WO2012078014A1 - Fragment d'anticorps recombinant monocaténaire neutralisant l'activité cytolytique de la vaginolysine - Google Patents

Fragment d'anticorps recombinant monocaténaire neutralisant l'activité cytolytique de la vaginolysine Download PDF

Info

Publication number
WO2012078014A1
WO2012078014A1 PCT/LT2011/000004 LT2011000004W WO2012078014A1 WO 2012078014 A1 WO2012078014 A1 WO 2012078014A1 LT 2011000004 W LT2011000004 W LT 2011000004W WO 2012078014 A1 WO2012078014 A1 WO 2012078014A1
Authority
WO
WIPO (PCT)
Prior art keywords
scfv
antibody fragment
vly
recombinant
vaginolysin
Prior art date
Application number
PCT/LT2011/000004
Other languages
English (en)
Inventor
Milda Pleckaityte
Edita Mistiniene
Jonas Henrikas Pesliakas
Gintautas Zvirblis
Aurelija Zvirbliene
Original Assignee
Uab Profarma
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Uab Profarma filed Critical Uab Profarma
Priority to EP11718794A priority Critical patent/EP2563810A1/fr
Publication of WO2012078014A1 publication Critical patent/WO2012078014A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/12—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria
    • C07K16/1267—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-positive bacteria
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding

Definitions

  • This invention belongs to the field of protein biotechnology; actually, it describes the generation of recombinant antibody fragment - single-chain fragment variable (scFv) - that neutralizes the biological activity of vaginolysin.
  • scFv single-chain fragment variable
  • Vaginolysin is the main virulence factor of bacteria Gardnerella vaginalis. It belongs to the cholesterol-dependent cytolysins (CDCs), a large family of pore-forming toxins that are produced by more than 20 species from the genera Clostridium, Streptococcus, Listeria, Arcanobacterium, Bacillus and others. These toxins (often called as cytolysins or hemolysins) cause the lysis of cellular membrane and exhibit several other functions including induction of cytokine secretion and modulation of the immune system Thus, most likely these cytolysins play essential roles as virulence factors in the progression of infections by said bacteria [Tweten R. K. Infect. Immun. 2005, 73, pp.6199-6209].
  • BV Bacteria G. vaginalis is known as causing agent of bacterial vaginosis (BV) and the secreted toxin VLY is most likely involved in the progression of said disease [Cauci S, Monte M, Ropele C et al., Mol Microbiol, 1993, 9, pp. 53-58].
  • BV is a common condition, affecting millions of women annually, and is associated with numerous health problems including preterm labour resulting in low birth weight that is the main risk factor for neonatal mortality and morbidity, pelvic inflammatory disease, postpartum endometritis and other infection diseases. It might be supposed that neutralization of VLY using antibodies could be a promising method for a treatment and prevention of pathogenic effect induced by G. vaginalis.
  • Antibodies are widely used as biopharmaceutical preparations due to the progress in gene engineering and humanization technologies. Recombinant DNA technology facilitates the construction and expression of engineered antibodies. These novel molecules are designed to meet specific applications. Antibodies of biopharmaceutical relevance can be produced in different forms - either full-length chimeric or humanized immunoglobulins, or antibody fragments representing the antigen-binding region (scFv). Genes encoding variable (V) fragments of immunoglobulins can be cloned from mouse or human B cells and expressed in bacteria, yeast, plant cells, mammalian cells, phage- display system.
  • V variable fragments of immunoglobulins
  • a range of chimeric antibodies with murine V domains joined to constant (C) regions from human immunoglobulins have been produced and found to exhibit the expected binding characteristics and effector functions.
  • humanized antibodies have been developed, and bifunctional immunoglobulins are being used in tumour therapy and diagnosis.
  • Single chain antibodies and fusion proteins with antibody specificities jointed to nonimmunoglobulin sequences provide a source of antibody-like molecules with novel properties [Sandhu, Crit Rev Biotechnol. 1992; 12; pp. 437-462].
  • vaginolysin from G.vaginalis was produced by using gene engineering approaches [Gelber SE, Aguilar JL, Lewis KLT et al., J Bacteriol, 2008, 190, pp. 3896-3903].
  • Hybridomas producing monoclonal antibodies against VLY have been developed by the authors of the present invention [Zvirbliene A, Pleckaityte M, Lasickiene R, Toxicon, 2010, 56, pp.19-28].
  • Some of the monoclonal antibodies, as those produced by clones 9B4 and 23A2 have been shown to neutralize the cytolytic activity of VLY in vitro [WO 2010/095917].
  • Single chain antibody fragments specific to VLY and neutralizing its cytolytic activity are not found to be described in the prior art.
  • the problem might be solved by producing recombinant scFv against VLY that should recognize native vaginolysin from G.vaginalis and neutralize its capability to induce cell lysis.
  • the single-chain antibody fragments scFv have the advantage comparing with the full-lengh monoclonal antibodies, since manufacture thereof by bacterial biosynthesis is comparatively easy and cost effective. Lesser molecular weight of scFv is the basis for potentially stronger therapeutic action due to more effective scFv penetration into an infected tissue compared to full-lengh monoclonal antibody.
  • Such recombinant scFv might be useful for developing biopharmaceuticals with a potential therapeutic application to treat the pathogenic effect induced by G.vaginalis.
  • the aim of the present invention was generation of new single-chain recombinant antibody fragment (scFv) neutralizing the cytolytic activity of VLY.
  • the present invention provides recombinant scFv derived by the use of genetic material isolated from hybridoma cell line 9B4 (DSM ACC2991) producing neutralizing monoclonal antibody against VLY [WO 2010/095917].
  • the scFv recognizes VLY and neutralizes its biological activity in vitro, i.e., inhibits its capability to induce the lysis of human erythrocytes.
  • the present invention provides scFv that recognizes amino acid sequence (SEQ ID: NO.1)
  • This antibody fragment has amino acid sequence (SEQ ID: NO.2):
  • Antibody fragment according to present invention is designed for use in inhibition or neutralisation of biolpogical activity of vaginolisin.
  • Another preferred embodiment provides the preparation, comprising recombinant single- chain antibody fragmentof the present invention for use in inhibition and neutralization of biological activity of vaginolisin.
  • This preparation is designated for use in inhibition of infections, such as bacterial vaginosis, induced by Gardnerella vaginalis bacteria.
  • the field of application of the present invention is manufacture of preparations for the treatment of infection, such as bacterial vaginosis induced by G. vaginalis.
  • Such preparations are suitable for developing biopharmaceutical recombinant antibodies with a potential therapeutic use.
  • Yet another preferred embodiment provides a pharmaceutical composition, comprising an effective amount of preparation of the present invention in combination with pharmaceutically acceptable carrier, diluent, excipient and/or auxiliary substances for the prophylaxis and/or treatment of conditions induced by G. vaginalis infection.
  • Preferred embodiment of the present invention covers a group of conditions (pathologies), comprising preterm labour resulting in low birth weight, pelvic inflammatory disease, postpartum endometritis and other diseases induced by G.vaginalis infection.
  • Fig.1 illustrates schematic view of the construct VL-(G 4 S) -VH encoding the antibody fragment specific to VLY cytolysin.
  • the linker is (G 4 S) 4 .
  • Fig. 2 shows electrophoresis picture of the recombinant antibody fragment (scFv) in the lysate of transformed E.coli cells. It could be seen from SDS-PAGE, that scFv protein was found in the insoluble fraction of transformed E.coli cells.
  • Fig. 3 shows electrophoresis in polyacrylamide picture of purified recombinant antibody fragment (scFv).
  • M - prestained molecular weight markers (from the bottom upwards 15, 20, 25, 30, 40, 50 kDa).
  • Fig.4 illustrates the reactivity of the recombinant antibody fragment scFv with VLY cytolysin by ELISA.
  • the reactivity of recombinant purified antibody fragment scFv with VLY cytolysin by ELISA filled squares; as a positive control the reactivity of full-length monoclonal antibody 9B4 with VLY cytolysin is shown (filled triangles).
  • Fig.5 illustrates the neutralizing activity of the recombinant antibody fragment scFv by an in vitro hemolytic assay in the presence of cytolysin VLY.
  • the scFv neutralising activity was evaluated by human erythrocytes hemolytic treatment.
  • As a positive control full-length monoclonal antibody 9B4 is used.
  • RNA from hybridoma 9B4 - total RNA was purified from hybridoma 9B4 (DSM ACC2991 ) cells using single-step technique as described previously [Chomczynski and Sacchi, Anal Biochem, 1987, 162, pp. 156-159].
  • Cell homogenate was obtained using guanidinium thiocyanate as the denaturant, and RNA was extracted with phenol- chloroform mixture at reduced pH. The RNA was precipitated with isopropanol.
  • TTAATAGACAGATGGGGGTGTCGTTTTGGC and mouse heavy chain FR1 region high degeneracy primer 5'-CATATGSARGTNMAGCTGSAGSAGTC (R - designates A/G; S - C/G; N - A, C, G, T).
  • Mouse kappa chain Ig constant region primer 5'- TTAGGATACAGTTGGTGCAGCATC and mouse kappa chain Ig constant FR1 region universal degenerate primer: 5'-CATATGGAYATTGTGMTSACMCARWCTMCA (R - designates A/G; S - C/G; W - A/T; M - A/C; Y - C T).
  • the PCR products were cloned into vector plasmid and sequenced. The sequences were analysed by means of BLASTN searches of GenBank databases. The germlines were defined in the IgBLAST database.
  • scFv-VLY was constructed introducing the linker sequence (G S) 4 between VL (variable region of mouse Ig light (L) chain) and VH (variable region of mouse Ig heavy (H) chain) .
  • the construct scFV-VLY comprises 6-His tag at the N-end of protein.
  • the final plasmid was transformed into the E.coli BL21(DE3) strain. Recombinant scFv-VLY synthesis was induced with 0.5 mM of IPTG.
  • This amino acid sequence corresponds to amino acid sequence of VLY cytolysin from Gardnerella vaginalis that was determined and published previously (GenBank Nr. EU697812, EU 697811). Different strains of Gardnerella vaginalis may express slightly different variants of VLY that may differ from the SEQ ID: No.1 by one or few aa residues.
  • Hybridoma 9B4 (DSM ACC2991 ) cells (3x10 6 cells) were washed with sterile ice-cold PBS and lysed in solution D containing denaturant guanidinium thiocyanate.
  • the RNA was extracted from the homogenate with phenol-chloroform at pH 5. After addition of each reagent, the content was mixed thoroughly by inversion. The mixture was incubated for 15 min on ice. The tube was centrifuged and the upper aqueous phase containing RNA was collected. An equal volume of isopropanol was added to the extracted RNA. The solution was mixed well and the RNA was allowed to precipitate for 1 hour at -20°C. The precipitated RNA was collected by centrifugation, washed with 75 % ethanol, diluted in DEPC-treated water and stored at -70°C.
  • RNA extracted from the hybridoma 9B4 cells was used to synthesize first strand cDNA. Trace amounts of genomic DNA from RNA preparation were removed by DNasel (RNase free) treatment. DNA-free total RNA (0.5 ⁇ g) was mixed with oligo (dT) 18 primer and incubated with an RNA-dependent DNA polymerase reverse transcriptase. The reaction was terminated by heating at 70°C for 5 min.
  • the cDNA corresponding to the variable region of 9B4 hybridoma was obtained using sets of specific primers: 1) Mouse heavy chain constant region primer: 5'- TTAATAGACAGATGGGGGTGTCGTTTTGGC and mouse heavy chain FR1 region high degeneracy primer 5'-CATATGSARGTNMAGCTGSAGSAGTC (R - designates A/G; S - C/G; N - A, C, G, T); 2) Mouse kappa chain constant region primer: 5'- TTAGGATACAGTTGGTGCAGCATC and mouse kappa chain FR1 region universal degenerated primer: 5'-CATATGGAYATTGTGMTSACMCARWCTMCA (R - designates A/G; S - C/G; W - A/T; M - A/C; Y - C/T).
  • Each PCR reaction mixture contained: the first strand cDNA, 5' and 3' primers, respectively, dNTPs, Taq polymerase.
  • the obtained PCR products were cloned into pJET1.2 TA cloning vector (Femnentas, Vilnius, Lithuania) after DNA fragments purification from agarose gel.
  • the ligated constructs were transformed into competent E.coli DH10B cells and the transfected bacteria were plated into plates with LB medium containing 100 pg/ml ampicillin. The colonies from transformed plates were screened for inserts by appropriate restriction enzyme digestion of DNA minipreps.
  • the plasmids containing inserts were subjected for sequencing. For each IgG chain, 5 clones were sequenced and found to be identical.
  • primers designed to introduce linker sequence (G 4 S) 4 and restriction sites were used.
  • the VL and VH fragments were fused into the resulted construction VL-(G4S)4-VH (Fig.
  • the transformant cells harboring expression plasmid were grown in 500 ml of LB broth medium supplemented with kanamycin. When the culture reached an OD 600 value of 0.8-1.0, IPTG (isopropyl ⁇ -D- thiogalactoside) was added to the final concentration of 0.5 mM to induce the target gene expression at 37°C.
  • the cells were harvested by centrifugation. A portion of cells suspended in Tris-EDTA (TE) buffer was treated by sonication. The sonicated material was centrifuged and both supernatant (soluble fraction of the cells) and pellet (insoluble fraction of the cells) were subjected to 12 % sodium dodecylsulfate polyacrylamdide gel electrophoresis (SDS-PAGE) with subsequent Coomassie Brilliant Blue staining.
  • the target protein scFv of 27.5 kDa was found in insoluble fraction of E.coli cells (Fig. 2). The target protein harbors approx. 35 % of the total bacteria proteins and approx. 80 % of the sonicated pellets (insoluble fraction).
  • Oxidative renaturation of scFv was performed as follows. After the last washing cycle, the pellet containing scFv was solubilized in 10 mM Tris-HCI (pH 7.0) buffer, containing 7M guanidine hydrochloride (GuHCI). The suspension was stirred overnight at 4°C, centrifuged for 25 min at 40,000 x g and the supernatant was diluted with 10 mM Tris-HCI buffer (pH 7.0) containing 6 M GuHCI to the final protein concentration 1 mg/ml. The renaturation of scFv was performed by adding CuS0 4 solution to the final concentration 20 ⁇ and incubation for 1 hour at room temperature.
  • the reaction was stopped by adding EDTA solution to the final concentration 10mM.
  • Protein solution was centrifuged for 25 min. at 40,000 x g and the supernatant was loaded onto the Sephadex G-25 column equilibrated with 25 mM Tris buffer (pH 8.0) containing 0.25M Na 2 S0 4 .
  • Fractions with the target protein were collected, pooled and loaded on the Ni (II) NTA column (loading buffer: 25 mM Tris, pH 8.0). The desorption was performed with the same buffer containing 1 M imidazole.
  • the stable protein preparation might be obtained by transferring the purified antibody fragment scFv into formulation, suitable for long storage, which formulation comprise a selected buffer system; salts, necessary to maintain the protein stability and isotonicity; detergents; antioxidants and other auxiliary substances.
  • the specificity of the recombinant scFv derived from hybridoma 9B4 was investigated using an enzyme-linked immunoassay (ELISA).
  • ELISA enzyme-linked immunoassay
  • the recombinant purified scFv was serially diluted and added to the 96-well plate coated with recombinant purified VLY. After incubation for 1 h at room temperature, VLY-bound scFv was detected by incubation with mouse monoclonal antibody against His-5 and subsequent incubation with horse-radish peroxidase (HRP) labelled secondary antibody (anti-mouse IgG conjugate).
  • HRP horse-radish peroxidase
  • the enzymatic reaction was developed using ready-to-use TMB substrate. The optical density was measured at 405 nm.
  • Fig. 4 illustrates the titration curves of recombinant scFv and full- length antibody 9B4 in microtiter plates coated with recombinant VLY.
  • PBS Phosphate-buffered saline
  • pH 7,4 0% hemolysis
  • composition comprising scFv protein of present invention
  • scFv protein of present invention might further comprise one or more of following components:
  • a carrier such as polyhydroxy alcohols (e.g. mannitol, sorbitol), different monosaccharides (e.g. glucose), disaccharides (e.g. sucrose);
  • polyhydroxy alcohols e.g. mannitol, sorbitol
  • monosaccharides e.g. glucose
  • disaccharides e.g. sucrose
  • a buffer system to maintain necessary pH value such as acetate, phosphate, TRIS, HEPES
  • salts for maintaining isotonicity of the composition such as sodium chloride
  • liquid-air interface region e.g. polysorbate 80, polysorbate 20, various compounds of Pluronic type
  • - stabiliser such as polyethylenglycol, polyvynylpirrolidone, amino acids (e.g. L-methionine, L-arginine, L-histidine, L-glutathione acid, L- asparagine acid);
  • - chelating agent such as EDTA, EGTA, IDA
  • - antibacterial agent e.g. benzene derivatives, such as cresol, benzyl alcohol
  • SH agent such as glutathione, cisteine, acetylcisteine
  • VLY is the main virulence factor of G.vaginalis, its neutralization could be an efficient way to treat infection-induced pathology.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

Le fragment d'anticorps recombinant monocaténaire (scFv) ci-décrit a été obtenu à partir de cellules d'hybridomes 9B4 (DSM ACC2991) par des techniques de modification génétique. La protéine a été purifiée et sa spécificité envers la vaginolysine de G. vaginalis a été démontrée. Les exemples selon l'invention démontrent qu'il est possible d'utiliser le scFv pour traiter ou prévenir les pathologies induites par l'infection à G. vaginalis.
PCT/LT2011/000004 2010-12-07 2011-03-28 Fragment d'anticorps recombinant monocaténaire neutralisant l'activité cytolytique de la vaginolysine WO2012078014A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP11718794A EP2563810A1 (fr) 2010-12-07 2011-03-28 Fragment d'anticorps recombinant monocaténaire neutralisant l'activité cytolytique de la vaginolysine

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
LT2010104A LT5855B (lt) 2010-12-07 2010-12-07 Rekombinantinis viengrandžio antikūno fragmentas, neutralizuojantis vaginolizino citolitinį aktyvumą
LTLT2010104 2010-12-07

Publications (1)

Publication Number Publication Date
WO2012078014A1 true WO2012078014A1 (fr) 2012-06-14

Family

ID=44227537

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/LT2011/000004 WO2012078014A1 (fr) 2010-12-07 2011-03-28 Fragment d'anticorps recombinant monocaténaire neutralisant l'activité cytolytique de la vaginolysine

Country Status (3)

Country Link
EP (1) EP2563810A1 (fr)
LT (1) LT5855B (fr)
WO (1) WO2012078014A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104173985A (zh) * 2014-09-02 2014-12-03 郭书堂 一种治疗妇女产后受凉的药及其制备方法
WO2015003114A1 (fr) * 2013-07-05 2015-01-08 University Of Washington Through Its Center For Commercialization Anticorps monoclonal neutralisant la protéine mic soluble pour le traitement du cancer

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009117373A2 (fr) * 2008-03-15 2009-09-24 Columbia University Traitement et prévention des infections à gardnerella vaginalis
WO2010095917A1 (fr) 2009-02-23 2010-08-26 Biotechnologijos Institutas Anticorps monoclonaux contre la vagonilysine

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009117373A2 (fr) * 2008-03-15 2009-09-24 Columbia University Traitement et prévention des infections à gardnerella vaginalis
WO2010095917A1 (fr) 2009-02-23 2010-08-26 Biotechnologijos Institutas Anticorps monoclonaux contre la vagonilysine

Non-Patent Citations (18)

* Cited by examiner, † Cited by third party
Title
BREKKE, SANDLIE, NAT.REV. DRUG DISCOV., vol. 2, 2002, pages 52 - 62
CAUCI S, MONTE M, ROPELE C ET AL., MOL MICROBIOL, vol. 9, 1993, pages 53 - 58
CAUCI S, MONTE R, ROPELE M ET AL., MOL MICROBIOL, vol. 9, 1993, pages 1143 - 1155
CHOMCZYNSKI, SACCHI, ANAL BIOCHEM, vol. 162, 1987, pages 156 - 159
GARSIA-SUAREZ ET AL., INFECT. IMMUN., vol. 72, 2004, pages 4534 - 4540
GELBER SE, AGUILAR JL, LEWIS KLT ET AL., J BACTERIOL, vol. 190, 2008, pages 3896 - 3903
GELBER SHARI E ET AL: "Functional and phylogenetic characterization of vaginolysin, the human-specific cytolysin from Gardnerella vaginafis", JOURNAL OF BACTERIOLOGY, AMERICAN SOCIETY FOR MICROBIOLOGY, WASHINGTON, DC; US, vol. 190, no. 11, 1 June 2008 (2008-06-01), pages 3896 - 3903, XP009125383, ISSN: 0021-9193, [retrieved on 20080404], DOI: DOI:10.1128/JB.01965-07 *
JACOBS ET AL., FEBS LETT., vol. 459, 1999, pages 463 - 466
LANG, J. LMMUNOL., vol. 151, 1993, pages 466 - 472
MAYNARD ET AL., NATURE BIOTECHNOL., vol. 30, 2002, pages 597 - 601
MOUSLI, FEBS LETT., vol. 442, 1999, pages 183 - 188
MUKHERJEE ET AL., INFECT. IMMUN., vol. 70, 2002, pages 5896 - 5899
RANDIS TARA M ET AL: "Antibody-Based Detection and Inhibition of Vaginolysin, the Gardnerella vaginalis Cytolysin", PLOS ONE, PUBLIC LIBRARY OF SCIENCE, SAN FRANCISCO, CA, US, vol. 4, no. 4, 16 April 2009 (2009-04-16), pages E5207, XP009128317, ISSN: 1932-6203, DOI: DOI:10.1371/JOURNAL.PONE.0005207 *
SANDHU, CRIT REV BIOTECHNOL., vol. 12, 1992, pages 437 - 462
See also references of EP2563810A1 *
TWETEN R. K., INFECT. IMMUN., vol. 73, 2005, pages 6199 - 6209
ZVIRBLIENE A, PLECKAITYTE M, LASICKIENE R, TOXICON, vol. 56, 2010, pages 19 - 28
ZVIRBLIENE AURELIJA ET AL: "Production and characterization of monoclonal antibodies against vaginolysin: Mapping of a region critical for its cytolytic activity", TOXICON, vol. 56, no. 1, August 2010 (2010-08-01), pages 19 - 28, XP002648819, ISSN: 0041-0101 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015003114A1 (fr) * 2013-07-05 2015-01-08 University Of Washington Through Its Center For Commercialization Anticorps monoclonal neutralisant la protéine mic soluble pour le traitement du cancer
US9803017B2 (en) 2013-07-05 2017-10-31 University Of Washington Through Its Center For Commercialization Soluble MIC neutralizing monoclonal antibody for treating cancer
CN104173985A (zh) * 2014-09-02 2014-12-03 郭书堂 一种治疗妇女产后受凉的药及其制备方法

Also Published As

Publication number Publication date
LT5855B (lt) 2012-08-27
EP2563810A1 (fr) 2013-03-06
LT2010104A (en) 2012-06-25

Similar Documents

Publication Publication Date Title
Peek et al. Characterization of a periplasmic thiol: disulfide interchange protein required for the functional maturation of secreted virulence factors of Vibrio cholerae.
US7151159B2 (en) Amino acid sequences for therapeutic and prophylactic use against diseases due to clostridium difficile toxins
US20040220388A1 (en) Novel heterodimeric fusion proteins
TW201815825A (zh) 經修飾之抗原結合fab片段及包含其之抗原結合分子
EP4089111A1 (fr) Nouveau complexe polypeptidique
CN112409483B (zh) 抗pd-l1纳米抗体
WO2006085518A1 (fr) Procede permettant d’ameliorer un anticorps
EP3880703A1 (fr) Anticorps à domaine unique se liant à l'albumine sérique humaine
AU2016215087A1 (en) Tetra-specific, octameric binding agents and antibodies against Clostridium difficile toxin A and toxin B for treatment of C. difficile infection
Koçer et al. Effects of variable domain orientation on anti‐HER2 single‐chain variable fragment antibody expressed in the Escherichia coli cytoplasm
WO2012164372A1 (fr) Anticorps anti-parvovirus canin recombinant et utilisations de celui-ci
Wang et al. Construction of scFv that bind both fibronectin-binding protein A and clumping factor A of Stapylococcus aureus
EP2563810A1 (fr) Fragment d'anticorps recombinant monocaténaire neutralisant l'activité cytolytique de la vaginolysine
Moricoli et al. Blocking monocyte transmigration in in vitro system by a human antibody scFv anti-CD99. Efficient large scale purification from periplasmic inclusion bodies in E. coli expression system
Denizci Öncü et al. Structure‐based engineering of an antiangiogenic scFv antibody for soluble production in E. coli without loss of activity
Petrovskaya et al. Construction of TNF-binding proteins by grafting hypervariable regions of F10 antibody on human fibronectin domain scaffold
Farshdari et al. Enhanced Solubility of Anti-HER2 scFv Using Bacterial Pelb Leader Sequence: Influence of leader sequence on anti-HRR2 scFv expression
Pearce et al. Linear gene fusions of antibody fragments with streptavidin can be linked to biotin labelled secondary molecules to form bispecific reagents
EP2398823A1 (fr) Anticorps monoclonaux contre la vagonilysine
Farajzadeh et al. Design and construction of a novel humanized single-chain variable-fragment antibody against the tumor necrosis factor alpha
Karam et al. Production of an antibody fragment (scFv) targeting PcrV protein of pseudomonas aeruginosa in Fed-Batch cultivation mode
WO2020053627A1 (fr) Anticorps à domaine unique ciblés ayant une activité catalytique (t-can)
Zhu et al. Expression of a humanized single-chain variable fragment antibody targeting chronic myeloid leukemia cells in Escherichia coli and its characterization
Robert et al. Improvement in production and purification bioprocesses of bacterially expressed anti-alphaIIbbeta3 human single-chain FV antibodies
WO2013158217A1 (fr) Anticorps modifié destiné à l'inhibition de fibrose

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11718794

Country of ref document: EP

Kind code of ref document: A1

REEP Request for entry into the european phase

Ref document number: 2011718794

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2011718794

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE