WO2012073041A2 - Compounds - Google Patents
Compounds Download PDFInfo
- Publication number
- WO2012073041A2 WO2012073041A2 PCT/GB2011/052386 GB2011052386W WO2012073041A2 WO 2012073041 A2 WO2012073041 A2 WO 2012073041A2 GB 2011052386 W GB2011052386 W GB 2011052386W WO 2012073041 A2 WO2012073041 A2 WO 2012073041A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- formula
- cancer
- compound
- group
- alkyl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
- 0 CC*C(*)C(C(C(C**)=C1C(*)CC(C)*)=O)=C(C(*)C*)C1=O Chemical compound CC*C(*)C(C(C(C**)=C1C(*)CC(C)*)=O)=C(C(*)C*)C1=O 0.000 description 2
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D235/00—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, condensed with other rings
- C07D235/02—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, condensed with other rings condensed with carbocyclic rings or ring systems
- C07D235/04—Benzimidazoles; Hydrogenated benzimidazoles
- C07D235/24—Benzimidazoles; Hydrogenated benzimidazoles with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached in position 2
- C07D235/28—Sulfur atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C235/00—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms
- C07C235/02—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to acyclic carbon atoms and singly-bound oxygen atoms bound to the same carbon skeleton
- C07C235/04—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to acyclic carbon atoms and singly-bound oxygen atoms bound to the same carbon skeleton the carbon skeleton being acyclic and saturated
- C07C235/16—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to acyclic carbon atoms and singly-bound oxygen atoms bound to the same carbon skeleton the carbon skeleton being acyclic and saturated having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a six-membered aromatic ring
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C69/00—Esters of carboxylic acids; Esters of carbonic or haloformic acids
- C07C69/74—Esters of carboxylic acids having an esterified carboxyl group bound to a carbon atom of a ring other than a six-membered aromatic ring
- C07C69/753—Esters of carboxylic acids having an esterified carboxyl group bound to a carbon atom of a ring other than a six-membered aromatic ring of polycyclic acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C69/00—Esters of carboxylic acids; Esters of carbonic or haloformic acids
- C07C69/76—Esters of carboxylic acids having a carboxyl group bound to a carbon atom of a six-membered aromatic ring
- C07C69/94—Esters of carboxylic acids having a carboxyl group bound to a carbon atom of a six-membered aromatic ring of polycyclic hydroxy carboxylic acids, the hydroxy groups and the carboxyl groups of which are bound to carbon atoms of six-membered aromatic rings
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
- C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
- C07D209/04—Indoles; Hydrogenated indoles
- C07D209/30—Indoles; Hydrogenated indoles with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, directly attached to carbon atoms of the hetero ring
- C07D209/42—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D249/00—Heterocyclic compounds containing five-membered rings having three nitrogen atoms as the only ring hetero atoms
- C07D249/02—Heterocyclic compounds containing five-membered rings having three nitrogen atoms as the only ring hetero atoms not condensed with other rings
- C07D249/08—1,2,4-Triazoles; Hydrogenated 1,2,4-triazoles
- C07D249/10—1,2,4-Triazoles; Hydrogenated 1,2,4-triazoles with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D263/00—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings
- C07D263/02—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings
- C07D263/30—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
- C07D263/34—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
- C07D263/46—Sulfur atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D263/00—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings
- C07D263/52—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings condensed with carbocyclic rings or ring systems
- C07D263/54—Benzoxazoles; Hydrogenated benzoxazoles
- C07D263/56—Benzoxazoles; Hydrogenated benzoxazoles with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached in position 2
- C07D263/57—Aryl or substituted aryl radicals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D263/00—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings
- C07D263/52—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings condensed with carbocyclic rings or ring systems
- C07D263/62—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings condensed with carbocyclic rings or ring systems having two or more ring systems containing condensed 1,3-oxazole rings
- C07D263/64—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings condensed with carbocyclic rings or ring systems having two or more ring systems containing condensed 1,3-oxazole rings linked in positions 2 and 2' by chains containing six-membered aromatic rings or ring systems containing such rings
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D277/00—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
- C07D277/60—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings condensed with carbocyclic rings or ring systems
- C07D277/62—Benzothiazoles
- C07D277/68—Benzothiazoles with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached in position 2
- C07D277/70—Sulfur atoms
- C07D277/74—Sulfur atoms substituted by carbon atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D277/00—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
- C07D277/60—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings condensed with carbocyclic rings or ring systems
- C07D277/62—Benzothiazoles
- C07D277/68—Benzothiazoles with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached in position 2
- C07D277/82—Nitrogen atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D333/00—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom
- C07D333/50—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom condensed with carbocyclic rings or ring systems
- C07D333/52—Benzo[b]thiophenes; Hydrogenated benzo[b]thiophenes
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D333/00—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom
- C07D333/50—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom condensed with carbocyclic rings or ring systems
- C07D333/52—Benzo[b]thiophenes; Hydrogenated benzo[b]thiophenes
- C07D333/62—Benzo[b]thiophenes; Hydrogenated benzo[b]thiophenes with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to carbon atoms of the hetero ring
- C07D333/68—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen
- C07D333/70—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen attached in position 2
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D403/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
- C07D403/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings
- C07D403/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings linked by a chain containing hetero atoms as chain links
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D405/00—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
- C07D405/02—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings
- C07D405/12—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings linked by a chain containing hetero atoms as chain links
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D409/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
- C07D409/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings
- C07D409/12—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings linked by a chain containing hetero atoms as chain links
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
- C07D413/14—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing three or more hetero rings
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D417/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
- C07D417/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings
- C07D417/06—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D417/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
- C07D417/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings
- C07D417/12—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings linked by a chain containing hetero atoms as chain links
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
- C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
- C07D471/04—Ortho-condensed systems
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D491/00—Heterocyclic compounds containing in the condensed ring system both one or more rings having oxygen atoms as the only ring hetero atoms and one or more rings having nitrogen atoms as the only ring hetero atoms, not provided for by groups C07D451/00 - C07D459/00, C07D463/00, C07D477/00 or C07D489/00
- C07D491/02—Heterocyclic compounds containing in the condensed ring system both one or more rings having oxygen atoms as the only ring hetero atoms and one or more rings having nitrogen atoms as the only ring hetero atoms, not provided for by groups C07D451/00 - C07D459/00, C07D463/00, C07D477/00 or C07D489/00 in which the condensed system contains two hetero rings
- C07D491/04—Ortho-condensed systems
- C07D491/056—Ortho-condensed systems with two or more oxygen atoms as ring hetero atoms in the oxygen-containing ring
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D495/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms
- C07D495/02—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms in which the condensed system contains two hetero rings
- C07D495/04—Ortho-condensed systems
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C2601/00—Systems containing only non-condensed rings
- C07C2601/02—Systems containing only non-condensed rings with a three-membered ring
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C2603/00—Systems containing at least three condensed rings
- C07C2603/02—Ortho- or ortho- and peri-condensed systems
- C07C2603/04—Ortho- or ortho- and peri-condensed systems containing three rings
- C07C2603/22—Ortho- or ortho- and peri-condensed systems containing three rings containing only six-membered rings
- C07C2603/24—Anthracenes; Hydrogenated anthracenes
Definitions
- the field of the invention is generally related to new compounds, the new compounds for use in a method for treatment of the human or animal body by therapy, and, in particular, their use in a method of treating cancer.
- a method of treating cancer involving the inhibition of the cancer cell DNA base excision repair (BER) pathway through the inhibition of apurinic/apyrimidinic endonuclease (APE1 ) activity.
- Inhibition of APE1 activity results in an accumulation of unrepaired apurinic/apyrimidinic (AP) sites in the cancer cell.
- AP sites are cytotoxic and can induce a
- BER is required for the accurate removal of bases that have been damaged by alkylation, oxidation or ring-saturation. This pathway also handles a variety of other lesions including deaminated bases and DNA single strand breaks. BER is performed by at least two major sub-pathways. These sub-pathways differ from each other in the length of the repair patch and in the subsets of enzymes involved. However, both pathways are initiated by a damage specific DNA glycosylase, which removes the damaged base creating an abasic (AP) site. AP sites are obligatory intermediates in the BER pathway.
- AP sites are cytotoxic and represent a major threat to the integrity and survival of a cell. Inactivation of APE1 leads to an accumulation of AP sites, retards cell proliferation and activates apoptosis.
- APE1 is a critical enzyme in the recognition and processing of AP sites in the BER pathway. APE1 accounts for over 95% of the total AP endonuclease activity in human cell lines. AP sites can arise spontaneously at a rate of about 10,000 AP sites per day in each human cell. In addition the activity of DNA glycosylases that process damaged DNA bases generate AP sites that would certainly add to this burden. Indeed, the steady state level of AP lesions is estimated in some studies to be much higher approaching 50,000 or more per cell depending on age and tissue source. Inactivating APE1 and hence the BER pathway inhibits the ability of the cell to repair itself and thus maximises the cytotoxicity of chemotherapeutic agents which induce genomic DNA damage.
- Chemotherapy and radiation are the two main treatments currently available to improve outcomes in patients with advanced cancer.
- the cytotoxicity of many of these agents is directly related to their propensity to induce genomic DNA damage.
- the ability of cancer cells to recognise this damage and initiate DNA repair is an important mechanism for therapeutic resistance that negatively impacts upon therapeutic efficacy.
- Pharmacological inhibition of the BER pathway of DNA repair therefore, has the potential to maximise the cytotoxicity of a diverse range of anticancer agents.
- Ar1 , Ar2 and Ar3 are as defined below.
- a method of treating cancer in a patient comprising the step of administering a therapeutically effective amount of a compound of any one of Formulae 1 , 2, 3, 4, 5 and 6 or a pharmaceutically acceptable salt thereof.
- Ar, Ar1 , Ar2, Ar3 are each independently aryl or heteroaryl groups which may be substituted or unsubstituted with one or more R9 group.
- X1 and X2 are each independently alkyl or heteroalkyi groups, typically lower alkyl or heteroalkyi groups comprising a carbon backbone of 1 to 10 carbon atoms optionally including one or more heteroatoms, suitably 1 to 6, more suitably 2 to 4 carbon atoms optionally including one or more heteroatoms.
- the alkyl or heteroalkyi groups may be mono- or poly- substituted typically with one or more R10 group.
- R, R1 , R2, R3, R4, R5, R6, R7, R8, R9 and R10 are each independently H, alkyl, heteroalkyi, aryl, heteroaryl and combinations of two or more thereof or R1 1 , R1 1 being selected from O-, N-, NH-, CO, COO, CON, CONH, SO2, SO2N and SO2NH group linking one or more alkyl, heteroalkyi, aryl or heteroaryl group.
- R1 to R1 1 may be linked to form a cyclic group, such as a cycloalkyl, cycloheteroalkyi, polycyclic, cyclic ketone, cyclic ketone, cyclic alcohol, cyclic ester and cyclic ether group.
- Suitable heteroatoms include S, O, N and Se.
- a method of treating cancer in a patient comprising the step of administering a therapeutically effective amount of a compound of any one of Formulae 7 to 18 or a pharmaceutically acceptable salt thereof.
- Formulae 7 to 18 may include one or more substituent, defined as R above. Where heteroatoms are specified in Formulae 7 to 18, these may be the heteroatoms specified, or may be substituted for another heteroatom. Suitable heteroatoms include S, O, N and Se.
- R1 and R2 generally represent alkyl groups, in particular 1 to 5 atom alkyl groups.
- R1 may represent a methyl group and R2 may represent an ethyl group.
- R1 and R2 generally represent alkyl groups, in particular 1 to 5 atom alkyl groups. In particular R1 and R2 may represent methyl groups.
- R1 generally represents an alkyl group, in particular a 1 to 5 atom alkyl group.
- R1 may represent a methyl group.
- R2 generally represents a halo group, in particular CI .
- R1 is generally an ether group, in particular MeO.
- R1 generally represents a halo group, in particular F.
- a further aspect of the present invention relates to a compound of any one of Formulae 1 to 18, or a pharmaceutically acceptable salt thereof, for use in a method for treatment of the human or animal body by therapy.
- a further aspect of the present invention relates to a compound of any one of Formulae 1 to 18, or a pharmaceutically acceptable salt thereof, for use in the treatment of cancer.
- a further aspect of the present invention relates to a pharmaceutical composition
- a pharmaceutical composition comprising a compound of any one of Formulae 1 to 18 or a pharmaceutically acceptable salt thereof and one or more diluents, carriers or excipients.
- a further aspect of the present invention relates to a pharmaceutical composition
- a pharmaceutical composition comprising a compound of any one of Formulae 1 to 18 or a pharmaceutically acceptable salt thereof and one or more diluents, carriers or excipients for use in a method for treatment of the human or animal body by therapy.
- a further aspect of the present invention relates to a pharmaceutical composition
- a pharmaceutical composition comprising a compound of any one of Formulae 1 to 18 or a pharmaceutically acceptable salt thereof and one or more diluents, carriers or excipients for use in a method for use in the treatment of cancer.
- a further aspect of the present invention relates to a process for the preparation of a compound of Formulae 1 to 18 as hereinbefore defined.
- the present invention also provides a method for increasing, preferably maximising, the cytotoxicity of a chemotherapeutic agent comprising the steps of administering the chemotherapeutic agent and a compound of any one of Formulae 1 to 18
- a further aspect of the present invention relates to a compound of any one of Formulae 1 to 18, or a pharmaceutically acceptable salt thereof, in
- a chemotherapeutic agent for use in a method for treatment of the human or animal body by therapy; preferably, for use in the treatment of cancer; and, more preferably, for use in increasing the cytotoxicity of the chemotherapeutic agent.
- alkyl includes both straight chain and branched alkyl groups.
- the alkyl group may be substituted (mono- or poly-) or unsubstituted.
- Suitable substituents include, for example, halo, CF3, OH, CN, NO2, SO3H, SO2NH2, SO2Me, NH2, COOH, CONH2, alkyl and alkoxy.
- the alkyl group is a C1 -20 alkyl group, generally a C1 -15 alkyl group.
- the alkyl group may be a C1 -12 alkyl group, suitably a C1 -6 alkyl group, advantageously a C1 -3 alkyl group.
- Particularly preferred alkyl groups include, for example, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, pentyl and hexyl.
- heteroalkyi includes an alkyl group as defined above which comprises one or more heteroatoms.
- cycloalkyl refers to a cyclic alkyl group which may be substituted (mono- or poly-) or unsubstituted. Suitable substituents include, for example, halo, CF3, OH, CN, NO2, SO3H, SO2NH2, SO2Me, NH2, COOH, CONH2 and alkoxy.
- cycloheteroalkyl refers to a cyclic heteroalkyi group which may be substituted (mono- or poly-) or unsubstituted. Suitable substituents include, for example, halo, CF3, OH, CN, NO2, SO3H, SO2NH2, SO2Me, NH2, COOH, CONH2 and alkoxy. Preferred cycloheteroalkyl groups include morpholino, piperazinyl and piperidinyl groups.
- aryl refers to an aromatic, substituted (mono- or poly-) or unsubstituted group, and includes, for example, phenyl, naphthyl etc.
- suitable substituents include, for example, halo, CF3, OH, CN, NO2, SO3H, SO2NH2, SO2Me, NH2, COOH, CONH2 and alkoxy.
- heteroaryl refers to an aromatic, substituted (mono- or poly-) or unsubstituted group, which comprises one or more heteroatoms.
- Preferred heteroatoms include N, S, O.
- Preferred heteroaryl groups include pyrrole, pyrazole, pyrimidine, pyrazine, pyridine, quinoline, triazine, triazole, thiophene, selenazol, thiazole and furan.
- suitable substituents include, for example, halo, CF3, OH, CN, NO2, SO3H, SO2NH2, SO2Me, NH2, COOH, CONH2 and alkoxy.
- halo or halogeno refers to F, CI, Br or I.
- Ar1 , Ar2 and Ar3 may each independently represent a substituted or unsubstituted aryl or heteroaryl group.
- AM , Ar2 and Ar3 each independently represent 6-membered aryl rings which may be substituted or unsubstituted.
- Preferred substituents include one or more halo group, in particular fluoro group and/or one or more alkyl group, typically a lower alkyl group having a carbon backbone of one to six C atoms.
- Ar2 and Ar3 are each independently phenyl groups unsubstituted or substituted with one or more halo or methyl group.
- Ar1 is a toluyl group, in particular a 4-toluyl group
- Ar2 is a fluorophenyl group, in particular a 4-fluorophenyl group
- Ar3 is an unsubstituted phenyl group.
- a method of treating cancer in a patient comprising the step of administering a therapeutically effective amount of a compound of Formulae 2 or a
- Ar1 and Ar2 are typically each independently aryl or heteroaryl groups which may be substituted or unsubstituted.
- Ar1 and Ar2 independently represent a fused multi ring aryl or heteroaryl group, such as a 5- or 6-membered aryl or heteroaryl ring fused to a 5- or 6-membered aryl or heteroaryl ring.
- Suitable heteroatoms include N, S and O, more suitably N and O.
- Ar1 and Ar2 independently represent a 5- membered aryl or heteroaryl ring fused to a 6-membered aryl or heteroaryl ring.
- Ar1 and Ar2 independently represent a 5-membered heteroaryl ring fused to a 6-membered aryl ring.
- Ar1 and Ar2 may be the same.
- A1 and/or A2 may represent a 5- or 6- membered aryl group, suitably a 6- membered aryl group, typically substituted with a COO- group.
- Ar1 and/or Ar2 represents benzoxazol-2-yl, or benzimidazol-2-yl.
- Ar1 may represent 3-chlorobenzothien-2-yl and Ar2 may represent 4-benzoate.
- X1 and X2 are independently alkyl or heteroalkyl linker groups having a backbone of 1 to 10 atoms, typically 1 to 6 atoms. According to one
- X1 and X2 have a backbone of 2 atoms.
- Typical heteroatoms include S, O and N.
- X1 and X2 may be the same.
- X1 and/or X2 represent CH2S.
- R1 , R2, R3 and R4 represent H.
- R1 may represent an alkyl or heteroalkyl group, advantageously OMe.
- a method of treating cancer in a patient comprising the step of administering a therapeutically effective amount of a compound of Formulae 3 or a
- Ar1 , Ar2 and Ar3 are typically each independently aryl or heteroaryl groups which may be substituted or unsubstituted.
- Ar1 and Ar2 independently represent a 5- or 6- membered aryl or heteroaryl group. Suitable heteroatoms include N, S and O, more suitably N and S.
- Ar3 may represent a fused multi ring aryl or heteroaryl group, such as a 5- or 6-membered aryl or heteroaryl ring fused to a 5- or 6-membered aryl or heteroaryl ring. Such aryl or heteroaryl groups may be substituted or unsubstituted.
- Ar3 represents a naphthyl group.
- X1 represents an alkyl or heteroalkyl linker group having a backbone of 1 to 10 atoms, typically 2 to 6 atoms. Typical heteroatoms include S, O and N, in particular O.
- the alkyl or heteroalkyl groups may be substituted or
- X1 represents COCH2OCO.
- R1 represents H.
- a method of treating cancer in a patient comprising the step of administering a therapeutically effective amount of a compound of Formulae 4 or a pharmaceutically acceptable salt thereof:
- Ar, Ar1 and Ar2 are typically each independently aryl or heteroaryl groups which may be substituted or unsubstituted.
- Ar1 , Ar2 and Ar3 independently represent a 5- or 6-membered aryl or heteroaryl group.
- Suitable heteroatoms include N, S and O.
- Ar1 , Ar2 and Ar3 may independently represent a fused multi ring aryl or heteroaryl group, such as a 5- or 6-membered aryl or heteroaryl ring fused to a 5- or 6-membered aryl or heteroaryl ring.
- Suitable heteroatoms include N, S and O, in particular O.
- Ar1 , Ar2 and Ar3 independently represent a 5-membered heteroaryl ring fused to a 6-membered aryl ring.
- Ar1 represents a benzodioxole group
- Ar2 represents a pyrazole or a thiazole group
- Ar3 represents a benzodioxole or a thiophene group.
- X1 and X2 are independently alkyl or heteroalkyi linker groups having a backbone of 1 to 10 atoms, typically 1 to 6 atoms. Typical heteroatoms include S, O and N, in particular O and N.
- X1 represents CH2CONH and X2 represents (CH2)3CONHCH2.
- Z represents S or NH, preferably S.
- a method of treating cancer in a patient comprising the step of administering a therapeutically effective amount of a compound of Formulae 5 or a pharmaceutically acceptable salt thereof:
- Ar1 , Ar2 and Ar3 may each independently represent substituted or unsubstituted aryl or heteroaryl group.
- Ar1 , Ar2 and Ar3 may each independently represent substituted or unsubstituted aryl or heteroaryl group.
- substituents independently represent 6-membered aryl rings which may be substituted or unsubstituted.
- Preferred substituents include one or more halo group, in particular fluoro group and/or one or more alkyl group, typically a lower alkyl group having a carbon backbone of one to six C atoms.
- Ar1 , Ar2 and Ar3 are each independently phenyl groups unsubstituted or substituted with one or more halo or methyl group.
- Ar1 is a toluyl group, in particular a 4-toluyl group
- Ar2 is a fluorophenyl group, in particular a 4-fluorophenyl group
- Ar3 is an unsubstituted phenyl group.
- a method of treating cancer in a patient comprising the step of administering a therapeutically effective amount of a compound of Formulae 5 or a
- X1 and X2 are independently alkyl or heteroalkyl linker groups having a backbone of 1 to 10 atoms, typically 1 to 6 atoms. According to one embodiment X1 and X2 have a backbone of 1 to 3 atoms. Typical
- heteroatoms include S, O and N, in particular N and O.
- X1 and X2 may be cyclo-alkyl or heteroalkyl groups.
- R1 to R7 represent H.
- R8 is a 5- or 6- membered aryl ring, in particular a phenyl group.
- R8 may represent a substituted or unsubstituted phenyl group, such as a methoxyphenyl group.
- the compounds of Formulae 1 to 18 react with APE1 meaning that APE1 is unable to react with unrepaired AP sites.
- APE1 is a critical enzyme in the BER pathway, and this inactivation of APE1 leads to a corresponding depletion in the repair of DNA through the BER pathway.
- the depletion of APE1 leads to an accumulation of unrepaired AP sites.
- Such AP sites are cytotoxic, and their accumulation is associated with decreased cell viability and increased apoptosis. The cell proliferation is also reduced.
- the method of the present invention involves a reduction in the activity of APE1 in a cancerous cell of at least about 50%, suitably at least about 70%, advantageously at least about 90%.
- the method of the present invention involves a reduction in the activity of APE1 in a cancerous tumour of at least about 50%, suitably at least about 70%, advantageously at least about 90%.
- the method of the present invention involves an increase in the amount of AP sites in cancerous cells of at least about 50%, suitably at least about 70%, advantageously at least about 90%.
- the method of the present invention results in a reduction of the repair of DNA of cancerous cells through the BER mechanism of at least about 50%, generally at least about 70%, preferably at least about 90%.
- a reduction in the repair of cancerous cell DNA though the BER mechanism would result in a reduction of total repair of cancerous cell DNA of at least about 30%.
- the method of the present invention may result in an increase in cancer cell apoptosis of about 20% or more.
- a reduction in cancer cell proliferation of about 10% or more may also be observed.
- the size of cancerous tumours may be reduced by about 10% or more through the method of the present invention.
- the method of the present invention results in the effective prevention of the BER mechanism in cancerous cells.
- the method of the present invention results in the effective prevention of the BER mechanism in cancerous tumours.
- the method of the present invention specifically targets APE1 , and does not react with or inhibit any other molecules.
- the compounds of Formulae 1 to 18 have an IC50 of less than about 30 ⁇ ; suitably less than about 10 ⁇ ; preferably less than about 5 ⁇ .
- the compounds of the present invention have a relatively high aqueous solubility.
- the compounds of the present invention have a favourable solubility profile with xLogP ranging from about 1 .0 to about 5.0 of at least.
- the compounds of Formulae 1 to 18 have been found to be effective in vitro, in whole cell extracts as well as in connection with purified APE1 . They are associated with good membrane permeability.
- the method of the present invention may be used to treat all cancers.
- the method of the present invention is particularly effective in treating cancers associated with an aberrant expression of APE1 , typically an elevated expression of APE1 .
- suitable cancers include breast cancer, lung cancer, in particular non-small cell lung cancer, bone cancer, head-and-neck cancer, ovarian cancer, pancreatic cancer, gastro-oesophageal cancer, melanoma and brain cancer.
- the compounds of the present invention may be used in homologous recombination repair deficit, including BRCA-deficient breast and ovarian tumours.
- the dosage of compounds required is dependent on the specific compound administered. However, in general the method of the present invention may involve the administration of compounds at less than about 30 ⁇ , suitably less than about 10 ⁇ , more suitably less than about 5 ⁇ .
- the method of the present invention involves the administration of the compounds of the present invention at regular intervals, for instance once every week or more, potentially three times a week to daily administrations are envisaged.
- More than one compound of the present invention may be administered.
- the method of the present invention may involve the administration of one or more chemotherapeutic agent which does not fall into the scope of Formulae 1 to18.
- the method of the present invention may involve the administration of one or more chemotherapeutic agents which cause damage to cancer cell DNA, generally through alkylation, oxidation or ring-saturation of cancer cell DNA, or through instigation of damage such as deamination of DNA bases and DNA single strand breaks.
- the method of the present invention prevents or greatly reduces the proliferation of cancerous cells.
- the method of the present invention prevents or greatly reduces the proliferation of cancerous cells.
- cancerous cells proliferation of cancerous cells is reduced by at least about 10%, generally about 20% or more, preferably about 50% or more. In particular the spread of cancerous cells to different types of tissue is greatly reduced.
- the method of the present invention inhibits the activity of APE1 , and this leads to an increase in the number of AP sites.
- AP sites are cytotoxic and their accumulation increases cancer cell apoptosis as well as reducing proliferation of cancer cells.
- a method of preventing cancer, or preventing the proliferation of cancer involving the administration of one or more compounds of Formulae 1 to 18.
- the present invention also relates to compounds of Formulae 1 to 18, or pharmaceutically acceptable salts thereof, for use in any of the methods disclosed herein.
- reaction of the compounds of the present invention with APE1 prevents APE1 from reacting with AP sites. This leads to an inhibition of cancer cell
- composition comprising a compound of Formulae 1 to 18.
- composition comprises pharmaceutically acceptable excipients.
- the composition may comprise more than one of the compounds of Formulae 1 to 18.
- composition may comprise a chemotherapeutic agent which does not fall into the scope of Formulae 1 to 18.
- composition may be in the form of a tablet, a capsule, a solution, a suspension an elixir or any other standard pharmaceutical preparation.
- a further aspect of the invention provides the compositions comprising a compound of Formulae 1 to 18 for use in any one of the methods disclosed herein.
- chemotherapeutic agent comprising the steps of administering a compound of any one of Formulae 1 to 18 and the chemotherotherapeutic agent.
- chemotherapeutic agents and ionising radiation act through damaging cancer cell DNA.
- damage is generally repaired through the DNA base excision repair (BER) pathway.
- the therapeutic activity of such chemotherapeutic agents is necessarily limited by the contemporaneous repair of such damage ttrough the BER mechanism.
- the compounds of the present invention inactivate APE1 , inhibiting its ability to react with AP sites, and thus at least partially blocking the BER pathway. This reduces the rate of repair of DNA damage resulting in an associated increase in the effectiveness of such chemotherapeutic agents.
- the chemotherapeutic agents are generally those which act through damaging cancer cell DNA, such as alkylating agents (including temozolomide and dacarbazine), bleomycin, gencitabine, 5-fluorouracil and analogues, platinum compounds (such as cisplatin, oxaliplatin, carboplatin and others), 6- Thioguanine and other nucleoside analogues.
- the method involves the steps of administering a compound of any one of Formulae 1 to 18 and one or more of the group consisting of temozolomide, gemcitabine, 5-fluorouracil and analogues thereof, ionizing radiation, platinum compounds and nucleoside analogues.
- the compound of the present invention may be administered concomitantly or sequentially to the chemotherapeutic agent.
- the compound of the present invention and the chemotherapeutic agent may be in a single dosage form or multiple dosage forms.
- the compound of the present invention is advantageously administered as a single agent therapy in the treatment of breast cancer and ovarian cancer with homologous recombination repair deficit, including BRCA-deficient ovarian and breast cancer tumours.
- the method of the present invention results in an increase in cytotoxicity of known chemotherapeutic agents of about 20% or more, generally about 30% or more, advantageously about 50% or more.
- an increase in cytotoxicity of known chemotherapeutic agents of about 20% or more, generally about 30% or more, advantageously about 50% or more.
- chemotherapeutc agents is surprisingly great and the associated damage to cancer cells is surprisingly great.
- Figures 1 a to 1 d illustrate the inhibition of APE1 upon contact with the compounds of the present invention
- FIG. 2 details the structures of preferred compounds of the present invention
- Figure 3 details the inhibitory profile of various compounds of the present inventionwith respect to APE1 and Endonuclease IV.
- MMS Methyl methane sulfonate
- F fluorescein
- Q dabcyl
- X 3-hydroxy-2-(hydroxymethyl)-terahydrofuran (abasic site analogue)
- oligonucleotides for the radiolabeled DNA substrates for HeLa WCE assays - 18FNMR 5'GTCACCGTGFTACGACTC 3'(F tetrahydrofuran) and 18GNMR 5' GAGTCGTAGCACGGTGAC 3' - were obtained from Trilink
- the MeWo melanoma cancer cell line was a gift from Dr Andrew Jackson, University of Nottingham, UK. U89MG The glioma cancer cell line was a gift from Dr Tracey Bradshaw, University of Nottingham, UK.
- CellTiter 96 ® AQueous Non-Radiactive Cell Proliferation Assay (MTS) Kit was purchased from Promega.
- Sybyl8.0 a computational tool kit for molecular design and analyses.
- Sybyl8.0 was used to build inhibitor templates based on three previously reported APE1 inhibitors: lucanthone:, 1 -[[2- (diethylamino)ethyl]amino]-4-methyl-9H-thioxanthen-9-one.
- lucanthone 1 -[[2- (diethylamino)ethyl]amino]-4-methyl-9H-thioxanthen-9-one.
- pharmacophore templates were designed in silico (M1 , M2 and M3). Using these six templates, a shape-based similarity searching strategy using the programme Rapid Overlay of Chemical Structures 2.3 (ROCS 2.3; OpenEye Scientific) was applied to extract pharmacophorically related subsets of compounds from the ZINC database (http://zinc.docking.org/; 2008 version with ca. 2.5 million drug-like compounds). A Tanimoto similarity cut-off was set at 0.75 for all queries with the exception of the template M3, where the cut-off was set at 0.6. Hits from each of the six templates were saved in * .sdf format and subjected to docking against the APE1 active site model.
- a fluorescence based AP site cleavage assay was developed. Briefly, APE1 enzyme (80 ng, New England Biolabs)) was incubated in a buffer system comprising of 50 mM Tris-HCI, pH 8.0, 1 mM MgCI2, 50 mM NaCI, 2 mM DTT at 37°C for 10 minutes. 5' F-GCCCCCXGGGGACGTACGATATCCCGCTCC 3' and its complementary oligonucleotide 3' Q-
- CGGGGGCCCCCTGCATGCTATAGGGCGAGG 5' were annealed in a buffer containing 100 ⁇ Tris-HCI, 50 mM NaCI and 1 ⁇ EDTA.
- AP site cleavage was initiated by addition of the annealed substrate (25 nM) to the reaction mix. Fluorescence readings were taken at 5 minute intervals during a 30 minute incubation at 37°C using an Envision® Multilabel reader from Perkins Elmer with a 495 nM excitation and a 512 nM emission filter.
- the 6- mer lluorescein-containing molecule can dissociate from its complement by thermal melting.
- the quenching effect of the 3' dabcyl labal (which absorbs fluorescein fluorescence when in close proximity) is lost, and APE1 activity can be measured indirectly as an increase in fluorescence signal.
- Similar assays were developed for monitoring the AP endonuclease activity of endonuclease IV using a buffering system containing 10 mM HEPES-KOH, pH 7.4, 100 mM KCI and 60 ng of endonuclease IV (Trevigen). The final DMSO concentration was maintained at 1 .2% in all assays.
- APE1 was incubated with the candidate inhibitors at 100 ⁇ prior to initiating the AP site cleavage assay described in the previous section. Those candidates that showed complete or more than 90% inhibition of APE1 activity were subjected to serial dilution experiments for IC50 calculations. In addition, counter screening of potential inhibitors (at 100 ⁇ concentration) was performed using endonuclease IV cleavage assays.
- oligonucleotides 5'-F-GCCCCCXGGGGACGTACGATATCCCGCTCC-3' and 3'CGGGGGCCCCCTGCATGCTATAGGGCGAGG-5' were annealed as described previously.
- the double stranded oligonucleotide (5 nM) was incubated with 100 ⁇ of potential APE1 inhibitors in a buffer consisting of 50 ⁇ Tris-HCI, Ph 8.0, 1 mM MgCI2, 50 mM NaCI, and 2 mM DTT at 37°C for 30 minutes. Fluorescence intensity was measured every 5minutes. Any hits that showed a decrease of more than 50% in the fluorescence intensity were considered as quenchers.
- HeLa cells maintained in DMEM with 10% fetal bovine serum and 1 % penicillin-streptomycin, were harvested, washed with PBS, resuspended in cold 222 mM KCI plus protease inhibitors (0.5 mM PMSF, 1 g/mL each of leupepetin and pepstatin A) incubated on ice for 30 min, and clarified by centrifugation at 12,000 x g for 15 min at 4°C . The supernatant (whole cell extract) was retained, the protein concentration determined using the Bio-Rad Bradford reagent, and aliquots were stored at -80°C. AP endonuclease activity assays using radiolabeled oligonucleotide substrates (see above) were performed. In brief, potential APE1 inhibitors identified by the
- fluorescence assay were incubated at 100 ⁇ concentrations with 30 ng of HeLa whole cell extract at room temperature for 15 min in incision buffer consisting of 50 mM Tris-HCI pH 8, 1 mM MgCI2, 50 mM NaCI, and 2mM DTT. After incubation, 0.5 pmol 32P-radiolabeled tetrahydrofuran-containing 18mer double-stranded DNA was added.
- Incision reactions were then carried out immediately at 37 °C for 5 min in a final volume of 10 ⁇ _, after which the reaction was terminated by the addition of an equal volume of stop buffer (0.05% bromophenol blue and xylene cynol, 20 mM EDTA, 95% formamide) followed by denaturation of samples at 95°C for 10 min.
- stop buffer 0.05% bromophenol blue and xylene cynol, 20 mM EDTA, 95% formamide
- MeWo melanoma cancer cell line was grown in RPMI culture medium
- MTS assay AQueous Non- Radioactive Cell Proliferation Assays
- APE1 downloaded from the protein data bank and the DNA repair domain localised based on the previously reported ten critical amino acid residues that are essential for the AP endonuclease activity of APE1 (D70, D90, E96, Y171 , D210, N212, D219, D283, D308, and H309).
- the active site of APE1 was well defined and the Mg2+ ion involved in the APE1 catalytic mechanism was observed to occupy the centre of the cleft.
- Three new pharmacophore templates (M1 , M2 and M3) were designed and visualised on the APE1 model. The structures were then energy minimised and subjected to docking against the active site of the APE1 model. Predicted ligand poses were ranked on the basis of two fitness scoring functions: GOLDScore and ChemScore. One hundred docking runs were performed for each ligand and the docking programme was set to assign the best fitness score in a total of hundred runs.
- Shape-based similarity searching was applied to extract pharmacophorically related subsets of compounds from the ZINC database of commercially available small molecule compounds.
- the conformations of these compounds were then energy minimised and subjected to docking against the active site of the APE1 model.
- the top ranking 25% of the compounds with favourable GOLDsScore and ChemScores were shortlisted for further analyses.
- 5-Fluoro-1 H-indole-2-carboxylic acid belongs to the "CRT0044876 (C)" template (see Figure 2).
- CRT0044876, our previously described inhibitor was used as a positive control in these studies.
- the IC50 for APE1 inhibition ranged between 3 ⁇ to 26 ⁇ .
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Plural Heterocyclic Compounds (AREA)
Abstract
The invention provides a compound with the structural formula of any one of Formula 1 to Formula 18 or a pharmaceutically acceptable salt thereof, and uses thereof.
Description
Compounds
Field of the Invention The field of the invention is generally related to new compounds, the new compounds for use in a method for treatment of the human or animal body by therapy, and, in particular, their use in a method of treating cancer.
Specifically, there is provided a method of treating cancer involving the inhibition of the cancer cell DNA base excision repair (BER) pathway through the inhibition of apurinic/apyrimidinic endonuclease (APE1 ) activity. Inhibition of APE1 activity results in an accumulation of unrepaired apurinic/apyrimidinic (AP) sites in the cancer cell. AP sites are cytotoxic and can induce a
breakdown in cell integrity and promote cell apoptosis. Background of the Invention
BER is required for the accurate removal of bases that have been damaged by alkylation, oxidation or ring-saturation. This pathway also handles a variety of other lesions including deaminated bases and DNA single strand breaks. BER is performed by at least two major sub-pathways. These sub-pathways differ from each other in the length of the repair patch and in the subsets of enzymes involved. However, both pathways are initiated by a damage specific DNA glycosylase, which removes the damaged base creating an abasic (AP) site. AP sites are obligatory intermediates in the BER pathway.
AP sites are cytotoxic and represent a major threat to the integrity and survival of a cell. Inactivation of APE1 leads to an accumulation of AP sites, retards cell proliferation and activates apoptosis. APE1 is a critical enzyme in the recognition and processing of AP sites in the BER pathway. APE1 accounts for over 95% of the total AP endonuclease activity in human cell lines. AP sites can arise spontaneously at a rate of about 10,000 AP sites per day in each human cell. In addition the activity of DNA glycosylases that process damaged DNA bases generate AP sites that would certainly add to this burden. Indeed, the steady state level of AP lesions is estimated in some
studies to be much higher approaching 50,000 or more per cell depending on age and tissue source. Inactivating APE1 and hence the BER pathway inhibits the ability of the cell to repair itself and thus maximises the cytotoxicity of chemotherapeutic agents which induce genomic DNA damage.
Chemotherapy and radiation are the two main treatments currently available to improve outcomes in patients with advanced cancer. The cytotoxicity of many of these agents is directly related to their propensity to induce genomic DNA damage. However, the ability of cancer cells to recognise this damage and initiate DNA repair is an important mechanism for therapeutic resistance that negatively impacts upon therapeutic efficacy. Pharmacological inhibition of the BER pathway of DNA repair, therefore, has the potential to maximise the cytotoxicity of a diverse range of anticancer agents. Summary of the Invention
The present invention is defined by the claims.
According to a first aspect of the present invention there is provided a compound having the structure of Formula 1 and its pharmaceutically acceptable salts:
Formula 1
According to a further aspect of the present invention there is provided a method of treating cancer in a patient comprising the step of administering a therapeutically effective amount of a compound of any one of Formulae 1 , 2, 3, 4, 5 and 6 or a pharmaceutically acceptable salt thereof.
Ar, Ar1 , Ar2, Ar3 are each independently aryl or heteroaryl groups which may be substituted or unsubstituted with one or more R9 group.
X1 and X2 are each independently alkyl or heteroalkyi groups, typically lower alkyl or heteroalkyi groups comprising a carbon backbone of 1 to 10 carbon atoms optionally including one or more heteroatoms, suitably 1 to 6, more suitably 2 to 4 carbon atoms optionally including one or more heteroatoms. The alkyl or heteroalkyi groups may be mono- or poly- substituted typically with one or more R10 group.
Z is S or NH. R, R1 , R2, R3, R4, R5, R6, R7, R8, R9 and R10 are each independently H, alkyl, heteroalkyi, aryl, heteroaryl and combinations of two or more thereof or R1 1 , R1 1 being selected from O-, N-, NH-, CO, COO, CON, CONH, SO2, SO2N and SO2NH group linking one or more alkyl, heteroalkyi, aryl or heteroaryl group.
The alkyl, heteroalkyi, aryl and heteroaryl groups may be substituted or unsubstituted, typically being substituted with one or more halgeno, NH2, NO2, CN, OH, COOH, CONH2, C(=NH)NH2, SO3H, SO2NH2, SO2CH3, OCH3 or CF3 group
Two of R1 to R1 1 may be linked to form a cyclic group, such as a cycloalkyl, cycloheteroalkyi, polycyclic, cyclic ketone, cyclic ketone, cyclic alcohol, cyclic ester and cyclic ether group. Suitable heteroatoms include S, O, N and Se.
According to a further aspect of the present invention there is provided a method of treating cancer in a patient comprising the step of administering a
therapeutically effective amount of a compound of any one of Formulae 7 to 18 or a pharmaceutically acceptable salt thereof.
Formula 8
Formula 17
Formula 18
In the formulae above, all groups are defined as above. Formulae 7 to 18 may include one or more substituent, defined as R above. Where heteroatoms are specified in Formulae 7 to 18, these may be the heteroatoms specified, or may be substituted for another heteroatom. Suitable heteroatoms include S, O, N and Se.
In Formula 10, R1 and R2 generally represent alkyl groups, in particular 1 to 5 atom alkyl groups. In particular R1 may represent a methyl group and R2 may represent an ethyl group.
In Formula 12, R1 and R2 generally represent alkyl groups, in particular 1 to 5 atom alkyl groups. In particular R1 and R2 may represent methyl groups.
In Formula 14, R1 generally represents an alkyl group, in particular a 1 to 5 atom alkyl group. In particular R1 may represent a methyl group. R2 generally represents a halo group, in particular CI .
In Formula 16, R1 is generally an ether group, in particular MeO.
In Formula 18, R1 generally represents a halo group, in particular F.
A further aspect of the present invention relates to a compound of any one of Formulae 1 to 18, or a pharmaceutically acceptable salt thereof, for use in a method for treatment of the human or animal body by therapy.
A further aspect of the present invention relates to a compound of any one of Formulae 1 to 18, or a pharmaceutically acceptable salt thereof, for use in the treatment of cancer.
A further aspect of the present invention relates to a pharmaceutical composition comprising a compound of any one of Formulae 1 to 18 or a pharmaceutically acceptable salt thereof and one or more diluents, carriers or excipients.
A further aspect of the present invention relates to a pharmaceutical composition comprising a compound of any one of Formulae 1 to 18 or a pharmaceutically acceptable salt thereof and one or more diluents, carriers or excipients for use in a method for treatment of the human or animal body by therapy.
A further aspect of the present invention relates to a pharmaceutical composition comprising a compound of any one of Formulae 1 to 18 or a pharmaceutically acceptable salt thereof and one or more diluents, carriers or excipients for use in a method for use in the treatment of cancer.
A further aspect of the present invention relates to a process for the preparation of a compound of Formulae 1 to 18 as hereinbefore defined.
The present invention also provides a method for increasing, preferably maximising, the cytotoxicity of a chemotherapeutic agent comprising the steps of administering the chemotherapeutic agent and a compound of any one of Formulae 1 to 18
A further aspect of the present invention relates to a compound of any one of Formulae 1 to 18, or a pharmaceutically acceptable salt thereof, in
combination with a chemotherapeutic agent for use in a method for treatment of the human or animal body by therapy; preferably, for use in the treatment of cancer; and, more preferably, for use in increasing the cytotoxicity of the chemotherapeutic agent.
Detailed Description
As used herein the term "alkyl" includes both straight chain and branched alkyl groups. The alkyl group may be substituted (mono- or poly-) or unsubstituted. Suitable substituents include, for example, halo, CF3, OH, CN, NO2, SO3H, SO2NH2, SO2Me, NH2, COOH, CONH2, alkyl and alkoxy.
Typically, the alkyl group is a C1 -20 alkyl group, generally a C1 -15 alkyl group. The alkyl group may be a C1 -12 alkyl group, suitably a C1 -6 alkyl group, advantageously a C1 -3 alkyl group. Particularly preferred alkyl groups include, for example, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, pentyl and hexyl.
As used herein, the term "heteroalkyi" includes an alkyl group as defined above which comprises one or more heteroatoms.
As used herein, the term "cycloalkyl" refers to a cyclic alkyl group which may be substituted (mono- or poly-) or unsubstituted. Suitable substituents include, for example, halo, CF3, OH, CN, NO2, SO3H, SO2NH2, SO2Me, NH2, COOH, CONH2 and alkoxy.
Likewise, the term "cycloheteroalkyl" refers to a cyclic heteroalkyi group which may be substituted (mono- or poly-) or unsubstituted. Suitable substituents include, for example, halo, CF3, OH, CN, NO2, SO3H, SO2NH2, SO2Me,
NH2, COOH, CONH2 and alkoxy. Preferred cycloheteroalkyl groups include morpholino, piperazinyl and piperidinyl groups.
As used herein, the term "aryl" refers to an aromatic, substituted (mono- or poly-) or unsubstituted group, and includes, for example, phenyl, naphthyl etc. Again, suitable substituents include, for example, halo, CF3, OH, CN, NO2, SO3H, SO2NH2, SO2Me, NH2, COOH, CONH2 and alkoxy.
As used herein, the term "heteroaryl" refers to an aromatic, substituted (mono- or poly-) or unsubstituted group, which comprises one or more heteroatoms. Preferred heteroatoms include N, S, O. Preferred heteroaryl groups include pyrrole, pyrazole, pyrimidine, pyrazine, pyridine, quinoline, triazine, triazole, thiophene, selenazol, thiazole and furan. Again, suitable substituents include, for example, halo, CF3, OH, CN, NO2, SO3H, SO2NH2, SO2Me, NH2, COOH, CONH2 and alkoxy.
As used herein the term "halo" or "halogeno" refers to F, CI, Br or I.
According to an aspect of the present invention there is provided a compound of Formula 1 and its pharmaceutically acceptable salts:
wherein Ar1 , Ar2 and Ar3 may each independently represent a substituted or unsubstituted aryl or heteroaryl group. Typically AM , Ar2 and Ar3 each independently represent 6-membered aryl rings which may be substituted or unsubstituted. Preferred substituents include one or more halo group, in particular fluoro group and/or one or more alkyl group, typically a lower alkyl group having a carbon backbone of one to six C atoms.
Advantageously AM , Ar2 and Ar3 are each independently phenyl groups unsubstituted or substituted with one or more halo or methyl group.
According to one embodiment Ar1 is a toluyl group, in particular a 4-toluyl group, Ar2 is a fluorophenyl group, in particular a 4-fluorophenyl group and Ar3 is an unsubstituted phenyl group.
According to a further aspect of the present invention there is provided a method of treating cancer in a patient comprising the step of administering a therapeutically effective amount of a compound of Formulae 2 or a
pharmaceutically acceptable salt thereof:
wherein Ar1 and Ar2 are typically each independently aryl or heteroaryl groups which may be substituted or unsubstituted. Typical substitutents include one or more halo, COO-, SO2, =O, NO2, ether, amine or alkyl groups (optionally substituted by, for instance, one or more OH, COO- or halo groups).
According to one embodiment, Ar1 and Ar2 independently represent a fused multi ring aryl or heteroaryl group, such as a 5- or 6-membered aryl or heteroaryl ring fused to a 5- or 6-membered aryl or heteroaryl ring. Suitable heteroatoms include N, S and O, more suitably N and O. Advantageously Ar1 and Ar2 independently represent a 5- membered aryl or heteroaryl ring fused to a 6-membered aryl or heteroaryl ring. Suitably Ar1 and Ar2 independently represent a 5-membered heteroaryl ring fused to a 6-membered aryl ring.
Ar1 and Ar2 may be the same.
Alternatively A1 and/or A2 may represent a 5- or 6- membered aryl group, suitably a 6- membered aryl group, typically substituted with a COO- group. According to one embodiment, Ar1 and/or Ar2 represents benzoxazol-2-yl, or benzimidazol-2-yl.
Alternatively Ar1 may represent 3-chlorobenzothien-2-yl and Ar2 may represent 4-benzoate.
X1 and X2 are independently alkyl or heteroalkyl linker groups having a backbone of 1 to 10 atoms, typically 1 to 6 atoms. According to one
embodiment X1 and X2 have a backbone of 2 atoms. Typical heteroatoms include S, O and N. The alkyl or heteroalkyl groups may be substituted or unsubstituted. Suitable substituents include =O, OH, halo, amine, ether, alkyl.
X1 and X2 may be the same.
According to an aspect of the present invention X1 and/or X2 represent CH2S. Alternatively X1 may represent C(=O) and X2 may represent CH=N.
According to one embodiment, R1 , R2, R3 and R4 represent H. Alternatively R1 may represent an alkyl or heteroalkyl group, advantageously OMe. According to a further aspect of the present invention there is provided a method of treating cancer in a patient comprising the step of administering a therapeutically effective amount of a compound of Formulae 3 or a
wherein Ar1 , Ar2 and Ar3 are typically each independently aryl or heteroaryl groups which may be substituted or unsubstituted. Typical substitutents include one or more halo, COO-, SO2, =O, NO2, ether amine or alkyl groups (optionally substituted by for instance one or more OH, COO- or halo groups), in particular methoxy.
Suitably Ar1 and Ar2 independently represent a 5- or 6- membered aryl or heteroaryl group. Suitable heteroatoms include N, S and O, more suitably N and S. According to one embodiment, Ar1 is a phenyl group and Ar2 thienyl or a pyrimidine group. Typically Ar1 and Ar2 are unsubstituted or substituted with one or more =O, NO2 or lower alkyl group. Ar3 may represent a fused multi ring aryl or heteroaryl group, such as a 5- or 6-membered aryl or heteroaryl ring fused to a 5- or 6-membered aryl or heteroaryl ring. Such aryl or heteroaryl groups may be substituted or unsubstituted. According to one embodiment, Ar3 represents a naphthyl group.
X1 represents an alkyl or heteroalkyl linker group having a backbone of 1 to 10 atoms, typically 2 to 6 atoms. Typical heteroatoms include S, O and N, in particular O. The alkyl or heteroalkyl groups may be substituted or
unsubstituted. Suitable substituents include =O, OH, halo, amine, ether, alkyl. According to one embodiment X1 represents COCH2OCO.
Typically R1 represents H.
According to a further aspect of the present invention there is provided a method of treating cancer in a patient comprising the step of administering a
therapeutically effective amount of a compound of Formulae 4 or a pharmaceutically acceptable salt thereof:
wherein Ar, Ar1 and Ar2 are typically each independently aryl or heteroaryl groups which may be substituted or unsubstituted. Typical substitutents include one or more halo, COO-, SO2, =O, NO2, ether, amine or alkyl groups (optionally substituted by for instance one or more OH, COO- or halo groups), in particular methoxy.
Suitably Ar1 , Ar2 and Ar3 independently represent a 5- or 6-membered aryl or heteroaryl group. Suitable heteroatoms include N, S and O.
Alternatively Ar1 , Ar2 and Ar3 may independently represent a fused multi ring aryl or heteroaryl group, such as a 5- or 6-membered aryl or heteroaryl ring fused to a 5- or 6-membered aryl or heteroaryl ring. Suitable heteroatoms include N, S and O, in particular O. Suitably Ar1 , Ar2 and Ar3 independently represent a 5-membered heteroaryl ring fused to a 6-membered aryl ring.
According to one embodiment, Ar1 represents a benzodioxole group, Ar2 represents a pyrazole or a thiazole group and Ar3 represents a benzodioxole or a thiophene group.
X1 and X2 are independently alkyl or heteroalkyi linker groups having a backbone of 1 to 10 atoms, typically 1 to 6 atoms. Typical heteroatoms include S, O and N, in particular O and N. The alkyl or heteroalkyi groups may
be substituted or unsubstituted. Suitable substituents include =O, OH, halo, amine, ether, alkyl.
According to one embodiment, X1 represents CH2CONH and X2 represents (CH2)3CONHCH2.
Z represents S or NH, preferably S.
According to a further aspect of the present invention there is provided a method of treating cancer in a patient comprising the step of administering a therapeutically effective amount of a compound of Formulae 5 or a pharmaceutically acceptable salt thereof:
wherein Ar1 , Ar2 and Ar3 may each independently represent substituted or unsubstituted aryl or heteroaryl group. Typically Ar1 , Ar2 and Ar3
independently represent 6-membered aryl rings which may be substituted or unsubstituted. Preferred substituents include one or more halo group, in particular fluoro group and/or one or more alkyl group, typically a lower alkyl group having a carbon backbone of one to six C atoms.
Advantageously Ar1 , Ar2 and Ar3 are each independently phenyl groups unsubstituted or substituted with one or more halo or methyl group.
According to one embodiment Ar1 is a toluyl group, in particular a 4-toluyl group, Ar2 is a fluorophenyl group, in particular a 4-fluorophenyl group and Ar3 is an unsubstituted phenyl group.
According to a further aspect of the present invention there is provided a method of treating cancer in a patient comprising the step of administering a
therapeutically effective amount of a compound of Formulae 5 or a
pharmaceutically acceptable salt thereof:
X1 and X2 are independently alkyl or heteroalkyl linker groups having a backbone of 1 to 10 atoms, typically 1 to 6 atoms. According to one embodiment X1 and X2 have a backbone of 1 to 3 atoms. Typical
heteroatoms include S, O and N, in particular N and O. X1 and X2 may be cyclo-alkyl or heteroalkyl groups. The alkyl or heteroalkyl groups may be substituted or unsubstituted. Suitable substituents include =O, OH, halo, amine, ether, alkyl.
According to an aspect of the present invention X1 represents NHC=O, OC=O or C=OO. X2 may typically represent CH2S, cyclopropyl, CH2OC=O or CH2.
According to one embodiment, R1 to R7 represent H.
R8 typically represents an alkyl, heteroalkyl, aryl or heteroaryl group which may be substituted or unsubstituted. Typical substitutents include one or more halo, COO-, SO2, =O, NO2, ether, amine or alkyl groups (optionally substituted by for instance one or more OH, COO- or halo groups), in particular methyl. Suitable heteroatoms include N, S and O, more suitably N. According to an aspect of the present invention R8 represents a 5-membered heteroaryl group, especially a thiazole group.
According to one embodiment R8 is a 1 to 6 carbon alkyl chain, in particular a methyl, ethyl, propyl or butyl group. In particular R8 is a butyl group.
Alternatively, R8 is a 5- or 6- membered aryl ring, in particular a phenyl group. R8 may represent a substituted or unsubstituted phenyl group, such as a methoxyphenyl group.
The compounds of Formulae 1 to 18 react with APE1 meaning that APE1 is unable to react with unrepaired AP sites. Through the reaction with the compounds of the present invention the activity of APE1 is greatly inhibited. As noted above, APE1 is a critical enzyme in the BER pathway, and this inactivation of APE1 leads to a corresponding depletion in the repair of DNA through the BER pathway. In addition, the depletion of APE1 leads to an accumulation of unrepaired AP sites. Such AP sites are cytotoxic, and their accumulation is associated with decreased cell viability and increased apoptosis. The cell proliferation is also reduced.
Typically the method of the present invention involves a reduction in the activity of APE1 in a cancerous cell of at least about 50%, suitably at least about 70%, advantageously at least about 90%. Generally the method of the present invention involves a reduction in the activity of APE1 in a cancerous tumour of at least about 50%, suitably at least about 70%, advantageously at least about 90%.
Generally the method of the present invention involves an increase in the amount of AP sites in cancerous cells of at least about 50%, suitably at least about 70%, advantageously at least about 90%.
According to one embodiment, the method of the present invention results in a reduction of the repair of DNA of cancerous cells through the BER mechanism of at least about 50%, generally at least about 70%, preferably at least about 90%. Such a reduction in the repair of cancerous cell DNA though the BER mechanism would result in a reduction of total repair of cancerous cell DNA of at least about 30%.
The method of the present invention may result in an increase in cancer cell apoptosis of about 20% or more. A reduction in cancer cell proliferation of about 10% or more may also be observed. The size of cancerous tumours may be reduced by about 10% or more through the method of the present invention.
Advantageously, the method of the present invention results in the effective prevention of the BER mechanism in cancerous cells. According to one embodiment, the method of the present invention results in the effective prevention of the BER mechanism in cancerous tumours.
Preferably, the method of the present invention specifically targets APE1 , and does not react with or inhibit any other molecules.
Typically the compounds of Formulae 1 to 18 have an IC50 of less than about 30μΜ; suitably less than about 10μΜ; preferably less than about 5μΜ.
Generally the compounds of the present invention have a relatively high aqueous solubility. Typically the compounds of the present invention have a favourable solubility profile with xLogP ranging from about 1 .0 to about 5.0 of at least. The compounds of Formulae 1 to 18 have been found to be effective in vitro, in whole cell extracts as well as in connection with purified APE1 . They are associated with good membrane permeability.
The method of the present invention may be used to treat all cancers.
However, the method of the present invention is particularly effective in treating cancers associated with an aberrant expression of APE1 , typically an elevated expression of APE1 . Suitable cancers include breast cancer, lung cancer, in particular non-small cell lung cancer, bone cancer, head-and-neck cancer, ovarian cancer, pancreatic cancer, gastro-oesophageal cancer, melanoma and brain cancer. Moreover the compounds of the present invention may be used in homologous recombination repair deficit, including BRCA-deficient breast and ovarian tumours.
The dosage of compounds required is dependent on the specific compound administered. However, in general the method of the present invention may involve the administration of compounds at less than about 30μΜ, suitably less than about 10μΜ, more suitably less than about 5μΜ.
Typically the method of the present invention involves the administration of the compounds of the present invention at regular intervals, for instance once every week or more, potentially three times a week to daily administrations are envisaged.
More than one compound of the present invention may be administered.
The method of the present invention may involve the administration of one or more chemotherapeutic agent which does not fall into the scope of Formulae 1 to18. In particular, the method of the present invention may involve the administration of one or more chemotherapeutic agents which cause damage to cancer cell DNA, generally through alkylation, oxidation or ring-saturation of cancer cell DNA, or through instigation of damage such as deamination of DNA bases and DNA single strand breaks.
Surprisingly it has been found that the administration of the compounds of the present invention with such chemotherapeutic agents results in a synergistic increase in cancer cell apoptosis and reduction in cancer cell proliferation.
According to one embodiment, the method of the present invention prevents or greatly reduces the proliferation of cancerous cells. Typically the
proliferation of cancerous cells is reduced by at least about 10%, generally about 20% or more, preferably about 50% or more. In particular the spread of cancerous cells to different types of tissue is greatly reduced.
As noted above, the method of the present invention inhibits the activity of APE1 , and this leads to an increase in the number of AP sites. AP sites are
cytotoxic and their accumulation increases cancer cell apoptosis as well as reducing proliferation of cancer cells.
According to a further aspect of the present invention there is provided the use of a compound of any one of Formulae 1 to 18 in the treatment of cancer.
According to a further aspect of the present invention there is provided the use of a compound of any one of Formulae 1 to18 in the manufacture of a medicament for the treatment of cancer.
According to a further aspect of the present invention there is provided a method of preventing cancer, or preventing the proliferation of cancer involving the administration of one or more compounds of Formulae 1 to 18. The present invention also relates to compounds of Formulae 1 to 18, or pharmaceutically acceptable salts thereof, for use in any of the methods disclosed herein.
The reaction of the compounds of the present invention with APE1 prevents APE1 from reacting with AP sites. This leads to an inhibition of cancer cell
DNA repair through the BER pathway resulting in an accumulation of AP sites. Cell proliferation is reduced or prevented accordingly. The rate of apoptosis is also increased accordingly. These effects lead to a decreased chance of cancer cell formation. The progression of the disease is slowed or halted accordingly.
In particular, the risk of cancer progressing to different types of tissue is reduced. According to a further aspect of the present invention there is provided a composition comprising a compound of Formulae 1 to 18.
Typically the composition comprises pharmaceutically acceptable excipients.
The composition may comprise more than one of the compounds of Formulae 1 to 18.
The composition may comprise a chemotherapeutic agent which does not fall into the scope of Formulae 1 to 18.
The composition may be in the form of a tablet, a capsule, a solution, a suspension an elixir or any other standard pharmaceutical preparation. A further aspect of the invention provides the compositions comprising a compound of Formulae 1 to 18 for use in any one of the methods disclosed herein.
According to a further aspect of the present invention there is provided a method of increasing, preferably maximising, the cytotoxicity of a
chemotherapeutic agent comprising the steps of administering a compound of any one of Formulae 1 to 18 and the chemotherotherapeutic agent.
Several known chemotherapeutic agents and ionising radiation act through damaging cancer cell DNA. In particular, through alkylation, oxidation or ring saturation of cancer cell DNA, or through instigation of damage such as deamination o DNA bases and DNA single strand breaks. Such damage is generally repaired through the DNA base excision repair (BER) pathway. The therapeutic activity of such chemotherapeutic agents is necessarily limited by the contemporaneous repair of such damage ttrough the BER mechanism. The compounds of the present invention inactivate APE1 , inhibiting its ability to react with AP sites, and thus at least partially blocking the BER pathway. This reduces the rate of repair of DNA damage resulting in an associated increase in the effectiveness of such chemotherapeutic agents.
The chemotherapeutic agents are generally those which act through damaging cancer cell DNA, such as alkylating agents (including temozolomide and dacarbazine), bleomycin, gencitabine, 5-fluorouracil and analogues,
platinum compounds (such as cisplatin, oxaliplatin, carboplatin and others), 6- Thioguanine and other nucleoside analogues.
According to one aspect of the present invention, the method involves the steps of administering a compound of any one of Formulae 1 to 18 and one or more of the group consisting of temozolomide, gemcitabine, 5-fluorouracil and analogues thereof, ionizing radiation, platinum compounds and nucleoside analogues. The compound of the present invention may be administered concomitantly or sequentially to the chemotherapeutic agent. The compound of the present invention and the chemotherapeutic agent may be in a single dosage form or multiple dosage forms. The compound of the present invention is advantageously administered as a single agent therapy in the treatment of breast cancer and ovarian cancer with homologous recombination repair deficit, including BRCA-deficient ovarian and breast cancer tumours. Typically the method of the present invention results in an increase in cytotoxicity of known chemotherapeutic agents of about 20% or more, generally about 30% or more, advantageously about 50% or more. Generally there is a correlation in the increase in the number of AP sites and the increase in the cytotoxity of known chemotherapeutic agents.
Surprisingly, when the compounds of the present invention are administered together with chemotherapeutic agents that act through damaging cancer cell DNA, a synergistic effect is exhibited, in that the cytotoxicity of the
chemotherapeutc agents is surprisingly great and the associated damage to cancer cells is surprisingly great.
The present invention will now be described by way of example only with reference to the accompanying Figures in which:
Figures 1 a to 1 d illustrate the inhibition of APE1 upon contact with the compounds of the present invention;
Figure 2 details the structures of preferred compounds of the present invention;
Figure 3 details the inhibitory profile of various compounds of the present inventionwith respect to APE1 and Endonuclease IV.
Example 1 MATERIALS AND METHODS
Enzymes, oligonucleotides and chemicals Human APE1 , uracil-DNA
glycosylase and E.coli endonuclease IV were obtained from New England Biolabs. Methyl methane sulfonate (MMS) was purchased from Sigma-Aldrich. Stock solutions of test compounds were dissolved in DMSO. MMS was dissolved in phosphate buffered saline.
The oligonucleotides; 5' F-GCCCCCXGGGGACGTACGATATCCCGCTCC 3' and 3' Q-CGGGGGCCCCCTGCATGCTATAGGGCGAGG 5' [where F = fluorescein, Q = dabcyl and X is 3-hydroxy-2-(hydroxymethyl)-terahydrofuran (abasic site analogue)] were custom-made by Eurogentec Ltd. The
oligonucleotides for the radiolabeled DNA substrates for HeLa WCE assays - 18FNMR 5'GTCACCGTGFTACGACTC 3'(F = tetrahydrofuran) and 18GNMR 5' GAGTCGTAGCACGGTGAC 3' - were obtained from Trilink
Biotechnologies, Inc and Midland certified reagent company, respectively.
Potential APE1 inhibitors were purchased from Maybridge Chemicals
(Tintagel, UK), ChemBridge Corporation (CA, USA), ASINEX intelligent chemistry (Laan van Vredenoord, Netherlands), Life Chemicals
(Braunschweig, GERMANY), Enamine Ltd (Kiev, Ukraine), Specs Chemicals (Delft, Netherlands), ChemDiv Inc. (CA, USA), Ukrorgsynthesis Ltd (Kiev, Ukraine) and Sigma-Aldrich.
The MeWo melanoma cancer cell line was a gift from Dr Andrew Jackson, University of Nottingham, UK. U89MG The glioma cancer cell line was a gift
from Dr Tracey Bradshaw, University of Nottingham, UK. CellTiter 96 ® AQueous Non-Radiactive Cell Proliferation Assay (MTS) Kit was purchased from Promega.
Virtual screening strategy
Publicly available coordinates of the high resolution crystal structure of APE1 (PDB accession code 1 BIX) , was downloaded from the protein data bank (www.pdb.org). The crystal structure was then visualised using Visual Molecular Dynamics 1 .8.6 (VMD1 .8.6). Molecular modelling was
accomplished using Sybyl8.0, a computational tool kit for molecular design and analyses. Sybyl8.0 was used to build inhibitor templates based on three previously reported APE1 inhibitors: lucanthone:, 1 -[[2- (diethylamino)ethyl]amino]-4-methyl-9H-thioxanthen-9-one. In addition, based on the structural features of the active site of APE1 , three new
pharmacophore templates were designed in silico (M1 , M2 and M3). Using these six templates, a shape-based similarity searching strategy using the programme Rapid Overlay of Chemical Structures 2.3 (ROCS 2.3; OpenEye Scientific) was applied to extract pharmacophorically related subsets of compounds from the ZINC database (http://zinc.docking.org/; 2008 version with ca. 2.5 million drug-like compounds). A Tanimoto similarity cut-off was set at 0.75 for all queries with the exception of the template M3, where the cut-off was set at 0.6. Hits from each of the six templates were saved in *.sdf format and subjected to docking against the APE1 active site model. The Docking runs were performed using a UNIX supercomputer system. Briefly, the structures were energy minimised and stored in .mol2 format. Gene Optimisation for Ligand Docking 2.7 (GOLD2.7) was used for calculating the docked poses of chemical structures in the APE1 active site pocket. Predicted ligand poses were ranked on the basis of two fitness scoring functions:
GOLDScore and ChemScore. One hundred docking runs were performed for each ligand.
Fluorescence-based AP site cleavage assay
A fluorescence based AP site cleavage assay was developed. Briefly, APE1 enzyme (80 ng, New England Biolabs)) was incubated in a buffer system comprising of 50 mM Tris-HCI, pH 8.0, 1 mM MgCI2, 50 mM NaCI, 2 mM DTT at 37°C for 10 minutes. 5' F-GCCCCCXGGGGACGTACGATATCCCGCTCC 3' and its complementary oligonucleotide 3' Q-
CGGGGGCCCCCTGCATGCTATAGGGCGAGG 5' were annealed in a buffer containing 100 μΜ Tris-HCI, 50 mM NaCI and 1 μΜ EDTA. AP site cleavage was initiated by addition of the annealed substrate (25 nM) to the reaction mix. Fluorescence readings were taken at 5 minute intervals during a 30 minute incubation at 37°C using an Envision® Multilabel reader from Perkins Elmer with a 495 nM excitation and a 512 nM emission filter. If the DNA is cleaved at the abasic site at position 7 from the 5' end by APE1 , the 6- mer lluorescein-containing molecule can dissociate from its complement by thermal melting. As a result, the quenching effect of the 3' dabcyl labal (which absorbs fluorescein fluorescence when in close proximity) is lost, and APE1 activity can be measured indirectly as an increase in fluorescence signal. Similar assays were developed for monitoring the AP endonuclease activity of endonuclease IV using a buffering system containing 10 mM HEPES-KOH, pH 7.4, 100 mM KCI and 60 ng of endonuclease IV (Trevigen). The final DMSO concentration was maintained at 1 .2% in all assays.
Screening of virtual APE1 inhibitor candidates
APE1 was incubated with the candidate inhibitors at 100 μΜ prior to initiating the AP site cleavage assay described in the previous section. Those candidates that showed complete or more than 90% inhibition of APE1 activity were subjected to serial dilution experiments for IC50 calculations. In addition, counter screening of potential inhibitors (at 100 μΜ concentration) was performed using endonuclease IV cleavage assays.
Fluorescence quenching assay
To investigate the possibility that compounds might possess intrinsic quenching activity, fluorescence quenching assays were performed. Briefly,
the oligonucleotides 5'-F-GCCCCCXGGGGACGTACGATATCCCGCTCC-3' and 3'CGGGGGCCCCCTGCATGCTATAGGGCGAGG-5' were annealed as described previously. The double stranded oligonucleotide (5 nM) was incubated with 100 μΜ of potential APE1 inhibitors in a buffer consisting of 50 μΜ Tris-HCI, Ph 8.0, 1 mM MgCI2, 50 mM NaCI, and 2 mM DTT at 37°C for 30 minutes. Fluorescence intensity was measured every 5minutes. Any hits that showed a decrease of more than 50% in the fluorescence intensity were considered as quenchers. HeLa whole cell extract AP site cleavage assay
HeLa cells, maintained in DMEM with 10% fetal bovine serum and 1 % penicillin-streptomycin, were harvested, washed with PBS, resuspended in cold 222 mM KCI plus protease inhibitors (0.5 mM PMSF, 1 g/mL each of leupepetin and pepstatin A) incubated on ice for 30 min, and clarified by centrifugation at 12,000 x g for 15 min at 4°C . The supernatant (whole cell extract) was retained, the protein concentration determined using the Bio-Rad Bradford reagent, and aliquots were stored at -80°C. AP endonuclease activity assays using radiolabeled oligonucleotide substrates (see above) were performed. In brief, potential APE1 inhibitors identified by the
fluorescence assay were incubated at 100 μΜ concentrations with 30 ng of HeLa whole cell extract at room temperature for 15 min in incision buffer consisting of 50 mM Tris-HCI pH 8, 1 mM MgCI2, 50 mM NaCI, and 2mM DTT. After incubation, 0.5 pmol 32P-radiolabeled tetrahydrofuran-containing 18mer double-stranded DNA was added. Incision reactions were then carried out immediately at 37 °C for 5 min in a final volume of 10 μΙ_, after which the reaction was terminated by the addition of an equal volume of stop buffer (0.05% bromophenol blue and xylene cynol, 20 mM EDTA, 95% formamide) followed by denaturation of samples at 95°C for 10 min. The radiolabeled substrate and product were separated on a standard polyacrylamide denaturing gel and quantified by phosphorimager analysis.
Cell lines and culture media
MeWo melanoma cancer cell line was grown in RPMI culture medium
[supplemented with penicillin 0.06 g/L, streptomycin 0.1 g/L pH 7.0, 10%
foetal bovine serum (FBS, PAA Cell Culture Company). U89MG was grown in DMEM culture medium [supplemented with penicillin 0.06 g/L, streptomycin 0.1 g/L, pH 7.0, 10% foetal bovine serum (FBS, PAA Cell Culture Company). Only cultures with a plating efficiency of over 70% were used for the following analysis.
96 ® AQueous Non-Radioactive Cell Proliferation Assay
To evaluate intrinsic cytotoxicity and to evaluate the potentiation of cytotoxicity of alkylating agents by APE1 inhibitors, CellTiter 96 ® AQueous Non- Radioactive Cell Proliferation Assays (MTS assay) were performed as per manufacturer's recommendation (Promega). Briefly, 2,000 cells per well (in 200 μΙ_ of medium) were seeded into a 96-well plate. For intrinsic cytotoxicity assessments, cells were incubated with varying concentrations of APE1 inhibitors and MTS assay was performed on day 5. For potentiation
experiments, cells were pre-incubated with APE1 inhibitor for 24 hours and then exposed to alkylating agents (temozolomide or MMS) and MTS assay was conducted as described previously
RESULTS
Virtual screening
The publicly available coordinates of the high resolution crystal structure of APE1 (1 BIX) were
downloaded from the protein data bank and the DNA repair domain localised based on the previously reported ten critical amino acid residues that are essential for the AP endonuclease activity of APE1 (D70, D90, E96, Y171 , D210, N212, D219, D283, D308, and H309). The active site of APE1 was well defined and the Mg2+ ion involved in the APE1 catalytic mechanism was observed to occupy the centre of the cleft.
Three new pharmacophore templates (M1 , M2 and M3) were designed and visualised on the APE1 model. The structures were then energy minimised and subjected to docking against the active site of the APE1 model. Predicted ligand poses were ranked on the basis of two fitness scoring functions: GOLDScore and ChemScore. One hundred docking runs were performed for each ligand and the docking programme was set to assign the best fitness score in a total of hundred runs.
Shape-based similarity searching was applied to extract pharmacophorically related subsets of compounds from the ZINC database of commercially available small molecule compounds. A total of 2,533 vrtual hits with similarities to the templates were identified (C= 359, A=371 , L= 485 ,M1 = 373, M2 = 459 , M3=488). The conformations of these compounds were then energy minimised and subjected to docking against the active site of the APE1 model. The top ranking 25% of the compounds with favourable GOLDsScore and ChemScores were shortlisted for further analyses.
Presented below are in silico, biochemical, and cytotoxicity analyses of five representative compounds as described below. 5-Fluoro-1 H-indole-2-carboxylic acid (compound 1 ) belongs to the "CRT0044876 (C)" template (see Figure 2).
The compounds N-(3-benzooxazol-2-yl-4-hydroxy-phenyl)-2-(2- naphthyloxy)acetamide (compound 2), [3-(2-naphthyl)-5-phenyl-2,5- dihydropyrazol-1-yl]carbonylmethyl 5-nitrothiophene-2-carboxylate (compound 3) and N-(4-fluorophenyl)-2-[4-phenylsulfonyl-2-(p-tolyl)oxazol-5-yl]sulfanyl- acetamide (compound 4) belong to the M3 template (see Figure 2) and (9,10- dioxo-1 -anthryl)carbamoyl methyl pentanoate (compound 5) belongs to the "lucanthone (L)" template (see Figure 2).
Biochemical screening (Figure 3)
Compounds 1 -5 were tested in the fluorescence APE1 cleavage assay.
CRT0044876, our previously described inhibitor, was used as a positive control in these studies. The IC50 for APE1 inhibition ranged between 3 μΜ to 26 μΜ. We then counter-screened the compounds against endonuclease IV, an E.coli orthologue of APE1 that perform AP site cleavage in a way similar to APE1 but has a structurally different active site . We found that these compounds had no inhibitory activity against endonuclease IV implying that they are specific to the exonuclease III family of AP endonucleases to which APE1 belongs. We then tested if the compounds possessed any intrinsic fluorescence quenching activity, which was not the case. We next confirmed APE1 inhibition in a radiolabeled oligonucleotide assay. In order to determine potency, the compounds were tested in the HeLa whole cell extract assay. Compounds 1 , 2, and 4 showed significant inhibition of AP site cleavage.
Cytotoxicity analysis
In order to test the biological activity of APE1 inhibitors under physiological conditions, survival analysis was undertaken in MeWo melanoma and U89MG glioma cell lines. Initially compounds were tested for their inherent toxicity.
Whilst compound 1 was non-toxic at up to 100μΜ, the GI50 (cell growth inhibition) ranged between 400 nM and 50 μΜ for other APE1 inhibitors. We then investigated if our newly identified inhibitors at relatively non-toxic concentrations would potentiate the cytotoxicity of MMS. Compound 4 (at 20 μΜ)
significantly potentiated the cytotoxicity of MMS in the MeWo melanoma cell line. Similar results were also observed in the U89MG glioma cell line.
Example 2
The compounds summarised in Figure 2 were prepared in accordance with the methods summarised above. Their specificity for the inhibition of AP
endonuclease was tested and is detailed in Figure 3.
While the present invention has been illustrated by the description of one or more embodiments thereof, and while the embodiments have been described in considerable detail, they are not intended to restrict or in any way limit the scope of the appended claims to such detail. Additional advantages and modifications will readily appear to those skilled in the art. The invention in its broader aspects is therefore not limited to the specific details, representative apparatus and method and illustrative examples shown and described. Accordingly, departures may be made from such details without departing from the scope or spirit of the general inventive concept.
Claims
Formula 3
Formula 8
Formula 14
Formula 16
Formula 18 or a pharmaceutically acceptable salt thereof; wherein Ar, Ar1 , Ar2, Ar3 are each independently aryl or heteroaryl groups which may be substituted or unsubstituted with one or more R9 group; wherein X1 and X2 are each independently alkyl or heteroalkyi groups; wherein Z is S or NH; wherein R, R1 , R2, R3, R4, R5, R6, R7, R8, R9 and R10 are each independently H, alkyl, heteroalkyi, aryl, heteroaryl and combinations of two or more thereof or R1 1 , R1 1 being selected from 0-, N-, NH-, CO, COO, CON, CONH, SO2, SO2N and SO2NH group linking one or more alkyl, heteroalkyi, aryl or heteroaryl group; and wherein alkyl, heteroalkyl, aryl and heteroaryl groups may be substituted or unsubstituted,
2. A compound according to claim 1 for use in a method for treatment of the human or animal body by therapy.
3. A compound according to claim 1 for use in a method of treating cancer.
4. A compound according to claim 1 for use in a method for increasing the cytotoxicity of a chemotherapeutic agent comprising the steps of administering the chemotherapeutic agent and said compound.
5. A compound according to claim 4 wherein said compound is administered concomitantly or sequentially to the chemotherapeutic agent.
6. A compound according to claim 1 for use in a method of treating cancer wherein said compound is administered in combination with a treatment comprising the use of ionizing radiation.
7. A pharmaceutical composition comprising at least one compound according to claim 1 and one or more diluents, carriers or excipients.
8. The composition according to claim 7 further comprising a
chemotherapeutic agent which does not fall into the scope of Formulae 1 to 18.
9. The composition according to claim 8 or the compound according to claim 4 wherein the the chemotherapeutic agents in use damages cancer cell DNA, preferably through alkylation, oxidation or ring saturation.
10. The composition according to claim 8 or the compound according to claim 4 wherein the chemotherapeutic agent is selected from the group consisting of alkylating agents, including temozolomide and dacarbazine; bleomycin;
gencitabine; 5-fluorouracil and analogues; platinum compounds, such as cisplatin, oxaliplatin and carboplati; and 6-Thioguanine.
1 1 . The compound according to claim 4 or 5 or composition according to claim 8 to 10 wherein said compound and said chemotherapeutic agent are in a single dosage form or multiple dosage form.
12. The composition according to any of claims 7 to 1 1 in the form of a tablet, a capsule, a solution, a suspension, an elixir or any other standard
pharmaceutical preparation.
13. The composition according to any of claim 7 to 12 for use in a method for treatment of the human or animal body by therapy.
14. The composition according to any of claim 7 to 12 for use in a method of treating cancer.
15. The compound according to claim 3 or composition according to claim 14 wherein said cancer comprises an aberrant expression of APE1 , typically an elevated expression of APE1.
16. The compound according to claim 3 or 15 or composition according to claim 14 or wherein said cancer is selected from the group consisting of breast cancer; lung cancer, in particular non-small cell lung cancer; bone cancer; head- and-neck cancer; ovarian cancer; pancreatic cancer; gastro-oesophageal cancer; melanoma; and brain cancer.
17. The compound according to claim 1 or composition according to claim 7 to 12 for use in the treatment of homologous recombination repair deficit; including BRCA-deficient breast and ovarian tumours.
18. A method for treating cancer in a patient comprising the step of administering a therapeutically effective amount of a compound according to claim 1.
19. A compound, composition or method according to any preceding claim wherein alkyl, heteroalkyi, aryl and heteroaryl groups are substituted with one or more halgeno, NH2, N02, CN, OH, COOH, CONH2, C(=NH)NH2, SO3H, SO2NH2, SO2CH3, OCH3 or CF3 group;
20. A compound, composition or method according to any preceding claim wherein two of R1 to R1 1 may be linked to form a cyclic group, such as a cycloalkyi, cycloheteroalkyi, polycyclic, cyclic ketone, cyclic ketone, cyclic alcohol, cyclic ester and cyclic ether group.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GB1020397.4 | 2010-12-02 | ||
| GBGB1020397.4A GB201020397D0 (en) | 2010-12-02 | 2010-12-02 | Compounds |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2012073041A2 true WO2012073041A2 (en) | 2012-06-07 |
| WO2012073041A3 WO2012073041A3 (en) | 2013-02-07 |
Family
ID=43500964
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB2011/052386 Ceased WO2012073041A2 (en) | 2010-12-02 | 2011-12-02 | Compounds |
Country Status (2)
| Country | Link |
|---|---|
| GB (1) | GB201020397D0 (en) |
| WO (1) | WO2012073041A2 (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104230897A (en) * | 2013-06-17 | 2014-12-24 | 上海汇伦生命科技有限公司 | Benzimidazole-2-piperazine heterocyclic compounds as well as pharmaceutical compositions, preparation methods and applications of benzimidazole-2-piperazine heterocyclic compounds |
| CN104230898A (en) * | 2013-06-17 | 2014-12-24 | 上海汇伦生命科技有限公司 | Benzimidazole-2-piperazine heterocyclic compounds as well as pharmaceutical composition, preparation method and application of benzimidazole-2-piperazine heterocyclic compounds |
| JP2021528368A (en) * | 2018-05-10 | 2021-10-21 | ユニヴァーシティー・オブ・ルイスヴィル・リサーチ・ファウンデイション・インコーポレーテッド | Inhibitor of RAS neoplastic protein, its preparation method and its usage method |
| US11351130B2 (en) | 2017-04-17 | 2022-06-07 | Indiana University Research And Technology Corporation | Prevention and reversal of inflammation induced DNA damage |
| US20220204484A1 (en) * | 2017-06-30 | 2022-06-30 | University Of Pittsburgh - Of The Commonwealth System Of Higher Education | Chemical inhibition of the e3 ligase subunit fbxo7 confers neuroprotection and anti-inflammatory activity by stabilizing mitochondria |
| CN116535366A (en) * | 2023-03-20 | 2023-08-04 | 广州医科大学 | Thiazole compound and preparation method and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2002317377A1 (en) * | 2001-07-20 | 2003-03-03 | Cancer Research Technology Limited | Biphenyl apurinic/apyrimidinic site endonuclease inhibitors to treat cancer |
-
2010
- 2010-12-02 GB GBGB1020397.4A patent/GB201020397D0/en not_active Ceased
-
2011
- 2011-12-02 WO PCT/GB2011/052386 patent/WO2012073041A2/en not_active Ceased
Non-Patent Citations (1)
| Title |
|---|
| None |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104230897A (en) * | 2013-06-17 | 2014-12-24 | 上海汇伦生命科技有限公司 | Benzimidazole-2-piperazine heterocyclic compounds as well as pharmaceutical compositions, preparation methods and applications of benzimidazole-2-piperazine heterocyclic compounds |
| CN104230898A (en) * | 2013-06-17 | 2014-12-24 | 上海汇伦生命科技有限公司 | Benzimidazole-2-piperazine heterocyclic compounds as well as pharmaceutical composition, preparation method and application of benzimidazole-2-piperazine heterocyclic compounds |
| US11351130B2 (en) | 2017-04-17 | 2022-06-07 | Indiana University Research And Technology Corporation | Prevention and reversal of inflammation induced DNA damage |
| US20220204484A1 (en) * | 2017-06-30 | 2022-06-30 | University Of Pittsburgh - Of The Commonwealth System Of Higher Education | Chemical inhibition of the e3 ligase subunit fbxo7 confers neuroprotection and anti-inflammatory activity by stabilizing mitochondria |
| US12398123B2 (en) * | 2017-06-30 | 2025-08-26 | University of Pittsburgh—of the Commonwealth System of Higher Education | Chemical inhibition of the E3 ligase subunit FBXO7 confers neuroprotection and anti-inflammatory activity by stabilizing mitochondria |
| JP2021528368A (en) * | 2018-05-10 | 2021-10-21 | ユニヴァーシティー・オブ・ルイスヴィル・リサーチ・ファウンデイション・インコーポレーテッド | Inhibitor of RAS neoplastic protein, its preparation method and its usage method |
| JP2024056937A (en) * | 2018-05-10 | 2024-04-23 | ユニヴァーシティー・オブ・ルイスヴィル・リサーチ・ファウンデイション・インコーポレーテッド | Inhibitors of RAS oncoproteins, methods for making and using same - Patents.com |
| US12582660B2 (en) | 2018-05-10 | 2026-03-24 | University Of Louisville Research Foundation, Inc. | Inhibitors of the RAS oncoprotein, methods of making and methods of use thereof |
| CN116535366A (en) * | 2023-03-20 | 2023-08-04 | 广州医科大学 | Thiazole compound and preparation method and application thereof |
| CN116535366B (en) * | 2023-03-20 | 2023-12-05 | 广州医科大学 | A kind of thiazole compound and its preparation method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| GB201020397D0 (en) | 2011-01-12 |
| WO2012073041A3 (en) | 2013-02-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Eissa et al. | Discovery and antiproliferative evaluation of new quinoxalines as potential DNA intercalators and topoisomerase II inhibitors | |
| Al-Ghorbani et al. | Piperazine and morpholine: Synthetic preview and pharmaceutical applications | |
| US8084454B2 (en) | Compounds with anti-cancer activity | |
| Wei et al. | Development and application of indolines in pharmaceuticals | |
| WO2012073041A2 (en) | Compounds | |
| EP1792613A2 (en) | Dicationic compounds which selectively recognize G-quadruplex DNA | |
| Mahale et al. | Biphenyl-4-carboxylic acid [2-(1 H-Indol-3-yl)-ethyl]-methylamide (CA224), a nonplanar analogue of fascaplysin, inhibits cdk4 and tubulin polymerization: evaluation of in vitro and in vivo anticancer activity | |
| CN104363913A (en) | CDK8/CDK19 selective inhibitors and their use in anti-metastatic and chemopreventative methods for cancer | |
| US10912761B2 (en) | Methods and compositions involving RAD51 inhibitors | |
| IL262325A (en) | Combinations for the treatment of neoplasms using quiescent cell targeting and inhibitors of mitosis | |
| Rabal et al. | Design and synthesis of novel epigenetic inhibitors targeting histone deacetylases, DNA methyltransferase 1, and lysine methyltransferase G9a with in vivo efficacy in multiple myeloma | |
| Durgun et al. | Synthesis, characterization, in vitro cytotoxicity and antimicrobial investigation and evaluation of physicochemical properties of novel 4-(2-methylacetamide) benzenesulfonamide derivatives | |
| JP6155026B2 (en) | Novel compounds for the inhibition of protein kinases and their therapeutic use | |
| Sadeghpour et al. | 4-Aminocoumarin derivatives: synthesis and applications | |
| Gupta et al. | Bacterial cell death to overcome drug resistance with multitargeting bis-naphthalimides as potent antibacterial agents against Enterococcus faecalis | |
| US20150087886A1 (en) | Novel bifunctional metnase/intnase inhibitors and related compositions and methods of treatment of cancer | |
| Yu et al. | Design, synthesis and antitumor activity of 4-aminoquinazoline derivatives targeting VEGFR-2 tyrosine kinase | |
| EP4204097A1 (en) | Methods of treating cancer | |
| EP3833352A2 (en) | Non-polyamine based polyamine transport inhibitors and their use in the treatment of human cancers | |
| Verma et al. | Design, Synthesis, Antimicrobial, and Antimalarial Evaluation of Quinoline Hydrazone Derivatives: Insight through Density Functional Theory Analysis, Molecular Docking, and Absorption, Distribution, Metabolism, Excretion, and Toxicity Predictions | |
| CN111454278B (en) | PAK1 inhibitor and its synthesis and application in the preparation of antitumor drugs | |
| TWI406853B (en) | Dual inhibitors of egfr and vegfr-2 and uses and production processes thereof | |
| Das et al. | 9-fluorenone-based synthetic sulfonamide compounds as dual inhibitors of SARS-CoV-2 Main-Protease and Papain-like Protease | |
| KANTHETI et al. | SYNTHESIS OF 1-(3, 4-BIS (BENZYLOXY) PHENYL)-2-(4 (SUBSTITUTEDSULFONYL) PIPERAZIN-1-YL) ETHANONES: MOLECULAR DOCKING AND ANTIBACTERIAL PROPERTIES | |
| Abdelmonsef et al. | Vanillin-tethered quinazolin-2, 4-dione analogues through five-and/or six-membered nitrogen-containing heterocycles as antibacterial agents: synthesis, biological evaluation and molecular docking study |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11804747 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 11804747 Country of ref document: EP Kind code of ref document: A2 |








































