WO2012096654A1 - Méthodes et compositions pour le traitement du cancer et procédés associés - Google Patents

Méthodes et compositions pour le traitement du cancer et procédés associés Download PDF

Info

Publication number
WO2012096654A1
WO2012096654A1 PCT/US2011/020864 US2011020864W WO2012096654A1 WO 2012096654 A1 WO2012096654 A1 WO 2012096654A1 US 2011020864 W US2011020864 W US 2011020864W WO 2012096654 A1 WO2012096654 A1 WO 2012096654A1
Authority
WO
WIPO (PCT)
Prior art keywords
egfr
klf6
agent
foxol
patient
Prior art date
Application number
PCT/US2011/020864
Other languages
English (en)
Inventor
Goutham Narla
Michael Ohlmeyer
Original Assignee
Mount Sinai School Of Medicine
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Mount Sinai School Of Medicine filed Critical Mount Sinai School Of Medicine
Priority to PCT/US2011/020864 priority Critical patent/WO2012096654A1/fr
Priority to CA2860862A priority patent/CA2860862A1/fr
Priority to PCT/US2012/020922 priority patent/WO2012097054A1/fr
Publication of WO2012096654A1 publication Critical patent/WO2012096654A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/54—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one sulfur as the ring hetero atoms, e.g. sulthiame
    • A61K31/5415—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one sulfur as the ring hetero atoms, e.g. sulthiame ortho- or peri-condensed with carbocyclic ring systems, e.g. phenothiazine, chlorpromazine, piroxicam
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/517—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57423—Specifically defined cancers of lung
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/71—Assays involving receptors, cell surface antigens or cell surface determinants for growth factors; for growth regulators
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Definitions

  • the invention relates to anti-cancer therapeutics.
  • ErbB2/HER2, ErbB3/HER3, and ErbB4/HER4) are transmembrane tyrosine kinases that are activated by ligand-induced dimerization. These receptors regulate cell proliferation, differentiation, and migration, and their abnormal activation is associated with a variety of human cancers.
  • Several cancer drugs interact with the ATP -binding site of the EGFR kinase to halt tumor growth and increase apoptosis in cancer cells.
  • anti-cancer therapeutics Compounds that directly inhibit the kinase activity of the EGFR, as well as antibodies that reduce EGFR kinase activity by blocking EGFR activation have been used as anti-cancer therapeutics. Such therapeutics are not effective for many EGFR-related illnesses or are not effective against certain patient populations. Additionally, efficacy of anti-EGFR therapeutics is limited by the invariable development of primary or acquired drug resistance.
  • the present inventor has discovered a new nuclear transcriptional network involving the KLF6 and FOXO 1 tumor suppressor genes that regulate response to anti- EGFR-based therapies.
  • the discovery has led to new and improved therapies for treatment of cancer.
  • the invention relates to anti-cancer therapeutics.
  • the invention relates to treating cancers with a combination of an anti-epidermal growth factor receptor (anti-EGFR) agent and an agent that increases the activity of the Kruppel-like factor 6 (KLF6) tumor suppressor gene.
  • anti-EGFR anti-epidermal growth factor receptor
  • KLF6 Kruppel-like factor 6
  • the invention relates to treating cancers with a combination of an anti-EGFR agent and an agent that increases the activity of the transcription factor forkhead box 01 (FOXOl) tumor suppressor gene.
  • the invention relates to treating cancers with a combination of an anti-EGFR agent and an agent that increases the activity of KLF6 or an agent that increases FOXOl .
  • the invention relates to treating cancers with a combination of an anti-EGFR agent and an agent that increases nuclear accumulation of nuclear FOXOl .
  • the invention relates to treating cancers with a combination of an anti-EGFR agent and an agent that increases nuclear accumulation of nuclear KLF6.
  • the invention relates to treating cancers with an anti-EGFR therapeutic and a phenothiazine.
  • the invention relates to treating cancers with erlotinib and trifluoperazine or chlorpromazine.
  • the invention relates to treating cancers with a combination of an anti-EGFR- agent and an agent that increases the activity of KLF6 in patients with primary or acquired drug resistance to anti-EGFR agents.
  • the invention relates to treating cancers with a combination of an anti-EGFR- agent and an agent that increases nuclear localization of KLF6 in patients with primary or acquired drug resistance to anti-EGFR agents.
  • the invention relates to enhancing sensitivity to anti-EGFR agents by increasing KLF6 activity.
  • the invention relates to restoring sensitivity to anti-EGFR agents by increasing KLF6 activity.
  • the invention relates to treating cancers with a combination of an anti-EGFR- agent and an agent that increases the activity of FOXOl in patients with primary or acquired drug resistance to anti-EGFR agents.
  • the invention relates to treating cancers with a combination of an anti-EGFR- agent and an agent that increases nuclear localization of FOXOl in patients with primary or acquired drug resistance to anti-EGFR agents.
  • the invention relates to enhancing sensitivity to anti-EGFR agents by increasing FOXOl activity.
  • the invention relates to restoring sensitivity to anti-EGFR agents by increasing FOXOl activity.
  • the invention relates to a method of identifying a compound that enhances cellular sensitivity to an anti-EGFR agent by contacting a cell with a test compound and determining whether the test compound increases activity of KLF6 or FOXOl in the cell.
  • kits including an anti-EGFR agent and an agent that increases activity of KLF6.
  • kits including an anti-EGFR agent and an agent that increases activity of FOXOl .
  • the invention relates to pharmaceutical compositions including an anti-EGFR agent, an agent that enhances the therapeutic effect of the anti-EGFR agent, and a pharmaceutically acceptable excipient.
  • the invention relates to treating cancers with a combination of an anti-EGFR agent and an agent that increases the activity of the KLF6 tumor suppressor gene, provided that the agent that increases activity of KLF6 is not a phenothiazine.
  • the invention relates to treating cancers with a combination of an anti-EGFR agent and an agent that increases the activity of the FOXOl tumor suppressor gene, provided that the agent that increases activity of FOXOl is not a phenothiazine.
  • the invention relates to treating lung cancer, preferably non- small cell lung cancer (NSCLC) and more preferably lung adenocarcinoma, with a combination of an anti-EGFR agent, preferably erlotinib, and an agent that increases the activity of the KLF6 tumor suppressor gene, preferably a phenothiazine and more preferably trifluoperazine or chlorpromazine, or a pharmaceutically acceptable salt thereof.
  • NSCLC non- small cell lung cancer
  • lung adenocarcinoma a combination of an anti-EGFR agent, preferably erlotinib, and an agent that increases the activity of the KLF6 tumor suppressor gene, preferably a phenothiazine and more preferably trifluoperazine or chlorpromazine, or a pharmaceutically acceptable salt thereof.
  • the invention relates to treating lung cancer, preferably non- small cell lung cancer (NSCLC) and more preferably lung adenocarcinoma, with a combination of an anti-EGFR agent, preferably erlotinib, and an agent that increases the activity of the KLF6 tumor suppressor gene, wherein the agent that increases activity of the KLF6 tumor suppressor gene is not a phenothiazine or a pharmaceutically acceptable salt thereof.
  • NSCLC non- small cell lung cancer
  • lung adenocarcinoma a combination of an anti-EGFR agent, preferably erlotinib, and an agent that increases the activity of the KLF6 tumor suppressor gene, wherein the agent that increases activity of the KLF6 tumor suppressor gene is not a phenothiazine or a pharmaceutically acceptable salt thereof.
  • the invention relates to the use of an agent that increases activity of the KLF6 tumor suppressor gene as an adjunct anti-cancer therapy for cancer patients who have been treated with an anti-EGFR agent and developed primary or acquired drug resistance to the anti-EGFR agent.
  • the invention relates to treating cancers with a synergistic combination of an anti-EGFR agent and an agent that increases the activity of the KLF6 tumor suppressor gene.
  • the invention relates to treating lung cancer, preferably non- small cell lung cancer (NSCLC) and more preferably lung adenocarcinoma, with a combination of an anti-EGFR agent, preferably erlotinib, and an agent that increases the activity of the FOXOl tumor suppressor gene, preferably a phenothiazine and more preferably trifluoperazine or chlorpromazine or a pharmaceutically acceptable salt thereof.
  • NSCLC non- small cell lung cancer
  • lung adenocarcinoma a combination of an anti-EGFR agent, preferably erlotinib, and an agent that increases the activity of the FOXOl tumor suppressor gene, preferably a phenothiazine and more preferably trifluoperazine or chlorpromazine or a pharmaceutically acceptable salt thereof.
  • the invention relates to treating lung cancer, preferably non- small cell lung cancer (NSCLC) and more preferably lung adenocarcinoma, with a combination of an anti-EGFR agent, preferably erlotinib, and an agent that increases the activity of the FOXOl tumor suppressor gene, wherein the agent that increases activity of the FOXOl tumor suppressor gene is not a phenothiazine or a pharmaceutically acceptable salt thereof.
  • NSCLC non- small cell lung cancer
  • lung adenocarcinoma a combination of an anti-EGFR agent, preferably erlotinib, and an agent that increases the activity of the FOXOl tumor suppressor gene, wherein the agent that increases activity of the FOXOl tumor suppressor gene is not a phenothiazine or a pharmaceutically acceptable salt thereof.
  • the invention relates use of an agent that increases activity of the FOXOl tumor suppressor gene as an adjunct anti-cancer therapy for cancer patients who have been treated with an anti-EGFR agent and developed primary or acquired drug resistance to the anti-EGFR agent.
  • the invention relates to treating cancers with a synergistic combination of an anti-EGFR agent and an agent that increases the activity of the FOXOl tumor suppressor gene.
  • the invention relates to treating neoplastic disease by administering an agent that increases KLF6 activity or an agent that increases FOXOl activity to a subject suffering from neoplastic disease.
  • the invention relates to treating neoplastic disease by administering an agent that increases KLF6 activity or an agent that increases FOXOl activity to a subject suffering from neoplastic disease who is predicted to be only partially responsive or non-responsive to an anti-EGFR.
  • the invention relates to predicting whether a patient will respond to anti-EGFR therapy by determining the functional state or localization of KLF6 in cells of the patient, wherein when the cells exhibit an essentially normal functional state or a normal localization of KLF6 the patient is predicted to be a patient who will respond to anti-EGFR therapy, and when the cells exhibit a reduced functional state or mislocalization of KLF6 the patient is predicted to be a patient who will not respond to anti-EGFR therapy.
  • the invention relates to predicting whether a patient will respond to anti-EGFR therapy by determining the functional state or localization of FOXOl in cells of the patient, wherein when the cells exhibit an essentially normal functional state or a normal localization of FOXOl the patient is predicted to be a patient who will respond to anti-EGFR therapy, and when the cells exhibit a reduced functional state or mislocalization of FOXOl the patient is predicted to be a patient who will not respond to anti-EGFR therapy.
  • FIG la-g shows results demonstrating EGFR-activation correlates with KLF6 downregulation in primary human and mouse lung adenocarcinoma
  • qRT-PCR quantitative real-time PCR
  • KLP6 protein present in protein lysates from tumor and matched adjacent normal tissue
  • KLF6 protein expression as in EGFR-activated and EGFR nonactivated tumor samples
  • T-EGFR total EGFR
  • P-EGFR— Y-1068 phosphotyrosine-EGFR
  • Normal normal diet
  • L858R doxycycline- supplemented diet
  • FIG. 2a-k shows results demonstrating lung adenocarcinoma cell lines upregulate KLF6 in response to anti-EGFR therapy erlotinib.
  • FIG. 3a-e shows results demonstrating that modulation of AKT signaling regulates KLF6.
  • P-AKT phosphorylated-AKT
  • T-AKT total AKT
  • KLF6 Actin and quantification of pAKT/AKT ratio
  • P-AKT phosphorylated-AKT
  • T-AKT total AKT
  • KLF6 phosphorylated-AKT
  • GAPDH GAPDH
  • FIG. 4a-g shows results demonstrating transcription factor FOXOl modulates KLF6 expression in A549 cells transiently transfected with pCINEO-FOXO 1.
  • FOXOl mRNA expression f
  • KLF6 mRNA expression and
  • FIG 5a-d shows results demonstrating decreased FOXOl expression correlated with downregulation of KLF6 expression in a mouse model and human primary lung adenocarcinomas,
  • FIG 6a-c shows results demonstrating that inhibition of EGFR-signaling causes upregulation of KLF6 expression via increased accumulation of nuclear FOXOl .
  • FIG 7a-e shows results demonstrating constitutive activation of AKT via PTEN depletion confers resistance to erlotinib.
  • e Western blot of protein lysates in HCC827 and HI 650 cell lines, untreated or treated with 1 ⁇ erlotinib for 48 h. Experiments were repeated three independent times, statistical significance determined via Students' T-test, reported as means (with ⁇ standard deviation), P-values as follows: *P ⁇ 0.05; **P ⁇ 0.001.
  • FIG 8a-d shows results demonstrating stable knockdown of KLF6 in the erlotinib-sensitive HCC827 cell line confers drug resistance in culture and in vivo, (a) Wild-type KLF6 expression, (b) Western blot analysis, (c) Apoptosis levels, and (d) Tumor growth rates in control cell line shLuc-HCC827 and stable knockdown cell line shKLF6-HCC827, either untreated or treated with 50 nM erlotinib.
  • FIG 9a-g shows results demonstrating inhibition of FOXOl nuclear export results in upregulation of KLF6 expression and increased apoptosis.
  • FIG lOa-b shows results demonstrating that knockdown of KLF6 abrogates apoptotic response to TFP.
  • FIG lla-f shows results demonstrating trifluoperazine and erlotinib administered in combination decrease tumorigenicity in a xenograft model of lung adenocarcinoma.
  • Subcutaneous lung adenocarcinoma-derived cell line xenograft tumors derived from injection into nude mice that were subsequently administered DMSO (vehicle control), erlotinib (80 mg/kg), TFP (20 mg/kg) or both (80 mg/kg erlotinib, 20 mg/kg TFP) were analyzed for (a) Growth rate, (b) Kaplan Meyer survival analysis, (c) KLF6 mRNA expression, (d) Western blot analysis, (e) KLF6 protein expression, (f) Quantification of TUNEL positive cells, and (g) Quantification of nuclear-localized proliferating-cell nuclear antigen (PCNA).
  • PCNA nuclear-localized proliferating-cell nuclear antigen
  • FIG 12 shows a schematic representation of the EGFR-AKT-FOXO 1 -KLF6 signaling axes and associated inhibitors utilized to determine functional signaling relationships among the signaling components of the cascade.
  • the present invention relates to cancer therapies.
  • KLF6 The transcription factors forkhead box 01 (FOXOl) and Kruppel like factor 6 (KLF6) have roles in the regulation of diverse cellular processes including development, differentiation, proliferation and apoptosis.
  • KLF6 is a tumor suppressor gene that is frequently inactivated by loss of heterozygosity (LOH), dysregulated alternative splicing, somatic mutation, and/or decreased expression in human cancer.
  • LHO heterozygosity
  • COPEB has been reported to be significantly dysregulated in lung cancer tumors compared to normal tissue and/or as a contributor to gene signatures that predict survival of lung cancer patients.
  • KLF6 expression was also found to be significantly decreased in patient-derived lung adenocarcinoma samples compared to matched normal lung tissue. Overexpression of KLF6 has been reported to be connected with spontaneous apoptosis and decreased colony formation in lung adenocarcinoma cell lines.
  • FOXOl is a transcriptional regulator of the Gl/S checkpoint and of apoptosis.
  • FOXOl has been identified as a direct transcriptional activator of KLF6 gene expression, through binding to the KLF6 promoter.
  • FOXO 1 has also been identified as being functionally inactivated in cancer through decreased expression by AKT-mediated phosphorylation and/or cytoplasmic mislocalization in a variety of human malignancies.
  • the inventor has discovered a novel signalizing network in which inhibition of EGFR signaling results in decreased AKT activation and increased nuclear accumulation of FOXOl, resulting in transactivation of the KLF6 tumor suppressor gene.
  • the inventor has surprisingly found that restoration of KLF6 activity by, for example, increasing nuclear accumulation of FOXOl restored sensitivity to an anti-EGFR therapeutic in a resistant lung adenocarcinoma cell line.
  • adenocarcinoma combined treatment with the anti-EGFR agent, erlotinib, and the phenothiazine FOXOl nuclear export inhibitor, trifluoperazine showed synergistic effects in reducing tumor growth and increasing survival.
  • the inventor has identified a transcriptional network involving the KLF6 and FOXOl tumor suppressor genes that regulates response to anti-EGFR-based therapies in both cell culture and in vivo models of the disease. Inhibition of AKT signaling was found to promote FOXOl nuclear localization, resulting in transactivation of the KLF6 tumor suppressor gene and induction of apoptosis in lung adenocarcinoma cell lines.
  • the invention provides a method of treating cancers with a combination of an anti-epidermal growth factor receptor (anti-EGFR) agent and an agent that increases the activity or changes the localization of the Kruppel-like factor 6 (KLF6) and/or FOXOl tumor suppressor genes.
  • anti-EGFR anti-epidermal growth factor receptor
  • anti-epidermal growth factor receptor and "anti- EGFR agent” also refer to any chemical entity that is currently known in the art or that will be identified in the future, and that, upon administration to a patient, results in inhibition of a biological activity associated with activation of the EGF receptor in the patient, including any of the downstream biological effects otherwise resulting from the binding to EGFR of its natural ligand.
  • anti-EGFR agents include any agent that can block EGFR activation or any of the downstream biological effects of EGFR activation that are relevant to treating cancer in a patient.
  • Such an inhibitor can act by binding directly to the intracellular domain of the receptor and inhibiting its kinase activity.
  • such an inhibitor can act by occupying the ligand binding site or a portion thereof of the EGFR receptor, thereby making the receptor inaccessible to its natural ligand so that its normal biological activity is prevented or reduced.
  • such an inhibitor can act by modulating the dimerization of EGFR polypeptides, or interaction of EGFR polypeptide with other proteins, or enhance ubiquitination and endocytotic degradation of EGFR.
  • EGFR kinase inhibitors include but are not limited to low molecular weight inhibitors (small molecule based approaches), antibodies or antibody fragments, antisense constructs, small inhibitory RNAs (i.e. RNA interference by dsRNA; RNAi), and ribozymes.
  • the EGFR kinase inhibitor is a small organic molecule or an antibody that binds specifically to the human EGFR.
  • Anti-EGFR agents can include, for example, quinazoline EGFR kinase inhibitors, pyrido-pyrimidine EGFR kinase inhibitors, pyrimido-pyrimidine EGFR kinase inhibitors, pyrrolo-pyrimidine EGFR kinase inhibitors, pyrazolo-pyrimidine EGFR kinase inhibitors, phenylamino-pyrimidine EGFR kinase inhibitors, oxindole EGFR kinase inhibitors, indolocarbazole EGFR kinase inhibitors, phthalazine EGFR kinase inhibitors, isoflavone EGFR kinase inhibitors, quinalone EGFR kinase inhibitors, and tyrphostin EGFR kinase inhibitors, such as those described in the following patent publications, and all pharmaceutically acceptable salts and solvates of said anti-EGFR kin
  • low molecular weight anti-EGFR agents include any of the EGFR kinase inhibitors described in Traxler, P., 1998, Exp. Opin. Ther. Patents
  • low molecular weight anti-EGFR agents that can be used according to the present invention include erlotinib, (also known as [6,7-bis(2- methoxyethoxy)-4-quinazolin-4-yl]-(3-ethynylphenyl) amine; OSI-774, or TarcevaTM (erlotinib HC1); OSI Pharmaceuticals/Genentech/Roche) (U.S. Pat. No. 5,747,498;
  • a particularly preferred low molecular weight anti-EGFR agents that can be used according to the present invention is erlotinib, i.e., [6, 7-bis(2-methoxyethoxy)-4- quinazolin-4-yl]-(3-ethynylphenyl) amine, its hydrochloride salt (i.e. erlotinib HC1, TarcevaTM), or other salt forms (e.g., erlotinib mesylate).
  • erlotinib i.e., [6, 7-bis(2-methoxyethoxy)-4- quinazolin-4-yl]-(3-ethynylphenyl) amine
  • its hydrochloride salt i.e. erlotinib HC1, TarcevaTM
  • other salt forms e.g., erlotinib mesylate
  • Antibody-based anti-EGFR agents include any anti-EGFR antibody or antibody fragment that can partially or completely block EGFR activation by its natural ligand.
  • Non-limiting examples of antibody-based anti-EGFR agents include those described in Modjtahedi, H., et al, 1993, Br. J. Cancer 67:247-253; Teramoto, T., et al, 1996, Cancer 77:639-645; Goldstein et al, 1995, Clin. Cancer Res. 1 : 1311-1318; Huang, S. M., et al, 1999, Cancer Res. 15:59(8): 1935-40; and Yang, X., et al, 1999, Cancer Res. 59: 1236- 1243.
  • the anti-EGFR agent can be the monoclonal antibody Mab E7.6.3 (Yang, X. D. et al. (1999) Cancer Res. 59: 1236-43), or Mab C225 (ATCC Accession No. HB-8508), or an antibody or antibody fragment having the binding specificity thereof.
  • Suitable monoclonal antibody EGFR kinase inhibitors include, but are not limited to, IMC-C225 (also known as cetuximab or ErbituxTM; Imclone Systems), ABX-EGF (Abgenix), EMI 72000 (Merck KgaA, Darmstadt), RH3 (York Medical Bioscience Inc.), MDX-447 (Medarex/Merck KgaA), and Vectibix (Amgen).
  • Anti-EGFR antibody can be administered, for example, with weekly doses in the range of about 0.5 mg/kg to about 10 mg/kg, preferably about 2 mg/kg to about 3 mg/kg, or about 2 mg/kg.
  • Antibody can be administered every two weeks with doses in the range of about 1 mg/kg to about 15 mg/kg, preferably about 3 mg/kg to about 10 mg/kg, or about 6 mg/kg. Antibody can be administered every three weeks with doses in the range of about 2 mg/kg to about 30 mg/kg, preferably about 5 mg/kg to about 15 mg/kg, or about 9 mg/kg. Some antibodies can be administered with doses in the range of 50 to 500 mg/m 2 , where dosing in mg/m 2 , as opposed to the conventional measurement of dose in mg/kg, is a measurement based on surface area.
  • the therapeutically effective amount of EGFR antibody in the composition can be chosen from about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 11 mg, about 12 mg, about 13 mg, about 14 mg, or about 15 mg.
  • monoclonal anti-EGFR antibody e.g., Cetixumab is administered at an initial weekly dosage of 250 mg/m 2 followed by a dose of 400 mg/m 2 .
  • the terms "agent that increases activity of KLF6” “agent that increases activity of the KLF6 tumor suppressor” and “KLF6 activating agent” are synonymous and refer to any chemical entity that is currently known in the art or that will be identified in the future, and that, upon administration to a patient, results in increased biological activity associated with increased expression of the Kruppel-like factor 6 gene in the patient.
  • Increased activity of KLF6 may be due to, for example and without limitation, increased transcription of the KLF6 gene, decreased alternative splicing of the KLF6 gene into its oncogenic splice variant, KLF6-SV1, increased translation of KLF6 mRNA, change in the subcellular localization of KLF6, or increased half- life of KLF6 mRNA or protein.
  • Expression of the KLF6 may be activated by FOXOl, which exists in both the nucleus and cytoplasm. As described herein, agents that cause accumulation of FOXOl in the nucleus lead to increased KLF6 expression. Accordingly, "KLF6 activating agents" include agents that increase nuclear accumulation of FOXOl .
  • Nuclear accumulation of a FOXOl may be due to, for example and without limitation, increased retention of FOXOl in the nucleus, e.g., by binding to a stable nuclear component or inhibition of nuclear export, or an increased rate of transport of FOXOl from the cytoplasm to the nucleus or agents that increase the half-life of FOXOl protein or increase expression of FOXOl mRNA expression.
  • KLF6 or FOXOl activating agents can be agents that changes the phosphorylation or ubiquitination state of a protein, thereby affecting it stability, localization and/or function.
  • increase of FOXOl activity may be used in the compositions and methods described herein, independent of an increase in KLF6 activity.
  • the invention thus provides an "agent that increases activity of FOXOl", “agent that increases activity of the FOXOl tumor suppressor” and “FOXOl activating agent,” all of which are synonymous and refer to any chemical entity that is currently known in the art or that will be identified in the future, and that, upon administration to a patient, results in increased biological activity associated with expression of the FOXOl gene in a patient.
  • Increased activity of FOXOl may be due to, for example and without limitation, increased transcription of the FOXOl gene, increased translation of FOXOl mRNA, change in the subcellular localization of FOXOl, or increased half-life of FOXOl mRNA or protein.
  • Nuclear accumulation of a FOXOl may be due to, for example and without limitation, increased retention of FOXOl in the nucleus, e.g., by binding to a stable nuclear component or inhibition of nuclear export, or an increased rate of transport of FOXOl from the cytoplasm to the nucleus or agents that increase the half- life of FOXOl protein or increase expression of FOXOl mRNA expression.
  • FOXOl activating agents can be agents that change the phosphorylation or ubiquitination state of a protein, thereby affecting it stability, localization and/or function.
  • a KLF6 activating agent is a phenothiazine compound, e.g., trifluoperazine (IUPAC name 10-[3-(4-methylpiperazin-l-yl)propyl]-2- (trifluoromethyl)-lOH-phenothiazine) or chlorpromazine (IUPAC name 3-(2-chloro-10H- phenothiazin-10-yl)-N,N-dimethyl-propan-l -amine) or a pharmaceutically acceptable salt thereof.
  • trifluoperazine and chlorpromazine affect FOXOl nuclear localization leading to increased KLF6 expression.
  • Phenothiazine compounds are well known in the art. Examples of phenothiazine compounds include aliphatic compounds, piperidines, and, and piperazines. Phenothiazines with aliphatic side-chains include acepromazine, aceprometazine, ahistan, alimemazine, aminopromazine, chloracizine, chlorphenetazine, chlorproetazine, chlorpromazine, cyamemazine, dacemazine, diethazine, dimethothiazine,
  • dimethoxanthate dimethoxanthate, ethacizine, ethopropazine, etymemazine, fenethazine, fluacizine, isopromethazine, levomepromazine methiomeprazine, methopromazine,
  • methotrimeprazine metiazinic acid, promazine, promethazine, propiomazine, propionyl- promazine, thiazinamium chloride, thiomethylpropazine, trifluomeprazine, and triflupromazine.
  • Phenothiazines with methylpiperazine side-chains include butaperazine, perazine, prochlorperazine, thiethylperazine, thioproperazine, and trifluoperazine.
  • Phenothiazines with piperazine-ethanol side-chains include acetophenazine,
  • Phenothiazines with piperazine-ethyl side-chains include cyclophenazine, imiclozapine, methophenazine, and oxaflumazine.
  • Phenothiazines with piperidine side-chains include duoperone, flupimazine, homophenazine, mesoridazine, metopimazine, oxyridazine, pipamazine, pipazethate, periciazine, piperacetazine, pipotiazine, perimetazine, spiclomazine, sulforidazine, and thioridazine.
  • Miscellaneous phenothiazines include azaclorcizine, azaftozine, dichloropromazine, fenoverine, flutizenol, ftormetazine, ftorpropazine, prothipendyl, mequitazine, methdilazine, moricizine, oxomemazine, propyromazine, protizinic acid, pyrathiazine, quizaltazine, and tolonium chloride.
  • Other examples of phenothiazine compounds are compounds 186057T and 5216177 that are disclosed in Kau et al, Cancer Cell, 2003, 4:463-476.
  • Exemplary dosage ranges for phentothiazine compounds are as follows.
  • Thioridazine 25 mg-100 mg per dose, 2-4 doses/day, 50-800 mg/day.
  • Fluphenazine 0.5 mg-10 mg per dose, 1-4 doses/day, 0.5-40 mg/day.
  • Mesoridazine 50-100 mg per dose, 3 doses/day, 150-400 mg/day.
  • Trifluoperazine 1-20 mg per dose, 2 doses/day, 2-40 mg/day.
  • Chlorpromazine 30-800 mg per dose, 1-4 doses/day, 30 mg-2 g/day.
  • Perphenazine 4-16 mg/dose, 2-4 doses/day, 12-64 mg/day.
  • Phenothiazine compounds are dopamine receptor antagonists and are clinically useful as antipsychotics, antihistaminics and antiemetics. Without being bound by theory, the inhibitory effect of trifluoperazine and chlorpromazine on FOXOl nuclear export that leads to nuclear accumulation of FOXOl and KLF6 activation is not believed due to activity of these compounds at dopamine receptors. See Kau et al, Cancer Cell, 2003, 4:463-476.
  • KLF6 activating agents include all KLF6 activating agents except phenothiazines.
  • the invention also encompasses a pharmaceutical composition that is comprised of an anti-EGFR agent, an agent that increases activity of the KLF6 tumor suppressor and a pharmaceutically acceptable carrier.
  • the invention also encompasses a pharmaceutical composition that is comprised of an anti-EGFR agent, an agent that increases activity of and/or changes the localization of the FOXOl tumor suppressor and a pharmaceutically acceptable carrier.
  • the amount of anti-EGFR agent administered and the timing of anti-EGFR agent administration will depend on the type (species, gender, age, weight, smoker/non-smoker, etc.) and condition of the patient being treated, the severity of the disease or condition being treated, and on the route of administration.
  • small molecule EGFR kinase inhibitors can be administered to a patient in doses ranging from 0.001 to 100 mg/kg of body weight per day or per week in single or divided doses, or by continuous infusion (see for example, International Patent Publication No. WO 01/34574).
  • erlotinib can be administered to a patient in doses ranging from 5-200 mg per day, or 100-1600 mg per week, in single or divided doses, or by continuous infusion. Another dose is 150 mg/day.
  • the invention provides a method for the treatment of cancer in a patient in need thereof, comprising administering to a patient either simultaneously or sequentially a therapeutically effective amount of a combination comprising an anti- EGFR agent and an agent that increases activity of the KLF6 tumor suppressor gene.
  • an anti-EGFR agent and an agent that increases activity of the KLF6 tumor suppressor gene are administered in an amount that provides for a synergistic antitumor effect.
  • an anti-EGFR agent and an agent that increases activity of the KLF6 tumor suppressor gene are administered in an amount that is subtherapeutic with respect to the individual components.
  • the EGFR Kinase inhibitor is erlotinib.
  • the invention provides a method for the treatment of cancer in a patient in need thereof, comprising administering to a patient either simultaneously or sequentially a therapeutically effective amount of a combination comprising an anti- EGFR agent and an agent that increases activity of the FOXOl tumor suppressor gene.
  • an anti-EGFR agent and an agent that increases activity of the FOXOl tumor suppressor gene are administered in an amount that provides for a synergistic antitumor effect.
  • an anti-EGFR agent and an agent that increases activity of the FOXOl tumor suppressor gene are administered in an amount that is subtherapeutic with respect to the individual components.
  • the EGFR Kinase inhibitor is erlotinib.
  • the compounds, compositions and methods of the invention are useful as therapeutics for treatment, prevention, amelioration, or management of various cancers or neoplastic diseases and symptoms thereof.
  • compositions and methods described herein may be useful generally for the prevention, therapeutic treatment, prophylactic treatment or management of various cancers or neoplastic disorders of the central nervous system, peripheral nervous system, gastrointestinal/digestive system, genitourinary system, gynecological, head and neck, hematological/blood, musculoskeletal/soft tissue, respiratory, and breast.
  • Examples of use include, but are not limited to, protection against and repair of injury resulting from cancers or neoplastic disorders of the brain (astrocytoma, gliobastoma, glioma), spinal cord, pituitary gland, breast (Infiltrating, Pre-invasive, inflammatory cancers, Paget's Disease, Metastatic and Recurrent Breast Cancer), blood (Hodgkin's Disease, Leukemia, Multiple Myeloma, Lymphoma), Lymph node cancer, Lung (Adenocarcinoma, Oat Cell, Non-small Cell, Small Cell, Squamous Cell, Mesothelioma), skin (melanoma, basal cell, squamous cell, Kapsosi's Sarcoma), Bone Cancer (Ewing's Sarcoma, Osteosarcoma, Chondrosarcoma), head and neck (laryngeal, pharyngeal (nasal cavity & sinus cavity), and esophageal cancers
  • Leukemia acute leukemia, acute lymphocytic leukemia, acute myelocytic leukemia, myeloblastic, promyelocytic, myelomonocytic, monocytic erythroleukemia, chronic leukemia, chronic myelocytic (granulocytic) leukemia, chronic lymphocytic leukemia, Polycythemia vera, Gastric carcinoma, Lymphoma (malignant and non-malignant): Hodgkin's disease, non- Hodgkin's disease, Multiple myeloma, Waldenstrom's macroglobulinemia, Heavy chain disease, Solid tumors sarcomas and carcinomas: fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangio
  • cancer, malignancy or dysproliferative changes are treatable or preventable in the ovary, breast, colon, lung, skin, pancreas, prostate, bladder, or uterus.
  • the cancer treatable or preventable by the administration of an effective amount of a compound or combination of compounds is sarcoma, melanoma, or leukemia.
  • administering is multiple myeloma, leukemia, a myelodysplasia syndrome or a myeloproliferative disorder.
  • the cancer treatable or preventable by the administration of an effective amount of a compound or compounds is a glioma.
  • the compound may be administered according to the current method to treat, ameliorate or manage various syndromes associated with various functional benign or cancerous tumors.
  • various syndromes that may benefit from treatment with the compounds are Beckwith-Wiedmann Syndrome, SBLA Syndrome, Li-Fraumeni
  • the compounds may be used in accordance with the method of the current invention to address the above-noted syndromes.
  • the compounds may be administered to address hereditary syndromes such as Li Fraumeni, Hereditary Nonpolyposis Colorectal Cancer, Familial Adenomatous Polyposis, and Von Hippel-Lindau Syndrome by either delaying the onset of the neoplastic aspects of the disease, reducing the number of neoplastic growths associated with the syndrome, or in general enhancing the quality of life or the longevity of those patients afflicted with these conditions.
  • the compounds may also be administered prophylactically to address syndromes related to certain treatment, chemotherapy or radiation therapy, of the neoplastic disorder or cancer, such as androgen deprivation syndrome, therapy related myelodysplasia syndrome or somnolence syndrome, in the hopes of preventing the syndromes or reducing the severity of the syndrome.
  • syndromes related to certain treatment, chemotherapy or radiation therapy of the neoplastic disorder or cancer, such as androgen deprivation syndrome, therapy related myelodysplasia syndrome or somnolence syndrome, in the hopes of preventing the syndromes or reducing the severity of the syndrome.
  • cancers and neoplastic disorders are merely illustrative of the range of disorders that can be addressed by the compounds used in the method of the current invention. Accordingly, this invention generally provides preventative, therapeutic, or prophylactic treatment of the consequences of cancers or neoplastic disorders.
  • Cancer or a neoplastic disease including, but not limited to, a neoplasm, a tumor, a metastasis, or any disease or disorder characterized by uncontrolled cell growth, can be treated or prevented by administration of an effective amount of a compound of the invention.
  • a composition comprising an effective amount of one or more Compounds of the Invention, or a pharmaceutically acceptable salt thereof, is
  • the invention encompasses methods for treating or preventing cancer or a neoplastic disease comprising administering to a patient need thereof an effective amount of a compound and another therapeutic agent.
  • the therapeutic agent is a chemotherapeutic agent including, but not limited to, methotrexate, taxol, mercaptopurine, thioguanine, hydroxyurea, cytarabine, cyclophosphamide, ifosfamide, nitrosoureas, cisplatin, carboplatin, mitomycin, dacarbazine, procarbizine, etoposides, campathecins, bleomycin, doxorubicin, idarubicin, daunorubicin,
  • chemotherapeutic agent including, but not limited to, methotrexate, taxol, mercaptopurine, thioguanine, hydroxyurea, cytarabine, cyclophosphamide, ifos
  • the compound exerts its activity at the same time the other therapeutic agent exerts its activity.
  • Other therapeutic agents are: Radiation: .gamma.-radiation, Alkylating agents Nitrogen mustards:
  • dacarbazine, Platinum containing compounds Cisplatin carboplatin, Plant Alkaloids, Vinca alkaloids: vincristine, Vinblastine, Vindesine, Vinorelbine, Taxoids: paclitaxel, Docetaxol, DNA Topoisomerase Inhibitors
  • Epipodophyllins etoposide, Teniposide, Topotecan, 9-aminocamptothecin irinotecan (Campto.RTM.), crisnatol, Mytomycins: Mytomycin C, Mytomycin C Anti-metabolites, Anti-folates: DHFR inhibitors:
  • methotrexate, Trimetrexate, IMP dehydrogenase Inhibitors mycophenolic acid
  • Bleomycins bleomycin A2, Bleomycin B2, Peplomycin, Anthracyclines: daunorubicin, Doxorubicin (adriamycin), Idarubicin, Epirubicin, Pirarubicin, Zorubicin, Mitoxantrone, MDR inhibitors: verapamil, Ca 2+ ATPase inhibitors: thapsigargin, TNF-a
  • inhibitors/thalidomide angiogenesis inhibitors 3-(3,4-dimethoxy-phenyl)-3-(l-oxo-l,3- dihydro-isoindol-2-yl)-propionamide (SelCIDsTM), ImiDsTM, Revimid.TM , ActimidTM.
  • the present methods for treating or preventing cancer further comprise administering radiation therapy.
  • the cancer can be refractory or non- refractory.
  • the compound can be administered to a patient that has undergone surgery as treatment for the cancer.
  • compound can be administered to a patient that has undergone surgery as treatment for the cancer concurrently with chemotherapy or radiation therapy.
  • a chemotherapeutic agent or radiation therapy is administered prior or subsequent to administration of a compound, preferably at least an hour, five hours, 12 hours, a day, a week, a month, more preferably several months (e.g., up to three months).
  • the chemotherapeutic agent or radiation therapy administered concurrently with, or prior or subsequent to, the administration of a compound can be accomplished by any method known in the art.
  • the chemotherapeutic agents are preferably administered in a series of sessions, any one or a combination of the chemotherapeutic agents listed above can be administered.
  • any radiation therapy protocol can be used depending upon the type of cancer to be treated.
  • x-ray radiation can be administered; in particular, high-energy megavoltage (radiation of greater that 1 MeV energy) can be used for deep tumors, and electron beam and orthovoltage x-ray radiation can be used for skin cancers.
  • Gamma-ray emitting radioisotopes such as radioactive isotopes of radium, cobalt and other elements, may also be administered to expose tissues to radiation.
  • the invention provides methods of treatment of cancer or neoplastic disease with a compound as an alternative to chemotherapy or radiation therapy where the chemotherapy or the radiation therapy has proven or may prove too toxic, e.g., results in unacceptable or unbearable side effects, for the patient being treated.
  • the invention provides methods of treatment wherein the compound is administered prior to, simultaneously with or following treatment with chemotherapy or radiation in an effort to prevent or ameliorate the toxic side effects of the treatment method.
  • the patient being treated can, optionally, be treated with other cancer treatments such as surgery, radiation therapy or chemotherapy, depending on which treatment is found to be acceptable or bearable.
  • the compounds, compositions and methods of the invention are useful as therapeutics for treatment of cancers and neoplastic diseases that are caused, in whole or in part, by mutations in EGFR.
  • the compounds, compositions and methods of the invention are useful as therapeutics for treatment of cancers and neoplastic diseases that are treatable, in whole or in part, with anti-EGFR agents.
  • Cancers and neoplastic diseases that may be treated with the compounds, compositions and methods of the invention include, for example and without limitation, prostatic, pulmonary, pancreatic, gastric, hepatocellular, lung, breast, glioblastoma, head and neck, ovarian, renal cell, leukemia, lymphomas, sarcomas, mesotheliomas and endometrial cancers.
  • the compounds, compositions and methods of the invention are used to treat lung cancer, more preferably non small cell lung cancer (NSCLC) and, most preferably, lung adenocarcinoma.
  • NSCLC non small cell lung cancer
  • Lung adenocarcinoma is the most common histology (-50%) among non-small cell lung cancers (NSCLC), which as a group constitute the majority of all lung malignancies (-80%).
  • NSCLC non-small cell lung cancers
  • the use of traditional cytotoxic chemotherapy to treat lung cancer is supported by evidence from dozens of randomized controlled trials. Data from clinical trials suggests, however, that >50% of patients derive no benefit from chemotherapy and thus can be considered to have chemotherapy-resistant lung cancer.
  • T790M T790 residue
  • K-Ras or PI3K activating mutations downstream of EGFR
  • MET amplification or activation of the PI3K/AKT signaling axis through several mechanisms, for example, due to loss of the PTEN tumor suppressor gene and activating PI3K muatations.
  • the PI3K-AKT signaling axis is believed to play a role in the transformed phenotype in lung adenocarcinoma.
  • an anti-EGFR agent including erlotinib
  • an anti-EGFR agent may be administered in either a therapeutic or subtherapeutic amount for the treatment of NSCLC.
  • an anti-EGFR agent, including erlotinib is administered in a generally subtherapeutic amount of between about 1 mg/kg and about 95 mg/kg for the duration of the treatment regimen.
  • the treatment regimen in one embodiment, is 35 days.
  • An anti- EGFR agent, including erlotinib may also be administered in an amount of between about 25 mg/kg and about 75 mg/kg or about 50 mg/kg.
  • Therapeutic amounts of an anti- EGFR agent, including erlotinib may also be used, including amounts of about 100 mg/kg or greater.
  • the isolated compounds to be used within the method of the current invention may be demonstrated to inhibit tumor cell proliferation, cell transformation and tumorigenesis in vitro or in vivo using a variety of assays known in the art, or described herein.
  • assays can use cells of a cancer cell line or cells from a patient.
  • Many assays well-known in the art can be used to assess such survival and/or growth; for example, cell proliferation can be assayed by measuring ( 3 H)-thymidine incorporation, by direct cell count, by detecting changes in transcription, translation or activity of known genes such as proto-oncogenes (e.g., fos, myc) or cell cycle markers (Rb, cdc2, cyclin A, Dl, D2, D3 or E).
  • proto-oncogenes e.g., fos, myc
  • cell cycle markers Rb, cdc2, cyclin A, Dl, D2, D3 or E.
  • protein can be quantitated by known immunodiagnostic methods such as Western blotting or immunoprecipitation using commercially available antibodies (for example, many cell cycle marker antibodies are from Santa Cruz, Inc.).
  • mRNA can be quantitated by methods that are well known and routine in the art, for example by northern analysis, RNase protection, the polymerase chain reaction in connection with the reverse transcription, etc.
  • Cell viability can be assessed by using trypan-blue staining or other cell death or viability markers known in the art. Differentiation can be assessed visually based on changes in morphology and by changes in relevant marker gene expression, etc.
  • the present invention provides for cell cycle and cell proliferation analysis by a variety of techniques known in the art, including but not limited to the following:
  • bromodeoxyuridine (“BRDU”) incorporation may be used as an assay to identify proliferating cells.
  • the BRDU assay identifies a cell population undergoing DNA synthesis by incorporation of BRDU into newly synthesized DNA. Newly synthesized DNA may then be detected using an anti-BRDU antibody (see Hoshino et al., 1986, Int. J. Cancer 38, 369; Campana et al., 1988, J. Immunol. Meth. 107, 79).
  • Cell proliferation may also be examined using (3H)-thymidine incorporation (see e.g., Chen, J., 1996, Oncogene 13: 1395 403; Jeoung, J., 1995, J. Biol. Chem. 270: 18367 73).
  • This assay allows for quantitative characterization of S-phase DNA synthesis.
  • cells synthesizing DNA will incorporate ( 3 H)-thyrnidine into newly synthesized DNA. Incorporation may then be measured by standard techniques in the art such as by counting of radioisotope in a Scintillation counter (e.g., Beckman LS 3800 Liquid Scintillation Counter).
  • PCNA proliferating cell nuclear antigen
  • Cell proliferation may be measured by counting samples of a cell population over time (e.g., daily cell counts). Cells may be counted using a hemacytometer and light microscopy (e.g., HyLite hemacytometer, Hausser Scientific). Cell number may be plotted against time in order to obtain a growth curve for the population of interest. In a preferred embodiment, cells counted by this method are first mixed with the dye Trypan- blue (Sigma), such that living cells exclude the dye, and are counted as viable members of the population.
  • Trypan- blue Sigma
  • DNA content and/or mitotic index of the cells may be measured, for example, based on the DNAploidy value of the cell.
  • cells in the Gl phase of the cell cycle generally contain a 2N DNA ploidy value.
  • Cells in which DNA has been replicated but have not progressed through mitosis e.g., cells in S-phase
  • Ploidy value and cell-cycle kinetics may be further measured using propidum iodide assay (see e.g., Turner, T., et al, 1998, Prostate 34: 175 81).
  • the DNA ploidy may be determined by quantitation of DNA Feulgen staining (which binds to DNA in a stoichiometric manner) on a computerized microdensitometrystaining system (see e.g., Bacus, S., 1989, Am. J. Pathol. 135:783 92).
  • DNA content may be analyzed by preparation of a chromosomal spread (Zabalou, S., 1994, Hereditas. 120: 127 40; Pardue, 1994, Meth. Cell Biol. 44:333 351).
  • cell-cycle proteins e.g., CycA. CycB, CycE, CycD, cdc2, Cdk4/6, Rb, p21 or p27
  • cell-cycle proteins e.g., CycA. CycB, CycE, CycD, cdc2, Cdk4/6, Rb, p21 or p27
  • identification in an anti-proliferative signaling pathway may be indicated by the induction of p21cipl .
  • Increased levels of p21 expression in cells results in delayed entry into Gl of the cell cycle (Harper et al, 1993, Cell 75:805 816; Li et al, 1996, Curr. Biol. 6: 189 199).
  • p21 induction may be identified by immunostaining using a specific anti-p21 antibody available commercially (e.g., from Santa Cruz, Inc.).
  • cell-cycle proteins may be examined by Western blot analysis using commercially available antibodies.
  • cell populations are synchronized prior to detection of a cell cycle protein.
  • Cell-cycle proteins may also be detected by FACS (fluorescence-activated cell sorter) analysis using antibodies against the protein of interest.
  • Detection of changes in length of the cell cycle or speed of cell cycle may also be used to measure inhibition of cell proliferation by a compound of the invention.
  • the length of the cell cycle is determined by the doubling time of a population of cells (e.g., using cells contacted or not contacted with one or more
  • FACS analysis is used to analyze the phase of cell cycle progression, or purify Gl, S, and G2/M fractions (see e.g., Delia, D. et al, 1997, Oncogene 14:2137 47).
  • Lapse of cell cycle checkpoint(s), and/or induction of cell cycle checkpoint(s), may be examined by the methods described herein, or by any method known in the art.
  • a cell cycle checkpoint is a mechanism which ensures that a certain cellular events occur in a particular order.
  • Checkpoint genes are defined by mutations that allow late events to occur without prior completion of an early event (Weinert, T., and Hartwell, L., 1993, Genetics, 134:63 80). Induction or inhibition of cell cycle checkpoint genes may be assayed, for example, by Western blot analysis, or by immunostaining, etc.
  • Lapse of cell cycle checkpoints may be further assessed by the progression of a cell through the checkpoint without prior occurrence of specific events (e.g. progression into mitosis without complete replication of the genomic DNA).
  • activity and post-translational modifications of proteins involved in the cell cycle can play an integral role in the regulation and proliferative state of a cell.
  • the invention provides for assays involved in the detection of post-translational modifications (e.g., phosphorylation) by any method known in the art.
  • post-translational modifications e.g., phosphorylation
  • antibodies that detect phosphorylated tyrosine residues are commercially available, and may be used in Western blot analysis to detect proteins with such modifications.
  • proteins with such modifications are commercially available, and may be used in Western blot analysis to detect proteins with such modifications.
  • modifications such as myristylation, may be detected on thin layer chromatography or reverse phase h.p.l.c. (see e.g., Glover, C, 1988, Biochem. J. 250:485 91; Paige, L., 1988, Biochem J.; 250:485 91).
  • kinase activity Activity of signaling and cell cycle proteins and/or protein complexes is often mediated by a kinase activity.
  • the present invention provides for analysis of kinase activity by assays such as the histone HI assay (see e.g., Delia, D. et al, 1997, Oncogene 14:2137 47).
  • cell culture models include, but are not limited to, for lung cancer, primary rat lung tumor cells (Swafford et al., 1997, Mol. Cell. Biol., 17: 1366 1374) and large-cell undifferentiated cancer cell lines (Mabry et al, 1991, Cancer Cells, 3:53 58); colorectal cell lines for colon cancer (Park and Gazdar, 1996, J. Cell Biochem. Suppl. 24: 131 141); multiple established cell lines for breast cancer (Hambly et al, 1997, Breast Cancer Res. Treat. 43:247 258; Gierthy et al, 1997,
  • cells with a transformed cell phenotype are contacted with one or more compounds, and examined for change in characteristics associated with a transformed phenotype (a set of in vitro characteristics associated with a tumorigenic ability in vivo), for example, but not limited to, colony formation in soft agar, a more rounded cell morphology, looser substratum attachment, loss of contact inhibition, loss of anchorage dependence, release of proteases such as plasminogen activator, increased sugar transport, decreased serum requirement, or expression of fetal antigens, etc. (see Luria et al, 1978, General Virology, 3d Ed., John Wiley & Sons, New York, pp. 436 446).
  • Loss of invasiveness or decreased adhesion may also be used to demonstrate the anti-cancer effects of the compounds used in the method of the Invention.
  • a critical aspect of the formation of a metastatic cancer is the ability of a precancerous or cancerous cell to detach from primary site of disease and establish a novel colony of growth at a secondary site. The ability of a cell to invade peripheral sites is reflective of a potential for a cancerous state.
  • Loss of invasiveness may be measured by a variety of techniques known in the art including, for example, induction of E-cadherin-mediated cell-cell adhesion. Such E-cadherin-mediated adhesion can result in phenotypic reversion and loss of invasiveness (Hordijk et al, 1997, Science 278: 1464 66).
  • Loss of invasiveness may further be examined by inhibition of cell migration.
  • a variety of 2-dimensional and 3 -dimensional cellular matrices are commercially available (Calbiochem-Novabiochem Corp. San Diego, Calif). Cell migration across or into a matrix may be examined by microscopy, time-lapsed photography or videography, or by any method in the art allowing measurement of cellular migration.
  • a related cellular matrices are commercially available (Calbiochem-Novabiochem Corp. San Diego, Calif).
  • loss of invasiveness is examined by response to hepatocyte growth factor (HGF).
  • HGF-induced cell scattering is correlated with invasiveness of cells such as Madin-Darby canine kidney (MDCK) cells.
  • MDCK Madin-Darby canine kidney
  • loss of invasiveness may be measured by cell migration through a chemotaxis chamber (Neuroprobe/Precision Biochemicals Inc. Vancouver, BC).
  • a chemo-attractant agent is incubated on one side of the chamber (e.g., the bottom chamber) and cells are plated on a filter separating the opposite side (e.g., the top chamber).
  • the cells In order for cells to pass from the top chamber to the bottom chamber, the cells must actively migrate through small pores in the filter.
  • Checkerboard analysis of the number of cells that have migrated may then be correlated with invasiveness (see e.g., Ohnishi, T., 1993, Biochem. Biophys. Res. Commun. 193:518 25).
  • general animal models applicable to many types of cancer have been described, including, but not restricted to, the p53-deficient mouse model (Donehower, 1996, Semin. Cancer Biol. 7:269 278), the Min mouse (Shoemaker et al, 1997, Biochem. Biophys.
  • a compounds ability to arrest or retard the growth of a tumor in vivo may be verified using a 9L rat gliasarcoma model as disclosed in (Murphy et al. 2007, J Neurooncol. 85: 181- 189).
  • 9L gliasarcoma are implanted into rats.
  • the 9L gliasarcoma may be derived from a piece of tumor that is implanted or from a cell culture. Further, the 9L gliasarcoma may be implanted subcutaneously as disclosed in Murphy et al.
  • a compound to be used in the methods of the invention can be administered to a test animal, in one embodiment a test animal predisposed to develop a type of tumor, and the test animal subsequently examined for a decreased incidence of tumor formation in comparison with an animal not administered the compound.
  • a compound can be administered to test animals having tumors (e.g., animals in which tumors have been induced by introduction of malignant, neoplastic, or transformed cells, or by administration of a carcinogen) and subsequently examining the tumors in the test animals for tumor regression in comparison to animals not administered the compound.
  • tumors e.g., animals in which tumors have been induced by introduction of malignant, neoplastic, or transformed cells, or by administration of a carcinogen
  • Further compounds used within the methods of the invention may be tested in various in vivo assays in the art to determine their ability to prevent, treat, ameliorate, or manage the symptoms associated with cancer.
  • the compound's ability to address cachexia may be evaluated in vitro using an interleukin-6 assay disclosed in Kuroda et al, Clinical Cancer Research 2005 11 :5590-5594.
  • in vivo assays including, but not limited to, the Yoshida AH- 130 rat ascites hepatoma assay (Carbo et al, British Journal of Cancer (2000) 83(4):526-531; Costelli et al, Am J Physiol Regul Integr Comp Physiol (2006) 291 :R674-R683); T-Cell Targeted Human Tumor Necrosis Factor murine model (Probert et al., (1993) 151(4): 1894-1906); R-l clone murine model (Lazarus et al.
  • compounds are tested for anti-neoplastic activity in the in vitro and in vivo models described in the Examples below.
  • an agent that increases KLF6 and/or FOXOl activity is used as adjunct therapy, to treatment with an anti-EGFR agent, including erlotinib.
  • Adjunct therapy includes, for example, treatment of a patient with a combination of an anti-EGFR agent and an agent that increases KLF6 and/or activity where the patient has failed to respond to therapy with an anti-EGFR agent either as monotherapy or in combination with one or more other therapeutic agent.
  • adjunct therapy includes treatment of a patient with a combination of an anti-EGFR agent and an agent that increases KLF6 and/or activity where the patient has developed primary or acquired drug resistance to the anti-EGFR agent.
  • One example of adjunct therapy is the use of compounds and compositions that increase the activity of KLF6 and/or FOXOl as therapy to treat patients who have developed resistant to an anti-EGFR therapy.
  • compounds and compositions described herein may be used in combination therapy as primary therapy for treatment of cancers and other neoplastic diseases.
  • compounds and compositions described herein may be used in combination therapy as primary therapy in combination with an anti-EGFR agent.
  • the invention also provides for treatment with a KLF6 and/or FOXOl activating agent as first line therapy with an anti-EGFR agent for treating a patient who is predicted to be only partially responsive or non-responsive to anti-EGFR agents.
  • an anti-EGFR agent for treating a patient who is predicted to be only partially responsive or non-responsive to anti-EGFR agents.
  • Such partially or non-responsive patients may be identified, for example and without limitation, as having a PI3K mutation, having increased levels of phosphorylated AKT (e.g., at ser 473 and/or thr 308), having decreased activity of KLF6 and/or FOXOl, having mislocalized of KLF6 and/or FOXOl, or any other method known in the art that would predict a patient would not respond fully to an anti-EFGR agent.
  • the invention provides for treatment with a KLF6 and/or FOXOl activating agent as first line therapy with an anti-EGFR agent for treating a patient who is predicted to be only partially responsive or non-
  • the invention provides for predicting whether a patient will respond to anti-EGFR therapy by determining the functional state or localization of KLF6 in cells of the patient.
  • patients with cells that exhibit an essentially normal functional state of KLF6 and normal localization of KLF6 are predicted to respond to anti-EGFR therapy.
  • Patients with cells that exhibit a reduced functional state of KLF6 or mislocalized of KLF6 are predicted to be resistant to or fail to respond anti-EGFR therapy.
  • the functional state of KLF6 may be determined by examining KLF6 expression or KLF6 activity. Localization of KLF6 may be determined by determining the level of KLF6 in cell fractions or by immunolocalization methods that are known in the art. The functional state of KLF6 may also be assessed by determining whether cells bear of mutant KLF6 allele or are deleted for one or both KLF6 alleles.
  • the invention provides for predicting whether a patient will respond to anti-EGFR therapy by determining the functional state or localization of FOXOl in cells of the patient.
  • patients with cells that exhibit an essentially normal functional state of FOXOl and normal localization of FOXOl are predicted to respond to anti-EGFR therapy.
  • Patients with cells that exhibit a reduced functional state of FOXOl or mislocalized of FOXOl are predicted to be resistant to or fail to respond anti-EGFR therapy.
  • the functional state of FOXOl may be determined by examining FOXOl expression or FOXOl activity. Localization of FOXOl may be determined by determining the level of FOXOl in cell fractions or by immuno localization methods that are known in the art. The functional state of FOXOl may also be assessed by
  • Antibody-based anti-EGFR agent, or antisense, RNAi or ribozyme constructs can be administered to a patient in doses ranging from 0.1 to 100 mg/kg of body weight per day or per week in single or divided doses, or by continuous infusion. In some instances, dosage levels below the lower limit of the aforesaid range may be more than adequate, while in other cases still larger doses may be employed without causing any harmful side effect, provided that such larger doses are first divided into several small doses for administration throughout the day.
  • “combination treatment with” “coadministration of and “co-administering” an anti-EGFR agent and an agent that increases activity of the KLF6 tumor suppressor gene (both components referred to together as the "two active agents") refer to any administration of the two active agents, either separately or together, where the two active agents are administered as part of an appropriate dose regimen designed to obtain the benefit of the combination therapy.
  • the two active agents can be administered either as part of the same pharmaceutical composition or in separate pharmaceutical compositions.
  • An anti-EGFR agent can be administered prior to, at the same time as, or subsequent to administration of an agent that increases activity of the KLF6 tumor suppressor gene, or in some combination thereof.
  • an agent that increases activity of the KLF6 tumor suppressor gene can be administered prior to, at the same time as, or subsequent to, each administration of the anti-EGFR agent, or some combination thereof, or at different intervals in relation to the anti-EGFR agent treatment, or in a single dose prior to, at any time during, or subsequent to the course of treatment with the anti-EGFR agent.
  • the anti-EGFR agent and/or KLF6 activating agent will typically be administered to the patient in a dose regimen that provides for the most effective treatment of the cancer (from both efficacy and safety perspectives) for which the patient is being treated, as known in the art, and as disclosed, e.g. in International Patent Publication No. WO 01/34574.
  • anti-EGFR agent and/or KLF6 activating agent can be administered in any effective manner known in the art, such as by oral, topical, intravenous, intra-peritoneal, intramuscular, intra-articular, subcutaneous, intranasal, intra-ocular, vaginal, rectal, or intradermal routes, depending upon the type of cancer being treated, the type of anti-EGFR agent being used (e.g., small molecule, antibody, RNAi or antisense construct), and the medical judgment of the prescribing physician as based, e.g., on the results of published clinical studies.
  • anti-EGFR agent e.g., small molecule, antibody, RNAi or antisense construct
  • the anti-EGFR agent and KLF6 activating agent can be administered either separately or together by the same or different routes, and in a wide variety of different dosage forms.
  • the anti-EGFR agent is preferably administered orally or parenterally, and KLF6 activating agent is preferably administered orally or parenterally.
  • the anti-EGFR agent is administered orally.
  • the anti-EGFR agent is erlotinib HC1 (TarcevaTM)
  • oral administration is preferable.
  • the anti-EGFR agent and KLF6 activating agent can be administered with various pharmaceutically acceptable inert carriers in the form of tablets, capsules, lozenges, troches, hard candies, powders, sprays, creams, salves, suppositories, jellies, gels, pastes, lotions, ointments, elixirs, syrups, and the like. Administration of such dosage forms can be carried out in single or multiple doses. Carriers include solid diluents or fillers, sterile aqueous media and various non-toxic organic solvents, etc. Oral pharmaceutical compositions can be suitably sweetened and/or flavored.
  • the anti-EGFR agent and KLF6 activating agent can be combined together with various pharmaceutically acceptable inert carriers in the form of sprays, creams, salves, suppositories, jellies, gels, pastes, lotions, ointments, and the like. Administration of such dosage forms can be carried out in single or multiple doses.
  • Carriers include solid diluents or fillers, sterile aqueous media, and various non-toxic organic solvents, etc.
  • tablets containing one or both of the active agents are combined with any of various excipients such as, for example, micro-crystalline cellulose, sodium citrate, calcium carbonate, dicalcium phosphate and glycine, along with various disintegrants such as starch (and preferably corn, potato or tapioca starch), alginic acid and certain complex silicates, together with granulation binders like polyvinyl pyrrolidone, sucrose, gelatin and acacia.
  • disintegrants such as starch (and preferably corn, potato or tapioca starch), alginic acid and certain complex silicates, together with granulation binders like polyvinyl pyrrolidone, sucrose, gelatin and acacia.
  • lubricating agents such as magnesium stearate, sodium lauryl sulfate and talc are often very useful for tableting purposes.
  • Solid compositions of a similar type may also be employed as fillers in gelatin capsules; preferred materials in this connection also include lactose or milk sugar as well as high molecular weight polyethylene glycols.
  • the EGFR kinase inhibitor may be combined with various sweetening or flavoring agents, coloring matter or dyes, and, if so desired, emulsifying and/or suspending agents as well, together with such diluents as water, ethanol, propylene glycol, glycerin and various like combinations thereof.
  • solutions in either sesame or peanut oil or in aqueous propylene glycol may be employed, as well as sterile aqueous solutions comprising the active agent or a corresponding water-soluble salt thereof.
  • sterile aqueous solutions are preferably suitably buffered, and are also preferably rendered isotonic, e.g., with sufficient saline or glucose.
  • These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal injection purposes.
  • the oily solutions are suitable for intra-articular, intramuscular and subcutaneous injection purposes. The preparation of all these solutions under sterile conditions is readily accomplished by standard pharmaceutical techniques well known to those skilled in the art.
  • Any parenteral formulation selected for administration of proteinaceous anti-EGFR agents should be selected so as to avoid denaturation and loss of biological activity.
  • a topical formulation comprising an anti-EGFR agent and/or a KLF6 activating agent in about 0.1% (w/v) to about 5% (w/v) concentration can be prepared.
  • the active agents can be administered separately or together to animals using any of the forms and by any of the routes described above.
  • the EGFR kinase inhibitor is administered in the form of a capsule, bolus, tablet, liquid drench, by injection or as an implant.
  • the EGFR kinase inhibitor can be administered with the animal feedstuff, and for this purpose a concentrated feed additive or premix may be prepared for a normal animal feed.
  • the PDX is preferably administered in the form of liquid drench, by injection or as an implant.
  • Such formulations are prepared in a conventional manner in accordance with standard veterinary practice.
  • the present invention further provides a kit comprising a single container comprising anti-EGFR agent and KLF6 activating agent.
  • the present invention further provides a kit comprising a first container comprising an anti-EGFR agent and a second container comprising a KLF6 activating agent.
  • the kit containers may further include a pharmaceutically acceptable carrier.
  • the kit may further include a sterile diluent, which is preferably stored in a separate additional container.
  • the kit may further include a package insert comprising printed instructions directing the use of the combined treatment as a method for treating cancer.
  • composition is comprised of a pharmaceutically acceptable carrier and a non-toxic therapeutically effective amount of an anti-EGFR agent and KLF6 activating agent (including pharmaceutically acceptable salts of each component thereof).
  • an anti-EGFR agent and KLF6 activating agent including pharmaceutically acceptable salts of each component thereof.
  • the invention encompasses a
  • compositions for the treatment of disease comprising a pharmaceutically acceptable carrier and a non-toxic therapeutically effective amount of an anti-EGFR agent and KLF6 activating agent (including pharmaceutically acceptable salts of each component thereof).
  • salts refers to salts prepared from pharmaceutically acceptable non-toxic bases or acids. When a compound of the present invention is acidic, its corresponding salt can be conveniently prepared from
  • salts derived from such inorganic bases include aluminum, ammonium, calcium, copper (cupric and cuprous), ferric, ferrous, lithium, magnesium, manganese (manganic and manganous), potassium, sodium, zinc and the like salts. Particularly preferred are the ammonium, calcium, magnesium, potassium and sodium slats.
  • Salts derived from pharmaceutically acceptable organic non-toxic bases include salts of primary, secondary, and tertiary amines, as well as cyclic amines and substituted amines such as naturally occurring and synthesized substituted amines.
  • organic non-toxic bases from which salts can be formed include ion exchange resins such as, for example, arginine, betaine, caffeine, choline, ⁇ ', ⁇ '-dibenzylethylenediamine, diethylamine, 2-diethylaminoethanol, 2-dimethylaminoethanol, ethanolamine, ethylenediamine, N-ethylmorpholine, N-ethylpiperidine, glucamine, glucosamine, histidine, hydrabamine, isopropylamine, lysine, methylglucamine, morpholine, piperazine, piperidine, polyamine resins, procaine, purines, theobromine, triethylameine, trimethylamine, tripropylamine, tromethamine and the like.
  • ion exchange resins such as, for example, arginine, betaine, caffeine, choline, ⁇ ', ⁇ '-dibenzylethylenediamine, diethy
  • a compound of the present invention is basic, its corresponding salt can be conveniently prepared from pharmaceutically acceptable non-toxic acids, including inorganic and organic acids.
  • acids include, for example, acetic, benzenesulfonic, benzoic, camphorsulfonic, citric, ethanesulfonic, fumaric, gluconic, glutamic, hydrobromic, hydrochloric, isethionic, lactic, maleic, malic, mandelic, methanesulfonic, mucic, nitric, pamoic, pantothenic, phosphoric, succinic, sulfuric, tartaric, p- toluenesulfonic acid and the like.
  • Particularly preferred are citric, hydrobromic, hydrochloric, maleic, phosphoric, sulfuric and tartaric acids.
  • compositions of the present invention comprise an anti- EGFR agent and KLF6 activating agent (including pharmaceutically acceptable salts of each component thereof) as active ingredient, a pharmaceutically acceptable carrier and optionally other therapeutic ingredients or adjuvants.
  • Other therapeutic agents may include those cytotoxic, chemotherapeutic or anti-cancer agents, or agents that enhance the effects of such agents, as listed above.
  • the compositions include compositions suitable for oral, rectal, topical, and parenteral (including subcutaneous, intramuscular, and intravenous) administration, although the most suitable route in any given case will depend on the particular host, and nature and severity of the conditions for which the active ingredient is being administered.
  • the pharmaceutical compositions may be conveniently presented in unit dosage form and prepared by any of the methods well known in the art of pharmacy.
  • the compounds represented by an anti-EGFR agent and KLF6 activating agent combination (including pharmaceutically acceptable salts of each component thereof) of this invention can be combined as the active ingredient in intimate admixture with a pharmaceutical carrier according to conventional pharmaceutical compounding techniques.
  • the carrier may take a wide variety of forms depending on the form of preparation desired for administration, e.g. oral or parenteral (including intravenous).
  • the pharmaceutical compositions of the present invention can be presented as discrete units suitable for oral administration such as capsules, cachets or tablets each containing a predetermined amount of the active ingredient.
  • compositions can be presented as a powder, as granules, as a solution, as a suspension in an aqueous liquid, as a non-aqueous liquid, as an oil-in- water emulsion, or as a water-in- oil liquid emulsion.
  • an anti- EGFR agent and KLF6 activating agent combination may also be administered by controlled release means and/or delivery devices.
  • the combination compositions may be prepared by any of the methods of pharmacy. In general, such methods include a step of bringing into association the active ingredients with the carrier that constitutes one or more necessary ingredients.
  • the compositions are prepared by uniformly and intimately admixing the active ingredient with liquid carriers or finely divided solid carriers or both. The product can then be conveniently shaped into the desired presentation.
  • a pharmaceutical composition can comprise an anti-EGFR agent and KLF6 activating agent in combination with an anticancer agent, wherein said anti-cancer agent is a member selected from the group consisting of alkylating drugs, antimetabolites, microtubule inhibitors, podophyllotoxins, antibiotics, nitrosoureas, hormone therapies, kinase inhibitors, activators of tumor cell apoptosis, and antiangiogenic agents.
  • said anti-cancer agent is a member selected from the group consisting of alkylating drugs, antimetabolites, microtubule inhibitors, podophyllotoxins, antibiotics, nitrosoureas, hormone therapies, kinase inhibitors, activators of tumor cell apoptosis, and antiangiogenic agents.
  • the pharmaceutical carrier employed can be, for example, a solid, liquid, or gas.
  • solid carriers include lactose, terra alba, sucrose, talc, gelatin, agar, pectin, acacia, magnesium stearate, and stearic acid.
  • liquid carriers are sugar syrup, peanut oil, olive oil, and water.
  • gaseous carriers include carbon dioxide and nitrogen.
  • oral liquid preparations such as suspensions, elixirs and solutions
  • carriers such as starches, sugars, microcrystalline cellulose, diluents, granulating agents, lubricants, binders, disintegrating agents, and the like may be used to form oral solid preparations such as powders, capsules and tablets.
  • oral solid preparations such as powders, capsules and tablets.
  • tablets and capsules are the preferred oral dosage units whereby solid pharmaceutical carriers are employed.
  • tablets may be coated by standard aqueous or nonaqueous techniques.
  • a tablet containing the composition of this invention may be prepared by compression or molding, optionally with one or more accessory ingredients or adjuvants.
  • Compressed tablets may be prepared by compressing, in a suitable machine, the active ingredient in a free-flowing form such as powder or granules, optionally mixed with a binder, lubricant, inert diluent, surface active or dispersing agent. Molded tablets may be made by molding in a suitable machine, a mixture of the powdered compound moistened with an inert liquid diluent.
  • Each tablet preferably contains from about 0.05 mg to about 5 g of the active ingredient and each cachet or capsule preferably containing from about 0.05 mg to about 5 g of the active ingredient.
  • compositions of the present invention suitable for parenteral administration may be prepared as solutions or suspensions of the active compounds in water.
  • a suitable surfactant can be included such as, for example,
  • Dispersions can also be prepared in glycerol, liquid
  • polyethylene glycols and mixtures thereof in oils. Further, a preservative can be included to prevent the detrimental growth of microorganisms.
  • compositions of the present invention suitable for injectable use include sterile aqueous solutions or dispersions.
  • the compositions can be in the form of sterile powders for the extemporaneous preparation of such sterile injectable solutions or dispersions.
  • the final injectable form must be sterile and must be effectively fluid for easy syringability.
  • the pharmaceutical compositions must be stable under the conditions of manufacture and storage; thus, preferably should be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol and liquid polyethylene glycol), vegetable oils, and suitable mixtures thereof.
  • compositions of the present invention can be in a form suitable for topical use such as, for example, an aerosol, cream, ointment, lotion, dusting powder, or the like. Further, the compositions can be in a form suitable for use in transdermal devices. These formulations may be prepared, utilizing an anti-EGFR agent and KLF6 activating agent (including pharmaceutically acceptable salts of each component thereof) of this invention, via conventional processing methods. As an example, a cream or ointment is prepared by admixing hydrophilic material and water, together with about 5 wt % to about 10 wt % of the compound, to produce a cream or ointment having a desired consistency.
  • compositions of this invention can be in a form suitable for rectal administration wherein the carrier is a solid. It is preferable that the mixture forms unit dose suppositories. Suitable carriers include cocoa butter and other materials commonly used in the art. The suppositories may be conveniently formed by first admixing the composition with the softened or melted carrier(s) followed by chilling and shaping in molds.
  • the pharmaceutical formulations described above may include, as appropriate, one or more additional carrier ingredients such as diluents, buffers, flavoring agents, binders, surface-active agents, thickeners, lubricants, preservatives (including anti-oxidants) and the like.
  • additional carrier ingredients such as diluents, buffers, flavoring agents, binders, surface-active agents, thickeners, lubricants, preservatives (including anti-oxidants) and the like.
  • additional carrier ingredients such as diluents, buffers, flavoring agents, binders, surface-active agents, thickeners, lubricants, preservatives (including anti-oxidants) and the like.
  • additional carrier ingredients such as diluents, buffers, flavoring agents, binders, surface-active agents, thickeners, lubricants, preservatives (including anti-oxidants) and the like.
  • other adjuvants can be included to render the formulation isotonic with the blood of the intended recipient
  • HCC827, H2122, H1975, and H1650 cell lines were obtained from the American Tissue Culture Collection and were cultured according to the supplier's instructions.
  • Cell line A5491uc was obtained from Caliper Life Sciences and were cultured according to the supplier's instructions.
  • H3255 cell line was obtained from Dr. Katerina Politi and Dr. Harold Varmus at Memorial Sloan-Kettering Cancer Center.
  • EGFR L858R -derived tumor samples (Politi, K., et al. Genes Dev 20, 1496-1510 (2006)) were generously provided from Dr. Katerina Politi and Dr.
  • Rabbit antibodies specific for P-EGFR (2234), EGFR (4405), L858R (3197), P-AKT (4058), AKT (9272), P-ERK (9272), ERK (4695), Cleaved Caspase 3 (9661), P-FOXOl (2486), and FOXOl (2880) were obtained from Cell Signaling Technologies.
  • Rabbit polyclonal KLF6 antibody (sc-7158), goat polyclonal Actin antibody (sc-1616), and mouse monoclonal GAPDH antibody (sc-32233) were purchased from Santa Cruz Biotechnology.
  • Rabbit polyclonal PARP (G7341) was obtained from Promega.
  • GGGCTCTGGAGGAAAAGAAA SEQ ID NO: 4
  • GPDH glyceraldehyde-3 -phosphate dehydrogenase
  • Plasmids and siRNAs Plasmids and siRNAs.
  • AKTmyr and FOXOl plasmids were transfected into cells by Lipofectamine 2000 incubation (Invitrogen) for 20 minutes.
  • Validated KLF6-specific siRNA was transfected using HiPerfect (Qiagen) into cell lines seeded at 60-70% confluency.
  • FOXOl inhibition transfections were performed using FOXOl A ON-TARGETplus SMARTpool from Dharmacon. Knockdown and overexpression was assessed by western blotting and quantitative real-time PCR.
  • KLF6 promoter assay HCC827 cells were co-transfected with ⁇ g of pGL3- KLF6 promoter luciferase construct and pRL-TK plasmid (see Yea, S., et al.
  • HI 650 cells were seeded and grown to 60-70% confluency, and treated with increasing doses of TFP.
  • Cell lysates were extracted using NE-PER Nuclear and Cytoplasmic Extraction Reagents (Thermo Scientific) according to supplier's protocol.
  • HCC827 shLuc and shKLF6 were plated at a low density in 6-well plates. After 24 h, cells were treated with 50nM of erlotinib and further incubated for 7 days. Cells were fixed and then stained with 1% crystal violet staining solution.
  • pSUPER.retro.puro vectors (Oligoengine) encoding short hairpin RNA targeting KLF6 were designed. See Shepherd, F.A., et al. N Engl J Med 353, 123-132 (2005). A pSUPER vector encoding Luciferase shRNA was used as a control. Stable cell lines of HCC827 were generated by retroviral transfection of the pSUPER-shLuciferase (shLuc) and pSUPER-shKLF6 (shKLF6) and selected with 2 ⁇ g/mL puromycin as described by Shepherd, F.A., et al, N Engl J Med 353, 123-132 (2005).
  • Tumor volume was assessed weekly as described by Sangodkar, J., et al. (Lung Cancer 66, 292-297 (2009)) until volumes reached an average of 100mm 3 .
  • the following treatments were administered via intraperitoneal injection: Vehicle (DMSO) and erlotinib (25mg/kg). A total of 4 treatments were given with a 48h rest period.
  • H1650 cells (5 x 10 6 ) were similarly injected into the right flank of 6 to 8-week old female BALB/c nu/nu mice. Tumor volume was assessed weekly as previously described by Sangodkar, J., et al, supra until volumes reached an average of 200mm 3 .
  • the following treatments were administered via intraperitoneal injection: Vehicle control (DMSO), erlotinib (25mg/kg), TFP (lOmg/kg), and combination erlotinib (25mg/kg) and TFP (lOmg/kg). A total of four treatments were given with a 48h rest period. All animal studies were approved by the Mount Sinai School of Medicine IACUC.
  • Activated EGFR signaling drives transcriptional downregulation of KLF6 expression in primary human lung adenocarcinomas and a murine model of the disease
  • KLF6 mRNA and protein expression was decreased in all patient tumor samples analyzed, by an average of more than 50% as compared to surrounding normal lung tissue (Fig. la, b).
  • Tumor samples were deemed 'activated' if pEGFR (Y1068) expression was higher compared to matched surrounding lung tissue from the same patient.
  • Activated EGFR signaling as assessed by comparing tyrosine phosphorylation between matched normal and tumor tissue, was associated with significantly lower KLF6 expression in patient lung adenocarcinomas when compared to tumors demonstrating low levels of EGFR activation (Fig. lc, d).
  • Example 3 KLF6 is transcriptionally upregulated by anti-EGFR-based therapy and mediates the apoptotic response to erlotinib in human lung adenocarcinoma cell lines
  • erlotinib sensitivity was determined in a panel of four commonly used lung adenocarcinoma cell lines with a variety of the molecular alterations in either EGFR or downstream mediators of its signaling pathway (Fig. 2a).
  • Increasing doses of erlotinib were added as previously described (Sos, M.L., et al. Cancer Res 69, 3256-3261 (2009)) and cellular apoptosis was measured using a combination of fluorescence-activated cell-sorting (FACS) analysis (through determination of the sub-Gl fraction) (Fig. 2b) and western blotting for cleaved PARP (Fig.
  • FACS fluorescence-activated cell-sorting
  • results showed the HCC827 cell line, harboring an exon 19 deletion, was highly sensitive to erlotinib with a measured IC 50 of 50nm.
  • variable sensitivity of the lung adenocarcinoma cell lines to anti-EGFR- based therapy was used to determine the effects of EGFR inhibition on KLF6 gene transcription.
  • the effects of erlotinib on KLF6 promoter activity were analyzed using a hybrid 2.2kb KLF6 promoter-luciferase construct (Yea, S., et al. Gastroenterology 134, 1521-1531 (2008)) in the erlotinib-sensitive lung adenocarcinoma HCC827cell line (Fig. 2d).
  • EGFR L858R mouse model in which treatment with erlotinib results in spontaneous tumor regression in the mice.
  • tumors treated with erlotinib showed increased KLF6 expression at both the mRNA and protein level (Fig. 2g and data not shown).
  • the upregulation of KLF6 in these tumors in vivo resulted in increased spontaneous apoptosis as demonstrated by increased Caspase 3 cleavage (Fig. 2h).
  • EGFR activates two major downstream pathways, the Ras-Raf-MAPK and the PI3K-AKT signaling cascades, resulting in both increased cellular proliferation and survival.
  • KLF6 promoter activity and KLF6 mRNA and protein levels were measured in A549 lung adenocarcinoma cell line that overexpressed a constitutively active form of AKT construct (Boehm, J.S., et al. Cell 129, 1065-1079 (2007)). Results showed that increased AKT signaling resulted in a marked reduction in KLF6 promoter activity and endogenous mRNA and protein expression of the KLF6 tumor suppressor (Fig. 3c, d, e). These results demonstrated that the KLF6 expression is negatively regulated by EGFR-driven activation of the PI3K-AKT signaling pathway in human lung adenocarcinoma.
  • FOXOl is a transcriptional regulator of KLF6 in lung adenocarcinoma
  • a key downstream regulator of PI3K-AKT signaling is the transcription factor FOXOl .
  • Post-translational modification of FOXO proteins is a critical mechanism for regulation of their function.
  • AKT -mediated phosphorylation maintains FOXO proteins in the cytoplasm and targets them for proteasome-mediated degradation.
  • KLF6 is a direct transcriptional target of FOXOl .
  • Terragni J., et al. BMC Cell Biol 9, 6 (2008).
  • A549 cells were transiently transfected with pCINEO-FOXOl construct and analyzed after 48hrs for FOXOl and KLF6 mRNA levels, respectively, via quantitative real-time PCR. Data was normalized to GAPDH (similar results were obtained with normalization to 18S and Actin as housekeeping controls), results were calculated as fold change mRNA expression compared to control cells transfected with pCINEO. KLF6 promoter activity was measured by a dual-reporter assay in the presence of FOXOl overexpression and results were calculated as fold change compared to control vector- transfected cells.
  • FOXOl and KLF6 mRNA expression were determined by quantitative real-time PCR, normalized to GAPDH, in A549 cells 48 h after transfection with sequence specific siRNAs to FOXOl (siFOXOl) or control construct (siNTC). Western blots were used to determine the expression of the apoptotic markers PARP and caspase-3, normalized to GAPDH, 48 hours after treatment with siFOXOl . [0180] Results showed that overexpression of FOXOl in the A549 lung adenocarcinoma cell lines increased KLF6 promoter activity, mRNA, and protein expression (Fig. 4a-d). Silencing of FOXOl using sequence specific siRNAs (Fig.
  • activated AKT signaling was associated with decreased KLF6 mRNA and protein expression as assessed by quantitative real-time PCR and western blotting in heterozygous PTEN mice compared to age-matched/sex-matched wild-type littermates (Fig. 5c, d).
  • HCC827 cell lines treated with 1 ⁇ erlotinib for 48 h exhibited significantly increased levels of apoptosis, as measured by FACS analysis by sub-Gl propidium iodide staining (Fig. 7b) and cleaved PARP (Fig. 7c).
  • the erlotinib-resistant H1650 cell line showed no increase in apoptosis following erlotinib treatment (Fig. 7b, c).
  • KLF6 expression was significant upregulated in the treatment-sensitive HCC827 cell line and not in the resistant HI 650 cell line (Fig. 7d, e).
  • KLF6 RNAi reduced KLF6 expression (Fig. 8a, b) in the HCC827 cell line. Expression of KLF6 RNAi also decreased erlotinib driven apoptosis, as
  • Trifluoperazine Hydrochloride (TFP), a FDA-approved antipsychotic and antiemetic, is an effective nuclear export inhibitor of the FOXOl transcription factor that increases FOXOl nuclear localization via calmodulin inhibition upstream of AKT and downstream of PI3K. Kau, T.R., et al. Cancer Cell 4, 463-476 (2003). TFP was used to inhibit nuclear export of FOXOl and determine if activation of the FOXOl /KLF6 transcriptional network could restore sensitivity to the PTEN-depleted, erlotinib-resistant cell line, HI 650.
  • HI 650 cells were treated for 1 h with increasing doses of TFP (0, 20 ⁇ , 40 ⁇ ) and fractionated into nuclear and cytoplasmic fractions.
  • BRCAl served as a nuclear marker
  • GAPDH served as a cytoplasmic marker for the fractionation.
  • chlorpromazine at 48 hours resulted in significant nuclear accumulation of FOXOl, compared to untreated control cells.
  • FACS analysis by sub-Gl propidium iodide staining of H1650 cells treated with increasing doses of CPZ for 48hrs demonstrates increased amount of apoptosis in response to the drug.
  • this data suggests a general class effect of phenothiazine based small molecules in relocalizing FOXOl from the cytoplasm to the nucleus and in the induction of apoptosis in metastatic lung cancer cell lines.
  • Combination treatment with TFP and erlotinib increased apoptosis and decreased tumorigenicity in a resistant cell line in vitro and in vivo
  • Example 9 [0195] These data highlight the involvement of the Ras-Raf-MAPK signaling pathway in the regulation of cellular proliferation and the AKT-PI3K signaling axis in the regulation of cellular survival.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Molecular Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Pathology (AREA)
  • Microbiology (AREA)
  • General Physics & Mathematics (AREA)
  • Epidemiology (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Toxicology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne des agents thérapeutiques anticancéreux. Dans certains aspects, les cancers sont traités par une combinaison d'un agent anti-EGFR et d'un agent qui augmente l'activité du gène suppresseur de tumeur KLF6 et/ou un agent qui augmente l'activité du gène suppresseur de tumeur FOXO1. Dans un aspect préféré, l'agent anti-EGFR erlotinib et le composé de phénothiazine, la trifluopérazine, ou le composé de phénothiazine, la chlorpromazine, sont utilisés en combinaison pour traiter un cancer du poumon non à petites cellules chez un patient présentant une pharmacorésistance primaire ou acquise vis-à-vis de l'erlotinib. Dans des aspects supplémentaires, l'invention concerne des compositions et des trousses utiles pour le traitement de cancers, des procédés de criblage pour la recherche de composés qui augmentent l'activité d'un agent anti-EGFR, et des procédés de détermination de savoir si un patient sera sensible à une thérapie anti-EGFR.
PCT/US2011/020864 2011-01-11 2011-01-11 Méthodes et compositions pour le traitement du cancer et procédés associés WO2012096654A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
PCT/US2011/020864 WO2012096654A1 (fr) 2011-01-11 2011-01-11 Méthodes et compositions pour le traitement du cancer et procédés associés
CA2860862A CA2860862A1 (fr) 2011-01-11 2011-01-11 Methodes et compositions pour le traitement du cancer et procedes associes
PCT/US2012/020922 WO2012097054A1 (fr) 2011-01-11 2012-01-11 Méthodes et compositions pour le traitement du cancer et méthodes associées

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US2011/020864 WO2012096654A1 (fr) 2011-01-11 2011-01-11 Méthodes et compositions pour le traitement du cancer et procédés associés

Publications (1)

Publication Number Publication Date
WO2012096654A1 true WO2012096654A1 (fr) 2012-07-19

Family

ID=46507358

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2011/020864 WO2012096654A1 (fr) 2011-01-11 2011-01-11 Méthodes et compositions pour le traitement du cancer et procédés associés

Country Status (2)

Country Link
CA (1) CA2860862A1 (fr)
WO (1) WO2012096654A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120322792A1 (en) * 2011-01-11 2012-12-20 Mount Sinai School Of Medicine Method and Compositions for Treating Cancer and Related Methods
WO2015136061A3 (fr) * 2014-03-13 2016-01-21 Ecole Polytechnique Federale De Lausanne (Epfl) Association de médicaments pour le traitement de maladies prolifératives

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005027842A2 (fr) * 2003-09-18 2005-03-31 Combinatorx, Incorporated Associations de medicaments destinees au traitement de tumeurs
US20070280928A1 (en) * 2006-03-13 2007-12-06 Buck Elizabeth A Combined treatment with an EGFR kinase inhibitor and an agent that sensitizes tumor cells to the effects of EGFR kinase inhibitors
US20090156523A1 (en) * 2005-07-11 2009-06-18 Irm Llc Methods and compositions for modulating foxo1 activity and insulin signaling

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005027842A2 (fr) * 2003-09-18 2005-03-31 Combinatorx, Incorporated Associations de medicaments destinees au traitement de tumeurs
US20090156523A1 (en) * 2005-07-11 2009-06-18 Irm Llc Methods and compositions for modulating foxo1 activity and insulin signaling
US20070280928A1 (en) * 2006-03-13 2007-12-06 Buck Elizabeth A Combined treatment with an EGFR kinase inhibitor and an agent that sensitizes tumor cells to the effects of EGFR kinase inhibitors

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
GRIDELLI ET AL.: "Erlotinib in non-small cell lung cancer treatment: current status and future development.", ONCOLOGIST, vol. 12, no. 7, 2007, pages 840 - 9 *
KAU ET AL.: "A Chemical Genetic Screen Identifies Inhibitors of Regulated Nuclear Export of a Forkhead Transcription Factor in PTEN-Deficient Tumor Cells.", CANCER CELL, vol. 4, no. 6, 2003, pages 463 - 476 *
MAEKAWA ET AL.: "The Role of FOX01 (FKHR) in Apoptosis of Non-Small Cell Lung Cancer (NSCLC).", CHEST 2006 - POSTER PRESENTATIONS., 25 October 2006 (2006-10-25), pages 243S, Retrieved from the Internet <URL:http://meeting.chestpubs.org/cgi/content/abstract/130/4/234S-a> [retrieved on 20110713] *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120322792A1 (en) * 2011-01-11 2012-12-20 Mount Sinai School Of Medicine Method and Compositions for Treating Cancer and Related Methods
US9134297B2 (en) * 2011-01-11 2015-09-15 Icahn School Of Medicine At Mount Sinai Method and compositions for treating cancer and related methods
US9494572B2 (en) 2011-01-11 2016-11-15 Icahn School Of Medicine At Mount Sinai Method and compositions for treating cancer and related methods
WO2015136061A3 (fr) * 2014-03-13 2016-01-21 Ecole Polytechnique Federale De Lausanne (Epfl) Association de médicaments pour le traitement de maladies prolifératives

Also Published As

Publication number Publication date
CA2860862A1 (fr) 2012-07-19

Similar Documents

Publication Publication Date Title
Nagpal et al. Neoadjuvant neratinib promotes ferroptosis and inhibits brain metastasis in a novel syngeneic model of spontaneous HER2+ ve breast cancer metastasis
Jin et al. Combined inhibition of ATR and WEE1 as a novel therapeutic strategy in triple-negative breast cancer
KR102473113B1 (ko) 암 치료를 위한 병용 요법
Dong et al. Selective inhibition of PDGFR by imatinib elicits the sustained activation of ERK and downstream receptor signaling in malignant glioma cells
Felip et al. Therapeutic potential of the new TRIB3-mediated cell autophagy anticancer drug ABTL0812 in endometrial cancer
US20210008073A1 (en) Platelet-derived growth factor receptor mutations and compositions and methods relating thereto
US9494572B2 (en) Method and compositions for treating cancer and related methods
KR20160143775A (ko) iNOS-억제 조성물들 및 이들의 유방암 치료제로서의 용도
EP2994155B1 (fr) Ciblage de l&#39;interaction entre un egfr et un sglt1 pour la cancérothérapie
Cuneo et al. Enhancing the radiation response in KRAS mutant colorectal cancers using the c-Met inhibitor crizotinib
US8198266B2 (en) Use of an EGFR antagonist for the treatment of glomerolonephritis
Chung et al. Sorafenib suppresses TGF-β responses by inducing caveolae/lipid raft-mediated internalization/degradation of cell-surface type II TGF-β receptors: Implications in development of effective adjunctive therapy for hepatocellular carcinoma
Parag-Sharma et al. Synergistic efficacy of combined EGFR and HDAC inhibitors overcomes tolerance to EGFR monotherapy in salivary mucoepidermoid carcinoma
Moreira et al. Targeting MYC-driven replication stress in medulloblastoma with AZD1775 and gemcitabine
Naruse et al. Therapeutic implication of mTORC2 in oral squamous cell carcinoma
US20130344140A1 (en) Novel pharmaceutical combinations and methods for treating cancer
WO2012097054A1 (fr) Méthodes et compositions pour le traitement du cancer et méthodes associées
WO2012096654A1 (fr) Méthodes et compositions pour le traitement du cancer et procédés associés
US20180133214A1 (en) Pharmaceutical composition for treating cancer and a method of using the same
WO2015171622A1 (fr) Peptides pour le traitement du cancer
US20110014303A1 (en) Method for the treatment of cancer
EP2905032B1 (fr) Procédé et composition pharmaceutique pour inhiber la voie de signalisation pi3k/akt/mtor
Lim et al. Ibrutinib disrupts blood-tumor barrier integrity and prolongs survival in rodent glioma model
US20100152140A1 (en) Method of Cancer Treatment with Naphthol Analogs
US20240197709A1 (en) Potentiating the tumor-selective effects of nqo1-bioactivatable agent by use of cmet inhibitor

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11855683

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11855683

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2860862

Country of ref document: CA