WO2012089602A1 - Small molecule conjugates for intracellular delivery of biologically active compounds - Google Patents

Small molecule conjugates for intracellular delivery of biologically active compounds Download PDF

Info

Publication number
WO2012089602A1
WO2012089602A1 PCT/EP2011/073718 EP2011073718W WO2012089602A1 WO 2012089602 A1 WO2012089602 A1 WO 2012089602A1 EP 2011073718 W EP2011073718 W EP 2011073718W WO 2012089602 A1 WO2012089602 A1 WO 2012089602A1
Authority
WO
WIPO (PCT)
Prior art keywords
phenyl
compound
sirna
biologically active
amino
Prior art date
Application number
PCT/EP2011/073718
Other languages
French (fr)
Inventor
Philipp Hadwiger
Torsten Hoffmann
Kerstin Jahn-Hofmann
Eric A. Kitas
David L. Lewis
Peter Mohr
Hans Martin Mueller
Guenther Ott
Ingo Roehl
David B. Rozema
Original Assignee
F. Hoffmann-La Roche Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to MX2013006329A priority Critical patent/MX341992B/en
Application filed by F. Hoffmann-La Roche Ag filed Critical F. Hoffmann-La Roche Ag
Priority to BR112013016772A priority patent/BR112013016772B8/en
Priority to CN201180063452.9A priority patent/CN103282502B/en
Priority to ES11802425.6T priority patent/ES2574177T3/en
Priority to JP2013546673A priority patent/JP5876075B2/en
Priority to CA2822176A priority patent/CA2822176C/en
Priority to RU2013134746A priority patent/RU2629957C2/en
Priority to MX2016009207A priority patent/MX356826B/en
Priority to EP11802425.6A priority patent/EP2658982B1/en
Priority to KR1020137019895A priority patent/KR101559642B1/en
Publication of WO2012089602A1 publication Critical patent/WO2012089602A1/en
Priority to US13/917,524 priority patent/US9301990B2/en
Priority to US15/090,147 priority patent/US9968647B2/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
    • C07K5/04—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
    • C07K5/08—Tripeptides
    • C07K5/0815—Tripeptides with the first amino acid being basic
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/59—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
    • A61K47/60—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/65—Peptidic linkers, binders or spacers, e.g. peptidic enzyme-labile linkers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C271/00—Derivatives of carbamic acids, i.e. compounds containing any of the groups, the nitrogen atom not being part of nitro or nitroso groups
    • C07C271/06—Esters of carbamic acids
    • C07C271/08—Esters of carbamic acids having oxygen atoms of carbamate groups bound to acyclic carbon atoms
    • C07C271/10—Esters of carbamic acids having oxygen atoms of carbamate groups bound to acyclic carbon atoms with the nitrogen atoms of the carbamate groups bound to hydrogen atoms or to acyclic carbon atoms
    • C07C271/20—Esters of carbamic acids having oxygen atoms of carbamate groups bound to acyclic carbon atoms with the nitrogen atoms of the carbamate groups bound to hydrogen atoms or to acyclic carbon atoms to carbon atoms of hydrocarbon radicals substituted by nitrogen atoms not being part of nitro or nitroso groups
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C69/00—Esters of carboxylic acids; Esters of carbonic or haloformic acids
    • C07C69/96—Esters of carbonic or haloformic acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H15/00—Compounds containing hydrocarbon or substituted hydrocarbon radicals directly attached to hetero atoms of saccharide radicals
    • C07H15/02—Acyclic radicals, not substituted by cyclic structures
    • C07H15/04—Acyclic radicals, not substituted by cyclic structures attached to an oxygen atom of the saccharide radical
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H15/00—Compounds containing hydrocarbon or substituted hydrocarbon radicals directly attached to hetero atoms of saccharide radicals
    • C07H15/20—Carbocyclic rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H15/00—Compounds containing hydrocarbon or substituted hydrocarbon radicals directly attached to hetero atoms of saccharide radicals
    • C07H15/26—Acyclic or carbocyclic radicals, substituted by hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K19/00—Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/16—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing nitrogen, e.g. nitro-, nitroso-, azo-compounds, nitriles, cyanates
    • A61K47/18—Amines; Amides; Ureas; Quaternary ammonium compounds; Amino acids; Oligopeptides having up to five amino acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/77—Internalization into the cell
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/02—Linear peptides containing at least one abnormal peptide link
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/322—2'-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications

Definitions

  • R 3 is -NH-phenyl, which phenyl group is further substituted with -(CH 2 )-0-C(0)-0-(4-nitro-phenyl); n is 0; and
  • Y is -C(0)-N-(CH 2 -CH 2 -0) p -CH 2 -CH 2 -;
  • the compounds of formula (I) or (la) are useful as ligands on biologically active substances, such as nucleic acids, peptides or proteins, to which they are covalently attached.
  • the covalent bond is created by the reaction of a suitable functional group, such as i.e. a primary amine group, in the biologically active substance with the activated carbonyl group in the -O- C(0)-0- moiety of R as defined herein before.
  • a conjugate comprising the compounds of formula (I) or (la) and a biologically active substance.
  • biologically active substance refers to an inorganic or organic molecule including a small molecule, peptide (e.g.
  • the present invention therefore also provides a method for delivery of a biologically active substance, into cells wherein said biologically active substance may subsequently be cleaved off the conjugate to unfold a therapeutic activity.
  • Conjugates of formula (I) or (la) covalently attached to a biologically active substance are designated herein as formula (II) or (Ila), respectively.
  • the present invention provides compounds of formula
  • R a is -(CH 2 ) k -NH 2 ;
  • R 1 and k have the meanings given for formula (I) above; and the biologically active substance is a nucleic acid, a protein or a peptide.
  • the biologically active substance in formula (II) or (Ila) is a nucleic acid, most preferably a siRNA.
  • the biologically active substance in formula (II) or (Ila) is a protein or a peptide.
  • Another embodiment of the invention is a pharmaceutical composition comprising the conjugates of the compounds of formula (I) or (la) covalently attached to a biologically active substance.
  • a pharmaceutical composition comprising the compounds of formula (Ila) together with pharmaceutically acceptable excipients.
  • the covalent attachment of the siRNA to the compounds of formula (I) or (la) is achieved via reaction of a suitable nucleophilic group, i.e. a primary amine group, in the siRNA with the activated -C(O)- group in R of said compounds of formula (I) or (la).
  • a suitable nucleophilic group i.e. a primary amine group
  • the activation of that -C(O)- group is obtained by a /?-nitrophenoxy carbonate as shown in scheme 2 below.
  • the compounds of formula (II) or (Ila) wherein the biological active substance is siRNA is co-administered with a delivery polymer.
  • Delivery polymers provide a means of disrupting cell membranes and mediate endosomal release.
  • said delivery polymer and the siRNA conjugate of the invention are not covalently attached and synthesized separately and may be supplied in separate containers or a single container.
  • Delivery polymers for oligonucleotides such as siRNA are well known in the art. For example, Rozema et al., in U.S. Patent Publication 20040162260 demonstrated a means to reversibly regulate membrane disruptive activity of a membrane active polyamine.
  • Reversible regulation provided a means to limit activity to the endosomes of target cells, thus limiting toxicity.
  • Their method relied on reaction of amines on the polyamine with 2-propionic-3-methylmaleic anhydride. This modification converted the polycation to a polyanion via conversion of primary amines to carboxyl-containing groups and reversibly inhibited membrane activity of the polyamine.
  • the nucleic acid was covalently linked to the delivery polymer.
  • US provisional patent application 61/307490 a new generation of delivery polymers is described.
  • membrane active polyamine comprising an amphipathic terpolymer formed by random polymerization of amine-containing monomers, lower hydrophobic monomers, and higher hydrophobic monomers are provided.
  • This new generation of delivery polymers removed the requirement that polynucleotide and polymer are associated either by covalent linkage or by charge-charge interaction.
  • Non-limiting examples of delivery polymers used for co-administration with the siRNA conjugates of the invention are membrane active polyamines and poly(vinyl ether) (PBAVE), Dynamic PolyConjugates (DPC; Rozema et al. 2007) and improved DPCs as disclosed in US provisional patent application 61/307490.
  • PBAVE poly(vinyl ether)
  • DPC Dynamic PolyConjugates
  • improved DPCs as disclosed in US provisional patent application 61/307490.
  • RNA degradation pathways induced by DNase II were identified in vitro and are disclosed in this invention:
  • RNA strands containing at least one 2' -OH nucleotide are rapidly degraded via a cyclic pentavalent phosphorus intermediate, leading to 2'-3' cyclic phosphates at the 5'-cleavage product.
  • the formation of the pentavalent intermediate can be inhibited by nucleotides lacking a 2'-OH group such as 2'-deoxy, 2'- ⁇ 9-methyl (2'-OMe)or 2'-deoxy-2'-fluoro (2'-F) nucleotides.
  • a 5'-phosphate also protects and slows down the exonucleolytic cleavage kinetics, but can not fully block this pathway. This is most probably due to the cleavage of the 5 '-phosphate by phosphatases or an inherent phosphatase activity of the DNase II enzyme preparation used in the stability assay.
  • siRNAs can be significantly stabilized when using the following design, wherein an oligonucleotide is provided with an antisense strand with the modification pattern: 5'-(w)- (Zl)- (Z2)- (Z3)n a -3' and a sense strand with the modification pattern 5'- (Z3)n s -3' , wherein w is independently a 5 '-phosphate or 5 '-phosphothioate or H,
  • Z2 is independently a 2'-deoxy nucleoside or 2'-Fluoro-modified nucleoside
  • Z3 is independently a 2' -modified nucleoside
  • n a is 8-23 and n s is 8-25.
  • an oligonucleotide is provided with an antisense strand with the modification pattern: 5'-(w)- (Zl)- (Z2)- (Z3) n a -3' and a sense strand with the modification pattern 5'- (Z3) n s -3' , wherein Z3 is a 2'-OMethyl modified nucleoside, a 2'-Fluoro-modified nucleoside or a 2deoxy-nucleoside and all remaining substituents as well as the variables n a and n s have the meaning given above.
  • nucleosides in the nucleic acid sequence of the oligonucleotice with the novel modification pattern can either be linked by 5 '-3' phosphodiesters or 5 '-3' phosphorothioates.
  • the "anti-sense" strand is the siRNA strand that is complementary to the target mRNA and that will be binding to the mRNA once the siRNA is unwound.
  • the sense strand of said siRNA comprising the novel modification pattern is complimentary to the antisense strand.
  • siRNA comprising the novel modification pattern proofed to be particularly advantageous when covalently attached to a delivery polymer as exemplified by Rozema et al. (Dynamic PolyConjugates (DPC; Rozema et al. 2007). Potency and duration of effect can be significantly enhanced employing the siRNA modification strategy outlined in this invention.
  • said siRNA comprising the novel modification pattern are especially useful when conjugated to small molecules that alter the pharmacokinetic properties of siRNA such as cholesterol or the compounds of formula (I) and (la) provided herein.
  • a conjugate of a small molecule and an oligonucleotide wherein the oligonucleotide has the following modification pattern: the antisense strand with the modification pattern: : 5'-(w)- (Zl)- (Z2)- (Z3) n a -3' and a sense strand with the modification pattern 5'- (Z3) n s -, wherein the substituents as well as the variables n a and n s have the meaning given above.
  • said small molecule is cholesterol.
  • said small molecule is a compound of formula (I) or (I a), resulting in compounds of formula (II) or (Ila).
  • siRNAs conjugates are co-administered with a delivery polymer. Suitable delivery polymers are described above.
  • said siRNA comprising the novel modification pattern are especially useful when conjugated to a ligand that is known to bind to a specific receptor which internalizes the conjugate into a cell.
  • the asialoglycoprotein receptor (ASGPR) expressed on hepatocytes is a well known receptor enabling the clearance (endocytosis and lysosomal degradation) of desialylated proteins from circulation.
  • the N-Acetyl-D- galactosamine has a high binding affinity for the receptor, especially when presented multivalent and when the galactose residues are properly spaced (J Biol Bhem, 2001, 276, 37577).
  • the synthetic ligand shown below was prepared to be covalently attached to the siRNAs comprising the novel modification pattern. Since this type of endocytosis leads to lysosomal degradation of the internalized material the siRNA must be prepared in such a way that it is stable in the lysosome, which is now solved by the novel modification pattern outlined above.
  • the ligand for the ASGPR is attached via an amid bond to the biologically active substance.
  • the amid bond formation can be established with the aid of NHS chemistry.
  • the ligand employed in the conjugation reaction is shown below (formula III).
  • For interaction with the ASGPR the O- acetate groups need to be removed as shown in (formula IV) for an siRNA.
  • a nuclease cleavage site can be introduced by 3'- or 5 '-overhangs containing at least one 2' -OH nucleotide at either the sense or the antisense strand.
  • the final active siRNA species is generated by intracellular nuclease processing.
  • the use of defined cleavage sites implemented by 2' -OH nucleotides within the base paired region is possible. This can be done using at least one 2' -OH nucleotide complementary to the opposite strand or by introduction of either at least one mismatched 2'-OH nucleotide or a hairpin/bulge containing at least one 2'-OH nucleotide.
  • a conjugate of a small molecule and an oligonucleotide is provided wherein
  • the small molecule comprises a nucleotide linker comprising 1-10 preferably 1-5, most preferably 1-3 2'OH-nucleotides;
  • the nucleotide linker is cleaved by intracellular nucleases such as DNAse II after internalization of the conjugate into the endosome, thus releasing the siRNA.
  • said conjugate is co-administered with a delivery polymer. Suitable delivery polymers are described above.
  • a compound of formula (V) comprises a cholesterol moiety, and a nucleotide linker comprising 1-10 preferably 1- 5, most preferably 1-3 2'OH-nucleotides.
  • This nucleotide linker is useful for covalently attaching an oligonucleotide such as a siRNA to the compound of formula (V).
  • said oligonucleotide has the novel modification pattern outlined above.
  • a conjugate of a compound of formula (V) and an oligonucleotide is provided, wherein the oligonucleotide is covalently attached to the nucleotide linker of the compound of formula (V).
  • the nucleotide linker is cleaved by intracellular nucleases such as DNAse II after internalization of the conjugate of a compound of formula (V) and an oligonucleotide into the endosome, thus releasing the siRNA.
  • said conjugate of a compound of formula (V) and an oligonucleotide is coadministered with a delivery polymer.
  • a delivery polymer Suitable delivery polymers are described above.
  • said delivery polymer and the conjugate of a compound of formula (V) and an oligonucleotide of the invention are not covalently attached and synthesized separately and may be supplied in separate containers or a single container.
  • peptide refers to any polymer compound produced by amide bond formation between an .alpha.-carboxyl group of one D- or L-amino acid and an .alpha.- amino group of another D- or L-amino acid.
  • protein refers to polypeptides of specific sequence of more than about 50 residues.
  • di-peptide motif refers to any motif comprising an amide bond formed by either the D- or L-alpha or beta amino group of a first amino acid with the alpha- carboxyl group of a second D- or L-amino acid.
  • amino acid refers to any molecule that contains both amine and carboxyl functional groups.
  • amino acid refers to both natural, non- natural and synthetic amino acids. Any natural amino acids used in the present invention are referred to herein by their common abbreviations.
  • ligand refers to a moiety that is capable of covalently or otherwise chemically binding a biologically active substance.
  • ligand in the context of the invention is preferably a compound of formula (I) or (la) covalently attached to a biologically active substance.
  • biologically active substance refers to an inorganic or organic molecule including a small molecule, peptide (e.g. cell penetrating peptides), protein, carbohydrate (including monosaccharides, oligosaccharides, and polysaccharides), nucleoprotein, mucoprotein, lipoprotein, synthetic polypeptide or protein, or a small molecule linked to a protein, glycoprotein, steroid, nucleic acid (any form of DNA, including cDNA, or RNA, or a fragment thereof), nucleotide, nucleoside, oligonucleotides (including antisense oligonucleotides, LNA and siRNA), gene, lipid, hormone, or combination thereof, that causes a biological effect when administered in vivo to an animal, including but not limited to birds and mammals, including humans.
  • said biologically active substance is a peptide or a nucleic acid.
  • Preferred nucleic acids used herein are siRNAs
  • nucleic acid means an oligomer or polymer composed of nucleotides, e.g., deoxyribonucleotides or ribonucleotides, or compounds produced synthetically (e.g., PNA as described in U.S. Pat. No. 5,948,902 and the references cited therein) which can hybridize with naturally occurring nucleic acids in a sequence specific manner analogous to that of two naturally occurring nucleic acids, e.g., can participate in Watson-Crick base pairing interactions.
  • nucleotides e.g., deoxyribonucleotides or ribonucleotides, or compounds produced synthetically (e.g., PNA as described in U.S. Pat. No. 5,948,902 and the references cited therein) which can hybridize with naturally occurring nucleic acids in a sequence specific manner analogous to that of two naturally occurring nucleic acids, e.g., can participate in Watson-Crick base pairing interactions.
  • Non-naturally occurring nucleic acids are oligomers or polymers which contain nucleobase sequences which do not occur in nature, or species which contain functional equivalents of naturally occurring nucleobases, sugars, or inter-sugar linkages, like peptide nucleic acids (PNA), threose nucleic acids (TNA), locked nucleic acids (LNA), or glycerol nucleic acids (GNA).
  • PNA peptide nucleic acids
  • TAA threose nucleic acids
  • LNA locked nucleic acids
  • GNA glycerol nucleic acids
  • This term includes oligomers that contain the naturally occurring nucleic acid nucleobases adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U), as well as oligomers that contain base analogs or modified nucleobases.
  • Nucleic acids can derive from a variety of natural sources such as viral, bacterial and eukaryotic DNAs and RNAs. Other nucleic acids can be derived from synthetic sources, and include any of the multiple oligonucleotides that are being manufactured for use as research reagents, diagnostic agents or potential and definite therapeutic agents. The term includes oligomers comprising of a single strand nucleic acid or a double strand nucleic acid.
  • 2' -OH -nucleotide refers to ⁇ -D-ribonucleotide comprising of naturally occurring nucleobases having a 2'-OH group.
  • phosphate is modified that one of the O or OH groups is replaced by S and termed herein as "5'-phosphothioate"
  • phosphorothioate refers to a internucleotide linkage in which one of the non-bridging oxygens is replaced by sulfur.
  • delivery polymer refers to polymers suitable for functional delivery of a biologically active substance.
  • the delivery polymer is either covalently attached to or coadministered with the biologically substance conjugated to the compounds described herein and mediates endosomal escape after internalization into the cell and uptake into the endosome.
  • polymer in this context means any compound that is made up of two or more monomelic units covalently bonded to each other, where the monomelic units may be the same or different, such that the polymer may be a homopolymer or a heteropolymer.
  • Representative polymers include peptides, polysaccharides, nucleic acids and the like, where the polymers may be naturally occurring or synthetic.
  • Non-limiting examples of delivery polymers are for example reviewed in INTERNATIONAL JOURNAL OF PHARMACEUTICAL RESEARCH AND DEVELOPMENT, October - 2010 / Volume - 2 / Issue - 8 / Article No -2.
  • Non-limiting examples of delivery polymers useful for delivery of nucleic acids are disclosed in EP applications 10165502.5 and 10191030.5, PCT publication WO 2008/0022309 and US provisional application 61/307490 and references cited herein; which are all included by reference.
  • pharmaceutical composition includes the conjugates of the invention, a pharmaceutical carrier or diluent and any other media or agent necessary for formulation.
  • pharmaceutical carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible.
  • the carrier is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g. by injection or infusion).
  • carrier may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of presence of microorganisms may be ensured both by sterilization procedures, supra, and by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol, sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin. Regardless of the route of administration selected, the conjugates of the present invention, which may be used in a suitable hydrated form, and/or the pharmaceutical compositions of the present invention, are formulated into pharmaceutically acceptable dosage forms by conventional methods known to those of skill in the art.
  • adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents.
  • the pharmaceutical composition must be sterile and fluid to the extent that the composition is deliverable by syringe.
  • the carrier preferably is an isotonic buffered saline solution.
  • Proper fluidity can be maintained, for example, by use of coating such as lecithin, by maintenance of required particle size in the case of dispersion and by use of surfactants.
  • isotonic agents for example, sugars, polyalcohols such as mannitol or sorbitol, and sodium chloride in the composition.
  • Figure 1 shows Co-Administration of siRNA-conjugates comprising the compounds of formula (I) or (la) and a delivery polymer in vivo.
  • Figure 2 shows Co-Administration of siRNA-conjugates comprising the compounds of formula (I) or (la) and a delivery polymer in vivo.
  • Figure 3 shows Co- Administration of siRNA-conjugates comprising the compounds of formula (I) or (la) and a delivery polymer in vivo.
  • Figure 4 shows Co-Administration of siRNA-conjugates comprising the compounds of formula (I) or (la) and a delivery polymer in vivo.
  • Figure 5a shows antisense strand mediated gene silencing with fully 2' -modified siRNAs.
  • COS7 cells were cotransfected with EGFP-directed siRNAs at 3 nM and psiCHECK2-AT. The knockdown activity of the siRNAs was assessed by measuring renilla versus firefly luciferase activity from the reporter construct. siRNAs were sorted by knockdown activity of unmodified (2-19-2) reference siRNAs.
  • Figure 5b shows sense strand mediated gene silencing with fully 2'-modified siRNAs.
  • COS7 cells were cotransfected with EGFP-directed siRNAs at 3 nM and psiCHECK2-ST. The knockdown activity of the siRNAs was assessed by measuring luciferase expression from the reporter construct.
  • siRNAs were sorted by knockdown activity of unmodified (2-19-2) reference siRNAs.
  • Figure 6a shows reduction of serum FVII activity in non-human primates upon intravenous injection of various 2' -modified siRNAs covalently attached to a delivery polymer.
  • Figure 6b shows the development of the prothrombin time in non-human primates upon treatment with 2' -modified siRNAs covalently conjugated to a delivery polymer.
  • Step 1 3-[(3S,8S,9S,10R,13R,14S,17R)-17-(( )-l,5-Dimethyl-hexyl)-10,13-dimethyl- 2,3,4,7,8,9,10, 11,12,13,14,15,16, 17-tetradecahydro-lH-cyclopenta[a]phenanthren-3-yloxy]- propylamine
  • the title amine was prepared from its nitrile precursor according to a literature protocol [ Lollo et al , WO2001/070415].
  • Step 2 N- ⁇ 3-[(3S,8S,9S,10R, 13R,14S,17R)-17-((R)-l,5-Dimethyl-hexyl)-10,13-dimethyl- 2,3,4,7,8,9,10, l l,12,13,14,15,16,17-tetradecahydro-lH-cyclopenta[fl]phenanthren-3-yloxy]- propylj-succinamic acid
  • Step 3 Nl-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-Dimethyl-17-((R)-6-methylheptan-2-yl)- 2,3,4,7,8,9,10, 11,12,13, 14.15, 16, 17-tetradecahydro-lH-cyclopenta[a]phenanthren-3- yloxy)propyl)-N4-((S)-l-((S)-l-(4-(hydroxymethyl)phenylamino)-6-((4- methoxyphenyl)diphenylmethylamino)-l-oxohexan-2-ylamino)-3-(4-nitrophenyl)-l-oxopropan- 2-yl) succinamide
  • Step a (S)-2-[(S)-2-(9H-Fluoren-9-ylmethoxycarbonylamino)-3-(4-nitro-phenyl)- propionylamino] -6- ⁇ [(4-methoxy-phenyl)-diphenyl-methyl] -amino ⁇ -hexanoic acid
  • Step b [(S)- l-((S)- l-(4-Hydroxymethyl-phenylcarbamoyl)-5- ⁇ [(4-methoxy-phenyl)-diphenyl- methyl] -amino ⁇ -pentylcarbamoyl)-2-(4-nitro-phenyl)-ethyl]-carbamic acid 9H-fluoren-9- ylmethyl ester
  • Step c (S)-2-[(S)-2-Amino-3-(4-nitro-phenyl)-propionylamino]-6- ⁇ [(4-methoxy-phenyl)- diphenyl-methyl] -amino ⁇ -hexanoic acid (4-hydroxymethyl-phenyl)-amide Chiral
  • the former was prepared from (S)-2-(((9H-fluoren-9- yl)methoxy)carbonylamino)-3-(4-cyanophenyl)propanoic acid as described above in steps a] - c].
  • the former was prepared from (S)-2-(((9H-fluoren-9- yl)methoxy)carbonylamino)-3-(3,4-dichlorophenyl)propanoic acid as described above in steps a] - c] .
  • the fomier was prepared from (S)-2-(((9H-fluoren-9-yl)methoxy)-carbonylamino)-3-(4- chlorophenyl)propanoic acid as described above in steps a] - c].
  • the former was prepared from (S)-2-(((9H-fluoren-9- yl)methoxy)carbonylamino)-3-(4-fluorophenyl)propanoic acid as described above in steps a] - c]. MS: expected mass: 1378.7669, found mass: 1378.7609.
  • the former was prepared from (S)-2-(((9H-fluoren-9- yl)methoxy)carbonylamino)-3-(2-fluorophenyl)propanoic acid as described above in steps a] - c].
  • the former was prepared from (S)-2-(((9H-fluoren-9- yl)methoxy)carbonylamino)-3-(3-fluorophenyl)propanoic acid as described above in steps a] - c].
  • Step 1 Nl-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)- 2,3,4,7,8,9,10,11,12,13, 14,15, 16,17-tetradecahydro-lH-cyclopenta[a]phenanthren-3- yloxy)propyl)-N4-((S)-l-(4-fluorophenyl)-4-((S)-l-(4-(hydroxymethyl)phenylamino)-6-((4- methoxyphenyl)diphenylmethylamino)-l-oxohexan-2-ylamino)-4-oxobutan-2-yl)succinamide
  • Huenig'sBase 48.7 mg, 64.1 ⁇ , 377 ⁇ , Eq: 2.00 was added and the reaction stirred at ambient temperature over night. TLC indicated the consumption of starting material. All volatiles were removed i. V. and the crude product purified by flash chromatography Si02 / 5% MeOH / 0.1% NEt3 in CH2C12 to yield 197 mg of the title compound as off-white solid.
  • Step2 4-((S)-2-((S)-3-(4-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6- methylheptan-2-yl)-2,3,4 ,7,8,9,10,11,12,13, 14,15,16,17-tetradecahydro-lH- cyclopenta[a]phenanthren-3-yloxy)propylamino)-4-oxobutanamido)-4-(4- fluorophenyl)butanamido)-6-((4-methoxyphenyl)diphenylmethylamino)hexanamido)-benzyl 4- nitrophenyl carbonate Chiral
  • Step 1 The necessary dipeptidic building block for step 1 was prepared as follows: Step a: (S)-2-[(S)-3-(9H-Fluoren-9-ylmethoxycarbonylamino)-4-(4-fluoro-phenyl)- butyrylamino]-6- ⁇ [(4-methoxy-phenyl)-diphenyl-methyl]-amino ⁇ -hexanoic acid
  • Step b ⁇ (S)-2-(4-Fluoro-phenyl)- l-[((S)- l-(4-hydroxymethyl-phenylcarbamoyl)-5- ⁇ [(4- methoxy-phenyl)-diphenyl-methyl] -amino ⁇ -pentylcarbamoyl)-methyl] -ethyl ⁇ -carbamic acid 9H- fluoren-9-ylmethyl ester
  • Huenig's base (662 mg, 871 ⁇ , 5.21 mmol, Eq: 2.00) was added and the reaction allowed to proceed over night.
  • the mixture was poured onto crashed ice / NH 4 C1 (pH ⁇ 7), extracted 2 x with AcOEt, washed with H20 and brine, dried over Na2S04, and evaporated to dryness.
  • the crude product was triturated with diethyl ether (1 x 50 ml); the resultant solid was filtered off and dryed to yield 0.796 g of the title compound as light-brown solid.
  • Step c (S)-2-[(S)-3-Amino-4-(4-fluoro-phenyl)-butyrylamino]-6- ⁇ [(4-methoxy-phenyl)- diphenyl-methyl] -amino ⁇ -hexanoic acid (4-hydroxymethyl-phenyl)-amide
  • the former was prepared from (S)-3-(((9H- fluoren-9-yl)methoxy)cai-bonylamino)-4-(4-chlorophenyl)-butanoic acidas described above in steps a] - c].
  • the former was prepared from (S)-2-(((9H- fluoren-9-yl)methoxy)carbonylamino)-3-(4-methoxyphenyl)propanoic acid as described above in steps a] - c] of example 1.
  • the former was prepared from (S)-3-(((9H-fluoren-9- yl)methoxy)carbonylamino)-4-(4-cyanophenyl)butanoic acid as described above in steps a] - c]. MS: expected mass: 1399.7872, found mass: 1399.7857.
  • TPTU [125700-71-2](233 mg, 784 ⁇ , Eq: 1.00) was added to a solution of N- ⁇ 3- [(3S,8S,9S,10R,13R,14S,17R)-17-((R)-l,5-dimethyl-hexyl)-10,13-dimethyl-
  • Hiinig's base (465 mg, 629 ⁇ , 3.6 mmol, Eq: 6) was added to a solution of the previous alcohol (718 mg, 600 ⁇ , Eq: 1.00) and bis(4-nitrophenyl) carbonate (548 mg, 1.8 mmol, Eq: 3) in THF (20 ml). The yellow solution was stirred overnight at room temperature. The solvent was removed under reduced pressure. The remaining residue was triturated with diethyl ether. The solid was collected by filtration, washed with ether and dried under reduced pressure to obtain the title compound (800 mg, 529 ⁇ ) as a light brown solid.
  • L-Fmoc-Phe-OSu (0.969 g, 2.00 mmol, Eq: 1.00) was suspended in a 1 : 1 v/v mixture of 1,2-dimethoxyethane and water ( 17 ml) and treated at 0°C with L-norleucine (0.275 g, 2.10 mmoll, Eq: 1.05) and NaHC0 3 (0.185 g, 2.20 mmol, Eq: 1.10). The cooling bath was removed and the reaction allowed to proceed at ambient temperature for 14 h.
  • Step 2 ⁇ (S)- 1-[(S)- l-(4-Hydroxymethyl-phenylcarbamoyl)-pentylcarbamoyl]-2-phenyl-ethyl ⁇ - carbamic acid 9H-fluoren-9-ylmethyl ester
  • Step 3 (S)-2-((S)-2-Amino-3-phenyl-propionylamino)-hexanoic acid (4-hydroxymethyl- phenyl)-amide
  • Step 1
  • the resin was washed alternately with DMF and IPA (3 X 10 mL).
  • a solution of Fmoc-Gly-OH (488 mg, 1.64 mmol, Eq: 4), TPTU (487 mg, 1.64 mmol, Eq: 4) and Huenig' s base (636 mg, 859 ⁇ , 4.92 mmol, Eq: 12) in DMF (10 mL) was stirred for 5 minutes and then shaken with the resin for one hour.
  • the resin was washed alternately with DMF and isopropyl alcohol (3X).
  • Step 2 Nl-(3-((3S,8S,9S, 10R, 13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)- 2,3,4,7,8,9,10,11,12,13, 14,15, 16,17-tetradecahydro-lH-cyclopenta[a]phenanthren-3- yloxy)propyl)-N4-((S)-l-((S)-l-(4-(hydroxymethyl)phenylamino)-4-(methylthio)-l-oxobutan-2- ylamino)-4-methyl-l-oxopentan-2-yl)succinamide
  • the product (208 mg, 210 ⁇ ) was obtained as a light yellow solid.
  • Step 3 was prepared in analogy to example 18, step 3. After purification on silica gel, the title compound (161 mg, 137 ⁇ ) was obtained as light brown solid. MS expected mass: 1057.6174, found mass 1057.6184 Example 20
  • the titled compound was prepared in analogy to example 18, step 3. After purification on silica gel (87 mg, 89.4 ⁇ ) the title compound was obtained as light brown solid.
  • Step 3 The title compound was obtained in analogy to example 18, step 3 (176 mg, 161 ⁇ ⁇ ⁇ ) as light brown solid. MS expected mass:984.5572, found mass 984.5489
  • the product (240 mg, 278 ⁇ ) was obtained as a light yellow solid.
  • the product (153 mg, 151 ⁇ ) was obtained as light yellow solid.
  • Step 2 Nl-(3-((3S,8S,9S,10R,13R,14S, 17R)-10, 13-dimethyl-17-((R)-6-methylheptan-2-yl)- 2,3,4,7,8,9,10,11, 12,13, 14,15, 16,17-tetradecahydro-lH-cyclopenta[a]phenanthren-3- yloxy)propyl)-N4-((S)-l-((S)-l-(4-(hydroxymethyl)phenylamino)-l-oxo-3-phenylpropan-2- ylamino)-l-oxo-3-phenylpropan-2-yl)succinamide
  • the compound was prepared in analogy to example 1 step c to obtain the product (245 mg, 877 ⁇ ) as light yellow solid.
  • the compound was prepared in analogy to example 16 step 2 (165 mg, 198 ⁇ ) as light brown solid.
  • 2-Chlorotrityl chloride resin (5 g, 7.5 mmol, Eq: 1.00) was swollen in DCM and then treated with a solution of Fmoc-Asn(Trt)-OH (8.95 g, 15.0 mmol, Eq: 2) and Huenig's base (3.88 g, 5.1 ml, 30.0 mmol, Eq: 4) in DCM overnight. The resin was washed with DCM and capped with a solution of 10% Huenig's base in methanol.
  • the compound was prepared in analogy to example 16 step 2 (89 mg, 91.4 ⁇ ) as light yellow solid.
  • the compound was prepared in analogy to example 16 step 1, starting with Fmoc-D-Lys(Boc)- OH, (158 mg, 116 ⁇ ) as light brown solid.
  • Step a ⁇ 2-[2-(2-Amino-ethoxy)-ethoxy]-ethyl ⁇ -carbamic acid (3S,8S,9S,10R,13R,14S,17R)-17- ((R)-l,5-dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,l 1,12,13, 14,15, 16,17-tetradecahydro- lH-cyclopenta[a]phenanthren-3-yl ester
  • Step b N-[2-(2- ⁇ 2-[(3S,8S,9S,10R,13R,14S,17R)-17-((R)-l,5-Dimethyl-hexyl)-10,13-dimethyl- 2,3,4,7,8,9,10,11,12,13, 14,15, 16,17-tetradecahydro-lH-cyclopenta[a]phenanthren-3- yloxycarbonylamino] -ethoxy ⁇ -ethoxy )-ethyl] -succinamic acid
  • step a The amine from step a (480 mg, 0.856 mmol) and triethylamine (0.13 mL, 0.94 mmol) were dissolved in 5 mL dichloromethane. After adding succinic anhydride (90 mg, 0.9 mmol) the solution was stirred overnight at room temperature. TLC check showed still some starting material. More succinic anhydride (20 mg, 0.2 mmol) was added. After stirring the reaction for another 3 hours at room temperature, it was diluted with dichloromethane and washed with a 5%KHS04/ 10%K2SO4 mixture. The organic extract was dried over anhydrous MgS04- dihydrate, filtered and evaporated in vacuo to obtain the desired acid (490 mg, 0.667 mmol).
  • the title compound was prepared analogous to example 16 using a cholesterol -PEG derivative in step 2 of the synthesis.
  • Step a tert-butyl [25-( ⁇ (3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl- 17-[(2R)-6-methylheptan- 2-yl]-2,3,4,7,8,9,10,l 1,12,13, 14,15, 16,17-tetradecahydro-lH-cyclopenta[a]phenanthren-3- yl ⁇ oxy)-25-oxo-3,6,9,12,15,18,21-heptaoxa-24-azapentacos-l-yl]carbamate
  • Step b l-[(3beta)-cholest-5-en-3-yloxy]-l,27-dioxo-5,8,l l,14,17,20,23-heptaoxa-2,26- diazatriacontan-30-oic acid
  • the title compound was prepared analogous to example 16 using a cholesterol- -PEG derivative in step 2 of the synthesis.
  • Alpha, omega-bis-amino 20(ethylene glycol) (538 mg, 0.6 mmol) and triethylamine (92 uL, 0.66 mmol) were dissolved in 15 mL dry dichloromethane.
  • a solution of cholesteryl chloroformate (270 mg, 0.6 mmol) in 2 mL dry dichloromethane was added dropwise at room temperature. The solution was stirred overnight, then concentrated in vacuo to a small volume and purified directly on silica gel (eluent: MeC12/MeOH 95:5 -> 9:4 -> 4: 1 v/v) to obtain the product (350 mg, 0.254 mmol) as a waxy solid.
  • Step b 1 - [(3beta)-cholest-5-en-3 -yloxy] - 1 ,63-dioxo-
  • step a The amine from step a (329 mg, 0.251 mmol), succinic anhydride (26.4 mg, 0.264 mmol) and triethylamine (40 uL, 0.286 mmol) wered dissolved in 5 mL dry dichloromethane. After adding more triethylamine (40 uL, 0.286 mmol), the solution (pH>8) was stirred overnight at room temperature. The reaction was diluted with dichloromethane and washed twice with a KHS04 5%/K2S04 10% aqueous mixture. The organic extract was dried over anhydrous MgS04, filtered and evaporated to obtain the product (260 mg, 0.175 mmol) as a colorless, waxy solid.
  • DMSO Dimethyl sulfoxide
  • DIPEA N,N-Diisopropylethylamine
  • sodium acetate solution (3 M, pH 5.2) were purchased from Sigma Aldrich Chemie GmbH (Traufmün, Germany).
  • Triethylammonium acetate (TEAA) 2.0 M, pH 7.0
  • Acetonitrile (ACN, HPLC quality) for RP-HPLC were purchased from Biosolve (Valkenswaard, Netherlands).
  • Ethanol (EtOH, p. a.) was purchased from Merck (Darmstadt, Germany). Purified water from a Optilab HF (Membra Pure, Germany) system was used. Resource RPC 3 mL column (10 x 0,64 cm; 15 ⁇ particle size) was purchased from GE Healthcare (Freiburg, Germany).
  • HPLC purification was accomplished using an ⁇ Explorer 100 system (GE Healthcare).
  • RNA containing 2'-Omethyl nucleotides were generated employing the corresponding phosphoramidites, 2'-Omethyl phosphoramidites and TFA- hexylaminolinker amidite (Sigma-Aldrich, SAFC, Hamburg, Germany). Cleavage and deprotection as well as purification was achieved by methods known in the field (Wincott F., et al, NAR 1995, 23,14, 2677-84).
  • RNA was characterized by anion exchange HPLC (purity: 96.1%) and identity was confirmed by ESI-MS ([M+H] l+ calculated: 6937.4; [M+H] 1+measured: 6939.0. Sequence: 5'-(NH2C6)GGAAUCuuAuAuuuGAUCcAsA-3 '; u, c: 2'-0-methyl nucleotides of corresponding RNA nucleotides, s: phosphorthioate.
  • RNA equipped with a C-6 aminolinker at the 5'-end (16.5 mg, 1 equivalent) is dissolved in 500 L DMSO and 150 lL water.
  • the p-Nitrophenylcarbonate derivative (10 equivalents) dissolved in 1 mL DMSO is added followed by 8 DIPEA.
  • the reaction mixture is shaken at 35°C in the dark and monitored using RP-HPLC (Resource RPC 3 mL, buffer: A: 0.1M TEAA in water, B: 0.1M TEAA in 95% ACN, gradient: 3% B to 100% B in 20 CV).
  • RNA conjugate is precipitated using sodium acetate (3 M) in EtOH at -20°C.
  • corresponding conjugates are purified using the conditions described above. Pure fractions are pooled and the material is precipitated using sodium acetate/EtOH to give the desired RNA conjugate.
  • RNA conjugates containing a MMT protecting group in the dipeptide sequence are further processed according to the procedure given below.
  • the crude RNA conjugate pellet is dissolved in 500 water and 1.5 mL sodium acetate buffer (3 M, pH 5.2 or 0.1M, pH 4.0). The solution is shaken for 2 days at 30°C. The reaction mixture is monitored using RP-HPLC (Resource RPC 3 mL, buffer: A: 0.1M TEAA in water, B: 0.1M TEAA in 95% ACN, gradient: 3% B to 100% B in 20 CV). After complete cleavage of the MMT protecting group the RNA conjugate is directly purified using the conditions just mentioned above. Pure fractions are pooled and the desired conjugate is precipitated using sodium acetate/EtOH.
  • RNA conjugate lacking the dipeptide motif was synthesized.
  • cholesterol was attached to the 5 '-end via a linker described in the literature (Nature Biotech, 2007, 25, 1149). This conjugate is referred to as "non-cleavable”.
  • RNA conjugates were analyzed by RP HPLC for purity and identity was confirmed by ESI MS (negative mode). Briefly, RP-HPLC was performed on a Dionex Ultimate system (Dionex, Idstein, Germany) equipped with a XBridge C 18 column (2.5 x 50mm, 2.5 ⁇ particle size, Waters, Eschborn, Germany) at 65°C column temperature. Gradient elution was performed using 100 mM hexafluoroisopropanol (HFIP) and 16 mM triethylamine in 1% methanol as eluent A and in 95% methanol as eluent B (1% B to 18%B in 30 minutes). UV detection was recorded at 260 nm. For mass spectrometric analysis a ThermoFinnigan LCQ DecaXP ESI-MS system with micro-spray source and ion trap detector was coupled online to the HPLC system.
  • HFIP hexafluoroisopropano
  • Examples of specific compounds of formula (Ila) are disclosed in table 1. The resulting compounds are referred to "di-peptide containing cholesterol siRNA conjugates" , wherein the specific di-peptide containing cholesterol siRNA conjugates are further referred to as "Title compound example X- (NHC6)-(siRNA sequence)" and "siRNA with Title compound of Example X”. siRNA preparation
  • Antisense sequence 5'-uuGGAUcAAAuAuAAGAuUCcscsU-3 '
  • u, c 2'-0-methyl nucleotides of corresponding RNA nucleotides, s: phosphorthioate
  • the di-peptide containing cholesterol siRNA conjugates directed against the apolipoprotein B mRNA were generated by mixing an equimolar solution of complementary strands in annealing buffer (20 mM sodium phosphate, pH 6.8; 100 mM sodium chloride), heated in a water bath at 80-85°C for 3 minutes and cooled to room temperature over a period of 3 - 4 hours. Duplex formation was confirmed by native gel electrophoresis.
  • Table 1 Di-peptide containing cholesterol siRNA conjugates (5' -3') and analytical data. Key: lower case letters a, c, g, u, are 2'-0-Methyl nucleotides; A phosphorothioate linkages is symbolized with a lower case "s”. (NHC6) is the aminohexyl linker incorporated at the 5 '-end of the sense strand.
  • Table 2 Di-peptide containing cholesterol siRNA conjugates .
  • the last entry represents a siRNA conjugate lacking the di-peptide motif.
  • Key: lower case letters a, c, g, u, are 2'-0-Methyl nucleotides; A phosphorothioate linkages is symbolized with a lower case "s”.
  • (NHC6) is the aminohexyl linker incorporated at the 5' -end of the sense strand.
  • mice Six to eight week old mice (strain C57BL/6 or ICR, -18-20 g each) were obtained from Harlan Sprague Dawley (Indianapolis IN). Mice were housed at least 2 days prior to injection. Feeding was performed ad libitum with Harlan Teklad Rodent Diet (Harlan, Madison WI).
  • the injected dose was, unless otherwise stated, 15 mg/kg for the delivery polymer and 0.1 mg/kg with respect to the di-peptide containing cholesterol siRNA conjugates .
  • Solutions were injected by infusion into the tail vein. 48 hours post injection serum ApoB levels were measured relative to isotonic glucose treated animals according to the procedure below.
  • Serum ApoB protein levels were determined by standard sandwich ELISA methods. Briefly, a polyclonal goat anti-mouse ApoB antibody and a rabbit anti-mouse ApoB antibody (Biodesign International) were used as capture and detection antibodies respectively. An HRP-conjugated goat anti-rabbit IgG antibody (Sigma) was applied afterwards to bind the ApoB/antibody complex. Absorbance of tetramethyl-benzidine (TMB, Sigma) colorimetric development was then measured by a Tecan Safire2 (Austria, Europe) microplate reader at 450 nm.
  • TMB tetramethyl-benzidine
  • Figure 2 summarizes di-peptide containing cholesterol siRNA conjugates that were as efficacious or had improved efficacy compared to siRNA with Title compound of Example 16 consisting of the Phe-Lys motif. All these conjugates were significantly more active compared to the "non-cleavable" cholesterol siRNA conjugate SEQ ID NO pair 266/154. The best performing di-peptide containing cholesterol siRNA conjugates had a fluorine modified phenyl ring in the Phy-Lys motif (siRNA with Title compound of Example 8, siRNA with Title compound
  • Example 9 had the phenylalanine substituted with beta- phenylalanine (siRNA with Title compound of Example 11) or a derivative thereof (siRNA with Title compound of Example 10).
  • di-peptide containing cholesterol siRNA conjugates with di-peptide motifs consisting of D-amino acids are performing equal to the non-cleavable control conjugate it is conceivable that the other di-peptide sequences are indeed cleaved by a protease activity in vivo.
  • the broad acceptance of different amino acids and derivatives thereof it is likely that more than one enzyme is participating in the cleavage reaction as suggested in the literature (Bioconjugate Chem. 2002,13,855).
  • the polymer dose was kept constant at 15 mg/kg.
  • the siRNA dose was titrated and the effect on serum ApoB content was measured.
  • the Di-peptide containing cholesterol siRNA conjugates containing the Phe-Lys (F-K) motif was significantly more potent compared to the control conjugate lacking the di-peptide sequence.
  • Example 36 2'-modified oligoribonucleotide synthesis Oligoribonucleotides were synthesized according to the phosphoramidite technology on solid phase. Depending on the scale either an ABI 394 synthesizer (Applied Biosystems) or an AKTA oligopilot 100 (GE Healthcare, Freiburg, Germany) was used. Syntheses were performed on a solid support made of controlled pore glass (CPG, 520A, with a loading of 75 ⁇ /g, obtained from Prime Synthesis, Aston, PA, USA). All 2'-modified RNA phosphoramidites as well as ancillary reagents were purchased from SAFC (Hamburg, Germany).
  • the 2'-Deoxy-2'-fluoro-phosphoramidites carried the same protecting groups as the 2'-(9-methyl RNA amidites. All amidites were dissolved in anhydrous acetonitrile (100 mM) and molecular sieves (3A) were added. To generate the 5'-phosphate the 2-[2-(4,4'-Dimethoxytrityloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)- (N,N-diisopropyl)-phosphoramidite from Glen Research (Sterling, Virginia, USA) was used.
  • Example 37 Cleavage and deprotection of support bound oligomer.
  • Crude oligomers were purified by anionic exchange HPLC using a column packed with Source Q15 (GE Helthcare) and an AKTA Explorer system (GE Helthcare).
  • Buffer A was 10 mM sodium perchlorate, 20 mM Tris, 1 mM EDTA, pH 7.4 (Fluka, Buchs, Switzerland) and contained 20% Acetonitrile and buffer B was the same as buffer A with the exception of 500 mM sodium perchlorate.
  • Example 39 Annealing of oligoribonucleotides to generate siRNA
  • annealing buffer 100 mM NaCl, 20 mM sodium phosphate, pH 6.8
  • siRNAs lacking any 2'-OH residues show potent in vitro knock down activity
  • a panel of EGFP mRNA-targeted siRNAs with different 2 '-modification chemistries SEQ ID pairs 31/32 to 149/150, and see Table 3 for examples.
  • the siRNAs were screened for sense and antisense activity with the Dual-Glo® Luciferase Assay System (Promega) using the psiCHECK2 vector (Promega) in COS7 cells (DSMZ, Braunschweig, Germany, cat. No. ACC-60).
  • Table 3 Exemplary siR A sequences and chemical modifications used for determination of in vitro knock down activity dependent on 2' -modifications. Reference duplices and selected examples of corresponding modification variants used in this study.
  • Xf indicates a 2'-fluoro modification of the nucleotide X, small letters indicate a 2'-0-methyl modification, underlined letters indicate a DNA nucleotide, all other capital letters indicate ribonucleotides.
  • the letter "p" indicates a 5 '-phosphate.
  • IP ion pairing
  • HPLC high performance liquid chromatography
  • ESI electrospray ionization
  • MS mass spectrometry
  • AEX anion exchange
  • UV-detection traces at 260 nm were used for quantitative analysis, MS data served for cleavage site identification within the RNA sequence.
  • A. IP-RP-HPLC was done employing a Waters XBridge Ci 8 column (2.5 x 50 mm, 2.5 ⁇ ⁇ particle size) at 65°C column temperature. Gradient elution was performed using 100 mM hexafluoroisopropanol (HFIP) and 16 niM triethylamine in 1% methanol as eluent A and composition A in 95% methanol as eluent B. A gradient from 1% B to 18% B in 30 minutes was employed.
  • HFIP hexafluoroisopropanol
  • Eluent B contained 1 M NaBr in eluent A. .
  • a gradient from 25 to 62% B in 18 minutes was employed.
  • RNA strands containing at least one 2' -OH nucleotide are rapidly degraded via a cyclic pentavalent intermediate, leading to 2'-3 ' cyclic phosphates at the 5 '-cleavage product.
  • the formation of the pentavalent intermediate can be inhibited using nucleotides lacking a 2'-OH group, like e.g. 2'-deoxy, 2'-OMe or 2'-F.
  • RNA is degraded via a 5'-exonucleolytic pathway, that is independent from the 2' -modification on the 5'-terminal nucleotides.
  • This degradation pathway can be inhibited using 5'-terminal non-nucleotide moieties, like e.g. a C6-aminolinker (e.g. SEQ ID NO 160 in SEQ ID NO pair 160/159 or SEQ ID NO 165 in SEQ ID NO pair 165/166) or a phosphorothioate at the first internucleotide linkage (e.g. SEQ ID NO 160 in SEQ ID NO pair 160/159).
  • 5'-terminal non-nucleotide moieties like e.g. a C6-aminolinker (e.g. SEQ ID NO 160 in SEQ ID NO pair 160/159 or SEQ ID NO 165 in SEQ ID NO pair 165/166) or a phosphorothioate at the first internucleotide linkage (e.g. SEQ ID NO 160 in SEQ ID NO pair 160/159).
  • a 5'-phosphate group slows down the exonucleolytic cleavage kinetics, but can not fully block the degradation starting at this end (e.g. SEQ ID NO 160 in SEQ ID NO pair 160/159). This is most probably due to the cleavage of the 5 '-phosphate by either phosphatases or by an inherent phosphatase activity of the DNase II enzyme.
  • RNA strands were oligonucleotides containing no 2'-OH nucleotide within the strand, starting with a 2'-OMe nucleotide at the 5 '-end connected by a phosphorothioate linkage to the second nucleotide (e.g. SEQ ID NO 173 in SEQ ID NO pair 173/174).
  • Other terminal non-2'-OH nucleotides also protect against the 5'-exo degradation, but to a lower extent compared to the 2'-OMe modification (refer to Table 9)
  • Example 42 In vivo knock down activity of siRNAs devoid of 2'-OH residues
  • FVII mRNA measurements were done from liver homogenates using QuantiGene 1.0 branched DNA (bDNA) Assay Kit (Panomics, Fremont, Calif., USA,Cat-No: QG0004). At necropsy 1-2 g liver tissue was snap frozen in liquid nitrogen. Frozen tissue was powderizedwith mortar and pistil on dry ice. 15-25 mg of tissue was transferred to a chilled 1,5 mL reaction tube, 1 mL 1:3 Lysis Mixture prediluted in MilliQ water and 3,3 ⁇ ⁇ Proteinase K(50 ⁇ g/ ⁇ L) was added and tissue was lysed by several seconds ultrasound sonication at 30-50% power (HD2070, Bandelin, Berlin, Germany).
  • Lysates were stored at -80°C until analysis.
  • lysate was thawed and digested with Proteinase K for 15min at 1000 rpm in a thermomixer at 65 °C (Thermomixer comfort, Eppendorf, Hamburg, Germany).
  • FVII and GAPDH mRNA levels were determined using QuantiGene 1.0 bDNA Assay Kit reagents according to the manufacturer's recommendations.
  • FVII mRNA expression was analyzed using 20 ⁇ ⁇ lysate and a mouse FVII probe set.
  • GAPDH mRNA expression was analysed using 40 lysate and rattus norwegicus probe sets shown to be cross-react with mice (sequences of probesets see above).
  • the siRNA concentration in the liver tissue samples was determined using a proprietary oligonucleotide detection method as described in WO2010043512. Briefly, the siRNA quantification is based on the hybridization of a fluorescently (Atto-425) labeled PNA-probe (Atto425-00-GCAAAGGCGTGCCAACT, obtained from Panagene Inc. Korea) complementary to the antisense strand of the siRNA duplex, followed by AEX-HPLC based separation. Quantification was done by fluorescence detection against an external calibration curve that was generated from a dilution series of the two FVII siRNA used in the in vivo experiment (see example 42). For plasma samples between 0.2 to 2 ⁇ L ⁇ and for tissue ⁇ lmg aliquots were injected onto the HPLC system.
  • Liver tissue analysis of the stabilized siRNA lacking 2'-OH nucleotide showed high concentrations of intact antisense strand in the liver in the ug/g range, but - 95% was present in the 5'-dephosphorylated inactive form (see table IR.04).
  • the resulting RNA with a terminal 2'- OMe nucleotide is not prone for rephosphorylation in the cytoplasm by the phosphokinase hClpl (see below).
  • the antisense strand of the 2' -OH containing siRNA was completely degraded in the tissue within the first 6 hours post dosing.
  • Example 44 In vitro knock down activity of siRNAs with optimized 5'-ends
  • siRNAs that may be intracellularly (re-)phosporylated at the antisense' s 5 '-end to result in the RNAi- competent species
  • All siRNAs from this screen are shown in Table 7.
  • the alternating 2'-OMe / 2'-F modification pattern was identical to the 1 st generation design (without any 2'-OH residues) with exception of various modifications at the first two nucleotides at the 5 '-end of the antisense strand.
  • the two 5 '-terminal nucleotides of the antisense strand were generated as 2'-F or 2'- deoxy modified nucleotides in various combinations with and without an additional 5'-phosphate or 5'-phosphothioate. All siRNAs were screened in dose response (24 nM to 0.00037 nM in 4fold dilutions) for knock down activity after transfection of primary mouse hepatocytes (30000 cells per well; 96 well plate formate) using Lipofectamine 2000 according to the manufacturer's instructions.
  • siRNAs were comparable active to the parental duplex (SEQ ID NO pair 182/168); comparable active siRNAs: SEQ ID NO pairs 181/186 and 181/185) in terms of IC 50 values, one with a 5'-terminal 2'-F and a phosphate group and one with two 5'-terminal 2'- deoxy nucleotides and a 5'-phosphorothioate (see Table 7 for IC50 values). Both of them are ⁇ 5- 6-fold more active compared to the siRNA (SEQ ID NO pair 181/166) used in the first animal experiment with the terminal 2'-OMe nucleotide.
  • Example 45 In vitro 5 '-phosphorylation of siRNAs with optimized 5'-termini All siRNAs without a 5'-phosphate or 5'-phosphorothioate listed in Table 7 were assessed for phosphorylation by hClpl in a HeLa S lOO cell extract.
  • IP-RP-HPLC was done employing a Waters XBridge C 18 column (2.5 x 50 mm, 2.5 ⁇ particle size) at 65°C column temperature. Gradient elution was performed using 100 mM hexafluoroisopropanol (HFIP) and 16 mM triethylamine in 1% methanol as eluent A and composition A in 95% methanol as eluent B. A gradient from 1% B to 18% B in 30 minutes was employed.
  • HFIP hexafluoroisopropanol
  • Eluent B contained 1 M NaBr in eluent A. .
  • a gradient from 25 to 62% B in 18 minutes was employed.
  • the ratio of 5 '-phosphorylation is calculated for each strand of a siRNA from the UV trace at 260nm using the following equitation (PA is peak area):
  • % (5'-phophorylation) 100 * PA [5'-phosphorylated strand] / (PA [5'-phosphorylated strand] + PA [parent strand] )
  • the antisense strand of an siRNA cannot be 5'-phosphorylated, when a 2'-OMe nucleotide is located at the 5'-terminus (SEQ ID NO pair 181/196 and SEQ ID NO pair 181/195).
  • the antisense strand is susceptible to 5 '-phosphorylation, when a 2'-F, 2'- deoxy or 2'-OH nucleotide is incorporated at the 5'-terminus (SEQ ID NO pair 181/195, SEQ ID NO pair 181/192, SEQ ID NO pair 181/197, SEQ ID NO pair 181/199 and SEQ ID NO pair 182/168).
  • the two siRNAs that were comparably active in the in vitro assay as the parental SEQ ID NO pair 182/168 (SEQ ID NO pair 181/186 and 181/185), are susceptible to 5'- phosphorylation once the synthetically introduced 5 '-phosphate / 5'-PTO group is cleaved in vivo, eg. by phosphatases.
  • Table 8 Percentage of 5'-phosphorylated strand after 4 hours incubation in SlOO HeLa cell extract. Key: lower case letters a, c, g, u, are 2'-0-Methyl nucleotides; Upper case letters A, C, G, U followed by "f " indicates a 2'-fluoro nucleotide. (in vdT) represents an inverted deoxythimidine (3 '-3 '-linked). A phosphorothioate linkages is symbolized with a lower case "s". dT is deoxythimidine.
  • All antisense strands were screened for DNAse II stability as described in example 41.
  • the two antisense strands present in the siRNAs that were comparable active to the parental duplex (SEQ ID NO 186 and SEQ ID NO pair 185 one with a 5'-terminal 2'-F and a phosphate group and one with two 5 '-terminal 2'-deoxy nucleotides and a 5'-phosphorthioate are stable towards DNAse II cleavage II (> 70% intact strand after 20 hr incubation).
  • Example 47 In vivo knock down activity of siRNAs with optimized 5' ends
  • siRNAs were administred as under identical conditions as described for the first mouse experiment (example 42, this patent application).
  • FVII levels plasma samples from mice were prepared by collecting blood (9 volumes) by submandibular bleeding into microcentrifuge tubes containing 0.109 mol/L sodium citrate anticoagulant (1 volume) following standard procedures. FVII activity in plasma was measured with a chromogenic method using a BIOPHEN VII kit (Hyphen BioMed/Aniara, Mason, OH) following manufacturer's recommendations. Absorbance of colorimetric development was measured using a Tecan Safire2 microplate reader at 405 nm.
  • Example 48 In vitro knock down activity of siRNAs with optimized 3' ends
  • gcUfgGfaGfuUfcGfuGfaCfcGfcCf(irwdT) 221 dGsGfcGfgUfcAfcGfaAfcUfcCfaGfc(invdT) 0,4377
  • 201 gcUfgGfaGfuUfcGfuGfaCfcGfcCf(invdT) 214 dGsGfcGfgUfcAfcGfaAfcUfcCfaGfcdTsdT 0,1479
  • Table 12 In vitro knock down activity of Ahal -targeting siRNAs with different 3'-ends.
  • siRNAs with 2 nucleotide dTsdT-overhangs on the antisense strand performed always better than those with a single invdT overhang at the antisense' s 3 '-end (while sense strands were the same). Further benefitial was the combination with a sense strand modified with a single invdT-overhang as 3 'overhang.
  • Example 49 In vivo knock down activity of siRNAs in non-human primates
  • DPCs were prepared by covalently attaching polymer "149 RAFT" to the indicated siRNA targeting coagulation Factor VII (siF7) at 4: 1 wt:wt ratio (polymer: siRNA) through a disulfide linkage and then modifying the polymer-siRNA conjugate with a 2: 1 wt:wt mixture of CDM- PEG:CDM-NAG at a 7x wt:wt ratio (CDM:polymer). Cynomolgous monkeys were dosed with 1 mg/kg DPC (polymer weight) and 0.25 mg/kg of the indicated siRNA.
  • mice were given an IM injection containing a combination of ketamine (up to 7 mg/kg) and dexmedetomidine (up to 0.03 mg/kg) and moved to a procedure room.
  • animals were placed on a water jacketed heating pad and the injection site was shaved and prepped with an antiseptic.
  • An intravenous catheter (20 to 22 gauge) was inserted into a systemic vein (cephalic or small saphenous) and the DPC solution was infused (2 ml/kg) slowly over 1 to 2 minutes.
  • a pulse oximeter was used to monitor the heart rate and oxygen saturation during and immediately following the injection procedure. Each injection procedure took about 20 minutes to perform. After injection the catheter was removed and gentle
  • Blood samples (1-5 ml) were obtained for the measurement of gene inhibition (F7 activity, coagulation time), blood chemistries, and markers of liver damage (CBC, chemistry panel, ALT, cytokines, complement).
  • F7 activity coagulation time
  • CBC chemistry panel
  • ALT cytokines, complement
  • animals were given an IM injection containing a combination of ketamine (up to 7 mg/kg) and dexmedetomidine (up to 0.03 mg/kg).
  • animals were moved on to a portable procedure table and a 22 gauge needle and syringe were used to collect blood from the femoral vein.
  • pressure was applied to the venipuncture site and the blood was divided into the appropriate sample tubes for each blood test.
  • Blood samples from non-human primates were prepared by filling serum separator tubes with whole blood and allowing the blood to clot at room temperature for at least 20 minutes. After clotting, blood tubes were centrifuged for 3 minutes at 9000 rpm, aliquoted into eppendorf tubes, and stored at -20 °C until assayed. F7 activity in serum was measured with a chromogenic method using a BIOPHEN VII kit (Hyphen BioMed/Aniara, Mason, OH) following manufacturer' s recommendations. Absorbance of colorimetric development was measured using a Tecan Safire2 microplate reader at 405 nm.
  • Blood samples from non-human primates were prepared by completely filling sodium citrate tubes (BD Vacutainer) with whole blood and gently mixing to prevent clot formation. Tubes were transported to a clinical testing lab within one hour and coagulation assays were performed within 4 hours from the time of collection.
  • BD Vacutainer sodium citrate tubes
  • Example 50 In vivo knock down activity of siRNAs with cleavable RNA linkers
  • Table 14 the in vivo efficacy based on FVII protein inhibition in serum was compared using cholesterol or the GalNAc-palmitoyl siRNA conjugate in the same sequence context in mice.
  • the in vivo experiment was conducted as described in example 42.
  • FVII inhibition was strongly decreased for the cholesterol conjugated siRNAs containing no 2' -OH nucleotide compared to the GalNAc-palmitoyl conjugated counterparts (SEQ ID NO pair 179/166 vs. 179/190, SEQ ID NO pair 257/264 vs. SEQ ID NO pair 179/262, SEQ ID NO pair 257/263 vs.
  • SEQ ID NO pair 179/163 and SEQ ID NO pair 257/166 vs. SEQ ID NO pair 179/166).
  • the cholesterol conjugate lead to higher FVII inhibition compared to the GalNAc-palmitoyl derivative (SEQ ID NO pair 180/168 vs. SEQ ID NO pair 258/168).
  • the small molecule ligands GalNAc-palmitoyl and cholesterol used in the described in vivo experiment are connected to the siRNA via a non-cleavable linker to the 5 '-end of the sense strand.
  • the sense strand exhibit 2'-OH nucleotides the ligand is still cleavable by nucleases (e.g. DNase II in the endosomal or lysosomal compartment).
  • the cleavage reaction releases the free siRNA that is then released into the cytoplasm by the endosomal perturbing activity of the delivery polymer.
  • the ligands are stably connected to the duplex, as no enzymatic (nuclease/protease/esterase etc.) or chemical mechanism triggers the cleavage of the ligand. Therefore, fully stable cholesterol conjugated siRNA can be trapped in cell membranes due to the membrane interaction of the lipophilic cholesterol ligand. Even high concentrations of the siRNA in the tissue is not sufficient for effective release of the siRNA into in the cytoplasm. In contrast, the less lipophilic GalNAc-palmitoyl conjugated siRNA can be released into the cytoplasm, due to a less pronounced interaction with cell membranes.
  • 2'-OH nucleotides can either be implemented by adding single stranded overhangs with at least one 2'-OH-nucleotide at the 3'- or 5 '-end of the RNA strand or by using 2'-OH nucleotides within the duplex region of an siRNA.
  • the enzymatic activity of nucleases present in the endosome / lysosome cleaves selectively at this positions.
  • the cholesterol was connected to the sense strand via a single stranded overhang containing 3 2'-OH nucleotides (AUC) at the 5'-terminus.
  • siRNA with a cholesterol conjugated via a linker according to formula la to the 5'-terminus of the sense strand lead to 93% FVII activity reduction in serum. All results were achieved by co-administration of 15 mg/kg of a delivery polymer with 2.5 mg/kg of the cholesterol conjugated siRNA in mice.
  • cleavable linker improves the in vivo potency of siRNAs containing no 2'-OH nucleotide.
  • the cleavable linker can either comprised of 2'-OH containing nucleotides, a di-peptide cleavage motive or a disulfide linker chemistry. All cleavable linker constructs improve the in vivo potency in a co-administration setup of a cholesterol conjugated siRNAs with a slow endosomal release delivery polymer.
  • Example 51 In vitro serum stability of siRNAs with cleavable linkers The stability of the cleavable linker was evaluated in an in vitro stability assay. The cholesterol conjugated sense strands were incubated in 90% mouse serum at 37°C for various time points. The incubation reaction was stopped by addition of proteinase K in a sodium dodecyl sulfate (SDS) containing buffer- The treatment degrades all proteins and enzymes without interfering with the RNA strand integrity. 25 L of this solution was directly injected onto a AEX-HPLC system connected to a UV detector at 260nm.
  • SDS sodium dodecyl sulfate
  • % (free RNA) 100 * PA [free RNA] / (PA [free RNA] + PA [cholesterol conjugated RNA])
  • the 3nt nucleotide (AUC)-overhang is quantitatively cleaved in less than 1 hour in 90% mouse serum.
  • the cleavage occurs 3' to the two pyrimidine nucleotides in the overhang, leading to two distinct cleavage metabolites (peak areas of metabolites were summarized for data evaluation).
  • the di-peptide containing linker according to formula la the disulfide and the stably linked cholesterol are fully stable in mouse serum.
  • Example 52 Tissue distribution of siRNAs with cleavable linkers
  • the siRNA concentration in the liver tissue samples was determined using a proprietary oligonucleotide detection method as described in WO2010043512. Briefly, the siRNA quantification is based on the hybridization of a fluorescently (Atto-425) labeled PNA-probe (Atto425-00-TGAGTTGGCACGCCTTT obtained from Panagene Inc, Korea) complementary to the sense strand of the siRNA duplex, followed by AEX-HPLC based separation. Quantification was done by fluorescence detection against an external calibration curve that was generated from a dilution series of the two FVII siRNA used in the in vivo experiment (see example 42). For plasma samples between 0.2 to 2 ⁇ ⁇ and for tissue ⁇ lmg aliquots were injected onto the HPLC system.
  • the total amount of cholesterol siRNA conjugate equipped with an (AUC)-linker on the sense strand delivered into the liver is ⁇ 6-fold lower as compared to the stably or the disulfide attached cholesterol and ⁇ 3-fold lower compared to the di-peptide conjugated cholesterol siRNA.
  • the reduced tissue presence can be attributed to the fact that the AUC-linker is not only a substrate for intracellular nucleases, but also for nucleases present in circulation as shown in the in vitro incubation with mouse serum.
  • the cholesterol ligand is cleaved from the siRNA already in circulation the resulting siRNA is prone to renal clearance and is rapidly excreted into urine without delivery into tissue.
  • GGCAACUAC CGCGGGUCU AAGACCCGC UGUAGUUGC
  • GGCAACUACAA CGCGGGUCUUGUA
  • GGCAACUAC CGCGGGUCU dGgdCadAcdTadC pcdGcdGgdGudCudT AAGACCCGC UGUAGUUGC adAgdAcdCcdGcd gdTadGudTgdCcdTsd
  • UGCCCAUCC AGCUCGACC dCCfdTGfdGUfdC pdAGfdCUfdCGfdAC UGGUCGAGC AGGAUGGGC GfdAGfdCUfdTsd fdCAfdGGfdAUfdGG

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicinal Preparation (AREA)
  • Peptides Or Proteins (AREA)
  • Polymers With Sulfur, Phosphorus Or Metals In The Main Chain (AREA)
  • Polyethers (AREA)
  • Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
  • Saccharide Compounds (AREA)

Abstract

The invention provides novel compounds and conjugates of these compounds useful for the delivery of biologically active substances. Further novel design criteria for chemically stabilized siRNA particular useful when covalently attached to a delivery polymer to achieve in vivo mRNA knock down are disclosed therein.

Description

SMALL MOLECULE CONJUGATES FOR INTRACELLULAR DELIVERY OF
BIOLOGICALLY ACTIVE COMPOUNDS
The present invention relates to novel small molecule conjugates useful for the delivery of biologically active substances, such as nucleic acids, peptides and proteins. The delivery of nucleic acids and other substantially cell membrane impermeable compounds into a living cell is highly restricted by the complex membrane system of the cell.
One means that has been used to deliver a biologically active substance such as nucleic acids in vivo has been to attach the biologically active substance to either a small targeting molecule or a hydrophobic molecule such as a lipid or sterol. While some delivery and activity has been observed with these conjugates, the biologically active substance dose required with these methods has been prohibitively large, resulting often in undesired toxicity effects in vivo. Provided herein are small molecule compounds that can be conjugated to a biologically active substance and mediate successful delivery of said biologically active substance into a cell. Surprisingly it has been found that significantly decreased doses of the biologically active substance are now sufficient for successful delivery when using the novel compounds provided herein. Thus, the novel compounds provide a powerful tool for the delivery of biologically active substances with considerably limited toxicity in vivo.
In one embodiment, the present invention is directed to the compounds of formula
Figure imgf000002_0001
(I), wherein
Y is a linker group selected from -(CH2)3- or -C(0)-N-(CH2-CH2-0)P-CH2-CH2-; RSS -(Cl-6) alkyl;
-(CH2)-naphthyl; or
-(CH2)m-phenyl, which phenyl is unsubstituted or up to four times substituted with a substituent independently selected from
-NO2,
-CN,
Halogen,
-0-(CH2)-phenyl,
-0-(Cl-6) alkyl, or
-C(0)-NH2;
R2 is hydrogen;
-(CH2)k-N-C(Ph)3, which phenyl rings are unsubstituted or independently substituted with -0-(Cl-4)alkyl;
-(CH2)k -C(0)-NH2; -(CH2)k -phenyl;
-(Cl-6) alkyl, which is unsubstituted or once substituted with -S-CH3;
R is -NH-phenyl, which phenyl group is further substituted with a substituent independently selected from
-(CH2)-OH; or -(CH2)-0-C(0)-0-(4-nitro-phenyl); k is 1, 2, 3, 4, 5, 6; m is 1, 2, 3 or 4; n is 0 or 1 ; and p is an integer from 1 to 20.
In another embodiment, the compounds of formula (I) may have the specific conformation as shown in formula (la)
Figure imgf000004_0001
wherein all substituents R1, R2, R3 and Y as well as the variables k, m, n, and p have the meaning given above.
In yet another embodiment, the present invention is directed to compounds of formula (I) or (la), wherein Y is -(CH2)3-; and all remaining substituent groups have the meaning given above.
In yet another embodiment, the present invention is directed to compounds of formula (I) or (la), wherein Y is -C(0)-N-(CH2-CH2-0)p-CH2-CH2-; and all substituent groups have the meaning given above.
In yet another embodiment, there are provided the compounds of formulae (I) or (la), wherein Y is -(CH2)3-;
R2 is -(CH2)k-N-C(Ph)3, which phenyl rings are unsubstituted or independently substituted with -0-(C l-4)alkyl; and
R3 is -NH-phenyl, which phenyl group is further substituted with -(CH2)-0-C(0)-0-(4-nitro-phenyl); n is 0; and
R1 and k have the meanings given above.
In yet another embodiment, there are provided the compounds of formulae (I) or (la), wherein
Y is -C(0)-N-(CH2-CH2-0)p-CH2-CH2-;
R2 is -(CH2)k-N-C(Ph)3, which phenyl rings are unsubstituted or independently substituted with -0-(Cl-4)alkyl; and
R3 is -NH-phenyl, which phenyl group is further substituted with -(CH2)-0-C(0)-0-(4-nitro-phenyl); n is 0; and
R1, k and p have the meanings given above.
The term "(CI -6) alkyl" as used herein means a linear or branched, saturated hydrocarbon containing from 1 to 6 carbon atoms. Preferred CI -6 alkyl groups include methyl, ethyl, propyl, iso-propyl, butyl, 2-butyl and the like.
The term "halogen" as used herein means fluorine, chlorine, bromine, or iodine with fluorine and chlorine being preferred.
The compounds according to the present invention can be generally obtained using methods known to the person of ordinary skill in the art of organic- or medicinal chemistry. More particularly the compounds of formula (la), wherein Y is -(CH2)3- and n = 0, can be obtained using compound (A) as starting material.
Figure imgf000006_0001
The synthesis of (A) is described inter alia in WO2001/070415.
The compound of formula (A) is further reacted in the presence of Huenig's base and ethyl acetate (AcOET), followed by the addition of dihydrofuran-2,5-dione in THF, to give the compounds of formula (B)
Figure imgf000006_0002
Figure imgf000006_0003
to give the compounds of formula (la).
The compounds of formula (I) or (la) are useful as ligands on biologically active substances, such as nucleic acids, peptides or proteins, to which they are covalently attached. Preferably, the covalent bond is created by the reaction of a suitable functional group, such as i.e. a primary amine group, in the biologically active substance with the activated carbonyl group in the -O- C(0)-0- moiety of R as defined herein before. Hence provided herein is a conjugate comprising the compounds of formula (I) or (la) and a biologically active substance. The term "biologically active substance" as used herein refers to an inorganic or organic molecule including a small molecule, peptide (e.g. cell penetrating peptides), protein, carbohydrate (including monosaccharides, oligosaccharides, and polysaccharides), nucleoprotein, mucoprotein, lipoprotein, synthetic polypeptide or protein, or a small molecule linked to a protein, glycoprotein, steroid, nucleic acid (any form of DNA, including cDNA, or RNA, or a fragment thereof), nucleotide, nucleoside, oligonucleotides (including antisense oligonucleotides, LNA and siRNA), gene, lipid, hormone, or combination thereof, that causes a biological effect when administered in vivo to an animal, including but not limited to birds and mammals, including humans. Preferably, said biologically active substance is a peptide or a nucleic acid. Preferred nucleic acids used herein are siRNAs.
The conjugate comprising the present compounds covalently attached to a biologically active substance shows an improved ability to be taken up by cells compared to said biologically active substance alone. Once the conjugate is delivered into the cell and trafficking to the lysosome, the corresponding biologically active substance is released by enzymatic cleavage. This cleavage preferably takes place when a di-peptide motif, preferably consisting of the sequence a- or
Figure imgf000007_0001
and lysine as present in the compounds of formula (I) or (la) is incorporated in the conjugate (see scheme 1). Most preferably the conjugate contains the di- peptide motif and a spacer such as the p-aminobenzylcarbamate spacer (Bioconjugate Chem. 2002,13,855) that spontaneously fragments once the amide bond C -terminal of the di-peptide motif is cleaved as exemplified for siRNAs in scheme 2. Hence the conjugates comprising compounds of formula (I) or (la) are also referred to as dipeptide containing cholesterol conjugates. Enzymatic cleavage of the biologically active substance from the dipeptide containing cholesterol conjugates of this invention is catalyzed by innate proteases of the cell. One example of an innate protease capable of cleaving the di-peptide motif present in the compounds of formula (I) or (la) is Cathepsin B. Cathepsin B is a known ubiquitous cysteine protease located in the lysosomes of mammalian cells (Bioconjugate Chem. 2002,13,855; J.Med.Chem. 2005,48,1344; Nat. Biotechnology 2003,21,778). Thus, the di-peptide motif described above is also referred to as Cathepsin-cleavable dipeptide-motif.
The present invention therefore also provides a method for delivery of a biologically active substance, into cells wherein said biologically active substance may subsequently be cleaved off the conjugate to unfold a therapeutic activity. Di-peptide motif with
R1-(phenyl)alanine moiety R2-lysine moiety
Figure imgf000008_0001
enzymatic cleavage with biologically active substance attached in R3
Scheme 1
In a further embodiment of the present invention, there is provided a conjugate of the compounds of formula (I) or (la) covalently attached to a biologically active compound, preferably siRNA or a peptide moiety. Preferably said peptide moiety is a peptide that exhibits membrane perturbing properties like cell penetrating peptides or amphiphilic peptides.
Conjugates of formula (I) or (la) covalently attached to a biologically active substance are designated herein as formula (II) or (Ila), respectively.
Therefore, in a further embodiment, the present invention provides a compound of formula
Figure imgf000008_0002
wherein Ra is -(CH2)k-NH2;
R1 and k have the meanings given for formula (I) above; and the biologically active substance is a nucleic acid, a protein or a peptide.
In a more specific embodiment, the present invention provides compounds of formula
Figure imgf000009_0001
(Ila) wherein
Ra is -(CH2)k-NH2; R1 and k have the meanings given for formula (I) above; and the biologically active substance is a nucleic acid, a protein or a peptide.
In a preferred embodiment, the biologically active substance in formula (II) or (Ila) is a nucleic acid, most preferably a siRNA.
In another preferred embodiment, the biologically active substance in formula (II) or (Ila) is a protein or a peptide.
The compounds of formula (II) or (Ila) may have valuable properties in therapy. Therefore, in a further embodiment, there are provided the compounds of formula (II) or (Ila) for use as medicaments.
Another embodiment of the invention is a pharmaceutical composition comprising the conjugates of the compounds of formula (I) or (la) covalently attached to a biologically active substance. In still another embodiment of the invention there is provided a pharmaceutical composition comprising the compounds of formula (Ila) together with pharmaceutically acceptable excipients.
Below embodiments are exemplified for conjugates of the compounds of formula (I) or (la) covalently attached to siRNA, thus the compounds of formula (II) or (Ila) wherein the biological active substance is siRNA. It is understood that these embodiments are also applicable for other biologically active substances such as peptides and proteins.
The covalent attachment of the siRNA to the compounds of formula (I) or (la) is achieved via reaction of a suitable nucleophilic group, i.e. a primary amine group, in the siRNA with the activated -C(O)- group in R of said compounds of formula (I) or (la). The activation of that -C(O)- group is obtained by a /?-nitrophenoxy carbonate as shown in scheme 2 below. holesterol moie
Figure imgf000010_0001
(scheme 2)
The /?-nitrophenyl activated carbonate may for example be reacted with the siRNA equipped with a hexylamino-linker to generate a carbamate linkage to yield the siRNA conjugate. Once the siRNA is taken up intracellularly and transfected to the lysosome the compounds of formula (II) or (Ila) wherein the biological active substance is siRNA are cleaved by the protease activity releasing the siRNA as also shown in scheme 2. The cholesterol moiety of the conjugate of the compounds of formula (II) or (Ila) modifies the PK properties of siRNA in such a way that systemic administration enables gene silencing in vivo.
Figure imgf000011_0001
+ m CO2 + u [ψK ,-siRNA
Figure imgf000011_0002
Scheme 3
In one embodiment the compounds of formula (II) or (Ila) wherein the biological active substance is siRNA is co-administered with a delivery polymer. Delivery polymers provide a means of disrupting cell membranes and mediate endosomal release. In another embodiment, said delivery polymer and the siRNA conjugate of the invention are not covalently attached and synthesized separately and may be supplied in separate containers or a single container. Delivery polymers for oligonucleotides such as siRNA are well known in the art. For example, Rozema et al., in U.S. Patent Publication 20040162260 demonstrated a means to reversibly regulate membrane disruptive activity of a membrane active polyamine. Reversible regulation provided a means to limit activity to the endosomes of target cells, thus limiting toxicity. Their method relied on reaction of amines on the polyamine with 2-propionic-3-methylmaleic anhydride. This modification converted the polycation to a polyanion via conversion of primary amines to carboxyl-containing groups and reversibly inhibited membrane activity of the polyamine. To enable co-delivery of the nucleic acid with the delivery vehicle, the nucleic acid was covalently linked to the delivery polymer. In US provisional patent application 61/307490 a new generation of delivery polymers is described. Therein, membrane active polyamine comprising an amphipathic terpolymer formed by random polymerization of amine-containing monomers, lower hydrophobic monomers, and higher hydrophobic monomers are provided. This new generation of delivery polymers removed the requirement that polynucleotide and polymer are associated either by covalent linkage or by charge-charge interaction.
Non-limiting examples of delivery polymers used for co-administration with the siRNA conjugates of the invention are membrane active polyamines and poly(vinyl ether) (PBAVE), Dynamic PolyConjugates (DPC; Rozema et al. 2007) and improved DPCs as disclosed in US provisional patent application 61/307490.
In a further embodiment, a new chemical siRNA modification pattern for functional in vivo delivery is provided. This new chemical siRNA modification pattern is especially useful with delivery vehicles which display a relatively strong endosomal / lysosomal retention. It was found that siRNA stabilization against degradation by endosomal / lysosomal-localized nucleases such as DNAse II strongly improves target knock down. Such stabilization may directly effect the amount of siRNA released into the cytoplasm where the cellular RNAi machinery is located. Only the siRNA portion available in the cytoplasm will trigger the RNAi effect. In addition to poor pharmacokinetic characteristics, siRNAs are susceptible to nucleases in the biological environment when administered as such into the circulation without a protecting delivery vehicle. Accordingly, many siRNAs are rapidly degraded either extracellularly in the tissue and blood stream or after intracellular uptake (endosome).
One well known nuclease localized in the endosomal / lysosomal compartment is DNase II. This enzyme is active at a pH below 6-6.5 with maximum activity in the pH-range of 4.5-5, reflecting conditions present in the acidified environment of the endosomal/ lysosomal compartment. The following RNA degradation pathways induced by DNase II were identified in vitro and are disclosed in this invention:
A. RNA strands containing at least one 2' -OH nucleotide are rapidly degraded via a cyclic pentavalent phosphorus intermediate, leading to 2'-3' cyclic phosphates at the 5'-cleavage product. The formation of the pentavalent intermediate can be inhibited by nucleotides lacking a 2'-OH group such as 2'-deoxy, 2'-<9-methyl (2'-OMe)or 2'-deoxy-2'-fluoro (2'-F) nucleotides.
B. Additionally, RNA is degraded in a 5'-exonucleolytic pathway independent of the 2'- modification on the 5 '-terminal nucleotides. This degradation pathway can be inhibited by 5'- terminal non-nucleotide moieties, like e.g. cholesterol, aminoalkyl-linker or a phosphothioate at the first internucleotide linkage.
C. A 5'-phosphate also protects and slows down the exonucleolytic cleavage kinetics, but can not fully block this pathway. This is most probably due to the cleavage of the 5 '-phosphate by phosphatases or an inherent phosphatase activity of the DNase II enzyme preparation used in the stability assay.
D. The best protection was achieved with oligonucleotides lacking any 2'-OH nucleotide within the strand, starting with a 2'-OMe nucleotide at the 5 '-end connected by a phosphorothioate (PTO) linkage to the second nucleotide. Other terminal non-2'-OH nucleotides also protect against the 5'-exo degradation, but to a lower extent compared to the 2'-OMe modification.
Hence the inventors of the present invention found that siRNAs can be significantly stabilized when using the following design, wherein an oligonucleotide is provided with an antisense strand with the modification pattern: 5'-(w)- (Zl)- (Z2)- (Z3)na-3' and a sense strand with the modification pattern 5'- (Z3)n s-3' , wherein w is independently a 5 '-phosphate or 5 '-phosphothioate or H,
Zl is independently a 2' -modified nuleoside.
Z2 is independently a 2'-deoxy nucleoside or 2'-Fluoro-modified nucleoside, Z3 is independently a 2' -modified nucleoside, na is 8-23 and ns is 8-25. In one preferred embodiment an oligonucleotide is provided with an antisense strand with the modification pattern: 5'-(w)- (Zl)- (Z2)- (Z3) na -3' and a sense strand with the modification pattern 5'- (Z3) ns -3' , wherein Zl is a a 2'-Fluoro-modified nucleoside or a 2deoxy-nucleoside and all remaining substituents as well as the variables na and ns have the meaning given above.
In one preferred embodiment an oligonucleotide is provided with an antisense strand with the modification pattern: 5'-(w)- (Zl)- (Z2)- (Z3) na -3' and a sense strand with the modification pattern 5'- (Z3) ns -3' , wherein Z3 is a 2'-OMethyl modified nucleoside, a 2'-Fluoro-modified nucleoside or a 2deoxy-nucleoside and all remaining substituents as well as the variables na and ns have the meaning given above. In one preferred embodiment an oligonucleotide is provided with an antisense strand with the modification pattern: 5'-(w)- (Zl)- (Z2)- (Z3) na -3' and a sense strand with the modification pattern 5'- (Z3) ns -3' , wherein Zl is a a 2'-Fluoro-modified nucleoside or a 2deoxy-nucleoside and Z3 is a 2'-0-Methyl modified nucleoside, a 2'-Fluoro-modified nucleoside or a 2deoxy- nucleoside and all remaining substituents as well as the variables na and ns have the meaning given above.
The nucleosides in the nucleic acid sequence of the oligonucleotice with the novel modification pattern can either be linked by 5 '-3' phosphodiesters or 5 '-3' phosphorothioates.
As used herein, the "anti-sense" strand is the siRNA strand that is complementary to the target mRNA and that will be binding to the mRNA once the siRNA is unwound.
The sense strand of said siRNA comprising the novel modification pattern is complimentary to the antisense strand.
Said siRNA comprising the novel modification pattern proofed to be particularly advantageous when covalently attached to a delivery polymer as exemplified by Rozema et al. (Dynamic PolyConjugates (DPC; Rozema et al. 2007). Potency and duration of effect can be significantly enhanced employing the siRNA modification strategy outlined in this invention.
In another embodiment, said siRNA comprising the novel modification pattern are especially useful when conjugated to small molecules that alter the pharmacokinetic properties of siRNA such as cholesterol or the compounds of formula (I) and (la) provided herein. In one embodiment a conjugate of a small molecule and an oligonucleotide is provided wherein the oligonucleotide has the following modification pattern: the antisense strand with the modification pattern: : 5'-(w)- (Zl)- (Z2)- (Z3) na -3' and a sense strand with the modification pattern 5'- (Z3) ns -, wherein the substituents as well as the variables na and ns have the meaning given above. In one embodiment said small molecule is cholesterol. In another embodiment said small molecule is a compound of formula (I) or (I a), resulting in compounds of formula (II) or (Ila).
Preferably, said siRNAs conjugates are co-administered with a delivery polymer. Suitable delivery polymers are described above. In one embodiment, said siRNA comprising the novel modification pattern are especially useful when conjugated to a ligand that is known to bind to a specific receptor which internalizes the conjugate into a cell. Particularly, the asialoglycoprotein receptor (ASGPR) expressed on hepatocytes is a well known receptor enabling the clearance (endocytosis and lysosomal degradation) of desialylated proteins from circulation. It has been shown that the N-Acetyl-D- galactosamine has a high binding affinity for the receptor, especially when presented multivalent and when the galactose residues are properly spaced (J Biol Bhem, 2001, 276, 37577). In order to utilize this high capacity receptor for receptor mediated endocytosis of the biologically active substance, the synthetic ligand shown below was prepared to be covalently attached to the siRNAs comprising the novel modification pattern. Since this type of endocytosis leads to lysosomal degradation of the internalized material the siRNA must be prepared in such a way that it is stable in the lysosome, which is now solved by the novel modification pattern outlined above.
The ligand for the ASGPR is attached via an amid bond to the biologically active substance. The amid bond formation can be established with the aid of NHS chemistry. The ligand employed in the conjugation reaction is shown below (formula III). For interaction with the ASGPR the O- acetate groups need to be removed as shown in (formula IV) for an siRNA.
Figure imgf000015_0001
(Ill)
Figure imgf000016_0001
In one embodiment of the invention, a conjugate of a compound of formula IV and an oligonucleotide is provided, wherein the oligonucleotide has the following modification pattern: the antisense strand with the modification pattern 5'-(w)- (Zl)- (72)- (73) na -3' and a sense strand with the modification pattern 5'- (Z3) ns -, wherein the substituents as well as the variables na and ns have the meaning given above. Said conjugate is also referred to as GalNAc palmitoyl conjugate. Preferably, said GalNAc palmitoyl conjugate are co-administered with a delivery polymer. Suitable delivery polymers are described above.
It was found that for these modification patterns cleavable linkers proofed to be advantageous compared to stably linked small molecule ligands. Possible cleavable linkersare a di-peptide motifas exemplified in scheme 1 or a cleavable RNA-linker comprising 2' -OH containing nucleotides. The cleavable RNA-linker is especially useful in connection with the siRNAs having the novel modification pattern (fully 2' -modified siRNA) described above.
In principle a nuclease cleavage site can be introduced by 3'- or 5 '-overhangs containing at least one 2' -OH nucleotide at either the sense or the antisense strand. The final active siRNA species is generated by intracellular nuclease processing. Also, the use of defined cleavage sites implemented by 2' -OH nucleotides within the base paired region is possible. This can be done using at least one 2' -OH nucleotide complementary to the opposite strand or by introduction of either at least one mismatched 2'-OH nucleotide or a hairpin/bulge containing at least one 2'-OH nucleotide.
In contrast to other cleavable linker chemistries the use of defined cleavage sites by introduction of 2'-OH nucleotides lead to a more versatile conjugation approach. By introducing selective cleavage sites on one or on both strands of the siRNA either at the 3' and / or the 5 '-end or within the duplex structure, multiple conjugation is possible.
Accordingly, in one embodiment, a conjugate of a small molecule and an oligonucleotide is provided wherein
a) the small molecule comprises a nucleotide linker comprising 1-10 preferably 1-5, most preferably 1-3 2'OH-nucleotides;
b) the oligonucleotide has the following modification pattern: the antisense strand with the modification pattern 5'-(w)- (Zl)- (Z2)- (Z3) na -3' and a sense strand with the modification pattern 5'- (Z3) ns -, wherein the substituents as well as the variables na and ns have the meaning given above; and
c) the oligonucleotide is covalently attached to the nucleotide linker of the small molecule .
The nucleotide linker is cleaved by intracellular nucleases such as DNAse II after internalization of the conjugate into the endosome, thus releasing the siRNA. Preferably, said conjugate is co-administered with a delivery polymer. Suitable delivery polymers are described above.
In another embodiment of the invention a compound of formula (V) is provided. This compound comprises a cholesterol moiety, anda nucleotide linker comprising 1-10 preferably 1- 5, most preferably 1-3 2'OH-nucleotides. This nucleotide linker is useful for covalently attaching an oligonucleotide such as a siRNA to the compound of formula (V). Preferably, said oligonucleotide has the novel modification pattern outlined above. Hence in another embodiment a conjugate of a compound of formula (V) and an oligonucleotide is provided, wherein the oligonucleotide is covalently attached to the nucleotide linker of the compound of formula (V). The nucleotide linker is cleaved by intracellular nucleases such as DNAse II after internalization of the conjugate of a compound of formula (V) and an oligonucleotide into the endosome, thus releasing the siRNA.
Figure imgf000018_0001
R = nucleotide linker
(V)
Preferably, said conjugate of a compound of formula (V) and an oligonucleotide is coadministered with a delivery polymer. Suitable delivery polymers are described above.
In another embodiment, said delivery polymer and the conjugate of a compound of formula (V) and an oligonucleotide of the invention are not covalently attached and synthesized separately and may be supplied in separate containers or a single container.
Definitions
The term "small molecule" as used herein, refers to organic or inorganic molecules either synthesized or found in nature, generally having a molecular weight less than 10,000 grams per mole, optionally less than 5,000 grams per mole, and optionally less than 2,000 grams per mole.
The term "peptide" as used herein refers to any polymer compound produced by amide bond formation between an .alpha.-carboxyl group of one D- or L-amino acid and an .alpha.- amino group of another D- or L-amino acid. The term "protein" as used herein refers to polypeptides of specific sequence of more than about 50 residues. The term "di-peptide motif" as used herein refers to any motif comprising an amide bond formed by either the D- or L-alpha or beta amino group of a first amino acid with the alpha- carboxyl group of a second D- or L-amino acid.
As used herein, the term "amino acid" refers to any molecule that contains both amine and carboxyl functional groups. Thus the term "amino acid" refers to both natural, non- natural and synthetic amino acids. Any natural amino acids used in the present invention are referred to herein by their common abbreviations.
The term "ligand" as used herein refers to a moiety that is capable of covalently or otherwise chemically binding a biologically active substance. The term "ligand" in the context of the invention is preferably a compound of formula (I) or (la) covalently attached to a biologically active substance.
The term "biologically active substance" as used herein refers to an inorganic or organic molecule including a small molecule, peptide (e.g. cell penetrating peptides), protein, carbohydrate (including monosaccharides, oligosaccharides, and polysaccharides), nucleoprotein, mucoprotein, lipoprotein, synthetic polypeptide or protein, or a small molecule linked to a protein, glycoprotein, steroid, nucleic acid (any form of DNA, including cDNA, or RNA, or a fragment thereof), nucleotide, nucleoside, oligonucleotides (including antisense oligonucleotides, LNA and siRNA), gene, lipid, hormone, or combination thereof, that causes a biological effect when administered in vivo to an animal, including but not limited to birds and mammals, including humans. Preferably, said biologically active substance is a peptide or a nucleic acid. Preferred nucleic acids used herein are siRNAs.
The term "nucleic acid" as used herein means an oligomer or polymer composed of nucleotides, e.g., deoxyribonucleotides or ribonucleotides, or compounds produced synthetically (e.g., PNA as described in U.S. Pat. No. 5,948,902 and the references cited therein) which can hybridize with naturally occurring nucleic acids in a sequence specific manner analogous to that of two naturally occurring nucleic acids, e.g., can participate in Watson-Crick base pairing interactions. Non-naturally occurring nucleic acids are oligomers or polymers which contain nucleobase sequences which do not occur in nature, or species which contain functional equivalents of naturally occurring nucleobases, sugars, or inter-sugar linkages, like peptide nucleic acids (PNA), threose nucleic acids (TNA), locked nucleic acids (LNA), or glycerol nucleic acids (GNA). This term includes oligomers that contain the naturally occurring nucleic acid nucleobases adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U), as well as oligomers that contain base analogs or modified nucleobases. Nucleic acids can derive from a variety of natural sources such as viral, bacterial and eukaryotic DNAs and RNAs. Other nucleic acids can be derived from synthetic sources, and include any of the multiple oligonucleotides that are being manufactured for use as research reagents, diagnostic agents or potential and definite therapeutic agents. The term includes oligomers comprising of a single strand nucleic acid or a double strand nucleic acid.
The term "2' -modified" as used herein refers to a β-D-ribonucleoside or β-D- ribonucleotide comprising of naturally occurring nucleobases having the 2'-OH group replaced by H, F, 0-CH3 or other substituents known in the art.
The term "2' -OH -nucleotide" as used herein refers to β-D-ribonucleotide comprising of naturally occurring nucleobases having a 2'-OH group.
The term "5 '-phosphate" as used herein refers to the formula -0-P(=0)(OH)OH. In another aspect the phosphate is modified that one of the O or OH groups is replaced by S and termed herein as "5'-phosphothioate"
The term "phosphorothioate" as used herein refers to a internucleotide linkage in which one of the non-bridging oxygens is replaced by sulfur.
The term "delivery polymer" as used herein refers to polymers suitable for functional delivery of a biologically active substance. In the context of the present invention the delivery polymer is either covalently attached to or coadministered with the biologically substance conjugated to the compounds described herein and mediates endosomal escape after internalization into the cell and uptake into the endosome. The term "polymer" in this context means any compound that is made up of two or more monomelic units covalently bonded to each other, where the monomelic units may be the same or different, such that the polymer may be a homopolymer or a heteropolymer. Representative polymers include peptides, polysaccharides, nucleic acids and the like, where the polymers may be naturally occurring or synthetic. Non-limiting examples of delivery polymers are for example reviewed in INTERNATIONAL JOURNAL OF PHARMACEUTICAL RESEARCH AND DEVELOPMENT, October - 2010 / Volume - 2 / Issue - 8 / Article No -2. Non-limiting examples of delivery polymers useful for delivery of nucleic acids are disclosed in EP applications 10165502.5 and 10191030.5, PCT publication WO 2008/0022309 and US provisional application 61/307490 and references cited herein; which are all included by reference.
As used herein, "pharmaceutical composition" includes the conjugates of the invention, a pharmaceutical carrier or diluent and any other media or agent necessary for formulation.
As used herein, "pharmaceutical carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. Preferably, the carrier is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g. by injection or infusion).
A conjugate of the present invention can be administered by a variety of methods known in the art. As will be appreciated by the skilled artisan, the route and/or mode of administration will vary depending upon the desired results. To administer a conjugate of the invention by certain routes of administration, it may be necessary to coat the conjugate with, or co-administer the conjugate with, a material to prevent its inactivation. For example, the conjugate may be administered to a subject in an appropriate carrier or a diluent. Pharmaceutically acceptable diluents include saline and aqueous buffer solutions. Pharmaceutical carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. The use of such media and agents for pharmaceutically active substances is known in the art.
The phrases "parenteral administration" and "administered parenterally" as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion.
These carrier may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of presence of microorganisms may be ensured both by sterilization procedures, supra, and by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol, sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin. Regardless of the route of administration selected, the conjugates of the present invention, which may be used in a suitable hydrated form, and/or the pharmaceutical compositions of the present invention, are formulated into pharmaceutically acceptable dosage forms by conventional methods known to those of skill in the art.
Actual dosage levels of the active ingredients in the pharmaceutical compositions of the present invention may be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient. The selected dosage level will depend upon a variety of pharmacokinetic factors including the activity of the particular compositions of the present invention employed, the route of administration, the time of administration, the rate of excretion of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compositions employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.
The pharmaceutical composition must be sterile and fluid to the extent that the composition is deliverable by syringe. In addition to water, the carrier preferably is an isotonic buffered saline solution.
Proper fluidity can be maintained, for example, by use of coating such as lecithin, by maintenance of required particle size in the case of dispersion and by use of surfactants. In many cases, it is preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol or sorbitol, and sodium chloride in the composition. Short description of the figures
Figure 1 shows Co-Administration of siRNA-conjugates comprising the compounds of formula (I) or (la) and a delivery polymer in vivo. Figure 2 shows Co-Administration of siRNA-conjugates comprising the compounds of formula (I) or (la) and a delivery polymer in vivo.
Figure 3 shows Co- Administration of siRNA-conjugates comprising the compounds of formula (I) or (la) and a delivery polymer in vivo.
Figure 4 shows Co-Administration of siRNA-conjugates comprising the compounds of formula (I) or (la) and a delivery polymer in vivo.
Figure 5a shows antisense strand mediated gene silencing with fully 2' -modified siRNAs. COS7 cells were cotransfected with EGFP-directed siRNAs at 3 nM and psiCHECK2-AT. The knockdown activity of the siRNAs was assessed by measuring renilla versus firefly luciferase activity from the reporter construct. siRNAs were sorted by knockdown activity of unmodified (2-19-2) reference siRNAs. Figure 5b shows sense strand mediated gene silencing with fully 2'-modified siRNAs. COS7 cells were cotransfected with EGFP-directed siRNAs at 3 nM and psiCHECK2-ST. The knockdown activity of the siRNAs was assessed by measuring luciferase expression from the reporter construct. siRNAs were sorted by knockdown activity of unmodified (2-19-2) reference siRNAs.
Figure 6a shows reduction of serum FVII activity in non-human primates upon intravenous injection of various 2' -modified siRNAs covalently attached to a delivery polymer.
Figure 6b shows the development of the prothrombin time in non-human primates upon treatment with 2' -modified siRNAs covalently conjugated to a delivery polymer.
The invention will be more fully understood by reference to the following examples. They should not, however, be construed as limiting the scope of the invention. Examples
Example 1
Step 1: 3-[(3S,8S,9S,10R,13R,14S,17R)-17-(( )-l,5-Dimethyl-hexyl)-10,13-dimethyl- 2,3,4,7,8,9,10, 11,12,13,14,15,16, 17-tetradecahydro-lH-cyclopenta[a]phenanthren-3-yloxy]- propylamine
Chiral
Figure imgf000024_0001
The title amine was prepared from its nitrile precursor according to a literature protocol [ Lollo et al , WO2001/070415].
Step 2: N-{3-[(3S,8S,9S,10R, 13R,14S,17R)-17-((R)-l,5-Dimethyl-hexyl)-10,13-dimethyl- 2,3,4,7,8,9,10, l l,12,13,14,15,16,17-tetradecahydro-lH-cyclopenta[fl]phenanthren-3-yloxy]- propylj-succinamic acid
Figure imgf000024_0002
In a 2 L round-bottomed flask, 3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6- methylheptan-2-yl)-2,3,4,7,8,9,10,l 1,12,13, 14,15,16,17-tetradecahydro-lH- cyclopenta[a]phenanthren-3-yloxy)propan-l-amine (21.15 g, 47.7 mmol, Eq: 1.00) and Huenig's base (12.3 g, 16.6 ml, 95.3 mmol, Eq: 2.00) were combined with AcOEt (845 ml) to give a colorless solution. Dihydrofuran-2,5-dione (4.77 g, 47.7 mmol, Eq: 1.00) in THF (42 ml) was added and the reaction mixture was stirred at ambient temperature over night => white suspension. All volatiles were removed i. v., the residue dissolved in CH2C12, the organic layer washed with NH4C1 and brine, dried over Na2S04, and evaporated to dryness. The crude product was dissolved in CH3CN / H20 and lyophilized to yield 29.8 g of the title compound as fluffy powder.
MS (ISP): (M-H) 542.5.
Step 3: Nl-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-Dimethyl-17-((R)-6-methylheptan-2-yl)- 2,3,4,7,8,9,10, 11,12,13, 14.15, 16, 17-tetradecahydro-lH-cyclopenta[a]phenanthren-3- yloxy)propyl)-N4-((S)-l-((S)-l-(4-(hydroxymethyl)phenylamino)-6-((4- methoxyphenyl)diphenylmethylamino)-l-oxohexan-2-ylamino)-3-(4-nitrophenyl)-l-oxopropan- 2-yl) succinamide
Chiral
Figure imgf000025_0001
In a 10 mL round-bottomed flask, the above prepaed 4-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13- dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,l 1,12,13, 14,15,16,17-tetradecahydro-lH- cyclopenta[a]phenanthren-3-yloxy)propylamino)-4-oxobutanoic acid (106 mg, 184 μηιοΐ, Eq: 1.00), (S)-2-((S)-2-amino-3-(4-nitrophenyl)propanamido)-N-(4-(hydroxymethyl)phenyl)-6-((4- methoxyphenyl)diphenylmethylamino)hexanamide (132 mg, 184 μmol, Eq: 1.00), HOAt (25.0 mg, 184 μηιοΐ, Eq: 1.00) and EDC hydrochloride (35.3 mg, 184 μιηοΐ, Eq: 1.00) were mixed together in CH2C12 (1.8 ml) to give a yellow solution. Huenig'sBase (47.5 mg, 64.2 μΐ, 368 μιηοΐ, Eq: 2.00) was added and the reaction stirred at ambient temperature over night. TLC indicated the consumption of starting material. All volatiles were removed i. V. and the crude product purified by flash chromatography Si02 / 7% MeOH / 0.1% NEt3 in CH2C12 to produce 128 mg of the title compound as light yellow solid.
MS: expected mass: 1240.7552, found mass: 1240. 7518. Step 4:
Chiral
Figure imgf000026_0001
In a 10 mL round-bottomed flask, the above prepared Nl-(3-((3S,8S,9S,10R,13R,14S,17R)- 10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,l 1,12,13, 14,15, 16,17- tetradecahydro-lH-cyclopenta[a]phenanthren-3-yloxy)propyl)-N4-((S)-l-((S)- l-(4- (hydroxymethyl)phenylamino)-6-((4-methoxyphenyl)diphenylmethylamino)-l-oxohexan-2- ylamino)-3-(4-nitrophenyl)-l-oxopropan-2-yl)succinamide (126 mg, 101 μιηοΐ, Eq: 1.00) and Huenig's base (39.3 mg, 53.2 μΐ, 304 μιηοΐ, Eq: 3.00) were combined with CH2C12 (1.4 ml) and DMF (1.0 ml) to give a yellow suspension; bis(4-nitrophenyl) carbonate (46.3 mg, 152 μιηοΐ, Eq: 1.50) was added and the reaction allowed to proceed over night. The mixture was poured onto crashed ice, extracted 2 x with AcOEt, washed with H20, dried over Na2S04, and evaporated to dryness. After trituration with -10 ml of diethyl ether, 99 mg of the title product was obtained as an off-white solid. MS: expected mass: 1405.7614, found mass: 1405.7518. The necessary dipeptide building block for step 3 was prepared as follows:
Step a: (S)-2-[(S)-2-(9H-Fluoren-9-ylmethoxycarbonylamino)-3-(4-nitro-phenyl)- propionylamino] -6- { [(4-methoxy-phenyl)-diphenyl-methyl] -amino } -hexanoic acid
Chiral
Figure imgf000027_0001
In a 25 mL round-bottomed flask, (S)-2-amino-6-((4-methoxyphenyl)diphenylmethyl- amino)hexanoic acid (Bioconjugate Chem. 2002, 13, 855-869, 968 mg, 2.31 mmol, Eq: 1.00) was dissolved in CH2C12 (20 ml) to give a light yellow solution. Huenig's base (897 mg, 1.21 ml, 6.94 mmol, Eq: 3.00) and trimethylchlorosilane (528 mg, 621 μΐ, 4.86 mmol, Eq: 2.10) were added and the reaction mixture was stirred for 15 min.
In a second 50 mL round-bottomed flask,(S)-2-(((9H-fluoren-9-yl)methoxy)carbonylamino)-3- (4-nitrophenyl)propanoic acid (1 g, 2.31 mmol, Eq: 1.00) was dissolved in DMF (20 ml) to give a colorless solution.Huenig's base (359 mg, 485 μΐ, 2.78 mmol, Eq: 1.20) and TPTU [125700-71- 2] (687 mg, 2.31 mmol, Eq: 1.00) were added and the reaction mixture was stirred for 20'. The solution from the first flask containing the corresponding silyl ester mono silyl amine was added and the reaction was stirred for another 3 hours. The mixture was poured onto crashed ice / NH4C1, extracted 2 x with AcOEt, washed with H20 and brine, dried over Na2S04, and evaporated to dryness. Flash chromatography Si02 / 10% MeOH / 0.1 % NEt3 in CH2C12 afforded 1.38 g of the title compound as brownish foam.
MS (ISP): (M+H) 833.5, (M+Na) 855.4. Step b: [(S)- l-((S)- l-(4-Hydroxymethyl-phenylcarbamoyl)-5-{ [(4-methoxy-phenyl)-diphenyl- methyl] -amino }-pentylcarbamoyl)-2-(4-nitro-phenyl)-ethyl]-carbamic acid 9H-fluoren-9- ylmethyl ester
Chiral
Figure imgf000028_0001
In a 250 mL pear-shaped flask, the above synthesized (S)-2-((S)-2-(((9H-fluoren-9- yl)methoxy)carbonylamino)-3-(4-nitrophenyl)propanamido)-6-((4-methoxyphenyl)diphenyl- methylamino)hexanoic acid (1.38 g, 1.66 mmol, Eq: 1.00), (4-aminophenyl)methanol (204 mg, 1.66 mmol, Eq: 1.00), HO At (226 mg, 1.66 mmol, Eq: 1.00) and EDC hydrochloride (318 mg, 1.66 mmol, Eq: 1.00) were dissolved in CH2C12 ( 16.6 ml) to give a yellow solution. Huenig's base (428 mg, 579 μΐ, 3.31 mmol, Eq: 2.00) was added and the reaction allowed to proceed over night. The mixture was poured onto crashed ice / NH4C1 (pH ~7), extracted 2 x with AcOEt, washed with H20, dried over Na2S04, and evaporated to dryness. The crude product was triturated with diethyl ether (1 x 50 mL); the resultant solid was filtered off and dryed to yield 1.214 g of the title compound as light-brown solid. MS (ISP): (M+H) 938.7.
Step c: (S)-2-[(S)-2-Amino-3-(4-nitro-phenyl)-propionylamino]-6-{ [(4-methoxy-phenyl)- diphenyl-methyl] -amino }-hexanoic acid (4-hydroxymethyl-phenyl)-amide Chiral
In a 50 mL round-bottomed flask, the above prepared [(S)- l-((S)- l-(4-hydroxymethyl- phenylcarbamoyl)-5-{ [(4-methoxy-phenyl)-diphenyl-methyl] -amino }-pentylcarbamoyl)-2-(4- nitro-phenyl)-ethyl]-carbamic acid 9H-fluoren-9-ylmethyl ester (1.214 g, 1.29 mmol, Eq: 1.001) was combined with THF (19 ml) to give a brown solution. At 0°, diethylamine (1.77 g, 2.49 ml, 24.2 mmol, Eq: 18.70) was added. The reaction was stirred at ambient temperature for 3h when MS indicated the disappearance of the starting material. All volatiles were evaporated i. V.; ensuing flash chromatography Si02 / 0.1% NEt3 in CH2C12 => 10% MeOH / 0.1% NEt3 in CH2C12, followed by a second flash chromatography Si02 / 5% MeOH / 0.1% NEt3 in CH2C12 afforded 502 mg of the title compound as light brown foam.
MS: expected mass: 715.337, found mass: 715.3362.
Example 2
0-Benzyl-N-[4-( { 3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-tyrosyl- N~6~- [(4-methoxyphenyl)(diphenyl)methyl]-N- [4-( { [(4- nitrophenoxy)carbonyl]oxy } methyl)phenyl] -L-ly sinamide
Chiral
Figure imgf000030_0001
Was prepared in analogy to Example 1, but using in step 3 (S)-2-[(S)-2-amino-3-(4-benzyloxy- phenyl)-propionylamino]-6- { [(4-methoxy-phenyl)-diphenyl-methyl] -amino }-hexanoic acid (4- hydroxymethyl-phenyl)-amide instead of (S)-2-((S)-2-amino-3-(4-nitrophenyl)propanamido)-N- (4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenyl-methylamino)hexanamide as coupling partner. The former was prepared from (S)-2-(((9H-fluoren-9- yl)methoxy)carbonylamino)-3-(4-(benzyloxy)phenyl)propanoic acid as described above in steps
MS: expected mass: 1466.8182, found mass: 1466.8136. Example 3
N-[4-({3-[(3Beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-4-cyano-L- phenylalanyl-N~6~-[(4-methoxyphenyl)(diphenyl)methyl]-N-[4-({ [(4- nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-lysinamide
Figure imgf000031_0001
Was prepared in analogy to Example 1, but using in step 3 (S)-2-[(S)-2-amino-3-(4-cyano- phenyl)-propionylamino]-6-{ [(4-methoxy-phenyl)-diphenyl-methyl] -amino }-hexanoic acid (4- hydroxymethyl-phenyl)-amide instead of (S)-2-((S)-2-amino-3-(4-nitrophenyl)-propanamido)-N- (4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenyl-methylamino)hexanamide as coupling partner. The former was prepared from (S)-2-(((9H-fluoren-9- yl)methoxy)carbonylamino)-3-(4-cyanophenyl)propanoic acid as described above in steps a] - c].
MS: expected mass: 1385.7716, found mass: 1385.7696. Example 4
3,4-Dichloro-N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L- phenylalanyl-N~6~-[(4-methoxyphenyl)(diphenyl)methyl]-N-[4-({ [(4- nitrophenoxy)carbonyl] oxy } methyl)phenyl] -L-ly sinamide
Figure imgf000032_0001
Was prepared in analogy to Example 1, but using in step 3 (S)-2-[(S)-2-amino-3-(3,4-dichloro- phenyl)-propionylamino]-6-{ [(4-methoxy-phenyl)-diphenyl-methyl] -amino }-hexanoic acid (4- hydroxymethyl-phenyl)- amide instead of (S)-2-((S)-2-amino-3-(4-nitrophenyl)-propanamido)- N-(4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenyl-methylamino)hexanamide as coupling partner. The former was prepared from (S)-2-(((9H-fluoren-9- yl)methoxy)carbonylamino)-3-(3,4-dichlorophenyl)propanoic acid as described above in steps a] - c] .
MS: expected mass: 1428.6984, found mass: 1428.695. Example 5
4-Chloro-N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L- phenylalanyl-N~6~- [(4-methoxyphenyl)(diphenyl)methyl] -N- [4-( { [(4- nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-lysinamide
Figure imgf000033_0001
Was prepared in analogy to Example 1, but using in step 3 (S)-2-((S)-2-amino-3-(4- chlorophenyl)propanamido)-N-(4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenyl- methylamino)hexanamide instead of (S)-2-((S)-2-amino-3-(4-nitrophenyl)-propanamido)-N-(4- (hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenyl-methylamino)hexanamide as coupling partner. The fomier was prepared from (S)-2-(((9H-fluoren-9-yl)methoxy)-carbonylamino)-3-(4- chlorophenyl)propanoic acid as described above in steps a] - c].
MS: expected mass: 1394.7373, found mass: 1394.7342. Example 6
4-{ [(2S)-2-{ [(2S)-2-[(4-{ [3-({(3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-[(2R)-6- methylheptan-2-yl]-2,3,4,7,8,9,10,l 1,12,13, 14,15,16,17-tetradecahydro-lH- cyclopenta[a]phenanthren-3-yl }oxy)propyl] amino } -4-oxobutanoyl)amino] -3-(naphthalen- 1 - yl)propanoyl] amino } -6- { [(4-methoxyphenyl)(diphenyl)methyl] amino }hexanoyl] amino jbenzyl 4-nitrophenyl carbonate (non-preferred name)
Figure imgf000034_0001
Was prepared in analogy to Example 1, but using in step 3 (S)-2-((S)-2-amino-3-naphthalen-l- yl-propionylamino)-6-{ [(4-methoxy-phenyl)-diphenyl-methyl] -amino }-hexanoic acid (4- hydroxymethyl-phenyl)-amide instead of (S)-2-((S)-2-amino-3-(4-nitrophenyl)-propanamido)-N- (4-(hydiOxymethyl)phenyl)-6-((4-methoxyphenyl)diphenyl-methylamino)hexanamide as coupling partner. The former was prepared from (S)-2-(((9H-fluoren-9- yl)methoxy)carbonylamino)-3-(naphthalen-l-yl)propanoic acid as described above in steps a] - c]. MS: expected mass: 1410.792, found mass: 1410.7918. Example 7
N-[4-({3-[(3Beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-4-fluoro-L- phenylalanyl-N~6— [(4-methoxyphenyl)(dipheny l)methyl] -N- [4-( { [(4- nitrophenoxy)carbonyl] oxy } methyl)phenyl] -L-ly sinamide
Figure imgf000035_0001
Was prepared in analogy to Example 1, but using in step 3 (S)-2-[(S)-2-amino-3-(4-fluoro- phenyl)-piOpionylamino]-6-{ [(4-methoxy-phenyl)-diphenyl-methyl]-amino}-hexanoic acid (4- hydroxymethyl-phenyl)- amide instead of (S)-2-((S)-2-amino-3-(4-nitrophenyl)-propanamido)-N- (4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenyl-metliylamino)-hexanamide as coupling partner. The former was prepared from (S)-2-(((9H-fluoren-9- yl)methoxy)carbonylamino)-3-(4-fluorophenyl)propanoic acid as described above in steps a] - c]. MS: expected mass: 1378.7669, found mass: 1378.7609.
Example 8
N-[4-({3-[(3Beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-2-fluoro-L- phenylalanyl-N~6— [(4-methoxyphenyl)(diphenyl)methyl] -N- [4-( { [(4- nitrophenoxy )carbonyl] oxy } methyl)phenyl] -L-ly sinamide Chiral
Figure imgf000036_0001
Was prepared in analogy to Example 1, but using in step 3 (S)-2-[(S)-2-Amino-3-(2-fluoro- phenyl)-propionylamino]-6-{ [(4-methoxy-phenyl)-diphenyl-methyl] -amino }-hexanoic acid (4- hydroxymethyl-phenyl)-amide instead of (S)-2-((S)-2-amino-3-(4-nitrophenyl)-propanamido)-N- (4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenyl-methylamino)-hexanamide as coupling partner. The former was prepared from (S)-2-(((9H-fluoren-9- yl)methoxy)carbonylamino)-3-(2-fluorophenyl)propanoic acid as described above in steps a] - c].
MS: expected mass: 1378.7669, found mass: 1378.7689.
Example 9
N-[4-({3-[(3Beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-3-fluoro-L- phenylalanyl-N~6— [(4-methoxyphenyl)(diphenyl)methyl] -N- [4-( { [(4- nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-lysinamide
Figure imgf000037_0001
Was prepared in analogy to Example 1, but using in step 3 (S)-2-[(S)-2-amino-3-(3-f uoro- phenyl)-propionylamino]-6-{ [(4-methoxy-phenyl)-diphenyl-methyl] -amino }-hexanoic acid (4- hydroxymethyl-phenyl)- amide instead of (S)-2-((S)-2-amino-3-(4-nitrophenyl)-propanamido)- N-(4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenyl-methylamino)-hexanamide as coupling partner. The former was prepared from (S)-2-(((9H-fluoren-9- yl)methoxy)carbonylamino)-3-(3-fluorophenyl)propanoic acid as described above in steps a] - c].
MS: expected mass: 1378.7669, found mass: 1378.7659. Example 10
Step 1: Nl-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)- 2,3,4,7,8,9,10,11,12,13, 14,15, 16,17-tetradecahydro-lH-cyclopenta[a]phenanthren-3- yloxy)propyl)-N4-((S)-l-(4-fluorophenyl)-4-((S)-l-(4-(hydroxymethyl)phenylamino)-6-((4- methoxyphenyl)diphenylmethylamino)-l-oxohexan-2-ylamino)-4-oxobutan-2-yl)succinamide
Figure imgf000038_0001
In a 10 niL round-bottomed flask, the above prepaed 4-(3-((3S,8S,9S, 10R, 13R,14S,17R)- 10,13- dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,l 1,12,13, 14,15, 16,17-tetradecahydro- lH- cyclopenta[a]phenanthren-3-yloxy)propylamino)-4-oxobutanoic acid (109 mg, 188 μιηοΐ, Eq: 1.00), (S)-2-[(S)-3-amino-4-(4-fluoro-phenyl)-butyrylamino]-6-{ [(4-mefhoxy-phenyl)-diphenyl- methyl] -amino }-hexanoic acid (4-hydroxymethyl-phenyl)-amide (132 mg, 188 μιηοΐ, Eq: 1.00), HOAt (25.6 mg, 188 μmol, Eq: 1.00) and EDC hydrochloride (36.1 mg, 188 μιηοΐ, Eq: 1.00) were mixed together in CH2C12 (2 ml) to give a yellow solution. Huenig'sBase (48.7 mg, 64.1 μΐ, 377 μιηοΐ, Eq: 2.00) was added and the reaction stirred at ambient temperature over night. TLC indicated the consumption of starting material. All volatiles were removed i. V. and the crude product purified by flash chromatography Si02 / 5% MeOH / 0.1% NEt3 in CH2C12 to yield 197 mg of the title compound as off-white solid.
MS: expected mass: 1227.7763, found mass: 1227.7714. Step2: 4-((S)-2-((S)-3-(4-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6- methylheptan-2-yl)-2,3,4 ,7,8,9,10,11,12,13, 14,15,16,17-tetradecahydro-lH- cyclopenta[a]phenanthren-3-yloxy)propylamino)-4-oxobutanamido)-4-(4- fluorophenyl)butanamido)-6-((4-methoxyphenyl)diphenylmethylamino)hexanamido)-benzyl 4- nitrophenyl carbonate Chiral
Figure imgf000039_0001
In a 10 mL round-bottomed flask, the above prepared Nl-(3-((3S,8S,9S, 10R,13R, 14S, 17R)- 10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,l l, 12, 13, 14,15, 16,17- tetradecahydro-lH-cyclopenta[a]phenanthren-3-yloxy)propyl)-N4-((S)-l-(4-fluorophenyl)-4- ((S)-l-(4-(hydroxymethyl)phenylamino)-6-((4-methoxyphenyl)diphenylmethylamino)-l- oxohexan-2-ylamino)-4-oxobutan-2-yl)succinamide (196 mg, 160 μηιοΐ, Eq: 1.00) and Huenig's base (61.9 mg, 81.4 μΐ, 479 μmol, Eq: 3.00) were combined with CH2C12 ( 1.6 ml) and DMF (0.8 ml) to give a yellow suspension; bis(4-nitrophenyl) carbonate (72.8 mg, 239 μιηοΐ, Eq: 1.50) was added and the reaction allowed to proceed at ambient temperature over night. The mixture was poured onto crashed ice / NH4C1 (pH ~6), extracted 2 x with AcOEt, washed with H20 and brine, dried over Na2S04, and evaporated to dryness. After trituration with AcOEt / heptane one obtained 123 mg of the title compound as light yellow solid.
MS: expected mass: 1392.7825, found mass: 1392.7819.
The necessary dipeptidic building block for step 1 was prepared as follows: Step a: (S)-2-[(S)-3-(9H-Fluoren-9-ylmethoxycarbonylamino)-4-(4-fluoro-phenyl)- butyrylamino]-6-{ [(4-methoxy-phenyl)-diphenyl-methyl]-amino}-hexanoic acid
Figure imgf000040_0001
In a 25 niL round-bottomed flask, (S)-2-amino-6-((4-methoxyphenyl)diphenylmethyl- amino)hexanoic acid (Bioconjugate Chem. 2002, 13, 855-869, 1040 mg, 2.48 mmol, Eq: 1.00) was dissolved in CH2C12 (12.5 ml) to give a pale yellow solution. Huenig's base (961 mg, 1.27 ml, 7.44 mmol, Eq: 3.00) and trimethylchlorosilane (566 mg, 621 μΐ, 5.21 mmol, Eq: 2.10) were added and the reaction mixture was stirred at ambient temperature for 20 min.
In a second 50 mL round-bottomed flask, (S)-3-(((9H-fluoren-9-yl)methoxy)carbonyl-amino)-4- (4-fluorophenyl)butanoic acid (1040 mg, 2.48 mmol, Eq: 1.00) was dissolved in DMF (12.5 ml) to give a colorless solution. Huenig's base (385 mg, 506 μΐ, 2.98 mmol, Eq: 1.20) and TPTU [125700-71-2] (737 mg, 2.48 mmol, Eq: 1.00) were added and the reaction mixture was stirred for 15 min. The solution from the first flask containing the corresponding silyl ester monosilylamine was added and the reaction was stirred for another 3 hours at ambient temperature. The mixture was poured onto crashed ice / NH4C1, extracted 2 x with AcOEt, washed with H20 and brine, dried over Na2S04, and evaporated to dryness. Flash chromatography Si02 / 5% MeOH / 0.1% NEt3 in CH2C12 afforded 2.10 g of the title compound as yellow foam.
MS (ISP): (M+H) 820.6. Step b: { (S)-2-(4-Fluoro-phenyl)- l-[((S)- l-(4-hydroxymethyl-phenylcarbamoyl)-5- { [(4- methoxy-phenyl)-diphenyl-methyl] -amino } -pentylcarbamoyl)-methyl] -ethyl } -carbamic acid 9H- fluoren-9-ylmethyl ester
Chiral
Figure imgf000041_0001
In a 250 mL pear-shaped flask, the above synthesized { (S)-2-(4-fluoro-phenyl)-l-[((S)-l-(4- hydroxymethyl-phenylcarbamoyl)-5- { [(4-methoxy-phenyl)-diphenyl-methyl] -amino } - pentylcarbamoyl)-methyl] -ethyl} -carbamic acid 9H-fluoren-9-ylmethyl ester (2.10 g, 2.56 mmol, Eq: 1.00), (4-aminophenyl)methanol (315 mg, 2.55 mmol, Eq: 1.00), HOAt (349 mg, 2.56 mmol, Eq: 1.00) and EDC hydrochloride (491 mg, 2.56 mmol, Eq: 1.00) were dissolved in CH2C12 (12.5 ml). Huenig's base (662 mg, 871 μΐ, 5.21 mmol, Eq: 2.00) was added and the reaction allowed to proceed over night. The mixture was poured onto crashed ice / NH4C1 (pH ~7), extracted 2 x with AcOEt, washed with H20 and brine, dried over Na2S04, and evaporated to dryness. The crude product was triturated with diethyl ether (1 x 50 ml); the resultant solid was filtered off and dryed to yield 0.796 g of the title compound as light-brown solid.
MS (ISP): (M+H) 925.6.
Step c: (S)-2-[(S)-3-Amino-4-(4-fluoro-phenyl)-butyrylamino]-6- { [(4-methoxy-phenyl)- diphenyl-methyl] -amino }-hexanoic acid (4-hydroxymethyl-phenyl)-amide
Figure imgf000042_0001
In a 50 niL round-bottomed flask, the above prepared {(S)-2-(4-fluoro-phenyl)-l-[((S)-l-(4- hydroxymethyl-phenylcarbamoyl)-5-{ [(4-methoxy-phenyl)-diphenyl-methyl] -amino }- pentylcarbamoyl)-methyl] -ethyl }-carbamic acid 9H-fluoren-9-ylmethyl ester (793 mg, 857 mol, Eq: 1.001) was combined with THF (12 ml) to give a brownish solution. At 0°, diethylamine (1.13 g, 1.59 ml, 15.4 mmol, Eq: 18) was added. The reaction was stirred at ambient temperature over night. The mixture was poured onto crashed ice / NH4C1 (pH ~7), extracted 2 x with AcOEt, washed with H20 and brine, dried over Na2S04, and evaporated to dryness. Flash chromatography Si02 / 10% MeOH / 0.1% NEt3 in CH2C12 yielded 500 mg of the title compound as off-white solid.
MS: expected mass: 702.3581, found mass: 702.3578. Example 11
4-((S)-2-((S)-3-(4-(3-((3S,8S,9S, 10R, 13R, 14S,17R)-10, 13-dimethyl-17-((R)-6-methylheptan-2- yl)-2,3,4,7,8,9, 10, l 1, 12,13, 14, 15, 16, 17-tetradecahydro- lH-cyclopenta[a]phenanthren-3- yloxy)propylamino)-4-oxobutanamido)-4-phenylbutanamido)-6-((4- methoxyphenyl)diphenylmethylamino)hexanamido)benzyl 4-nitrophenyl carbonate
Figure imgf000043_0001
Was prepared in analogy to Example 10, but using in step 1 (S)-2-((S)-3-amino-4- phenylbutanamido)-N-(4-(hydroxymethyl)p]ienyl)-6-((4-methoxyphenyl)diphenyl- methylamino)hexanamide instead of (S)-2-[(S)-3-amino-4-(4-fluoiO-phenyl)-butyrylamino]-6- { [(4-methoxy-phenyl)-diphenyl-methyl] -amino }-hexanoic acid (4-hydroxymethyl-phenyl)- amide as coupling partner. The former was prepared from (S)-3-(((9H-fluoren-9- yl)methoxy)carbonylamino)-4-phenylbutanoic acid as described above in steps a] - c].
MS: expected mass: 1374.792, found mass: 1374.7877. Example 12
4-({N~2~-[(3S)-4-(4-chlorophenyl)-3-{ [4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4- oxobutanoyl] amino } butanoyl] -N~6— [(4-methoxyphenyl) (diphenyl)methyl] -L- lysyl}amino)benzyl 4-nitrophenyl carbonate
Figure imgf000044_0001
Was prepared in analogy to example 10, but using in step 1 (S)-2-((S)-3-amino-4-(4- chlorophenyl)butanamido)-N-(4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)- diphenylmethylamino)hexanamide instead of (S)-2-[(S)-3-amino-4-(4-fluoro-phenyl)- butyrylamino]-6-{ [(4-methoxy-phenyl)-diphenyl-methyl]-amino}-hexanoic acid (4- hydroxymethyl-phenyl)-amide as coupling partner. The former was prepared from (S)-3-(((9H- fluoren-9-yl)methoxy)cai-bonylamino)-4-(4-chlorophenyl)-butanoic acidas described above in steps a] - c].
MS (ISP): (M+H) 1409.9. Example 13
N-[4-({3-[(3Beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-0-methyl-L-tyrosyl- N~6~- [(4-methoxyphenyl)(diphenyl)methyl] -N- [4-( { [(4- nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-lysinamide
Figure imgf000045_0001
Was prepared in analogy to Example 1, but using in step 3 (S)-2-((S)-2-amino-3-(4- methoxyphenyl)propanamido)-N-(4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)- diphenylmethylamino)hexanamide instead of (S)-2-((S)-2-amino-3-(4-nitrophenyl)- propanamido)-N-(4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenyl- methylamino)hexanamide as coupling partner. The former was prepared from (S)-2-(((9H- fluoren-9-yl)methoxy)carbonylamino)-3-(4-methoxyphenyl)propanoic acid as described above in steps a] - c] of example 1. MS (ISP): (M+H) 1391.9.
Example 14
N-[4-({3-[(3Beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-D-phenylalanyl-N~6~- [(4-methoxyphenyl)(diphenyl)methyl] -N- [4-( { [(4-nitrophenoxy)carbonyl] oxy } methyl)phenyl] - D-lysinamide
Figure imgf000046_0001
Was prepared in analogy to example 1, but using in step 3 (R)-2-((R)-2-amino-3-phenyl- propanamido)-N-(4-(hydroxymethyl)phenyl)-6-((4-meth^
hexanamide instead of (S)-2-((S)-2-amino-3-(4-nitrophenyl)-propanamido)-N-(4- (hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenyl-methylamino)hexanamide as coupling partner. This building block was synthesized from (R)-2-(((9H-fluoren-9- yl)methoxy)carbonylamino)-6-aminohexanoic acid and (R)-2-amino-6-((4-methoxyphenyl)- diphenylmethylamino)hexanoic acid (see Bioconjugate Chem. 2002, 13, 885-869) as described above in steps a] - c].
MS: expected mass: 1360.7763, found mass: 1360.7774.
Example 15
4-({N~2— [(3S)-3-{ [4-({3-[(3Beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]amino}- 4-(4-cyanophenyl)butanoyl]-N~6~-[(4-methoxyphenyl)(diphenyl)methyl]-L-lysyl}amino)benzyl 4-nitrophenyl
Figure imgf000047_0001
Was prepared in analogy to example 10, but using in step 1 (S)-2-((S)-3-amino-4-(4- cyanophenyl)butanamido)-N-(4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenyl- methylamino)hexanamide instead of (S)-2-[(S)-3-amino-4-(4-fluoro-phenyl)-butyrylamino]-6- { [(4-methoxy-phenyl)-diphenyl-methyl] -amino }-hexanoic acid (4-hydroxymethyl-phenyl)- amide as coupling partner. The former was prepared from (S)-3-(((9H-fluoren-9- yl)methoxy)carbonylamino)-4-(4-cyanophenyl)butanoic acid as described above in steps a] - c]. MS: expected mass: 1399.7872, found mass: 1399.7857.
Example 16
N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-phenylalanyl-N~6~- [(4-methoxyphenyl)(diphenyl)methyl] -N- [4-( { [(4-nitrophenoxy)carbonyl] oxy } methyl)phenyl] - L-lysinamide
Figure imgf000048_0001
Step 1:
(S)-2-((S)-2-Amino-3-phenyl-piOpionylamino)-6-{ [(4-methoxy-phenyl)-diphenyl-methyl]- aminoj-hexanoic acid (4-hydroxymethyl-phenyl)-amide hiral
Figure imgf000048_0002
The building block (S)-2-((S)-2-amino-3-phenyl-propionylamino)-6-{ [(4-methoxy-phenyl)- diphenyl-methyl]-amino}-hexanoic acid (4-hydroxymethyl-phenyl)-amide was prepared in analogy to the procedure described in Bioconjugate Chem., Vol. 13, No.4, 2002, 855-869 MS (ISP): (M+H) 671.5
Step 2:
Nl-(3-((3S,8S,9S, 10R,13R,14S, 17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)- 2,3,4,7,8,9,10, 11,12,13, 14,15, 16,17-tetradecahydro-lH-cyclopenta[a]phenanthren-3- yloxy)propyl)-N4-((S)-l-((S)-l-(4-(hydroxymethyl)phenylamino)-6-((4- methoxyphenyl)diphenylmethylamino)-l-oxohexan-2-ylamino)-l-oxo-3-phenylpropan-2- yl)succinamide
Figure imgf000049_0001
TPTU [125700-71-2](233 mg, 784 μπιοΐ, Eq: 1.00) was added to a solution of N-{3- [(3S,8S,9S,10R,13R,14S,17R)-17-((R)-l,5-dimethyl-hexyl)-10,13-dimethyl-
2,3,4,7,8,9,10,11,12,13, 14,15, 16,17-tetradecahydro-lH-cyclopenta[a]phenanthren-3-yloxy]- propylj-succinamic acid (see example 1, step 2) (426 mg, 0.784 mmol, Eq: 1.00) and Huenig's base (304 mg, 411 μΐ, 2.35 mmol, Eq: 3) in DMF (10 ml). After 3 minutes (S)-2-((S)-2-amino-3- phenyl-propionylamino)-6-{ [(4-methoxy-phenyl)-diphenyl-methyl] -amino }-hexanoic acid (4- hydroxymethyl-phenyl)- amide (step 1) was added TLC at t = 1 h showed the reaction was complete. The solvent was removed under reduced pressure. The remaining residue was taken up in ethyl acetate and extracted with NaHC03 half sat. solution (1 X), potassium hydrogen phthalate solution 0.05M (2 X), water (1 X) and brine (1 X). The organic extract was dried over MgS04 and concentrated under reduced pressure. The crude material was purified by flash chromatography to obtain the titled product (682 mg,513, μιηοΐ) as a light brown solid.
MS (ISP): (M+H) 1196.8 Step 3:
Hiinig's base (465 mg, 629 μΐ, 3.6 mmol, Eq: 6) was added to a solution of the previous alcohol (718 mg, 600 μιηοΐ, Eq: 1.00) and bis(4-nitrophenyl) carbonate (548 mg, 1.8 mmol, Eq: 3) in THF (20 ml). The yellow solution was stirred overnight at room temperature. The solvent was removed under reduced pressure. The remaining residue was triturated with diethyl ether. The solid was collected by filtration, washed with ether and dried under reduced pressure to obtain the title compound (800 mg, 529 μιηοΐ) as a light brown solid.
MS (ISP): (M+H) 1361.9
Example 17 Step 1 (S)-2-[(S)-2-(9H-Fluoren-9-ylmethoxycarbonylamino)-3-phenyl-propionylamino]- hexanoic acid
Figure imgf000050_0001
Commercially available L-Fmoc-Phe-OSu (0.969 g, 2.00 mmol, Eq: 1.00) was suspended in a 1 : 1 v/v mixture of 1,2-dimethoxyethane and water ( 17 ml) and treated at 0°C with L-norleucine (0.275 g, 2.10 mmoll, Eq: 1.05) and NaHC03 (0.185 g, 2.20 mmol, Eq: 1.10). The cooling bath was removed and the reaction allowed to proceed at ambient temperature for 14 h. The mixture was poured onto crashed ice / citric acid (pH ~3), extracted 2x with ethyl acetate, washed with H20 and brine, dried over Na2S04, and evaporated to dryness. Flash chromatography Si02 / AcOEt yielded 0.870 mg of the title compound as white solid.
MS (ISP): (M+H) 501.2.
Step 2: { (S)- 1-[(S)- l-(4-Hydroxymethyl-phenylcarbamoyl)-pentylcarbamoyl]-2-phenyl-ethyl}- carbamic acid 9H-fluoren-9-ylmethyl ester
Figure imgf000051_0001
In a pear-shaped flask, the above synthesized (S)-2-[(S)-2-(9H-fluoren-9-ylmethoxy- carbonylamino)-3-phenyl-propionylamino]-hexanoic acid (10.72 g, 21 mmol, Eq: 1.00), (4- aminophenyl)methanol (2.717 g, 22 mmol, Eq: 1.03), and 2-ethoxy-l-ethoxycarbonyl- l,2- dihydroquinoline (EEDQ) (7.994 g, 32 mmol, Eq: 1.50) were dissolved in CH2C12 (320 ml) and stirred over night under a balloon of Ar. The mixture was poured onto crashed ice / NH4C1, extracted 2 x with AcOEt, washed with H20, dried over Na2S04, and the volume reduced to ~ 300 ml. The precipitate was filtered off and dryed to give 5.25 g of the title compound as light- brown solid.
MS (ISP): (M+H ) 606.3.
Step 3: (S)-2-((S)-2-Amino-3-phenyl-propionylamino)-hexanoic acid (4-hydroxymethyl- phenyl)-amide
Figure imgf000051_0002
In a round -bottomed flask, the above prepared { (S)- l-[(S)- l-(4-hydroxymethyl- phenylcai-bamoyl)-pentylcai-bamoyl]-2-phenyl-ethyl}-carbamic acid 9H-fluoren-9-ylmethyl ester (4.738 g, 7.822 mmol, Eq: 1.0) was dissolved in CH2C12 (28 ml). At 0°, diethylamine (28 ml, 19.80 g, 271 mmol, Eq: 35) was added and the reaction mixture stirred at ambient temperature over night. All volatiles were evaporated i. V.; ensuing flash chromatography Si02 / CH2C12 / 10% MeOH, followed by crystallization from AcOEt, yielded 2.116 g of the title compound as light brown crystals.
MS (ISP): (M+H ) 384.2. Step 4
Nl-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)- 2,3,4,7,8,9,10,11,12,13, 14,15, 16,17-tetradecahydro-lH-cyclopenta[a]phenanthren-3- yloxy)propyl)-N4-((S)-l-((S)-l-(4-(hydroxymethyl)phenylamino)-l-oxohexan-2-ylamino)-l- oxo-3-phenylpropan-2-yl)succinamide
Figure imgf000052_0001
was prepared therewith in analogy to example 16 step 2 MS (ISP): (M+H) 909.7 (M+Na) 931.8. Step 5
N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-phenylalanyl-N-[4- ( { [(4-nitrophenoxy)carbonyl] oxy } methyl)phenyl] -L-norleucinamide
Figure imgf000052_0002
was prepared therewith in analogy to example 16 step 3
MS expected mass: 1073.6453, found mass 1073.642
Example 18
N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-alanyl-N-[4-({ [(4- nitrophenoxy)carbonyl] oxy } methyl)phenyl] glycinamide
Figure imgf000053_0001
Step 1 :
Addition of FMOC-4-Aminobenzylalcohol to the 2-chlorotrityl resin
Figure imgf000053_0002
2-Chlorotrityl chloride resin (Novabiochem 01-64-01 14, 100-200 mesh), 1%DVB (18 g, 21.6 mmol, Eq: 1.00) was swollen in DCM/DMF=1/1 (300 mL) for ten minutes. The resin was drained and a solution of FMOC-4-aminobenzyl alcohol (14.9 g, 43.2 mmol, Eq: 2) and pyridine (6.83 g, 6.99 ml, 86.4 mmol, Eq: 4) in DCM/DMF=1/1 (300 mL) was added. The mixture was shaken over night. The resin was drained and capped with a solution of 10% Hiinig's Base in methanol (300 mL). The resin was washed with DMF and DCM and dried over night with HV to obtain 21.7 g resin. Determination of the load resulted in 0.41 mmoL/g. Step 2:
Nl-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)- 2,3,4,7,8,9,10,11,12,13, 14,15, 16,17-tetradecahydro-lH-cyclopenta[a]phenanthren-3- yloxy)propyl)-N4-((S)-l-(2-(4-(hydroxymethyl)phenylamino)-2-oxoethylamino)-l-oxopropan-2- yl)succinamide
Figure imgf000054_0001
The resin from step 1(1 g, 410 μηιοΐ, Eq: 1.00) was prewashed with DMF (2 X) and treated with piperidine/DMF=l/4 (10 n L) for 5 and 10 minutes. The resin was washed alternately with DMF and IPA (3 X 10 mL). A solution of Fmoc-Gly-OH (488 mg, 1.64 mmol, Eq: 4), TPTU (487 mg, 1.64 mmol, Eq: 4) and Huenig' s base (636 mg, 859 μΐ, 4.92 mmol, Eq: 12) in DMF (10 mL) was stirred for 5 minutes and then shaken with the resin for one hour. The resin was washed alternately with DMF and isopropyl alcohol (3X).
The following Fmoc cleavages and subsequent couplings of Fmoc-Ala-OH (511 mg, 1.64 mmol, Eq: 4) and N-{3-[(3S,8S,9S,10R,13R,14S,17R)-17-((R)-l,5-Dimethyl-hexyl)-10,13-dimethyl- 2,3,4,7,8,9,10,11,12,13, 14,15, 16,17-tetradecahydro-lH-cyclopenta[«]phenanthren-3-yloxy]- propylj-succinamic acid (example 1, step 2) (892 mg, 1.64 mmol, Eq: 4) were performed accordingly. The dried peptide resin was stirred for about 2 X 30 min in TFA 1%/DCM (2 X 20 mL). The reaction mixture was filtered and the resin was washed with DCM. The filtrates were pooled and the solvents evaporated under vacuum. The crude material was triturated with diethyl ether (2 x ). After purification by flash chromatography, the product (84 mg, 97.3 μιηοΐ) was obtained as a white solid. MS expected mass:776.5452, found mass 776.5455
Step 3:
The above prepared alcohol Nl-(3-((3S,8S.9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6- methylheptan-2-yl)-2,3,4 ,7,8,9,10,11,12,13, 14, 15, 16,17-tetradecahydro-lH- cyclopenta[a]phenanthren-3-yloxy)propyl)-N4-((S)-l-(2-(4-(hydroxymethyl)phenylamino)-2- oxoethylamino)-l-oxopropan-2-yl)succinamide [RO5545270] (70 mg, 90.1 μπιοΐ, Eq: 1.00) and bis(4-nitrophenyl) carbonate (137 mg, 450 μιηοΐ, Eq: 5) under Argon at room temperature were dissolved in DMF (4 ml) and treated with Huenig's base (34.9 mg, 47.2 μΐ, 270 μιηοΐ, Eq: 3). and the mixture was alloiwed to react overnight. The solvent was removed in vacuo. The resulting solid was triturated with diethylether. The solid was collected by filtration and washed with diethyl ether. The product was dried in vacuo to obtain the title compound (84 mg, 80.2 μηιοΐ) as a light brown solid.
MS expected mass:941.5514, found mass 941.5518
Example 19 N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-leucyl-N-[4-({ [(4- nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-methioninamide
Figure imgf000055_0001
Addition of FMOC-4-aminobenzylalcohol to the 2-chlorotrityl resin
Figure imgf000056_0001
was prepared in analogy to example 18, step 1
Step 2 Nl-(3-((3S,8S,9S, 10R, 13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)- 2,3,4,7,8,9,10,11,12,13, 14,15, 16,17-tetradecahydro-lH-cyclopenta[a]phenanthren-3- yloxy)propyl)-N4-((S)-l-((S)-l-(4-(hydroxymethyl)phenylamino)-4-(methylthio)-l-oxobutan-2- ylamino)-4-methyl-l-oxopentan-2-yl)succinamide
Figure imgf000056_0002
was prepared in analogy to example 18, step 2, using Fmoc-Met-OH (609 mg, 1.64 mmol, Eq: 4) and Fmoc-Leu-OH (580 mg, 1.64 mmol, Eq: 4) as amino acids.
The product (208 mg, 210 μιηοΐ) was obtained as a light yellow solid.
MS (ISP): (M+H) 893.6183
Step 3 was prepared in analogy to example 18, step 3. After purification on silica gel, the title compound (161 mg, 137 μιηοΐ) was obtained as light brown solid. MS expected mass: 1057.6174, found mass 1057.6184 Example 20
N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-leucyl-N~l~ nitrophenoxy )carbonyl] oxy } methyl)phenyl] -L-aspartamide
Figure imgf000057_0001
Step 1:
Addition of FMOC-4-aminobenzylalcohol to the 2-chlorotrityl resin
Figure imgf000057_0002
was performed in analogy to example 18, step 1
Step 2
(S)-2-((S)-2-(4-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylhept; 2,3,4,7,8,9,10,11,12,13, 14,15, 16,17-tetradecahydro-lH-cyclopenta[a]phenanthren-3- yloxy)propylamino)-4-oxobutanamido)-4-methylpentanamido)-Nl-(4- (hydroxymethyl)phenyl)succinamide
Figure imgf000058_0001
Was prepared in analogy to example 18, step 2, using Fmoc-Asn-OH (581 mg, 1.64 mmol, Eq: 4) and Fmoc-Leu-OH (580 mg, 1.64 mmol, Eq: 4) as amino acids. The product (87 mg, 89.4 μιηοΐ) was obtained as a light yellow solid.
MS expected mass:875.6136, found mass 875.6133
Step 3
The titled compound was prepared in analogy to example 18, step 3. After purification on silica gel (87 mg, 89.4 μιηοΐ) the title compound was obtained as light brown solid.
MS expected mass: 1040.6198, found mass 1040.6188
Example 21
N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-alanyl-N~l~-[4-({ [(4- nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-aspartamide
Figure imgf000058_0002
Step 1:
Addition of FMOC-4-aminobenzylalcohol to the 2-chlorotrityl resin
Figure imgf000059_0001
was performed in analogy to example 18, step 1
Step 2
(S)-2-((S)-2-(4-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylhept;
2,3,4,7,8,9,10,11,12,13, 14,15, 16,17-tetradecahydro-lH-cyclopenta[a]phenanthren-3- yloxy)propylamino)-4-oxobutanamido)propanamido)-Nl-(4- (hydroxymethyl)phenyl)succinamide
Figure imgf000059_0002
Was prepared in analogy to example 18, step 2, using Fmoc-Asn-OH (581 mg, 1.64 mmol, Eq: 4) and Fmoc-Ala-OH (511 mg, 1.64 mmol, Eq: 4) as amino acids. The product (140 mg, 159 μιηοΐ) was obtained as light yellow solid.
MS (ISP): (M+H) 834.8 (M+Na) 856.7 Step 3
The title compound was prepared in analogy to example 18, step 3. After purification on silica gel (169 mg, 152 μηιοΐ) it was obtained as light brown solid.
MS expected mass:998.5729, found mass 998.5739 Example 22
N~2~- [4-( { 3 -[(3beta)-cholest-5 -en-3 -yloxy]propyl } amino)-4-oxobutanoyl] -L-asparaginyl-N- [4- ( { [(4-nitrophenoxy)carbonyl] oxy } methyl)phenyl] glycinamide
Figure imgf000060_0001
Was performed in analogy to example 18, step 1 Step 2
(S)-2-(4-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)- 2,3,4,7,8,9,10,11,12,13, 14,15, 16,17-tetradecahydro-lH-cyclopenta[a]phenanthren-3- yloxy)propylamino)-4-oxobutanamido)-Nl-(2-(4-(hydroxymethyl)phenylamino)-2- oxoethyl)succinamide
Figure imgf000061_0001
Was prepared in analogy to example 18, step 2, using Fmoc-Gly-OH (488 mg, 1.64 mmol, Eq: 4) and Fmoc-Asn-OH (581 mg, 1.64 mmol, Eq: 4) as amino acids.
The product (140 mg, 162 μιηοΐ) was obtained as white solid.
MS expected mass:819.551, found mass 819.5503
Step 3: The title compound was obtained in analogy to example 18, step 3 (176 mg, 161 μιηοΐ) as light brown solid. MS expected mass:984.5572, found mass 984.5489
Example 23
N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-phenylalanyl-N-[4- ( { [(4-nitrophenoxy)carbonyl] oxy } methyl)phenyl] glycinamide
Figure imgf000061_0002
Step 1:
Addition of FMOC-4-aminobenzylalcohol to the 2-chlorotrityl resin
Figure imgf000062_0001
Was performed in analogy to example 18, step 1
Step 2:
Nl-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)- 2,3,4,7,8,9,10,11,12,13, 14,15, 16,17-tetradecahydro-lH-cyclopenta[a]phenanthren-3- yloxy)propyl)-N4-((S)-l-(2-(4-(hydroxymethyl)phenylamino)-2-oxoethylamino)-l-oxo-3- phenylpropan-2-yl) succinamide
Figure imgf000062_0002
Was prepared in analogy to example 18, step 2, using Fmoc-Gly-OH (488 mg, 1.64 mmol, Eq: 4) and Fmoc-Phe-OH (635 mg, 1.64 mmol, Eq: 4) as amino acids.
The product (259 mg, 288 μιηοΐ) was obtained as white solid.
MS expected mass:852.5765, found mass 852.5754
Step 3
The title compound was obtained in analogy to example 18, step 3. (280 mg, 247 μιηοΐ) as light brown solid. MS expected mass: 1017.5827, found mass 1017.5775
Example 24
N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-leucyl-N-[4-({ [(4- nitrophenoxy)carbonyl]oxy}methyl)phenyl]glycinamide
Figure imgf000063_0001
Step 1:
Addition of FMOC-4-aminobenzylalcohol to the 2-chlorotrityl resin
Figure imgf000063_0002
Was performed in analogy to example 18, step 1
Step 2
Nl-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)- 2,3,4,7,8,9,10,11,12,13, 14,15, 16,17-tetradecahydro-lH-cyclopenta[a]phenanthren-3- yloxy)propyl)-N4-((S)-l-(2-(4-(hydroxymethyl)phenylamino)-2-oxoethylamino)-4-methyl-l- oxopentan-2-yl) succinamide
Figure imgf000064_0001
Was prepared in analogy to example 18, step 2, using Fmoc-Gly-OH (488 mg, 1.64 mmol, Eq: 4) and Fmoc-Leu-OH (580 mg, 1.64 mmol, Eq: 4) as amino acids.
The product (240 mg, 278 μιηοΐ) was obtained as a light yellow solid.
MS expected mass:818.5921, found mass 818.5921
Step 3
The title compound was prepared in analogy to example 18, step 3. After purification on silica gel, it (194 mg, 177 μιηοΐ) was obtained as light yellow solid.
MS expected mass:983.5983 found mass 983.6004
Example 25
N-[4-( { 3-[(3beta)-cholest-5-en-3-yloxy]propyl } amino)-4-oxobutanoyl] -L-leucyl-N- [4-( { [(4- nitrophenoxy)carbonyl] oxy } methyl)phenyl] -L-phenylalaninamide
Figure imgf000065_0001
Step 1:
Addition of FMOC-4-aminobenzylalcohol to the 2-chlorotrityl resin
Figure imgf000065_0002
Was performed in analogy to example 18, step 1
Step 2
Nl-(3-((3S,8S,9S,10R,13R,14S, 17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)- 2,3,4,7,8,9,10,11,12,13, 14,15, 16,17-tetradecahydro-lH-cyclopenta[a]phenanthren-3- yloxy)propyl)-N4-((S)-l-((S)-l-(4-(hydroxymethyl)phenylamino)-l-oxo-3-phenylpropan ylamino)-4-methyl-l-oxopentan-2-yl)succinamide
Figure imgf000065_0003
Was prepared in analogy to example 18, step 2, using Fmoc-Phe-OH (635 mg, 1.64 mmol, Eq: 4) and Fmoc-Leu-OH (580 mg, 1.64 mmol, Eq: 4) as amino acids.
The product (153 mg, 151 μιηοΐ) was obtained as light yellow solid.
MS expected mass:908.6391 found mass 908.637
Step 3:
The title compound was prepared in analogy to example 18, step 3. After purification on silica gel, it (117 mg, 98 μιηοΐ) was obtained as white solid.
MS expected mass: 1073.6453 found mass 1073.646
Example 26
N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-phenylalanyl-N-[4- ( { [(4-nitrophenoxy)carbonyl] oxy } methyl)phenyl] -L-phenylalaninamide
Figure imgf000066_0001
Figure imgf000066_0002
Was performed in analogy to example 18, step 1
Step 2 Nl-(3-((3S,8S,9S,10R,13R,14S, 17R)-10, 13-dimethyl-17-((R)-6-methylheptan-2-yl)- 2,3,4,7,8,9,10,11, 12,13, 14,15, 16,17-tetradecahydro-lH-cyclopenta[a]phenanthren-3- yloxy)propyl)-N4-((S)-l-((S)-l-(4-(hydroxymethyl)phenylamino)-l-oxo-3-phenylpropan-2- ylamino)-l-oxo-3-phenylpropan-2-yl)succinamide
Figure imgf000067_0001
Was prepared in analogy to example 18, step 2, with Fmoc-Phe-OH (635 mg, 1.64 mmol, Eq: 4) as amino acid.
The product (240 mg, 204 μιηοΐ) was obtained as light yellow solid. MS expected mass:942.6234 found mass 942.6218
Step 3:
The title compound was prepared analogously to example 18, step 3. After purification on silica gel, it (190 mg, 154 μιηοΐ) was obtained as white solid. MS expected mass: 1107.6296 found mass 1107.6287 Example 27
N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-leucyl-N-[4-({ [(4- nitrophenoxy)carbonyl] oxy } methyl)phenyl] -L-leucinamide
Figure imgf000068_0001
Step 1:
Addition of FMOC-4-aminobenzylalcohol to the 2-chlorotrityl resin
Figure imgf000068_0002
Was performed analogously to example 18, step 1
Step 2
Nl-(3-((3S,8S,9S,10R, 13R,14S,17R)-10, 13-dimethyl-17-((R)-6-methylheptan-2-yl)- 2,3,4,7,8,9, 10,11, 12,13, 14,15, 16,17-tetradecahydro-lH-cyclopenta[a]phenanthren-3- yloxy)propyl)-N4-((S)-l-((S)-l-(4-(hydroxymethyl)phenylamino)-4-methyl-l-oxopentan-2- ylamino)-4-methyl- 1 -oxopentan-2-yl)succinamide
Figure imgf000069_0001
Was prepared in analogy to example 18, step 2, with Fmoc-Leu-OH (1.59 g, 4.5 mmol, Eq: 3) as amino acid.
The product (254 mg, 284 μιηοΐ) was obtained as white solid MS expected mass:874.6547 found mass 874.6527
Step 3
The title compound was prepared in analogy to example 18, step 3. After purification on silica gel it was obtained as white solid (178 mg, 168 μιηοΐ). MS expected mass: 1039.6609 found mass 1039.6588
Example 28
N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-alanyl-N-[4-({ [(4- nitrophenoxy)carbonyl] oxy } methyl)phenyl] -L-alaninamide
Figure imgf000069_0002
Step 1
{ (S)-l-[(S)-l-(4-Hydroxymethyl-phenylcarbamoyl)-ethylcarbamoyl]-ethyl}-carbamic acid 9H- fluoren-9-ylmethyl ester
Figure imgf000070_0001
A solution of Fmoc-Ala-Ala-OH (1 g, 2.61 mmol, Eq: 1.00) and (4-aminophenyl)methanol (483 mg, 3.92 mmol, Eq: 1.5) in THF (20 ml) was treated with EEDQ (970 mg, 3.92 mmol, Eq: 1.5). The solution was stirred over night at room temperature. The mixture was diluted with 10% 2- propanol/ethyl acetate (100 mL) and the solution was washed with KHS04 5%/K2S04 10% (2 X), water (IX) and brine (IX), dried over MgS04 and evaporated in vacuo. The residue was sonicated in diethyl ether for several minutes and the solid was collected by filtration to obtain the product (1.27 g, 1.2 mmol) as light brown solid.
MS (ISP): (M+H) 488.3
Step 2:
(S)-2-Amino-N-[(S)- l-(4-hydroxymethyl-phenylcarbamoyl)-ethyl]-propionamide
The compound was prepared in analogy to example 1 step c to obtain the product (245 mg, 877 μιηοΐ) as light yellow solid.
MS (ISP): (M+H) 266.3, (M+Na) 288.2 (2M+H) 531.3
Step 3:
Nl-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)- 2,3,4,7,8,9,10,11,12,13, 14,15, 16,17-tetradecahydro-lH-cyclopenta[a]phenanthren-3- yloxy)propyl)-N4-((S)- 1-((S)-1 -(4-(hydroxymethyl)phenylamino)- 1 -oxopropan-2-ylamino)- 1 - oxopropan-2-yl)succinamide
Figure imgf000071_0001
The compound was prepared in analogy to example 16 step 2 (165 mg, 198 μηιοΐ) as light brown solid.
MS expected mass: 790.5608, found mass 790.5587
Step 4
The title compound was prepared in analogy to example 18, step 3. After purification on silica gel it was obtained as white solid (99 mg, 98.4 μιτιοΐ).
MS expected mass: 955.567, found mass 955.5651 Example 29
N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-isoleucyl-N~l~-[4- ({ [(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-aspartamide
Figure imgf000072_0001
Step 1
(S)-2-[(2S,3S)-2-(9H-Fluoren-9-ylmethoxycarbonylamino)-3-methyl-pentanoylamino]- succinamic acid
Figure imgf000072_0002
2-Chlorotrityl chloride resin (5 g, 7.5 mmol, Eq: 1.00) was swollen in DCM and then treated with a solution of Fmoc-Asn(Trt)-OH (8.95 g, 15.0 mmol, Eq: 2) and Huenig's base (3.88 g, 5.1 ml, 30.0 mmol, Eq: 4) in DCM overnight. The resin was washed with DCM and capped with a solution of 10% Huenig's base in methanol. Coupling of Fmoc-Ile-OH (5.3 g, 15.0 mmol, Eq: 2) with TPTU (4.46 g, 15.0 mmol, Eq: 2) and Huenig's base (3.88 g, 5.1 ml, 30.0 mmol, Eq: 4) according to standard solid phase peptide synthesis. The product was cleaved from the resin with a cocktail of TFA/Water/triisopropylsilane (95/2.5/2.5 v/v/v) for two hours at room temperature. The resin was filtered and the filtrate was concentrated under reduced pressure to a small volume. After trituration with diethyl ether, the product was filtered and dried in vacuum to obtain the product (2.85 g, 5.79 mmol) as white solid. MS expected mass: 467.2056, found mass 467.2056
Step 2
{(lS,2S)-l-[2-Cai-bamoyl-l-((S)-4-hydroxymethyl-phenylcai-bamoyl)-ethylcarbamoyl]-2- methyl-butyl }-carbamic acid 9H-fluoren-9-ylmethyl ester
Figure imgf000073_0001
The compound was prepared in analogy to example 28 step 1 (620 mg, 336 μιηοΐ) yellow solid.
Step 3
(S)-2-((2S,3S)-2-Amino-3-methyl-pentanoylamino)-N* l*-(4-hydroxymethyl-phenyl)- succinamide
Figure imgf000073_0002
The compound was prepai'ed in analogy to example 1 step c (100 mg, 228 μιηοΐ) as light yellow solid. Ste 4
(S)-2-((2S,3S)-2-(4-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan- 2-yl)-2,3,4,7,8,9, 10, 11, 12, 13, 14, 15,16, 17-tetradecahydro-lH-cyclopenta[a]phenanthren-3- yloxy)propylamino)-4-oxobutanamido)-3-methylpentanamido)-Nl-(4- (hydroxymethyl)phenyl)succinamide
Figure imgf000074_0001
The compound was prepared in analogy to example 16 step 2 (89 mg, 91.4 μιηοΐ) as light yellow solid.
Step 5
The compound from the previous step was reacted to the title compound analogously to example 18, step 3. After purification on silica gel, it (42 mg, 36.3 μιηοΐ) was obtained as a light brown solid.
MS expected mass: 1040.6198, found mass 1040.6177
Example 30
N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-phenylalanyl-N~6~- [(4-methoxyphenyl)(diphenyl)methyl] -N- [4-( { [(4-nitrophenoxy)carbonyl] oxy } methyl)phenyl] - D-lysinamide
Figure imgf000075_0001
The compound was prepared in analogy to example 16 step 1, starting with Fmoc-D-Lys(Boc)- OH, (158 mg, 116 μηιοΐ) as light brown solid.
MS (ISP): (M+H ) 1362.8 (M+Na) 1383.8
Example 31
N-{ 15-[(3beta)-cholest-5-en-3-yloxy]-4,15-dioxo-8,l l-dioxa-5,14-diazapentadecan-l-oyl}-L- phenylalanyl-N~6— [(4-methoxyphenyl)(diphenyl)methyl] -N- [4-( { [(4- nitrophenoxy)carbonyl] oxy } methyl)phenyl] -L-ly sinamide
Figure imgf000075_0002
The title compound was prepared analogous to example 16 using a cholesterol-oligo-PEG derivative in step 2 of the synthesis. MS (ISP): (M+H) 1479.8
The necessary cholesterol-PEG intermediate N-[2-(2-{2-[(3S,8S,9S,10R,13R,14S,17R)-17-((R)- l,5-Dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,l 1,12,13, 14,15,16,17-tetradecahydro-lH- cyclopenta[a]phenanthren-3-yloxycarbonylamino]-ethoxy}-ethoxy)-ethyl]-succinamic acid for step 2 was prepared as follows:
Step a: {2-[2-(2-Amino-ethoxy)-ethoxy]-ethyl}-carbamic acid (3S,8S,9S,10R,13R,14S,17R)-17- ((R)-l,5-dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,l 1,12,13, 14,15, 16,17-tetradecahydro- lH-cyclopenta[a]phenanthren-3-yl ester
Figure imgf000076_0001
A solution of cholesteryl chloroformate (1 g, 2.23 mmol) in 25 mL dichloromethane was added dropwise under stirring to a solution of 2,2'-(ethylenedioxy)bis-(ethylamine) (495 mg, 3.34 mmol) in 75 mL dichloromethane. The reaction was stirred overnight at room temperature. The reaction was diluted with dichloromethane and extracted with water. The organic extract was dried over anhydrous MgS04 dihydrate, filtered and evaporated. After purification on amino- modified silica gel (eluent: MeC12 -> MeC12/MeOH=975:25 v/v) the product (615 mg) was obtained as a white, waxy solid.
MS (ISP): (M+H ) 561.5 Step b: N-[2-(2-{2-[(3S,8S,9S,10R,13R,14S,17R)-17-((R)-l,5-Dimethyl-hexyl)-10,13-dimethyl- 2,3,4,7,8,9,10,11,12,13, 14,15, 16,17-tetradecahydro-lH-cyclopenta[a]phenanthren-3- yloxycarbonylamino] -ethoxy } -ethoxy )-ethyl] -succinamic acid
Figure imgf000077_0001
The amine from step a (480 mg, 0.856 mmol) and triethylamine (0.13 mL, 0.94 mmol) were dissolved in 5 mL dichloromethane. After adding succinic anhydride (90 mg, 0.9 mmol) the solution was stirred overnight at room temperature. TLC check showed still some starting material. More succinic anhydride (20 mg, 0.2 mmol) was added. After stirring the reaction for another 3 hours at room temperature, it was diluted with dichloromethane and washed with a 5%KHS04/ 10%K2SO4 mixture. The organic extract was dried over anhydrous MgS04- dihydrate, filtered and evaporated in vacuo to obtain the desired acid (490 mg, 0.667 mmol).
MS (ISP): (M+H ) 661.5
Example 32
N-{30-[(3beta)-cholest-5-en-3-yloxy]-4,30-dioxo-8,l l, 14,17,20,23,26-heptaoxa-5,29- diazatriacontan- l-oyl}-L-phenylalanyl-N~6~-[(4-methoxyphenyl)(diphenyl)methyl]-N-[4-({ [(4- nitrophenoxy)carbonyl] oxy } methyl )phenyl] -L-ly sinamide
Figure imgf000078_0001
The title compound was prepared analogous to example 16 using a cholesterol -PEG derivative in step 2 of the synthesis.
MS (ISP): (M+H) 1699.9
The necessary cholesterol-PEG intermediate l-[(3beta)-cholest-5-en-3-yloxy]-l,27-dioxo- 5,8,11, 14, 17,20,23-heptaoxa-2,26-diazatriacontan-30-oic acid for step 2 was prepared as follows
Step a: tert-butyl [25-({(3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl- 17-[(2R)-6-methylheptan- 2-yl]-2,3,4,7,8,9,10,l 1,12,13, 14,15, 16,17-tetradecahydro-lH-cyclopenta[a]phenanthren-3- yl}oxy)-25-oxo-3,6,9,12,15,18,21-heptaoxa-24-azapentacos-l-yl]carbamate
Figure imgf000078_0002
Cholesteryl chloroformate (476 mg, 1.06 mmol) and triethylamine (155 uL, 1.113 mmol) were dissolved in 5 mL dichloromethane. Then a solution of alpha-amino-omega-boc-amino- octa(ethylene glycol) (497 mg, 1.06 mmol) dissolved in 1 mL dichloromethane was added. The solution was stirred over night at room temperature and diluted with dichloromethane and extracted with a KHS04 5%/K2S04 10% aquieous mixture. The organic extract was dried over anhydrous MgS04, filtered and evaporated in vacuo. After purification on silica gel (eluent: MeC12/MeOH=975:25 -> 95:5 v/v) the product (530 mg, 0.571 mmol) was obtained as a colorless oil.
MS (ISP): (M+NH4 ) 898.7
Step b: l-[(3beta)-cholest-5-en-3-yloxy]-l,27-dioxo-5,8,l l,14,17,20,23-heptaoxa-2,26- diazatriacontan-30-oic acid
Figure imgf000079_0001
The previous Boc derivative (450 mg, 0.511 mmol) was dissolved in HCl 4M in dioxane (10.2 mL, 40.9 mmol). The solution was stirred at room temperature for 40 min. The solvent was removed in vacuo and the remaining white solid was dissolved in 5 mL dichloromethane and treated with triethylamine (32 uL, 0.229 mmol) and succinic anhydride (11.5 mg, 0.114 mmol) overnight. More succinic anhydride (11 mg, 0.11 mmol, 0.2 equiv.) was added and after 60 min the reaction was diluted with dichloromethane and washed with KHS04 5%/K2S04 10% buffer. The organic extract was dried over MgS04 anhydrous, filtered and evaporated to obtain 390 mg of the desired product. MS (ISP): (M+H ) 881.7
Example 33
N-{ 66-[(3beta)-cholest-5-en-3-yloxy]-4,66-dioxo- 8,l l,14, 17,20,23,26,29,32,35,38,41,44,47,50,53,56,59,62-nonadecaoxa-5,65- diazahexahexacontan-l-oyl }-L-phenylalanyl-N~6~-[(4-methoxyphenyl)(diphenyl)methyl]-N-[4- ({ [(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-lysinamide
Figure imgf000080_0001
The title compound was prepared analogous to example 16 using a cholesterol- -PEG derivative in step 2 of the synthesis.
MS (ISP): (M+H) 2228.1
The necessary cholesterol-PEG intermediate l-[(3beta)-cholest-5-en-3-yloxy]-l ,63-dioxo- 5,8, 1 l ,14,17,20,23,26,29,32,35,38,41 ,44,47,50,53,56,59-nonadecaoxa-2,62- diazahexahexacontan-66-oic acid for step 2 was prepared as follows:
Step a (3beta)-cholest-5-en-3-yl (59-amino- 3,6,9, 12,15, 18,21,24,27,30,33,36,39,42,45,48,51,54,57 nonadecaoxanonapentacont-1- yl)carbamate Chiral
Figure imgf000081_0001
Alpha, omega-bis-amino 20(ethylene glycol) (538 mg, 0.6 mmol) and triethylamine (92 uL, 0.66 mmol) were dissolved in 15 mL dry dichloromethane. A solution of cholesteryl chloroformate (270 mg, 0.6 mmol) in 2 mL dry dichloromethane was added dropwise at room temperature. The solution was stirred overnight, then concentrated in vacuo to a small volume and purified directly on silica gel (eluent: MeC12/MeOH=95:5 -> 9:4 -> 4: 1 v/v) to obtain the product (350 mg, 0.254 mmol) as a waxy solid.
MS (ISP): (M+H) 1309.9
Step b: 1 - [(3beta)-cholest-5-en-3 -yloxy] - 1 ,63-dioxo-
5,8,11, 14,17,20,23,26,29,32,35,38,41,44,47,50,53,56,59-nonadecaoxa-2,62- diazahexahexacontan-66-oic acid
Figure imgf000082_0001
The amine from step a (329 mg, 0.251 mmol), succinic anhydride (26.4 mg, 0.264 mmol) and triethylamine (40 uL, 0.286 mmol) wered dissolved in 5 mL dry dichloromethane. After adding more triethylamine (40 uL, 0.286 mmol), the solution (pH>8) was stirred overnight at room temperature. The reaction was diluted with dichloromethane and washed twice with a KHS04 5%/K2S04 10% aqueous mixture. The organic extract was dried over anhydrous MgS04, filtered and evaporated to obtain the product (260 mg, 0.175 mmol) as a colorless, waxy solid.
MS (ISP): (M+NH4 ) 1408.9
Example 34: General procedure for the preparation of RNA conjugates
Materials
Dimethyl sulfoxide (DMSO), N,N-Diisopropylethylamine (DIPEA) and sodium acetate solution (3 M, pH 5.2) were purchased from Sigma Aldrich Chemie GmbH (Traufkirchen, Germany). Triethylammonium acetate (TEAA) (2.0 M, pH 7.0) and Acetonitrile (ACN, HPLC quality) for RP-HPLC were purchased from Biosolve (Valkenswaard, Netherlands).
Ethanol (EtOH, p. a.) was purchased from Merck (Darmstadt, Germany). Purified water from a Optilab HF (Membra Pure, Germany) system was used. Resource RPC 3 mL column (10 x 0,64 cm; 15 μιη particle size) was purchased from GE Healthcare (Freiburg, Germany).
HPLC purification was accomplished using an ΑΚΤΑ Explorer 100 system (GE Healthcare).
Synthesis of amino-modified RNA RNA equipped with a hexylaminolinker at the 5 '-end of the sense strand was produced by standard phosphoramidite chemistry on solid phase at a scale of 1215 μιηοΐ using an AKTA Oligopilot 100 (GE Healthcare, Freiburg, Germany) and controlled pore glass as solid support (Prime Synthesis, Aston, PA, USA). RNA containing 2'-Omethyl nucleotides were generated employing the corresponding phosphoramidites, 2'-Omethyl phosphoramidites and TFA- hexylaminolinker amidite (Sigma-Aldrich, SAFC, Hamburg, Germany). Cleavage and deprotection as well as purification was achieved by methods known in the field (Wincott F., et al, NAR 1995, 23,14, 2677-84).
The amino-modified RNA was characterized by anion exchange HPLC (purity: 96.1%) and identity was confirmed by ESI-MS ([M+H] l+ calculated: 6937.4; [M+H] 1+measured: 6939.0. Sequence: 5'-(NH2C6)GGAAUCuuAuAuuuGAUCcAsA-3 '; u, c: 2'-0-methyl nucleotides of corresponding RNA nucleotides, s: phosphorthioate.
General experimental conjugation procedure
The title compounds of examples 1-33 were coupled via the amino-modified RNA according the following procedure: RNA equipped with a C-6 aminolinker at the 5'-end (16.5 mg, 1 equivalent) is dissolved in 500 L DMSO and 150 lL water. The p-Nitrophenylcarbonate derivative (10 equivalents) dissolved in 1 mL DMSO is added followed by 8 DIPEA. The reaction mixture is shaken at 35°C in the dark and monitored using RP-HPLC (Resource RPC 3 mL, buffer: A: 0.1M TEAA in water, B: 0.1M TEAA in 95% ACN, gradient: 3% B to 100% B in 20 CV). Once the reaction is gone to completion the RNA conjugate is precipitated using sodium acetate (3 M) in EtOH at -20°C. For examples lacking a MMT protecting group in the dipeptide motif the corresponding conjugates are purified using the conditions described above. Pure fractions are pooled and the material is precipitated using sodium acetate/EtOH to give the desired RNA conjugate. RNA conjugates containing a MMT protecting group in the dipeptide sequence are further processed according to the procedure given below.
General procedure for MMT cleavage
The crude RNA conjugate pellet is dissolved in 500 water and 1.5 mL sodium acetate buffer (3 M, pH 5.2 or 0.1M, pH 4.0). The solution is shaken for 2 days at 30°C. The reaction mixture is monitored using RP-HPLC (Resource RPC 3 mL, buffer: A: 0.1M TEAA in water, B: 0.1M TEAA in 95% ACN, gradient: 3% B to 100% B in 20 CV). After complete cleavage of the MMT protecting group the RNA conjugate is directly purified using the conditions just mentioned above. Pure fractions are pooled and the desired conjugate is precipitated using sodium acetate/EtOH.
As a control a RNA conjugate lacking the dipeptide motif was synthesized. For this purpose cholesterol was attached to the 5 '-end via a linker described in the literature (Nature Biotech, 2007, 25, 1149). This conjugate is referred to as "non-cleavable".
All the RNA conjugates were analyzed by RP HPLC for purity and identity was confirmed by ESI MS (negative mode). Briefly, RP-HPLC was performed on a Dionex Ultimate system (Dionex, Idstein, Germany) equipped with a XBridge C18 column (2.5 x 50mm, 2.5 μιη particle size, Waters, Eschborn, Germany) at 65°C column temperature. Gradient elution was performed using 100 mM hexafluoroisopropanol (HFIP) and 16 mM triethylamine in 1% methanol as eluent A and in 95% methanol as eluent B (1% B to 18%B in 30 minutes). UV detection was recorded at 260 nm. For mass spectrometric analysis a ThermoFinnigan LCQ DecaXP ESI-MS system with micro-spray source and ion trap detector was coupled online to the HPLC system.
Examples of specific compounds of formula (Ila) are disclosed in table 1. The resulting compounds are referred to "di-peptide containing cholesterol siRNA conjugates" , wherein the specific di-peptide containing cholesterol siRNA conjugates are further referred to as "Title compound example X- (NHC6)-(siRNA sequence)" and "siRNA with Title compound of Example X". siRNA preparation
Antisense sequence: 5'-uuGGAUcAAAuAuAAGAuUCcscsU-3 '
u, c: 2'-0-methyl nucleotides of corresponding RNA nucleotides, s: phosphorthioate The di-peptide containing cholesterol siRNA conjugates directed against the apolipoprotein B mRNA were generated by mixing an equimolar solution of complementary strands in annealing buffer (20 mM sodium phosphate, pH 6.8; 100 mM sodium chloride), heated in a water bath at 80-85°C for 3 minutes and cooled to room temperature over a period of 3 - 4 hours. Duplex formation was confirmed by native gel electrophoresis.
All prepared di-peptide containing cholesterol siRNA conjugates are listed in table 2.
Table 1: Di-peptide containing cholesterol siRNA conjugates (5' -3') and analytical data. Key: lower case letters a, c, g, u, are 2'-0-Methyl nucleotides; A phosphorothioate linkages is symbolized with a lower case "s". (NHC6) is the aminohexyl linker incorporated at the 5 '-end of the sense strand.
Figure imgf000085_0001
Table 2: Di-peptide containing cholesterol siRNA conjugates . The last entry (SEQ ID NO pair 266/154) represents a siRNA conjugate lacking the di-peptide motif. Key: lower case letters a, c, g, u, are 2'-0-Methyl nucleotides; A phosphorothioate linkages is symbolized with a lower case "s". (NHC6) is the aminohexyl linker incorporated at the 5' -end of the sense strand.
SEQ ID SEQ ID
No Sense sequence (5'— 3') No Antisense sequence (5'— 3')
(Title compound E l6)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGG AUc A A Au Au A AG AuUCcsc sU
(Title compound Ex 31)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUc AA Au Au AAGAuUCcsc sU
(Title compound Ex 33)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
(Title compound Ex 32)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGG AUc A A Au Au A AG AuUCcsc sU
(Title compound Ex 17)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
(Title compound Ex 30)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
(Title compound Ex 27)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
(Title compound Ex 28)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
(Title compound Ex 29)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGG AUc A A Au Au A AG AuUCcsc sU
(Title compound Ex 1)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGG AUc A A Au Au A AG AuUCcsc sU
(Title compound Ex 2)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGG AUc A A Au Au A AG AuUCcsc sU
(Title compound Ex 3)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
(Title compound Ex 4)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
(Title compound Ex 5)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGG AUc A A Au Au A AG AuUCcsc sU
(Title compound Ex 6)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUc AA Au Au AAGAuUCcsc sU
(Title compound Ex 7)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
(Title compound Ex 8)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
(Title compound Ex 9)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
(Title compound Ex 10)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGG AUc A A Au Au A AG AuUCcsc sU
(Title compound Ex 1 1)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
(Title compound Ex 12)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
(Title compound Ex 13)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGG AUc A A Au Au A AG AuUCcsc sU
(Title compound Ex 14)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGG AUc A A Au Au A AG AuUCcsc sU
(Title compound Ex 24)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGG AUc A A Au Au A AG AuUCcsc sU
(Title compound Ex 23)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
(Title compound Ex 22)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU SEQ ID SEQ ID
No Sense sequence (5'— 3') No Antisense sequence (5'— 3')
(Title compound Ex 26)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUc A A Au AuAAGAuUCcsc sU
(Title compound Ex 25)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGG AUc A A Au Au A AG AuUCcsc sU
(Title compound Ex 20)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
(Title compound Ex 19)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
(Title compound Ex 18)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
(Title compound Ex 21)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uGGAUcAAAuAuAAGAuUCcscsU
(Title compound Ex 15)(NHC6)
GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
(Chol)GGAAUCuuAuAuuuGAUC
266 cAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
Example 35: In vivo experiments
Co-Administration of di-peptide containing cholesterol siRNA conjugates and delivery polymer in vivo.
Six to eight week old mice (strain C57BL/6 or ICR, -18-20 g each) were obtained from Harlan Sprague Dawley (Indianapolis IN). Mice were housed at least 2 days prior to injection. Feeding was performed ad libitum with Harlan Teklad Rodent Diet (Harlan, Madison WI).
Mice (n=3 per group) were injected with a mixture of 0.2 mL solution of delivery polymer and 0.2 ml di-peptide containing cholesterol siRNA conjugates . The injected dose was, unless otherwise stated, 15 mg/kg for the delivery polymer and 0.1 mg/kg with respect to the di-peptide containing cholesterol siRNA conjugates . Solutions were injected by infusion into the tail vein. 48 hours post injection serum ApoB levels were measured relative to isotonic glucose treated animals according to the procedure below.
Serum ApoB levels determination.
Mice were fasted for 4 h before serum collection by submandibular bleeding. Serum ApoB protein levels were determined by standard sandwich ELISA methods. Briefly, a polyclonal goat anti-mouse ApoB antibody and a rabbit anti-mouse ApoB antibody (Biodesign International) were used as capture and detection antibodies respectively. An HRP-conjugated goat anti-rabbit IgG antibody (Sigma) was applied afterwards to bind the ApoB/antibody complex. Absorbance of tetramethyl-benzidine (TMB, Sigma) colorimetric development was then measured by a Tecan Safire2 (Austria, Europe) microplate reader at 450 nm. In figure 1 various di-peptide containing cholesterol siRNA conjugates were benchmarked against the same siRNA conjugated to cholesterol but lacking the cleavable motif elaborated earlier in this section. The effect of this siRNA conjugate (SEQ ID NO pair 266/154, "non- cleavable control") on serum ApoB levels was set to 1 in order to evaluate the influence of the di-peptide containing conjugates relative to the non-cleavable control. Substituting the initially used Phe-Lys motif (siRNA with Title compound of Example 16) with the corresponding D- amino acids (siRNA with Title compound of Example 14) or just replacing the Lys with the unnatural enantiomer (siRNA with Title compound of Example 30) yielded ApoB reduction less pronounced or equivalent to the non-cleavable control siRNA. Replacing Lys by Gly (siRNA with Title compound of Example 23) or Phe by p-Methoxyphenylalanine (siRNA with Title compound of Example 13) reduced the potency compared to siRNA with Title compound of Example 16. Other di-peptide motifs containing siRNA conjugates were shown to be as efficacious as the original Phe-Lys containing conjugate.
Figure 2 summarizes di-peptide containing cholesterol siRNA conjugates that were as efficacious or had improved efficacy compared to siRNA with Title compound of Example 16 consisting of the Phe-Lys motif. All these conjugates were significantly more active compared to the "non-cleavable" cholesterol siRNA conjugate SEQ ID NO pair 266/154. The best performing di-peptide containing cholesterol siRNA conjugates had a fluorine modified phenyl ring in the Phy-Lys motif (siRNA with Title compound of Example 8, siRNA with Title compound
Example 9) or had the phenylalanine substituted with beta- phenylalanine (siRNA with Title compound of Example 11) or a derivative thereof (siRNA with Title compound of Example 10).
Since di-peptide containing cholesterol siRNA conjugates with di-peptide motifs consisting of D-amino acids are performing equal to the non-cleavable control conjugate it is conceivable that the other di-peptide sequences are indeed cleaved by a protease activity in vivo. However, given the broad acceptance of different amino acids and derivatives thereof it is likely that more than one enzyme is participating in the cleavage reaction as suggested in the literature (Bioconjugate Chem. 2002,13,855). As shown in figure 3, the incorporation of a Cathepsin cleavable di-peptide motif (in this case Phe-Lys, siRNA with Title compound of Example 16) between the siRNA and the small molecule ligand cholesterol boosts the potency of the siRNA conjugate compared to the straight cholesterol siRNA conjugate (SEQ ID NO pair 266/154). Further spacing of the cholesterol ligand from the di-peptide motif by means of PEG based linkers diminishes the potency proportional to the length of the PEG linker.
In figure 4 the polymer dose was kept constant at 15 mg/kg. The siRNA dose was titrated and the effect on serum ApoB content was measured. The Di-peptide containing cholesterol siRNA conjugates containing the Phe-Lys (F-K) motif was significantly more potent compared to the control conjugate lacking the di-peptide sequence.
Example 36: 2'-modified oligoribonucleotide synthesis Oligoribonucleotides were synthesized according to the phosphoramidite technology on solid phase. Depending on the scale either an ABI 394 synthesizer (Applied Biosystems) or an AKTA oligopilot 100 (GE Healthcare, Freiburg, Germany) was used. Syntheses were performed on a solid support made of controlled pore glass (CPG, 520A, with a loading of 75 μιηοΐ/g, obtained from Prime Synthesis, Aston, PA, USA). All 2'-modified RNA phosphoramidites as well as ancillary reagents were purchased from SAFC (Hamburg, Germany). Specifically, the following 2'-OMethyl phosphoramidites were used: (5'-0-dimethoxytrityl-N6-(benzoyl)-2'-C)-methyl- adenosine-3'-0-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, 5'-0-dimethoxytrityl- N4-(acetyl)-2' -Omethyl-cytidine-3 ' -0-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, (5'-0-dimethoxytrityl-N2-(isobutyryl)-2'-C)-methyl-guanosine-3'-C)-(2-cyanoethyl-N,N- diisopropylamino) phosphoramidite, and 5'-0-dimethoxytrityl-2'-0-methyl-uridine-3'-C>-(2- cyanoethyl-N,N-diisopropylamino) phosphoramidite. The 2'-Deoxy-2'-fluoro-phosphoramidites carried the same protecting groups as the 2'-(9-methyl RNA amidites. All amidites were dissolved in anhydrous acetonitrile (100 mM) and molecular sieves (3A) were added. To generate the 5'-phosphate the 2-[2-(4,4'-Dimethoxytrityloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)- (N,N-diisopropyl)-phosphoramidite from Glen Research (Sterling, Virginia, USA) was used. In order to introduce the C-6 aminolinker at the 5 '-end of the oligomers the 6- (Trifluoroacetylamino)-hexyl-(2-cyanoethyl)-(N,N-diisopropyl)- phosphoramidite from Thermo Fisher Scientific (Milwaukee, Wisconsin, USA) was employed. The 5 '-modifications were introduced without any modification of the synthesis cycle. 5-Ethyl thiotetrazole (ETT, 500 mM in acetonitrile) was used as activator solution. Coupling times were 6 minutes. In order to introduce phosphorothioate linkages a 50 mM solution of 3-((Dimethylamino-methylidene)amino)-3H-l,2,4-dithiazole-3-thione (DDTT, obtained from AM Chemicals, Oceanside, CA, USA) in anhydrous Acetonitrile/pyridine (1: 1 v/v) was employed.
Example 37: Cleavage and deprotection of support bound oligomer.
After finalization of the solid phase synthesis, the dried solid support was transferred to a
15 mL tube and treated with concentrated aqueous ammonia (Aldrich) for 18 hours at 40°C. After centrifugation the supernatant was transferred to a new tube and the CPG was washed with aqueous ammonia. The combined solutions were evaporated and the solid residue was
reconstituted in buffer A (see below). Example 38: Purification of oligoribonucleotides
Crude oligomers were purified by anionic exchange HPLC using a column packed with Source Q15 (GE Helthcare) and an AKTA Explorer system (GE Helthcare). Buffer A was 10 mM sodium perchlorate, 20 mM Tris, 1 mM EDTA, pH 7.4 (Fluka, Buchs, Switzerland) and contained 20% Acetonitrile and buffer B was the same as buffer A with the exception of 500 mM sodium perchlorate. A gradient of 22%B to 42%B within 32 column volumes (CV) was employed. UV traces at 280 nm were recorded Appropriate fractions were pooled and precipitated with 3M NaOAc, pH=5.2 and 70% Ethanol. Finally, the pellet was washed with 70% Ethanol.
Example 39: Annealing of oligoribonucleotides to generate siRNA Complementary strands were mixed by combining equimolar RNA solutions. The mixture was lyophilized and reconstituted with an appropriate volume of annealing buffer (100 mM NaCl, 20 mM sodium phosphate, pH 6.8) to achieve the desired concentration. This solution was placed into a water bath at 95 °C which was cooled to rt within 3h.
Example 40: In vitro activity of siRNAs devoid of 2'-OH residues
In order to investigate if siRNAs lacking any 2'-OH residues show potent in vitro knock down activity, we tested a panel of EGFP mRNA-targeted siRNAs with different 2 '-modification chemistries (SEQ ID pairs 31/32 to 149/150, and see Table 3 for examples). The siRNAs were screened for sense and antisense activity with the Dual-Glo® Luciferase Assay System (Promega) using the psiCHECK2 vector (Promega) in COS7 cells (DSMZ, Braunschweig, Germany, cat. No. ACC-60). To address the silencing activity conferred by sense and antisense strand we cloned each corresponding 19mer target site sequence as separate psiCHECK2 construct (psiCHECK2-AT for antisense activity, psiCHECK2-ST for sense activity) into the multiple cloning region located 3 ' to the translational stop codon of the synthetic Renilla luciferase. By using Lipofectamine 2000 (Invitrogen GmbH, Karlsruhe, Germany, cat. No. 11668-019) COS7 cells were co-transfected with vector construct and 3nM of the corresponding siRNA complementary to the cloned target site. Successful siRNA-mediated silencing was determined 24 hours after transfection via the activity of the renilla luciferase normalized to firefly luciferase levels to take transfection efficiency into account (see Figure 5a for antisense activity and Figure 5b for sense activity).
Table 3: Exemplary siR A sequences and chemical modifications used for determination of in vitro knock down activity dependent on 2' -modifications. Reference duplices and selected examples of corresponding modification variants used in this study. Xf indicates a 2'-fluoro modification of the nucleotide X, small letters indicate a 2'-0-methyl modification, underlined letters indicate a DNA nucleotide, all other capital letters indicate ribonucleotides. The letter "p" indicates a 5 '-phosphate.
RNA duplices unmod 5'- UGCCCAUCCUGGUCGAGCUTT -3'
3'- TTACGGGUAGGACCAGCUCGAp -5'
F/OMe 5'- UfgCfcCfaUfcCfuGfgUfcGfaGfcUfTsT -3' 3 ' TsTaCfgGfgUfaGfgAfcCfaGfcUfcGfap 5 '
F/DNA 5 ' UfGCfCCfAUfCCfUGfGUfCGfAGfCUfTsT
3 ' TsTACfGGfGUfAGfGAfCCfAGfCUfCGfAp 5 '
DNA/OMe 5 ' UgCcCaUcCuGgUcGaGcUTsT -3'
3 ' TsTaCgGgUaGgAcCaGcUcGap 5 '
It was found that the 5 most potent modified siRNAs (> 60% knock-down) were designed in an alternating 2'-fluoro/2'-0-methyls (2'F/2'-OMe) pattern. While conferring antisense activity, this chemistry fully eliminated the activity of the corresponding sense strands, as shown by lack or minimal renilla luciferase activity for all tested 2'F/2'-OMe variants.
We concluded that such 2'F/2'-OMe pattern is promoting the siRNA's intended antisense strand activity while undesired off-target effects coming from the sense strand are fully suppressed. This design is specifically preferable for siRNAs, that come with the need for protection against 2'O-directed nucleolytic cleavage. Example 41: Detection of DNAse II-sensitive sites by in vitro assay
An ion pairing (IP) reversed phase (RP) high performance liquid chromatography (HPLC) coupled to an electrospray ionization (ESI) mass spectrometry (MS) or an anion exchange (AEX)-HPLC based method was established to test the in vitro stability of selected single and double stranded RNAs.
Method description: For stability analysis a 10 μΜ solution of either single stranded or double stranded RNA was incubated at 37°C in 5mM sodium acetate buffer solution (pH 4.5) containing 0.8 or 8 units DNase II (from bovine spleen, Type V, Sigma Aldrich). The incubation reaction was stopped by adding a 100 mM triethyl ammonium acetate (TEAA) solution, shifting the pH to 7 and inactivating the DNase II enzyme. Analysis was done by either LC/MS combined with UV-detection or by AEX-HPLC with UV-detection. UV-detection traces at 260 nm were used for quantitative analysis, MS data served for cleavage site identification within the RNA sequence. A. IP-RP-HPLC was done employing a Waters XBridge Ci8 column (2.5 x 50 mm, 2.5 μιη particle size) at 65°C column temperature. Gradient elution was performed using 100 mM hexafluoroisopropanol (HFIP) and 16 niM triethylamine in 1% methanol as eluent A and composition A in 95% methanol as eluent B. A gradient from 1% B to 18% B in 30 minutes was employed.
B . AEX-HPLC was performed on a Dionex DNA Pac200 column (4 x 250 mm) at 50°C using a 20 mM phosphate buffer containing 10% ACN at pH=l l . Eluent B contained 1 M NaBr in eluent A. . A gradient from 25 to 62% B in 18 minutes was employed.
Table 4: Duplexes and the remaining intact strandsevaluated for their stability against DNase II. Key: lower case letters a, c, g, u, are 2'-0-Methyl nucleotides; Upper case letters A, C, G, U followed by "f " indicates a 2'-fluoro nucleotide. Lower case "p" indicates a 5'-phosphate. (invdT) represents an inverted deoxythimidine (3 '-3 '-linked). A phosphorothioate linkages is symbolized with a lower case "s". dT is deoxythimidine. (NHC6) is the aminohexyl linker incorporated at the 5 '-end of the sense strand.
Figure imgf000093_0001
Conclusions:
A. RNA strands containing at least one 2' -OH nucleotide (e.g. both strands of SEQ ID NO piar 157/158) are rapidly degraded via a cyclic pentavalent intermediate, leading to 2'-3 ' cyclic phosphates at the 5 '-cleavage product. The formation of the pentavalent intermediate can be inhibited using nucleotides lacking a 2'-OH group, like e.g. 2'-deoxy, 2'-OMe or 2'-F. B. Additionally, RNA is degraded via a 5'-exonucleolytic pathway, that is independent from the 2' -modification on the 5'-terminal nucleotides. This degradation pathway can be inhibited using 5'-terminal non-nucleotide moieties, like e.g. a C6-aminolinker (e.g. SEQ ID NO 160 in SEQ ID NO pair 160/159 or SEQ ID NO 165 in SEQ ID NO pair 165/166) or a phosphorothioate at the first internucleotide linkage (e.g. SEQ ID NO 160 in SEQ ID NO pair 160/159).
C. A 5'-phosphate group slows down the exonucleolytic cleavage kinetics, but can not fully block the degradation starting at this end (e.g. SEQ ID NO 160 in SEQ ID NO pair 160/159). This is most probably due to the cleavage of the 5 '-phosphate by either phosphatases or by an inherent phosphatase activity of the DNase II enzyme.
D. The best protection for RNA strands was achieved with oligonucleotides containing no 2'-OH nucleotide within the strand, starting with a 2'-OMe nucleotide at the 5 '-end connected by a phosphorothioate linkage to the second nucleotide (e.g. SEQ ID NO 173 in SEQ ID NO pair 173/174). Other terminal non-2'-OH nucleotides also protect against the 5'-exo degradation, but to a lower extent compared to the 2'-OMe modification (refer to Table 9)
Example 42: In vivo knock down activity of siRNAs devoid of 2'-OH residues
In vivo experiments were conducted with mice injected with Factor VII (F VII) -targeting siRNAs (SEQ ID NO pairs 179/166 and 180/168, see Table 5) co-administered with DPC-GalNac. Table 5 a: Sequences of siRNAs for in vivo experiment. Key: lower case letters a, c, g, u, are -O- Methyl nucleotides; Upper case letters A, C, G, U followed by "f " indicates a 2'-fluoro nucleotide.
Lower case "p" indicates a 5'-phosphate. (invdT) represents an inverted deoxythimidine (3' -3' -linked). A phosphorothioate linkages is symbolized with a lower case "s". dT is deoxythimidine. (NHC6) is the aminohexyl linker incorporated at the 5 '-end of the sense strand. GalNAc refers to the structure in formula (IV).
SEQ ID SEQ ID Sequence 5'->3'
NO pair NOs
179 GalNAc-(NHC6)- GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT)
179/166
166 puGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT)
180 GalNAc-(NHC6)-GcAAAGGcGuGccAAcucAdTsdT
180/168
168 UGAGUUGGcACGCCUUUGCdTsdT A FVII siRNA with an alternating 2'-OMe/2'-F pattern on sense and antisense strand was generated with a 5 '-terminal 2'-OMe nucleotide on the antisense and a 5 '-terminal 2'-F strand on the sense strand. Both strands are protected by an inv(dT) at the 3 '-terminal overhang. The antisense strand was bearing a 5 '-phosphate group to maintain activity of the siRNA. The sense strand was conjugated to a GalNAc-palmitoyl construct at its 5 'end for targeting to hepatocytes by the asialyloglycoprotein-receptor. siRNA (2.5 mg/kg) was co-administered with GalNAc- targeted PBAVE (15 mg kg) in mice.
FVII mRNA measurements were done from liver homogenates using QuantiGene 1.0 branched DNA (bDNA) Assay Kit (Panomics, Fremont, Calif., USA,Cat-No: QG0004). At necropsy 1-2 g liver tissue was snap frozen in liquid nitrogen. Frozen tissue was powderizedwith mortar and pistil on dry ice. 15-25 mg of tissue was transferred to a chilled 1,5 mL reaction tube, 1 mL 1:3 Lysis Mixture prediluted in MilliQ water and 3,3 μΐ^ Proteinase K(50μg/μL) was added and tissue was lysed by several seconds ultrasound sonication at 30-50% power (HD2070, Bandelin, Berlin, Germany). Lysates were stored at -80°C until analysis. For mRNA analysis lysate was thawed and digested with Proteinase K for 15min at 1000 rpm in a thermomixer at 65 °C (Thermomixer comfort, Eppendorf, Hamburg, Germany). FVII and GAPDH mRNA levels were determined using QuantiGene 1.0 bDNA Assay Kit reagents according to the manufacturer's recommendations. FVII mRNA expression was analyzed using 20 μΐ^ lysate and a mouse FVII probe set. GAPDH mRNA expression was analysed using 40 lysate and rattus norwegicus probe sets shown to be cross-react with mice (sequences of probesets see above). As assay readout the chemiluminescence signal at end of the assay was measured in a Victor 2 Light luminescence counter (Perkin Elmer, Wiesbaden, Germany) as relative light units (RLU). The signal for FVII mRNA was divided by signal for GAPDH mRNA from the same lysate Values are reported as FVII mRNA expression normalized to GAPDH. Results demonstrate a 79% FVII mRNA knock down at 48 hours post dosing after administration of SEQ ID NO pair 179/166. In contrast,the 2'-OH nucleotide bearing siRNA SEQ ID NO pair 180/168 showed no significant knock down (< 25 %), as shown in Table 5.
Table 5 b: Results of in vivo knockdown studies
SEQ ID NO SEQ ID NO
pair 179/166 pair 180/168 Time Remaining Remaining
[hour] mRNA [%] mRNA [%]
1 84 92
6 83 88
24 53 100
48 21 76
Example 43: Tissue distribution of siRNAs devoid of 2'-OH residues
The siRNA concentration in the liver tissue samples was determined using a proprietary oligonucleotide detection method as described in WO2010043512. Briefly, the siRNA quantification is based on the hybridization of a fluorescently (Atto-425) labeled PNA-probe (Atto425-00-GCAAAGGCGTGCCAACT, obtained from Panagene Inc. Korea) complementary to the antisense strand of the siRNA duplex, followed by AEX-HPLC based separation. Quantification was done by fluorescence detection against an external calibration curve that was generated from a dilution series of the two FVII siRNA used in the in vivo experiment (see example 42). For plasma samples between 0.2 to 2 μL· and for tissue ~ lmg aliquots were injected onto the HPLC system.
Liver tissue analysis of the stabilized siRNA lacking 2'-OH nucleotide showed high concentrations of intact antisense strand in the liver in the ug/g range, but - 95% was present in the 5'-dephosphorylated inactive form (see table IR.04). The resulting RNA with a terminal 2'- OMe nucleotide is not prone for rephosphorylation in the cytoplasm by the phosphokinase hClpl (see below). In contrast, the antisense strand of the 2' -OH containing siRNA was completely degraded in the tissue within the first 6 hours post dosing.
Table 6: Liver tissue analysis of the stabilized siRNA containing no 2' -OH nucleotide
SEQ ID NO pair 181/186 in SEQ ID NO pair 181/185 in
Liver [ng/g] Liver [ng/g] Time [hour] - 5'-Phosphat + 5'-Phosphat - 5'-Phosphat + 5'-Phosphat
1 873 171 9 BDL
6 1351 106 BDL* BDL
24 1043 65 BDL BDL
48 1062 66 BDL BDL
* BDL = below detection limit
Example 44: In vitro knock down activity of siRNAs with optimized 5'-ends
An additional in vitro screen for FVII siRNAs was conducted in order to identify siRNAs that may be intracellularly (re-)phosporylated at the antisense' s 5 '-end to result in the RNAi- competent species All siRNAs from this screen are shown in Table 7. The alternating 2'-OMe / 2'-F modification pattern was identical to the 1st generation design (without any 2'-OH residues) with exception of various modifications at the first two nucleotides at the 5 '-end of the antisense strand. The two 5 '-terminal nucleotides of the antisense strand were generated as 2'-F or 2'- deoxy modified nucleotides in various combinations with and without an additional 5'-phosphate or 5'-phosphothioate. All siRNAs were screened in dose response (24 nM to 0.00037 nM in 4fold dilutions) for knock down activity after transfection of primary mouse hepatocytes (30000 cells per well; 96 well plate formate) using Lipofectamine 2000 according to the manufacturer's instructions. Two siRNAs were comparable active to the parental duplex (SEQ ID NO pair 182/168); comparable active siRNAs: SEQ ID NO pairs 181/186 and 181/185) in terms of IC50 values, one with a 5'-terminal 2'-F and a phosphate group and one with two 5'-terminal 2'- deoxy nucleotides and a 5'-phosphorothioate (see Table 7 for IC50 values). Both of them are ~5- 6-fold more active compared to the siRNA (SEQ ID NO pair 181/166) used in the first animal experiment with the terminal 2'-OMe nucleotide.
Table 7: IC 50 values
Figure imgf000098_0001
Example 45: In vitro 5 '-phosphorylation of siRNAs with optimized 5'-termini All siRNAs without a 5'-phosphate or 5'-phosphorothioate listed in Table 7 were assessed for phosphorylation by hClpl in a HeLa S lOO cell extract.
5 '-phosphorylation s was analyzed from S lOO HeLa extracts as described by Weitzer and Martinez (S. Weitzer and J. Martinez. hClpl: a novel kinase revitalizes RNA metabolism. Cell Cycle 6 (17):2133-2137, 2007). Directly after incubation of 1 μΜ siRNAs in the S lOO HeLa extract containing 5mM ATP, the solution was analyzed by either IP-RP-HPLC or AEX-HPLC under denaturing conditions by injection of 5 sample solution :
A. IP-RP-HPLC was done employing a Waters XBridge C18 column (2.5 x 50 mm, 2.5 μηι particle size) at 65°C column temperature. Gradient elution was performed using 100 mM hexafluoroisopropanol (HFIP) and 16 mM triethylamine in 1% methanol as eluent A and composition A in 95% methanol as eluent B. A gradient from 1% B to 18% B in 30 minutes was employed.
B. AEX-HPLC was performed on a Dionex DNA Pac200 column (4 x 250 mm) at 50°C using a 20 mM phosphate buffer containing 10% ACN at pH=l l. Eluent B contained 1 M NaBr in eluent A. . A gradient from 25 to 62% B in 18 minutes was employed.
The ratio of 5 '-phosphorylation is calculated for each strand of a siRNA from the UV trace at 260nm using the following equitation (PA is peak area):
% (5'-phophorylation) = 100 * PA [5'-phosphorylated strand] / (PA [5'-phosphorylated strand] + PA [parent strand] )
In Table 8 is shown, that the antisense strand of an siRNA cannot be 5'-phosphorylated, when a 2'-OMe nucleotide is located at the 5'-terminus (SEQ ID NO pair 181/196 and SEQ ID NO pair 181/195). In contrast the antisense strand is susceptible to 5 '-phosphorylation, when a 2'-F, 2'- deoxy or 2'-OH nucleotide is incorporated at the 5'-terminus (SEQ ID NO pair 181/195, SEQ ID NO pair 181/192, SEQ ID NO pair 181/197, SEQ ID NO pair 181/199 and SEQ ID NO pair 182/168). The two siRNAs, that were comparably active in the in vitro assay as the parental SEQ ID NO pair 182/168 (SEQ ID NO pair 181/186 and 181/185), are susceptible to 5'- phosphorylation once the synthetically introduced 5 '-phosphate / 5'-PTO group is cleaved in vivo, eg. by phosphatases. Table 8: Percentage of 5'-phosphorylated strand after 4 hours incubation in SlOO HeLa cell extract. Key: lower case letters a, c, g, u, are 2'-0-Methyl nucleotides; Upper case letters A, C, G, U followed by "f " indicates a 2'-fluoro nucleotide. (in vdT) represents an inverted deoxythimidine (3 '-3 '-linked). A phosphorothioate linkages is symbolized with a lower case "s". dT is deoxythimidine.
Figure imgf000100_0001
Example 46: In vitro DNAse II-stability of siRNAs with optimized 5' ends
All antisense strands were screened for DNAse II stability as described in example 41. The two antisense strands present in the siRNAs that were comparable active to the parental duplex (SEQ ID NO 186 and SEQ ID NO pair 185 one with a 5'-terminal 2'-F and a phosphate group and one with two 5 '-terminal 2'-deoxy nucleotides and a 5'-phosphorthioate are stable towards DNAse II cleavage II (> 70% intact strand after 20 hr incubation).
Table 9: In vitro stability of siRNAs towards DNase II after 20 hours incubation Sense Antisense
SEQ ID SEQ ID
NO NO Sequence (5'-3') % intact strand
181 192 UfsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 11
181 197 dTsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 0
181 199 dTsdGaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 0
181 193 psUfsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 106
181 187 psdTsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 96
181 194 psdTsdGaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 101
181 191 psUfGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 100
181 198 psdTGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 95
181 186 psdTdGaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 99
181 185 pUfsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 71
181 189 pdTsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 74
181 188 pdTsdGaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 64
Example 47: In vivo knock down activity of siRNAs with optimized 5' ends
In order to evaluate if the in vitro improvement by optimized 5 '-ends transfers to the in vivo situation, we conducted further mouse experiments with GalNAc-palmitoyl conjugates of selected siRNAs (see Table 10). SiRNAs were administred as under identical conditions as described for the first mouse experiment (example 42, this patent application).
For measurement of FVII levels, plasma samples from mice were prepared by collecting blood (9 volumes) by submandibular bleeding into microcentrifuge tubes containing 0.109 mol/L sodium citrate anticoagulant (1 volume) following standard procedures. FVII activity in plasma was measured with a chromogenic method using a BIOPHEN VII kit (Hyphen BioMed/Aniara, Mason, OH) following manufacturer's recommendations. Absorbance of colorimetric development was measured using a Tecan Safire2 microplate reader at 405 nm.
The siRNAs under investigation showed improved in vivo activity, fully correlating with the in vitro screening results. FVII activity in serum was reduced by more than 80% for both siRNAs 48 hours post dosing, compared to 49% using the first generation DNase II stable siRNA design (see Table 10). This result clearly underscores the importance of a 5'-terminal nucleotide on the antisense strand that can be effectively phosphorylated, in case phosphatases in vivo cleave the synthetically generated 5'-phosphate or 5'-phosphofhioate group. In case of a 5'- terminal 2'-OMe nucleotide as used in the first design or describedin the literature as a more potent siRNA design based on in vitro comparison with canonical siRNAs. (Allerson et al. J. Med Chem. 2005, 48, 901-904), the cleavage of the synthetic phosphate in vivo would lead to a strong reduction in potency of the corresponding siRNA. .
Table 10: In vivo knockdown activity of siRNAs with optimized 5'ends. Key: lower case letters a, c, g, u, are 2'-0-Methyl nucleotides; Upper case letters A, C, G, U followed by "f " indicates a 2'-fluoro nucleotide. Lower case "p" indicates a 5 '-phosphate. (invdT) represents an inverted deoxythimidine (3'- 3'-linked). A phosphorothioate linkages is symbolized with a lower case "s".(NHC6) is the aminohexyl linker incorporated at the 5 '-end of the sense strand.GalNAc refers to the structure in formula (IV).
Figure imgf000102_0001
Example 48: In vitro knock down activity of siRNAs with optimized 3' ends
To further increase activity of the DNase II stable siRNAs an SAR study of the 3 '-overhang was performed. Various combinations of invdT, dTinvdT or dTsdT on either the sense or the antisense strand 3'-overhang were applied to Ahal- and EGFP-targeting siRNAs (see Tables 1 1 and 12, respectively) and were pairwise compared for composition of both 3 'ends in most potent siRNAs. All siRNAs were screened in dose response (24nM to 0.00037 nM in 4-fold dilutions) for knock down activity after transfection of primary mouse hepatocytes (30000 cells/well; 96 well plate format) using Lipofectamine2000 according to the manufacturer's instructions. Table 11 : In vitro knock down activity of EGFP-targeting siRNAs with different 3 '-ends.
SEQ m O I Sense strand sequence (5 '-3') SEQ m O (Antisense strand sequence (5 '-31 | IC50 [nM]
45 GCUGGAGUUCGUGACCGCCdTdT 46 GGCGGUCACGAACUCCAGCdTdT 1 ,0490 212 GcuGGAGuucGuGAccGccdTsdT 225 GGCGGUcACGAACUCcAGCdTsdT # /A
201 gcUfgGfaGfuUfcGfuGfaCfcGfcCf(irwdT) 221 dGsGfcGfgUfcAfcGfaAfcUfcCfaGfc(invdT) 0,4377 201 gcUfgGfaGfuUfcGfuGfaCfcGfcCf(invdT) 214 dGsGfcGfgUfcAfcGfaAfcUfcCfaGfcdTsdT 0,1479
21 1 gcUfgGfaGfuUfcGfuGfaCfcGfcCfdT(invdT) 223 dGsGfcGfgUfcAfcGfaAfcUfcCfaGfcdT(invdT) 0,5833 203 gcUfgGfaGfuUfcGfuGfaCfcGfcCfdTsdT 214 dGsGfcGfgUfcAfcGfaAfcUfcCfaGfcdTsdT 0,2166
204 Gfc Ufg Gfa Gfu Ufc Gfu Gfa Cfc Gfc Cf(i nvdT) 224 pGfsGfcGfgUfcAfcGfaAfcUfcCfaGfc(invdT) 0,9100 204 Gfc Ufg Gfa Gfu Ufc Gfu Gfa Cfc Gfc Cffi nvdT) 215 pGfsGfcGfgUfcAfcGfaAfcUfcCfaGfcdTsdT 0,2241
207 Gfc Ufg Gfa Gfu Ufc Gfu Gfa Cfc Gfc CfdT(invdT) 218 pGfsGfcGfgUfcAfcGfaAfcUfcCfaGfcdT(invdT) 0,3474 206 Gfc Ufg Gfa Gfu Ufc Gfu Gfa Cfc Gfc CfdTsdT 215 pGfsGfcGfgUfcAfcGfaAfcUfcCfaGfcdTsdT 0,2392
205 GfscUfgGfaGfuUfcGfuGfaCfcGfcCf(invdT) 220 GfsGfcGfgUfcAfcGfaAf UfcCfaGfc(invdT) 0,4251 205 GfscUfgGfaGfuUfcGfuGfaCfcGfcCffinvdT) 216 Gfs Gfc Gfg Ufc Afc Gfa Afc Ufc Cfa Gfc dTs dT 0,2349
210 Gfs cUfgGfaGfuUfcGfuGfaCfcGfcCfdT(i nvdT) 222 GfsGfcGfgUfcAfcGfaAfcUfcCfaGfctlT(invdT) 0,5230 209 GfscUfgGfaGfuUfcGfuGfaCfcGfcCfdTsdT 216 Gfs Gfc Gfg Ufc Afc Gfa Afc Ufc Cfa Gfc dTs dT 0,4937
200 gscUfgGfaGfuUfcGfuGfaCfcGfcCf(invdT) 217 pdGsGfcGfgUfcAfcGfaAfcUfcCfaGfc(invdT) 0,2643 200 gscUfgGfaGfuUfcGfuGfaCfcGfcCf(invdT) 213 pdGsGfcGfgUfcAfcGfaAfcUfcCfaGfc dTsdT 0,0936
208 gscUfgGfaGfuUfcGfuGfaCfcGfcCfdT(invdT) 219 pdGsGfcGfgUfcAfcGfaAfcUfcCfaGfcdT(invdT) 0,3776 202 gscUfgGfaGfuUfcGfuGfaCfcGfcCfdTsdT 213 pdGsGfcGfgUfcAfcGfaAfcUfcCfaGfcdTsdT 0,1569
Table 12: In vitro knock down activity of Ahal -targeting siRNAs with different 3'-ends.
SEQ ID NO I Sense strand sequence (5'-3') I SEQ ID NO Antisense strand sequence (5 '-3") IC50 [nM]
157 GGAuGAAGuGGAGAuuAGudTsdT 158 ACuAAUCUCcACUUcAUCCdTsdT 0,094
234 Gfg Afu Gfa Afg Ufg Gfa GfaUfu Afg Uf(i nvdT) 246 Afs CfuAfa Ufc UfcCfaCfuUfc Afu Cfc (i nvdT) 0,081 234 GfgAfuGfaAfgUfgGfaGfaUfuAfgUffmvdT) 240 AfsCfuAfaUfcUfcCfaCfuUfcAfuCfcdTsdT 0,036
233 Gfg Afu Gfa Afg Ufg Gfa GfaUfu Afg UfdT(invdT) 239 Afs CfuAfa Ufc UfcCfaCfuUfc Afu Cfc dT(invdT) 0,034 236 Gfg Afu Gfa Afg Ufg Gfa GfaUfu Afg UfdTsdT 240 Afs CfuAfa Ufc Ufc Cfa Cfu Ufc Afu Cfc dTs dT 0,040
231 Gfs gAfu GfaAfg Ufg GfaGfaUfuAfg Uf(i nvdT) 241 pAfs CfuAfa Ufc Ufc CfaCfuUfcAfu Cfc (i nvdT) 0,037 231 Gfs gAfu GfaAfg Ufg GfaGfaUfuAfg Uffi nvdT) 267 pAfs CfuAfa Ufc Ufc CfaCfuUfcAfu Cfc dTsdT 0,030
229 Gfs gAfu GfaAfg Ufg GfaGfaUfuAfg UfdT(invdT) 268 pAfs CfuAfa Ufc Ufc CfaCfuUfcAfu Cfc dT(invdT) 0,024
228 Gfs gAfu GfaAfg Ufg GfaGfaUfuAfg UfdTsdT 267 pAfs CfuAfa Ufc Ufc CfaCfuUfcAfu Cfc dTsdT 0,021
232 g gAfu GfaAfg Ufg GfaGfaUfuAfg Uf(i nvdT) 245 dAsCfu Afa Ufc Ufc Cfa CfuUfcAfu Cfc (invdT) 0,060 232 g gAfu GfaAfg Ufg GfaGfaUfuAfg UffinvdT) 238 d As Cfu Af a Ufc Ufc Cfa Cfu Ufc Afu Cfc dTs dT 0,030
237 g gAfu GfaAfg Ufg GfaGfaUfuAfg UfdT(invdT) 244 dAsCfu Afa Ufc Ufc Cfa CfuUfcAfu Cfc dT(invdT) 0,045
230 g gAfu GfaAfg Ufg GfaGfaUfuAfg UfdTsdT 238 d As Cfu Afa Ufc Ufc Cfa Cfu Ufc Afu Cfc dTs dT 0,025
227 gsgAfuGfaAfgUfgGfaGfaUfuAfgUfijnvdT) 243 pdAsCfuAfaUfcUfcCfaCfuUfcAfuCfc(mvdT) 0,045
227 gsgAfuGfaAfgUfgGfaGfaUfuAfgUfiinvdT) 266 p d As Cfu Afa Ufc Ufc Cfa Cfu Ufc Afu Cfc dTs dT 0,015
235 gsgAfuGfaAfgUfgGfaGfaUfuAfgUfdT(invdT) 242 pdAsCfuAfaUfcUfcCfaCfuUfcAfuCfcdT(invdT) 0,039 226 gsgAfuGfaAfgUfgGfaGfaUfuAfgUfdTsdT 266 p d As Cfu Afa Ufc Ufc Cfa Cfu Ufc Afu Cfc dTs dT 0,014
It was found, that siRNAs with 2 nucleotide dTsdT-overhangs on the antisense strand performed always better than those with a single invdT overhang at the antisense' s 3 '-end (while sense strands were the same). Further benefitial was the combination with a sense strand modified with a single invdT-overhang as 3 'overhang.
Example 49: In vivo knock down activity of siRNAs in non-human primates
Preparation of DPCs and dosing
DPCs were prepared by covalently attaching polymer "149 RAFT" to the indicated siRNA targeting coagulation Factor VII (siF7) at 4: 1 wt:wt ratio (polymer: siRNA) through a disulfide linkage and then modifying the polymer-siRNA conjugate with a 2: 1 wt:wt mixture of CDM- PEG:CDM-NAG at a 7x wt:wt ratio (CDM:polymer). Cynomolgous monkeys were dosed with 1 mg/kg DPC (polymer weight) and 0.25 mg/kg of the indicated siRNA. One animal received DPC containing siF7 SEQ ID NO pair 151/152, two animals received DPC containing siF7 SEQ ID NO pair 253/254), #1 and #2), and two animals received DPC containing SEQ ID NO pair 251/255, #1 and #2). F7 values were normalized to the average of the two pre-dose values. Animals receiving DPCs containing SEQ ID NO pair 253/254 or SEQ ID NO pair 251/255 had greater levels of F7 knockdown and longer PT than the animal receiving SEQ ID NO pair 251/252.
DPC Injection Procedure
For each injection procedure, animals were given an IM injection containing a combination of ketamine (up to 7 mg/kg) and dexmedetomidine (up to 0.03 mg/kg) and moved to a procedure room. In the procedure room, animals were placed on a water jacketed heating pad and the injection site was shaved and prepped with an antiseptic. An intravenous catheter (20 to 22 gauge) was inserted into a systemic vein (cephalic or small saphenous) and the DPC solution was infused (2 ml/kg) slowly over 1 to 2 minutes. A pulse oximeter was used to monitor the heart rate and oxygen saturation during and immediately following the injection procedure. Each injection procedure took about 20 minutes to perform. After injection the catheter was removed and gentle
pressure was applied to the venipuncture site. Animals were taken back to their cages and given an IM injection of the reversal drug atipamezole (antisedan) (0.10 to 0.15 mg/kg). Animals were monitored until they regained normal activity. Blood Collection Procedure
Blood samples (1-5 ml) were obtained for the measurement of gene inhibition (F7 activity, coagulation time), blood chemistries, and markers of liver damage (CBC, chemistry panel, ALT, cytokines, complement). For these blood collection procedures, animals were given an IM injection containing a combination of ketamine (up to 7 mg/kg) and dexmedetomidine (up to 0.03 mg/kg). Once sedated, animals were moved on to a portable procedure table and a 22 gauge needle and syringe were used to collect blood from the femoral vein. Immediately after the blood collection, pressure was applied to the venipuncture site and the blood was divided into the appropriate sample tubes for each blood test. Animals were then given an IM injection of the reversal drug atipamezole (antisedan) (0.10 to 0.15 mg/kg) and returned to their cage. No more than 20% of total blood volume was drawn in any 30-day period (estimated blood volume=60 ml/kg). Each blood collection procedure took about 10 minutes to perform. Factor VII (F7) activity measurements
Blood samples from non-human primates were prepared by filling serum separator tubes with whole blood and allowing the blood to clot at room temperature for at least 20 minutes. After clotting, blood tubes were centrifuged for 3 minutes at 9000 rpm, aliquoted into eppendorf tubes, and stored at -20 °C until assayed. F7 activity in serum was measured with a chromogenic method using a BIOPHEN VII kit (Hyphen BioMed/Aniara, Mason, OH) following manufacturer' s recommendations. Absorbance of colorimetric development was measured using a Tecan Safire2 microplate reader at 405 nm.
Coagulation tests (protime, partial protime and fibrinogen)
Blood samples from non-human primates were prepared by completely filling sodium citrate tubes (BD Vacutainer) with whole blood and gently mixing to prevent clot formation. Tubes were transported to a clinical testing lab within one hour and coagulation assays were performed within 4 hours from the time of collection.
Table 13:FVII SiRNA used for NHP experiment: Key: lower case letters a, c, g, u, are 2'-0-Methyl nucleotides; Upper case letters A, C, G, U followed by "f " indicates a 2' -fluoro nucleotide. Lower case "p" indicates a 5'-phosphate. (invdT) represents an inverted deoxythirmdine (3'-3'-linked). A
Figure imgf000105_0001
Changing from an single nucleotide (invdT)-3' -overhang on both strands to an asymmetric siRNA design with a 3 '-(invdT) overhang on the sense strand and a dTsdT overhang on the antisense strand, but otherwise constant modification pattern lead to a more pronounced serum FVII reduction and a significantly prolonged duration of this effect in non-human primates (see figure 6a). This observation is supported by an expected biologic consequence, namely a more pronounced effect on the prothrombin time corresponding to the extent of Factor 7 reduction (see figure 6b).
Example 50: In vivo knock down activity of siRNAs with cleavable RNA linkers In Table 14 the in vivo efficacy based on FVII protein inhibition in serum was compared using cholesterol or the GalNAc-palmitoyl siRNA conjugate in the same sequence context in mice. The in vivo experiment was conducted as described in example 42. FVII inhibition was strongly decreased for the cholesterol conjugated siRNAs containing no 2' -OH nucleotide compared to the GalNAc-palmitoyl conjugated counterparts (SEQ ID NO pair 179/166 vs. 179/190, SEQ ID NO pair 257/264 vs. SEQ ID NO pair 179/262, SEQ ID NO pair 257/263 vs. SEQ ID NO pair 179/163 and SEQ ID NO pair 257/166 vs. (SEQ ID NO pair 179/166). In contrast for a 2'-OH containing siRNA the cholesterol conjugate lead to higher FVII inhibition compared to the GalNAc-palmitoyl derivative (SEQ ID NO pair 180/168 vs. SEQ ID NO pair 258/168).
The small molecule ligands GalNAc-palmitoyl and cholesterol used in the described in vivo experiment are connected to the siRNA via a non-cleavable linker to the 5 '-end of the sense strand. In case the sense strand exhibit 2'-OH nucleotides the ligand is still cleavable by nucleases (e.g. DNase II in the endosomal or lysosomal compartment). The cleavage reaction releases the free siRNA that is then released into the cytoplasm by the endosomal perturbing activity of the delivery polymer.
For siRNAs lacking a 2' -OH nucleotide in the sense strand, the ligands are stably connected to the duplex, as no enzymatic (nuclease/protease/esterase etc.) or chemical mechanism triggers the cleavage of the ligand. Therefore, fully stable cholesterol conjugated siRNA can be trapped in cell membranes due to the membrane interaction of the lipophilic cholesterol ligand. Even high concentrations of the siRNA in the tissue is not sufficient for effective release of the siRNA into in the cytoplasm. In contrast, the less lipophilic GalNAc-palmitoyl conjugated siRNA can be released into the cytoplasm, due to a less pronounced interaction with cell membranes. For this reason a stable, non-cleavable GalNAc-palmitoyl siRNA conjugate is more efficacious compared to a cholesterol conjugated to the same siRNA. Developing cleavable linker constructs would help to circumvent the issue of membrane trapping for stably conjugated cholesterol siRNA. Using disulfide linker chemistry is described as an attractive possibility to introduce a defined cleavage site but cleavage is most probably restricted to the reducing environment of specific organelles within the cell (PNAS, 2006, 103, 13872). As cleavage is expected to be slow in the endosomal/lysosomal compartment most of the cholesterol-disulfide conjugated siRNA can still be trapped in membranes as described for the non-cleavable cholesterol conjugates.
Table 14
Figure imgf000107_0001
In addition to the well established disulfide cleavable linker chemistry another possibility is the generation of defined cleavage sites by using 2'-OH nucleotides at certain positions. Introduction of 2' -OH nucleotides at selective positions is a new approach to achieve cleavage of the conjugates from RNA strands. The 2'-OH nucleotides can either be implemented by adding single stranded overhangs with at least one 2'-OH-nucleotide at the 3'- or 5 '-end of the RNA strand or by using 2'-OH nucleotides within the duplex region of an siRNA. The enzymatic activity of nucleases present in the endosome / lysosome cleaves selectively at this positions. In a first design the cholesterol was connected to the sense strand via a single stranded overhang containing 3 2'-OH nucleotides (AUC) at the 5'-terminus.
Cholesterol conjugated siRNAs comparing various cleavable linker chemistries are shown in Table 15. All siRNAs have the identical sequence context, just the linker chemistry was altered. Cholesterol was connected to the sense strand via single stranded overhang comprised of a three 2'-OH nucleotides (AUC)to the 5'-terminus. When co-administered with a delivery polymer this siRNA (SEQ ID NO pair 260/263) lead to 77% FVII down modulation in serum in mice, compared to only 60% when using the identical siRNA with a stably attached cholesterol (SEQ ID NO pair 257/263). The same siRNA with a cholesterol conjugated via a linker according to formula la to the 5'-terminus of the sense strand (SEQ ID NO pair 261/263) lead to 93% FVII activity reduction in serum. All results were achieved by co-administration of 15 mg/kg of a delivery polymer with 2.5 mg/kg of the cholesterol conjugated siRNA in mice.
Table 15 In vivo comparison of various linker chemistries for cholesterol conjugated siRNAs
Figure imgf000108_0001
These results indicate, that the use of a cleavable linker improves the in vivo potency of siRNAs containing no 2'-OH nucleotide. The cleavable linker can either comprised of 2'-OH containing nucleotides, a di-peptide cleavage motive or a disulfide linker chemistry. All cleavable linker constructs improve the in vivo potency in a co-administration setup of a cholesterol conjugated siRNAs with a slow endosomal release delivery polymer.
Example 51: In vitro serum stability of siRNAs with cleavable linkers The stability of the cleavable linker was evaluated in an in vitro stability assay. The cholesterol conjugated sense strands were incubated in 90% mouse serum at 37°C for various time points. The incubation reaction was stopped by addition of proteinase K in a sodium dodecyl sulfate (SDS) containing buffer- The treatment degrades all proteins and enzymes without interfering with the RNA strand integrity. 25 L of this solution was directly injected onto a AEX-HPLC system connected to a UV detector at 260nm. AEX-HPLC was performed on a Dionex DNA Pac200 column (4x250mm) at 75°C using a 20mM Tris buffer containing 50% ACN at pH=8. 800 mM NaBr in eluent B serves as eluent salt. A gradient from 25 to 62% B in 18 minutes was employed. The cholesterol containing single stranded RNA elutes from the HPLC column as a broad peak at 260 nm After cleavage of the cholesterol sharp symmetric peaks is observed at lower retention time. Cleavage rate of cholesterol was determined by the following equitation (PA = Peak Area):
% (free RNA) = 100 * PA [free RNA] / (PA [free RNA] + PA [cholesterol conjugated RNA])
In vitro it was shown, that the 3nt nucleotide (AUC)-overhang is quantitatively cleaved in less than 1 hour in 90% mouse serum. The cleavage occurs 3' to the two pyrimidine nucleotides in the overhang, leading to two distinct cleavage metabolites (peak areas of metabolites were summarized for data evaluation). In contrast, the di-peptide containing linker according to formula la , the disulfide and the stably linked cholesterol are fully stable in mouse serum.
Example 52: Tissue distribution of siRNAs with cleavable linkers The siRNA concentration in the liver tissue samples was determined using a proprietary oligonucleotide detection method as described in WO2010043512. Briefly, the siRNA quantification is based on the hybridization of a fluorescently (Atto-425) labeled PNA-probe (Atto425-00-TGAGTTGGCACGCCTTT obtained from Panagene Inc, Korea) complementary to the sense strand of the siRNA duplex, followed by AEX-HPLC based separation. Quantification was done by fluorescence detection against an external calibration curve that was generated from a dilution series of the two FVII siRNA used in the in vivo experiment (see example 42). For plasma samples between 0.2 to 2 μΐ^ and for tissue ~ lmg aliquots were injected onto the HPLC system.
In Table 16 results from liver tissue analysis are shown. When analyzing the siRNA content it was found, that the sense strand that is present in liver tissue, is quantitatively cleaved from cholesterol when using either the di-peptide linker motive or the 3 nt 5 '-overhang with the unmodified linker sequence AUC. In contrast, only 15% of the disulfide linked siRNA that is present in the liver is cleaved from cholesterol within the first 48 hours post dosing and nothing of the stably attached cholesterol is cleaved from the siRNA.
When comparing the absolute amounts of cholesterol-free siRNA in liver tissue similar amounts were found for the disulfide linker and for the RNA AUC-linker, nicely correlating with equal FVII serum activity 48 hours post dosing The lower FVII activity achieved with the di-peptide linked cholesterol siRNA fully correlates with the higher absolute amount of the cleaved cholesterol-free siRNA.
The total amount of cholesterol siRNA conjugate equipped with an (AUC)-linker on the sense strand delivered into the liver is ~ 6-fold lower as compared to the stably or the disulfide attached cholesterol and ~ 3-fold lower compared to the di-peptide conjugated cholesterol siRNA. The reduced tissue presence can be attributed to the fact that the AUC-linker is not only a substrate for intracellular nucleases, but also for nucleases present in circulation as shown in the in vitro incubation with mouse serum. When the cholesterol ligand is cleaved from the siRNA already in circulation the resulting siRNA is prone to renal clearance and is rapidly excreted into urine without delivery into tissue.
Table 16: SE SE Total % sense
Q Q siRNA cleaved
ID ID in Liver ligand
NO Sense strand sequence (5'-3') NO Antisense strand sequence (5'-3') [ng/g] in liver
Chol-(NH2C6)-
GfcAfaAfgGfcGfuGfcCfaAfcUf psdTdGfaGfuUfgGfcAfcGfcCfliUfuGfc(
257 cAf(invdT) 263 invdT) 5837 0
Chol-C6SSC6-
GfcAfaAfgGfcGfuGfcCfaAfcUf psdTdGfaGfuUfgGfcAfcGfcCfuUfuGfc(
259 cAf(invdT) 263 invdT) 4357 14,8
Chol-AUC-
GfcAfaAfgGfcGfuGfcCfaAfcUf psdTdGfaGfuUfgGfcAfcGfcCfuUfuGfc(
260 cAf(invdT) 263 invdT) 912 96, 1
Chol-Cathepsin-
GfcAfaAfgGfcGfuGfcCfaAfcUf psdTdGfaGfuUfgGfcAfcGfcCfuUfuGfc(
261 cAf(invdT) 263 invdT) 2760 99,8
In the following tables siRNAs used in the examples are summarized: Table 17: Core sequences
SEQ ID NO Sense strand sequence (5'-3') SEQ ID NO Antisense strand sequence (5'-3')
1 ACAUGAAGCAGCACGACUU 2 AAGUCGUGCUGCUUCAUGU
3 GCCCGACAACCACUACCUG 4 CAGGUAGUGGUUGUCGGGC
5 CGAGAAGCGCGAUCACAUG 6 CAUGUGAUCGCGCUUCUCG
7 AUAUCAUGGCCGACAAGCA 8 UGCUUGUCGGCCAUGAUAU
9 ACAAGCUGGAGUACAACUA 10 UAGUUGUACUCCAGCUUGU
11 GCAGCUCGCCGACCACUAC 12 GUAGUGGUCGGCGAGCUGC
13 CGUCCAGGAGCGCACCAUC 14 GAUGGUGCGCUCCUGGACG
15 GCUGGAGUUCGUGACCGCC 16 GGCGGUCACGAACUCCAGC
17 CCACCCUGACCUACGGCGU 18 ACGCCGUAGGUCAGGGUGG
19 CGACUUCAAGGAGGACGGC 20 GCCGUCCUCCUUGAAGUCG
21 UUCAAGAUCCGCCACAACA 22 UGUUGUGGCGGAUCUUGAA
23 GGCAACUACAAGACCCGCG 24 CGCGGGUCUUGUAGUUGCC
25 CCGGCAAGCUGCCCGUGCC 26 GGCACGGGCAGCUUGCCGG
27 UGCCCAUCCUGGUCGAGCU 28 AGCUCGACCAGGAUGGGCA
29 CAAGUUCAGCGUGUCCGGC 30 GCCGGACACGCUGAACUUG
151 GGAAUCUUAUAUUUGAUCCAA 152 UUGGAUCAAAUAUAAGAUUCCCU
155 GGAUGAAGUGGAGAUUAGU 156 ACUAAUCUCCACUUCAUCC
161 GCAAAGGCGUGCCAACUCA 162 UGAGUUGGCACGCCUUUGC
161 GCAAAGGCGUGCCAACUCA 178 TGAGUUGGCACGCCUUUGC
161 GCAAAGGCGUGCCAACUCA 256 TGAGUUGGCACGCCUUUGC
163 GGAUCAUCUCAAGUCUUAC 164 GUAAGACUUGAGAUGAUCC
171 UGACCACAGUCGGAUUAAA 172 UUUAAUCCGACUGUGGUCA
247 GUUGGUGAAUGGAGCUCAG 248 CUGAGCUCCAUUCACCAAC
249 GGUCCUGUUGUUGGUGAAU 250 AUUCACCAACAACAGGACC Table 18: Mapping of core sequences and modified sequence
Core sequences Modified sequences
SE
Q SE SE SE ID Q Antisense Q Q
N Sense strand ID strand sequence ID Sense strand ID Antisense strand O sequence (5 '-3') NO (5'-3') NO sequence (5 '-3') NO sequence (5'-3')
ACAUGAAGC AAGUCGUGC AGCACGACU UGCUUCAUG ACAUGAAGCAG AAGUCGUGCUGCU
1 U 2 U 31 CACGACUUdTdT 32 UCAUGUdTdT
ACAUGAAGC AAGUCGUGC AfcAfuGfaAfgCfa
AGCACGACU UGCUUCAUG GfcAfcGfaCfuUfd paAfgUfcGfuGfcUfg
1 U 2 U 61 TsdT 62 CfuUfcAfuGfudTsdT
ACAUGAAGC AAGUCGUGC dAcdAudGadAgdC padAgdTcdGudGcdTg AGCACGACU UGCUUCAUG adGcdAcdGadCud dCudTcdAudGudTsd
1 U 2 U 91 TdTsdT 92 T
ACAUGAAGC AAGUCGUGC AfdCAfdTGfdAAf pdAAfdGUfdCGfdTG AGCACGACU UGCUUCAUG dGCfdAGfdCAfdC fdCUfdGCfdTUfdCAf
1 U 2 U 121 GfdACfdTUfdTsdT 122 dTGfdTdTsdT
GCCCGACAA CAGGUAGUG CCACUACCU GUUGUCGGG GCCCGACAACC CAGGUAGUGGUU
3 G 4 C 33 ACUACCUGdTdT 34 GUCGGGCdTdT
GCCCGACAA CAGGUAGUG GfcCfcGfaCfaAfcC
CCACUACCU GUUGUCGGG faCfuAfcCfuGfdTs pcAfgGfuAfgUfgGfu
3 G 4 C 63 dT 64 UfgUfcGfgGfcdTsdT
GCCCGACAA CAGGUAGUG dGcdCcdGadCadA pcdAgdGudAgdTgdG CCACUACCU GUUGUCGGG cdCadCudAcdCud udTgdTcdGgdGcdTsd
3 G 4 C 93 GdTsdT 94 T
GCCCGACAA CAGGUAGUG GfdCCfdCGfdACf pdCAfdGGfdTAfdGU CCACUACCU GUUGUCGGG dAAfdCCfdACfdT fdGGfdTUfdGUfdCG
3 G 4 C 123 AfdCCfdTGfdTsdT 124 fdGGfdCdTsdT
CGAGAAGCG CAUGUGAUC CGAUCACAU GCGCUUCUC CGAGAAGCGCG CAUGUGAUCGCGC
5 G 6 G 35 AUCACAUGdTdT 36 UUCUCGdTdT
CGAGAAGCG CAUGUGAUC CfgAfgAfaGfcGfc
CGAUCACAU GCGCUUCUC GfaUfcAfcAfuGfd pcAfuGfuGfaUfcGfc
5 G 6 G 65 TsdT 66 GfcUfuCfuCfgdTsdT
CGAGAAGCG CAUGUGAUC dCgdAgdAadGcdG pcdAudGudGadTcdG CGAUCACAU GCGCUUCUC cdGadTcdAcdAud cdGcdTudCudCgdTsd
5 G 6 G 95 GdTsdT 96 T
CGAGAAGCG CAUGUGAUC CfdGAfdGAfdAGf pdCAfdTGfdTGfdAU CGAUCACAU GCGCUUCUC dCGfdCGfdAUfdC fdCGfdCGfdCUfdTCf
5 G 6 G 125 AfdCAfdTGfdTsdT 126 dTCfdGdTsdT
AUAUCAUGG UGCUUGUCG CCGACAAGC GCCAUGAUA AUAUCAUGGCC UGCUUGUCGGCCA
7 A 8 U 37 GACAAGCAdTdT 38 UGAUAUdTdT
AUAUCAUGG UGCUUGUCG AfuAfuCfaUfgGfc
CCGACAAGC GCCAUGAUA CfgAfcAfaGfcAfd puGfcUfuGfaCfgGfc
7 A 8 U 67 TsdT 68 CfaUfgAfuAfudTsdT
AUAUCAUGG UGCUUGUCG dAudAudCadTgdG pudGcdTudGudCgdG CCGACAAGC GCCAUGAUA cdCgdAcdAadGcd cdCadTgdAudAudTsd
7 A 8 U 97 AdTsdT 98 T
AfdTAfdTCfdAUf
AUAUCAUGG UGCUUGUCG dGGfdCCfdGAfdC pdTGfdCUfdTGfdTCf CCGACAAGC GCCAUGAUA AfdAGfdCAfdTsd dGGfdCCfdAUfdGAf
7 A 8 U 127 T 128 dTAfdTdTsdT Core sequences Modified sequences
SE
Q SE SE SE ID Q Antisense Q Q
N Sense strand ID strand sequence ID Sense strand ID Antisense strand O sequence (5 '-3') NO (5'-3') NO sequence (5 '-3') NO sequence (5'-3')
ACAAGCUGG UAGUUGUAC AGUACAACU UCCAGCUUG ACAAGCUGGAG UAGUUGUACUCCA
9 A 10 U 39 UACAACUAdTdT 40 GCUUGUdTdT
ACAAGCUGG UAGUUGUAC AfcAfaGfcUfgGfa
AGUACAACU UCCAGCUUG GfuAfcAfaCfuAfd puAfgUfuGfuAfcUfc
9 A 10 U 69 TsdT 70 CfaGfcUfuGfudTsdT
ACAAGCUGG UAGUUGUAC dAcdAadGcdTgdG pudAgdTudGudAcdT AGUACAACU UCCAGCUUG adGudAcdAadCud cdCadGcdTudGudTsd
9 A 10 u 99 AdTsdT 100 T
ACAAGCUGG UAGUUGUAC AfdCAfdAGfdCUf pdTAfdGUfdTGfdTA AGUACAACU UCCAGCUUG dGGfdAGfdTAfdC fdCUfdCCfdAGfdCUf
9 A 10 U 129 AfdACfdTAfdTsdT 130 dTGfdTdTsdT
GCAGCUCGC GUAGUGGUC CGACCACUA GGCGAGCUG GCAGCUCGCCG GUAGUGGUCGGC
11 C 12 C 41 ACCACUACdTdT 42 GAGCUGCdTdT
GCAGCUCGC GUAGUGGUC GfcAfgCfuCfgCfc
CGACCACUA GGCGAGCUG GfaCfcAfcUfaCfdT pgUfaGfuGfgUfcGfg
11 C 12 C 71 sdT 72 CfgAfgCfuGfcdTsdT
GCAGCUCGC GUAGUGGUC dGcdAgdCudCgdC pgdTadGudGgdTcdG CGACCACUA GGCGAGCUG cdGadCcdAcdTad gdCgdAgdCudGcdTsd
1 1 C 12 C 101 CdTsdT 102 T
GfdCAfdGCfdTCf
GCAGCUCGC GUAGUGGUC dGCfdCGfdACfdC pdGUfdAGfdTGfdGU CGACCACUA GGCGAGCUG AfdCUfdACfdTsd fdCGfdGCfdGAfdGC
11 C 12 C 131 T 132 fdTGfdCdTsdT
CGUCCAGGA GAUGGUGCG GCGCACCAU CUCCUGGAC CGUCCAGGAGC GAUGGUGCGCUCC
13 C 14 G 43 GCACCAUCdTdT 44 UGGACGdTdT
CGUCCAGGA GAUGGUGCG CfgUfcCfaGfgAfg
GCGCACCAU CUCCUGGAC CfgCfaCfcAfuCfdT pgAfuGfgUfgCfgCfu
13 C 14 G 73 sdT 74 CfcUfgGfaCfgdTsdT
CGUCCAGGA GAUGGUGCG dCgdTcdCadGgdA pgdAudGgdTgdCgdC GCGCACCAU CUCCUGGAC gdCgdCadCcdAud udCcdTgdGadCgdTsd
13 C 14 G 103 CdTsdT 104 T
CGUCCAGGA GAUGGUGCG CfdGUfdCCfdAGf pdGAfdTGfdGUfdGC GCGCACCAU CUCCUGGAC dGAfdGCfdGCfdA fdGCfdTCfdCUfdGGf
13 C 14 G 133 CfdCAfdTCfdTsdT 134 dACfdGdTsdT
GCUGGAGUU GGCGGUCAC CGUGACCGC GAACUCCAG GCUGGAGUUCG GGCGGUCACGAAC
15 C 16 C 45 UGACCGCCdTdT 46 UCCAGCdTdT
GCUGGAGUU GGCGGUCAC GfcUfgGfaGfuUfc
CGUGACCGC GAACUCCAG GfuGfaCfcGfcCfd pgGfcGfgUfcAfcGfa
15 C 16 C 75 TsdT 76 AfcUfcCfaGfcdTsdT
GCUGGAGUU GGCGGUCAC dGcdTgdGadGudT pgdGcdGgdTcdAcdG CGUGACCGC GAACUCCAG cdGudGadCcdGcd adAcdTcdCadGcdTsd
15 C 16 C 105 CdTsdT 106 T
GCUGGAGUU GGCGGUCAC GfdCUfdGGfdAGf pdGGfdCGfdGUfdCA CGUGACCGC GAACUCCAG dTUfdCGfdTGfdA fdCGfdAAfdCUfdCCf
15 C 16 C 135 CfdCGfdCCfdTsdT 136 dAGfdCdTsdT
GCUGGAGUU GGCGGUCAC gscUfgGfaGfuUfc pdGsGfcGfgUfcAfcGf
15 CGUGACCGC 16 GAACUCCAG 200 GfuGfaCfcGfcCfG 213 aAfcUfcCfaGfcdTsdT Core sequences Modified sequences
SE
Q SE SE SE ID Q Antisense Q Q
N Sense strand ID strand sequence ID Sense strand ID Antisense strand O sequence (5'-3') NO (5'-3·) NO sequence (5 '-3') NO sequence (5'-3')
C C nvdT)
GCUGGAGUU GGCGGUCAC gcUfgGfaGfuUfcG
CGUGACCGC GAACUCCAG fiiGfaCfcGfcCf(inv dGsGfcGfgUfcAfcGfa
15 C 16 C 201 dT) 214 AfcUfcCfaGfcdTsdT
GCUGGAGUU GGCGGUCAC gscUfgGfaGfuUfc
CGUGACCGC GAACUCCAG GfuGfaCfcGfcCfd pdGsGfcGfgUfcAfcGf
15 C 16 C 202 TsdT 213 aAfcUfcCfaGfcdTsdT
GCUGGAGUU GGCGGUCAC gcUfgGfaGfuUfcG
CGUGACCGC GAACUCCAG fuGfaCfcGfcCfdTs dGsGfcGfgUfcAfcGfa
15 C 16 C 203 dT 214 AfcUfcCfaGfcdTsdT
GCUGGAGUU GGCGGUCAC GfcUfgGfaGfuUfc
CGUGACCGC GAACUCCAG GfuGfaCfcGfcCf(i pGfsGfcGfgUfcAfcGf
15 C 16 C 204 nvdT) 215 aAfcUfcCfaGfcdTsdT
GCUGGAGUU GGCGGUCAC GfscUfgGfaGfuUfc
CGUGACCGC GAACUCCAG GfuGfaCfcGfcCfO GfsGfcGfgUfcAfcGfa
15 C 16 C 205 nvdT) 216 AfcUfcCfaGfcdTsdT
GCUGGAGUU GGCGGUCAC GfcUfgGfaGfuUfc
CGUGACCGC GAACUCCAG GfuGfaCfcGfcCfd pGfsGfcGfgUfcAfcGf
15 C 16 C 206 TsdT 215 aAfcUfcCfaGfcdTsdT
GCUGGAGUU GGCGGUCAC gscUfgGfaGfuUfc pdGsGfcGfgUfcAfcGf CGUGACCGC GAACUCCAG GfuGfaCfcGfcCfO aAfcUfcCfaGfcOnvdT
15 C 16 C 200 nvdT) 217 )
GCUGGAGUU GGCGGUCAC GfcUfgGfaGfuUfc pGfsGfcGfgUfcAfcGf CGUGACCGC GAACUCCAG GfuGfaCfcGfcCfd aAfcUfcCfaGfcdT(inv
15 C 16 C 207 T(invdT) 218 dT)
GCUGGAGUU GGCGGUCAC gscUfgGfaGfuUfc pdGsGfcGfgUfcAfcGf CGUGACCGC GAACUCCAG GfuGfaCfcGfcCfd aAfcUfcCfaGfcdTOnv
15 C 16 C 208 T(invdT) 219 dT)
GCUGGAGUU GGCGGUCAC GfscUfgGfaGfuUfc
CGUGACCGC GAACUCCAG GfuGfaCfcGfcCfO GfsGfcGfgUfcAfcGfa
15 C 16 C 205 nvdT) 220 AfcUfcCfaGfc(invdT)
GCUGGAGUU GGCGGUCAC gcUfgGfaGfuUfcG
CGUGACCGC GAACUCCAG fuGfaCfcGfcCf(inv dGsGfcGfgUfcAfcGfa
15 C 16 C 201 dT) 221 AfcUfcCfaGfc(invdT)
GCUGGAGUU GGCGGUCAC GfscUfgGfaGfuUfc
CGUGACCGC GAACUCCAG GfuGfaCfcGfcCfd GfsGfcGfgUfcAfcGfa
15 C 16 C 209 TsdT 216 AfcUfcCfaGfcdTsdT
GCUGGAGUU GGCGGUCAC GfscUfgGfaGfuUfc GfsGfcGfgUfcAfcGfa CGUGACCGC GAACUCCAG GfuGfaCfcGfcCfd AfcUfcCfaGfcdT(invd
15 C 16 C 210 T(invdT) 222 T)
GCUGGAGUU GGCGGUCAC gcUfgGfaGfuUfcG dGsGfcGfgUfcAfcGfa CGUGACCGC GAACUCCAG fuGfaCfcGfcCfdT(i AfcUfcCfaGfcdTOnvd
15 C 16 C 21 1 nvdT) 223 T)
GCUGGAGUU GGCGGUCAC GfcUfgGfaGfuUfc pGfsGfcGfgUfcAfcGf CGUGACCGC GAACUCCAG GfuGfaCfcGfcCfO aAfcUfcCfaGfcOnvdT
15 C 16 C 204 nvdT) 224 )
GCUGGAGUU GGCGGUCAC CGUGACCGC GAACUCCAG GCUGGAGUUCG GGCGGUCACGAAC
15 C 16 C 45 UGACCGCCdTdT 46 UCCAGCdTdT
15 GCUGGAGUU 16 GGCGGUCAC 212 GcuGGAGuucGuG 225 GGCGGUcACGAAC Core sequences Modified sequences
SE
Q SE SE SE ID Q Antisense Q Q
N Sense strand ID strand sequence ID Sense strand ID Antisense strand O sequence (5 '-3') NO (5'-3') NO sequence (5 '-3') NO sequence (5'-3')
CGUGACCGC GAACUCCAG AccGccdTsdT UCcAGCdTsdT C C
CCACCCUGA ACGCCGUAG CCUACGGCG GUCAGGGUG CCACCCUGACC ACGCCGUAGGUCA
17 U 18 G 47 UACGGCGUdTdT 48 GGGUGGdTdT
CCACCCUGA ACGCCGUAG CfcAfcCfcUfgAfc
CCUACGGCG GUCAGGGUG CfuAfcGfgCfgUfd paCfgCfcGfuAfgGfuC
17 U 18 G 77 TsdT 78 faGfgGfuGfgdTsdT
CCACCCUGA ACGCCGUAG dCcdAcdCcdTgdA padCgdCcdGudAgdG CCUACGGCG GUCAGGGUG cdCudAcdGgdCgd udCadGgdGudGgdTs
17 U 18 G 107 TdTsdT 108 dT
CfdCAfdCCfdCUf
CCACCCUGA ACGCCGUAG dGAfdCCfdTAfdC pdACfdGCfdCGfdTA CCUACGGCG GUCAGGGUG GfdGCfdGUfdTsd fdGGfdTCfdAGfdGG
17 U 18 G 137 T 138 fdTGfdGdTsdT
CGACUUCAA GGAGGACGG GCCGUCCUCC CGACUUCAAGG GCCGUCCUCCUUG
19 C 20 UUGAAGUCG 49 AGGACGGCdTdT 50 AAGUCGdTdT
CGACUUCAA CfgAfcUfuCfaAfg
GGAGGACGG GCCGUCCUCC GfaGfgAfcGfgCfd pgCfcGfiiCfcUfcCfuU
19 C 20 UUGAAGUCG 79 TsdT 80 fgAfaGfuCfgdTsdT
CGACUUCAA dCgdAcdTudCadA pgdCcdGudCcdTcdCu GGAGGACGG GCCGUCCUCC gdGadGgdAcdGgd dTgdAadGudCgdTsd
19 C 20 UUGAAGUCG 109 CdTsdT 110 T
CfdGAfdCUfdTCf
CGACUUCAA dAAfdGGfdAGfdG pdGCfdCGfdTCfdCU GGAGGACGG GCCGUCCUCC AfdCGfdGCfdTsd fdCCfdTUfdGAfdAGf
19 C 20 UUGAAGUCG 139 T 140 dTCfdGdTsdT
UUCAAGAUC UGUUGUGGC CGCCACAAC GGAUCUUGA UUCAAGAUCCG UGUUGUGGCGGA
21 A 22 A 51 CCACAACAdTdT 52 UCUUGAAdTdT
UUCAAGAUC UGUUGUGGC UfuCfaAfgAfuCfc
CGCCACAAC GGAUCUUGA GfcCfaCfaAfcAfdT puGfuUfgUfgGfcGfg
21 A 22 A 81 sdT 82 AfuCfuUfgAfadTsdT
UUCAAGAUC UGUUGUGGC dTudCadAgdAudC pudGudTgdTgdGcdG CGCCACAAC GGAUCUUGA cdGcdCadCadAcd gdAudCudTgdAadTsd
21 A 22 A 111 AdTsdT 1 12 T
UfdTCfdAAfdGAf
UUCAAGAUC UGUUGUGGC dTCfdCGfdCCfdA pdTGfdTUfdGUfdGG CGCCACAAC GGAUCUUGA CfdAAfdCAfdTsd fdCGfdGAfdTCfdTUf
21 A 22 A 141 T 142 dGAfdAdTsdT
GGCAACUAC CGCGGGUCU AAGACCCGC UGUAGUUGC GGCAACUACAA CGCGGGUCUUGUA
23 G 24 C 53 GACCCGCGdTdT 54 GUUGCCdTdT
GGCAACUAC CGCGGGUCU GfgCfaAfcUfaCfa
AAGACCCGC UGUAGUUGC AfgAfcCfcGfcGfd pcGfcGfgGfuCfuUfg
23 G 24 C 83 TsdT 84 UfaGfuUfgCfcdTsdT
GGCAACUAC CGCGGGUCU dGgdCadAcdTadC pcdGcdGgdGudCudT AAGACCCGC UGUAGUUGC adAgdAcdCcdGcd gdTadGudTgdCcdTsd
23 G 24 C 113 GdTsdT 114 T Core sequences Modified sequences
SE
Q SE SE SE ID Q Antisense Q Q
N Sense strand ID strand sequence ID Sense strand ID Antisense strand O sequence (5 '-3') NO (5'-3·) NO sequence (5 '-3') NO sequence (5'-3')
GGCAACUAC CGCGGGUCU GfdGCfdAAfdCUf pdCGfdCGfdGGfdTC AAGACCCGC UGUAGUUGC dACfdAAfdGAfdC fdTUfdGUfdAGfdTUf
23 G 24 C 143 CfdCGfdCGfdTsdT 144 dGCfdCdTsdT
CCGGCAAGC GGCACGGGC UGCCCGUGC AGCUUGCCG CCGGCAAGCUG GGCACGGGCAGCU
25 C 26 G 55 CCCGUGCCdTdT 56 UGCCGGdTdT
CCGGCAAGC GGCACGGGC CfcGfgCfaAfgCfu
UGCCCGUGC AGCUUGCCG GfcCfcGfuGfcCfd pgGfcAfcGfgGfcAfg
25 C 26 G 85 TsdT 86 CfuUfgCfcGfgdTsdT
CCGGCAAGC GGCACGGGC dCcdGgdCadAgdC pgdGcdAcdGgdGcdA UGCCCGUGC AGCUUGCCG udGcdCcdGudGcd gdCudTgdCcdGgdTsd
25 C 26 G 115 CdTsdT 116 T
CCGGCAAGC GGCACGGGC CfdCGfdGCfdAAf pdGGfdCAfdCGfdGG UGCCCGUGC AGCUUGCCG dGCfdTGfdCCfdC fdCAfdGCfdTUfdGCf
25 C 26 G 145 GfdTGfdCCfdTsdT 146 dCGfdGdTsdT
UGCCCAUCC AGCUCGACC UGGUCGAGC AGGAUGGGC UGCCCAUCCUG AGCUCGACCAGGA
27 U 28 A 57 GUCGAGCUdTdT 58 UGGGCAdTdT
UGCCCAUCC AGCUCGACC UfgCfcCfaUfcCfu
UGGUCGAGC AGGAUGGGC GfgUfcGfaGfcUfd paGfcUfcGfaCfcAfgG
27 U 28 A 87 TsdT 88 faUfgGfgCfadTsdT
UGCCCAUCC AGCUCGACC dTgdCcdCadTcdCu
UGGUCGAGC AGGAUGGGC dGgdTcdGadGcdT padGcdTcdGadCcdAg
27 U 28 A 117 dTsdT 1 18 dGadTgdGgdCadTsdT
UfdGCfdCCfdAUf
UGCCCAUCC AGCUCGACC dCCfdTGfdGUfdC pdAGfdCUfdCGfdAC UGGUCGAGC AGGAUGGGC GfdAGfdCUfdTsd fdCAfdGGfdAUfdGG
27 U 28 A 147 T 148 fdGCfdAdTsdT
CAAGUUCAG GCCGGACAC CGUGUCCGG GCUGAACUU CAAGUUCAGCG GCCGGACACGCUG
29 C 30 G 59 UGUCCGGCdTdT 60 AACUUGdTdT
CAAGUUCAG GCCGGACAC CfaAfgUfuCfaGfc
CGUGUCCGG GCUGAACUU GfuGfuCfcGfgCfd PgCfcGfgAfcAfcGfcU
29 C 30 G 89 TsdT 90 fgAfaCfuUfgdTsdT
CAAGUUCAG GCCGGACAC dCadAgdTudCadG pgdCcdGgdAcdAcdG CGUGUCCGG GCUGAACUU cdGudGudCcdGgd cdTgdAadCudTgdTsd
29 C 30 G 119 CdTsdT 120 T
CAAGUUCAG GCCGGACAC CfdAAfdGUfdTCf pdGCfdCGfdGAfdCA CGUGUCCGG GCUGAACUU dAGfdCGfdTGfdT fdCGfdCUfdGAfdAC
29 C 30 G 149 CfdCGfdGCfdTsdT 150 fdTUfdGdTsdT
GGAAUCUUA UUGGAUCAA
15 UAUUUGAUC AUAUAAGAU GGAAUCuuAuAu uuGGAUcAAAuAuA 1 CAA 152 ucccu 153 uuGAUCcAsA 154 AGAuUCcscsU
GGAAUCUUA UUGGAUCAA (Chol)GGAAUCuu
15 UAUUUGAUC AUAUAAGAU AuAuuuGAUCcAs uuGGAUcAAAuAuA 1 CAA 152 UCCCU 265 A 154 AGAuUCcscsU
GGAUGAAGU ACUAAUCUC
15 GGAGAUUAG CACUUCAUC GGAuGAAGuGG ACuAAUCUCcACU 5 U 156 C 157 AGAuuAGudTsdT 158 UcAUCCdTsdT
15 GGAUGAAGU ACUAAUCUC (NH2C6)GfgAfuGf pasCfuAfaUfcUfcCfa 5 GGAGAUUAG 156 CACUUCAUC 160 aAfgUfgGfaGfaUf 159 CfuUfcAfuCfc(invdT) Core sequences Modified sequences
SE
Q SE SE SE ID Q Antisense Q Q
N Sense strand ID strand sequence ID Sense strand ID Antisense strand O sequence (5 '-3') NO (5'-3') NO sequence (5 '-3') NO sequence (5'-3')
U C uAfgUf(invdT)
GGAUGAAGU ACUAAUCUC gsgAfuGfaAfgUfg
15 GGAGAUUAG CACUUCAUC GfaGfaUfuAfgUfd dAsCfuAfaUfcUfcCf 5 U 156 C 226 TsdT 266 aCfuUfcAfuCfcdTsdT
GGAUGAAGU ACUAAUCUC gsgAfuGfaAfgUfg
15 GGAGAUUAG CACUUCAUC GfaGfaUfuAfgUf(i pdAsCfuAfaUfcUfcCf 5 U 156 C 227 nvdT) 266 aCfuUfcAfuCfcdTsdT
GGAUGAAGU ACUAAUCUC GfsgAfuGfaAfgUf
15 GGAGAUUAG CACUUCAUC gGfaGfaUfuAfgUf pAfsCfuAfaUfcUfcCf 5 U 156 C 228 dTsdT 267 aCfuUfcAfuCfcdTsdT
GGAUGAAGU ACUAAUCUC GfsgAfuGfaAfgUf pAfsCfuAfaUfcUfcCf
15 GGAGAUUAG CACUUCAUC gGfaGfaUfuAfgUf aCfuUfcAfuCfcdT(inv 5 U 156 C 229 dT(invdT) 268 dT)
GGAUGAAGU ACUAAUCUC ggAfuGfaAfgUfgG
15 GGAGAUUAG CACUUCAUC faGfaUfuAfgUfdTs dAsCfuAfaUfcUfcCfa 5 U 156 C 230 dT 238 CfuUfcAfuCfcdTsdT
GGAUGAAGU ACUAAUCUC GfsgAfuGfaAfgUf
15 GGAGAUUAG CACUUCAUC gGfaGfaUfuAfgUf( pAfsCfuAfaUfcUfcCf 5 U 156 C 231 invdT) 267 aCfuUfcAfuCfcdTsdT
GGAUGAAGU ACUAAUCUC ggAfuGfaAfgUfgG
15 GGAGAUUAG CACUUCAUC faGfaUfuAfgUf(inv dAsCfuAfaUfcUfcCfa 5 U 156 C 232 dT) 238 CfuUfcAfuCfcdTsdT
GGAUGAAGU ACUAAUCUC GfgAfuGfaAfgUfg AfsCfuAfaUfcUfcCfa
15 GGAGAUUAG CACUUCAUC GfaGfaUfuAfgUfd CfuUfcAfuCfcdTGnvd 5 U 156 C 233 T(invdT) 239 T)
GGAUGAAGU ACUAAUCUC GfgAfuGfaAfgUfg
15 GGAGAUUAG CACUUCAUC GfaGfaUfuAfgUf(i AfsCfuAfaUfcUfcCfa 5 U 156 C 234 nvdT) 240 CfuUfcAfuCfcdTsdT
GGAUGAAGU ACUAAUCUC GfsgAfuGfaAfgUf pAfsCfuAfaUfcUfcCf
15 GGAGAUUAG CACUUCAUC gGfaGfaUfuAfgUf( aCfuUfcAfuCfcGnvdT 5 U 156 C 231 invdT) 241 )
GGAUGAAGU ACUAAUCUC GfgAfuGfaAfgUfg
15 GGAGAUUAG CACUUCAUC GfaGfaUfuAfgUfG pasCfuAfaUfcUfcCfa 5 U 156 C 234 nvdT) 159 CfuUfcAfuCfc(invdT)
GGAUGAAGU ACUAAUCUC gsgAfuGfaAfgUfg pdAsCfuAfaUfcUfcCf
15 GGAGAUUAG CACUUCAUC GfaGfaUfuAfgUfd aCfuUfcAfuCfcdTGnv 5 U 156 C 235 T(invdT) 242 dT)
GGAUGAAGU ACUAAUCUC GfgAfuGfaAfgUfg
15 GGAGAUUAG CACUUCAUC GfaGfaUfuAfgUfd AfsCfuAfaUfcUfcCfa 5 U 156 C 236 TsdT 240 CfuUfcAfuCfcdTsdT
GGAUGAAGU ACUAAUCUC gsgAfuGfaAfgUfg pdAsCfuAfaUfcUfcCf
15 GGAGAUUAG CACUUCAUC GfaGfaUfuAfgUfG aCfuUfcAfuCfcGnvdT 5 U 156 C 227 nvdT) 243 )
GGAUGAAGU ACUAAUCUC ggAfuGfaAfgUfgG dAsCfuAfaUfcUfcCfa
15 GGAGAUUAG CACUUCAUC faGfaUfuAfgUfdT( CfuUfcAfuCfcdTGnvd 5 U 156 C 237 invdT) 244 T)
GGAUGAAGU ACUAAUCUC ggAfuGfaAfgUfgG
15 GGAGAUUAG CACUUCAUC faGfaUfuAfgUf(inv dAsCfuAfaUfcUfcCfa 5 U 156 C 232 dT) 245 CfuUfcAfuCfc(invdT)
15 GGAUGAAGU 156 ACUAAUCUC 234 GfgAfuGfaAfgUfg 246 AfsCfuAfaUfcUfcCfa Core sequences Modified sequences
SE
Q SE SE SE ID Q Antisense Q Q
N Sense strand ID strand sequence ID Sense strand ID Antisense strand O sequence (5 '-3') NO (5'-3') NO sequence (5 '-3') NO sequence (5'-3')
5 GGAGAUUAG CACUUCAUC GfaGfaUfuAfgUfG CfuUfcAfuCfc(invdT) U C nvdT)
GGAUGAAGU ACUAAUCUC
15 GGAGAUUAG CACUUCAUC GGAuGAAGuGG ACuAAUCUCcACU 5 U 156 C 157 AGAuuAGudTsdT 158 UcAUCCdTsdT
GCAAAGGCG UGAGUUGGC (NH2C6)GfcAfaAf
16 UGCCAACUC ACGCCUUUG gGfcGfuGfcCfaAfc puGfaGfuUfgGfcAfc A 162 C 165 UfcAf(invdT) 166 GfcCfuUfuGfc(invdT)
GCAAAGGCG UGAGUUGGC (NH2C6)GcAAAG
16 UGCCAACUC ACGCCUUUG GcGuGccAAcucAd UGAGUUGGcACGC A 162 C 167 TsdT 168 CUUUGCdTsdT
GCAAAGGCG UGAGUUGGC GalNAc-(NH2C6)- UGCCAACUC ACGCCUUUG GfcAfaAfgGfcGfu
16 A C GfcCfaAfcUfcAf(i puGfaGfuUfgGfcAfc
162 179 nvdT) 166 GfcCfuUfuGfc(invdT)
GCAAAGGCG UGAGUUGGC GalNAc-(NH2C6)- UGAGUUGGcACGC
16 UGCCAACUC ACGCCUUUG GcAAAGGcGuGcc CUUUGCdTsdT A 162 C 180 AAcucAdTsdT 168
GCAAAGGCG UGAGUUGGC GfcAfaAfgGfcGfu pUfsGfaGfuUfgGfcAf
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAf(i cGfcCfuUfuGfc(invdT A 162 C 181 nvdT) 185 )
GCAAAGGCG TGAGUUGGC GfcAfaAfgGfcGfu psdTdGaGfuUfgGfcA
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAf(i fcGfcCfuUfuGfc(invd A 178 C 181 nvdT) 186 T)
GCAAAGGCG TGAGUUGGC GfcAfaAfgGfcGfu psdTsGfaGfuUfgGfcA
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAf(i fcGfcCfuUfuGfc(invd A 178 C 181 nvdT) 187 T)
GCAAAGGCG TGAGUUGGC GfcAfaAfgGfcGfu pdTsdGaGfuUfgGfcA
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAf(i fcGfcCfuUfuGfc(invd A 178 C 181 nvdT) 188 T)
GCAAAGGCG TGAGUUGGC GfcAfaAfgGfcGfu pdTsGfaGfaUfgGfcAf
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAf(i cGfcCfuUfuGfc(invdT A 178 C 181 nvdT) 189 )
GCAAAGGCG UGAGUUGGC GfcAfaAfgGfcGfu
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAf(i pusGfaGfuUfgGfcAfc A 162 C 181 nvdT) 190 GfcCfuUfuGfc(invdT)
GCAAAGGCG UGAGUUGGC GfcAfaAfgGfcGfu
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAf(i puGfaGfuUfgGfcAfc A 162 C 181 nvdT) 166 GfcCfuUfuGfc(invdT)
GCAAAGGCG UGAGUUGGC GfcAfaAfgGfcGfu psUfGfaGfuUfgGfcAf
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAf(i cGfcCfuUfuGfc(invdT A 162 C 181 nvdT) 191 )
GCAAAGGCG UGAGUUGGC GfcAfaAfgGfcGfu
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAf(i UfsGfaGfuUfgGfcAfc A 162 C 181 nvdT) 192 GfcCfuUfuGfc(invdT)
GCAAAGGCG UGAGUUGGC GfcAfaAfgGfcGfu psUfsGfaGfuUfgGfcA
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAf(i fcGfcCfuUfuGfc(invd A 162 C 181 nvdT) 193 T)
GCAAAGGCG TGAGUUGGC GfcAfaAfgGfcGfu psdTsdGaGfuUfgGfc
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAf(i AfcGfcCfuUfuGfc(inv A 178 C 181 nvdT) 194 dT) Core sequences Modified sequences
SE
Q SE SE SE ID Q Antisense Q Q
N Sense strand ID strand sequence ID Sense strand ID Antisense strand O sequence (5 '-3') NO (5'-3·) NO sequence (5 '-3') NO sequence (5'-3')
GCAAAGGCG UGAGUUGGC GfcAfaAfgGfcGfu
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAf(i usGfaGfuUfgGfcAfcG A 162 C 181 nvdT) 195 fcCfuUfuGfc(invdT)
GCAAAGGCG UGAGUUGGC GfcAfaAfgGfcGfu
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAfG uGfaGfuUfgGfcAfcGf A 162 C 181 nvdT) 196 cCfuUfuGfc(invdT)
GCAAAGGCG TGAGUUGGC GfcAfaAfgGfcGfu
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAfG dTsGfaGfuUfgGfcAfc A 178 C 181 nvdT) 197 GfcCfuUfuGfc(invdT)
GCAAAGGCG TGAGUUGGC GfcAfaAfgGfcGfu psdTGfaGfuUfgGfcAf
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAfG cGfcCfuUfuGfcGnvdT A 178 C 181 nvdT) 198 )
GCAAAGGCG TGAGUUGGC GfcAfaAfgGfcGfu dTsdGaG JfgGfcAf
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAfG cGfcCfuUfuGfcGnvdT A 178 C 181 nvdT) 199 )
GCAAAGGCG UGAGUUGGC (Chol)GfcAfaAfgG
16 UGCCAACUC ACGCCUUUG fcGfuGfcCfaAfcUf pusGfaGfuUfgGfcAfc A 162 C 183 cAf(invdT) 190 GfcCfuUfuGfc(invdT)
GCAAAGGCG UGAGUUGGC GfcAfaAfgGfcGfu
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAfG uGfaGfuUfgGfcAfcGf A 162 C 181 nvdT) 196 cCfuUfuGfc(invdT)
GCAAAGGCG UGAGUUGGC GfcAfaAfgGfcGfu
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAfG usGfaGfuUfgGfcAfcG A 162 C 181 nvdT) 195 fcCfuUfuGfc(invdT)
GCAAAGGCG UGAGUUGGC GfcAfaAfgGfcGfu
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAfG UfsGfaGfuUfgGfcAfc A 162 C 181 nvdT) 192 GfcCfuUfuGfc(invdT)
GCAAAGGCG TGAGUUGGC GfcAfaAfgGfcGfu
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAfG dTsGfaGfuUfgGfcAfc A 178 C 181 nvdT) 197 GfcCfuUfuGfc(invdT)
GCAAAGGCG TGAGUUGGC GfcAfaAfgGfcGfu dTsdGaGMJfgGfcAf
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAfG cGfcCfuUfuGfcGnvdT A 178 C 181 nvdT) 199 )
GCAAAGGCG UGAGUUGGC
16 UGCCAACUC ACGCCUUUG GcAAAGGcGuGcc UGAGUUGGcACGC A 162 C 182 AAcucAdTsdT 168 CUUUGCdTsdT
GCAAAGGCG UGAGUUGGC GfcAfaAfgGfcGfu
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcA UGAGUUGGcACGC A 162 C 184 168 CUUUGCdTsdT
Gal Ac-(NH2C6)-
GCAAAGGCG UGAGUUGGC GfcAfaAfgGfcGfu
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAfG puGfaGfuUfgGfcAfc A 162 C 179 nvdT) 166 GfcCfuUfuGfc(invdT)
GalNAc-(NH2C6)-
GCAAAGGCG UGAGUUGGC GfcAfaAfgGfcGfu
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAfG pusGfaGfuUfgGfcAfc A 162 C 179 nvdT) 190 GfcCfuUfuGfc(invdT)
GalNAc-(NH2C6)-
GCAAAGGCG UGAGUUGGC GfcAfaAfgGfcGfu pUfsGfaGfuUfgGfcAf
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAfG cGfcCfuUfuGfcGnvdT A 162 C 179 nvdT) 185 ) Core sequences Modified sequences
SE
Q SE SE SE ID Q Antisense Q Q
N Sense strand ID strand sequence ID Sense strand ID Antisense strand O sequence (5 '-3') NO (5'-3') NO sequence (5 '-3') NO sequence (5'-3')
GalNAc-(NH2C6)-
GCAAAGGCG TGAGUUGGC GfcAfaAfgGfcGfu psdTdGfaGfuUfgGfc
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAfG AfcGfcCfuUfuGfcGnv 1 A 178 C 179 nvdT) 186 dT)
GalNAc-(NH2C6)-
GCAAAGGCG UGAGUUGGC GfcAfaAfgGfcGfu
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAf(i puGfaGfuUfgGfcAfc 1 A 162 C 179 nvdT) 166 GfcCfuUfuGfc(invdT)
GalNAc-(NH2C6)-
GCAAAGGCG UGAGUUGGC GfcAfaAfgGfcGfu
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAfG pusGfaGfuUfgGfcAfc 1 A 162 C 179 nvdT) 190 GfcCfuUfuGfc(invdT)
GalNAc-(NH2C6)-
GCAAAGGCG UGAGUUGGC GfcAfaAfgGfcGfu pUfsGfaGfuUfgGfcAf
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAfG cGfcCfuUfuGfcGnvdT 1 A 162 C 179 nvdT) 262 )
Gal Ac-(NH2C6)-
GCAAAGGCG TGAGUUGGC GfcAfaAfgGfcGfu psdTdGfaGfuUfgGfc
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAfG AfcGfcCfuUfuGfcGnv 1 A 256 C 179 nvdT) 263 dT)
Chol-(NH2C6)-
GCAAAGGCG UGAGUUGGC GfcAfaAfgGfcGfu
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAfG puGfaGfuUfgGfcAfc 1 A 162 C 257 nvdT) 166 GfcCfuUfuGfc(invdT)
Chol-(NH2C6)-
GCAAAGGCG UGAGUUGGC GfcAfaAfgGfcGfu
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAfG pusGfaGfuUfgGfcAfc 1 A 162 C 257 nvdT) 190 GfcCfuUfuGfc(invdT)
Chol-(NH2C6)-
GCAAAGGCG UGAGUUGGC GfcAfaAfgGfcGfu pUfsGfaGfuUfgGfcAf
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAfG cGfcCfuUfuGfcGnvdT 1 A 162 C 257 nvdT) 264 )
Chol-(NH2C6)-
GCAAAGGCG TGAGUUGGC GfcAfaAfgGfcGfu psdTdGfaGfuUfgGfc
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAfG AfcGfcCfuUfuGfcGnv 1 A 256 C 257 nvdT) 263 dT)
GCAAAGGCG UGAGUUGGC Chol-(NH2C6)-
16 UGCCAACUC ACGCCUUUG GcAAAGGcGuGcc UGAGUUGGcACGC 1 A 162 C 258 AAcucAdTsdT 168 CUUUGCdTsdT
Chol-(NH2C6)-
GCAAAGGCG TGAGUUGGC GfcAfaAfgGfcGfu psdTdGfaGfuUfgGfc
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAfG AfcGfcCfuUfuGfcGnv 1 A 256 C 257 nvdT) 263 dT)
Chol-C6SSC6-
GCAAAGGCG TGAGUUGGC GfcAfaAfgGfcGfu psdTdGfaGfuUfgGfc
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAfG AfcGfcCfuUfuGfcGnv 1 A 256 C 259 nvdT) 263 dT)
Chol-AUC-
GCAAAGGCG TGAGUUGGC GfcAfaAfgGfcGfu psdTdGfaGfuUfgGfc
16 UGCCAACUC ACGCCUUUG GfcCfaAfcUfcAfG AfcGfcCfuUfuGfcGnv 1 A 256 C 260 nvdT) 263 dT)
Figure imgf000121_0001

Claims

Claims
1. A compound of formula
Figure imgf000122_0001
wherein
Y is a linker group selected from -(CH2)3- or -C(0)-N-(CH2-CH2-0)p-CH2-CH2-; RSS -(Cl-6) alkyl;
-(CH2)-naphthyl; or
-(CH2)m-phenyl, which phenyl is unsubstituted or up to four times substituted with a substituent independently selected from
-N02,
-CN,
Halogen,
-0-(CH2)-phenyl,
-0-(Cl-6) alkyl, or
-C(0)-NH2; R2 is hydrogen;
-(CH2)k-N-C(Ph)3, which phenyl rings are unsubstituted or independently substituted with -0-(Cl-4)alkyl;
-(CH2)k -C(0)-NH2;
-(CH2)k -phenyl;
-(CI -6) alkyl, which is unsubstituted or once substituted with -S-CH3;
R3 is -NH-phenyl, which phenyl group is further substituted with a substituent independently selected from
-(CH2)-OH; or
(CH2)-0-C(0)-0-(4-nitro-ph« k is 1, 2, 3, 4, 5, 6; m is 1,
2, 3 or 4; n is 0 or 1 ; and p is an integer from 1 to 20.
The compound of claim 1, having the conformation as shown in formula (la)
Figure imgf000123_0001
3. The compound of any of claim 1 or 2, wherein Y is -(CH2)3-
4. The compound of claim 3, wherein
Y is -(CH2)3-; R is -(CH2)k-N-C(Ph)3, which phenyl rings are unsubstituted or independently substituted with -0-(Cl-4)alkyl; and
R3 is -NH-phenyl, which phenyl group is further substituted with
-(CH2)-0-C(0)-0-(4-nitro-phenyl); n is 0; and
R1 and k have the meanings given above.
5. The compound of any of claims 1 or 2, wherein Y is -C(0)-N-(CH2-CH2-0)P-CH2-CH2-;
6. The compound of claim 5, wherein
Y is -C(0)-N-(CH2-CH2-0)p-CH2-CH2-;
R is -(CH2)k-N-C(Ph)3, which phenyl rings are unsubstituted or independently substituted with -0-(C l-4)alkyl; and
R3 is -NH-phenyl, which phenyl group is further substituted with
-(CH2)-0-C(0)-0-(4-nitro-phenyl); n is 0; and
R1, k and p have the meanings given above.
7. Use of the compound of any of claims 1-6 as a ligand of an biologically active compound, wherein said ligand is covalently attached to the biologically active compound.
8. Use according to claim 7, wherein said biologically active compound is a peptide.
9. Use according to claim 7, wherein said biologically active compound is a nucleic acid.
10. A compound of the formula
Figure imgf000125_0001
(Π) wherein Ra is -(CH2)k-NH2;
R1 and k have the meanings given for formula (I) above; and the biologically active substance is a nucleic acid, a protein or a peptide.
11. The compound of claim 10, having the conformation as shown in formula (Ila)
Figure imgf000125_0002
(Ila) wherein
Ra is -(CH2)k-NH2;
R1 and k have the meanings given for formula (I) above; and the biologically active substance is a nucleic acid, a protein or a peptide.
12. The compound of any of claims 10 or 11, wherein the biologically active compound is a protein or a peptide.
13. The compound of any of claims 10 or 11, wherein the biologically active compound is a nucleic acid.
14. The compound of claim 13, wherein the nucleic acid is an oligonucleotide comprising an antisense strand with the modification pattern 5'-(w)- (Zl)- (Z2)- (Z3)na-3' and a sense strand with the modification pattern 5'- (Z3)n s-3\ wherein w is independently a 5 '-phosphate or 5'-phosphothioate or H, Zl is independently a 2' -modified nuleoside.
Z2 is independently a 2'-deoxy nucleoside or 2'-Fluoro-modified nucleoside, Z3 is independently a 2' -modified nucleoside, na is 8-23 and ns is 8-25.
15. The compound of any of claims 13 or 14, wherein the nucleic acid is a siRNA
16. The compound of any of claims 13 to 15, wherein the nucleic acid is covalently attached to a delivery polymer
17. A pharmaceutical composition comprising the compounds of any of claims 10 to 16.
18. Use of the compound of any of claims 10 to 16 for in vivo delivery of the biologically active compound.
19. Use of the compound of any of claims 10 to 15 for in vivo delivery of the biologically active compound, wherein the conjugate is coadministered with a delivery polymer.
20. An oligonucleotide comprising an antisense strand with the modification pattern5'-(w)- (Zl)- (Z2)- (Z3)na-3' and a sense strand with the modification pattern 5'- (Z3)n s-3', wherein w is independently a 5 '-phosphate or 5'-phosphothioate or H, Zl is independently a 2' -modified nuleoside. Z2 is independently a 2'-deoxy nucleoside or 2'-Fluoro-modified nucleoside,
Z3 is independently a 2 '-modified nucleoside, na is 8-23 and ns is 8-25."
21. The oligonucleotide of claim 20, wherein Zl is a a 2'-Fluoro-modified nucleoside or a 2deoxy-nucleoside and all remaining substituents as well as the variables na and ns have the meaning given above.
22. The oligonucleotide of any of claims 20 or 21, wherein Z3 is a 2'-OMethyl modified nucleoside, a 2'-Fluoro-modified nucleoside or a 2deoxy-nucleoside and all remaining substituents as well as the variables na and ns have the meaning given above.
23. The oligonucleotide of any of claims 20 to 23, covalently linked to a delivery polymer.
24. A conjugate comprising an oligonucleotide of any of claims 20 to 23 and cholesterol.
25. A conjugate comprising an oligonucleotide of any of claims 20 to 23 and a compound of the formula
Figure imgf000127_0001
26. A conjugate of a small molecule and an oligonucleotide of any of claims 20 to 23 , wherein the small molecule comprises a nucleotide linker comprising 1-10 2'OH-nucleotides; and the oligonucleotide is covalently attached to the nucleotide linker of the small molecule .
27. A conjugate according to claim 26, wherein the small molecule is cholesterol or a compound of the formula
Figure imgf000128_0001
wherein R is a nucleotide linker comprising 1-10 2'OH-nucleotides.
28. A pharmaceutical composition comprising an oligonucleotide according to any of claims 20 to 23 or a conjugate according to any of claims 24-27.
29. The compounds, use and methods essentially as hereinbefore described.
PCT/EP2011/073718 2010-12-29 2011-12-22 Small molecule conjugates for intracellular delivery of biologically active compounds WO2012089602A1 (en)

Priority Applications (12)

Application Number Priority Date Filing Date Title
CA2822176A CA2822176C (en) 2010-12-29 2011-12-22 Small molecule conjugates for intracellular delivery of biologically active compounds
BR112013016772A BR112013016772B8 (en) 2010-12-29 2011-12-22 compounds, compound use and pharmaceutical composition
CN201180063452.9A CN103282502B (en) 2010-12-29 2011-12-22 Small molecule conjugates for Intracellular delivery bioactive compound
ES11802425.6T ES2574177T3 (en) 2010-12-29 2011-12-22 Small molecule conjugates for intracellular dispensing of biologically active compounds
JP2013546673A JP5876075B2 (en) 2010-12-29 2011-12-22 Small molecule complexes for intracellular delivery of bioactive compounds
MX2013006329A MX341992B (en) 2010-12-29 2011-12-22 Small molecule conjugates for intracellular delivery of biologically active compounds.
RU2013134746A RU2629957C2 (en) 2010-12-29 2011-12-22 Low-molecular conjugates for intracellular delivery of biologically active compounds
KR1020137019895A KR101559642B1 (en) 2010-12-29 2011-12-22 Small molecule conjugates for intracellular delivery of biologically active compounds
EP11802425.6A EP2658982B1 (en) 2010-12-29 2011-12-22 Small molecule conjugates for intracellular delivery of biologically active compounds
MX2016009207A MX356826B (en) 2010-12-29 2011-12-22 Small molecule conjugates for intracellular delivery of biologically active compounds.
US13/917,524 US9301990B2 (en) 2010-12-29 2013-06-13 Small molecule conjugates for intracellular delivery of biologically active compounds
US15/090,147 US9968647B2 (en) 2010-12-29 2016-04-04 Small molecule conjugates for intracellular delivery of biologically active compounds

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201061427845P 2010-12-29 2010-12-29
US61/427,845 2010-12-29

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13/917,524 Continuation US9301990B2 (en) 2010-12-29 2013-06-13 Small molecule conjugates for intracellular delivery of biologically active compounds

Publications (1)

Publication Number Publication Date
WO2012089602A1 true WO2012089602A1 (en) 2012-07-05

Family

ID=44509306

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/EP2011/063436 WO2012089352A1 (en) 2010-12-29 2011-08-04 Small molecule conjugates for intracellular delivery of nucleic acids
PCT/EP2011/073718 WO2012089602A1 (en) 2010-12-29 2011-12-22 Small molecule conjugates for intracellular delivery of biologically active compounds

Family Applications Before (1)

Application Number Title Priority Date Filing Date
PCT/EP2011/063436 WO2012089352A1 (en) 2010-12-29 2011-08-04 Small molecule conjugates for intracellular delivery of nucleic acids

Country Status (12)

Country Link
US (5) US8426554B2 (en)
EP (3) EP3147367A1 (en)
JP (3) JP5876073B2 (en)
KR (2) KR20130108655A (en)
CN (4) CN104328121A (en)
BR (4) BR112013016761B1 (en)
CA (4) CA2976966C (en)
ES (2) ES2605990T3 (en)
HK (1) HK1189031A1 (en)
MX (3) MX342609B (en)
RU (2) RU2582235C2 (en)
WO (2) WO2012089352A1 (en)

Cited By (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014076213A1 (en) * 2012-11-15 2014-05-22 Friedrich-Schiller-Universität Jena New cell-specifically active nucleotide molecules and application kit for the application thereof
WO2014179620A1 (en) 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
WO2015168618A2 (en) 2014-05-01 2015-11-05 Isis Pharmaceuticals, Inc. Compositions and methods for modulating growth hormone receptor expression
WO2015168172A1 (en) 2014-04-28 2015-11-05 Isis Pharmaceuticals, Inc. Linkage modified oligomeric compounds
WO2015168589A2 (en) 2014-05-01 2015-11-05 Isis Pharmaceuticals, Inc. Compositions and methods for modulating angiopoietin-like 3 expression
JP2016501195A (en) * 2012-11-15 2016-01-18 ロシュ イノベーション センター コペンハーゲン エーエス Oligonucleotide conjugate
WO2017053722A1 (en) 2015-09-24 2017-03-30 Ionis Pharmaceuticals, Inc. Modulators of kras expression
WO2017079745A1 (en) 2015-11-06 2017-05-11 Ionis Pharmaceuticals, Inc. Conjugated antisense compounds for use in therapy
WO2018014041A2 (en) 2016-07-15 2018-01-18 Ionis Pharmaceuticals, Inc. Compounds and methods for modulation of smn2
US10023861B2 (en) 2011-08-29 2018-07-17 Ionis Pharmaceuticals, Inc. Oligomer-conjugate complexes and their use
US10246709B2 (en) 2016-03-07 2019-04-02 Arrowhead Pharmaceuticals, Inc. Targeting ligands for therapeutic compounds
US10280423B2 (en) 2014-05-01 2019-05-07 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating complement factor B expression
US10294474B2 (en) 2016-09-02 2019-05-21 Arrowhead Pharmaceuticals, Inc. Targeting ligands
WO2019140452A1 (en) 2018-01-15 2019-07-18 Ionis Pharmaceuticals, Inc. Modulators of dnm2 expression
WO2019217527A1 (en) 2018-05-09 2019-11-14 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing fxi expression
US10557137B2 (en) 2015-11-06 2020-02-11 Ionis Pharmaceuticals, Inc. Modulating apolipoprotein (a) expression
WO2020033748A1 (en) 2018-08-08 2020-02-13 Arcturus Therapeutics, Inc. Compositions and agents against nonalcoholic steatohepatitis
US10570169B2 (en) 2014-05-22 2020-02-25 Ionis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
WO2020061200A1 (en) 2018-09-19 2020-03-26 Ionis Pharmaceuticals, Inc. Modulators of pnpla3 expression
WO2021074772A1 (en) 2019-10-14 2021-04-22 Astrazeneca Ab Modulators of pnpla3 expression
EP3862362A2 (en) 2014-05-01 2021-08-11 Ionis Pharmaceuticals, Inc. Conjugates of modified antisense oligonucleotides and their use for modulating pkk expression
US11149264B2 (en) 2018-02-12 2021-10-19 Ionis Pharmaceuticals, Inc. Modified compounds and uses thereof
US11299737B1 (en) 2020-02-28 2022-04-12 Ionis Pharmaceuticals, Inc. Compounds and methods for modulating SMN2
US11400161B2 (en) 2016-10-06 2022-08-02 Ionis Pharmaceuticals, Inc. Method of conjugating oligomeric compounds
US11447521B2 (en) 2020-11-18 2022-09-20 Ionis Pharmaceuticals, Inc. Compounds and methods for modulating angiotensinogen expression
EP4092119A2 (en) 2015-07-10 2022-11-23 Ionis Pharmaceuticals, Inc. Modulators of diacyglycerol acyltransferase 2 (dgat2)
WO2023056440A1 (en) 2021-10-01 2023-04-06 Adarx Pharmaceuticals, Inc. Prekallikrein-modulating compositions and methods of use thereof
EP4309732A2 (en) 2017-03-24 2024-01-24 Ionis Pharmaceuticals, Inc. Modulators of pcsk9 expression
US12013403B2 (en) 2014-09-12 2024-06-18 Biogen Ma Inc. Compositions and methods for detection of SMN protein in a subject and treatment of a subject

Families Citing this family (109)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080281041A1 (en) * 1999-06-07 2008-11-13 Rozema David B Reversibly Masked Polymers
WO2012019168A2 (en) 2010-08-06 2012-02-09 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
CA2821992A1 (en) 2010-10-01 2012-04-05 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US8501930B2 (en) 2010-12-17 2013-08-06 Arrowhead Madison Inc. Peptide-based in vivo siRNA delivery system
EP3147367A1 (en) 2010-12-29 2017-03-29 F. Hoffmann-La Roche AG Small molecule conjugates for intracellular delivery of nucleic acids
DE12722942T1 (en) 2011-03-31 2021-09-30 Modernatx, Inc. RELEASE AND FORMULATION OF MANIPULATED NUCLEIC ACIDS
US9464124B2 (en) 2011-09-12 2016-10-11 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
EP3492109B1 (en) 2011-10-03 2020-03-04 ModernaTX, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
JP2015501844A (en) 2011-12-16 2015-01-19 モデルナ セラピューティクス インコーポレイテッドＭｏｄｅｒｎａ Ｔｈｅｒａｐｅｕｔｉｃｓ，Ｉｎｃ． Modified nucleosides, nucleotides and nucleic acid compositions
EP2833923A4 (en) 2012-04-02 2016-02-24 Moderna Therapeutics Inc Modified polynucleotides for the production of proteins
US9283287B2 (en) 2012-04-02 2016-03-15 Moderna Therapeutics, Inc. Modified polynucleotides for the production of nuclear proteins
US9572897B2 (en) 2012-04-02 2017-02-21 Modernatx, Inc. Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins
US9878056B2 (en) 2012-04-02 2018-01-30 Modernatx, Inc. Modified polynucleotides for the production of cosmetic proteins and peptides
US20150148292A1 (en) 2012-07-09 2015-05-28 Emory University Bone morphogenetic protein pathway activation, compositions for ossification, and methods related thereto
LT2922554T (en) 2012-11-26 2022-06-27 Modernatx, Inc. Terminally modified rna
AU2014211406B2 (en) 2013-01-30 2019-07-18 Roche Innovation Center Copenhagen A/S LNA oligonucleotide carbohydrate conjugates
WO2014118272A1 (en) 2013-01-30 2014-08-07 Santaris Pharma A/S Antimir-122 oligonucleotide carbohydrate conjugates
JP2016511256A (en) 2013-02-28 2016-04-14 アローヘッド リサーチ コーポレイション Organic composition for treating EPAS1-related diseases
US8980864B2 (en) 2013-03-15 2015-03-17 Moderna Therapeutics, Inc. Compositions and methods of altering cholesterol levels
MX371093B (en) 2013-05-01 2020-01-16 Regulus Therapeutics Inc Microrna compounds and methods for modulating mir-122.
AU2014259953B2 (en) 2013-05-01 2020-07-02 Regulus Therapeutics Inc. Compounds and methods for enhanced cellular uptake
SI3013959T1 (en) 2013-06-27 2020-04-30 Roche Innovation Center Copenhagen A/S Antisense oligomers and conjugates targeting pcsk9
EP3030244B1 (en) * 2013-08-07 2021-04-21 Arrowhead Pharmaceuticals, Inc. Polyconjugates for delivery of rnai triggers to tumor cells in vivo
WO2015034925A1 (en) 2013-09-03 2015-03-12 Moderna Therapeutics, Inc. Circular polynucleotides
US10002177B1 (en) * 2013-09-16 2018-06-19 Amazon Technologies, Inc. Crowdsourced analysis of decontextualized data
WO2015048744A2 (en) 2013-09-30 2015-04-02 Moderna Therapeutics, Inc. Polynucleotides encoding immune modulating polypeptides
EP3052521A1 (en) 2013-10-03 2016-08-10 Moderna Therapeutics, Inc. Polynucleotides encoding low density lipoprotein receptor
WO2015061536A1 (en) 2013-10-25 2015-04-30 Regulus Therapeutics Inc. Microrna compounds and methods for modulating mir-21 activity
GB201408623D0 (en) 2014-05-15 2014-07-02 Santaris Pharma As Oligomers and oligomer conjugates
TW201620526A (en) 2014-06-17 2016-06-16 愛羅海德研究公司 Compositions and methods for inhibiting gene expression of alpha-1 antitrypsin
US10517898B2 (en) 2014-11-20 2019-12-31 The Regents Of The University Of California Compositions and methods related to hematologic recovery
EP3569711B1 (en) * 2014-12-15 2021-02-03 Dicerna Pharmaceuticals, Inc. Ligand-modified double-stranded nucleic acids
MX2017014638A (en) 2015-05-29 2018-01-23 Arrowhead Pharmaceuticals Inc Biologically cleavable tetrapeptide linking agents.
EA201792103A1 (en) 2015-05-29 2018-06-29 Эрроухэд Фармасьютикалз, Инк. COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF HIF2ALPH GENES
AU2016306275A1 (en) 2015-08-07 2018-02-08 Arrowhead Pharmaceuticals, Inc. RNAi therapy for Hepatitis B virus infection
WO2017055423A1 (en) 2015-10-02 2017-04-06 Roche Innovation Center Copenhagen A/S Oligonucleotide conjugation process
WO2017067970A1 (en) 2015-10-22 2017-04-27 Roche Innovation Center Copenhagen A/S In vitro toxicity screening assay
WO2017085550A1 (en) 2015-11-16 2017-05-26 Olix Pharmaceuticals, Inc. Treatment of age-related macular degeneration using rna complexes that target myd88 or tlr3
US10358648B2 (en) 2016-02-02 2019-07-23 Olix Pharmaceuticals, Inc. Treatment of atopic dermatitis and asthma using RNA complexes that target IL4Rα, TRPA1, or F2RL1
AR108038A1 (en) 2016-03-14 2018-07-11 Roche Innovation Ct Copenhagen As OLIGONUCLEOTIDES TO REDUCE THE EXPRESSION OF PD-L1 (PROGRAMMED DEATH LINK-1)
EP3472347B1 (en) 2016-06-17 2023-01-04 F. Hoffmann-La Roche AG In vitro nephrotoxicity screening assay
US11105794B2 (en) 2016-06-17 2021-08-31 Hoffmann-La Roche Inc. In vitro nephrotoxicity screening assay
WO2018017814A1 (en) 2016-07-20 2018-01-25 President And Fellows Of Harvard College Peptidoglycan glycosyltransferase inhibitors of sed proteins for treating bacterial infections
JOP20170161A1 (en) 2016-08-04 2019-01-30 Arrowhead Pharmaceuticals Inc RNAi Agents for Hepatitis B Virus Infection
CA3033756A1 (en) 2016-09-02 2018-03-08 Dicerna Pharmaceuticals, Inc. 4'-phosphate analogs and oligonucleotides comprising the same
WO2018053142A2 (en) 2016-09-14 2018-03-22 President And Fellows Of Harvard College Methods and compositions for modulating erythropoiesis
WO2018112032A1 (en) 2016-12-13 2018-06-21 President And Fellows Of Harvard College Methods and compositions for targeting tumor-infiltrating tregs using inhibitors of ccr8 and tnfrsf8
WO2018112365A2 (en) 2016-12-16 2018-06-21 Evelo Biosciences, Inc. Methods of treating colorectal cancer and melanoma using parabacteroides goldsteinii
WO2018112364A1 (en) 2016-12-16 2018-06-21 Evelo Biosciences, Inc. Combination therapies for treating melanoma
WO2018112360A1 (en) 2016-12-16 2018-06-21 Evelo Biosciences, Inc. Combination therapies for treating cancer
WO2018112363A1 (en) 2016-12-16 2018-06-21 Evelo Biosciences, Inc. Methods of treating cancer using parabacteroides
AU2018208505B2 (en) 2017-01-10 2024-03-07 Arrowhead Pharmaceuticals, Inc. Alpha-1 antitrypsin (AAT) RNAi agents, compositions including AAT RNAi agents, and methods of use
US20200121739A1 (en) 2017-01-18 2020-04-23 Evelo Biosciences, Inc. Bacteria for treating cancer
EP3570857A1 (en) 2017-01-18 2019-11-27 Evelo Biosciences, Inc. Methods of treating cancer
TW201920648A (en) 2017-08-29 2019-06-01 美商艾弗洛生物科技股份有限公司 Treating cancer using a BLAUTIA Strain
US11123437B2 (en) 2017-09-05 2021-09-21 Mainline Biosciences, Inc. Selective CXCR4 binding peptide conjugate and methods for making and using the same
WO2019105435A1 (en) 2017-12-01 2019-06-06 苏州瑞博生物技术有限公司 Nucleic acid, composition and conjugate containing nucleic acid, preparation method and use
JP7365052B2 (en) 2017-12-01 2023-10-19 スーチョウ リボ ライフ サイエンス カンパニー、リミテッド Nucleic acids, compositions and complexes containing the nucleic acids, and preparation methods and uses
CN118236391A (en) * 2017-12-01 2024-06-25 苏州瑞博生物技术股份有限公司 Nucleic acid, composition containing nucleic acid, conjugate, preparation method and application
US11492620B2 (en) 2017-12-01 2022-11-08 Suzhou Ribo Life Science Co., Ltd. Double-stranded oligonucleotide, composition and conjugate comprising double-stranded oligonucleotide, preparation method thereof and use thereof
US11633482B2 (en) 2017-12-29 2023-04-25 Suzhou Ribo Life Science Co., Ltd. Conjugates and preparation and use thereof
US20210095277A1 (en) 2018-01-18 2021-04-01 Roche Innovation Center Copenhagen A/S Antisense oligonucleotides targeting srebp1
WO2019169138A1 (en) 2018-02-28 2019-09-06 Evelo Biosciences, Inc. Compositions and methods for treating cancer using paraclostridium benzoelyticum
WO2019169160A1 (en) 2018-02-28 2019-09-06 Evelo Biosciences, Inc. Compositions and methods for treating cancer using ruminococcus gnavus
WO2019169143A1 (en) 2018-02-28 2019-09-06 Evelo Biosciences, Inc. Compositions and methods for treating cancer using turicibacter sanguinis
WO2019169168A1 (en) 2018-02-28 2019-09-06 Evelo Biosciences, Inc. Compositions and methods for treating cancer using agathobaculum
WO2019178057A1 (en) 2018-03-12 2019-09-19 Evelo Biosciences, Inc. Methods of treating cancer using burkholderia
EP3790991A1 (en) 2018-05-07 2021-03-17 Roche Innovation Center Copenhagen A/S Massively parallel discovery methods for oligonucleotide therapeutics
EP3790972A1 (en) 2018-05-08 2021-03-17 Regulus Therapeutics Inc. Galnac conjugated modified oligonucleotide as mir-122 inhibitor having hcv antiviral activity with reduced hyperbilirubinemia side-effect
WO2020007826A1 (en) 2018-07-05 2020-01-09 Roche Innovation Center Copenhagen A/S Antisense oligonucleotides targeting mbtps1
WO2020011744A2 (en) 2018-07-11 2020-01-16 Roche Innovation Center Copenhagen A/S Antisense oligonucleotides targeting cers5
WO2020011745A2 (en) 2018-07-11 2020-01-16 Roche Innovation Center Copenhagen A/S Antisense oligonucleotides targeting cers6
JP2021535092A (en) 2018-08-13 2021-12-16 フラッグシップ パイオニアリング イノベーションズ ブイ， インコーポレイテッド Conjoined twins and how to use them
CN111655849B (en) 2018-08-21 2024-05-10 苏州瑞博生物技术股份有限公司 Nucleic acid, pharmaceutical composition containing nucleic acid, conjugate and application of conjugate
US11273137B2 (en) 2018-09-04 2022-03-15 Board Of Trustees Of Michigan State University Methods and compositions to prevent and treat disorders associated with mutations in the ODC1 gene
CN111655297A (en) * 2018-09-30 2020-09-11 苏州瑞博生物技术有限公司 siRNA conjugate and preparation method and application thereof
CA3132199A1 (en) 2019-03-12 2020-09-17 President And Fellows Of Harvard College Methods and compositions for treating cancer
JP2022527108A (en) 2019-03-29 2022-05-30 ディセルナ ファーマシューティカルズ インコーポレイテッド Compositions and Methods for the Treatment of KRAS-Related Diseases or Disorders
CN113795581A (en) 2019-05-03 2021-12-14 迪克纳制药公司 Double stranded nucleic acid inhibitor molecules with shortened sense strand
US20220226269A1 (en) 2019-06-12 2022-07-21 President And Fellows Of Harvard College Methods and compositions for modulation of an interspecies gut bacterial pathway for levodopa metabolism
CN110218728A (en) * 2019-06-28 2019-09-10 厦门甘宝利生物医药有限公司 A kind of noval chemical compound and its application
WO2021008708A1 (en) * 2019-07-18 2021-01-21 Biontech Rna Pharmaceuticals Gmbh Method for determining at least one parameter of a sample composition comprising nucleic acid, such as rna, and optionally particles
WO2021022110A1 (en) 2019-08-01 2021-02-04 Evelo Biosciences, Inc. Inducing immune effects using bacteria of the genus bifidobacterium
CN111041025B (en) 2019-12-17 2021-06-18 深圳市瑞吉生物科技有限公司 mRNA targeting molecule based on combination of N-acetylgalactosamine polypeptide and preparation method thereof
CN112111524B (en) * 2020-01-10 2024-02-27 深圳瑞吉生物科技有限公司 Preparation method of mRNA-GalNAc targeting molecule, in-vivo delivery system and application thereof
KR20220142445A (en) 2020-01-15 2022-10-21 다이서나 파마수이티컬, 인크. 4'-O-methylene phosphonate nucleic acids and analogs thereof
JP2023516878A (en) * 2020-01-26 2023-04-21 メインライン バイオサイエンシーズ（シャンハイ）シーオー．，エルティーディ． Isotopically labeled selective CXCR4 binding peptide conjugates and methods of making and using the same
AU2021232598A1 (en) 2020-03-04 2022-09-08 Regeneron Pharmaceuticals, Inc. Methods and compositions for sensitization of tumor cells to immune therapy
WO2021242826A1 (en) 2020-05-27 2021-12-02 The Regents Of The University Of California Compositions and methods for transdifferentiating cells
CN111744019B (en) 2020-07-01 2023-08-04 深圳瑞吉生物科技有限公司 Mannose-based mRNA targeted delivery system and application thereof
WO2022031433A1 (en) 2020-08-04 2022-02-10 Dicerna Pharmaceuticals, Inc. Systemic delivery of oligonucleotides
WO2022056454A2 (en) 2020-09-14 2022-03-17 President And Fellows Of Harvard College Methods and compositions for treating hpv-positive cancers
IL301306A (en) 2020-09-16 2023-05-01 Harvard College Methods of treating an individual that has failed an anti-pd-1/anti-pd-l1 therapy
JP7349578B2 (en) 2020-10-27 2023-09-22 エルシダ オンコロジー， インコーポレイテッド Nanoparticle drug conjugates targeted to folate receptors and their uses
CA3227661A1 (en) 2021-08-05 2023-02-09 Weimin Wang 1'-alkyl modified ribose derivatives and methods of use
CN118434751A (en) 2021-08-30 2024-08-02 兆维生物科技公司 Functionalized N-acetylgalactosamine analogues
WO2023034561A2 (en) * 2021-09-02 2023-03-09 Vanderbilt University Lipophilic oligonucleotide conjugates
CA3233113A1 (en) 2021-09-22 2023-03-30 Sanegene Bio Usa Inc. 2'-alkyl or 3'-alkyl modified ribose derivatives for use in the in-vivo delivery of oligonucleotides
WO2023059695A1 (en) 2021-10-05 2023-04-13 Sanegene Bio Usa Inc. Polyhydroxylated cyclopentane derivatives and methods of use
WO2023114746A1 (en) * 2021-12-15 2023-06-22 Hongene Biotech Corporation Functionalized n-acetylgalactosamine analogs
WO2023150181A1 (en) 2022-02-01 2023-08-10 President And Fellows Of Harvard College Methods and compositions for treating cancer
US20230346819A1 (en) 2022-02-22 2023-11-02 Sanegene Bio Usa Inc. 5'-modified carbocyclic ribonucleotide derivatives and methods of use
WO2024015796A1 (en) 2022-07-11 2024-01-18 Sanegene Bio Usa Inc. Optimized 2'- modified ribose derivatives and methods of use
WO2024031101A1 (en) 2022-08-05 2024-02-08 Sanegene Bio Usa Inc. Double stranded rna targeting angiotensinogen (agt) and methods of use thereof
WO2024081954A2 (en) 2022-10-14 2024-04-18 Sanegene Bio Usa Inc. Small interfering rna targeting c3 and uses thereof
WO2024118503A1 (en) 2022-11-28 2024-06-06 Hongene Biotech Corporation Functionalized n-acetylgalactosamine analogs
WO2024137590A2 (en) 2022-12-19 2024-06-27 Sanegene Bio Usa Inc. Small interfering rna targeting cfb and uses thereof
US20240309383A1 (en) 2023-02-24 2024-09-19 Suzhou Sanegene Bio Inc. Small interfering rna targeting hbv and uses thereof
WO2024186673A2 (en) 2023-03-03 2024-09-12 Sanegene Bio Usa Inc. Small interfering rna targeting apoc3 and uses thereof

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5948902A (en) 1997-11-20 1999-09-07 South Alabama Medical Science Foundation Antisense oligonucleotides to human serine/threonine protein phosphatase genes
WO2001070415A1 (en) 2000-03-20 2001-09-27 Solipat Ag Device and method for applying coating material
US20040162260A1 (en) 2003-02-18 2004-08-19 Rozema David B. Reversible attachment of a membrane active polymer to a polynucleotide
WO2007048244A2 (en) * 2005-10-28 2007-05-03 Topigen Pharmaceuticals Inc. Small interfering ribonucleic acid duplexes comprising arabinose modified nucleotides
WO2007138324A2 (en) * 2006-05-30 2007-12-06 University College London Materials and complexes for the delivery of biologically-active material to cells
WO2008022309A2 (en) 2006-08-18 2008-02-21 F. Hoffmann-La Roche Ag Polyconjugates for in vivo delivery of polynucleotides
WO2010043512A1 (en) 2008-10-15 2010-04-22 F. Hoffmann-La Roche Ag Oligonucleotide detection method

Family Cites Families (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6214345B1 (en) * 1993-05-14 2001-04-10 Bristol-Myers Squibb Co. Lysosomal enzyme-cleavable antitumor drug conjugates
US6197332B1 (en) * 1997-08-13 2001-03-06 Chiron Corporation Lipid-conjugated polyamide compounds and related compositions and methods thereof
DE19935302A1 (en) * 1999-07-28 2001-02-08 Aventis Pharma Gmbh Conjugates and processes for their preparation and their use for the transport of molecules across biological membranes
WO2001060415A1 (en) 2000-02-18 2001-08-23 The Immune Response Corporation Methods and compositions for gene delivery
WO2001074399A1 (en) * 2000-03-30 2001-10-11 Ajinomoto Co., Inc. Drugs retained in target tissue over long time
US6696038B1 (en) * 2000-09-14 2004-02-24 Expression Genetics, Inc. Cationic lipopolymer as biocompatible gene delivery agent
US20040142474A1 (en) 2000-09-14 2004-07-22 Expression Genetics, Inc. Novel cationic lipopolymer as a biocompatible gene delivery agent
US7091186B2 (en) 2001-09-24 2006-08-15 Seattle Genetics, Inc. p-Amidobenzylethers in drug delivery agents
US8969543B2 (en) * 2003-04-03 2015-03-03 Bioneer Corporation SiRNA-hydrophilic polymer conjugates for intracellular delivery of siRNA and method thereof
US7541330B2 (en) * 2004-06-15 2009-06-02 Kosan Biosciences Incorporated Conjugates with reduced adverse systemic effects
US7915399B2 (en) * 2006-06-09 2011-03-29 Protiva Biotherapeutics, Inc. Modified siRNA molecules and uses thereof
EP2121030A4 (en) * 2007-01-17 2013-06-19 Immunomedics Inc Polymeric carriers of therapeutic agents and recognition moieties for antibody-based targeting of disease sites
DE102007018610A1 (en) * 2007-04-18 2008-10-23 Ceramtec Ag Innovative Ceramic Engineering Ceramic material having a composition that is tuned to a given by a metallic material thermal expansion coefficient
UA97559C2 (en) * 2007-11-08 2012-02-27 Оцука Фармасьютікал Ко., Лтд. Nucleic acid complex and a nucleic acid delivery composition
CA3043911A1 (en) 2007-12-04 2009-07-02 Arbutus Biopharma Corporation Targeting lipids
CN101468203B (en) * 2007-12-25 2012-06-27 沈阳药科大学 Method for preparing cleavable polyethyleneglycol lipid derivates and application
JP5788312B2 (en) * 2008-04-11 2015-09-30 アルニラム ファーマスーティカルズ インコーポレイテッドＡｌｎｙｌａｍ Ｐｈａｒｍａｃｅｕｔｉｃａｌｓ， Ｉｎｃ． Site-specific delivery of nucleic acids by combining targeting ligands with endosomal degradable components
TWI455944B (en) * 2008-07-01 2014-10-11 Daiichi Sankyo Co Ltd Double-stranded polynucleotides
US8273869B2 (en) * 2009-06-15 2012-09-25 Alnylam Pharmaceuticals, Inc. Lipid formulated dsRNA targeting the PCSK9 gene
WO2011005980A1 (en) 2009-07-09 2011-01-13 Intradigm Corporation Novel heterobifunctional polyethylene glycol reagents, their preparation and uses thereof
PT2539451E (en) 2010-02-24 2016-03-28 Arrowhead Res Corp Compositions for targeted delivery of sirna
WO2011154331A1 (en) 2010-06-10 2011-12-15 F. Hoffmann-La Roche Ag Polymers for delivery of nucleic acids
EP3192800A1 (en) * 2010-12-17 2017-07-19 Arrowhead Pharmaceuticals, Inc. Galactose cluster-pharmacokinetic modulator targeting moiety for sirna
EP3147367A1 (en) 2010-12-29 2017-03-29 F. Hoffmann-La Roche AG Small molecule conjugates for intracellular delivery of nucleic acids

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5948902A (en) 1997-11-20 1999-09-07 South Alabama Medical Science Foundation Antisense oligonucleotides to human serine/threonine protein phosphatase genes
WO2001070415A1 (en) 2000-03-20 2001-09-27 Solipat Ag Device and method for applying coating material
US20040162260A1 (en) 2003-02-18 2004-08-19 Rozema David B. Reversible attachment of a membrane active polymer to a polynucleotide
WO2007048244A2 (en) * 2005-10-28 2007-05-03 Topigen Pharmaceuticals Inc. Small interfering ribonucleic acid duplexes comprising arabinose modified nucleotides
WO2007138324A2 (en) * 2006-05-30 2007-12-06 University College London Materials and complexes for the delivery of biologically-active material to cells
WO2008022309A2 (en) 2006-08-18 2008-02-21 F. Hoffmann-La Roche Ag Polyconjugates for in vivo delivery of polynucleotides
WO2010043512A1 (en) 2008-10-15 2010-04-22 F. Hoffmann-La Roche Ag Oligonucleotide detection method

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
ALLERSON ET AL., J. MED CHEM., vol. 48, 2005, pages 901 - 904
BIOCONJUGATE CHEM., vol. 13, 2002, pages 855
BIOCONJUGATE CHEM., vol. 13, 2002, pages 855 - 869
BIOCONJUGATE CHEM., vol. 13, 2002, pages 885 - 869
BIOCONJUGATE CHEM., vol. 13, no. 4, 2002, pages 855 - 869
CHEN Q ET AL: "Lipophilic siRNAs mediate efficient gene silencing in oligodendrocytes with direct CNC delivery", JOURNAL OF CONTROLLED RELEASE, ELSEVIER, AMSTERDAM, NL, vol. 144, 1 January 2010 (2010-01-01), pages 227 - 232, XP002601402, ISSN: 0168-3659, [retrieved on 20100217] *
INTERNATIONAL JOURNAL OF PHARMACEUTICAL RESEARCH AND DEVELOPMENT, vol. 2, no. 8, October 2010 (2010-10-01)
J BIOL BHEM, vol. 276, 2001, pages 37577
J.MED.CHEM., vol. 48, 2005, pages 1344
NAT. BIOTECHNOLOGY, vol. 21, 2003, pages 778
NATURE BIOTECH, vol. 25, 2007, pages 1149
S. WEITZER; J. MARTINEZ: "hClpl: a novel kinase revitalizes RNA metabolism", CELL CYCLE, vol. 6, no. 17, 2007, pages 2133 - 2137
WINCOTT F., NAR, vol. 23, no. 14, 1995, pages 2677 - 84

Cited By (72)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10023861B2 (en) 2011-08-29 2018-07-17 Ionis Pharmaceuticals, Inc. Oligomer-conjugate complexes and their use
JP2016501195A (en) * 2012-11-15 2016-01-18 ロシュ イノベーション センター コペンハーゲン エーエス Oligonucleotide conjugate
US10077443B2 (en) 2012-11-15 2018-09-18 Roche Innovation Center Copenhagen A/S Oligonucleotide conjugates
US11155816B2 (en) 2012-11-15 2021-10-26 Roche Innovation Center Copenhagen A/S Oligonucleotide conjugates
WO2014076213A1 (en) * 2012-11-15 2014-05-22 Friedrich-Schiller-Universität Jena New cell-specifically active nucleotide molecules and application kit for the application thereof
US9957504B2 (en) 2013-05-01 2018-05-01 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating apolipoprotein (a) expression
EP3633039A1 (en) 2013-05-01 2020-04-08 Ionis Pharmaceuticals, Inc. Compositions and methods
US9145558B2 (en) 2013-05-01 2015-09-29 Isis Pharmaceuticals, Inc. Compositions and methods for modulating HBV expression
EP3828275A1 (en) 2013-05-01 2021-06-02 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating ttr expression
US10883104B2 (en) 2013-05-01 2021-01-05 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating apolipoprotein (a) expression
EP3690049A1 (en) 2013-05-01 2020-08-05 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating apolipoprotein c-iii expression
US10683499B2 (en) 2013-05-01 2020-06-16 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating TTR expression
US9181550B2 (en) 2013-05-01 2015-11-10 Isis Pharmaceuticals, Inc. Compositions and methods for modulating apolipoprotein (a) expression
US9181549B2 (en) 2013-05-01 2015-11-10 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
WO2014179627A2 (en) 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. Compositions and methods for modulating hbv and ttr expression
US9127276B2 (en) 2013-05-01 2015-09-08 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
US9932580B2 (en) 2013-05-01 2018-04-03 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating HBV expression
WO2014179626A2 (en) 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. Compositions and methods for modulating apolipoprotein c-iii expression
US9714421B2 (en) 2013-05-01 2017-07-25 Ionis Pharmaceuticals, Inc. Compositions and methods
EP4438129A2 (en) 2013-05-01 2024-10-02 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating apolipoprotein c-iii expression
US11299736B1 (en) 2013-05-01 2022-04-12 Ionis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
US9932581B2 (en) 2013-05-01 2018-04-03 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating apolipoprotein C-III expression
US11851655B2 (en) 2013-05-01 2023-12-26 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating apolipoprotein (a) expression
WO2014179625A1 (en) 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. COMPOSITIONS AND METHODS FOR MODULATING APOLIPOPROTEIN (a) EXPRESSION
EP3524680A1 (en) 2013-05-01 2019-08-14 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating ttr expression
WO2014179629A2 (en) 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. Compositions and methods
WO2014179620A1 (en) 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
US9163239B2 (en) 2013-05-01 2015-10-20 Isis Pharmaceuticals, Inc. Compositions and methods for modulating apolipoprotein C-III expression
EP3647318A1 (en) 2014-04-28 2020-05-06 Ionis Pharmaceuticals, Inc. Linkage modified oligomeric compounds
US9926556B2 (en) 2014-04-28 2018-03-27 Ionis Pharmaceuticals, Inc. Linkage modified oligomeric compounds
WO2015168172A1 (en) 2014-04-28 2015-11-05 Isis Pharmaceuticals, Inc. Linkage modified oligomeric compounds
US9382540B2 (en) 2014-05-01 2016-07-05 Isis Pharmaceuticals, Inc Compositions and methods for modulating angiopoietin-like 3 expression
EP3757215A2 (en) 2014-05-01 2020-12-30 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating growth hormone receptor expression
EP3862362A2 (en) 2014-05-01 2021-08-11 Ionis Pharmaceuticals, Inc. Conjugates of modified antisense oligonucleotides and their use for modulating pkk expression
EP3608406A1 (en) 2014-05-01 2020-02-12 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating complement factor b expression
US11312964B2 (en) 2014-05-01 2022-04-26 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating growth hormone receptor expression
US10280423B2 (en) 2014-05-01 2019-05-07 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating complement factor B expression
US9994855B2 (en) 2014-05-01 2018-06-12 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating growth hormone receptor expression
EP3974534A1 (en) 2014-05-01 2022-03-30 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating growth hormone receptor expression
EP3845547A1 (en) 2014-05-01 2021-07-07 Ionis Pharmaceuticals, Inc. Galnac3 conjugated modified oligonucleotide for modulating angiopoietin-like 3 expression
WO2015168589A2 (en) 2014-05-01 2015-11-05 Isis Pharmaceuticals, Inc. Compositions and methods for modulating angiopoietin-like 3 expression
US11732265B2 (en) 2014-05-01 2023-08-22 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating complement factor B expression
US10793862B2 (en) 2014-05-01 2020-10-06 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating growth hormone receptor expression
US10875884B2 (en) 2014-05-01 2020-12-29 Isis Pharmaceuticals, Inc. Compositions and methods for modulating angiopoietin-like 3 expression
EP4219718A2 (en) 2014-05-01 2023-08-02 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating complement factor b expression
WO2015168618A2 (en) 2014-05-01 2015-11-05 Isis Pharmaceuticals, Inc. Compositions and methods for modulating growth hormone receptor expression
US10570169B2 (en) 2014-05-22 2020-02-25 Ionis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
US12013403B2 (en) 2014-09-12 2024-06-18 Biogen Ma Inc. Compositions and methods for detection of SMN protein in a subject and treatment of a subject
EP4092119A2 (en) 2015-07-10 2022-11-23 Ionis Pharmaceuticals, Inc. Modulators of diacyglycerol acyltransferase 2 (dgat2)
WO2017053722A1 (en) 2015-09-24 2017-03-30 Ionis Pharmaceuticals, Inc. Modulators of kras expression
WO2017079745A1 (en) 2015-11-06 2017-05-11 Ionis Pharmaceuticals, Inc. Conjugated antisense compounds for use in therapy
EP4119569A1 (en) 2015-11-06 2023-01-18 Ionis Pharmaceuticals, Inc. Conjugated antisense compounds for use in therapy
US11319536B2 (en) 2015-11-06 2022-05-03 Ionis Pharmacueticals, Inc. Modulating apolipoprotein (a) expression
US10557137B2 (en) 2015-11-06 2020-02-11 Ionis Pharmaceuticals, Inc. Modulating apolipoprotein (a) expression
US12116573B2 (en) 2016-03-07 2024-10-15 Arrowhead Pharmaceuticals, Inc. Targeting ligands for therapeutic compounds
US10246709B2 (en) 2016-03-07 2019-04-02 Arrowhead Pharmaceuticals, Inc. Targeting ligands for therapeutic compounds
WO2018014041A2 (en) 2016-07-15 2018-01-18 Ionis Pharmaceuticals, Inc. Compounds and methods for modulation of smn2
EP4206213A1 (en) 2016-07-15 2023-07-05 Ionis Pharmaceuticals, Inc. Compounds and methods for modulation of smn2
US11174481B2 (en) 2016-09-02 2021-11-16 Arrowhead Pharmaceuticals, Inc. Targeting ligands
US10294474B2 (en) 2016-09-02 2019-05-21 Arrowhead Pharmaceuticals, Inc. Targeting ligands
US11400161B2 (en) 2016-10-06 2022-08-02 Ionis Pharmaceuticals, Inc. Method of conjugating oligomeric compounds
EP4309732A2 (en) 2017-03-24 2024-01-24 Ionis Pharmaceuticals, Inc. Modulators of pcsk9 expression
WO2019140452A1 (en) 2018-01-15 2019-07-18 Ionis Pharmaceuticals, Inc. Modulators of dnm2 expression
US11149264B2 (en) 2018-02-12 2021-10-19 Ionis Pharmaceuticals, Inc. Modified compounds and uses thereof
US11332733B2 (en) 2018-02-12 2022-05-17 lonis Pharmaceuticals, Inc. Modified compounds and uses thereof
WO2019217527A1 (en) 2018-05-09 2019-11-14 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing fxi expression
WO2020033748A1 (en) 2018-08-08 2020-02-13 Arcturus Therapeutics, Inc. Compositions and agents against nonalcoholic steatohepatitis
WO2020061200A1 (en) 2018-09-19 2020-03-26 Ionis Pharmaceuticals, Inc. Modulators of pnpla3 expression
WO2021074772A1 (en) 2019-10-14 2021-04-22 Astrazeneca Ab Modulators of pnpla3 expression
US11299737B1 (en) 2020-02-28 2022-04-12 Ionis Pharmaceuticals, Inc. Compounds and methods for modulating SMN2
US11447521B2 (en) 2020-11-18 2022-09-20 Ionis Pharmaceuticals, Inc. Compounds and methods for modulating angiotensinogen expression
WO2023056440A1 (en) 2021-10-01 2023-04-06 Adarx Pharmaceuticals, Inc. Prekallikrein-modulating compositions and methods of use thereof

Also Published As

Publication number Publication date
US20130190484A1 (en) 2013-07-25
MX2013006330A (en) 2013-06-28
CA3131967A1 (en) 2012-07-05
CN103282503A (en) 2013-09-04
CA2822161A1 (en) 2012-07-05
BR122020024388B1 (en) 2021-09-21
WO2012089352A1 (en) 2012-07-05
ES2574177T3 (en) 2016-06-15
BR122020024394B1 (en) 2021-05-11
EP2658982B1 (en) 2016-04-20
BR112013016772A2 (en) 2016-10-11
CN104328121A (en) 2015-02-04
KR20130116907A (en) 2013-10-24
US8802773B2 (en) 2014-08-12
CN106117310B (en) 2021-04-06
RU2629957C2 (en) 2017-09-05
CN106117310A (en) 2016-11-16
HK1189031A1 (en) 2014-05-23
US20120172412A1 (en) 2012-07-05
EP2658982A1 (en) 2013-11-06
CN103282503B (en) 2015-12-02
CA2976966A1 (en) 2012-07-05
JP2014505469A (en) 2014-03-06
MX341992B (en) 2016-09-09
MX2013006329A (en) 2013-06-28
BR112013016772B8 (en) 2021-02-09
US9301990B2 (en) 2016-04-05
JP2015165799A (en) 2015-09-24
US20140135380A1 (en) 2014-05-15
KR101559642B1 (en) 2015-10-12
EP2658981A1 (en) 2013-11-06
CN103282502A (en) 2013-09-04
EP2658981B1 (en) 2016-09-28
US20140135381A1 (en) 2014-05-15
MX356826B (en) 2018-06-15
BR112013016761B1 (en) 2021-04-06
CA2822176C (en) 2017-06-13
BR112013016761A2 (en) 2016-10-11
JP2014504499A (en) 2014-02-24
JP5876073B2 (en) 2016-03-02
US20170022505A1 (en) 2017-01-26
CN103282502B (en) 2016-08-10
CA2822161C (en) 2018-05-29
EP3147367A1 (en) 2017-03-29
US9968647B2 (en) 2018-05-15
RU2013134746A (en) 2015-02-10
CA2822176A1 (en) 2012-07-05
RU2013134745A (en) 2015-02-10
RU2582235C2 (en) 2016-04-20
US9198947B2 (en) 2015-12-01
CA2976966C (en) 2021-11-09
US8426554B2 (en) 2013-04-23
MX342609B (en) 2016-10-06
KR20130108655A (en) 2013-10-04
BR112013016772B1 (en) 2021-01-05
JP5876075B2 (en) 2016-03-02
ES2605990T3 (en) 2017-03-17

Similar Documents

Publication Publication Date Title
US9968647B2 (en) Small molecule conjugates for intracellular delivery of biologically active compounds
EP2651420B1 (en) Peptide-based in vivo sirna delivery system
TWI565476B (en) Peptide-based in vivo sirna delivery system

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11802425

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2011802425

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: MX/A/2013/006329

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2822176

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2013546673

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 20137019895

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2013134746

Country of ref document: RU

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112013016772

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112013016772

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20130628