calibration lines for the target gene as well as the references were measured in each PCR run. For quantification of DNA, 15 pg to 10 ng of DNA was used in a serial 1: 4 dilution to measure the calibration line. As a template for the quantification of DNA was respectively

 Leukocyte DNA used. It was necessary to ensure that the measured DNA levels were within the calibration line, as this was the only way to assume a linear course of the PCR reaction. For the

 Calibration line, the linear regression of the data points was determined in each case.

In order to achieve a reproducible measurement of AGCN for EGFR, the assay was based on TaqMan probes and using two

 Reference regions developed. As tumors progressively accumulate aberrations, including point mutations, deletions, amplifications, and additions or reductions from chromosome arms or whole chromosomes to polyploid chromosome sets, the selection of reference regions was crucial. Selection of reference regions was made based on the array data and subsequent review (Naylor et al., High resolution genomic analysis of sporadic breast cancer using array-comparative comparative genomic hybridization., Breast Cancer Res. 2005; 7 (6): R1 186-98 PMID:

 6457699). The loci on chromosome 2 and chromosome 10 showed for

Breast cancer small aberration rates of <10%. The EGFR gene locus showed DNA gains in> 55% of all analyzed array CGHs. In addition to the primer and TaqMan probe design, the primers were checked for their efficiencies using a calibration line in a SYBR green assay.

The mixture using QuantiTect SYBR green master mix comprised: 7.5 μΙ 2x master mix, 0.4 μΙ primer forward (100 pmol / μΙ), 0.4 μΙ primer backward (100 pmol / μΙ), 2 μΙ DNA (5 ng / μΙ), ad aqua dest. 15 μΙ. The corresponding

Protocol of carrying out the Quantitative Polymerase Chain Reaction (qPCR) is summarized in Table 5. Table 5: Quantitative Polymerase Chain Reaction (qPCR) protocol.

The following Tables 6 to 12 show the sequences of the oligonucleotides used for the various analyzes. These have a characteristic name. In this case, uniform forward primer or sense primer with the term "F" and reverse primer or antisense primer with the suffix "R" are marked. Additional primers are labeled with the prefix "N." In Tables 7 to 10, the suffix "F0" represents a telomere side, and the suffix "E0" indicates a centromere-side amplicon boundary., Table 6 shows the quantification of chromosome 2, the chromosome 10 and the EGFR by TaqMan assay.

Table 6: Oligonucleotides used for the quantitative analysis of DNA gene copies. "P" means "double-labeled oligonucleotide" at the 5 ^' end with the fluorescent dye 6-FAM-phosphoramidite "[6-FAM]" and at 3 ^' - End with the 3 ^' black hole quencher 1 a against 6-FAM phosphoramidite.

For the precise quantification of gene copy number of single cells after WGA (short for "whole genome amplification", linear amplification of the template DNA) and the distinction between polyploidy and distinct gene amplifications of the EGFR, a further reference gene concept was developed, which was based on an assay with a single reference gene, the repetitive LINE1 sequence, which is present in the human genome in approximately 1,000 copies, allowing a more accurate measurement of DNA content in a cell after WGA than the use of diploid regions such as chromosome 2 and chromosome 10 Due to the high number of copies of the LINE1 a cost-effective protocol with the intercalating DNA-dye SYBR green could be established

Reference assays provided scope for a second parallel assay in the EGFR gene. This allowed verification of the reproducibility of single cell WGAs at the EGFR gene locus in the same qPCR run. The efficiency of the PCR was 98.8% for the assay with MDA-MB 468 DNA carrying 30-fold amplification and 98.6% with leukocyte DNA as diploid control. The efficiencies of PCR were thus comparable for multiple and single copies, demonstrating the reliability of the protocol for quantification. For the LINE-1 assays, the mean CV was 9.9%. AGCNs for the EGFR gene after single cell WGA for diploid cells ranged from 0.2 to 1.7. At an expected value of 1, the highest measured value corresponded to a deviation of 70% (0.7 CTs (abbreviation for the English term "cycle Threshold for the Cycle Threshold), and the lowest reading of 80% (2.25 CTs). The coefficient of variance of the measurement averaged 1.5%.

Table 7: Oligonucleotides used for the quantitative analysis of DNA gene copies.

Table 7 shows the SYBR green assay-based quantification of LINE1 and EGFR. The forward and reverse primers suitable for quantitative determination of copy number are shown for the exons 3, 4, 5, 7, 9, 14, 15, 16, 17, 19, 20 and 21 of the EGFR gene. Table 8: Oligonucleotides used for the quantitative analysis of DNA gene copies: SYBR green Assay-based validation of tiling array data for MDA-MB-468 WT, abbreviated as WT.

Name Sequence (5 '3') Annealing Amplicon SEQ ID

 Temperature [Bp] NO

[° C]

 WT-F01-F CAGTCAGCACATTGACACTGG 60 108 37

WT-F01-R AAGTGTGGACCAGCTCTGTCTC 38

WT-F02-F AG C C AG CTCTTTG ATTCTTG G 60 109 39

WT-F02-R CA AG AG AA ACCTATTG CAA G C 40

WT-F03-F TCTGTAGCTCATGGATTACTTGG 60 209 41

WT-F03-R TACCCGTGGGCTGTGTACC 42

WT-F04-F GAATCCAGGTCAAACCATGTG 60 105 43

WT-F04-R TACACAGATGCCTGCTCAAAG 44

HERV-K1-F CCAAAGAAGAGACTCTGAGAGGAC 60 59 45

HERV-K1-R AGTCTTGACATGGCTGTTATTGAG 46

HERV-K2-F G AAATCCAAG CTGTATGTTCAATG 60 268 47

HERV-K2-R ATTAGAAGTCAGCCTAATGCCATC 48

WT-F05-F GGCTCCCATGATTCTCCTG 60 219 49

WT-F05-R G G CA CA CTG A G CATTAAG 50

N-WT-F01-F AACCAGCCATATTCCATTCATC 60 212 51

N-WT-F01-R GCCCAAAGTCAGGTCATATACAG 52

N-WT-F02-F TCACCCAAGTCGTGTATGTCAG 60 251 53

N-WT-F02-R CCACTCTCGAAATTGTTCAGC 54

N-WT-F03-F AAGAAAGGTGATGAGCATGGAC 60 50 55

N-WT-F03-R CCCTTAAATTTGAGAACAAGTGG 56

N-WT-F04-F G A AA G CATTTCA G CCTTTCA C 60 174 57

N-WT-F04-R CACATGTTCAAATG AATTG ATG C 58

N-WT-F05-F TTCTTTGCAGATTAAATTGTTTG 60 1 11 59

N-WT-F05-R AGAGGAATAGGCAGATCAATGG 60

N-WT-F06-F ACTGTTCTTGGGTAGATTGTTCTG 60 257 61

N-WT-F06-R TGTTGGTCGTTGTATTTGTTTC 62

N-WT-F07-F TTTAG AAG ATG GATTG GTG AGG AG 60 50 63

N-WT-F07-R CCTGTTCTTGTTCTGACCATTG 64

WT-E01-F CTCCAGAAGCCCTGACATTG 60 91 65

WT-E01-R CTTCCTCCTATCCCTCACTGC 66

WT-E02-F CTG G GAG G ACAAG GTAAGAG G 60 208 67

WT-E02-R AATGGTG GAGTCACAG CTCAC 68

N-WT-E01-F GGGACCACATCTTACTCTCCAG 60 149 69

N-WT-E01-R ACAGCACCTTCCTCCTTACATC 70

N-WT-E02-F AGGAGAGTGCAGTGAGGGATAG 60 71 71

N-WT-E02-R ACAGCACCTTCCTCCTTACATC 72

N-WT-E03-F TACCAACAGTTCTCCCTCATCC 60 144 73

N-WT-E03-R AGTCTG CGGTGTAG AG G AAATC 74

N-WT-E04-F ATATAGATTCGGCAGCCTTCAG 60 120 75

N-WT-E04-R TCCAATATCCAAGAGGCAGAAC 76

N-WT-E05-F TCCTCAAAGATTGGTTTGTTTG 60 288 77

N-WT-E04-R TCCAATATCCAAGAGGCAGAAC 76 Table 9: Oligonucleotides used for the quantitative analysis of DNA gene copies: SYBR green Assay-based validation of tiling array data MDA-MB-468 0106, abbreviated as 0106.

Table 10: Oligonucleotides used for the quantitative analysis of DNA gene copies: SYBR green Assay-based validation of tiling array data for MDA-MB-468 0107, abbreviated 0107.

Table 1 1: Oligonucleotides used for the quantitative analysis of DNA gene copies: SYBR green Assay-based validation of tiling array data for MDA-MB-468 +, abbreviated MDA +.

Table 12: Oligonucleotides used to characterize the telomere-directed amplicon border of MDA-MB-468 WT, abbreviated WT.

1.2. evaluation

Depending on the experimental approach, two different methods for absolute or relative quantification were used to evaluate the data. Basically, the two methods differed by the use of a

Calibration line (Rutledge and Cote, Mathematics of quantitative kinetic PCR and the application of Standard curves, Nucleic Acids Res., 2003, Vol 31, No. 16 e93, PMID: 12907745) for the absolute quantification that results from relative quantification by a single Reference sample, to which the samples were respectively related relatively. Relative quantification (PfaffI, Real-time RT-PCR: New approaches to exact mRNA quantification, BlOspektrum 1/04, Volume 10, Holzapfel and Wickert, Quantitative Real-Time-PCR (qRT-PCR) 2007 Volume 37, No. 2, pp. 120-126) assumed that the efficiencies of the assays to be compared were identical. The efficiency of the assays was determined by a series of calibration over the slope. In each case leukocyte DNA was used as control for the quantification of DNA. Since in this type of calculation the control was considered as an arbitrary constant, this was not included in the error calculation. The error calculation was carried out as follows: The value CV (coefficient of variation) corresponded to the mean value for the absolute quantification (Pfaffl, Realtime RT-PCR: New Approaches to Exact MRNA Quantification.) BlOspektrum 1/04, Volume 10: Holzapfel and Wickert, Quantitative Real-Time PCR (qRT-PCR), Biology in Our Time, 2007, Vol. 37, No. 2, pp. 120-126), was used to measure calibration lines for the target gene and the references in each PCR run. For quantification of DNA, 15 pg to 10 ng of DNA was used in a serial 1: 4 dilution to measure the calibration line. Leukocyte DNA was used as template for the quantification of DNA. It was necessary to ensure that the measured DNA levels were within the calibration line, as this was the only way to predict the linearity of the PCR reaction. The linear regression of the data points was determined for the calibration line.

1.3. Cell culture conditions

All cell lines were cultured in sterile culture bottles from Nunc (Wiesbaden). The cultivation took place in Hera150 incubators (Heraeus Kendro, Langselbold) at 37 ° C. in a water-saturated atmosphere with 5% (v / v) C0 ₂ . The cell lines were passaged one to two times a week, depending on the rate of cell division, under sterile conditions at a confluency of about 80%. For this, the adherently growing cells were washed with PBS at 37 ° C. and then removed from the culture dish with trypsin / EDTA solution (0.05% / 0.02% (w / v)). The process was done by adding fresh preheated

Complete medium stopped and seeded the resuspended cells in a density of 20% to 30%. For longer storage of eukaryotic cells, the cells were frozen in liquid nitrogen at -196 ° C. To prevent the formation of ice crystals in the cells were added to the cells by adding the strong hygroscopic dimethylsulfoxide (DMSO) slowly removed the water. 2x10 'cells were resuspended in 1 ml of freezing medium (10% v / v) DMSO, 90% (v / v) medium, transferred to Kryotubes (Nunc, Wiesbaden) and cooled to -80 ° C. After 24 h (the unit "hour" is always abbreviated as "h") were the

 Cryotubes stored in liquid nitrogen. To re-culture the cryopreserved cells, the cells were washed after thawing (37 ° C in a water bath) with complete medium to remove the toxic DMSO. The cells resuspended in the complete medium were seeded in T75 cell culture bottles.

2.1. DNA quantification methods for the analysis of EGFR amplicon in

 Tumor cells and fine tiling array CGH

The method of CGH (Comparative Genomic Hybridization) is used for

 specific detection of changes in the DNA copy number. The method is based on the simultaneous hybridization of equal proportions of different fluorescently labeled test (tumor DNA) and reference DNA (normal DNA) on metaphase chromosomes or on microarrays with cDNA clones, BAC clones or oligonucleotides. Tumor and reference DNA were simultaneously hybridized to normal metaphase chromosomes (classical CGH), BAC clones, cDNA or oligonucleotides (array CGH). Both the sample DNA and reference DNA (Nimblegen) were probed before hybridization

Fluorescent dyes labeled to be quantified after hybridization by reading on a microarray scanner can. The labeling of the sample DNA was carried out with Cy3 (channel 532 nm), the reference DNA with Cy5 (channel 633 nm). Fine Tiling Array CGH used arrays created to our specifications. Without the proprietary quality controls, 395,000 oligonucleotides were available per array, with a maximum length of 50 to 75 bases and a tiling (overlap) of 15 bases, with a new oligonucleotide starting every 15 bases

range of about 5.7 megabases. The design of the array was performed by Nimblegen (Wisconsin, USA). The

Oligonucleotides were designed for a uniform hybridization temperature of 76 ° C set. These should be specific to the human genome. This, however, meant that in some areas with highly conserved or repetitive sequence motifs no clear sample design was possible, so that gaps in the sequence to be imaged occurred. Based on data from older arrays of BAC clones, our array design included an area of about 4.7 megabases on chromosome 7 in the region of the EGFR gene, as well as 177 kilobases

 Chromosome 2 and 196 kilobases on chromosome 10, the two areas where the reference assays of our quantitative real-time PCR are based (selection based on Naylor et al., High resolution genomic analysis of sporadic breast cancer using array-based comparative genomic hybridization Breast Cancer Res. 2005; 7 (6): R1186-98. PMID: 16457699). This array layout allows high-resolution imaging of the sequence areas that were previously examined using quantitative real-time PCR. As samples, leukocyte DNA was used as

 Normal reference, three tumor cell lines amplifying the EGFR gene (A431, BT20, MDA-MB-468), the hemizygous tumor cell line MCF-7 carrying only one copy of the EGFR gene, three subclones of the MDA-MB-468 cell line with different high EGFR gene copies, as well as Whole Genome Amplification (WGA) products of this line of 500 cells and six single-cell WGAs used. Each of these samples required 2.5 μg of high molecular weight DNA at a concentration of about 250 ng / μΙ. In this case, the ratio of the optical densities of the absorption maximum of nucleic acids, measured at 260 nm, to the absorption maximum of proteins, measured at 280 nm, should be> 1, 7, and make a statement about the Proteinfreiheit the nucleic acid solution. The ratio of the optical densities at 260 nm to 230 nm should be> 1.5, and a statement about the purity of an RNA solution against certain impurities with organic substances such. Phenolates, thiocyanates or others having an absorption maximum at 230 nm.

2.2. Hybridization of Fine Tiling Array CGH

Sample preparation, labeling, hybridization, and the

Data collection was performed by the company Nimblegen. 2.3. Evaluation of Fine Tiling Array CGH

The obtained data sets were normalized with the Quantsmooth algorithm using the regions of chromosome 2 and chromosome 10, and the signals were smoothed. The normalization and adaptation of the data were carried out at the Institute for Bioinformatics of the University of Hamburg (Dr. H. Pospisil)

 "Quantsmooth" is part of an R software-based software package, and then the algorithm's smoothing function was used to detect the maximum changes in the arrays' ascents and descents, which were then defined as the start and end points of the respective amplicons ,

3. Detection of EGFR gene amplifications in breast carcinoma and

 metastatic tissues

EGFR is overexpressed in up to 95% of breast cancers, and is in some studies associated with an unfavorable prognosis of the further course of the disease (overview in: Wolfram Dempke, Molecular Therapy in Hematology, Oncology, Verlag Unl-Med, Bremen, ISBN: 3837410218). In order to achieve a reproducible measurement of AGCN for EGFR, assays based on TaqMan probes and using two

Reference regions developed. As tumors progressively grow, they accumulate more and more genomic aberrations, including point mutations, deletions, amplifications, or gains or losses

Chromosome arms or whole chromosomes to polyploids

Belonging to sets of chromosomes, the selection of reference regions was of crucial importance. To minimize the likelihood of aberrant measurements between the references that excluded assured quantification, these were determined based on the evaluation of 65 high resolution array CGHs (Wang et al., DNA amplification method tolerant to sample degradation, Genome Res Nov; 14 (11): 2357-66.

15520297). The panel of samples analyzed included 47 primary ones Breast and 18 breast cancer cell lines. The array system had an average resolution of 0.9 Mb. The selection of the reference regions was made based on the array data and a subsequent literature search. The loci on chromosome 2 and chromosome 10 showed low aberration rates of <10% for breast cancers. The EGFR gene locus showed DNA gains in> 55% of all analyzed array CGHs. After the primer and TaqMan probe design, the primers were analyzed using a

 Calibration line checked in a SYBR green assay for their efficiencies. There were efficiencies of 98.2% (chromosome 2), 98.4% (chromosome 10) and 98.7% (EGFR). Melting curve analysis and checking the PCR products on an agarose gel excluded primer mismatching and dimer formation (Sönke Meyer-Staeckling, Investigations on the structure of an amplicon in intron 1 of the human epidermal growth factor receptor: first mutation in the

 Breast cancer formation. Dissertation, University of Hamburg, 2009).

4. Determination of the number of copies of the EGFR gene in premalignant tissue of the oral mucosa and the female mammary gland

Carcinoma of the oral mucosa is the most common form of cancer in the head and neck area. Every year, about 10,000 people fall ill in Germany (ages between 55 and 65 years). Men are affected 3 times more frequently than women. The mortality of mucosal carcinoma is high. The median relative 5-year survival rate is below 50% and has not been significantly improved despite some advances in therapy over the last 2 decades. This is mainly because two-thirds of the cases are diagnosed in advanced stages, often with lymph node metastases. Oral leukoplakia is the most common oral intraepithelial neoplasia. It is considered a precancerous condition of oral mucosa. Early detection at a stage where neoplasia is still non-invasive and therefore intraepithelial would significantly improve prognosis.

Like all carcinomas, the oral mucosal carcinoma also develops Changes (mutations) in the DNA and aberrations of the chromosomes. in the nucleus. In a work by Lippman et al. (Oral Cancer Prevention and the Evolution of Molecular-Targeted Drug Development, J. Clin. Oncol., 23, 346-356, 2005), the results of various working groups worldwide have been assembled into a progression model. At the beginning of the development of oral intraepithelial neoplasia, activation of the EGFRs and of the enzyme telomerase prevents the shortening of the telomeres of the chromosomes leading to cell death and thus favors the transmission of mutations into daughter cells. Both events may be linked together.

It has been described that activation of the EGFR with a chromosomal aberration at the EGFR locus on the short arm of chromosome 7

 Werkmeister et al., The erbB oncogenes as prognostic markers in oral squamous cell carcinoma, Am J. Surg., 172, 681-683, 1996, Werkmeister et al., Clinical relevance of aberrations of erbB-1 and erbB- 2 oncogenes detected by competitive differential polymerase chain reaction in oral carcinomas, Oral Oncology 36, 100-105, 2000. PMID: 10889928). Already in leukoplakia, an oral intraepithelial neoplasia (OIN), these are often detectable if it results in a carcinoma.

Evidence of aberration occurs with an established laboratory method, fluorescence in situ hybridization, abbreviated to FISH. This requires about 4 thick sections of the paraffin-embedded tissue of the leukoplakia. In fluorescence in situ hybridization, the DNA of the tumor cells is examined directly in tissue association, i. In this study the histology of the extracted leukoplakia and its surrounding tissue is preserved. The finding for the molecular genetic study FISH can thus be directly assigned to specific cells in tissue association ("in situ" analysis).

The evaluation of the FISH turned out to be red and green punctiform signals in the cell nucleus. The signal is generated by the attachment of so-called DNA probes, which in this case are complementary to the DNA sequence of the EGFR gene and the centromeres of chromosome 7, caused. Each DNA probe carries dyes that have been excited by a special excitation wavelength of the microscope for light emission (fluorescence), and thereby under the microscope produced visible punctiform signals. The finding was taken immediately using a sensitive CCD camera and stored as an image file on a computer. The method of FISH is very sensitive and allows the detection of fewer cells with an aberration of the EGFR among thousands of unaltered cells.

In addition, we were able to show that in about 1/3 of the breast cancers and in% of the surrounding normal morphological tissue an allelic imbalance (AI, Allelic Imbalance) occurs in the EGFR gene. Fine mapping of this gene region with other microsatellite markers revealed that AI was preferentially present at this locus (84% of all AI cases). A quantitative PCR assay showed that the AI was due to amplification, which also led to overexpression of the EGFR. In addition to the premalignant precursors ADH (atypical ductal hyperplasia) and DCIS (ductal carcinoma in situ) in the breasts of female patients also showed their

 Lymph node metastases have the same mutation in the EGFR gene locus. The Kaplan-Meier analysis of the follow-up data revealed a short, metastasis-free interval for patients with AI in the EGFR gene locus. It can therefore be assumed that AI in the EGFR gene locus is an early event in the development of aggressive breast cancer.

5. Determination of the number of copies of the EGFR gene in individual tumor cells in body fluids

5.1. Processing and detection of tumor cells in bone marrow aspirates or

 blood

The bone marrow removed by puncture from the upper iliac crest and / or sternum was aspirated into heparin-containing monovettes. The mononuclear cells were separated by Ficoll density gradient centrifugation (density 1, 077 g / mol) at 800 xg for 30 min at room temperature. Interphase with the mononuclear cells was removed and washed with 50 ml of PBS for 10 min at 1400 rpm. Depending on the erythrocyte fraction, an additional erythrocyte lysis according to the instructions of Manufacturer (Whole Blood Erythrocyte Lysing Kit, R & D Systems, Minneapolis). Of the mononuclear cells, 7 × 10 ⁵ cells were centrifuged for 3 minutes at 1 000 rpm on a microscope slide (Superfrost Plus, Fischer) (cytospins). The cytospins were dried overnight and frozen at -80 ° C until further use.

The tumor cells to be examined from a blood sample were enriched in a two-step process up to approximately 20,000 times compared to the blood cells. In the first step epithelial cells were enriched in a density gradient centrifugation with 1068 NycoPrep® (Nycomed, Luxembourg) as a density medium. The density gradient centrifugation is carried out as in Brandt and Griwatz (Two-layer buoyant density centrifugation gradient for enrichment of prostate-derived cells and cell clusters from peripheral blood., Clin. Chem. 42, No. 1, 1996, pp. 1881-1882, PMID : 8906098). The accumulation of epithelial cells over the blood averaged 20-fold. While the erythrocytes were largely depleted, leukocytes were only 90% to 98% depleted, so a further enrichment step was necessary. In a second enrichment step, cytokeratin-positive cells were enriched with an immunomagnetic method. Cytokeratin 8 and 18 are cytoskeletal proteins that are specific for epithelial cells. With the MACS® system (Miltenyi Biotec, Bergisch Gladbach), which has superparamagnetic microbeads with a diameter of less than 100 nm in diameter, and to which corresponding antibodies were bound, enrichments could be made to the antibody-antigen binding depending on the quality Factor 1 .000 be achieved. Overall, epithelial cells from the blood could thus be specifically enriched by about 20,000-fold (PhD thesis Cord Griwatz, 1996, Westfälische Wilhelms-Universität Münster). The immunomagnetic

Cell isolation is also described in Griwatz et al. (Immunological Enrichment Method for Epithelial Cells from Peripheral Blood, J. Immunol., Meth, 183, 1995, pp. 251-265, PMID: 7602148) (see also: German Patent B. Brandt DE 102 17 102 B4 2005.04.14 ).

Fluorescent-labeled antibodies were used to detect the tumor cells in cytospins from bone marrow or from blood. For this purpose, the mononuclear cells for 10 min at room temperature with a 4%

 Paraformaldehyde or 3.5% formalin solution, and then washed once with PBS (phosphate-buffered saline). After 5 min permeabilization of the fixed cells with 0.2% (v / v) Triton X (DAKO, Hamburg), the cells were washed three times for 2 min in PBS, and for 20 min with DAKO Blocking Solution (DAKO) or with AB-PBS against unspecific

 Antibody binding blocked. For incubation with the primary-labeled antibodies carried out at room temperature, one of each was tested against

 Cytokeratins targeted antibodies A45 / CY3 (1: 300) (Micromet, Munich) and CK5 / 8 oyster red (1: 500) (Progen Scientific GmbH, Heidelberg) together with CD45 / Alexa488 (1: 150) (Denovo Biolabels, Münster ) which is directed against the leukocyte-specific antigen CD45. After washing once in PBS, nuclear staining with DAPI was performed for 2 minutes at room temperature

 carried out. After washing twice with PBS, the cells were fixed in PBS with a coverslip and kept dark at 4 ° C until use.

5.2. Transfer of the cells into PCR reaction vessels

In order to exclude loss of cells or parts of the cell nucleus to be transferred, special rods cut from 0.19 to 0.23 pm were used as cell carriers (Paul Marienfeld GmbH & Co. KG, Lauda- Königshofen, on request) , These rods were coated with a hydrophobic silane prior to use to prevent irreversible binding of the DNA liberated from cell lysis to the glass surface.

To prepare the silanization, the rods were swirled in a 1: 1 mixture of NeoDisher (Dr. Weigert GmbH, Hamburg) and HPLC-purified water in a strongly alkaline medium for 30 min at 80 ° C to 90 ° C, dried and for 1 h in concentrated sulfuric acid pivoted to impurities and

Remove grease residues from the surface. After residue-free removal of the sulfuric acid by HPLC-purified water, the rods were 15 minutes at 1 15 ° C in a heating cabinet dried. Silanization was by panning in a 0.5% (v / v) solution octadecyltrichlorosilane in octane fraction (Fluka,

 Erlangen) for 2 at room temperature. Unbound silane was through

 Panning in ethanol> 99.9% (v / v) for one hour at room temperature. Finally, the ethanol was removed with a sharp jet of HPLC-purified water from a squirt bottle of each rod individually. Of the

 Lyse buffer consisting of 0.25% (w / v) sarcosyl, 2 M guanidine thiocyanate, 0.01 M sodium citrate (pH 7.0), 1% (v / v) dimethylsulfoxide and nuclease-free water contained detergents and sulfur-bridging substances. The buffer was aliquoted at -20 ° C. Each aliquot was freshly added with 60 mM dithiothreitol as antioxidant prior to use (modified according to Hartshorn et al., Rapid, single-tube method for quantitative preparation and analysis of RNA and DNA in small as one cell samples. BMC Biotechnol : 2 PMID: 15649321). To achieve efficient cell lysis, 20 μl lysis buffer was added to one end of the rod (0.2 μΙ diluted 1:10

 Lysis buffer) and dried at room temperature. The silane coating caused a concentration of the salts of the lysis buffer in a narrow space to a so-called lysospot. On the lysospot, the cell to be transferred was deposited in the smallest possible volume of liquid. The reaction vessel was frozen at -80 ° C. for> 20 min to increase the efficiency of the lysis (Spits et al., Whole-genome multiple displacement amplification from single cells, Nat. Protocols 2006; 1 (4): 1965-70, PMID: 17487184). , Subsequently, 1 μl of 1 μl of diluted protease (Qiagen, Hilden) was added to the lysate and the reaction vessel was incubated for 15 min at 50 ° C. (activation of the protease) and for 15 min at 70 ° C. (inactivation of the protease).

5.3. Whole Genome Amplification (WGA) by Multiple Displacement

 Amplification (MDA)

The WGA of the Genomiphi kit is based on the isothermal amplification of DNA by the strand-displacing property of phi29-DNA polymerase. The almost circular closed polymerase was combined with 3-exonuclease protected random hexamer primers bearing two thiophosphate modifications on the sugar backbone of the 3 ^' end. The WGA product is double-stranded and high molecular weight (> 10 kb). The average product quantities were included

 Single cells with a genomic weight of 6 to 7 pg at 2.5 to 3 pg. From 1 ng of genomic DNA, 5 to 7 pg of product was formed. After

 Protease treatment, the sample was heated according to manufacturer's instructions for 2 min at 95 ° C and immediately placed on ice water to form single-stranded DNA.

 Subsequently, 9 μl of Genomiphi reaction buffer and 1 μl of enzyme mix were added, gently mixed, centrifuged and then incubated for 16 h (kit version 1) or 2.5 h (kit version 2) at 30 ° C. in a thermocycler. The inactivation of the polymerase was carried out for 15 min at 65 ° C.

NucleoSEQ columns (Macherey-Nagel, Düren) were used to purify the WGA product. These gel filtration-based columns separated small DNA molecules such as random hexamer primer and unused dNTPs from the WGA product. The columns were equilibrated for 2 h with 600 μl nuclease-free water. After centrifuging for 1 min at 3500 rpm, the columns were again loaded with 300 μl of nuclease-free water and again centrifuged for 1 min. The columns were then placed on a fresh Eppendorf reaction vessel, loaded with 20 μl of WGA product and incubated for 5 min. centrifuged at 3500 rpm. The purified product was then diluted with 20 μl of nuclease-free water. The quality and quantity of the WGA product were then determined on the nanodrop spectrophotometer.

Sequencing of WGA amplified DNA from single cells has been reported

Validation of replication accuracy performed by the phi29 polymerase. In addition, the probability of contamination in the existing manipulation and amplification system was estimated by the users or other external influences. The sequenced DNA region of exons 5 to 9 of the TP53 gene was covered by three primer pairs and included one

Sequence length of 1,300 bases. For the validation attempt was the

Glioma cell line G22, which carried two known point mutations within the DNA binding domain. High molecular weight genomic DNA of G22 was compared as template for sequencing with three independently amplified G22 single cell WGAs. The point mutation in exon 7 resulted in an amino acid exchange of glycine for serine. The mutation in exon 5 leads to an exchange of arginine for histidine.

By repeating the sequencing three times from both the 3 ^' and 5 ^' directions, a total length of 7,200 bases was sequenced. Based on the high corrective reading activity of the polymerase, the result agreed with the manufacturer's information that a mutation produced by the phi29 polymerase could be excluded. The two point mutations showed an identical allele frequency in all sequencing. Contamination with foreign DNA or cells could then be excluded.

Validation of WGA amplified DNA from single cells by quantitative real-time PCR was performed using the Genomiphi V2 kit. The V2 kit represented the further development of the V1 kit. The versions differed in two decisive points:

1. The amplification time was from 16h of the V1 kit to 2.5h of the V2 kit

 shortened.

2. Kit version 1 always generated, unlike Kit version 2

 high molecular weight DNA in the negative control (NTC). According to the manufacturer, these were extended hexamer primers.

It became a test series to maximize the reaction time of Kit-V2

performed to determine the time at which no nonspecific product has been generated in the negative control. This should maximize the product yield of WGA amplified DNA from single cells. This experimental approach was already carried out earlier for Kit-V1. The results of the test series are shown in FIG. Figure 3 shows that the amount of product produced by the Genomiphi Kit-V1 increased linearly over time. The amount of product formed in the negative control was approximately 70% of the positive control product produced at each point of measurement. The amount of product in the negative control produced by the Genomiphi Kit-V2 after 5 h corresponded to about 80% of the amount of positive control product formed after 2.5 h. The product quantity of Negative control increased by about 5% after 16 h reaction time. Up to a reaction time of 2.5 h no formed product was detectable in the negative control. The amount of product produced from both versions of Genomiphi Kit was identical after the manufacturer's recommended amplification time. Based on the results of the test series, the manufacturer recommended

 Maintain amplification time of 2.5 h to prevent the formation of nonspecific products.

In order to be able to identify inaccuracies caused by the WGA in the quantification of single-cell WGAs, a further assay concept was created. This was based on a single reference assay which amplified a LINEI sequence that was genome-wide in approximately 1,000 copies and was thus much less susceptible to WGA-related fluctuations than normal diploid regions. Due to the high number of copies, a SYBR green-based method was chosen. By saving a second reference assay, space was created for a second, parallel assay in the EGFR gene. This allowed verification of the stability of single cell WGAs at the EGFR locus within the same qPCR run. The LINE1 primers were also checked via the melting curve and an agarose gel.

6. Determination of EGFR-AGCN in ovarian carcinoma tissue for prediction of resistance to platinum / taxane-containing chemotherapy

After the operation of the primary tumor, all patients were treated with one

Chemotherapy treated from carboplatin and paclitaxel. Since the time of their diagnosis, the patients have been observed. Here were u.a. the time to the first recurrence of a recurrent tumor and the

Considered overall survival. Of the paraffin-embedded primary tumors 4 μιη thick sections were taken. Subsequently, the

Microdissection of one tumor and one connective tissue area for DNA isolation. First, 20 μL buffer ATL from the Qiagen MicroAmp kit was pipetted into a 1.5 ml reaction vessel. The tumor and connective tissue areas were determined by light microscopy on the respective slide to be processed. Thereafter, the cannula with some buffer ATL from the

The reaction vessel wetted and the microdissection of the tumor cell areas was carried out Under the microscope. The tumor cells are scraped off with the cannula from the slide, and placed in the reaction vessel with buffer ATL. When there was a lot of tumor cell-free connective tissue on the slide, the microdissection of this tissue was also done. If the connective tissue is interspersed with tumor cells or too little tissue on the slide to isolate enough DNA, only tumor tissue was scratched. Otherwise the origin of the DNA could not be differentiated in this case.

From the scratched tumor cell or connective tissue, the genomic DNA was analyzed for further analysis with the Quiagen QIAamp DNA Micro Kit according to the

 Specifications of the manufacturer isolated. The previously scratched tumor or

Normal tissue in 20 μl lysis buffer ATL was additionally mixed with 10 μl proteinase K and shaken for 15 s in a vortexer. The reaction vessels were incubated for at least 3 h at 56 ° C in a thermoblock. For a better yield of DNA, the incubation could also be prolonged overnight. Thereafter, the reaction vessels were removed from the thermoblock, 25 μΙ buffer ATL and 50 μΙ buffer AL were added by pipette and the reaction vessels shaken for 15 s vortexer, which led to the lysis of the cells. 50 μΙ ethanol (96-100%) was added, vortexed again for 15 sec, and incubated for 5 min at room temperature. It came to the precipitation of the DNA. Centrifuge briefly with the Eppendorf centrifuge 5418 to remove any drops from the lid and from the rim of the reaction vessel. The supernatant was gently transferred to a QiaAmp MinElute column and centrifuged at 8000 rpm for 1 min with the Eppendorf 5418 centrifuge. There was adsorption of the DNA on the membrane at the bottom of the column. The collecting vessel for columning with the centrifuged liquid was discarded, and put the column into a new collecting vessel. 500μl wash buffer AW1 was added to the column and centrifuged at 8,000 rpm for 1 min with the Eppendorf 5418 centrifuge. Again the collection vessel was discarded with the liquid and the column placed in a new collection vessel. Subsequently, 500 μl wash buffer AW2 was added and centrifuged at 8000 rpm for 1 min with the Eppendorf centrifuge 5418. The collecting vessel with the liquid was discarded and placed the pillar in a new collection vessel. In these steps, the DNA was washed twice to remove the residues remove previous buffer and any cell debris. To completely dry the membrane of the column was centrifuged with the

 Eppendorf centrifuge 5418 at 13,000 rpm for 3 min. After that it will be

Discard the collecting vessel with the liquid again and place the column in a 5 ml reaction vessel. 20 μl of distilled water were pipetted directly onto the membrane of the column, incubated for 3 min at RT, and centrifuged at 13,000 rpm for 1 min with the Eppendorf centrifuge 5418. The DNA was eluted from the membrane with distilled water and collected in the 1.5 ml reaction vessel. The DNA concentration was determined with the NanoDrop ND-1000 spectrophotometer. In this case, DNA dissolved in 1 .mu.l of distilled water was pipetted onto the nano-drop device and the concentration was determined by the proportion of the absorption of the UV rays by the computer. With good DNA enrichment the absorption coefficient A260nm / A280nm should have a value of 1, 8.

To determine the EGFR-AGCN, a quantitative real-time PCR was performed with the isolated DNA of patients as described in Section 1.1. described carried out. Only 10% of patients with EGFR gene amplification have recurrence after carboplatin and paclitaxel, while 55% with a diploid tumor developed EGFR gene relapse after therapy.

Claims

claims

1. A method for predicting the therapeutic efficacy of EGFR inhibitors, characterized in that a sample of its tissue and / or its body fluid is taken from a patient, one or more DNA sections on chromosome 7p in the region of the EGFR gene by means of quantitative real Time PCR be amplified and quantified and the copy number thus obtained is used as a measure of the expected therapeutic efficacy.

2. The method according to claim 1, characterized in that the EGFR inhibitors are therapeutic, directed against EGFR antibodies and / or chemotherapeutic agents, in particular carboplatin and / or paclitaxel.

3. The method according to claim 1 or 2, characterized in that as

 DNA section for quantitative real-time PCR, the sequences of exons 3, 4, 5, 7, 9, 14 to 17 and 19 to 21 of the EGFR gene, the HERV K1 section or HERV K2 section of the EGFR amplicons can be used singly or in combination.

4. The method according to any one of the preceding claims, characterized

 in that for the exons of the EGFR gene primer pairs with the following sequences are used:

 for exon 3 as forward primer 5 -TACCTGGACCTTGAGGGATTG-3 'corresponding to SEQ ID NO 12 and as reverse primer 5'-ACTGCGTGAGCTTGTTACTCG-3' corresponding to SEQ ID NO 13;

 for exon 4 as forward primer 5'-CCATGACTGCAATCGTCTACC-3 'corresponding to SEQ ID NO 14 and as reverse primer 5 - TTGAACCCTAATGCACACGAG-3' corresponding to SEQ ID NO 15;

 alternatively for exon 4 as a forward primer 5'-GGTCAAAGGCTAACGTGCAG-3 'corresponding to SEQ ID NO 16 and as a reverse primer 5'-TTGAACCCTAATGCACACGAG-3' corresponding to SEQ ID NO 15;

for exon 5 as a forward primer 5'-TACATCATGCGACCATTCCAG-3 'corresponding to SEQ ID NO 17 and as a reverse primer 5'-TGGGCTTTGAGCAATGATTAG-3' corresponding to SEQ ID NO 18; for exon 7 as forward primer 5'-CACCACTCACTGAGACCTTGG-3 'corresponding to SEQ ID NO 19 and as reverse primer 5 - GAAATGGAGGCATGGTAGTCC-3' corresponding to SEQ ID NO 20;

 for exon 9 as a forward primer 5'-CACCGTCATCACCTTCCTTTC-3 'corresponding to SEQ ID NO 21 and as a reverse primer 5'-TCCTCCATCTCATAGCTGTCG-3' corresponding to SEQ ID NO 22;

for exon 14 as a forward primer 5'-CCAAGGGAGTTTGTGGAGAAC-3 'corresponding to SEQ ID NO 23 and as a reverse primer 5 ¹ - TGAAATGGACGTGGATAGCAG-3' corresponding to SEQ ID NO 24;

 for exon 15 as forward primer 5 -CCTACGGGTGAGTGGAAAGTG-3 'corresponding to SEQ ID NO 25 and as reverse primer 5'-ACAAACCTCGGCAATTTGTTG-3' corresponding to SEQ ID NO 26;

 for exon 16 as a forward primer 5'-TGTCCAACGAATGGGTAAGTG-3 'corresponding to SEQ ID NO 27 and as a reverse primer 5'-CCACAGCAGTGTGGTCATTC-3' corresponding to SEQ ID NO 28;

 for exon 7 as a forward primer 5'-TACATCCATCCGAGGAAATGG-3 'corresponding to SEQ ID NO 29 and as a reverse primer 5'-CAGCTTTGTGGACATTGAAGG-3' corresponding to SEQ ID NO 30;

 for exon 19 as a forward primer 5'-TCTAGACCCTGCTCATCTCCAC-3 'corresponding to SEQ ID NO 31 and as a reverse primer 5'-AGGCCAGTGCTGTCTCTAAGG-3' corresponding to SEQ ID NO 32;

 for exon 20 as a forward primer 5'-TCGCAAAGGTAATCAGGGAAG-3 'corresponding to SEQ ID NO 33 and as a reverse primer 5'-GGATCCTGGCTCCTTATCTCC-3' corresponding to SEQ ID NO 34;

 for exon 21 as a forward primer 5'-AGCCATAAGTCCTCGACGTG-3 'corresponding to SEQ ID NO 35 and as a reverse primer 5'-GAGAAGACCCTGCTGTGAGG-3' corresponding to SEQ ID NO 36.

5. The method according to any one of the preceding claims, characterized

 in that the following primer pairs are used for the HERV-K sections:

for HERV-K1 as a forward primer 5'-CCAAAGAAGAGACTCTGAGAGGAC-3 'corresponding to SEQ ID NO 45 and as a reverse primer 5'-AGTCTTGACATGGCTGTTATTGAG-3' corresponding to SEQ ID NO 46; for HERV-K2 as forward primer 5'-GAAATCCAAGCTGTATGTTCAATG-3 'corresponding to SEQ ID NO 47 and as reverse primer 5'-ATTAGAAGTCAGCCTAATGCCATC-3' corresponding to SEQ ID NO 48.

6. The method according to any one of the preceding claims, characterized

 characterized in that the therapeutic efficacy of inhibitors against EGF receptor or chemotherapy is considered to be probable when the measured copy number of the particular DNA segments is greater than 1.35 individually or on average.

7. The method according to any one of the preceding claims, characterized

 characterized in that single cells are used as a sample.

8. The method according to any one of the preceding claims, characterized

 characterized in that as a sample cells from primary tumors of the breast, and / or ovaries, and / or the oral mucosa, and / or the

 Bladder, and / or the lung, and / or the intestine, and / or the

 Lymph nodes, and / or bone marrow, and / or tumor cells from the blood, and / or biopsies of the above tumors and / or their

 Metastases, especially liver metastases of colon cancer, and / or ascites, and / or pleural fluid, and / or breast suction and / or smears may be used.

9. The method according to any one of the preceding claims, characterized

 characterized in that the number of copies of the chromosome 7p and the number of copies of the EGFR gene is determined by means of quantitative PCR via the use of sequences of the chromosomes 2 and 10 and the LINE1 repetitive sequence.

10. Kit for predicting the therapeutic efficacy of inhibitors against the EGF receptor and / or chemotherapeutic agents, in particular carboplatin and / or paclitaxel, wherein the kit reagents and / or reaction vessels and / or other means for carrying out the method according to one of claims 1 to 9 has.