WO2012095843A1 - Organisms with altered steroidal saponin and steroidal alkaloid levels and methods for producing same - Google Patents

Abstract

The present invention relates to a key gene (designated GAME4) in the biosynthesis of steroidal saponins and steroidal (glyco) alkaloids and to means and methods for altering its expression. The invention further provides genetically modified organisms having altered levels of steroidal saponins and/or steroidal alkaloids compared to unmodified organisms. The metabolites produced by the genetically modified organisms may be further used in the pharmaceutics industry.

Description

ORGANISMS WITH ALTERED STEROIDAL SAPONIN AND STEROIDAL ALKALOID LEVELS AND METHODS FOR PRODUCING SAME

FIELD OF THE INVENTION

The present invention relates to a key gene in the biosynthesis of steroidal saponins and steroidal alkaloids and to means and methods for altering the gene expression and the production of steroidal saponins and steroidal alkaloids.

BACKGROUND OF THE INVENTION

The broad group of triterpenoid compounds is widespread in the plant kingdom and derived from the cytosolic Mevalonic acid isoprenoid biosynthetic pathway. Steroidal saponins (SS) and Steroidal alkaloids (SAs) are two large classes of triterpenoids produced by plants. SSs were suggested to be derived from cholesterol and biosynthesized in the cytosol. In addition to their role as defensive substances in plants, SSs are widely used in the industry as saponifying agents and also as health promoting agents, for example a hormone precursors, !antifungal and anticancer drugs. Steroidal alkaloids (SAs), also known as "Solanum alkaloids" are common constituents of

i

numerous plants belonging to the Solanaceae family, particularly of the genus Solanum. Steroidal alkaloids are also produced by a large number of species in the Liliaceae family.

Estimated in the order of 1350 species, Solanum is one of the largest genera of flowering plants, representing about a half of the species in the Solanaceae. Diverse structural composition and biological activity, as well as occurrence in food plants (e.g. tomato, potato and eggplant) made SAs the subject of extensive investigations (Eich E. 2008. Solanaceae and Convolvulaceae - secondary metabolites: biosynthesis, chemotaxonomy, biological and economic significance: a handbook. Berlin: Springer).

Consisting of a C-27 cholestane skeleton and a heterocyclic nitrogen component, SAs were suggested to be synthesized in the! cytosol from cholesterol and in most cases are further glycosylated to form steroidal ^lycoalkaloids (SGAs) (Arnqvist L. et al. 2003. Plant Physiol 131 :1792-1799). The oligosaccharide moiety components of SGAs include D-glucose, D-galactose, L-rhamnosd, D-xylose, and L-arabinose, the first two monosaccharide being the predominant units directly conjugated to the hydroxyl group at C-3 ? of the alkamine steroidal skeleton (aglycone). Although several optional pathways for SA biosynthesis were suggested (Friedman 2002, supra; Kalinowska M. et al. 2005 Phytochemistry Reviews 4:237-257), the complex network of their biosynthesis was not elucidated to date.

In plants, S As serve as a phytoanticipins (antimicrobial compounds) that provide a pre-existing chemical barrier that protects plants against a broad range of pathogens. The mechanism of action of the tomato a-tomatine, for example, relies on disruption of the pathogen membranes followed by leakage of electrolytes and depolarization of the pathogen membrane potential. Although -tomatine is harmful to many organisms including mammals and humans and even plants, it was suggested that tomato plants are not affected by its occurrence, possibly due to the presence of sterol glycosides and acetylated sterol glycosides in tomato cell membranes. Steroidal alkaloids (e.g. a- tomatine) were found to act as anticancer agents and can be used against several human pathogens and viruses.

Steroidal alkaloids have been extensively studied, primarily in potato. Sprouting potato tubers are often used as a main source of food, and thus might expose animals and humans to relatively high levels of SGAs (total SGAs levels must not exceed 20 mg per 100 g fresh weight in new potato cultivars). In domesticated potato, chaconine and solanine comprise above 90% of the total SAs. Recently, Shakya and Navarre (Shakya R. and Navarre D.A. 2008. J Agric Food Chem 56:6949-6958) employed Liquid Chromatography - Mass Spectrometry (LC-MS) analyses of tuber extracts derived from 7 genotypes (4 wild species and 3 cultivars) and putatively identified over 50 SAs with solanidane or solanidane-like aglycones, of which many appeared to be novel. Several genes from potato, coding for glycosyltransferases (GTs) involved in the biosynthesis of a-solanine and a-chaconine from the aglycone solanidine, were characterized. (U.S. Patent No. 5,959,180 discloses DNA sequences from potato which encode the enzyme solanidine UDP-glucose glucosyltransferase (SGT). Recombinant DNA molecules containing the sequences, and use thereof, in particular, use of an antisense DNA construct to inhibit the production of SGT and thereby reduce glycoalkaloid levels in solanaceous plants, e.g., potato, are described. U.S. Patent Nos.7,375,259; 7,439,419 disclose nucleic acid sequences from potato that encode the enzymes UDP-glucose:solanidine glucosyltransferase (SGT2) and β- solanine/p-chaconine rhamnosyltransferase (SGT3), respectively.) Recombinant DNA molecules containing the sequences, and use thereof, in particular, use of the sequences and antisense constructs to inhibit the production of SGT2/SGT3 and thereby reduce levels of the predominant steroidal glycoalkaloids a.-chaconine and a-solanine in Solanaceous plants such as potato are also described.

In recent years, several groups analyzed the distribution of SAs in tomato plants.

Although approximately 100 putative SAs were reported to be present in various tomato organs, only a small number of tomato tissues was analyzed, α-tomatine, the major SGA in tomato, was reported to be accompanied by dehydrotomatine, and to be present in all green tomato tissues. Interestingly, some organs, such as VI type secretory and glandular trichomes were found to be depleted of α-tomatine and dehydrotomatine.

During fruit ripening, the levels of α-tomatine diminish. Recently it has been suggested that the conversion of α-tomatine to esculeoside A is dependent upon ripening.

Esculeoside A is the most abundant SGA of the ripe fruit and its levels were shown to be ripening and ethylene dependent.

The proteins of the Cytochrome P450 (CYP) family are membrane-bound monooxygenases that were found in all living organisms (Wong L. L. 1998. Current Opinion in Chemical Biology 2:263-268) and catalyze numerous reactions associated with secondary metabolism. For example, several studies reported, the function of CYPs in the biosynthesis of/brassinosteroids (Bishop G. J. et al. 1999. Proc Natl Acad Sci USA 96:1761-1766; Shimada Y. et al. 2001. Plant Physiol 126:770-779), hormones (e.g. gibberellic acid, Helliwell C.A. et al. 2001. Proc Natl Acad Sci USA 98:2065- 2070), triterpene saponins (e.g. glycyrrhizin, Seki H. et al. 2008. Proc Natl Acad Sci USA 105: 14204-14209), cyanogenic glucosides (Bak S. et al. 2000. Plant Physiol 123: 1437-1448) and more.

The inventors of the present invention have recently identified three glycosyltransferases that are putatively involved in the metabolism of tomato SAs (GL YCOALKAL OID METABOLISM 1-3 (GAME1-3). More specifically, alterations in GAME1 expression modified the SA profile in tomato plants in both reproductive and vegetative parts. It is suggested that these genes are involved in the metabolism of tomatidine (the a-tomatine precursor) partially by generating the lycotetraose moiety.

International Patent Application Publication No. WO 00/66716 discloses a method for producing transgenic organisms or cells comprising DNA sequences which code for sterol glycosyl transferases. The transgenic organisms include bacteria, fungi, plants and animals, which exhibit an increased production of steroid glycoside, steroid alkaloid and/or sterol glycoside compared to that of wild-type organisms or cells. The synthesized compounds are useful in the pharmaceutical and foodstuff industries as well as for protecting plants.

International Application Publication No. WO 2011 /02501 1 discloses a DNA encoding a glycoalkaloid biosynthase derived from a plant belonging to the family Solanaceae for example potato {Solarium tuberosum). Particularly, that invention discloses protein having an activity of a glycoalkaloid biosynthase derived from a plant belonging to the family Solanaceae and a method for producing and/or identifying an organism comprising the gene encoding the protein.

Steroidal saponins and steroidal alkaloids compounds are gaining interest due to their role in plant protection and their therapeutic effects. Thus, there is a need for and it would be highly advantageous to have means and methods for attenuating and enhancing the production of these compounds in organisms producing same as well as in additional organisms, particularly microorganisms.

SUMMARY OF THE INVENTION

The present invention relates to key enzymes in the production of triterpenoids, particularly steroidal alkaloids (SA) and steroidal saponins (SS), useful in attenuating and enhancing the biosynthesis of this class of triterpenoids in plants and other organisms. The present invention further relates to markers for identifying the genes and to methods of use thereof, particularly for marker-assisted breeding.

The present invention is based in part on the unexpected discovery that a member of the cytochrome p450 subfamily CYP88B1 is involved in the cytosolic mevalonic acid isoprenoid biosynthetic pathway leading, inter alia, to the production of steroidal saponins and steroidal alkaloids. The present invention now discloses that the gene, designated GLYCOALKALOID METABOLISM 4 (GAME4), is one of the first genes identified in the pathway. The present invention thus provides means and method for modulating the GAME4 expression and production of triterpenoids, particularly the production of steroidal alkaloids and steroidal saponins. The present invention is further based on the discovery that plants, in which the expression of GAME4 has been modified, either inhibited or enhanced, showed essentially the same growth pattern compared to corresponding wild type plants. The present invention further provides genetically modified organisms with reduced or enhanced GAME4 expression resulting in differential production of steroidal saponins and steroidal alkaloids. The present invention also provides genetic markers for identifying GAME4 in various populations of organisms capable of SA and SS production, particularly plants.

According to one aspect, the present invention provides a genetically modified organism comprising at least one cell having altered expression of GAME4 compared to a corresponding unmodified organism, wherein the genetically modified organism has an altered content of at least one compound selected from a steroidal saponin, a steroidal alkaloid and glycosylated derivatives thereof compared to a corresponding unmodified organism.

According to certain embodiments, the organism is capable of producing SA and SS, said organism is selected from the group consisting of a plant, a fungus, a bacterium and yeast. According to other embodiments, the organism is modified to produce SA and/or SS. According to these embodiments, the organism is typically a microorganism.

The present invention now shows that silencing the expression of the GAME4 gene in tomato and potato plants results in decreased production of steroidal alkaloids. Unexpectedly, silencing of this gene was accompanied with an increase in the production of steroidal saponins.

Thus, according to certain embodiments, the present invention provides a genetically modified steroidal alkaloid and steroidal saponin producing organism having inhibited expression of GAME4 compared to GAME4 expression in a corresponding unmodified organism. It is to be understood that inhibiting the expression of GAME4 may be achieved by various means, all of which are explicitly encompassed within the scope of present invention. According to certain embodiments, inhibiting GAME4 expression can be affected at the genomic and/or the transcript level using a variety of molecules that interfere with transcription and/or translation including, but not limited to, antisense, siRNA, Ribozyme, or DNAzyme molecules. Inserting a mutation to the GAME4 gene, including deletions, insertions, site specific mutations, zinc-finger nucleases and the like can be also used, as long as the mutation results in down- regulation of the gene expression. According to other embodiments, GAME4 expression is inhibited at the protein level using antagonists, enzymes that cleave the polypeptide and the like.

According to certain typical embodiments, the genetically modified organism is a transgenic organism comprising at least one cell comprising a GAME4 silencing molecule selected from the group consisting of RNA interference molecule and antisense molecule.

According to further typical embodiments, the present invention provides a transgenic organism having at least one cell comprising the GAME4 silencing molecule, wherein the organism has a decreased content of at least one steroidal alkaloid or derivatives thereof compared to a corresponding non-transgenic organism. According to other embodiments, the organism comprising said silencing molecule has an elevated content of at least one steroidal saponin or derivative thereof compared to a corresponding non-transgenic organism.

According to some embodiments, the transgenic organism comprises a plurality of cells comprising the GAME4 silencing molecule. According to additional embodiments, the majority of the organism cells comprise the GAME4 silencing molecule.

According to certain embodiments, the transgenic organism is a plant selected from the group consisting of tomato, potato and eggplant. According to one embodiment, the transgenic plant is a tomato plant having a reduced content of at least one steroidal alkaloid selected from the group presented in Table 1. According to other embodiments, the tomato plant has an elevated content of at least one steroidal saponin selected from the group presented in Table 2. According to some embodiments, the tomato plant has a reduced content of a steroidal alkaloid selected from the group consisting of a-tomatine, tomatidine and derivatives thereof.

According to certain typical embodiments, the tomato plant has a reduced content of a steroidal alkaloid selected from the group consisting of a-tomatine, tomatidine and derivatives thereof and an elevated content of at least one steroidal saponin or a derivative thereof. According to certain embodiments, the reduced content of the at least one steroidal alkaloid and its derivatives and elevated content of at least one steroidal saponin and its derivatives is found in the tomato plant leaves and/or fruit.

According to additional embodiments, the transgenic organism is a potato plant having a reduced content of at least one steroidal alkaloid selected from the group consisting of a-solanine, a-chaconine and derivatives thereof.

According to further embodiments, the potato plant has a reduced content of at least one steroidal alkaloid selected from the group consisting of a-solanine, a- chaconine and derivatives thereof and an elevated content of at least one steroidal saponin or a derivative thereof. According to certain embodiments, the reduced content of the at least one steroidal alkaloid and elevated content of at least one steroidal saponin and their derivatives is found in the potato plant leaves and or tubers.

The GAME4 silencing molecule can be designed as is known to a person skilled in the art. According to certain embodiments, the silencing molecule comprises a polynucleotide having a nucleic acid sequence substantially complementary to a region of the GAME4 gene, the gene having the nucleic acid sequence set forth in any one of SEQ ID NOs:2, 5, 7, 9, 1 1 and 13.

According to certain typical embodiments, the silencing molecule comprises polynucleotide having a nucleic acid sequence substantially complementary to the nucleic acid sequence set forth in SEQ ID NO: 15.

According to certain embodiments, the silencing molecule is an antisense RNA. According to currently typical embodiments, the silencing molecule is an RNA interference (RNAi) molecule. According these embodiments, the silencing molecules is a dsRNA molecule comprising a first polynucleotide having the nucleic acid sequence set forth in SEQ ID NO: 15 and a second polynucleotide having a nucleic acid sequence complementary to SEQ ID NO: 15. According to certain embodiments, the first and the second polynucleotides are separated by a spacer. According to typical embodiments, the spacer sequence is an intron. According to yet further embodiments, the expression of the first and the second polynucleotides is derived from one promoter. According to other embodiments, expression of the first and the second polynucleotides are derived from two promoters; the promoters can be identical or different. Each possibility represents a separate embodiment of the present invention.

According to other embodiments, the present invention provides a genetically modified organism having enhanced expression of GAME4 compared to a corresponding unmodified organism. Overexpression of GAME4 can be obtained by any method as is known to a person skilled in the art. According to certain embodiments, the present invention provides a transgenic organism comprising at least one cell comprising a transcribable polynucleotide encoding GAME4.. According to typical embodiment, the polynucleotide encoding GAME4 comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9; SEQ ID NO: 11 , SEQ ID NO: 13 and a functional fragment thereof. Each possibility represents a separate embodiment of the present invention.

According to some embodiments, the transgenic organism comprises a plurality of cells comprising a transcribable polynucleotide encoding GAME4. According to additional embodiments, the majority of the organism cells comprise the transcribable polynucleotide encoding GAME4.

According to certain embodiments, the genetically modified organism having enhanced expression of GAME4 has an increased content of at least one steroidal alkaloid, steroidal saponin or derivatives thereof compared to a corresponding non- transgenic organism.

According to certain exemplary embodiments, the genetically modified tomato plant having enhanced expression of GAME4 has elevated amounts of a steroidal alkaloid selected from the group consisting of a-tomatine isomer, tomatidine, dehydrotomatine and hydroxytomatine. According to some embodiments, the polynucleotides of the present invention are incorporated in a DNA construct enabling their expression in the organism cell. DNA constructs suitable to a particular organism, including plants, algae fungi, bacteria and yeast are known to a person skilled in the art. According to one embodiment, the DNA construct comprises at least one expression regulating element selected from the group consisting of a promoter, an enhancer, an origin of replication, a transcription termination sequence, a polyadenylation signal and the like.

The DNA constructs of the present invention are designed according to the organism type and the results to be achieved. In plants, reduction of toxic steroidal alkaloids is desired in the edible parts of the plant, including, for example, fruit and tubers. On the other hand, enriching the content of toxic steroidal alkaloids in non- edible roots and leaves contributes to the resistance of the plant against a broad range of pathogens. Plants and algae, as well as fungi, bacteria and yeast can be used for producing steroidal alkaloids and steroidal saponins for the pharmaceutical industry.

According to certain embodiments, the DNA construct comprises a promoter. The promoter can be constitutive, induced or tissue specific as is known in the art. According to certain typical embodiments, the promoter is operable in a plant cell.

Optionally, the DNA construct further comprises a selectable marker, enabling the convenient selection of the transformed cell/organism. Additionally or alternatively, a reporter gene can be incorporated into the construct, so as to enable selection of transformed cells or organisms expressing the reporter gene.

Suspensions of genetically modified cells and tissue cultures derived from the genetically modified cells or organisms are also encompassed within the scope of the present invention. The cell suspension and tissue cultures can be used for the production of desired steroidal alkaloids and/or saponins, which are then extracted from the cells or the growth medium. Alternatively, the genetically modified cells and/or tissue culture are used for regenerating an organism having modified expression of GAME4, therefore having modified content of steroidal alkaloids and/or steroidal saponins.

In the embodiments wherein the organism is a plant, the present invention also encompasses seeds of the genetically modified plant, wherein plants grown from said seeds have altered expression of GAME4 compared to plants grown from corresponding unmodified seeds, thereby having an altered content of at least one of steroidal saponin and steroidal alkaloid.

According to yet another aspect, the present invention provides an isolated polynucleotide marker capable of specifically hybridizing to a polynucleotide encoding GAME4 having a nucleic acid sequence at least 65% homologous to SEQ ID NO:2. According to certain embodiments, the marker is capable of specifically hybridizing to a polynucleotide encoding GAME4 having a nucleic acids sequence at least 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73% 74% or more homologous to SEQ ID NO:2. According to further embodiments, the polynucleotide is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84% or more homologous to SEQ ID NO:2; in yet additional embodiments, the polynucleotide is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94% or more homologous to SEQ ID NO:2; in yet further embodiments the polynucleotide is at least 95%, 96%», 97%, 98%, 99% or more homologous to SEQ ID NO:2. Each possibility represents a separate embodiment of the present invention.

According to certain embodiments, the marker is designed to specifically hybridize to a GAME4 fragment having the nucleic acid sequence set forth in SEQ ID NO: 15. According to other embodiments, the marker is a primer pair selected from the group consisting of SEQ ID NO:37 and SEQ NO:38 and SEQ ID NO:37 and SEQ ID NO:39.

According to yet additional aspect, the present invention provide a method of screening for an organism capable of producing altered content of at least one of steroidal alkaloid and steroidal saponin, the method comprising (a) providing a sample comprising genetic material from the organism; and (b) detecting in the sample the presence of a polynucleotide encoding GAME4.

According to certain embodiments, the polynucleotide encoding GAME4 has a nucleic acid sequence at least 65% homologous to SEQ ID NO:2. According to other embodiments, the polynucleotide encoding GAME4 has a nucleic acid sequence at least75%, at least 85%, at least 95% or more homologous to SEQ ID NO:2. According to yet additional embodiments, the polynucleotide encoding GAME4 has a nucleic acid sequence as set forth in any one of SEQ ID NOs: 2, 5, 7, 9, 11, and 13. According to certain embodiments, detecting the presence of the polynucleotide encoding GAME 4 comprises hybridizing an isolated polynucleotide marker to said polynucleotide. Each possibility represents a separate embodiment of the present invention.

According to a further aspect, the present invention provides a method of elevating the content of at least one steroidal saponin, steroidal alkaloid and derivatives thereof in a cell derived from an organism, comprising transforming the cell with a transcribable polynucleotide comprising a nucleic acids sequence encoding GAME4.

According to certain embodiments, the polynucleotide encoding GAME4 has a nucleic acid sequence as set forth in any one of SEQ ID NOs: 2, 5, 7, 9, 1 1 , 13 and homologous thereof.

According to other embodiments, the organism is selected from the group consisting of a plant, an alga, a fungus, a bacterium and yeast.

According to certain embodiments, the cell is propagated to generate a cell suspension. According to other embodiments, the cell is propagated to form a tissue culture and, optionally, to regenerate a transgenic organism comprising at least one cell having elevated content of at least one steroidal saponin, steroidal alkaloids and derivatives thereof compared to a corresponding cell of a non transgenic organism.

According to certain embodiments, the steroidal alkaloids and/or saponins are purified from the transgenic cells, tissue culture or organism. According to other embodiments, the steroidal alkaloids and/or saponins are purified from the growth medium of the transgenic cell suspension, tissue culture or organism.

According to yet another aspect, the present invention provides steroidal alkaloids and/or saponins obtained from the transgenic cells, tissue cultures or organisms of the present invention. The obtained steroidal alkaloids and/or saponins can be used in the pharmaceutical industry.

Other objects, features and advantages of the present invention will become clear from the following description and drawings. BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 shows a comparison of amino acid sequences, genomic DNA sequences and cDNAs between the GAME4 and its orthologues. Figure 1A presents a table of identity at the amino acid level between full length GAME4 proteins from Solanum tuberosum (SEQ ID NOs. 10 and 12), Solanum lycopersicum (SEQ ID NO:20), Solanum pimpinellifolium (SEQ ID NO:6), Solanum melongena (SEQ ID NO: 14) and for homologues of GAME4 from Populus trichocarpa (SEQ ID NO:26), Petunia x hybrida (SEQ ID NO:22) and Vitis vinifera (SEQ ID NO:24). Cells marked with gray background indicate highest sequence identities. Figure IB shows a comparison of amino acid sequences of GAME4 orthologues from S. lycopersicum (SEQ ID NO:3), S. pimpinelifulium (SEQ ID NO:6), S. pinelii (SEQ ID NO:8), S. melongena (SEQ ID NO: 14) and S. tuberosum (allele 1 (SEQ ID NO:10) and allele 2 (SEQ ID NO: 12)). Figure 1C shows a comparison of genomic DNA sequences from S. lycopersicum (SEQ ID NO: l), S. pimpinelifulium (SEQ ID NO:4) and Solanum phureja (SEQ ID NO: 16), and the cDNA sequence from S. lycopersicum (SEQ ID NO:2). Figure ID shows a comparison of cDNA sequences from S. lycopersicum (SEQ ID NO:2), S. pimpinelifulium (SEQ ID NO:5), S. pinelii (SEQ ID NO:7), S. melongena (SEQ ID NO:13) and S. tuberosum (allele 1 (SEQ ID NO:9) and allele 2 (SEQ ID NO:l l)). The full length protein sequences were aligned using ClustalX v2.0 program (see Materials and Methods) and presented using the Genedoc v2.7 program.

FIG. 2 demonstrates the expression patterns of GAME4 and GAME1 in wild type tomato tissues, and of GAME4 in fruits of rin and nor ripening mutants. Figure 2A and 2B: Quantitative Real Time-PCR (QRT-PCR) relative expression analyses of GAME4 and GAME1 transcripts in 21 tissues of wild type tomato (cv. MicroTom) plant, respectively. Figure 2C: GAME4 expression is elevated in 1-MCP -treated fruit (cv. Ailsa Craig) in MG and Or developmental stages compared to untreated control fruit. Figure 2D: GAME4 expression in tomato fruits of rin and nor ripening mutants (cv. Ailsa Craig background) is higher than in fruits of the wild type plants at Or and Ripe ripening stages.

Abbreviations: YL (YoUng leaves), ML (Mature leaves); Five stages of fruit development: IG (Immature Green); MG (Mature Green); Br (Breaker); Or (Orange); R (Ripe). In Figure 2C Student's t test (n = 3) results for significance (p-value < 0.05) are indicated by asterisk. Lettering above the bars (Figure 2D) denotes significant differences GAME4 relative expression levels, as calculated by the Student's i-test (P < 0.05, n =3).

FIG. 3 shows the altered levels of steroidal alkaloids and steroidal saponins in the leaves of the GAME4i potato plants.

Strong and significant reduction in the levels of putative steroidal alkaloids was observed in the leaves of GAME4i (R Ai) potato plants along with a major accumulation of two putative steroidal saponins (m/z=1031.5427 and m/z=1047.5435). Student's / test (wild type, n = 3; GAME4i, n=5) results for significance: p-value < 0.05 are indicated by asterisk; p-value < 0.01 are indicated by two asterisks.

FIG. 4 shows the distribution of a-solanine and α-chaconine levels, and two dominant steroidal saponins in the leaves of the GAME4i and wild type potato plants. Strong and significant reduction in the levels of steroidal alkaloids a-solanine and a- chaconine was observed in the leaves of GAME4i potato plants (Figure 4A and in Figure 4B respectively), compared to their levels in the leaves of wild type potato plants; major accumulation of two putative steroidal saponins (m/z=l 031.5427 (Figure 4C) and m/z=1047.5435 (Figure 4D) was observed in the leaves of GAME4i plants compared to their insignificant levels in the wild type plants leaves.

FIG. 5 shows the distribution of a-solanine and a-chaconine levels, and two major steroidal saponins in the tubers of the GAME4i and wild type potato plants under light and dark conditions. The tubers were laid for 21 days in dark or light and then peel was harvested. While the levels of a-chaconine (Figure 5A) and α-solanine (Figure 5B) accumulated upon light treatment in wild type tuber peel, their levels remained low and unaltered in the transgenic GAME4i tuber peel. The levels of the putative steroidal saponin (m/z=l 031.5427; Figure 4C) and the levels of the putative steroidal saponin (m/z=1047.5435; Figure 4D) remained very low in the wild type plants upon light treatment (though up to 1.5-fold accumulation was detectable). Their levels remained high and unaltered upon light treatment in two transgenic lines (#6 and #11), while in two additional transgenic lines (#5 and #12) up to 1.5-fold accumulation of these SSs was observed.

FIG. 6 shows a comparison of accumulation level of α-tomatine and its derivatives in the leaves of representative lines of wild type and GAME4i tomato plants. The arrows are pointing on the peaks of the metabolites compared: a-tomatine, isomer of a- tomatine and dehydrotomatine isomer 1.

FIG. 7 shows a putative structure of the steroidal saponin with m/z = 1215.5932 accumulating in ripe fruit after silencing of GAME4 in the tomato plant. The structure was generated using putative molecular formula received by application of the m/z value into Mass Lynx program, and further search of putative structures by Scifinder. The structure was further elucidated by Nucleic Magnetic Resonance (confirmed regions are marked with dashed line on the molecule).

FIG. 8 shows the sterol profile of GAME4i plants leaves. Figure 8A demonstrates the proposed pathway of sterol metabolism in plants and changes in leaves of GAME4- silenced plants. Figure 8B shows the profile of eight phytosterols, a- and ?-amyrins and a-tochopherol in mature leaves of GAME4i plants compared to the wild type. Lettering above the bars and in the chart (a and b) denotes significant differences in sterol levels, as calculated by the Student's ί-test P < 0.05, n = 6). The putative sterol biosynthetic pathway was generated using data available in the literature and in the Plant Metabolic Network. Dashed arrows represent multiple biosynthetic reactions; solid arrows represent single biosynthetic reaction. Wide arrow represents accumulation of the metabolite. Metabolites that were quantified but did not show any difference in levels are marked as NC ("No Change") - levels of metabolite were not changed between transgenic and wild type plant.

FIG. 9 shows schematically the diversity of steroidal alkaloid expression in tomato and its correspondence with GAME1 and GAME4 expression. The metabolic results were obtained by UPLC-QTof-MS analysis, while the expression results were obtained by Quantitative Real-Time PCR (see Materials and Methods). The color index refers to the relative levels of a particular metabolite or gene across the different tissues examined, when the highest level is defined as 100%. Hierarchical clustering of SAs was performed with the MeV v.4.5.1 software. White frames enclose several metabolite clusters discussed in the text. White arrows indicate the possible conversion of green tissue-associated metabolites into red-ripe tissue-associated metabolites.

FIG. 10 demonstrates the putative site of action of the GAME4 enzyme in the biosynthetic pathway of steroidal glycoalkaloids and saponins. Putative places of action (as hydroxylase or oxidize) of the GAME4 are marked with circles. Dashed arrows represent multiple reactions required. Activated residues in the substances are circled.

DETAILED DESCRIPTION OF THE INVENTION

The present invention discloses that the GL YCOALKALOID METABOLISM 4 (GAME4) gene, encoding a member of the cytochrome p450 subfamily CYP88B1 is the first discovered gene in the biosynthesis pathway of both steroidal alkaloids (SAs) and steroidal saponins (SSs) in plants. Based on this discovery, the present invention provides means and methods for modulating the levels of steroidal saponins and alkaloids in organism producing same, as well as for the production of steroidal saponins and steroidal alkaloids in other organisms, particularly microorganisms. Changing the levels of the production of these secondary metabolite can result in an improved organism, for example plants comprising elevated content of steroidal alkaloids having increased resistance to pathogens, or plants having a reduced content of these secondary compounds in its edible parts and thus producing improved crops. Alternatively or additionally, controlling the expression of GAME4 can be used for the production of desired steroidal alkaloids or steroidal saponins in a variety of organisms. Particularly, bacterial systems can be used for the production of the desired compounds for further use, for example in the pharmaceutical industry.

Definitions

The terms "organism producing steroidal alkaloids (SA) and steroidal saponins

(SA)" or "SA/SS producing organisms" refer to an organism naturally capable of producing triterpenoids of the steroidal saponin and steroidal alkaloid classes via any biosynthesis pathway. According to certain embodiments of the present invention, the organism is selected from the group consisting of plants, fungi, bacteria and yeast.

The term "gene" refers to a nucleic acid (e.g., DNA or RNA) sequence that comprises coding sequences necessary for the production of RNA or a polypeptide. A polypeptide can be encoded by a full-length coding sequence or by any part thereof. The term "parts thereof when used in reference to a gene refers to fragments of that gene. The fragments may range in size from a few nucleotides to the entire gene sequence minus one nucleotide. Thus, "a nucleic acid sequence comprising at least a part of a gene" may comprise fragments of the gene or the entire gene.

The term "gene" optionally also encompasses the coding regions of a structural gene and includes sequences located adjacent to the coding region on both the 5' and 3' ends for a distance of about 1 kb on either end such that the gene corresponds to the length of the full-length mRNA. The sequences which are located 5' of the coding region and which are present on the mRNA are referred to as 5' non-translated sequences. The sequences which are located 3' or downstream of the coding region and which are present on the mRNA are referred to as 3' non-translated sequences.

The terms "polynucleotide", "polynucleotide sequence", "nucleic acid sequence", and "isolated polynucleotide" are used interchangeably herein. These terms encompass nucleotide sequences and the like. A polynucleotide may be a polymer of RNA or DNA or hybrid thereof, that is single- or double-stranded, linear or branched, and that optionally contains synthetic, non-natural or altered nucleotide bases. The terms also encompass RNA/DNA hybrids.

The term "RNA interference" or "RNAi" refers to the silencing or decreasing of gene expression mediated by small double stranded RNAs. It is the process of sequence-specific, post-transcriptional gene silencing in animals and plants, initiated by inhibitory RNA (iRNA) that is homologous in its duplex region to the sequence of the silenced gene. The gene may be endogenous or exogenous to the organism, present integrated into a chromosome or present in a transfection vector that is not integrated into the genome. The expression of the gene is either completely or partially inhibited. RNAi may also be considered to inhibit the function of a target RNA; the function of the target RNA may be complete or partial.

Typically, the term RNAi molecule refers to single- or double-stranded RNA molecules comprising both a sense and antisense sequence. For example the RNA interference molecule can be a double-stranded polynucleotide molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises complementarity to a target nucleic acid molecule. Alternatively the R Ai molecule can be a single-stranded hairpin polynucleotide having self-complementary sense and antisense regions, wherein the antisense region comprises complementarity to a target nucleic acid molecule or it can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises complementarity to a target nucleic acid molecule, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active molecule capable of mediating RNAi.

The terms "complementary" or "complement thereof are used herein to refer to the sequences of polynucleotides which is capable of forming Watson & Crick base pairing with another specified polynucleotide throughout the entirety of the complementary region. This term is applied to pairs of polynucleotides based solely upon their sequences and not any particular set of conditions under which the two polynucleotides would actually bind.

The term "construct" as used herein refers to an artificially assembled or isolated nucleic acid molecule which includes the polynucleotide of interest. In general a construct may include the polynucleotide or polynucleotides of interest, a marker gene which in some cases can also be a gene of interest and appropriate regulatory sequences. It should be appreciated that the inclusion of regulatory sequences in a construct is optional, for example, such sequences may not be required in situations where the regulatory sequences of a host cell are to be used. The term construct includes vectors but should not be seen as being limited thereto.

The term "operably linked" refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is regulated by the other. For example, a promoter is operably linked with a coding sequence when it is capable of regulating the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter). Coding sequences can be operably linked to regulatory sequences in a sense or antisense orientation. The terms "promoter element," "promoter," or "promoter sequence" as used herein, refer to a DNA sequence that is located at the 5' end (i.e. precedes) the coding region of a DNA polymer. The location of most promoters known in nature precedes the transcribed region. The promoter functions as a switch, activating the expression of a gene. If the gene is activated, it is said to be transcribed, or participating in transcription. Transcription involves the synthesis of mRNA from the gene. The promoter, therefore, serves as a transcriptional regulatory element and also provides a site for initiation of transcription of the gene into mRNA.

As used herein, the term an "enhancer" refers to a DNA sequence which can stimulate promoter activity, and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specificity of a promoter.

The term "expression", as used herein, refers to the production of a functional end-product e.g., an mRNA or a protein.

The term "genetically modified organism" refers to an organism comprising at least one cell genetically modified by man. The genetic modification includes modification of an endogenous gene(s), for example by introducing mutation(s) deletions, insertions, transposable element(s) and the like into an endogenous polynucleotide or gene of interest. Additionally or alternatively, the genetic modification includes transforming the plant cell with heterologous polynucleotide. A "genetically modified organism" and a "corresponding unmodified organism" as used herein refer to an organism comprising at least one genetically modified cell and to an organism of the same type lacking said modification, respectively.

The term "transgenic" when used in reference to an organism according to the teachings of the present invention (i.e., a "transgenic organism" refers to an organism that contains at least one heterologous transcribable polynucleotide in one or more of its cells. The term "transgenic material" refers broadly to a plant, fungus, a bacterium or yeast or part thereof, including cells or tissues that contain at least one heterologous polynucleotide in at least one of cell. A "transgenic organism" and a "corresponding non transgenic organism" as used herein refer to an organism comprising at least one cell comprising a heterologous transcribable polynucleotide and to a plant of the same type lacking said heterologous transcribable polynucleotide, respectively.

The terms "transformants" or "transformed cells" include the primary transformed cell and cultures derived from that cell without regard to the number of transfers. All progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Mutant progeny that have the same functionality as screened for in the originally transformed cell are included in the definition of transformants.

Transformation of a cell may be stable or transient. The term "transient transformation" or "transiently transformed" refers to the introduction of one or more exogenous polynucleotides into a cell in the absence of integration of the exogenous polynucleotide into the host cell's genome. In contrast, the term "stable transformation" or "stably transformed" refers to the introduction and integration of one or more exogenous polynucleotides into the genome of a cell. The term "stable transformant" refers to a cell which has stably integrated one or more exogenous polynucleotides into the genomic or organellar DNA. It is to be understood that an organism or its cell transformed with the nucleic acids, constructs and/or vectors of the present invention can be transiently as well as stably transformed.

Preferred modes for carrying out the invention

It has been previously suggested that the biosynthesis of steroidal alkaloids and steroidal saponins starts from the Mevalonic Acid pathway in the cytosol. The present invention now discloses that the cytochrome p450 GLYCOALKALOID METABOLISM 4 (GAME4) gene encodes a key enzyme in the biosynthetic pathway leading from cholesterol to the formation of steroidal alkaloids and steroidal saponins. Without wishing to be bound by any specific theory or mechanism of action, the GAME4 gene may encode a Cholesterol hydroxylase / Dormantinon or Dormantinol oxidase, initiating an essential step in the biosynthesis of SAs in plants. These enzymes are involved in the formation of the intermediate compounds for a transamination reaction that convert SAs to Verazine, an intermediate for the biosynthesis of the steroidal alkaloids aglycons.

Thus, according to one aspect, the present invention provides a genetically modified organism comprising at least one cell having altered expression of GAME4 compared to a corresponding unmodified organism, wherein the modified organism has an altered content of at least one compound selected from a steroidal saponin, a steroidal alkaloid and glycosylated derivatives thereof compared to a corresponding unmodified organism.

The function of GAME4 early in the biosynthesis pathway of SAs and SSs enables using this gene for manipulating the synthesis of these secondary metabolites in any organism naturally capable of steroidal alkaloid and steroidal saponin synthesis. In addition, expression of this gene in other organism (that do not normally produce steroidal alkaloids or steroidal saponins), particularly microorganism, can lead to the mass production of steroidal alkaloids, steroidal saponins and derivatives thereof known for their beneficial pharmaceutical effects. According to certain embodiments of the present invention, SA and SS synthesis is manipulated in an organism selected from the group consisting of plants, fungi, bacteria and yeast.

The present invention further discloses that transgenic tomato and potato plants in which the expression of GAME4 is silenced (GAME4i plants) exhibit up to 90% reduction in the levels of steroidal alkaloids, including the major tomato SA, cc-tomatine and the major potato SAs a-solanine and a-chaconine. Unexpectedly, the reduction in steroidal alkaloids was accompanied with a major and significant accumulation of numerous putative steroidal saponins in the GAME4i tomato and potato plants. Without wishing to be bound by any specific theory or mechanism of action, these results suggest the occurrence of redirection of the metabolic flux from the biosynthesis of SAs towards the biosynthesis of SSs (Figure 10). This discovery provides an excellent tool to not only manipulate the levels of SAs, but also to allow the transgenic plant to alter the levels of valuable steroidal glycosaponins in planta as well as in fungi, bacteria and yeast, and optionally also in recombinant and heterologous systems. Inhibiting the expression of GAME4 in the tomato and potato plants did not significantly affected their growth.

According to certain embodiments, the present invention provides a genetically modified SA and SS producing organism in which the expression of GAME4 is inhibited compared to its expression in a corresponding unmodified organism. Down-regulation or inhibition of GAME4 expression can be effected on the genomic and/or the transcript level using a variety of molecules that interfere with transcription and/or translation (e.g., antisense, siRNA, Ribozyme, or DNAzyme), or on the protein level using, e.g., antagonists, enzymes that cleave the polypeptide, and the like.

According to certain typical embodiments, the present invention provides a transgenic organism having at least one cell comprising a GAME4 silencing molecule, wherein the organism has a decreased content of at least one steroidal alkaloid or a derivative thereof compared to a corresponding non-transgenic organism. According to other embodiments, the organism comprising the silencing molecule has an elevated content of at least one steroidal saponin or a derivative thereof compared to a corresponding non-transgenic organism.

According to certain embodiments, the transgenic organism is a plant selected from the group consisting of tomato, eggplant and potato. According to one embodiment, the transgenic plant is tomato plant having a reduced content of at least one steroidal alkaloid selected from the group presented in Table 1. According to other embodiments, the tomato plant has an elevated content of at least one steroidal saponin selected from the group presented in Table 2.

According to still further embodiments, the tomato plant has a reduced content of at least one steroidal alkaloid selected from the group presented in Table 1 and an elevated content of at least one steroidal saponins selected from the group presented in Table 2.

Table 1 : Steroidal Alkaloids which levels were down-regulated in GAME4-silenced tomato plants to

#, - number given to metabolite

RT, - retention time of metabolite peak; Ion., - ionization; Δρρη , - difference between theoretical and actual m/z of the given metabolite. ionization mode used for quantification

bPositive mode, actual (M+H)

°Negative mode, actual (M + [FA]-H) or (M-H)

dAppm (for positive mode)

e UGA-Unindentified Glycoalkaloid

Table 2: Putative Steroidal Saponins which levels were up-regulated in GAME4 silenced plants

According to typical embodiments, the tomato plant comprising GAME4 silencing molecule has a reduced content of a steroidal alkaloid selected from the group consisting of a- tomatine, tomatidine and derivatives thereof. According to other typical embodiments, the tomato plant comprising GAME4 silencing molecule has a reduced content of a steroidal alkaloid selected from the group consisting of a-tomatine, tomatidine and derivatives thereof and an elevated content of at least one steroidal saponin or a derivative thereof. According to certain embodiments, the reduced content of the at least one steroidal alkaloid and elevated content of at least one steroidal saponin is found in the tomato plant leaves and/or fruit.

According to additional embodiments, the transgenic organism comprising GAME4 silencing molecule is a potato plant having a reduced content of at least one steroidal alkaloid selected from the group consisting of a-solanine and a-chaconine. According to other typical embodiments, the potato plant comprising GAME4 silencing molecule has a reduced content of a steroidal alkaloid selected from the group consisting of a-solanine and a-chaconine and derivatives thereof and an elevated content of at least one steroidal saponin. According to certain embodiments, the reduced content of the at least one steroidal alkaloid and elevated content of at least one steroidal saponin is found in the potato plant leaves.

The GAME4 silencing molecule can be designed as is known to a person skilled in the art. According to certain embodiments, the silencing molecule comprises a polynucleotide having a nucleic acid sequence substantially complementary to a region of the GAME4 gene, the gene having the nucleic acid sequence set forth in any one of SEQ ID NOs:2, 5, 7, 9, 1 1 and 13. According to certain embodiments, the region of the GAME4 gene comprises the nucleic acid sequence set forth in SEQ ID NO: 15. According to certain embodiments, the silencing molecule is antisense RNA. According to currently typical embodiments, the silencing molecule is RNA interference (RNAi) molecule. According to additional embodiments, the RNAi molecule is dsRNA molecule. According to these embodiments, the dsRNA comprises a first polynucleotide having the nucleic acid sequence set forth in SEQ ID NO: 15 and a second polynucleotide having a nucleic acid sequence complementary to SEQ ID NO: 15. Antisense molecules

Antisense technology is the process in which an antisense RNA or DNA molecule interacts with a target sense DNA or RNA strand. A sense strand is a 5' to 3' mRNA molecule or DNA molecule. The complementary strand, or mirror strand, to the sense is called an antisense. When an antisense strand interacts with a sense mRNA strand, the double helix is recognized as foreign to the cell and will be degraded, resulting in reduced or absent protein production. Although DNA is already a double stranded molecule, antisense technology can be applied to it, building a triplex formation.

RNA antisense strands can be either catalytic or non-catalytic. The catalytic antisense strands, also called ribozymes, cleave the RNA molecule at specific sequences. A non- catalytic RNA antisense strand blocks further RNA processing.

Antisense modulation of GAME4 levels in cells and tissues may be effected by transforming the organism cells or tissues with at least one antisense compound, including antisense DNA, antisense RNA, a ribozyme, DNAzyme, a locked nucleic acid (LNA) and an aptamer. In some embodiments the molecules are chemically modified. In other embodiments the antisense molecule is antisense DNA or an antisense DNA analog.

RNA interference (RNAi) molecules

RNAi refers to the introduction of homologous double stranded RNA (dsRNA) to target a specific gene product, resulting in post transcriptional silencing of that gene. This phenomena was first reported in Caenorhabditis elegans by Guo and Kemphues (1 95, Cell, 81(4):61 1-620) and subsequently Fire et al. (1998, Nature 391 :806-811) discovered that it is the presence of dsRNA, formed from the annealing of sense and antisense strands present in the in vitro RNA preps, that is responsible for producing the interfering activity .

The present invention contemplates the use of RNA interference (RNAi) to down regulate the expression of GAME4 to attenuate the level of steroidal alkaloids and/or elevate the level of saponins in saponin-producing organisms. In both plants and animals, RNAi is mediated by RNA-induced silencing complex (RISC), a sequence-specific, multicomponent nuclease that destroys messenger RNAs homologous to the silencing trigger. RISC is known to contain short RNAs (approximately 22 nucleotides) derived from the double-stranded RNA trigger. The short-nucleotide RNA sequences are homologous to the target gene that is being suppressed. Thus, the short-nucleotide sequences appear to serve as guide sequences to instruct a multicomponent nuclease, RISC, to destroy the specific mRNAs .

The dsRNA used to initiate RNAi, may be isolated from native source or produced by known means, e.g., transcribed from DNA. Plasmids and vectors for generating RNAi molecules against target sequence are now readily available as exemplified herein below.

The dsRNA can be transcribed from the vectors as two separate strands. In other embodiments, the two strands of DNA used to form the dsRNA may belong to the same or two different duplexes in which they each form with a DNA strand of at least partially complementary sequence. When the dsRNA is thus-produced, the DNA sequence to be transcribed is flanked by two promoters, one controlling the transcription of one of the strands, and the other that of the complementary strand. These two promoters may be identical or different. Alternatively, a single promoter can derive the transcription of single- stranded hairpin polynucleotide having self-complementary sense and antisense regions that anneal to produce the dsRNA.

Inhibition is sequence-specific in that nucleotide sequences corresponding to the duplex region of the RNA are targeted for genetic inhibition. RNA molecules containing a nucleotide sequence identical to a portion of the target gene are preferred for inhibition. RNA sequences with insertions, deletions, and single point mutations relative to the target sequence have also been found to be effective for inhibition. Thus, sequence identity may optimized by sequence comparison and alignment algorithms known in the art (see Gribskov and Devereux, Sequence Analysis Primer, Stockton Press, 1991 , and references cited therein) and calculating the percent difference between the nucleotide sequences by, for example, the Smith- Waterman algorithm as implemented in the BESTFIT software program using default parameters (e.g., University of Wisconsin Genetic Computing Group). Greater than 90% sequence identity, or even 100% sequence identity, between the inhibitory RNA and the portion of the target gene is preferred. Alternatively, the duplex region of the RNA may be defined functionally as a nucleotide sequence that is capable of hybridizing with a portion of the target gene transcript. The length of the identical nucleotide sequences may be at least 25, 50, 100, 200, 300 or 400 bases .There is no upper limit on the length of the dsRNA that can be used. For example, the dsRNA can range from about 21 base pairs (bp) of the gene to the full length of the gene or more.

According to certain currently typical embodiments, the silencing molecule is RNAi comprising the nucleic acid sequence set forth in SEQ ID NO: 15. According to additional typical embodiments, the dsRNA comprises a first polynucleotide having the nucleic acid sequence set forth in SEQ ID NO: 15 and a second polynucleotide having a nucleic acid sequence complementary to SEQ ID NO: 15.

DNAzyme molecules

Another agent capable of down-regulating the expression of GAME4 is a DNAzyme molecule, which is capable of specifically cleaving an mRNA transcript or a DNA sequence of the GAME4 DNAzymes are single-stranded polynucleotides that are capable of cleaving both single- and double-stranded target sequences. A general model (the " 10-23" model) for the DNAzyme has been proposed. "10-23" DNAzymes have a catalytic domain of 15 deoxyribonucleotides, flanked by two substrate-recognition domains of seven to nine deoxyribonucleotides each. This type of DNAzyme can effectively cleave its substrate RNA at purine:pyrimidine junctions (for review of DNAzymes, see: Khachigian, L. M. (2002) Curr Opin Mol Ther 4, 1 19-121).

Examples of construction and amplification of synthetic, engineered DNAzymes recognizing single- and double-stranded target cleavage sites are disclosed in U.S. Patent No. 6,326,174.

Enzymatic oligonucleotide

The terms "enzymatic nucleic acid molecule" or "enzymatic oligonucleotide" refers to a nucleic acid molecule which has complementarity in a substrate binding region to a specified gene target, and also has an enzymatic activity which is active to specifically cleave target GAME4 RNA, thereby silencing GAME4. The complementary regions allow sufficient hybridization of the enzymatic nucleic acid molecule to the target RNA and subsequent cleavage. The term enzymatic nucleic acid is used interchangeably with for example, ribozymes, catalytic RNA, enzymatic RNA, catalytic DNA, aptazyme or aptamer-binding ribozyme, catalytic oligonucleotide, nucleozyme, DNAzyme, RNAenzyme. The specific enzymatic nucleic acid molecules described in the instant application are not limiting and an enzymatic nucleic acid molecule of this invention requires a specific substrate binding site which is complementary to one or more of the target nucleic acid regions, and that it have nucleotide sequences within or surrounding that substrate binding site which impart a nucleic acid cleaving and/or ligation activity to the molecule. US Patent No. 4,987,071 discloses examples of such molecules.

Mutagenesis

Inhibiting the expression of endogenous GAME4 gene can be also achieved by the introduction of one or more point mutations into a nucleic acid molecule encoding GAME4. Mutations can be introduced using, for example, site-directed mutagenesis (see, e.g. Wu Ed., 1993 Meth. In Enzymol. Vol. 217, San Diego: Academic Press; Higuchi, "Recombinant PCR" in Innis et al. Eds., 1990 PCR Protocols, San Diego: Academic Press, Inc). Such mutagenesis can be used to introduce a specific, desired amino acid insertion, deletion or substitution. Chemical mutagenesis using an agent such as Ethyl Methyl Sulfonate (EMS) can be employed to obtain a population of point mutations and screen for mutants of the GAME4 genes that may become silent or down-regulated. In plants, methods relaying on introgression of genes from natural populations can be used. Cultured and wild types species are crossed repetitively such that a plant comprising a given segment of the wild genome is isolated. Certain plant species, for example Maize (corn) or snapdragon have natural transposons. These transposons are either autonomous, i.e. the transposas is located within the transposon sequence or non-autonomous, without a transposas. A skilled person can cause transposons to "jump" and create mutations. Alternatively, a nucleic acid sequence can be synthesized having random nucleotides at one or more predetermined positions to generate random amino acid substituting.

Overexpression of GAME4

According to certain embodiments, the present invention provides a genetically modified organism having enhanced expression of GAME4 compared to a corresponding unmodified organism. According to certain typically embodiments, the organism overexpressing GAME4 produces elevated amount of at least one steroidal alkaloid.

In plants, steroidal alkaloids play a role in protecting the plant from various pathogens. Steroidal alkaloids are referred to as phytoanticipins, i.e. low molecular weight anti-microbial compounds that are present in the plant before challenge by microorganisms or produced after infection solely from preexisting constituents. Over-expression of GAME4 in non-edible parts of the plant can thus enhance the plant resistance to steroidal-alkaloid-sensitive pathogens.

Plants, as well as other organism including fungi, bacteria and yeast, typically bacterial and yeast over-expressing the GAME4 gene are used according to the teachings of the present invention for the production of steroidal alkaloids useful in the pharmaceutical industry. Any method as is known to a person skilled in the art can be used to over-express GAME4.

Transgenic organisms

Cloning of a polynucleotide encoding a GAME4 or a molecule that silences GAME4 can be performed by any method as is known to a person skilled in the art. Various DNA constructs may be used to express the GAME4 or G E^-targeted silencing molecule in a desired organism.

According to certain embodiments, GAME4 or a silencing molecule thereof form part of an expression vector comprising all necessary elements for expression of the GMAE4 or its silencing molecule. According to certain embodiments, the expression is controlled by a constitutive promoter. When the organism is a plant, the constitutive promoter is typically tissue specific. According to these embodiments, the tissue specific promoter is selected from the group consisting of root, tuber, leaves and fruit specific promoter. Root specific promoters are described, e.g. in Martinez, E. et al. 2003. Curr. Biol. 13: 1435-1441. Fruit specific promoters are described among others in Estornell L.H et al. 2009. Plant Biotechnol. J. 7:298- 309 and Fernandez A. I. Et al. 2009 Plant Physiol. 151 :1729-1740. Tuber specific promoters are described, e.g. in Rocha-Sosa M, et al, 1989. EMBO J. 8:23-29; McKibbin R.S. et al., 2006. Plant Biotechnol J. 4(4):409-18. Leaf specific promoters are described, e.g. in Yutao Yang, Guodong Yang, Shijuan Liu, Xingqi Guo and Chengchao Zheng. Science in China Series C: Life Sciences. 46: 651-660.

According to certain embodiments, the expression vector further comprises regulatory elements at the 3' non-coding sequence. As used herein, the "3' non-coding sequences" refer to DNA sequences located downstream of a coding sequence and include polyadenylation recognition sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression. The polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3' end of the mRNA precursor. The use of different 3' non-coding sequences is exemplified by Ingelbrecht I L et al. (1989. Plant Cell 1 :671-680).

Those skilled in the art will appreciate that the various components of the nucleic acid sequences and the transformation vectors described in the present invention are operatively linked, so as to result in expression of said nucleic acid or nucleic acid fragment. Techniques for operatively linking the components of the constructs and vectors of the present invention are well known to those skilled in the art. Such techniques include the use of linkers, such as synthetic linkers, for example including one or more restriction enzyme sites.

Methods for transforming an organism selected from the group consisting of a plant, a fungus, a bacterium and yeast according to the teachings of the present invention are known to those skilled in the art. As used herein the term "transformation" or "transforming" describes a process by which a foreign DNA, such as a DNA construct, including expression vector, enters and changes a recipient cell into a transformed, genetically altered or transgenic cell. Transformation may be stable, wherein the nucleic acid sequence is integrated into the organism genome and as such represents a stable and inherited trait, or transient, wherein the nucleic acid sequence is expressed by the cell transformed but is not integrated into the genome, and as such represents a transient trait. According to preferred embodiments the nucleic acid sequence of the present invention is stably transformed into the organism cell.

The genetically altered organisms having altered content of the desired steroidal alkaloid(s) or steroidal saponin(s) according to the teachings of the present invention are typically first selected based on the expression of the GAME4 gene or protein. Organisms having enhanced or aberrant expression of GAME4 are then analyzed for the content of steroidal alkaloids and/or steroidal saponins.

Detection of mutated GAME4 and/or the presence of GAME4 silencing molecule and/or over-expression GAME4 is performed employing standard methods of molecular genetics, known to a person of ordinary skill in the art.

For measuring the GAME4 gene or silencing molecule expression, cDNA or mRNA should be obtained from an organ in which the nucleic acid is expressed. The sample may be further processed before the detecting step. For example, the polynucleotides in the cell or tissue sample may be separated from other components of the sample, may be amplified, etc. All samples obtained from an organism, including those subjected to any sort of further processing are considered to be obtained from the organism.

Detection of the GAME4 gene or the silencing molecule typically requires amplification of the polynucleotides taken from the candidate altered organism. Methods for DNA amplification are known to a person skilled in the art. Most commonly used method for DNA amplification is PCR (polymerase chain reaction; see, for example, PCR Basics: from background to Bench, Springer Verlag, 2000; Eckert et al., 1991. PCR Methods and Applications 1 :17). Additional suitable amplification methods include the ligase chain reaction (LCR), transcription amplification and self-sustained sequence replication, and nucleic acid based sequence amplification (NASBA).

According to certain embodiments, the nucleic acid sequence comprising the GAME4 or its silencing molecule further comprises a nucleic acid sequence encoding a selectable marker. According to certain embodiments, the selectable marker confers resistance to antibiotic or, in case of plants and fungi, to herbicide; in these embodiments the transgenic organisms are selected according to their resistance to the antibiotic or herbicide.

The content of steroidal alkaloids and/or steroidal saponins is measured as exemplified hereinbelow and as is known to a person skilled in the art.

The following examples are presented in order to more fully illustrate some embodiments of the invention. They should, in no way be construed, however, as limiting the broad scope of the invention. One skilled in the art can readily devise many variations and modifications of the principles disclosed herein without departing from the scope of the invention.

EXAMPLES

Materials and Methods

Plant material

Tomato plants (Solarium ly coper sicum) cv. Ailsa Craig (AC) (obtained from the Tomato Genetic Resource Center (TGRC) and cv. Micro Tom were grown in a climate-controlled greenhouse at 24°C during the day and 18°C during night, with natural light. Fruit at the following stages: Immature Green (IG), Mature Green (MG), Breaker (Br), Orange (Or) and Ripe (R) were picked on average 10, 35, 38, 41 and 44 days post anthesis, respectively.

Phytosterol analysis

Phytosterol content of the tomato was analyzed as described by the Arabidopsis Metabolomics Consortium (http://tht.yrac.iastate.edu:81/media/protocols/

Analytical%20Platform_5.pdf) with slight modifications. Fully expanded tomato leaves were frozen in liquid nitrogen, grinded to a fine powder using a mortar and pestle. Then 150 mg frozen leaf powder were extracted at 75°C for 60 min. with 6 ml chloroform/methanol (2:1 v:v; containing 1.25 mg/1 epi-cholesterol (Steraloids, USA) as an internal standard). Extracts were kept at room temperature for at least 1 h., solvents were evaporated to dryness in the lyophilizer, and the remaining residue was saponified at 90°C for 60 min. in 2 ml 6% (w/v) KOH in methanol. Upon cooling to room temperature, 1.5 ml n-hexane and 1.5 ml H₂0 were added, and the mixture was shaken vigorously for 20 s. Following centrifugation (3000 g for 2 min.) to separate the phases, the hexane phase was transferred to a 2-ml Eppendorf^® tube and evaporated to dryness using a gentle stream of nitrogen. The aqueous phase was re- extracted with 1.5 ml n-hexane, centrifuged, and the hexane phase added to a 2-ml Eppendorf^® tube containing the pellet from the first extraction and evaporated as above. Subsequently, 50 μΐ of N-methyl-N-trimethylsilyl trifluoroacetamide (MSTFA) was added to the pellet, the sample was shaken vigorously for 30 s., and the mixture was transferred to a 2- ml auto-sampler glass vial with a 100-μ1 conical glass insert. After capping the vial, the reaction mixture was incubated at room temperature for at least 15 min. The GC-MS system was comprised of a COMBI PAL auto-sampler (CTC analytics AG), a Trace GC Ultra Gas Chromatograph equipped with a programmable temperature vaporizing (PTV) injector, and a DSQ quadrupole Mass Spectrometer (Thermo Electron Cooperation, Austin, USA). GC was performed on a 30 m x 0.25 mm x 0.25 μηι Zebron ZB-5 ms MS column (Phenomenex, USA). The PTV split technique was carried out as follows: samples were analyzed in the CT splitless mode. PTV inlet temperature was set at 280°C. Analytes were separated at a flow rate of 1.2 ml/min. using He as carrier gas and using a thermal gradient starting at 170°C at 1.5 min., which was ramped first to 280°C at 37°C/min. and then to 300°C at 1.5°C, where it vvas held for 5.0 min. Eluents were fragmented in electron impact mode with an ionization voltage of 70 eV. The reconstructed ion chromatograms and mass spectra were evaluated using the Xcalibur software v.1.4 (ThermoFinnigan, Manchester, UK). Compounds were identified by comparison of their retention index (RI) and mass spectrum to those generated for authentic standards analyzed on the same instrument: a-amyrin (Apin chemicals, UK); β- sitosterol, ?-amyrin, cholestanol, cholesterol and stigmasterol (Sigma, USA); lanosterol, cycloartenol, campesterol (Steraloids, USA), and 2,3-oxidosqualene (Echelon Biosciences Inc, USA). Phytosterols concentrations in planta were quantified against standards using standard curves.

Quantitative Real-Time PCR

RNA isolation from fruit (without placenta and seeds) was performed by the hot phenol method (Verwoerd T.C. et al. 1989 Nucleic Acids Res 17:2362), from seeds (cleaned from gel) as described by Ruuska and Ohlrogge (Ruuska S.A. and Ohlrogge J.B. 2001 Biotechniques 31 :752, 754, 756-758) and from all other tissues by the Trizol method (Sigma). DNase 1 (Sigma) treated RNA was reverse-transcribed using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and cDNA used for Real-Time PCR analysis performed as described in Mintz-Oron et al. (Mintz-Oron et al. 2008 Plant Physiol. 147: 823- 851).

Gene-specific oligonucleotides were designed by the Primer Express 2 software (Applied Biosystems). The clathrin adaptor complexes subunit (CAC) gene (Exposito- Rodriguez M. et al. 2008 BMC Plant Biol 8: 131) was used as an endogenous control.

The following primers were used for Real Time PCR:

For tomato only:

450-fl CTTCAATGTGTGGTGATCCAAAA (SEQ ID NO:27)

450-rl CCATAATTGTTGGCTTCCCAAA (SEQ ID NO:28) For potato only (three pairs of primers):

p450P-f 1 TTGCCATATTTTGGC AACACA (SEQ ID NO :29)

p450P-rl CCTCCTGTCCCAAACCTAGTAGC (SEQ ID NO:30)

p450P-f2 ATATTTTGGCAACACACTTTCTTACTTC (SEQ ID NO:31)

p450P-r2 ACATTCCTCCTGTCCCAAACC (SEQ ID NO:32)

p450P-f3 TTTGGGACAGGAGGAATGTATAGG (SEQ ID NO:33) p450P-r3 TATTCTTCATCCATCAAAACTTTTCTAATTA (SEQ ID NO:34)

Preparation of tomato tissue extracts

Tissues of tomato cv. MicroTom were frozen and grinded to a fine powder using an analytical mill (IKA, Al 1 basic) or mortar and pestle. Then, frozen tissue was extracted with 80% methanol: water (v/v) containing 0.1 % formic acid [the solid:liquid ratio was kept 1 :3 (w:v)]. The mixture was vortexed for 30 seconds, sonicated for 30 min at room temperature, vortexed again for 30 seconds, centrifuged (20,000 g, 10 min) and filtered through a 0.22 μιη PTFE membrane filter (Acrodisc® CR 13 mm, PALL).

Targeted profiling of semi-polar compounds including steroidal alkaloids and steroidal saponins by UPLC-OTQF-MS

For the profiling of semi-polar compounds, organic extracts from 200mg tomato tissues were filtered through a 0.22 μιη PTFE membrane filter (Acrodisc® CR 13 mm, PALL) before injection to the UPLC-QTOF-MS instrument. Mass spectral analyses were carried out by the UPLC-QTOF instrument (Waters Premier QTOF, Milford, MA, USA), with the UPLC column connected on-line to a UV detector (measuring at 240 nm; Waters, ACQUITY), and then to the MS detector. Separation of metabolites was performed on the 100 x 2.1 mm i.d., 1.7 μπι UPLC BEH C18 column (Waters ACQUITY). The mobile phase consisted of 0.1% formic acid in acetonitrile: water (5:95, v/v) (phase A), and 0.1% formic acid in acetonitrile (phase B). The linear gradient program was as follows: 100 - 72% A over 22 min, 72 - 60% A over 0.5 min, 60-0% A over 0.5 min, held at 100% B for further 1.5 min, then returned to the initial conditions (100% A) in 0.5 min, and conditioning at 100% A for 1 min The flow rate was 0.3 ml/min, the column temperature was kept at 35°C. Masses of the eluted compounds were detected by a QTOF Premier MS, equipped with electrospray ionization (ESI) source (performed in ESI-positive and ESI-negative modes). The following settings were applied during the UPLC-MS runs: capillary voltage at 3.0 kV; cone voltage at 30 eV; collision energy at 3 eV; argon was used as a collision gas. The m/z range was 50-1500 Da. The following settings were applied during the UPLC-MS/MS run: capillary spray at 3.0 kV; cone voltage at 30 eV; collision energies were 15 - 50 eV for positive mode and 15 - 60 eV for negative mode; argon was used as a collision gas. The MS was calibrated using sodium formate, and leucine enkephalin was used as the lock mass. A mixture of 15 standard compounds, injected after each batch of ten tomato samples, was used for instrument quality control. The MassLynx software version 4.1 (Waters) was used to control the instrument and calculate accurate masses. The UV spectra (200-600 nm) were acquired on a UPLC (Waters, ACQUITY) instrument equipped with an ACQUITY 2996 PDA under LC conditions as described above for the UPLC-QTOF analysis. Metabolites were identified using standard compounds by comparison of their retention times, UV spectra and MS/MS fragments. When the corresponding standards were not available, compounds were putatively identified applying several steps. First, the elemental composition was selected according to the accurate masses and the isotopic pattern using the MassLynx software. Then the elemental composition obtained was searched against the KNApSAcK metabolite database (Shinbo et al., 2006 Biotech. Agric. For. 57: 165-181.), the Dictionary of Natural Products (Chapman & Hall/CRC), and the MOTO database; Moco S. et al., 2006 Plant Physiol 141 :1205-1218). When a suitable candidate was not found, more comprehensive chemical databases were searched using SciFinder tool (SciFinder Scholar 2007). Predicted Log D values for pH 3 (pH of the UPLC mobile phase), found using SciFinder tool, were utilized for the retention time prediction in order to narrow the number of proposed structures. The interpretation of the observed UV and MS/MS spectra in comparison with those found in the literature (when possible) was the main tool for putative identification of metabolites. The analysis of the raw UPLC-QTOF-MS data was performed using the XCMS software (Smith et al., 2006 Anal. Chem. 78: 779-787) from the Bioconductor package (v. 2.1) for R statistical language (v. 2.6.1). XCMS performs chromatogram alignment, mass signal detection and peak integration. The XCMS set was constructed with the following parameters: fwhm = 10.8, step = 0.05, steps = 4, mzdiff = 0.07, snthresh = 8, max = 1000. Since injections of samples in the positive and negative ionization modes were performed in the separate injection sets, XCMS pre- processing was done for each ionization mode independently. The beginning of the chromatogram representing the column void volume and the last 3.5 minutes corresponding to column washing and equilibration were removed from analysis.

1-MCP treatment

Fruit (cv. AC) at the MG, Br and Or stages were incubated with 1 ppm of 1-MCP for 19 h, moved to open air for 24 h and subsequently frozen. Control fruit were incubated in air instead of 1-MCP. Generation of transgenic tomato and potato plants

A Gvi E^-silencing construct (RNAi) (GAME4i) was created by introducing the GAME4 fragment to pENTR™/O-T0P0® (Invitrogen) (by AscI and NotI) and further transfer of the resulting plasmid to pK7GWIWG2(II) binary vector under the control of 35S Cauliflower Mosaic Virus (CaMV) promoter (Karimi M. et al. 2002. Trends in Plant Science 7: 193- 195) using Gateway® LR Clonase™ II enzyme mix (Invitrogen).

The GAME4 over-expressing (GAME4oe) construct was generated by cloning the tomato GAME4 cDNAs (Ncol and BamHI) into plasmid pAA100-35S between the 35S Cauliflower Mosaic Vims (CaMV) promoter and a NOPALINE SYNTHASE (NOS) terminator, extracting the 35S::GAMEl ::tNOS cassette (Pad and AscI) and cloning to pBIN- PLUS (van Engelen et al., 1995. Transgenic Research 4:288-290).

Constructs were transformed into tomato cv. Micro Tom as described by Meissner et al. 1997 (Meissner R et al. 1997 Plant J 12:1465-1472) and Meissner R. et al. 2000 (Meissner et al. 2000 Plant J 22:265-274) and into potato cv. Desiree.

The GAME4 fragment was amplified using the following primers (including adaptors with restriction sites - marked in italics and lower case:

p450-Asc J^GGCGCGCCcacccttTGAAATCCTAGTTTTG (SEQ ID NO:35) p450-Not ^GCGGCCGCccccttCACCCTTTGGGTATGGTG (SEQ ID NO:36)

Example 1; The GLYCOALKALOID METABOLISM 4 gene and biosynthesis of SAs in the Solanaceae

The expression of the GAME4 was determined in 21 tomato tissues and developmental stages using Quantitative Real Time PCR (QRT-PCR). GAME4 expression was shown to be peel- and green tissues-associated (Figure 9 and Figure 2A). In addition, its expression appeared to be ripening regulated, showing a strong decline during fruit ripening. The ripening of climacteric fruit is characterized by an ethylene peak, leading to major changes in gene expression. The chemical 1-methylcyclopropene (1-MCP) is an inhibitor of ethylene perception and therefore interferes with fruit ripening. To examine whether GAME4 expression is indeed ripening regulated, its expression was measured in fruit treated with 1 - MCP at three ripening stages (Figure 2C). Application of 1-MCP resulted in a significant increase in GAME4 expression at the Mature Green (MG) and Breaker (Br) fruit ripening stages. In addition, at the Orange (Or) ripening stage there was an increase, although not statistically significant, in the expression of GAME4. GAME4 expression was also examined at two ripening stages, Or and Ripe (R), in the fruit ripening mutants ripening-inhibitor {rin) and not ripening (nor), known to be compromised in their ethylene signal transduction cascade. GAME4 transcript levels were significantly higher in Or fruit of the nor ripening mutant then in wild type (Figure 2D). Furthermore, at the red-ripe stage of ripening the transcript levels of GAME4 were significantly higher in both the rin and the nor ripening mutants compared to wild type, while in nor its expression was higher than in rin (Figure 2D).

Based on its expression profile, a tomato CYP protein of 487 amino acids, named

GLYCOALKALOID METABOLISM 4 (GAME4) was investigated. The protein exhibited highest similarity with potato (Figure 1A; SEQ ID NO: 10) (94% identity at the amino acid level), but had no putative orthologues in non-Solanaceae plant species (highest identity 48% with a cytochrome P450 monooxygenase [Petunia x hybrida] (Figure 1A; SEQ ID NO:21). The gene was found to be localized to chromosome #12 of the tomato genome. From the investigation of the amino acid sequences of the four Solanaceae plant species (Solanum lycopersicum, Solanum pimpinelifulium, Solanum pennellii and Solanum tuberosum), the GAME4 protein of S. lycopersicum was found to have the nearest homologue in S. pimpinelifolium (wild tomato species), when the GAME4 protein of the S. tuberosum was more homologous to the S. pinelii (wild tomato species) (Figure IB). Although GAME4 proteins from S. lycopersicum and S. pimpinelifolium displayed high homology, it is noteworthy that their genomic sequences exhibit different intron structure. For example, the genomic sequence of GAME4 from S. pimpinelifolium in addition to the three common introns present also in the genomic sequence of GAME4 from S, lycopersicum, contains five additional introns of 1 159bp, 934bp, 275bp, 137bp and 130bp each (Figure 1C). The cDNA sequences of GAME4 are presented in Figure ID.

Example 2: SA and SS levels in GAME4 silenced potato plants

To study GAME4 function in vivo, independent transgenic potato (21 plants) lines transformed with GAME4 silencing (RNAi) vector were generated (GAME4i plants) as described in "Material and Methods" hereinabove. The levels of SAs in the leaves of the transgenic plants compared to wild type were examined using UPLC-qTOF-MS. A significant (up to 90%) reduction in the levels of the major potato SAs (a-solanine and a-chaconine (Figure 3 and Figure 4) was observed in the transgenic potato plants as compared to the wild type. Moreover, the levels of additional 27 putative SAs were also strongly and significantly down-regulated in leaves of these potato plants (Figure 3 and Figure 4). In contrast with the reduction of the SA levels, a strong and significant accumulation of two putative steroidal saponins (m/z= 1031.5427 and m/z=1047.5435) was detected in potato leaves. Those SS molecules were all putatively identified as a structure with an open F-ring; hence they all lost H₂0 in the positive ionization mode.

In order to further investigate the silencing effects of GAME4 in potato tubers, the levels of the major potato SAs (α-solanine and α-chaconine) were measured in the peel of the tubers of GAME4i and wild type plants (Figure 5 A and 5B). The comparison of the SA content of wild type tubers that were exposed to light for 21 days with those kept in dark, revealed up to two-fold accumulation of the (α-solanine and a-chaconine). From the other hand, we observed significantly smaller amounts of (α-solanine and α-chaconine) in the peel of the tubers of GAME4i plants, when the SAs content mainly did not change during light treatment (Figure 5A and 5B).

In addition to the SAs levels, the levels of two putative steroidal saponines (m/z= 1031.5427 and m/z=1047.5435) were measured in the peel of the tubers exposed to light and compared to the SS content of tubers kept in dark (Figure 5C and 5D). Both putative SSs were present at high levels in the peel of the transgenic tubers. Two of the four transgenic lines had shown up to 1.5 times accumulation of both measured SSs, when in two additional GAME4i lines we saw stable levels of both SSs during light treatment and in the peel of the tubers kept in dark. Wild type plants accumulated minor quantities of the two SSs measured, when their levels accumulated during light treatment (Figure 5C and 5D).

Example 3: SA and SS levels in GAME4 silenced tomato plants

Independent transgenic tomato (11 plants) lines transformed with GAME4 silencing (RNAi) vector (GAME4i plants) were generated as described in "Material Methods" hereinabove. The levels of SAs in the leaves of the transgenic plants were examined compared to the levels in the wild type plants using UPLC-qTOF-MS. A significant reduction (more than fifty fold) in the levels of the major tomato SA, cc-tomatine was found in leaves of GAME4i tomato plants as compared to the wild type plants (Figure 6). Additional six putative SAs showed reduced levels (tenfold and more) as compared to SAs from wild type tomato leaves (Table 3, Figure 6). In contrast with the reduction of the SA levels, a strong and significant accumulation of a putative, previously not detected in planta, steroidal saponin (m/z=l 215.5932) was measured in tomato leaves. Metabolic profiles of samples derived from the GAME4i transgenic Mature green and Ripe tomato fruit were further generated, and compared with the metabolic profile of wild type fruits of the corresponding developmental stages using the XCMS analyses. As the output of the differential metabolites was studied, 32 of them were significantly downregulated, including all putative SAs and the tomato principle SA, ct-tomatine. On the other hand, the levels of 17 putatively identified steroidal saponins (SSs) were significantly upregulated. In many cases those substances were generated de novo in tomato fruit. All the SS molecules identified in transgenic tomato plants were putatively identified as a structure with an open F-ring; hence they all lost ¾0 in the positive ionization mode. The putative steroidal saponin (m/z=1215.5932) was the highest and the most abundant peak in the Total Ion Count (TIC) chromatogram, and was putatively identified as Asparagoside H or as Uttroside B. Its structure was partially verified by Nuclear Magnetic Resonance (NMR) (Figure 7).

Table 3 : Relative amounts of green tissue - specific glycoalkaloids in the leaves of the GAME4i plants compared to the wild type.

Example 4: Sterol Composition in GAME4 Silenced Tomato Plants

The sterol and triterpene profile in the leaves of the GAME4i tomato plants was examined employing Gas Chromatography Mass Spectrometry (GCMS). Several small but statistically significant alterations in the composition of sterols between the transgenic and the wild type plants were found (Figure 8 A and 8B). As can be seen from a putative pathway of sterol biosynthesis in plants (Figure 8A), the GAME4i tomato plants exhibited a change in the sterol and sterol precursors flux. Elevated levels of cholesterol (1.24 fold) and cycloartenol (1.62 fold), as compared to their levels in wild type plants were detected. In addition, the accumulation of the products of cholesterol metabolism: campesterol and ^-sitosterol was also evident (1.34 and 1.27 fold respectively). Surprisingly, the levels of stigmasterol (the following intermediate after ^-sitosterol) did not change. Although in the GAME4i plants, (5)-2,3-oxidosqualene accumulated to a small extent (1.24 fold), the levels of ?-amyrin and - amyrin remained unaffected. Example 5: Steroidal Alkaloids in tomato plants over-expressing GAME4

Metabolic profiling using UPLC-qTOF-MS was used to measure the levels of steroidal alkaloids in transgenic tomato lines over-expressing GAME4 produced as described hereinabove in comparison with their levels in wild-type tomato plants. Table 4 summarizes the results obtained, showing that the level of several steroidal alkaloids was dramatically increased due to GAME4 over-expression. Significant elevation was found for a-tomatine isomer, tomatidine and its derivatives, dehydrotomatine and hydroxytomatine.

Table 4: Putative Steroidal Alkaloids identified in tomato leaf tissue in which the GAME4 gene was over expressed driven by the CaMV35S promoter

# - number given to metabolite; RT, - retention time of metabolite peak; ionization mode used for quantification; ^bIdentification: A comparison to standard; B- using elemental composition and MS^F fragmentation; ^cPositive mode, actual (M+H); ^Negative mode, actual (M + Formic acid); ^eAppm (for positive mode); ^fMolecular formula; ^gFold differential: a ratio of average peak area intensities of GAME4 gene ove expressed lines and Wild type Micro Tom.

Example 6: Metabolic Profiling of SAs in Diverse Tomato Plant Tissues

The occurrence of steroidal alkaloids (SAs) in different tomato plant parts was examined by identifying and examining the distribution of 85 putative SAs in 21 tissues and fruit developmental stages by UPLC-qTOF-MS analysis (Figure 9). Hierarchical clustering of the profiling data revealed several clusters of tissue/developmental stage-specific SAs. For example, 21 metabolites, including -tomatine and its isomer, 4 isomers of dehydrotomatine and an isomer of hydroxytomatine, were found to be associated with green tissues, as they were detected in unripe fruit, leaves, and sepal-containing buds and flowers. 32 SAs unique to tissues of the ripe fruit stage (peel, flesh, or seeds) were also detected, among them an isomer of acetoxy-hydroxytomatine, di-hydroxytomatine, 3 isomers of lycoperoside G/F or esculeoside A and 3 isomers of their dehydro- form, 5 isomers of lycoperoside G/F or esculeoside A plus a hexose, and 4 isomers of esculeoside B. Pollen was found to be poor in SAs, as it contained only one SA, which was also found in buds and flowers (that also contained pollen). Apart from the 32 SAs mentioned previously as unique to the ripe fruit stage tissues, seeds harvested at the red-ripe stage fruit contained 9 unique SAs, 5 of them were isomers of hydroxytomatidine plus 3 hexose, acetoxy-hydroxy-dehydrotomatine and one unknown SGA. In roots two unique isomers of dehydrotomatine were identified. Buds and flowers were found to accumulate 12 SGAs that were unique to these tissues including five isomers of hydroxytomatine. The alkamine tomatidine, the precursor of a-tomatine, was found at very low levels in most green tissues and roots.

The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can, by applying current knowledge, readily modify and/or adapt for various applications such specific embodiments without undue experimentation and without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. The means, materials, and steps for carrying out various disclosed functions may take a variety of alternative forms without departing from the invention.

Claims

1. A genetically modified organism comprising at least one cell having altered expression of GAME4 compared to a corresponding unmodified organism, wherein the modified organism has an altered content of at least one compound selected from a steroidal saponin (SA), a steroidal alkaloid (SA) and derivatives thereof compared to a corresponding unmodified organism.

2. The genetically modified organism of claim 1, said organism is modified to produce at least one steroidal saponin, steroidal alkaloid or a combination thereof.

3. The genetically modified organism of claim 1, said organism is naturally capable of producing at least one steroidal saponins and at least one steroidal alkaloid.

4. The genetically modified organism of claim 3, said organism is selected from the group consisting of a plant, a fungus, a bacterium and a yeast.

5. The genetically modified organism of claim 3, wherein the expression of GAME4 is inhibited compared to the corresponding unmodified organism.

6. The genetically modified organism of claim 5, said organism produces elevated amounts of at least one steroidal saponin compared to the unmodified organism.

7. The genetically modified organism of claim 5, said organism produces reduced amounts of at least one steroidal alkaloid compared to the unmodified organism.

8. The genetically modified organism of claim 5, said organism produces reduced amount of at least one steroidal alkaloid and elevated amount of at least one steroidal saponin compared to the unmodified organism.

9. The genetically modified organism of any one of claims 6-8 wherein said organism is a plant.

10. The genetically modified organism of claim 5, said organism is a transgenic organism comprising at least one cell comprising a GAME4 silencing molecule selected from the group consisting of RNA interference molecule and antisense molecule.

1 1. The transgenic organism of claim 10 having at least one cell comprising the GAME4 silencing molecule, wherein said organism has a decreased content of at least one steroidal alkaloid or derivative thereof compared to a corresponding non- transgenic organism.

12. The transgenic organism of claim 10 having at least one cell comprising a GAME4 silencing molecule, wherein said organism has an elevated content of at least one steroidal saponin or derivatives thereof compared to a corresponding non- transgenic organism.

13. The transgenic organism of any one of claims 10-12, wherein said organism is a plant.

14. The transgenic plant of claim 13 selected from the group consisting of a tomato, a potato and an eggplant.

15. The transgenic tomato plant of claim 14, said plant ia a tomato plant having a reduced content of a steroidal alkaloid selected from the group consisting of a- tomatine, tomatidine and derivatives thereof and an elevated content of at least one steroidal saponin or a derivative thereof.

16. The transgenic tomato plant of claim 15, wherein the reduced content of the at least one steroidal alkaloid and its derivatives and elevated content of at least one steroidal saponin and its derivatives is found in said tomato plant organ sleeted from the group consisting of leaves and fruit.

17. The transgenic plant of claim 14, said plant is a potato plant having a reduced content of at least one steroidal alkaloid selected from the group consisting of a- solanine, a-chaconine and derivatives thereof and an elevated content of at least one steroidal saponin or a derivative thereof.

18. The transgenic potato plant of claim 17, wherein the reduced content of the at least one steroidal alkaloid and elevated content of at least one steroidal saponin and their derivatives is found in said potato plant organ selected rom the group consisting of leaves and tubers.

19. The transgenic plant of claim 10, wherein the silencing molecule comprises a polynucleotide having a nucleic acid sequence substantially complementary to a region of the GAME4 gene, the gene having the nucleic acid sequence set forth in any one of SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:l l and SEQ ID NO:13.

20. The transgenic plant of claim 19, wherein the silencing molecule comprises a polynucleotide having a nucleic acid sequence substantially complementary to a nucleic acid sequence set forth in SEQ ID NO: 15.

21. The transgenic plant of claim 20, wherein the silencing molecule is an RNA inhibitory molecule (RNAi) comprising a first polynucleotide having the nucleic acid sequence set forth in SEQ ID NO: 15 and a second polynucleotide having a nucleic acid sequence complementary to SEQ ID NO: 15.

22. The genetically modified organism of claim 1, wherein the expression of GAME4 in enhanced compared to the corresponding unmodified organism.

23. The genetically modified organism of claim 22, said organism is a transgenic organism comprising at least one cell comprising a transcribable polynucleotide encoding GAME4.

24. The transgenic organism of claim 23, wherein the polynucleotide encoding GAME4 comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9; SEQ ID NO:l 1, SEQ ID NO: 13, and a functional fragment thereof.

25. The transgenic organism of claim 24, said organism is a transgenic plant.

26. The transgenic plant of claim 25, wherein the plant is a tomato plant having elevated content of at least one of a-tomatine, tomatidine, dehydrotomatine and hy droxytomatine .

27. An isolated polynucleotide marker capable of specifically hybridizing to a polynucleotide encoding GAME4, the polynucleotide encoding GAME4 having a nucleic acid sequence at least 65% homologous to SEQ ID NO:2.

28. The isolated polynucleotide marker of claim 27 wherein the polynucleotide encoding GAME4 has a nucleic acids sequence at least 75%, at least 85%, at least 95% or more homologous to SEQ ID NO:2.

29. A method of screening for an organism capable of producing altered content of at least one of steroidal alkaloid and steroidal saponin, the method comprising (a) providing a sample comprising genetic material from the organism; and (b) detecting in the sample the presence of a polynucleotide encoding GAME4.

30. The method of claim 29. wherein the polynucleotide encoding GAME4 has a nucleic acid sequence at least 65% homologous to SEQ ID NO:2.

31. The method of claim 30, wherein the polynucleotide encoding GAME4 has a nucleic acid sequence least 75%, at least 85%, at least 95% or more homologous to SEQ ID O:2.

32. The method of claim 29, wherein the polynucleotide encoding GAME4 has a nucleic acid sequence as set forth in any one of SEQ ID NOs: 2, 5, 7, 9, 1 1 and 13.

33. A method of elevating the content of at least one steroidal alkaloid in a cell derived from an organism, comprising transforming the cell with a transcribable polynucleotide comprising a nucleic acids sequence encoding GAME4.

34. The method of claim 33, wherein the polynucleotide encoding GAME4 has a nucleic acid sequence as set forth in any one of SEQ ID NOs: 2, 5, 7, 9, 1 1, and 13.

35. The method of claim 33, wherein the organism is selected from the group consisting of a plant, a fungus, a bacterium and yeast.

36. The method of claim 33, wherein the cell is propagated to generate a cell suspension or a tissue culture.

37. The method of claim 36, wherein the tissue culture is regenerated to produce a transgenic organism comprising at least one cell having elevated content of at least one steroidal alkaloid compared to a corresponding cell of a non transgenic organism.

38. The method of claim 36, wherein the steroidal saponins are purified from the growth medium of the transgenic ell suspension, tissue culture or organism.