WO2012083681A1

WO2012083681A1 - Cynoglossus semilaevis gender-specific microsatellite marker and application thereof in super-female fish identification

Info

Publication number: WO2012083681A1
Application number: PCT/CN2011/077158
Authority: WO
Inventors: 陈松林; 邵长伟; 季相山; 梁卓; 李文龙; 宋文涛; 徐营
Original assignee: 中国水产科学研究院黄海水产研究所
Priority date: 2010-12-23
Filing date: 2011-07-14
Publication date: 2012-06-28
Also published as: CN102134593B; CN102134593A

Abstract

Cynoglossus semilaevis gender-specific microsatellite markers and an application thereof in super-female fish identification, wherein the nucleotide sequences of the gender-specific microsatellite markers are SEQIDNO:1 and SEQIDNO:2 respectively. A pair of primers for expanding the gender-specific microsatellite markers, an upstream primer and a downstream primer thereof have sequences SEQIDNO:3 and SEQIDNO:4 respectively. A method using the primers to identify the gender of a cynoglossus semilaevis: the amplified product segment of a super-female being 218 bp; the amplified product of females being two DNA segments, 216 – 220 bp and 204 – 208 bp in size respectively; the amplified product for males being one DNA segment, of 204 – 208 bp in size. Employment of the microsatellite markers enables rapid identification of cynoglossus semilaevis ZE female, WW super-female, and ZZ male, thereby solving a difficulty found in gender control of cynoglossus semilaevis, and in WW super-female and ZW female identification in a same-sex culture seeding.

Description

Sex-specific microsatellite markers of semi-smooth tongue and its application in identification of super females

The invention belongs to the technical field of fish sex identification and gender control in the technology of water production, and particularly relates to a gender-specific microsatellite marker of semi-smooth tongue and its application in the identification of super female fish.

Background technique

Cynoglossus semilaevis is a kind of large-scale underwater fish with warm water in the offshore. Its meat is tender and nutritious, and it is deeply loved by consumers. It is one of the leading species of marine fish in China. However, the growth rate of female and male individuals is quite different, and the growth rate of female individuals is 2 to 4 times faster than that of male individuals. Due to the slow growth of the male individuals and the small size of the individual, the aquaculture yield of the semi-smooth tongue is reduced, and the breeding cost is increased, thus seriously affecting the promotion of the semi-smooth tongue seedlings and the formation of the breeding industry. The research on genetic sex detection and gender control technology of semi-smooth tongues, especially the development and production of semi-smooth tongues, has become the key to the healthy, sustainable and rapid development of the semi-smooth aphid breeding industry.

The semi-smooth tongue has a female-specific sex chromosome (W chromosome), while the male sex chromosome is the same (ZZ) (Zhou Liqing et al., 2005). The female fish of the semi-smooth tongue produces Z-type and W-type eggs. Through artificial gynogenesis, two female gynogenetic fry of ZZ male fish and WW super female female can be produced, and the WW super female fry are matured, and then with ZZ male fish. Mating, you can mass produce ZW-type whole female fry. However, due to the existence of recombinant exchange, there are also some ZW females in the gynogenetic fry. However, it is necessary to screen and cultivate W super female individuals, which must be able to identify super female individuals and ordinary ZW female individuals. Therefore, the identification of semi-smooth tongue and super female individuals has become the key to the development of semi-smooth tongue female whole female fry.

Gender-specific molecular markers are a promising technical tool for identifying gender. However, current research on fish-specific molecular markers and rapid identification methods has only been carried out on a few species of fish. For example, Devl in (1994) of the West Vancouver Laboratory in Canada screened for the Y chromosome specificity of large scale salmon. DNA fragment; Griffiths et al. (2000) found two male-specific AFLP markers in the three-spotted squid iasterosteus aculeatus L. However, when applied to two other species of spiny fish, their gender cannot be correctly identified. Rachael et al. (2003) compared the Y-linked maps of four species of squid (Arctic carp, Atlantic salmon, brown carp, and rainbow trout) and found two and six sex-linked AFLP markers in Arctic carp and rainbow trout, respectively. However, these markers have species specificity and therefore have a narrow range of applications.

Because the sex differentiation of fish is relatively primitive, the difference between male and female chromosomes is small, so the identification of hereditary sex is difficult. Although the sex-specific molecular markers of fish can be used to identify the male and female sex of a few fish, it is very difficult to identify ZW females and W-super females using this marker. For example, Chen et al. (2007) isolated a female-specific AFLP marker from the semi-smooth tongue and transformed it into a SCAR marker, and established a PCR method to identify the sex of the semi-smooth tongue. But because the AFLP marker is a dominant inheritance Sub-markers, it is difficult to distinguish between homozygotes and heterozygotes; therefore, the semi-slip tongue AFLP female-specific and genetic sex identification techniques established by Chen et al. (2007) can distinguish between semi-smooth tongue ZZ male individuals and ZW female individuals, but cannot distinguish ZW female individuals from WW. Super female individual. So far, there have been no reports on the molecular biology methods for the identification of super-sex individuals in semi-smooth tongues at home and abroad. Therefore, it is of great significance and application value to explore the molecular biological methods that can identify the normal female and super female individuals of the semi-smooth tongue ZW. It is useful for screening and breeding a large number of semi-smooth tongues, and then breeding the whole female seedlings. Microsatellite markers are codominant, highly polymorphic, consistent with Mendelian genetic separation, and gender-linked. If a female or male-specific microsatellite marker is screened, primers can be designed based on the sequence of the specific marker. A molecular biological method for distinguishing ZW female individuals from WW super female individuals was established to solve the problem of identification of semi-smooth tongues ZW females and WW super female individuals. However, molecular markers for the identification of female specific microsatellite markers and WW super females have been reported at home and abroad. Summary of the invention

The object of the present invention is to provide a sex microsatellite marker of semi-smooth tongue and its application in the identification of super females, that is, by screening for gender-specific microsatellite markers to obtain molecular markers for identification of semi-smooth scorpion super females and ZW female individuals. Marking can solve the problem that ZW female fish and WW super female fish cannot be quickly identified in the semi-smooth tongue sex control and whole female breeding research to make up for the shortcomings of the prior art.

The present invention establishes the use of sex-specific microsatellite markers to identify the genotypes of the microsatellite markers in ZZ male fish, ZW female fish and W super female fish by the female specific microsatellite markers obtained in the genome sequencing of the semi-smooth tongue. A technical method for semi-smooth tongue 鳎 male fish, ZW female fish and W super female fish. It provides a reliable technical means for the production of semi-smooth tongue sex control and whole female seed production.

The technical solution of the present invention is as follows:

A sex-specific microsatellite marker of a semi-smooth tongue, characterized in that the nucleotide sequence of the microsatellite marker is SEQ ID): 1 and SEQ ID NO: 2, wherein SEQ ID NO: 1 is a 218 bp female W chromosome-specific microsatellite marker the sequence of:

Gaggccgacaggatcgtacataatcccaacttcacaataactccacaattggcactttttgttttgtt tttctcttttactttcttaacaattatacacactcggagcccgtatcgcaatgtcacaccgagggttt gtttcttctaaggtcacacacacacacacacacacacatcatgactgaagagtttctgtcgaaaaccac cggagtacgtcgta;

SEQ ID NO: 2 is the sequence of a 206 bp male Z chromosome-specific microsatellite marker:

Gaggccgacaggatcgtacatcctcccaacttcacaataactccacaattggcacttttttttttctc ttttactttcttaacaattacacaactcggagcccgtatcacaatgtcacaccgagggtctgtttct tctaaggtcaaacacacacacacgggcatgactgaagagtttcagttgaaaaccaccggagtacgtcg Ta.

An amplification primer for amplifying a microsatellite marker having SEQ ID NO: 1 and SEQ ID NO: 2, the sequence of the upstream primer is SEQ ID NO: 3, and the sequence of the downstream primer is SEQ ID NO: 4, wherein : SEQ ID NO: 3: gaggccgacaggatcgtac;

SEQ ID NO: 4: tacgacgtactccggtggtttt.

The above primers are used for identifying the super-sexual individuals of the semi-smooth tongue, including the genomic DNA extraction of the semi-smooth tongue, the amplification of the microsatellite primers, and the electrophoresis detection of the amplified products, which are characterized in that the amplification product of the semi-smooth scorpion super-skin is electrophoresed as a DNA fragment. The size of the amplified product was 216-220 bp; the amplified product of the female semi-smooth tongue was detected as two DNA fragments, the size of which was 216-220 and 204-208 bp respectively. The amplification product of the male semi-smooth tongue was electrophoresed as a DNA fragment with a size of 204- 208 bp.

The specific microsatellite markers of the W chromosome and the Z chromosome of the semi-smooth tongue were screened, and the microsatellite primers were designed based on the sequence of these gender-specific microsatellite markers, and the microsatellite primers were used to establish the identification method of the semi-smooth scorpion super female. The method of the invention has the advantages of accuracy, rapidity and high efficiency, and the gender-specific microsatellite marker can be used to quickly identify the semi-smooth tongue ZW female fish, the WW super female fish and the ZZ male fish, which solves the difficulty in the sex control and the parthenogenetic breeding of the semi-smooth tongue. To carry out the identification of WW super-female and ZW normal female fish, the mass cultivation and screening of W-super females, and the large-scale production and breeding of whole female seedlings, improve the aquaculture yield and economic benefits, and promote the health of the semi-smooth tongue breeding industry. Sustainable and rapid development, of great significance and industrial application value.

BRIEF DESCRIPTION OF THE DRAWINGS:

Figure 1 : Electrophoresis map of the sex-specific microsatellite markers of the present invention in the female and male amplification products of the semi-smooth tongue.

Among them, the lanes 1-12 in Figure 1 are females with semi-smooth tongues, the lanes 13-24 are males with semi-smooth tongues, A; the female alleles of semi-smooth tongues; B: the alleles present in both male and female individuals.

Figure 2: Microsatellite marker electrophoresis analysis of the semi-smooth tongue of the present invention.

Among them: the parental lane is the female parent of the cleavage gynogenetic larvae; 3, the four individuals in lanes 21, 24 and 35 are WW super-female individuals, and the other lanes are ZZ male individuals.

detailed description

The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

Screening of sex-specific microsatellite markers for semi-smooth tongue

1. Acquisition of sex-specific microsatellite markers for semi-smooth tongues:

The female-specific microsatellite marker sequences in the present invention are derived from our base for semi-smooth tongues. Due to group sequencing projects. The female individuals and male individuals of the semi-smooth tongue were sequenced by S0LEXA sequencing technology, and the female individual genome sequence was compared with the male individual genome sequence, and more than 10 gender-related microsatellite sequences were selected, according to these sex-related microsatellite sequences. Primer design software was used to design more than 10 pairs of primers for the flanking sequences of the repeating units.

2. Verification of gender-specific microsatellite markers: PCR amplification of more than 10 sex-related microsatellite marker sequences using 12-and-a-half-smooth tongue males and 12 female individual genomic DNA samples, using 15 μl system, double distilled water 10.6 μ 1; 10 X Buffer 1.5μ 1; dNTP (2.5mM) 0.8 μ 1; 0.5μ 1 for each of the upstream and downstream primers; Takara enzyme (rTaq 5U/u 1) 0.1 μ 1 added to ensure the activity of the enzyme; The mixture was vortexed and mixed, and then the corresponding DNA template was added 1.5 μl; a total of 15 μl. Amplification procedure: pre-denaturation at 94 ° C for 5 min, followed by denaturation-annealing-extension for 33 cycles according to the following procedure: 94 °C variability 30 S, 58-62 ° C annealing 30 s, 72 ° C extension 30 s. Finally, extend at 72 ° C for 5 min, end the procedure and store at 4 ° C. The amplified products were electrophoresed in a 6% denaturing polyacrylamide gel and stained by silver staining, and then whether the genotypes of these microsatellite markers in male and female individuals were significantly different. The results showed that one of the sex-related microsatellite markers CseF-SSRl was closely linked to the sex of the semi-smooth tongue. Primer SChen-1 (upstream primer 5'-gaggccgacaggatcgtac-3' (SEQ ID NO: 3), downstream primer 5'-tacgacgt actccgg tggtttt-3' (SEQ ID NO: 4) using CseF-SSR1 microsatellite marker Mature semi-smooth tongues 12 female and 12 male genomic DNA, a total of 2 alleles were amplified from the female fish genome, named A and B alleles according to their size. According to the molecular weight standard, the A allele is about 216-220 bp (216, 218, 220 bp), and the Β allele is 204-208 bp (204, 206, 208 bp). From the 12-tail male fish genome, only the 204-208 bp B allele was amplified, but the 216-220 bp A allele was not amplified (Fig. 1). Therefore, the size of 216-220 bp A was determined. The gene is a microsatellite marker specific for the female W chromosome of the semi-smooth tongue, and the B allele of 204-208 bp is a Z-specific male microsatellite marker.

3. Recovery of gender-specific microsatellite markers:

Primers using sex-specific microsatellite markers, the primer names are SChen-Ι (upstream primer 5, -gaggccgacaggatcgtac-3 ^} , downstream bow 1 5, -tacgacgtactccgg tggtttt_3, ) amplifying mature mature semi-smoothed female and male fin genomes DNA, fin genomic DNA extraction was performed according to conventional methods. PCR amplification using a 15μ 1 system, in which double distilled water 10.6μ 1; Buffer (10 X) 1.5 μ 1; dNTP (2.5mM) 0.8u 1; upstream and downstream primers each 0.5μ 1; to ensure the activity of the enzyme finally added Takara enzyme (rTaq 51 Ι / μ 1) 0.1 μ 1; adequately vortex and mix and dispense, then add the corresponding DNA template 1.5 μ 1; a total of 15 μ 1 . Amplification procedure: pre-denaturation at 94 ° C for 5 min, followed by denaturation-annealing-extension for 33 cycles according to the following procedure: denaturation at 94 ° C for 30 s, annealing at 58 ° C for 30 s, and extension at 72 ° C for 30 s. Finally at Extend at 72 ° C for 5 min, end the procedure and store at 4 ° C. The amplified products were separated by polyacrylamide gel electrophoresis. Two alleles of 216-220 and 204-208 bp were amplified from the female fish genome, and 204-208 bp was amplified from the male fish genome. Gene. The polyacrylamide gel containing the 216-220 and 204-208 bp DNA bands was cut out with a blade, and the target fragment was recovered after use.

4. Cloning of gender-specific microsatellite markers:

The recovered sex-specific microsatellite-tagged DNA fragments were cloned into a commercially available pMD 18-T vector by conventional gene cloning methods, ligated and transformed by standard methods, and clones containing the desired fragment were screened by conventional PCR, using agarose The length of the product is detected by gel electrophoresis, and a sample of the expected length can be regarded as a positive clone.

5. Determination of the sex marker sequence of the semi-smooth tongue:

Positive clones containing 216-220 and 204-208 bp sex-specific microsatellite marker DNA fragments were selected and sequenced using an ABI3730 sequencer. The sequences of the 218 bp female W chromosome-specific microsatellite marker (SEQ ID NO: 1) and 206 bp (SEQ ID NO: 2) male Z chromosome-specific microsatellite markers were obtained, respectively. No homologous sequences were found after alignment analysis of the obtained sex-specific microsatellite marker sequences in GenBank.

2. Identification of the semi-smooth scorpion super female fish using the selected markers

1. Semi-smooth tongue preparation of super female fish;

The mature eggs of the semi-smooth tongue were obtained according to the conventional method, and the gynogenesis was induced by the UV-inactivated semi-smooth tongue or the flower scorpion sperm. The sperm inactivation method was as follows: First, 100 fresh or frozen-thawed semen was treated with lmL MPRS (NaCl 60. 35 mM, KC1 5. 23 mM, NaHC0 ₃ 3. OmM, D-Glucose 55. 5 mM, Na3⁄4P0 ₄ 1. 8mM, CaCl ₂ · 6H ₂ 0 1. 13mM, MgCl ₂ · 6H20 1. 13mM) After dilution of the solution Inactivated by ultraviolet irradiation at 60-80 mj/cm ^{2 to} obtain ultraviolet-inactivated sperm. Then, the mice were inseminated with UV-inactivated sperm and semi-smooth scorpion eggs, and then inoculated in 20-23 Ό seawater after insemination. After 20-25 minutes of incubation, the above-mentioned fertilized eggs were transferred to a pressure cylinder of a Bio Press 5506 hydrostatic press produced in Japan. 38-41 MP pressure was subjected to hydrostatic shock treatment for 4-6 min. After hydrostatic treatment, the eggs were transferred to 20-23 °C seawater for incubation and culture; samples were taken before and after hatching of gynogenetic larvae DNA is extracted, or these gynogenetic larvae are cultured to more than 12 cm, and DNA is extracted from the caudal fin for detection of W super female fish.

2. Semi-smooth tongue DNA extraction: Includes: 1) DNA extraction methods for embryos and larvae; 2) DNA extraction methods for semi-smooth carp and adult fish.

1): DNA extraction method for individual embryos and larvae: Take 20-40 semi-smooth tongues, and develop embryos or larvae before and after hatching. Place a single embryo or larvae in a 1.5 ml centrifuge tube and place the bottom of the tube. Place liquid nitrogen 0.5 cm deep for 3-5 seconds, take out and grind and mix the sample, then add 20 μl of protease Κ solution, incubate at 56 ° C for 30-60 minutes, add commercially obtained 200 μl buffer GB (Tiangen Biotech Co LTD, Beijing) and Ιμΐ vector RNA stock solution at a concentration of 1μ ₈ /μ1 (the carrier RNA stock solution was prepared by dissolving 310 μ _{8 of} carrier RNA in 310 μl of Rnase-free double distilled water), and placed at 70 ° C for 10 minutes. After the liquid became clear, briefly centrifuge for 10 seconds; add 200 μl of absolute ethanol, gently mix the sample by inversion, leave it at room temperature for 5 minutes, briefly centrifuge, and transfer the whole solution to the commercially available adsorption column CR2 (Tiangen). Biotech Co LTD, Beijing), centrifuge at 12, OOOrpm for 30 seconds, discard the waste liquid, put the adsorption column CR2 back into the collection tube, and then recover the genomic DNA from the column according to the instructions of the CR2 column, and save the DNA product. At -20 degrees, spare.

2): Semi-slip tongue carp and adult fish DNA extraction method: For the semi-slip carp or adult fish of 12 cm or more, DNA is extracted from the caudal fin tissue of the rice grain. The extraction of the fin DNA is carried out according to the commonly used phenol-chloroform method.

3. Semi-smooth tongue 鳎 Identification of W super female fish

Using the sex-specific microsatellite marker CseF-SSR1 primer SChen-1 (upstream primer 5, -gaggccgacaggatcgtac-3 ', downstream bow 1 5, -tacgacgt actccgg tggtttt-3 ') to amplify the genomic DNA of the cleavage of the gynogenetic semi-smooth tongue, 5 μ 1。 The amplification of the 15 μ 1 system, wherein the double-distilled water was 10. 6 μ 1; Buffer (10 X ) 1. 5 μ 1; dNTP (2.5 mM) 0. 8 μ 1; In order to ensure the activity of the enzyme, the last addition of Takara enzyme (rTaq 5U / ul) Ο. ΐ μ ΐ ; full vortex mixing and packaging, and then add the corresponding DNA template 1. 5 μ 1; a total of 15 μ 1 . Amplification procedure: Pre-denaturation at 94 °C for 5 min, followed by denaturation-annealing-extension. 33 cycles were carried out according to the following procedure: denaturation at 94 °C for 30 S, annealing at 58 °C for 30 s, extension at 72 °C for 30 s. Finally, extend at 72 ° C for 5 min, end the procedure and store at 4 °C. The amplified product was electrophoresed in a 6% denaturing polyacrylamide gel and stained by silver staining, and then the electropherogram was analyzed. If the two individuals with both 216-220 bp and 204-208 bp alleles are genetically female individuals with a ZW type, only individuals with a 204-208 bp allele must be genetically ZZ-type. For male individuals, individuals who only amplified the 216-220 bp allele were genetically super-female individuals with a W-type chromosome (Fig. 2). This method can quickly identify W-super females from a large number of samples to be tested. Moreover, the female females identified by the method and the normal ZZ male fertilization obtained the whole female fry, which confirmed the accuracy of the identification method.

Industrial applicability

The specific microsatellite markers of the chromosomes and Z chromosomes of the semi-smooth tongues and the microsatellite primers designed according to the sequence of these sex-specific microsatellite markers can accurately and quickly identify the semi-smooth tongue ZW female fish, WW super female fish and ZZ male fish, solved the semi-smooth tongue sex control and unisex seed It is difficult to carry out the identification of WW super-female and ZW normal female fish in the cultivation, the mass cultivation and screening of WW super female fish, and the large-scale production and breeding of whole female seed, increase the breeding yield and economic benefit, and promote the culture of semi-smooth tongue. The healthy, sustainable and rapid development of the industry is of great significance and industrial application value.

Claims

1. A semi-smooth tongue-specific sex-specific microsatellite marker, characterized in that the nucleotide sequence of the microsatellite marker is SEQ ID NO: 1 and SEQ ID NO: 2, respectively; wherein SEQ ID NO: 1 is a 218 bp female W chromosome-specific microsatellite marker the sequence of:

Gaggccgacaggatcgtacatcctcccaacttcacaataactccacaattcccacttttttttttctc ttttactttcttaacaattacacaactcggagcccgtatcacaatgtcacaccgagggtctgtttct tctaaggtcaaacacacacacacgggcatgactgaagagtttcagttgaaaaccaccggagtacgtcg ta.

2. The primer for amplifying the microsatellite marker of claim 1 is SChen-l, the upstream primer sequence is SEQ ID NO: 3, and the downstream primer sequence is SEQ ID NO: 4;

SEQ ID NO: 3: upstream bow 1 5, -gaggccgacaggatcgtac-3 ';

SEQ ID NO: 4: Downstream bow 1 '5' -tacgacgtactccggtggtttt-3 '.

3. The primer of claim 2 for use in the identification of a semi-smooth scorpion super-sexual individual, comprising genomic DNA extraction of a semi-smooth tongue, microsatellite primer amplification, and electrophoretic detection of an amplification product, characterized by an amplification product of a semi-smooth scorpion super female individual. Electrophoresis was detected as a DNA fragment with a size of 216-220 bp.

4. The primer of claim 2 is for the identification of male and female individuals of the semi-smooth tongue, including genomic DNA extraction of the semi-smooth tongue, microsatellite primer amplification, and electrophoresis detection of the amplified product, characterized in that the electrophoretic detection of the amplification product of the female semi-smooth tongue is Two DNA fragments were 216-220 bp and 204-208 bp, respectively _. The amplified product of male semi-smooth tongue was electrophoresed as one DNA fragment with a size of 204-208 bp.