WO2012068310A2

WO2012068310A2 - Compositions and methods for improved saccharification of genetically modified plant-derived biomass

Info

Publication number: WO2012068310A2
Application number: PCT/US2011/061079
Authority: WO
Inventors: Kevin Gray
Original assignee: Qteros, Inc.
Priority date: 2010-11-16
Filing date: 2011-11-16
Publication date: 2012-05-24
Also published as: WO2012068310A3

Abstract

Compositions and methods are provided for enhancing saccharification of biomass derived from a genetically modified plant with one or more enzymes to enhance availability of substrates for fermentation by a microorganism. Microorganisms are also modified to enhance activity of one or more hydrolytic enzymes that are present endogenously in or are introduced heterologously into a host microorganism.

Description

COMPOSITIONS AND METHODS FOR IMPROVED SACCHARIFICATION OF

GENETICALLY MODIFIED PLANT-DERIVED BIOMASS

CROSS-REFERENCE

[0001] This application claims the benefit of U.S. Provisional Application No. 61/414,297, filed November 16, 2010, which application is incorporated herein by reference in its entirety.

BACKGROUND OF THE INVENTION

[0002] Biomass is a renewable source of energy, which can be biologically fermented to produce an end- product such as a fuel (e.g. alcohol, ethanol, organic acid, acetic acid, lactic acid, methane, or hydrogen). Biomass includes agricultural residues (corn stalks, grass, straw, grain hulls, bagasse, etc.), animal waste (manure from cattle, poultry, and hogs), woody materials (wood or bark, sawdust, timber slash, and mill scrap), municipal waste (waste paper, recycled toilet papers, yard clippings, etc.), and energy crops (poplars, willows, switch grass, alfalfa, prairie bluestem, algae etc.). Lignocellulosic biomass has cellulose and hemicellulose as two major components. To obtain a high fermentation efficiency of lignocellulosic biomass to end-product (yield) it is important to provide an appropriate fermentation environment to enhance end-product yield. More complete saccharification of biomass and fermentation of the saccharification products results in higher fuel yields.

[0003] Unfortunately, many organisms used for fermentation of carbonaceous substrates cannot saccharify polysaccharides into monosaccharides. Progress in bioproduct fermentation has been hampered by lack of suitable microorganisms that can effectively hydrolyze and metabolize all of the sugars present in a biomass. This can increase the cost of fermentation if hydrolysis is accomplished by the addition of expensive mixtures of enzymes that can hydrolyze five and six carbon polysaccharides. There is considerable need for organisms that can efficiently utilize polysaccharides such as cellulose and hemicellulose with little or no enzyme addition during fermentation.

[0004] Transgenic technologies have opened possibilities of modifying the agronomic performance of plant and algal biomass for improved industrial processing. Combining modified biomass having more efficient and complementary saccharification and fermentation characteristics with microorganisms that ferment polysaccharides can result in more economical production of biofuels and other chemicals.

SUMMARY OF THE INVENTION

[0005] Disclosed herein are processes for producing one or more fermentation end-products comprising: a. contacting a biomass derived from a genetically modified plant or algae comprising one or more genetic modifications with one or more microorganisms, wherein at least one of said microorganisms can hydrolyze and/or ferment said biomass; and b. allowing sufficient time for said microorganisms to hydrolyze and/or ferment said biomass to produce said fermentation end-products. Also disclosed herein are processes for producing one or more fermentation end-products comprising: a. contacting a biomass derived from a genetically modified plant or algae comprising one or more genetic modifications with: i. one or more microorganisms, wherein at least one of said microorganisms can hydro lyze and/or ferment said biomass; and ii. an external source of one or more enzymes that are capable of enhancing said hydrolysis; and b. allowing sufficient time for said microorganisms to hydrolyze and/or ferment said biomass to produce said fermentation end-products. In some embodiments, said genetically modified plant or algae is genetically modified kelp, seaweed, microalgae, macroalgae, maize, wheat, rice, barley, soybean, cotton, sorghum, sweet sorghum, oats, tobacco, miscanthus, switchgrass, alfalfa, rye, sugarcane, sugar beet, corn, or byproducts thereof. In some embodiments, said genetically modified plant is a genetically modified switchgrass, sorghum, miscanthus, sugarcane, corn, or byproducts thereof. In some embodiments, at least one of said genetic modifications results in altered expression and/or activity of proteins involved in cell wall degradation. In some embodiments, at least one of said genetic

modifications comprises a heterologous polynucleotide than encodes for one or more heterologous polysaccharide-degrading enzymes. In some embodiments, said polysaccharide-degrading enzymes comprise an amylase, protease, pullulanase, isoamylase, cellulase, hemicellulase, xylanase, cyclodextrin glycotransferase, lipase, phytase, laccase, oxidase, peroxidase, esterase, cutinase, pectinase,

glucuronidase, amyloglucosidase, glucoamylase, starch debranching enzyme, glucanase, glucosidase, arabinases, arabinosidase, galactanase, galactanase, galactosidase, mannanase, mannosidase, xylosidase, fucosidase, rhamnosidase, levanase, inulanase, or a combination thereof. In some embodiments, said enzymes comprise a cellulase or a hemicellulase. In some embodiments, at least one of said genetic modifications enables said genetically modified plant or algae to grow faster than an unmodified plant or algae of the same species. In some embodiments, at least one of said genetic modifications enables said genetically modified plant or algae to grow larger than an unmodified plant or algae of the same species. In some embodiments, at least one of said genetic modifications enables said genetically modified plant to grow a larger root structure than an unmodified plant of the same species. In some embodiments, at least one of said genetic modifications alters the chemical composition of said genetically modified plant or algae in comparison to an unmodified plant or algae of the same species. In some embodiments, said genetically modified plant or algae comprises more cellulose per gram of mass than the unmodified plant or algae. In some embodiments, said genetically modified plant or algae comprises more hemicellulose per gram of mass than the unmodified plant or algae. In some embodiments, said genetically modified plant or algae comprises less lignin per gram of mass than the unmodified plant or algae. In some embodiments, at least one of said genetic modifications increases said genetically modified plant or algae's resistance to a stress in comparison to an unmodified plant or algae of the same species. In some embodiments, said stress is dehydration. In some embodiments, said stress is heat. In some embodiments, said stress is cold. In some embodiments, said microorganisms comprise one or more bacteria, one or more yeasts, one or more non-yeast fungi, or a combination thereof. In some embodiments, at least one of said microorganisms is a mesophile. In some embodiments, at least one of said microorganisms is capable of fermentation of C5 and C6 carbohydrates. In some embodiments, at least one of said microorganisms can hydrolyze and ferment hemicellulosic or lignocellulosic material. In some embodiments, at least one of said microorganisms is genetically modified to have altered expression of one or more hydrolase enzymes. In some embodiments, said one or more hydrolase enzymes comprise an enzyme that catalyzes the hydrolysis of an oligomeric sugar target. In some embodiments, at least one of said microorganisms can hydrolyze and ferment hexose and pentose oligosaccharides. In some embodiments, at least one of said microorganisms is a Clostridium strain. In some embodiments, said Clostridium strain is Clostridium phytofermentans , Clostridium sp. Q.D, Clostridium algidixylanolyticum, Clostridium xylanolyticum, Clostridium cellulovorans, Clostridium cellulolyticum, Clostridium thermocellum, Clostridium josui, Clostridium papyrosolvens, Clostridium cellobioparum, Clostridium hungatei, Clostridium cellulosi, Clostridium stercorarium, Clostridium termitidis, Clostridium thermocopriae, Clostridium

celerecrescens, Clostridium polysaccharolyticum, Clostridium populeti, Clostridium lentocellum, Clostridium chartatabidum, Clostridium aldrichii, Clostridium herbivorans, or a variant thereof. In some embodiments, said Clostridium strain is Clostridium phytofermentans, Clostridium sp. Q.D, or a variant thereof. In some embodiments, said fermentation end-products comprise one or more alcohols, one or more organic acids, one or more carbonyl compounds, one or more saccharides, or a combination thereof. In some embodiments, said fermentation end-products comprise one or more alcohols. In some embodiments, said fermentation end-products comprise ethanol, methanol, butanol, propanol, or a combination thereof. In some embodiments, at least one of said fermentation end-products is ethanol.

[0006] Also disclosed herein are systems for producing one or more fermentation end-products comprising: a. a biomass derived from a genetically modified plant or algae that comprises one or more genetic modifications; b. one or more microorganisms, wherein at least one of said microorganisms can hydrolyze and/or ferment said biomass; and c. a vessel. In one embodiment, the system further comprises an external source of one or more enzymes that is capable of enhancing said hydrolysis. In one embodiment, said genetically modified plant or algae is genetically modified kelp, seaweed, microalgae, macroalgae, maize, wheat, rice, barley, soybean, cotton, sorghum, sweet sorghum, oats, tobacco, miscanthus, switchgrass, alfalfa, rye, sugarcane, sugar beet, corn, or byproducts thereof. In one embodiment, said genetically modified plant is a genetically modified switchgrass, sorghum, miscanthus, sugarcane, or corn, or byproducts thereof. In one embodiment, at least one of said genetic modifications results in altered expression and/or activity of proteins involved in cell wall degradation. In one embodiment, at least one of said genetic modifications comprises a heterologous polynucleotide than encodes for one or more heterologous polysaccharide-degrading enzymes. In one embodiment, said polysaccharide-degrading enzymes comprise an amylase, protease, pullulanase, isoamylase, cellulase, hemicellulase, xylanase, cyclodextrin glycotransferase, lipase, phytase, laccase, oxidase, peroxidase, esterase, cutinase, pectinase, glucuronidase, amyloglucosidase, glucoamylase, starch debranching enzyme, glucanase, glucosidase, arabinases, arabinosidase, galactanase, galactanase, galactosidase, mannanase, mannosidase, xylosidase, fucosidase, rhamnosidase, levanase, inulanase, or a combination thereof. In one embodiment, said enzymes comprise a cellulase or a hemicellulase. In one embodiment, at least one of said genetic modifications enables said genetically modified plant or algae to grow faster than an unmodified plant or algae of the same species. In one embodiment, at least one of said genetic modifications enables said genetically modified plant or algae to grow larger than an unmodified plant or algae of the same species. In one embodiment, at least one of said genetic modifications enables said genetically modified plant to grow a larger root structure than an unmodified plant of the same species. In one embodiment, at least one of said genetic modifications alters the chemical composition of said genetically modified plant or algae in comparison to an unmodified plant or algae of the same species. In one embodiment, said genetically modified plant or algae comprises more cellulose per gram of mass than the unmodified plant or algae. In one embodiment, said genetically modified plant or algae comprises more hemicellulose per gram of mass than the unmodified plant or algae. In one embodiment, said genetically modified plant or algae comprises less lignin per gram of mass than the unmodified plant or algae. In one embodiment, at least one of said genetic modifications increases said genetically modified plant or algae's resistance to a stress in comparison to an unmodified plant or algae of the same species. In one embodiment, said stress is dehydration. In one embodiment, said stress is heat. In one embodiment, said stress is cold In one embodiment, said microorganisms comprise one or more bacteria, one or more yeasts, one or more non-yeast fungi, or a combination thereof. In one embodiment, at least one of said microorganisms is a mesophile. In one embodiment, at least one of said microorganisms is capable of fermentation of C5 and C6 carbohydrates. In one embodiment, at least one of said

microorganisms can hydrolyze and ferment hemicellulosic or lignocellulosic material In one embodiment, at least one of said microorganisms is genetically modified to have altered expression of one or more hydrolase enzymes. In one embodiment, said one or more hydrolase enzymes comprise an enzyme that catalyzes the hydrolysis of an oligomeric sugar target. In one embodiment, one of said microorganisms can hydrolyze and ferment hexose and pentose oligosaccharides. In one embodiment, at least one of said microorganisms is a Clostridium strain. In one embodiment, said Clostridium strain is Clostridium phytofermentans , Clostridium sp. Q.D, Clostridium algidixylanolyticum, Clostridium xylanolyticum, Clostridium cellulovorans, Clostridium cellulolyticum, Clostridium thermocellum, Clostridium josui, Clostridium papyrosolvens, Clostridium cellobioparum, Clostridium hungatei, Clostridium cellulosi, Clostridium stercorarium, Clostridium termitidis, Clostridium thermocopriae, Clostridium

celerecrescens, Clostridium polysaccharolyticum, Clostridium populeti, Clostridium lentocellum, Clostridium chartatabidum, Clostridium aldrichii, Clostridium herbivorans, or a variant thereof. In one embodiment, said Clostridium strain is Clostridium phytofermentans, Clostridium sp. Q.D, or a variant thereof. In one embodiment, said fermentation end-products comprise one or more alcohols, one or more organic acids, one or more carbonyl compounds, one or more saccharides, or a combination thereof. In one embodiment, said fermentation end-products comprise one or more alcohols. In one embodiment, said fermentation end-products comprise ethanol, methanol, butanol, propanol, or a combination thereof. In one embodiment, at least one of said fermentation end-products is ethanol. [0007] Also disclosed herein are processes for producing one or more fermentation end-products comprising: a. contacting a biomass derived from a genetically modified plant or algae comprising one or more genetic modifications with a Clostridium species that can hydro lyze and/or ferment hemicellulosic or lignocellulosic material; and b. allowing sufficient time for said Clostridium species hydrolyze and/or ferment said biomass to produce said fermentation end-products, wherein said fermentation end-products comprise one or more alcohols. In one embodiment, the process further comprises an external source of one or more enzymes that is capable of enhancing said hydrolysis. In one embodiment, the process further comprises one or more other other microorganisms, wherein said other microorganisms comprise yeast, non-yeast fungi, or bacteria different than said Clostridium species. In one embodiment, said Clostridium species is Clostridium phytofermentans, Clostridium sp Q.D, or a variant thereof. In one embodiment, said genetically modified plant or algae is genetically modified kelp, seaweed, microalgae, macroalgae, maize, wheat, rice, barley, soybean, cotton, sorghum, sweet sorghum, oats, tobacco, miscanthus, switchgrass, alfalfa, rye, sugarcane, sugar beet, corn, or byproducts thereof. In one embodiment, said genetically modified plant is a genetically modified switchgrass, sorghum, miscanthus, sugarcane, corn, or byproducts thereof. In one embodiment, at least one of said genetic modifications results in altered expression and/or activity of proteins involved in cell wall degradation. In one embodiment, at least one of said genetic modifications comprises a heterologous polynucleotide than encodes for one or more heterologous polysaccharide-degrading enzymes. In one embodiment, said polysaccharide-degrading enzymes comprise an amylase, protease, pullulanase, isoamylase, cellulase, hemicellulase, xylanase, cyclodextrin glycotransferase, lipase, phytase, laccase, oxidase, peroxidase, esterase, cutinase, pectinase, glucuronidase, amyloglucosidase, glucoamylase, starch debranching enzyme, glucanase, glucosidase, arabinases, arabinosidase, galactanase, galactanase, galactosidase, mannanase, mannosidase, xylosidase, fucosidase, rhamnosidase, levanase, inulanase, or a combination thereof. In one embodiment, said enzymes comprise a cellulase or a hemicellulase. In one embodiment, said alcohols comprise ethanol.

[0008] Disclosed herein are processes for producing ethanol comprising: a. providing a genetically modified biomass derived from a genetically modified plant or algae wherein said genetically modified plant or algae comprises a heterologous polynucleotide that encodes for one or more heterologous polysaccharide degrading enzymes; b. contacting said genetically modified biomass with Clostridium phytofermentans, Clostridium sp Q.D, or a variant thereof; and, c. allowing sufficient time for said Clostridium phytofermentans, Clostridium sp Q.D, or a variant thereof to hydrolyze and/or ferement said genetically modified biomass to produce said ethanol. In one embodiment, the process further comprises an external source of one or more enzymes that is capable of enhancing said hydrolysis. In one embodiment, the process further comprises one or more other microorganisms, wherein said other microorganisms comprise yeast, non-yeast fungi, or bacteria different than said Clostridium

phytofermentans, Clostridium sp Q.D, or a variant thereof. In one embodiment, said genetically modified plant or algae is genetically modified kelp, seaweed, microalgae, macroalgae, maize, wheat, rice, barley, soybean, cotton, sorghum, sweet sorghum, oats, tobacco, miscanthus, switchgrass, alfalfa, rye, sugarcane, sugar beet, corn, or byproducts thereof. In one embodiment, said genetically modified plant is a genetically modified switchgrass, sorghum, miscanthus, sugarcane, corn, or byproducts thereof. In one embodiment, said polysaccharide-degrading enzymes comprise an amylase, protease, pullulanase, isoamylase, cellulase, hemicellulase, xylanase, cyclodextrin glycotransferase, lipase, phytase, laccase, oxidase, peroxidase, esterase, cutinase, pectinase, glucuronidase, amyloglucosidase, glucoamylase, starch debranching enzyme, glucanase, glucosidase, arabinases, arabinosidase, galactanase, galactanase, galactosidase, mannanase, mannosidase, xylosidase, fucosidase, rhamnosidase, levanase, inulanase, or a combination thereof. In one embodiment, said enzymes comprise a cellulase or a hemicellulase.

BRIEF DESCRIPTION OF THE DRAWINGS

[0009] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are used, and the accompanying drawings of which:

[0010] Figures 1A-1B illustrates ethanol production from corn stover utilizing a cocktail mix (A) and individual enzyme(s) components of the cocktail mix (B).

[0011] Figure 2 illustrates saccharification yield.

[0012] Figure 3 illustrates ethanol production from corn stover utilizing a cocktail mix (A) and individual enzyme(s) components of the cocktail mix (B).

[0013] Figure 4 illustrates a hydrolysis plot showing C. phytofermentans (Q) saccharification.

[0014] Figure 5 illustrates enzyme-assisted fermentation of corn stover.

[0015] Figure 6 illustrates a pathway map for cellulose hydrolysis and fermentation.

[0016] Figure 7 illustrates a plasmid map for pIMPl .

[0017] Figure 8 illustrates a plasmid map for pIMCphy.

[0018] Figure 9 illustrates a plasmid map for pCphyP3510.

[0019] Figure 10 illustrates CMC-congo red plate and Cellazyme Y assays.

[0020] Figure 11 illustrates a plasmid map for pCphyP3510-l 163.

[0021] Figure 12 illustrates the nucleic acid sequence of Cphy l 163 and relevant primers.

[0022] Figure 13 illustrates the nucleic acid sequence of Cphy_3367 and relevant primers.

[0023] Figure 14 illustrates the nucleic acid sequence of Cphy_3368 and relevant primers.

[0024] Figure 15 illustrates the nucleic acid sequence of Cphy_3202 and relevant primers.

[0025] Figure 16 depicts the nucleic acid sequence of Cphy_2058 and relevant primers.

[0026] Figure 17 depicts the nucleic acid sequences of Cphy_3289 and Cphy_3290 and relevant primers.

[0027] Figure 18 depicts the amino acid sequence of Cphy l 163.

[0028] Figure 19 illustrates the amino acid sequence of Cphy_3367.

[0029] Figure 20 illustrates the amino acid sequence of Cphy_3368. [0030] Figure 21 illustrates the amino acid sequence of Cphy_3202.

[0031] Figure 22 illustrates the amino acid sequence of Cphy_2058.

[0032] Figure 23 illustrates the amino acid sequence of Cphy l 100.

[0033] Figure 24 illustrates the amino acid sequence of Cphy_1510.

[0034] Figure 25 illustrates the amino acid sequence of Cphy_2128.

[0035] Figure 26 illustrates the amino acid sequence of Cphy_3289 chaperonin GroEL.

[0036] Figure 27 illustrates the amino acid sequence of Cphy_3290 chaperonin GroES.

[0037] Figure 28 illustrates the nucleic acid sequence of Cphy_3510.

[0038] Figure 29 depicts a method for producing fermentation end-products from biomass by first treating biomass with an acid at elevated temperature and pressure in a hydrolysis unit.

[0039] Figure 30 depicts a method for producing fermentation end-products from biomass by charging biomass to a fermentation vessel.

[0040] Figure 31 discloses pretreatments that produce hexose or pentose saccharides or oligomers that are then unprocessed or processed further and either, fermented separately or together.

INCORPORATION BY REFERENCE

[0041] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

DETAILED DESCRIPTION OF THE INVENTION

[0042] The following description and examples illustrate embodiments of the present invention in detail. Generally, methods and compositions directed to saccharification and fermentation of various biomass substrates to one or more fermentive products are disclosed.

[0043] Unless characterized differently, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0044] Definitions

[0045] The term "enzyme reactive conditions" as used herein, refers to an environmental condition (e.g., such factors as temperature, pH, lack of inhibiting substances) which will permit the enzyme to function. Enzyme reactive conditions can be either in vitro, such as in a test tube, or in vivo, such as within a cell.

[0046] The term "about" as used herein, refers to a range that is 15% plus or minus from a stated numerical value within the context of the particular usage. For example, about 10 would include a range from 8.5 to 11.5.

[0047] The terms "function" and "functional" as used herein refer to biological or enzymatic function.

[0048] The term "gene" as used herein, refers to a unit of inheritance that occupies a specific locus on a chromosome and consists of transcriptional and/or translational regulatory sequences and/or a coding region and/or non-translated sequences (e.g., introns, 5' and 3' untranslated sequences). The term "host cell" includes an individual cell or cell culture which can be or has been a recipient of any recombinant vector(s) or isolated polynucleotide. Host cells include progeny of a single host cell, and the progeny can not necessarily be completely identical (in morphology or in total DNA complement) to the original parent cell due to natural, accidental, or deliberate mutation and/or change. A host cell includes cells transfected, transformed, or infected in vivo or in vitro with a recombinant vector or a polynucleotide. A host cell which comprises a recombinant vector is a recombinant host cell, recombinant cell, or recombinant microorganism.

[0049] The term "isolated" as used herein, refers to material that is substantially or essentially free from components that normally accompany it in its native state. For example, an "isolated polynucleotide", as used herein, refers to a polynucleotide, which has been purified from the sequences which flank it in a naturally- occurring state, e.g., a DNA fragment which has been removed from the sequences that are normally adjacent to the fragment. Alternatively, an "isolated peptide" or an "isolated polypeptide" and the like, as used herein, refer to in vitro isolation and/or purification of a peptide or polypeptide molecule from its natural cellular environment, and from association with other components of the cell, e.g., it is not associated with in vivo substances.

[0050] The term "increased" or "increasing" as used herein, refers to the ability of one or more recombinant microorganisms to produce a greater amount of a given product or molecule {e.g., commodity chemical, biofuel, or intermediate product thereof) as compared to a control microorganism, such as an unmodified microorganism or a differently-modified microorganism. An "increased" amount is typically a "statistically significant" amount, and can include an increase that is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30 or more times (including all integers and decimal points in between, e.g., 1.5, 1.6, 1.7. 1.8, etc.) the amount produced by an unmodified microorganism or a differently modified microorganism.

[0051] The term "operably linked" as used herein means placing a gene under the regulatory control of a promoter, which then controls the transcription and optionally the translation of the gene. In one example for the construction of promoter/structural gene combinations, the genetic sequence or promoter is positioned at a distance from the gene transcription start site that is approximately the same as the distance between that genetic sequence or promoter and the gene it controls in its natural setting; e.g. the gene from which the genetic sequence or promoter is derived. As is known in the art, some variation in this distance can be accommodated without loss of function. Similarly, a regulatory sequence element can be positioned with respect to a gene to be placed under its control in the same position as the element is situated in its in its natural setting with respect to the native gene it controls.

[0052] The term "Constitutive promoter" refers to a polynucleotide sequence that induces transcription or is typically active, {e.g., promotes transcription), under most conditions, such as those that occur in a host cell. A constitutive promoter is generally active in a host cell through a variety of different environmental conditions.

[0053] The term "Inducible promoter" refers to a polynucleotide sequence that induces transcription or is typically active only under certain conditions, such as in the presence of a specific transcription factor or transcription factor complex, a given molecule factor (e.g., IPTG) or a given environmental condition (e.g., CO₂ concentration, nutrient levels, light, heat). In the absence of that condition, inducible promoters typically do not allow significant or measurable levels of transcriptional activity.

[0054] The terms "polynucleotide" or "nucleic acid" as used herein designates mRNA, RNA, cRNA, rRNA, cDNA or DNA. The term typically refers to polymeric form of nucleotides of at least 10 bases in length, either ribonucleotides or deoxynucleotides or a modified form of either type of nucleotide. The term includes single and double stranded forms of DNA.

[0055] As will be understood by those skilled in the art, a polynucleotide sequence can include genomic sequences, extra-genomic and plasmid-encoded sequences and smaller engineered gene segments that express, or can be adapted to express, proteins, polypeptides, peptides and the like. Such segments can be naturally isolated, or modified synthetically by the hand of man.

[0056] Polynucleotides can be single-stranded (coding or antisense) or double-stranded, and can be DNA (genomic, cDNA or synthetic) or RNA molecules. In one embodiment, additional coding or non-coding sequences can, be present within a polynucleotide. In another embodiment, a polynucleotide can be linked to other molecules and/or support materials.

[0057] Polynucleotides can comprise a native sequence (e.g., an endogenous sequence) or can comprise a variant, or a biological functional equivalent of such a sequence. Polynucleotide variants can contain one or more base substitutions, additions, deletions and/or insertions, as further described below. In one embodiment, a polynucleotide variant encodes a polypeptide with the same sequence as the native protein. In another embodiment, a polynucleotide variant encodes a polypeptide with substantially similar enzymatic activity as the native protein. In another embodiment, a polynucleotide variant encodes a protein with increased enzymatic activity relative to the native polypeptide. The effect on the enzymatic activity of the encoded polypeptide can generally be assessed as described herein.

[0058] A polynucleotide encoding a polypeptide can be combined with other DNA sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, other coding segments, and the like, such that their overall length can vary considerably. In one embodiment, the maximum length of a polynucleotide sequence which can be used to transform a microorganism is governed only by the nature of the recombinant protocol employed.

[0059] The terms "polynucleotide variant" and "variant" and the like refer to polynucleotides that display substantial sequence identity with any of the reference polynucleotide sequences or genes described herein, and to polynucleotides that hybridize with any polynucleotide reference sequence described herein, or any polynucleotide coding sequence of any gene or protein referred to herein, under low stringency, medium stringency, high stringency, or very high stringency conditions that are defined hereinafter and known in the art. These terms also encompass polynucleotides that are distinguished from a reference polynucleotide by the addition, deletion or substitution of at least one nucleotide.

Accordingly, the terms "polynucleotide variant" and "variant" include polynucleotides in which one or more nucleotides have been added or deleted, or replaced with different nucleotides. In this regard, it is well understood in the art that certain alterations inclusive of mutations, additions, deletions and substitutions can be made to a reference polynucleotide whereby the altered polynucleotide retains the biological function or activity of the reference polynucleotide, or has increased activity in relation to the reference polynucleotide (e.g., optimized). Polynucleotide variants include, for example, polynucleotides having at least 50% (and at least 51%> to at least 99% and all integer percentages in between) sequence identity with a reference polynucleotide described herein.

[0060] The terms "polynucleotide variant" and "variant" also include naturally- occurring allelic variants that encode these enzymes. Examples of naturally- occurring variants include allelic variants (same locus), homologs (different locus), and orthologs (different microorganism). Naturally occurring variants such as these can be identified and isolated using well-known molecular biology techniques including, for example, various polymerase chain reaction (PCR) and hybridization-based techniques as known in the art. Naturally-occurring variants can be isolated from any microorganism that encodes one or more genes having a suitable enzymatic activity described herein (e.g., C-C ligase, diol dehyodrogenase, pectate lyase, alginate lyase, diol dehydratase, transporter, etc.).

[0061] Non-naturally occurring variants can be made by mutagenesis techniques, including those applied to polynucleotides, cells, or microorganisms. The variants can contain nucleotide substitutions, deletions, inversions and insertions. Variation can occur in either or both the coding and non-coding regions. In certain aspects, non-naturally occurring variants can have been optimized for use in a given

microorganism (e.g., E. coli) or plant, such as by engineering and screening the enzymes for increased activity, stability, or any other desirable feature. The variations can produce both conservative and non- conservative amino acid substitutions (as compared to the originally encoded product). For

polynucleotide sequences, conservative variants include those sequences that, because of the degeneracy of the genetic code, encode the amino acid sequence of a reference polypeptide. Variant polynucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, by using site-directed mutagenesis but which still encode a biologically active polypeptide. Generally, variants of a reference polynucleotide sequence will have at least about 30%, 40% 50%, 55%, 60%, 65%, 70%, generally at least about 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more sequence identity with the reference polynucleotide sequence as determined by sequence alignment programs described elsewhere herein using default parameters. In one embodiment, a variant polynucleotide sequence encodes a protein with substantially similar activity compared to a protein encoded by the respective reference polynucleotide sequence. Substantially similar activity means variant protein activity that is within +/- 15%) of the activity of a protein encoded by the respective reference polynucleotide sequence. In another embodiment, a variant polynucleotide sequence encodes a protein with greater activity compared to a protein encoded by the respective reference polynucleotide sequence.

[0062] The terms "hybridizes under low stringency, hybridizes medium stringency, hybridizes high stringency, or hybridizes very high stringency conditions" as used herein, refers to conditions for hybridization and washing. Guidance for performing hybridization reactions can be found in Ausubel et al., "Current Protocols in Molecular Biology", John Wiley & Sons Inc, 1994-1998, Sections 6.3.1-6.3.6. Aqueous and non-aqueous methods are described in that reference and either can be used.

[0063] The term "low stringency" as used herein, refers to conditions that include and encompass from at least about 1% v/v to at least about 15% v/v formamide and from at least about 1 M to at least about 2 M salt for hybridization at 42° C, and at least about 1 M to at least about 2 M salt for washing at 42° C. Low stringency conditions also can include 1%> Bovine Serum Albumin (BSA), 1 mM EDTA, 0.5 M NaHP0₄ (pH 7.2), 7% SDS for hybridization at 65° C, and (i) 2X SSC, 0.1% SDS; or (ii) 0.5% BSA, 1 mM EDTA, 40 mM NaHP0₄ (pH 7.2), 5%> SDS for washing at room temperature. One embodiment, of low stringency conditions includes hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45° C, followed by two washes in 0.2X SSC, 0.1%> SDS at least at 50° C. (the temperature of the washes can be increased to 55° C. for low stringency conditions).

[0064] The term "Medium stringency" as used herein, refers to conditions that include and encompass from at least about 16%> v/v to at least about 30%> v/v formamide and from at least about 0.5 M to at least about 0.9 M salt for hybridization at 42° C, and at least about 0.1 M to at least about 0.2 M salt for washing at 55° C. Medium stringency conditions also can include 1%> Bovine Serum Albumin (BSA), 1 mM EDTA, 0.5 M NaHP04 (pH 7.2), 7% SDS for hybridization at 65° C, and (i) 2X SSC, 0.1% SDS; or (ii) 0.5% BSA, 1 mM EDTA, 40 mM NaHP0₄ (pH 7.2), 5% SDS for washing at 60-65° C. One embodiment, of medium stringency conditions includes hybridizing in 6X SSC at about 45° C, followed by one or more washes in 0.2X SSC, 0.1% SDS at 60° C.

[0065] The term "High stringency" as used herein, refers to conditions that include and encompass from at least about 31%> v/v to at least about 50%> v/v formamide and from about 0.01 M to about 0.15 M salt for hybridization at 42° C, and about 0.01 M to about 0.02 M salt for washing at 55° C. High stringency conditions also can include 1% BSA, 1 mM EDTA, 0.5 M NaHP0₄ (pH 7.2), 7% SDS for hybridization at 65° C, and (i) 0.2X SSC, 0.1% SDS; or (ii) 0.5% BSA, 1 mM EDTA, 40 mM NaHP0₄ (pH 7.2), 1% SDS for washing at a temperature in excess of 65° C. One embodiment of high stringency conditions includes hybridizing in 6X SSC at about 45° C, followed by one or more washes in 0.2X SSC, 0.1%> SDS at 65°C.

[0066] Due to the degeneracy of the genetic code, amino acids can be substituted for other amino acids in a protein sequence without appreciable loss of the desired activity (see Table 1 below). It is thus contemplated that various changes can be made in the peptide sequences of the disclosed protein sequences, or their corresponding nucleic acid sequences without appreciable loss of the biological activity.

[0067] In making such changes, the hydropathic index of amino acids can be considered. The importance of the hydropathic amino acid index in conferring interactive biological function on a protein is generally understood in the art (Kyte and Doolittle, J. Mol. Biol., 157: 105-132, 1982). It is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and the like.

[0068] Amino acids have been assigned a hydropathic index on the basis of their hydrophobicity and charge characteristics. These are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cysteine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2);

glutamate/glutamine/aspartate/asparagine (-3.5); lysine (-3.9); and arginine (-4.5).

[0069] It is known in the art that certain amino acids can be substituted by other amino acids having a similar hydropathic index or score and result in a protein with similar biological activity, e.g., still obtain a biologically-functional protein. In one embodiment, amino acids whose hydropathic indices are within +/-0.2 are substituted. In another embodiment, amino acids whose hydropathic indices are within +/-0.1 are substituted. In another embodiment, amino acids whose hydropathic indices are within +/-.0.5 are substituted.

[0070] It is also understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity. U.S. Pat. No. 4,554,101 (Hopp, which is herein incorporated by reference in its entirety) states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with a biological property of the protein. The following hydrophilicity values have been assigned to amino acids: arginine/lysine (+3.0);

aspartate/glutamate (+3.0.+-.1); serine (+0.3); asparagine/glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5.+-.1); alanine/histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5);

leucine/isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); and tryptophan (-3.4).

[0071] It is understood that an amino acid can be substituted by another amino acid having a similar hydrophilicity score and still result in a protein with similar biological activity, e.g., still obtain a biologically functional protein. In one embodiment, amino acids whose hydrophilicity values are within +/-0.2 are substituted. In another embodiment, amino acids whose hydrophilicity values are within +/-0.1 are substituted. In another embodiment, amino acids whose hydrophilicity values are within +/-.0.5 are substituted.

[0072] As outlined above, amino acid substitutions can be based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions which take any of the foregoing characteristics into consideration are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine. Changes which are not expected to be advantageous can also be used if these resulting proteins have the same or improved characteristics, relative to the unmodified polypeptide from which they are engineered.

[0073] In one embodiment, a polynucleotide comprises codons in its protein coding sequence that are optimized to increase the thermostability of an mRNA transcribed from the polynucleotide. In one embodiment, this optimization does not change the amino acid sequence encoded by the polynucleotide. In another embodiment, a polynucleotide comprises codons in its protein coding sequence that are optimized to increase translation efficiency of an mRNA from the polynucleotide in a host cell. In one embodiment, this optimization does not change the amino acid sequence encoded by the polynucleotide.

[0074] The RNA codon table below (Table 1) shows the 64 codons and the amino acid for each. The direction of the mRNA is 5' to 3 '.

Table 1

AUG^[A] (Met/M) ACG (Thr/T) AGG (Arg/R)

AAG (Lys/K) Lysine

Methionine Threonine Arginine

GCU (Ala/A) GAU (Asp/D) Aspartic

GUU (Val/V) Valine Alanine acid GGU (Gly/G) Glycine GUC (Val/V) Valine GCC (Ala/A) GAC (Asp/D) Aspartic GGC (Gly/G) Glycine

Alanine acid

G

GCA (Ala/A) GAA (Glu/E) Glutamic

GUA (Val/V) Valine Alanine acid GGA (Gly/G) Glycine GUG (Val/V) Valine GCG (Ala/A) GAG (Glu/E) Glutamic GGG (Gly/G) Glycine

Alanine acid

^A The codon AUG both codes for methionine anc serves as an initiation site: the first AUG in an mRNA's coding region is where translation into protein begins.

[0075] In one embodiment, a method disclosed which uses variants of full-length polypeptides having any of the enzymatic activities described herein, truncated fragments of these full-length polypeptides, variants of truncated fragments, as well as their related biologically active fragments. Typically, biologically active fragments of a polypeptide can participate in an interaction, for example, an intramolecular or an inter-molecular interaction. An inter-molecular interaction can be a specific binding interaction or an enzymatic interaction (e.g., the interaction can be transient and a covalent bond is formed or broken). Biologically active fragments of a polypeptide/enzyme an enzymatic activity described herein include peptides comprising amino acid sequences sufficiently similar to, or derived from, the amino acid sequences of a (putative) full-length reference polypeptide sequence. Typically, biologically active fragments comprise a domain or motif with at least one enzymatic activity, and can include one or more (and in some cases all) of the various active domains. A biologically active fragment of a an enzyme can be a polypeptide fragment which is, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 450, 500, 600 or more contiguous amino acids, including all integers in between, of a reference polypeptide sequence. In certain embodiments, a biologically active fragment comprises a conserved enzymatic sequence, domain, or motif, as described elsewhere herein and known in the art. Suitably, the biologically-active fragment has no less than about 1%, 10%, 25%, or 50%> of an activity of the wild-type polypeptide from which it is derived.

[0076] The term "exogenous" as used herein, refers to a polynucleotide sequence or polypeptide that does not naturally occur in a given wild-type cell or microorganism, but is typically introduced into the cell by a molecular biological technique, e.g., engineering to produce a recombinant microorganism or recombinant plant. Examples of "exogenous" polynucleotides include vectors, plasmids, and/or man- made nucleic acid constructs encoding a desired protein or enzyme.

[0077] The term "endogenous" as used herein, refers to naturally- occurring polynucleotide sequences or polypeptides that can be found in a given wild-type cell or microorganism. For example, certain naturally- occurring bacterial or yeast species do not typically contain a benzaldehyde lyase gene, and, therefore, do not comprise an "endogenous" polynucleotide sequence that encodes a benzaldehyde lyase. In this regard, it is also noted that even though a microorganism or plant can comprise an endogenous copy of a given polynucleotide sequence or gene, the introduction of a plasmid or vector encoding that sequence, such as to over-express or otherwise regulate the expression of the encoded protein, represents an "exogenous" copy of that gene or polynucleotide sequence. Any of the pathways, genes, or enzymes described herein can utilize or rely on an "endogenous" sequence, or can be provided as one or more "exogenous" polynucleotide sequences, and/or can be used according to the endogenous sequences already contained within a given microorganism or plant.

[0078] The term "sequence identity" for example, comprising a "sequence 50% identical to," as used herein, refers to the extent that sequences are identical on a nucleotide-by-nucleotide basis or an amino acid-by-amino acid basis over a window of comparison. Thus, a "percentage of sequence identity" can be calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, I) or the identical amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, He, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gin, Cys and Met) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (e.g., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.

[0079] The terms used to describe sequence relationships between two or more polynucleotides or polypeptides include "reference sequence", "comparison window", "sequence identity", "percentage of sequence identity" and "substantial identity". A "reference sequence" is at least 12 but frequently 15 to 18 and often at least 25 monomer units, inclusive of nucleotides and amino acid residues, in length. Because two polynucleotides can each comprise (1) a sequence (e.g., only a portion of the complete

polynucleotide sequence) that is similar between the two polynucleotides, and (2) a sequence that is divergent between the two polynucleotides, sequence comparisons between two (or more)

polynucleotides are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity. A "comparison window" refers to a conceptual segment of at least 6 contiguous positions, usually about 50 to about 100, more usually about 100 to about 150 in which a sequence is compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. The comparison window can comprise additions or deletions (e.g., gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window can be conducted by computerized implementations of algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, Wis., USA) or by inspection and the best alignment (e.g., resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected. Reference also can be made to the BLAST family of programs as for example disclosed by Altschul et al., 1997, Nucl. Acids Res.

25:3389, which is herein incorporated by reference in its entirety. A detailed discussion of sequence analysis can be found in Unit 19.3 of Ausubel et al., "Current Protocols in Molecular Biology", John Wiley & Sons Inc, 1994-1998, Chapter 15, which is herein incorporated by reference in its entirety.

[0080] The term "transformation" as used herein, refers to the permanent, heritable alteration in a cell resulting from the uptake and incorporation of foreign DNA into the host-cell genome. This includes the transfer of an exogenous gene from one microorganism into the genome of another microorganism as well as the addition of additional copies of an endogenous gene into a microorganism.

[0081] The term "vector" as used herein, refers to a polynucleotide molecule, such as a DNA molecule. It can be derived, from a plasmid, bacteriophage, yeast or virus, into which a polynucleotide can be inserted or cloned. A vector can contain one or more unique restriction sites and can be capable of autonomous replication in a defined host cell including a target cell or tissue or a progenitor cell or tissue thereof, or be integrable with the genome of the defined host such that the cloned sequence is reproducible. Accordingly, the vector can be an autonomously replicating vector, e.g., a vector that exists as an extra-chromosomal entity, the replication of which is independent of chromosomal replication, e.g., a linear or closed circular plasmid, an extra-chromosomal element, a mini-chromosome, or an artificial chromosome. The vector can contain any means for assuring self-replication. Alternatively, the vector can be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. Such a vector can comprise specific sequences that allow recombination into a particular, desired site of the host chromosome. A vector system can comprise a single vector or plasmid, two or more vectors or plasmids, which together contain the total DNA to be introduced into the genome of the host cell, or a transposon. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. A vector can be one which is operably functional in a bacterial cell, such as a cyanobacterial cell. The vector can include a reporter gene, such as a green fluorescent protein (GFP), which can be either fused in frame to one or more of the encoded polypeptides, or expressed separately. The vector can also include a selection marker such as an antibiotic resistance gene that can be used for selection of suitable transformants.

[0082] The terms "wild-type" and "naturally- occurring" as used herein are used interchangeably to refer to a gene or gene product that has the characteristics of that gene or gene product when isolated from a naturally occurring source. A wild type gene or gene product (e.g., a polypeptide) is that which is most frequently observed in a population and is thus arbitrarily designed the "normal" or "wild-type" form of the gene. [0083] The term "fuel" or "biofuel" as used herein has its ordinary meaning as known to those skilled in the art and can include one or more compounds suitable as liquid fuels, gaseous fuels, reagents, chemical feedstocks and includes, but is not limited to, hydrocarbons, hydrogen, methane, hydroxy compounds such as alcohols (e.g. ethanol, butanol, propanol, methanol, etc.), and carbonyl compounds such as aldehydes and ketones (e.g. acetone, formaldehyde, 1-propanal, etc.).

[0084] The terms "fermentation end-product", "end-product", or "fermentation product" as used herein has its ordinary meaning as known to those skilled in the art and can include one or more biofuels, chemical additives, processing aids, food additives, organic acids (e.g. acetic, lactic, formic, citric acid etc.), derivatives of organic acids such as esters (e.g. wax esters, glycerides, etc.) or other functional compounds. These end-products include, but are not limited to, an alcohol, ethanol, butanol, methanol, 1,

2- propanediol, 1, 3 -propanediol, lactic acid, formic acid, acetic acid, succinic acid, pyruvic acid, enzymes such as cellulases, polysaccharases, lipases, proteases, ligninases, and hemicellulases and can be present as a pure compound, a mixture, or an impure or diluted form.

[0085] Various end-products can be produced through saccharification and fermentation using enzyme- enhancing products and processes. Examples of end-products include but are not limited to methane, methanol, ethane, ethene, ethanol, n-propane, 1 -propene, 1 -propanol, propanal, acetone, propionate, n- butane, 1 -butene, 1 -butanol, butanal, butanoate, isobutanal, isobutanol, 2-methylbutanal, 2-methylbutanol,

3- methylbutanal, 3-methylbutanol, 2-butene, 2-butanol, 2-butanone, 2,3-butanediol, 3-hydroxy-2- butanone, 2,3-butanedione, ethylbenzene, ethenylbenzene, 2-phenylethanol, phenylacetaldehyde, 1- phenylbutane, 4-phenyl-l -butene, 4-phenyl-2-butene, 1 -phenyl-2-butene, 1 -phenyl-2-butanol, 4-phenyl-2- butanol, 1 -phenyl-2-butanone, 4-phenyl-2-butanone, l-phenyl-2,3-butandiol, l-phenyl-3-hydroxy-2- butanone, 4-phenyl-3-hydroxy-2-butanone, l-phenyl-2,3-butanedione, n-pentane, ethylphenol, ethenylphenol, 2-(4-hydroxyphenyl)ethanol, 4-hydroxyphenylacetaldehyde, 1 -(4-hydroxyphenyl) butane,

4- (4-hydroxyphenyl)-l -butene, 4-(4-hydroxyphenyl)-2-butene, 1 -(4-hydroxyphenyl)- 1 -butene, l-(4- hydroxyphenyl)-2-butanol, 4-(4-hydroxyphenyl)-2-butanol, 1 -(4-hydroxyphenyl)-2-butanone, 4-(4- hydroxyphenyl)-2-butanone, 1 -(4-hydroxyphenyl)-2,3-butandiol, 1 -(4-hydroxyphenyl)-3-hydroxy-2- butanone, 4-(4-hydroxyphenyl)-3-hydroxy-2-butanone, l-(4-hydroxyphenyl)-2,3-butanonedione, indolylethane, indolylethene, 2-(indole-3-)ethanol, n-pentane, 1-pentene, 1-pentanol, pentanal, pentanoate, 2-pentene, 2-pentanol, 3-pentanol, 2-pentanone, 3-pentanone, 4-methylpentanal, 4- methylpentanol, 2,3-pentanediol, 2-hydroxy-3-pentanone, 3-hydroxy-2-pentanone, 2,3-pentanedione, 2- methylpentane, 4-methyl- 1 -pentene, 4-methyl-2-pentene, 4-methyl-3-pentene, 4-methyl-2-pentanol, 2- methyl-3-pentanol, 4-methyl-2-pentanone, 2-methyl-3-pentanone, 4-methyl-2,3-pentanediol, 4-methyl-2- hydroxy-3-pentanone, 4-methyl-3-hydroxy-2-pentanone, 4-methyl-2,3-pentanedione, 1-phenylpentane, 1- phenyl- 1-pentene, l-phenyl-2-pentene, l-phenyl-3-pentene, l-phenyl-2-pentanol, l-phenyl-3-pentanol, 1- phenyl-2-pentanone, 1 -phenyl-3-pentanone, 1 -phenyl-2,3-pentanediol, 1 -phenyl-2-hydroxy-3-pentanone, l-phenyl-3-hydroxy-2-pentanone, l-phenyl-2,3-pentanedione, 4-methyl- 1-phenylpentane, 4-methyl-l- phenyl- 1 -pentene, 4-methyl- 1 -phenyl-2-pentene, 4-methyl- 1 -phenyl-3-pentene, 4-methyl- 1 -phenyl-3 - pentanol, 4-methyl- l -phenyl-2-pentanol, 4-methyl-l-phenyl-3-pentanone, 4-methyl- l-phenyl-2- pentanone, 4-methyl- 1 -phenyl-2,3-pentanediol, 4-methyl- 1 -phenyl-2,3-pentanedione, 4-methyl- 1 -phenyl- 3-hydroxy-2-pentanone, 4-methyl-l-phenyl-2-hydroxy-3-pentanone, 1 -(4-hydroxyphenyl) pentane, l-(4- hydroxyphenyl)-l-pentene, l-(4-hydroxyphenyl)-2-pentene, l-(4-hydroxyphenyl)-3-pentene, l-(4- hydroxyphenyl)-2-pentanol, l-(4-hydroxyphenyl)-3 -pentanol, l-(4-hydroxyphenyl)-2-pentanone, l-(4- hydroxyphenyl)-3-pentanone, 1 -(4-hydroxyphenyl)-2,3-pentanediol, 1 -(4-hydroxyphenyl)-2-hydroxy-3- pentanone, l-(4-hydroxyphenyl)-3-hydroxy-2-pentanone, l-(4-hydroxyphenyl)-2,3-pentanedione, 4- methyl-1 -(4-hydroxyphenyl) pentane, 4-methyl- l -(4-hydroxyphenyl)-2-pentene, 4-methyl-l -(4- hydroxyphenyl)-3-pentene, 4-methyl- 1 -(4-hydroxyphenyl)- 1-pentene, 4-methyl- l -(4-hydroxyphenyl)-3- pentanol, 4-methyl- l -(4-hydroxyphenyl)-2-pentanol, 4-methyl- l-(4-hydroxyphenyl)-3 -pentanone, 4- methyl- 1 -(4-hydroxyphenyl)-2-pentanone, 4-methyl- 1 -(4-hydroxyphenyl)-2,3-pentanediol, 4-methyl- 1 - (4-hydroxyphenyl)-2,3-pentanedione, 4-methyl-l-(4-hydroxyphenyl)-3-hydroxy-2-pentanone, 4-methyl- 1 -(4-hydroxyphenyl)-2-hydroxy-3-pentanone, 1 -indole-3-pentane, 1 -(indole-3)-l -pentene, 1 -(indole-3)-2- pentene, l-(indole-3)-3-pentene, l-(indole-3)-2-pentanol, l-(indole-3)-3-pentanol, l-(indole-3)-2- pentanone, 1 -(indole-3)-3-pentanone, 1 -(indole-3)-2,3-pentanediol, 1 -(indole-3)-2-hydroxy-3-pentanone, 1 -(indole-3)-3-hydroxy-2-pentanone, 1 -(indole-3)-2,3-pentanedione, 4-methyl-l -(indole-3-)pentane, 4- methyl-l-(indole-3)-2-pentene, 4-methyl-l -(indole-3)-3 -pentene, 4-methyl-l -(indole-3)-l -pentene, 4- methyl-2-(indole-3)-3-pentanol, 4-methyl- l-(indole-3)-2-pentanol, 4-methyl-l -(indole-3)-3-pentanone, 4- methyl-l-(indole-3)-2-pentanone, 4-methyl-l -(indole-3)-2,3-pentanediol, 4-methyl-l -(indole-3)-2,3- pentanedione, 4-methyl-l -(indole-3)-3-hydroxy-2-pentanone, 4-methyl-l -(indole-3)-2-hydroxy-3- pentanone, n-hexane, 1-hexene, 1-hexanol, hexanal, hexanoate, 2-hexene, 3-hexene, 2-hexanol, 3- hexanol, 2-hexanone, 3-hexanone, 2,3-hexanediol, 2,3-hexanedione, 3,4-hexanediol, 3,4-hexanedione, 2- hydroxy-3-hexanone, 3-hydroxy-2-hexanone, 3-hydroxy-4-hexanone, 4-hydroxy-3-hexanone, 2- methylhexane, 3-methylhexane, 2-methyl-2-hexene, 2-methyl-3-hexene, 5-methyl- 1-hexene, 5-methyl-2- hexene, 4-methyl- 1 -hexene, 4-methyl-2-hexene, 3-methyl-3-hexene, 3-methyl-2-hexene, 3-methyl-l- hexene, 2-methyl-3-hexanol, 5-methyl-2-hexanol, 5-methyl-3-hexanol, 2-methyl-3-hexanone, 5-methyl- 2-hexanone, 5-methyl-3-hexanone, 2-methyl-3,4-hexanediol, 2-methyl-3,4-hexanedione, 5-methyl-2,3- hexanediol, 5-methyl-2,3-hexanedione, 4-methyl-2,3-hexanediol, 4-methyl-2,3-hexanedione, 2-methyl-3- hydroxy-4-hexanone, 2-methyl-4-hydroxy-3-hexanone, 5-methyl-2-hydroxy-3-hexanone, 5-methyl-3- hydroxy-2-hexanone, 4-methyl-2-hydroxy-3-hexanone, 4-methyl-3-hydroxy-2-hexanone, 2,5- dimethylhexane, 2,5-dimethyl-2-hexene, 2,5-dimethyl-3-hexene, 2,5-dimethyl-3-hexanol, 2,5-dimethyl-3- hexanone, 2,5-dimethyl-3,4-hexanediol, 2,5-dimethyl-3,4-hexanedione, 2,5-dimethyl-3-hydroxy-4- hexanone, 5-methyl- 1 -phenylhexane, 4-methyl- 1 -phenylhexane, 5-methyl- 1 -phenyl- 1-hexene, 5-methyl- 1 -phenyl-2-hexene, 5-methyl- 1 -phenyl-3-hexene, 4-methyl- 1 -phenyl- 1 -hexene, 4-methyl- 1 -phenyl-2- hexene, 4-methyl-l -phenyl-3 -hexene, 5-methyl- 1 -phenyl-2-hexanol, 5-methyl-l-phenyl-3-hexanol, 4- methyl- 1 -phenyl-2-hexanol, 4-methyl- 1 -phenyl-3 -hexanol, 5-methyl- 1 -phenyl-2-hexanone, 5-methyl- 1 - phenyl-3 -hexanone, 4-methyl- 1 -phenyl-2-hexanone, 4-methyl- 1 -phenyl-3 -hexanone, 5-methyl- 1 -phenyl- 2,3-hexanediol, 4-methyl-l-phenyl-2,3-hexanediol, 5-methyl-l-phenyl-3-hydroxy-2-hexanone, 5-methyl-

1- phenyl-2-hydroxy-3-hexanone, 4-methyl- l-phenyl-3-hydroxy-2-hexanone, 4-methyl- l -phenyl-2- hydroxy-3-hexanone, 5-methyl-l -phenyl-2,3-hexanedione, 4-methyl-l-phenyl-2,3-hexanedione, 4- methyl- 1 -(4-hydroxyphenyl)hexane, 5-methyl- 1 -(4-hydroxyphenyl)- 1 -hexene, 5-methyl- 1 -(4- hydroxyphenyl)-2-hexene, 5-methyl- 1 -(4-hydroxyphenyl)-3 -hexene, 4-methyl- 1 -(4-hydroxyphenyl)- 1 - hexene, 4-methyl- 1 -(4-hydroxyphenyl)-2-hexene, 4-methyl- 1 -(4-hydroxyphenyl)-3 -hexene, 5-methyl- 1 - (4-hydroxyphenyl)-2-hexanol, 5-methyl- 1 -(4-hydroxyphenyl)-3 -hexanol, 4-methyl- 1 -(4-hydroxyphenyl)-

2- hexanol, 4-methyl- l-(4-hydroxyphenyl)-3 -hexanol, 5-methyl- l-(4-hydroxyphenyl)-2-hexanone, 5- methyl- 1 -(4-hydroxyphenyl)-3-hexanone, 4-methyl- 1 -(4-hydroxyphenyl)-2-hexanone, 4-methyl- 1 -(4- hydroxyphenyl)-3-hexanone, 5-methyl-l -(4-hydroxyphenyl)-2,3-hexanediol, 4-methyl- 1 -(4- hydroxyphenyl)-2,3-hexanediol, 5-methyl-l-(4-hydroxyphenyl)-3-hydroxy-2-hexanone, 5-methyl- 1 -(4- hydroxyphenyl)-2-hydroxy-3-hexanone, 4-methyl- l-(4-hydroxyphenyl)-3-hydroxy-2-hexanone, 4- methyl-l-(4-hydroxyphenyl)-2-hydroxy-3-hexanone, 5-methyl- l-(4-hydroxyphenyl)-2,3-hexanedione, 4- methyl- 1 -(4-hydroxyphenyl)-2,3-hexanedione, 4-methyl- 1 -(indole-3-)hexane, 5-methyl- 1 -(indole-3)- 1 - hexene, 5-methyl- l -(indole-3)-2-hexene, 5-methyl-l-(indole-3)-3-hexene, 4-methyl- 1 -(indole-3)- 1- hexene, 4-methyl- l -(indole-3)-2-hexene, 4-methyl-l-(indole-3)-3-hexene, 5-methyl- l-(indole-3)-2- hexanol, 5-methyl- l-(indole-3)-3 -hexanol, 4-methyl- l-(indole-3)-2-hexanol, 4-methyl-l-(indole-3)-3- hexanol, 5-methyl- l-(indole-3)-2-hexanone, 5-methyl- l-(indole-3)-3-hexanone, 4-methyl- l-(indole-3)-2- hexanone, 4-methyl-l-(indole-3)-3-hexanone, 5-methyl-l-(indole-3)-2,3-hexanediol, 4-methyl- l-(indole- 3)-2,3-hexanediol, 5-methyl-l-(indole-3)-3-hydroxy-2-hexanone, 5-methyl-l-(indole-3)-2-hydroxy-3- hexanone, 4-methyl-l-(indole-3)-3-hydroxy-2-hexanone, 4-methyl-l-(indole-3)-2-hydroxy-3-hexanone, 5-methyl-l-(indole-3)-2,3-hexanedione, 4-methyl-l-(indole-3)-2,3-hexanedione, n-heptane, 1-heptene, 1- heptanol, heptanal, heptanoate, 2-heptene, 3-heptene, 2-heptanol, 3-heptanol, 4-heptanol, 2-heptanone, 3- heptanone, 4-heptanone, 2,3-heptanediol, 2,3-heptanedione, 3,4-heptanediol, 3,4-heptanedione, 2- hydroxy-3-heptanone, 3-hydroxy-2-heptanone, 3-hydroxy-4-heptanone, 4-hydroxy-3-heptanone, 2- methylheptane, 3-methylheptane, 6-methyl-2-heptene, 6-methyl-3-heptene, 2-methyl-3-heptene, 2- methyl-2-heptene, 5-methyl-2-heptene, 5-methyl-3-heptene, 3-methyl-3-heptene, 2-methyl-3-heptanol, 2- methyl-4-heptanol, 6-methyl-3-heptanol, 5-methyl-3-heptanol, 3-methyl-4-heptanol, 2-methyl-3- heptanone, 2-methyl-4-heptanone, 6-methyl-3-heptanone, 5-methyl-3-heptanone, 3-methyl-4-heptanone, 2-methyl-3,4-heptanediol, 2-methyl-3,4-heptanedione, 6-methyl-3,4-heptanediol, 6-methyl-3,4- heptanedione, 5-methyl-3,4-heptanediol, 5-methyl-3,4-heptanedione, 2-methyl-3-hydroxy-4-heptanone,

2- methyl-4-hydroxy-3 -heptanone, 6-methyl-3 -hydroxy-4-heptanone, 6-methyl-4-hydroxy-3 -heptanone, 5- methyl-3-hydroxy-4-heptanone, 5-methyl-4-hydroxy-3-heptanone, 2,6-dimethylheptane, 2,5- dimethylheptane, 2,6-dimethyl-2-heptene, 2,6-dimethyl-3-heptene, 2,5-dimethyl-2-heptene, 2,5-dimethyl-

3- heptene, 3,6-dimethyl-3-heptene, 2,6-dimethyl-3-heptanol, 2,6-dimethyl-4-heptanol, 2,5-dimethyl-3- heptanol, 2,5-dimethyl-4-heptanol, 2,6-dimethyl-3,4-heptanediol, 2,6-dimethyl-3,4-heptanedione, 2,5- dimethyl-3,4-heptanediol, 2,5-dimethyl-3,4-heptanedione, 2,6-dimethyl-3-hydroxy-4-heptanone, 2,6- dimethyl-4-hydroxy-3-heptanone, 2,5-dimethyl-3-hydroxy-4-heptanone, 2,5-dimethyl-4-hydroxy-3- heptanone, n-octane, 1-octene, 2-octene, 1-octanol, octanal, octanoate, 3-octene, 4-octene, 4-octanol, 4- octanone, 4,5-octanediol, 4,5-octanedione, 4-hydroxy-5-octanone, 2-methyloctane, 2-methyl-3-octene, 2- methyl-4-octene, 7-methyl-3-octene, 3-methyl-3-octene, 3-methyl-4-octene, 6-methyl-3-octene, 2- methyl-4-octanol, 7-methyl-4-octanol, 3-methyl-4-octanol, 6-methyl-4-octanol, 2-methyl-4-octanone, 7- methyl-4-octanone, 3-methyl-4-octanone, 6-methyl-4-octanone, 2-methyl-4,5-octanediol, 2-methyl-4,5- octanedione, 3-methyl-4,5-octanediol, 3-methyl-4,5-octanedione, 2-methyl-4-hydroxy-5-octanone, 2- methyl-5-hydroxy-4-octanone, 3-methyl-4-hydroxy-5-octanone, 3-methyl-5-hydroxy-4-octanone, 2,7- dimethyloctane, 2,7-dimethyl-3-octene, 2,7-dimethyl-4-octene, 2,7-dimethyl-4-octanol, 2,7-dimethyl-4- octanone, 2,7-dimethyl-4,5-octanediol, 2,7-dimethyl-4,5-octanedione, 2,7-dimethyl-4-hydroxy-5- octanone, 2,6-dimethyloctane, 2,6-dimethyl-3-octene, 2,6-dimethyl-4-octene, 3,7-dimethyl-3-octene, 2,6- dimethyl-4-octanol, 3,7-dimethyl-4-octanol, 2,6-dimethyl-4-octanone, 3,7-dimethyl-4-octanone, 2,6- dimethyl-4,5-octanediol, 2,6-dimethyl-4,5-octanedione, 2,6-dimethyl-4-hydroxy-5-octanone, 2,6- dimethyl-5-hydroxy-4-octanone, 3,6-dimethyloctane, 3,6-dimethyl-3-octene, 3,6-dimethyl-4-octene, 3,6- dimethyl-4-octanol, 3,6-dimethyl-4-octanone, 3,6-dimethyl-4,5-octanediol, 3,6-dimethyl-4,5-octanedione, 3,6-dimethyl-4-hydroxy-5-octanone, n-nonane, 1-nonene, 1-nonanol, nonanal, nonanoate, 2- methylnonane, 2-methyl-4-nonene, 2-methyl-5-nonene, 8-methyl-4-nonene, 2-methyl-5-nonanol, 8- methyl-4-nonanol, 2-methyl-5-nonanone, 8-methyl-4-nonanone, 8-methyl-4,5-nonanediol, 8-methyl-4,5- nonanedione, 8-methyl-4-hydroxy-5-nonanone, 8-methyl-5-hydroxy-4-nonanone, 2,8-dimethylnonane, 2,8-dimethyl-3-nonene, 2,8-dimethyl-4-nonene, 2,8-dimethyl-5-nonene, 2,8-dimethyl-4-nonanol, 2,8- dimethyl-5-nonanol, 2,8-dimethyl-4-nonanone, 2,8-dimethyl-5-nonanone, 2,8-dimethyl-4,5-nonanediol, 2,8-dimethyl-4,5-nonanedione, 2,8-dimethyl-4-hydroxy-5-nonanone, 2,8-dimethyl-5-hydroxy-4- nonanone, 2,7-dimethylnonane, 3,8-dimethyl-3-nonene, 3,8-dimethyl-4-nonene, 3,8-dimethyl-5-nonene, 3,8-dimethyl-4-nonanol, 3,8-dimethyl-5-nonanol, 3,8-dimethyl-4-nonanone, 3,8-dimethyl-5-nonanone, 3,8-dimethyl-4,5-nonanediol, 3,8-dimethyl-4,5-nonanedione, 3,8-dimethyl-4-hydroxy-5-nonanone, 3,8- dimethyl-5-hydroxy-4-nonanone, n-decane, 1-decene, 1-decanol, decanoate, 2,9-dimethyldecane, 2,9- dimethyl-3-decene, 2,9-dimethyl-4-decene, 2,9-dimethyl-5-decanol, 2,9-dimethyl-5-decanone, 2,9- dimethyl-5,6-decanediol, 2,9-dimethyl-6-hydroxy-5-decanone, 2,9-dimethyl-5,6-decanedionen-undecane, 1-undecene, 1-undecanol, undecanal. undecanoate, n-dodecane, 1-dodecene, 1-dodecanol, dodecanal, dodecanoate, n-dodecane, 1 -decadecene, n-tridecane, 1-tridecene, 1 -tridecanol, tridecanal, tridecanoate, n-tetradecane, 1 -tetradecene, 1 -tetradecanol, tetradecanal, tetradecanoate, n-pentadecane, 1 -pentadecene, 1 -pentadecanol, pentadecanal, pentadecanoate, n-hexadecane, 1 -hexadecene, 1 -hexadecanol, hexadecanal, hexadecanoate, n-heptadecane, 1 -heptadecene, 1 -heptadecanol, heptadecanal, heptadecanoate, n- octadecane, 1-octadecene, 1 -octadecanol, octadecanal, octadecanoate, n-nonadecane, 1 -nonadecene, 1- nonadecanol, nonadecanal, nonadecanoate, eicosane, 1-eicosene, 1-eicosanol, eicosanal, eicosanoate, 3- hydroxy propanal, 1,3-propanediol, 4-hydroxybutanal, 1 ,4-butanediol, 3-hydroxy-2-butanone, 2,3- butandiol, 1,5-pentane diol, homocitrate, homoisocitorate, b-hydroxy adipate, glutarate, glutarsemialdehyde, glutaraldehyde, 2-hydroxy-l-cyclopentanone, 1,2-cyclopentanediol, cyclopentanone, cyclopentanol, (S)-2-acetolactate, (R)-2,3-Dihydroxy-isovalerate, 2-oxoisovalerate, isobutyryl-CoA, isobutyrate, isobutyraldehyde, 5-amino pentaldehyde, 1 , 10-diaminodecane, l,10-diamino-5-decene, 1,10- diamino-5 -hydroxy decane, l,10-diamino-5-decanone, l,10-diamino-5,6-decanediol, l,10-diamino-6- hydroxy-5-decanone, phenylacetoaldehyde, 1 ,4-diphenylbutane, 1,4-diphenyl-l-butene, 1 ,4-diphenyl-2- butene, 1 ,4-diphenyl-2-butanol, 1 ,4-diphenyl-2-butanone, l,4-diphenyl-2,3-butanediol, l,4-diphenyl-3- hydroxy-2-butanone, 1 -(4-hydeoxyphenyl)-4-phenylbutane, 1 -(4-hydeoxyphenyl)-4-phenyl- 1 -butene, 1 - (4-hydeoxyphenyl)-4-phenyl-2-butene, 1 -(4-hydeoxyphenyl)-4-phenyl-2-butanol, 1 -(4-hydeoxyphenyl)- 4-phenyl-2-butanone, 1 -(4-hydeoxyphenyl)-4-phenyl-2,3-butanediol, 1 -(4-hydeoxyphenyl)-4-phenyl-3- hydroxy-2-butanone, 1 -(indole-3)-4-phenylbutane, 1 -(indole-3)-4-phenyl- 1 -butene, 1 -(indole-3)-4- phenyl-2-butene, 1 -(indole-3)-4-phenyl-2-butanol, 1 -(indole-3)-4-phenyl-2-butanone, 1 -(indole-3)-4- phenyl-2,3-butanediol, l-(indole-3)-4-phenyl-3-hydroxy-2-butanone, 4-hydroxyphenylacetoaldehyde, 1 ,4-di(4-hydroxyphenyl)butane, 1 ,4-di(4-hydroxyphenyl)- 1 -butene, 1 ,4-di(4-hydroxyphenyl)-2-butene, 1 ,4-di(4-hydroxyphenyl)-2-butanol, 1 ,4-di(4-hydroxyphenyl)-2-butanone, 1 ,4-di(4-hydroxyphenyl)-2,3- butanediol, 1 ,4-di(4-hydroxyphenyl)-3-hydroxy-2-butanone, 1 -(4-hydroxyphenyl)-4-(indole-3-)butane, 1 - (4-hydroxyphenyl)-4-(indole-3)- 1 -butene, 1 -di(4-hydroxyphenyl)-4-(indole-3)-2-butene, 1 -(4- hydroxyphenyl)-4-(indole-3)-2-butanol, 1 -(4-hydroxyphenyl)-4-(indole-3)-2-butanone, 1 -(4- hydroxyphenyl)-4-(indole-3)-2,3-butanediol, l-(4-hydroxyphenyl-4-(indole-3)-3-hydroxy-2-butanone, indole-3-acetoaldehyde, 1 ,4-di(indole-3-)butane, 1 ,4-di(indole-3)-l -butene, 1 ,4-di(indole-3)-2-butene, l,4-di(indole-3)-2-butanol, l,4-di(indole-3)-2-butanone, l,4-di(indole-3)-2,3-butanediol, l,4-di(indole-3)- 3-hydroxy-2-butanone, succinate semialdehyde, hexane-l,8-dicarboxylic acid, 3-hexene-l,8-dicarboxylic acid, 3-hydroxy-hexane-l,8-dicarboxylic acid, 3-hexanone-l,8-dicarboxylic acid, 3,4-hexanediol-l,8- dicarboxylic acid, 4-hydroxy-3-hexanone-l,8-dicarboxylic acid, fucoidan, iodine, chlorophyll, carotenoid, calcium, magnesium, iron, sodium, potassium, phosphate, lactic acid, acetic acid or formic acid, or terpenes and/or isoprenoids.

[0086] The term "fermentation" as used herein has its ordinary meaning as known to those skilled in the art and can include culturing of a microorganism or group of microorganisms in or on a suitable medium for the microorganisms. The microorganisms can be aerobes, anaerobes, facultative anaerobes, heterotrophs, autotrophs, photoautotrophs, photoheterotrophs, chemoautotrophs, and/or

chemoheterotrophs. The cellular activity, including cell growth can be growing aerobic, microaerophilic, or anaerobic. The cells can be in any phase of growth, including lag (or conduction), exponential, transition, stationary, death, dormant, vegetative, sporulating, etc.

[0087] The term "external source" as it relates to a quantity of an enzyme or enzymes provided to a product or a process means that the quantity of the enzyme or enzymes is not produced by a

microorganism in the product or process. An external source of an enzyme can include, but is not limited to an enzyme provided in purified form, cell extracts, culture medium or an enzyme obtained from a commercially available source. [0088] The term "plant polysaccharide" as used herein has its ordinary meaning as known to those skilled in the art and can comprise one or more carbohydrate polymers of sugars and sugar derivatives as well as derivatives of sugar polymers and/or other polymeric materials that occur in plant matter.

Examples of plant polysaccharides include lignin, cellulose, starch, pectin, and hemicellulose. Other examples include chitin, sulfonated polysaccharides such as alginic acid, agarose, carrageenan, porphyran, furcelleran and funoran. Generally, the polysaccharide can have two or more sugar units or derivatives of sugar units. The sugar units and/or derivatives of sugar units can repeat in a regular pattern, or non-regular pattern. The sugar units can be hexose units or pentose units, or combinations of these. The derivatives of sugar units can be sugar alcohols, sugar acids, amino sugars, etc. The polysaccharides can be linear, branched, cross-linked, or a mixture thereof. One type or class of polysaccharide can be cross- linked to another type or class of polysaccharide.

[0089] The term "fermentable sugars" as used herein has its ordinary meaning as known to those skilled in the art and can include one or more sugars and/or sugar derivatives that can be used as a carbon source by the microorganism, including monomers, dimers, and polymers of these compounds including two or more of these compounds. In some cases, the microorganism can break down these polymers, such as by hydrolysis, prior to incorporating the broken down material. Examples of fermentable sugars include, but are not limited to glucose, xylose, arabinose, galactose, mannose, rhamnose, cellobiose, lactose, sucrose, maltose, and fructose.

[0090] The term "saccharification" as used herein has its ordinary meaning as known to those skilled in the art and can include conversion of plant polysaccharides to lower molecular weight species that can be used by the microorganism at hand. For some microorganisms, this would include conversion to monosaccharides, disaccharides, trisaccharides, and oligosaccharides of up to about seven monomer units, as well as similar sized chains of sugar derivatives and combinations of sugars and sugar derivatives. For some microorganisms, the allowable chain-length can be longer (e.g. 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 monomer units or more) and for some microorganisms the allowable chain-length can be shorter (e.g. 1, 2, 3, 4, 5, 6, or 7 monomer units).

[0091] The term "carbonaceous biomass" as used herein has its ordinary meaning as known to those skilled in the art and can include one or more biological material that can be converted into a biofuel, chemical or other product. Carbonaceous biomass can comprise municipal waste, wood, plant material, plant matter, plant extract, a natural or synthetic polymer, or a combination thereof.

[0092] Plant matter can include, but is not limited to, woody plant matter, non- woody plant matter, cellulosic material, lignocellulosic material, hemicellulosic material, carbohydrates, pectin, starch, inulin, fructans, glucans, corn, corn stover, sugar cane, grasses, stillage, leaves, switch grass, bamboo, sorghum, high biomass sorghum, algae and material derived from these. Plant matter can be derived from a genetically modified plant.

[0093] As used herein, the term "plant part" or "plant tissue" includes plant cells, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, scions and plant cells that are intact in plants or parts of plants such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruit, kernels, ears, cobs, husks, stalks, roots, root tips, anthers, and the like.

[0094] "Biomass" can include, but is not limited to, plant matter, such as woody or non- woody plant matter, crop plants, aquatic or marine biomass, fruit-based biomass such as fruit waste, and vegetable- based biomass such as vegetable waste, and animal based biomass among others. Examples of aquatic or marine biomass include, but are not limited to, kelp, other seaweed, algae, and marine microflora, microalgae, macroalgae, sea grass, salt marsh grasses such as Spartina sp. or Phragmites sp. and the like. The term "crop plant" includes any plant that is cultivated or harvested for the purpose of producing plant material that is sought after by man for either oral consumption, or for utilization in an industrial, pharmaceutical, or commercial process. The methods, processes, and systems of the present disclosure can be applied to any of a variety of plants, including, but not limited to maize, wheat, rice, barley, soybean, cotton, sorghum, sweet sorghum, oats, tobacco, Miscanthus grass, switchgrass, trees (softwoods and hardwoods), beans in general, rape/canola, alfalfa, flax, sunflower, safflower, millet, rye, sugarcane, sugar beet, cocoa, tea, Brassica, cotton, coffee, sweet potato, flax, peanut, clover; vegetables such as lettuce, tomato, cucurbits, cassava, potato, carrot, radish, pea, lentils, cabbage, cauliflower, broccoli, Brussels sprouts, peppers, and pineapple; tree fruits such as citrus, apples, pears, peaches, apricots, walnuts, avocado, banana, and coconut; and flowers such as orchids, carnations and roses, and nonvascular plants such as ferns, and gymnosperms such as palms. Biomass can also include plant matter derived from genetically-modified plants. In one embodiment, genetically modified algae or plants can produce hydrolytic enzymes (such as cellulases or hemicellulases or pectinases, etc.). In another embodiment, the production of hydrolytic enzymes occurs at or near the end of the genetically modified plant's life cycle. In another embodiment, the genetically modified plants are larger than unmodified plant of the same species. In another embodiment, the genetically modified plants have larger root structures than unmodified plants of the same species. In another embodiment, genetically modified plants comprise more cellulose per gram than unmodified microorganisms of the same species. In another embodiment, the genetically modified plants comprise more hemicellulose per gram than unmodified plants of the same species. In another embodiment, genetically modified plants comprise less lignin per gram than unmodified plants of the same species. In another embodiment, genetically modified plants are more resistant to stresses such as drough conditions, elevated temperatures, lower temperatures or high salt soil conditions than unmodified plants of the same species. Such biomass can encompass mutated species as well as those that initiate the breakdown of cell wall components.

[0095] In one embodiment, biomass does not include fossilized sources of carbon, such as hydrocarbons that are typically found within the top layer of the Earth's crust {e.g., natural gas, nonvolatile materials composed of almost pure carbon, like anthracite coal, etc.).

[0096] Examples of fruit and/or vegetable biomass include, but are not limited to, any source of pectin such as plant peel and pomace including citrus, orange, grapefruit, potato, tomato, grape, mango, gooseberry, carrot, sugar-beet, and apple, among others. In one embodiment, plant matter is characterized by the chemical species present, such as proteins, polysaccharides and oils. In one embodiment, plant matter includes agricultural waste byproducts or side streams such as pomace, corn steep liquor, corn steep solids, corn stover, distillers grains, Distillers Dried Solubles (DDS), Distillers Dried Grains (DDG), Condensed Distillers Solubles (CDS), Distillers Wet Grains (DWG), Distillers Dried Grains with Solubles (DDGS), peels, citrus peels, pits, fermentation waste, straw, lumber, sewage, garbage or food leftovers. These materials can come from farms, forestry, industrial sources, households, etc. In another embodiment, biomass comprises animal matter, including, for example milk, meat, fat, animal processing waste, and animal waste. The term "feedstock" is frequently used to refer to biomass being used for a process, such as those described herein.

[0097] Examples of polysaccharides, oligosaccharides, monosaccharides or other sugar components of biomass include, but are not limited to, alginate, agar, carrageenan, fucoidan, floridean starch, pectin, gluronate, mannuronate, mannitol, lyxose, cellulose, hemicellulose, glycerol, xylitol, glucose, mannose, galactose, xylose, xylan, mannan, arabinan, arabinose, glucuronate, galacturonate (including di- and tri- galacturonates), rhamnose, and the like.

[0098] The term "broth" as used herein has its ordinary meaning as known to those skilled in the art and can include the entire contents of the combination of soluble and insoluble matter, suspended matter, cells and medium, such as for example the entire contents of a fermentation reaction can be referred to as a fermentation broth.

[0099] The term "productivity" as used herein has its ordinary meaning as known to those skilled in the art and can include the mass of a material of interest produced in a given time in a given volume. Units can be, for example, grams per liter-hour, or some other combination of mass, volume, and time. In fermentation, productivity is frequently used to characterize how fast a product can be made within a given fermentation volume. The volume can be referenced to the total volume of the fermentation vessel, the working volume of the fermentation vessel, or the actual volume of broth being fermented. The context of the phrase will indicate the meaning intended to one of skill in the art. Productivity (e.g. g/L/d) is different from "titer" (e.g. g/L) in that productivity includes a time term, and titer is analogous to concentration.

[00100] The term "biocatalyst" as used herein has its ordinary meaning as known to those skilled in the art and can include one or more enzymes and/or microorganisms, including solutions, suspensions, and mixtures of enzymes and microorganisms. Also included are the enzymes incorporated in biomass, such as modified plants or algae. In some contexts this word will refer to the possible use of either enzymes or microorganisms to serve a particular function, in other contexts the word will refer to the combined use of the two, and in other contexts the word will refer to only one of the two. The context of the phrase will indicate the meaning intended to one of skill in the art.

[00101] The terms "conversion efficiency" or "yield" as used herein have their ordinary meaning as known to those skilled in the art and can include the mass of product made from a mass of substrate. The term can be expressed as a percentage yield of the product from a starting mass of substrate. For the production of ethanol from glucose, the net reaction is generally accepted as:

C₆H₁₂0₆ -» 2 C₂H₅OH + 2 C0₂

and the theoretical maximum conversion efficiency or yield is 51% (wt.). Frequently, the conversion efficiency will be referenced to the theoretical maximum, for example, "80% of the theoretical maximum." In the case of conversion of glucose to ethanol, this statement would indicate a conversion efficiency of 41% (wt.). The context of the phrase will indicate the substrate and product intended to one of skill in the art. For substrates comprising a mixture of different carbon sources such as found in biomass (xylan, xylose, glucose, cellobiose, arabinose cellulose, hemicellulose etc.), the theoretical maximum conversion efficiency of the biomass to ethanol is an average of the maximum conversion efficiencies of the individual carbon source constituents weighted by the relative concentration of each carbon source. In some cases, the theoretical maximum conversion efficiency is calculated based on an assumed saccharification yield. In one embodiment, given carbon source comprising lOg of cellulose, the theoretical maximum conversion efficiency can be calculated by assuming saccharification of the cellulose to the assimilable carbon source glucose of about 75% by weight. In this embodiment, lOg of cellulose can provide 7.5g of glucose which can provide a maximum theoretical conversion efficiency of about 7.5g_*51% or 3.8g of ethanol. In other cases, the efficiency of the saccharification step can be calculated or determined, e.g., saccharification yield. Saccharification yields can include between about 10-100%, about 20-90%, about 30-80%, about 40-70% or about 50-60%, such as about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or about 100% for any carbohydrate carbon sources larger than a single monosaccharide subunit.

[00102] The saccharification yield takes into account the amount of ethanol, and acidic products produced plus the amount of residual monomeric sugars detected in the media. The ethanol figures resulting from media components are not adjusted in this experiment. These can account for up to 3 g/1 ethanol production or equivalent of up to 6g/l sugar as much as +/- 10%- 15% saccharification yield (or saccharification efficiency). For this reason the saccharification yield % can be greater than 100%) for some plots.

[00103] The terms "pretreatment" or "pretreated" as used herein refer to any mechanical, chemical, thermal, biochemical process or combination of these processes whether in a combined step or performed sequentially, that achieves disruption or expansion of a biomass so as to render the biomass more susceptible to attack by enzymes and/or microbes. In some embodiments, pretreatment can include removal or disruption of lignin so is to make the cellulose and hemicellulose polymers in the plant biomass more available to cellulolytic enzymes and/or microbes, for example, by treatment with acid or base. In some embodiments, pretreatment can include the use of a microorganism of one type to render plant polysaccharides more accessible to microorganisms of another type. In some embodiments, pretreatment can also include disruption or expansion of cellulosic and/or hemicellulosic material. Steam explosion, and ammonia fiber expansion (or explosion) (AFEX) are well known thermal/chemical techniques. Hydrolysis, including methods that utilize acids and/or enzymes can be used. Other thermal, chemical, biochemical, enzymatic techniques can also be used. For example, other chemicals can be added to neutralize or detoxify the biomass or saccharide streams resulting from earlier pretreatment.

[00104] The terms "fed-batch" or "fed-batch fermentation" as used herein has its ordinary meaning as known to those skilled in the art and can include a method of culturing microorganisms where nutrients, other medium components, or biocatalysts (including, for example, enzymes, fresh microorganisms, extracellular broth, etc.) are supplied to the fermentor during cultivation, but culture broth is not harvested from the fermentor until the end of the fermentation, although it can also include "self seeding" or "partial harvest" techniques where a portion of the fermentor volume is harvested and then fresh medium is added to the remaining broth in the fermentor, with at least a portion of the inoculum being the broth that was left in the fermentor. In some embodiments, a fed-batch process might be referred to with a phrase such as, "fed-batch with cell augmentation." This phrase can include an operation where nutrients and microbial cells are added or one where microbial cells with no substantial amount of nutrients are added. The more general phrase "fed-batch" encompasses these operations as well. The context where any of these phrases is used will indicate to one of skill in the art the techniques being considered.

[00105] The term "SSF" as used herein, refers to simultaneous saccharification fermentation. The term "SHF" means sequential hydrolysis followed by subsequent fermentation.

[00106] A term "phytate" as used herein has its ordinary meaning as known to those skilled in the art can be include phytic acid, its salts, and its combined forms as well as combinations of these.

[00107] The term "recombinant" as used herein, refers to a microorganism is genetically modified to comprise one or more heterologous or endogenous nucleic acid molecules. Such nucleic acid molecules can be comprised extrachromosomally or integrated into the chromosome of a microorganism. The term "non-recombinant" means a microorganism is not genetically modified. For example, a recombinant microorganism can be modified to overexpress an endogenous gene encoding an enzyme through modification of promoter elements (e.g., replacing an endogenous promoter element with a constitutive or highly active promoter). Alternatively, a recombinant microorganism can be modified by introducing a heterologous or another copy of an endogenous nucleic acid molecule encoding a protein that is not otherwise expressed in the host microorganism.

[00108] The term "sugar compounds" as used herein has its ordinary meaning as known to those skilled in the art and can include monosaccharide sugars, including but not limited to hexoses and pentoses; sugar alcohols; sugar acids; sugar amines; compounds containing two or more of these linked together directly or indirectly through covalent or ionic bonds; and mixtures thereof. Included within this description are disaccharides; trisaccharides; oligosaccharides; polysaccharides; and sugar chains, branched and/or linear, of any length.

[00109] Generally, compositions and methods are provided for enzyme conditioning of feedstock or biomass to allow saccharification and fermentation to one or more industrially useful fermentive end- products.

[00110] In one aspect one or more products are provided for production of a biofuel from biomass.

[00111] Enzyme-assisted fermentation typically involves mixtures of enzymes, derived from several microorganisms, which are added during saccharification steps in order to improve end-product yield during fermentation by increasing hydrolysis. This can be an expensive proposition since mixes of enzymes are expensive and affect the final cost of a biofuel produced by a fermentation processes.

[00112] As demonstrated in the disclosure herein, it was observed that for certain enzyme-assisted cocktails tested at various concentrations, certain enzymes did not substantially affect saccharification and fermentation of the biomass tested. Furthermore, the enzyme cocktail (Novozymes A/S, Krogshoejvej, 36, 2880, Bagsvaerd, Denmark) is recommended for use at IX. However, by increasing dosing of enzymes to double that of recommended dosage (Fig. 1A demonstrates that various concentrations of a cocktail mix, e.g., 0.25X to 2X) no significant difference in ethanol production is observed in a simultaneous saccharification and fermentation. At 25% the recommended dosage more than 80% fermentation (as compared to full dosing) is observed. In addition, the non-enzyme assisted fermentation achieved only about 20%> of theoretical yield.

[00113] Fig. IB illustrates the performance of the individual enzyme components of the cocktail mix used in Fig. 1 A, and were supplied at IX. The results demonstrate that none of the individual components performed as well as the cocktail mixture. However, the results also demonstrate that individually, β- glucosidase, xylanase and hemicellulase did not enhance ethanol production. Cellulase alone (NS50013, Novozymes, supra) resulted in greater than 63%> yield relative to theoretical yield. Furthermore, a β- glucanase/xylanase mix that contains cellulase and hemicellulase activity also enhanced ethanol production.

[00114] Genetically modified biomass

[00115] In one embodiment, one or more fermentation end-products are produced by one or more microorganisms through the fermentation of biomass derived from genetically modified plants or algae. In one embodiment, the fermentation end-products include one or more alcohols (e.g., methanol, ethanol, butanol, propanol, etc.), one or more organic acids (e.g., acetic acid, lactic acid, formic acid, citric acid, succinic acid, pyruvic acid, etc.), one or more carbonyl compounds (e.g., acetone, formaldehyde, 1- propanol, 1, 2-propanediol, 1, 3 -propanediol, etc.), one or more enzymes (e.g., cellulases,

polysaccharases, lipases, proteases, ligninases, hemicellulases, etc.), one or more saccharides (e.g., arabinose, lyxose, ribose, xylose, rhamnose, ribulose, xylulose, allose, altrose, glucose, mannose, idose, galactose, talose, psicose, fructose, sorbose, tagatose, sucrose, lactulose, lactose, maltose, trehalose, cellobiose, laminaribiose, maltulose, isomaltulose, mannobiose, melibiose, melibiulose, rutinose, xylobiose, isomaltotriose, maltotriose, raffinose, arabinoxylan, cellulose, cellodextrin, xylan, glucuronoxylan, glucomannan, xyloglucan, etc), or a combination thereof. In one embodiment, the fermentation end-products comprise one or more alcohols. In another embodiment, the fermenatation end-products comprise ethanol. In one embodiment, the microorganisms comprise bacteria, yeast, non- yeast fungi, or a combination thereof. In one embodiment, at least one microorganism can ferment C5 sugars. In another embodiment, at least one microorganism can ferment C6 sugars. In another embodiment, at least one microorganism can hydrolyze and ferment hemicellulose or lignocellulose. In one embodiment, at least one microorganism is a Clostridium strain. In another embodiment, the Clostridium strain is Clostridium phytofermentans , Clostridium sp. Q.D, or a variant thereof. In one embodiment, the biomass comprises cellulose, hemicellulose, lignocellulose, or a combination thereof.

[00116] In one embodiment, a genetically modified plant or algae comprises one or more genetic modifications that enhance the ability to produce fermentation end-products from the plant. In one embodiment, the genetic modifications comprise one or more heterologous polynucleotides that encode for endogenous proteins; for example, an extra copy of one or more endogenous genes or a naturally occurring variant of a gene that is selected for a beneficial phenotype. In another embodiment, the genetic modifications comprise one or more polynucleotides that encode for exogenous proteins; for example, proteins from another plant or animal. In another embodiment, the genetic modifications comprise one or more polynucleotides that encode for recombinant proteins; for example, a temperature sensitive protein or enzyme, a protein or enzyme with altered cellular localization, etc. In one embodiment, the heterologous polynucleotides contain a promoter that enables for beneficial translation of the encoded protein; for example, a promoter that alters a tissue expression pattern, an inducible promoter, a promoter that turns on expression of the proteins later in the life cycle of the plant or algae, a promoter that increases the expression of the proteins, etc.

[00117] Genetically modified plant cells, algae cells, plants, or algae comprising an exogenous or endogenous polynucleotide can be generated using a method of DNA delivery known to one skilled in the art (see for example "Plant genetic transformation and gene expression; a laboratory manual", Draper J. et al. Eds. Blackwell Scientific Publications, 1988). DNA delivery methods include, but are not limited to: Agrobacterium-mediated transfection; biolistic DNA delivery; electrop oration of protoplasts; direct DNA uptake; PEG treatment of protoplast; UV laser microbeam; Gemini virus vectors; liposome-mediated DNA uptake; calcium phosphate treatment of protoplasts; agitation of cell suspensions with microbeads coated with the transforming DNA; or microinjection of DNA. In a non- limiting example, Agrobacterium can be used for dicotyledonous plants such as canola since it secures stable transformation. The methods using Agrobacterium can include an intermediate vector method using a wild-type tumor plasmid (nature, 287(1980) p. 654; Cell, 32 (1983) p. 1033; EMBO J., 3 (1984) p. 1525), an intermediate vector method using a vector deficient of a tumor formation gene region of T-DNA (EMBO J., 2 (1983) p. 2143;

Bio/Technoloy, 3(1985) p. 629), a binary vector method (Bio/Technology, 1 (1983) p. 262; Nature, 303 (1983) p. 179; Nucl. Acids Res., 12 (1984) p. 8711) and the like. Methods in which plants are infected with Agrobacterium can include direct inoculation to cultured cells, protoplast co-cultivation, and a leaf- disk method. A leaf-disk method can be convenient in many cases for producing a large number of transformed plants in a direct and easy way.

[00118] In one embodiment, a genetically modified plant or algae comprises one or more genetic modifications that enhance the ability to produce fermentation end-products from the plantor algae, wherein the genetic modifications increase a yield of biomass that can be harvested from a crop of the genetically modified plant or algae in comparison to a crop of an unmodified plant or algae of the same species. In one embodiment, the genetic modification enables the genetically modified plant or algae to grow more rapidly than the unmodified plant or algae. In another embodiment, the genetic modification enables the genetically modified plant or algae to grow to a larger size than the unmodified plant or algae. In another embodiment, the genetic modification enables the genetically modified plant to develop a larger root structure than the unmodified plant. In one embodiment, the larger root structure enables the plant to more efficiently uptake nutrients from soil. In another embodiment, the larger root structure enables the plant to more efficiently extract water from soil. In one embodiment, the crop of the genetically modified plant requires less fertilizer than the crop of the unmodified plant. In another embodiment, the crop of the genetically modified plant requires less irrigation than the crop of the unmodified plant. In one embodiment, the crop of the genetically modified plant can be grown at a higher density than the crop of the unmodified plant.

[00119] In one embodiment, a genetically modified plant or algae comprises one or more genetic modifications that enhance the abililty to produce fermentation end-products from the plant, wherein the genetic modifications alters the chemical composition of the genetically modified plant or algae in comparison to an unmodified plant or algae of the same species. In one embodiment, the genetically modified plant or algae produces more cellulose per gram of mass than the unmodified plant or algae; for example, between about 1% and about 300% more cellulose per gram of mass (e.g., about 1-300%), 1- 200%, 1-100%, 1-75%, 1-50%, 1-25%, 1-10%, 10-300%, 10-200%, 10-100%, 10-75%, 10-50%, 10-25%, 25-300%, 25-200%, 25-100%, 25-75%, 25-50%, 50-300%, 50-200%, 50-100%, 50-75%, 75-300%, 75- 200%, 75-100%, 100-300%, 100-200%, 200-300%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 225%, 250%), 275%), 300%)). In another embodiment, the genetically modified plant or algae produces more hemicellulose per gram of mass than the unmodified plant or algae; for example, between about 1%> and about 300% more cellulose per gram of mass (e.g., about 1-300%, 1-200%, 1-100%, 1-75%, 1-50%, 1- 25%, 1-10%, 10-300%, 10-200%, 10-100%, 10-75%, 10-50%, 10-25%, 25-300%, 25-200%, 25-100%, 25-75%, 25-50%, 50-300%, 50-200%, 50-100%, 50-75%, 75-300%, 75-200%, 75-100%, 100-300%, 100- 200%, 200-300%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 225%, 250%, 275%, 300%). In another embodiment, the genetically modified plant or algae produces less lignin per gram of mass than the unmodified plant or algae; for example, between about 1% and 100%) less lignin per gram of mass (e.g., about 1-100%, 1-75%, 1-50%, 1-25%, 1-10%, 10-100%, 10-75%, 10-50%, 10-25%, 25-100%, 25-75%, 25-50%, 50-100%, 50-75%, 75-100%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, 100%). In another embodiment, the genetically modified plant or algae produces more sugars per gram of mass than the unmodified plant or algae; for example, between about 1% and 300%> more sugars per gram of mass (e.g., about 1-300%), 1-200%), 1- 100%, 1-75%, 1-50%, 1-25%, 1-10%, 10-300%, 10-200%, 10-100%, 10-75%, 10-50%, 10-25%, 25- 300%, 25-200%, 25-100%, 25-75%, 25-50%, 50-300%, 50-200%, 50-100%, 50-75%, 75-300%, 75- 200%, 75-100%, 100-300%, 100-200%, 200-300%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 225%, 250%, 275%, 300%).

[00120] In one embodiment, a genetically modified plant comprises one or more genetic modifications that increase the genetically modified plant or algae's resistance to stresses in comparison to an unmodified plant or algae of the same species. In one embodiment, the genetically modified plant or algae is more resistance to drought than the unmodified plant or algae. In another embodiment, the genetically modified plant or algae recovers from drought conditions more rapidly than the unmodified plant. In another embodiment, the genetically modified plant or algae can survive at a temperature that would kill or stunt the growth of the unmodified plant. In one embodiment, the temperature is an elevated temperature (e.g., heat). In another embodiment, the termperature is a decreased temperature (e.g., cold). In one embodiment, the genetically modified plant or algae can grow in soil that contains a level of one or more salts that would dehydrate the unmodified plant or algae.

[00121] In one embodiment, a genetically modified plant or algae has a lack of or a reduction in expression of one or more proteins. In another embodiment, a genetically modified plant or algae has increased gene expression of one or more proteins.

[00122] In one embodiment, the type of plant or algae selected for genetic modification depends on one or more factors, including but not limited to the downstream use of the harvested plant or algae material, amenability of the plant or algae species to transformation, or the conditions under which the plant or algae will be grown, harvested, and/or processed. One of skill will further recognize that one or more additional factors for selecting appropriate plant or algae varieties for use in the methods, processes, and systems of the present disclosure can include high yield potential, good stalk strength, resistance to specific diseases, drought tolerance, rapid dry down and/or grain quality sufficient to allow storage and shipment to market with minimum loss. In one embodiment, a genetically modified plant or algae has reduced or lacks expression of lignin, phenolic compounds, pectin or cell wall protein.

[00123] In another embodiment, a genetically modified plant, (including an alga) expresses one or more cell wall degrading enzymes. In another embodiment, a genetically modified plant or algae expresses one or more enzymes useful for fermentation process including amylases (e.g. alpha amylases), proteases, pullulanases, isoamylases, cellulases, hemicellulases, xylanases, glucuronidases, cyclodextrin

glycotransferases, lipases, phytases, laccases, oxidases, peroxidases, esterases, cutinases, granular starch hydrolyzing enzyme and other glucoamylases, and , glucanases or glucosidases, pectinases, For example, xylanases have been identified and characterized in many fungi and bacteria. See, e.g. U.S. patent No. 5,437,992, U.S. patent application publ. No. 2005/0208178, U.S. patent application No. 2010/0159510 Al, and WO03/16654, each of which is hereby incorporated by reference in its entirety. Such transgenic plants or algae can be very useful for generating, for example, fermentation feedstocks for bioprocessing.

[00124] In one embodiment, the polysaccharide-degrading enzyme includes: starch degrading enzymes such as .alpha.-amylases (EC 3.2.1.1), glucuronidases (E.C. 3.2.1.131); exo- 1,4-a-D glucanases such as amyloglucosidases and glucoamylase (EC 3.2.1.3), β-amylases (EC 3.2.1.2), a-glucosidases (EC

3.2.1.20), and other exo-amylases; and starch debranching enzymes, such as a) isoamylase (EC 3.2.1.68), pullulanase (EC 3.2.1.41), and the like; b) cellulases such as exo-l,4-3-cellobiohydrolase (EC 3.2.1.91), exo-l,3" -D-glucanase (EC 3.2.1.39), β-glucosidase (EC 3.2.1.21); c) L-arabinases, such as endo-l,5-a- L-arabinase (EC 3.2.1.99), a-arabinosidases (EC 3.2.1.55) and the like; d) galactanases such as endo-1,4- β-D-galactanase (EC 3.2.1.89), endo-l,3^-D-galactanase (EC 3.2.1.90), a-galactosidase (EC 3.2.1.22), β- galactosidase (EC 3.2.1.23) and the like; e) mannanases, such as endo-l,4^-D-mannanase (EC 3.2.1.78), β-mannosidase (EC 3.2.1.25), a-mannosidase (EC 3.2.1.24) and the like; f) xylanases, such as endo-1,4- β-xylanase (EC 3.2.1.8), β-D-xylosidase (EC 3.2.1.37), l,3^-D-xylanase, and the like; g) other enzymes such as a-L-fucosidase (EC 3.2.1.51), a-L-rhamnosidase (EC 3.2.1.40), levanase (EC 3.2.1.65), inulanase (EC 3.2.1.7), and the like.

[00125] Another embodiment of the present disclosure encompasses the expression and accumulation of one or more heterologous starch degrading enzymes such as glucoamylase and amylase in the harvested plant or algae material for downstream use in, for example, ethanol production. Glucoamylases (a- 1,4- glucan glucohydrolases, E.C.3.2. 1.3.) are starch hydrolyzing exo-acting carbohydrases. Glucoamylases catalyze the removal of successive glucose units from the non-reducing ends of starch or related oligo and polysaccharide molecules and can hydrolyze both linear and branched glucosidic linkages of starch (amylose and amylopectin). The term "alpha-amylase (e.g., E.C. class 3.2.1.1 )" refers to enzymes that catalyze the hydrolysis of a-l,4-glucosidic linkages. These enzymes have also been described as those effecting the exo or endohydro lysis of 1,4-a-D-glucosidic linkages in polysaccharides containing 1,4-a- linked D-glucose units. Another term used to describe these enzymes is "glycogenase." Example of enzymes include a-l,4-glucan 4-glucanohydrase glucanohydrolase. Commercially, glucoamylases and amylases are enzymes that have been used in a wide variety of applications requiring the hydrolysis of starch.

[00126] Further additional enzymes which can be used include proteases, such as fungal and bacterial proteases. Fungal proteases include, for example, those obtained from Aspergillus, Trichoderma, Mucor and Rhizopus, such as A. niger, A. awamori, A. oryzae and M. miehei. Of particular interest in the present disclosure are cellobiohydrolase (CBH) enzymes (EC 3.2.1.91). Cellulases are enzymes capable of hydrolyzing the l,4^-D-glycosidic linkages in cellulose. Other enzymes include, but are not limited to, hemicellulases, such as mannases and arabinofuranosidases (EC 3.2.1.55); ligninases; lipases (e.g., E.C. 3.1.1.3), glucose oxidases, pectinases, xylanases, transglucosidases, alpha 1,6 glucosidases (e.g., E.C. 3.2.1.20); esterases such as ferulic acid esterase (EC 3.1.1.73) and acetyl xylan esterases (EC 3.1.1.72); and cutinases (e.g. E.C. 3.1.1.74).

[00127] C. phytofermentans produces over 160 cell wall degrading enzymes, including glycoside hydrolases, glycosyl transferases, polysaccharide lyases, carbohydrate esterases and CBM proteins. Any of the genes encoding these enzymes can be transferred to biomass plants and algae. Clostridium sp. Q.D produces a similar array of enzymes useful for incorporation into biomass plants and algae.

[00128] The choice of one or more enzymes can depend on the substrate specificity and/or the desired end-product for downstream use (e.g., enzymes with improved properties such as thermostability, acid stability, and the like). It will be recognized that any enzyme known in the art to perform one of the desired functions described herein can be used in the constructs of the present disclosure.

[00129] In one embodiment, the genetically modified plant or algae sequesters one or more enzymes so that the one or more enzymes do not digest their target protein until after the genetically modified plant or algae is harvested, for example, in a vacuole. Without being limiting, see, e.g., U.S. patent application Publ. No. US 2009/0193541 Al, which is hereby incorporated by reference in its entirety. Vacuoles can be protein storage vacuoles or lytic vacuoles. In another embodiment, a genetically modified plant expresses an enzyme in an inactive form, which can be subsequently activated. In one embodiment, the enzyme is subsequently activated by heat, change in pH, or addition of a chemical. In another embodiment, a genetically modified plant or algae expresses an enzyme and an enzyme activity modulator. In another embodiment, a genetically modified plant or algae expresses an enzyme and an inhibitor of enzyme activity. In another embodiment, a genetically modified plant or algae expresses an enzyme and an enzyme activity enhancer.

[00130] In one embodiment, a genetically modified plant or algae is modified with a transgene. A transgene herein refers to a gene that has been transferred from another species or bred to the genetically modified plant or algae. The transgene can comprise a promoter element, a structural element, and a selectable marker gene, for example, in the context of a vector. The promoter element provides for initiation of protein translation. The selectable marker gene provides a means for selecting a plant expressing the transgene of interest. The structural region encodes the protein of interest. In a further embodiment, a genetically modified plant or algae comprises a transgenic cell wall degrading enzyme.

[00131] In one embodiment, a useful transgenic plant or algae includes a plant or algae that is transgenic for at least a polynucleotide encoding a vacuole-targeted polypeptide of interest. One of skill in the art will recognize that a plant or algae may express one or more additional polypeptide sequences associated with or contributing to one or more secondary trait(s) of interest. The polypeptide can be cytoplasmically-expressed, targeted to a subcellular organelle, or secreted by the plant or algae cells. Secondary traits of interest include an agronomic trait that primarily is of benefit to a seed company, a grower, or a grain processor, for example, herbicide resistance, virus resistance, bacterial pathogen resistance, insect resistance, nematode resistance, and fungal resistance. See, e.g., U.S. Pat. Nos. 5,569,823; 5,304,730; 5,495,071 ; 6,329,504; and 6,337,431, each of which is hereby incorporated by reference in its entireties. A secondary trait of interest can also be one that increases plant or algae vigor or yield (including traits that allow a plant or algae to grow at different temperatures, soil conditions and levels of sunlight and precipitation), or one that allows identification of a plant or algae exhibiting a trait of interest (e.g., selectable marker gene, seed coat color, etc.). A plethora of genes useful for generating plants or algae with desired secondary traits are available in the art.

[00132] In one embodiment, gene expression can be regulated by an inducible promoter. The regulation can be from an exogenous source, such as a chemical fed to the plant, or from an endogenous source, such as a tissue-specific promoter. Expression of one or more proteins of interest can be controlled so that their subcellular localization is controlled in a manner suitable to generating a fermentation end-product. For example, an enzyme of interest can have an amino acid targeting region added to it which directs it to specific vesicular bodies, permitting release of the enzyme of interest under conditions to selectively disrupt the vesicles. In another embodiment, expression one or more proteins of interest can be regulated by an inducible promoter. In another embodiment, expression one or more proteins of interest can be regulated by a constitutive promoter.

[00133] A genetically modified plant can be generated by culturing one or more transformed plant cells in known media such as Murashige-Skooge medium that can be supplemented with selection antibiotics and/or plant growth hormones. Rooted seedlings are transplanted into soil and cultured for growth into regenerated plants.

[00134] The level of expression of one or more transgenes can vary depending on the position and number of transgenes inserted into a nuclear genome. In one embodiment, a genetically modified plant or algae can be generated that expresses one or more transgenes. In one embodiment, the one or more transgenes encode one or more enzymes, such as enzymes that degrade cell wall proteins. In one embodiment, a transgene encodes a cellulase, hemicellulase, xylanase, lipase, pectinase, glucanase or glucosidase.

[00135] In one embodiment, cells and tissues of a transgenic plant or algae are provided. In another embodiment, a transgenic plant or algae or its progeny can be used to transfer a gene of interest into other genotypes, cultivars, varieties and the like, through cross-breeding and selection. Thus a great variety of hybrid plants and algae carrying recombinant nucleic acids can be used.

[00136] In another embodiment, a transgenic plant or algae is provided where a transgene encodes for a protein that affects the expression or activity of one more enzymes, such as enyzmes that degrade cell wall proteins. In one embodiment, a transgene encodes an enzyme that can digest a cell wall protein of a plant or algae. In on embodiment, a transgene encodes a endoglucanases, exoglucanases,

cellobiohydrolases (CBH), beta-glucosidases, glycoside hydrolases, glycosyltransferases, lyases, and esterases active against components of cellulose, hemicelluloses, pectin, and starch, in the hydrolysis of high molecular weight components; e.g., Cphy l 163, Cphy_ 3367, Cphy_3368, Cphy_3202, and Cphy_2058. [00137] In one embodiment, a genetically modified plant or algae has increased cellulase activity. In one embodiment, a genetically modified plant or algae has increased cellulase activity that improves the utility of genetically modified plant or algae matter as a substrate for hydrolysis in a process for generating a fermentation end-product, such as a biofuel or chemical, as compared to a non- genetically modified plant or algae. In one embodiment, a transgenic plant or algae can be any plant useful for commercial production. In another embodiment, a transgenic plant is constructed from a plant or algae which is produced in large quantities. In one embodiment, the transgenic plant is processed to produce a substantial amount of leaves and stalks as a byproduct. In another embodiment, a genetically modified plant is grass, grain, maize, wheat, barley, rye, hop, hemp, rice, potato, soybean, sorghum, switchgrass, miscanthus, high biomass sorghum, corn, citrus, sugarcane, clover, tobacco, alfalfa, arabidopsis, coniferous tree, or deciduous trees.

[00138] In one embodiment, feedstock is saccharified by a microorganism to produce a fermentation end-product such as ethanol. In one embodiment, the microorganism is genetically modified so that it comprises one or more polynucleotides that encode one or more cellulases or hydrolases. In one embodiment, the one or more polynucleotides are heterologous. In another embodiment, the

microorganism is genetically modified so that it comprises one or more additional copies of a polynucleotide that encodes an endogenous cellulase or hydrolase as compared to the wild-type microorganism.

[00139] In one embodiment, feedstock is saccharified by a microorganism that is a Clostridium strain, a Trichoderma strain, a Saccharomyces strain, a Zymomonas strain, or another microorganism suitable for fermentation of biomass. In another embodiment, feedstock is saccharified by a microorganism that is Clostridium phytofermentans , Clostridium sp. Q.D, Clostridium algidixylanolyticum, Clostridium xylanolyticum, Clostridium cellulovorans, Clostridium cellulolyticum, Clostridium thermocellum, Clostridium josui, Clostridium papyrosolvens, Clostridium cellobioparum, Clostridium hungatei, Clostridium cellulosi, Clostridium stercorarium, Clostridium termitidis, Clostridium thermocopriae, Clostridium celerecrescens, Clostridium polysaccharolyticum, Clostridium populeti, Clostridium lentocellum, Clostridium chartatabidum, Clostridium aldrichii, Clostridium herbivorans, Acetivibrio cellulolyticus, Bacteroides cellulosolvens, Caldicellulosiruptor saccharolyticum, Ruminococcus albus, Ruminococcus flavefaciens, Fibrobacter succinogenes , Eubacterium cellulosolvens, Butyrivibrio fibrisolvens, Anaerocellum thermophilum, Halocella cellulolytica, Thermoanaerobacterium

thermosaccharolyticum, Sacharophagus degradans, or Thermoanaerobacterium saccharolyticum.

[00140] In another embodiment, feedstock is saccharified by a microorganism that is a Clostridium strain. In another embodiment, feedstock is saccharified by a microorganism that is Clostridium phytofermentans or Clostridium sp. Q.D.

[00141] Clostridium sp. Q.D is described in U.S. serial No. 61/327,051, which is herein incorporated by reference in its entirety. Clostridium sp. Q.D forms moist, shiny, beige, opaque, irregular or undulate colonies. The cells are entire, small, short rods, diplo or chains, motile, and form subterminal endospores. Q.D is able to utilize crystalline cellulose as a carbon source, and can form ethanol and acetic acid as major end-products. Clostridium sp. Q.D is a gram-positive bacterium, deposited under NRRL Accession No. NRRL B-50361 at the Agricultural Research Service Culture Collection, an International Depositary Authority, (National Center for Agricultural Utilization Research, U.S. Department of Agriculture, 1815 North University Street, Peoria, IL 61604 U.S.A.) , wherein the bacterium is an anaerobic, obligate mesophile that produces colonies that are beige pigmented, wherein the bacterium can use

polysaccharides as a sole carbon source and can reduce acetaldehyde into ethanol. The 16S rRNA gene sequence from Clostridium sp. Q.D shares 90% similarity to Clostridium phytofermentans, but is closer to Clostridium algidixylanolyticum starin SPL73 (99%), Clostridium sp. U201 (99%), and swine fecal bacterium strain RF3G-Cel2 (99%). Clostridium sp. Q.D can hydrolyze polysaccharides and higher saccharides that contain hexose sugar units, pentose sugar units, or that contain both, into lower saccharides and in some cases monosaccharides.

[00142] The wild-type strain of C. phytofermentans and eight lactate dehydrogenase derivative strains (LDH knockout strains) were deposited in the AGRICULTURAL RESEARCH SERVICE CULTURE COLLECTION (NRRL)(International Depositary Authority), National Center for Agricultural Utilization Research, Agricultural Research Service, U.S. Department of Agriculture, 1815 North University Street, Peoria, Illinois 61604 U.S.A. on March 9, 2010 in accordance with and under the provisions of the Budapest Treaty for the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure, e.g., they will be stored with all the care necessary to keep them viable and

uncontaminated for a period of at least five years after the most recent request for the furnishing of a sample of the deposits, and in any case, for a period of at least 30 (thirty) years after the date of deposit or for the enforceable life of any patent which may issue disclosing the cultures plus five years after the last request for a sample from the deposit. The strains were tested by the NRRL and determined to be viable. The NRRL has assigned the following NRRL deposit accession numbers to strains: C. phytofermentans Q8 (NRRL B-50351), C. phytofermentans 1 1 17-1 ( NRRL B-50352), C. phytofermentans 1 1 17-2 (NRRL B-50353), C. phytofermentans 1 1 17-3 (NRRL B-50354), C. phytofermentans 1 1 17-4 (NRRL B-50355), C. phytofermentans 1232-1 (NRRL B-50356), C. phytofermentans 1232-4 (NRRL B-50357), C.

phytofermentans 1232-5 (NRRL B-50358), and C. phytofermentans 1232-6 (NRRL B-50359).

[00143] Additional C. phytofermentans strains and derivatives were deposited in the NRRL in accordance with and under the provisions of the Budapest treaty. The NRRL has assigned the following NRRL deposit accession numbers to strains: Clostridium sp. Q.D (NRRL B-50361), Clostridium sp. Q.D-5 (NRRL B-50362), Clostridium sp. Q.D-7 (NRRL B-50363), Clostridium phytofermentans Q O (NRRL B-50364), all of which were deposited on April 9, 2010; Clostridium phytofermentans Q.12 (NRRL B- 50436) and Clostridium phytofermentans QA 3 (NRRL B-50437), deposited on November 3, 2010;

Clostridium phytofermentans Q.27 (NRRL B-50498), deposited on April 28, 201 1.

[00144] The depositor acknowledges the duty to replace the deposits should the depository be unable to furnish a sample when requested, due to the condition of the deposits. All restrictions on the availability to the public of the subject culture deposits will be irrevocably removed upon the granting of a patent disclosing them. The deposits are available as required by foreign patent laws in countries wherein counterparts of the subject application, or its progeny, are filed. However, it should be understood that the availability of a deposit does not constitute a license to practice the subject matter disclosed herein in derogation of patent rights granted by governmental action.

[00145] In one embodiment, a synergistic effect is observed with respect to saccharification yield when utilizing an organism that is capable of direct saccharification, e.g., C. phytofermentans or Clostridium sp. Q.D and an external source of a cellulase to achieve saccharification and fermentation (Fig. 2), such as complete saccharification and fermentation. In other words, the presence of cellulase enhances the effects of C. phytofermentans saccharification so that the resulting hydrolysis is better than expected from the addition of the two.

[00146] Saccharification yield of feedstock contacted with C. phytofermentans is generally not affected by the addition of an external source of β-glucosidase. The non-microbe innoculated reactions exhibited poor saccharification yield. The pH of the reactions was at about pH 6.5 and the temperature was about 35°C. Saccharification yield can be enhanced by decreasing pH to about 5.4 and increasing temperature to about 65°C. This result indicates that β-glucosidase can be excluded when adding an external source of enzymes to enhance saccharification and fermentation of feedstock.

[00147] Furthermore, various dosages of a hydrolytic enzyme cocktail (from 0.25 to 2X) result in theoretical ethanol conversions (Fig. 3A) that are similar. In addition, the curves for individual enzyme augmentations illustrate the impact of cellulase additions and also clearly demonstrate the ineffectiveness of B-glucosidase, xylanase and hemicelluloses additions (Fig. 3B). Figure 3 A and 3B correspond to the experiments illustrated in Figures 1A and IB, but are different in providing FPUs (Filter Paper Units) for hydrolytic enzymes or cellulases that are present in the cocktail mix.

[00148] When examining saccharification with and without a microbe, the extent of hydrolysis using enzyme alone resulted in a reduced saccharification yield, e.g., 16.8% (Fig. 4).

[00149] Furthermore, reducing dosages from 1.68 FPU/gram of glucan to lower than about 0.4 FPU resulted in proportional reduction to 0.168 FPU and 0.084 FPU loadings (Fig. 5).

[00150] Utilization of cellulases as the external source for enhancing saccharification and the fermentation yield can provide a substantial improvement in rate and yield of cellulose utilization by supplementation of additional endo-glucanase activity. The addition of a cellulase enzyme alone obviates the requirement of other enzymes for the saccharification of polysaccharides in a C5/C6 fermenting microorganism. In fact, small amounts of a cellulase synergistically enhance the rate of hydrolysis of C6 sugars so that biofuel production is more rapid and more efficient. This discovery will significantly reduce the cost of producing biofuels such as ethanol, hydrogen, methane and the like.

[00151] Clostridium phytofermentans is one microorganism that can simultaneously hydrolyze and ferment hexose (C6) and pentose (C5) polysaccharides. This microorganism has a complement of enzymes to adapt to any biomass substrate. However, the hydrolysis of cellulose in the naturally- occurring microorganism is initially slower than desirable for cost-effective production of biofuels.

Unlike other microorganisms, β-glucosidase does not enhance the hydrolysis of cellulose in this microorganism. In one embodiment, there is substantial improvement in the rate and yield of cellulose utilization for a microrganism by upregulation or supplementation of additional endo-glucanase activity. The addition of small amounts of a cellulase enzyme alone synergistically enhance the rate of hydrolysis of C6 sugars in C. phytofermentans and increases the yield of fermentation end-products. In a similar manner, small amounts of a cellulase enzyme synergistically enhance the rate of saccharification in Clostridium, sp. Q.D.

[00152] In one embodiment, a product for production of a biofuel comprises: a carbonaceous biomass, a microorganism that is capable of direct hydrolysis and fermentation of said biomass, and an external source of one or more enzymes that are capable of enhancing said hydrolysis, wherein said one or more enzymes do not include a xylanase, a hemicellulase, a glucanase or glucosidase, and wherein said external source is not said microorganism.

[00153] In another embodiment, a product for production of a biofuel is provided comprising: a carbonaceous biomass, a microorganism that is capable of direct hydrolysis and fermentation of said biomass, wherein said microorganism is modified to provide enhanced activity of one or more cellulases.

[00154] In another embodiment, a product for production of fermentive end-products comprises: (a) a fermentation vessel comprising a carbonaceous biomass; (b) a microorganism that is capable of direct hydrolysis and fermentation of said biomass; and (c) a source of one or more enzymes that is external to said microorganism, wherein said one or more enzymes do not include a xylanase, a hemicellulase, a glucanase or glucosidase; wherein the fermentation vessel is adapted to provide suitable conditions for fermentation of one or more carbohydrates into fermentive end-products.

[00155] In one embodiment, a microorganism is capable of direct fermentation of C5 (five carbon chain polysaccharide) and/or C6 (six carbon chain polysaccharide) carbohydrates. In one embodiment, such a capability is achieved through modifying the microorganism to express one or more genes encoding proteins associated with C5 and C6 carbohydrate metabolization.

[00156] Microorganisms that can be used in a composition or method disclosed herein include but are not limited to bacteria, yeast or fungi. In some embodiments, two or more different microorganisms can be used during saccharification and/or fermentation processes to produce an end-product.

Microorganisms used can be recombinant, non-recombinant or wild type.

[00157] In one embodiment, a microorganism used in a composition or method disclosed herein is a strain of Clostridia. The strain can be C. acetobutylicum, C. bejeirinckii, C. saccharoperbutylacetonicum, C. butylicum, C. butyricum, C. perfringens, C. tetani, C. sporogenes, C. thermocellum, C. saccarolyticum (now Thermoanaerobacter saccarolyticum), C. thermosulfurogenes (now Thermoanaerobacter thermosulfurigenes), C. thermohydrosulfuricum (now Thermoanaerobacter ethanolicus), C. sp. Q.D, and C. phytofermentans. In one embodiment, the microorganism is Clostridium phytofermentans. In another embodiment, the microorganism is C. sp. Q.D. [00158] In one embodiment, a microorganism can be modified to comprise one or more heterologous polynucleotides that enhance enzyme function. In one embodiment, enzymatic function is increased for one or more cellulase enzymes or other hydrolases.

[00159] In another embodiment, a microrganism can be modified to comprise one or more additional copies of an endogenous polynucleotide that encodes a protein. In one embodiment, the protein is a cellulase enzyme. In another embodiment, the protein is a hydrolase enzyme. In another embodiment, a microrganism can be modified to comprise more than one additional copy of an endogenous

polynucleotide that encodes a protein.

[00160] In another embodiment, a microorganism can be capable of uptake of one or more complex carbohydrates from a biomass (e.g., biomass comprises a higher concentration of oligomeric

carbohydrates relative to monomeric carbohydrates).

[00161] In one embodiment, one or more enzymes from an external source (e.g., enzymes provided in purified form, cell extracts, culture medium or commercially available source) is added to a product or process disclosed herein.

[00162] In one embodiment, a product or a process is disclosed for producing an end-product from biomass, a carbonaceous biomass is contacted with: (1) a microorganism that is capable of direct hydrolysis and fermentation of said biomass, and/or (2) an external source of one or more enzymes that are capable of enhancing said hydrolysis, wherein said one or more enzymes do not include a xylanase, a hemicellulase, a glucanase or glucosidase, and wherein said external source is not said microorganism; thereby producing a fermentive medium; and allowing sufficient time for said hydrolysis and

fermentation to produce a biofuel.

[00163] Furthermore, a microorganism that is used with or without an external source of one or more enzymes, can itself be modified to enhance enzyme function of one or more enzymes associated with hydro lyzation of biomass, fermentation of a polysaccharide or monosaccharide, or both.

[00164] Enzyme activity can also be enhanced by modifying conditions in a reaction vessel, including but not limited to time, pH of a culture medium, temperature, concentration of nutrients and/or catalyst, or a combination thereof.

[00165] A reaction vessel can be configured to separate one or more desired end-products.

[00166] Enzymes added externally can be in an amount from about 0.5 FPU/gram cellulose to about 20 FPU/gram cellulose, about 0.5 FPU/gram cellulose to about 40 FPU/gram cellulose, about 10 to about 30 FPU/gram cellulose, about 15 to about 25 FPU/gram cellulose, or about 20 to about 40 FPU/gram cellulose. In various embodiments, one or more cellulase enzymes can be added to a product or process disclosed herein to enhance saccharification and increase substrates available for fermentation.

[00167] In one embodiment, a modified microorganism can have enhanced activity of an enzyme that is equivalent to addition of said cellulases in an amount sufficient to provide activity of about 0.5 FPU/gram cellulose to about 20 FPU/gram cellulose, about 0.5 FPU to about 40 FPU/gram cellulose, about 10 to about 30 FPU/gram cellulose, about 15 to about 25 FPU/gram cellulose, or about 20 to about 40

FPU/gram cellulose.

[00168] In one embodiment, a product or process can provide hydrolysis of a biomass resulting in a greater concentration of cellobiose relative to monomeric carboyhdrates. Such monomeric carbohydrates can comprise glucose, xylose and arabinose.

[00169] In one embodiment, batch fermentation with a microorganism and of a mixture of hexose and pentose saccharides can provide uptake rates of about 0.1, 0.2, 0.4, 0.5, 0.6 0.7, 0.8, 1, 2, 3, 4, 5, or about 6 g/L/h or more of hexose (e.g. glucose, cellulose, cellobiose etc.), and about 0.1, 0.2, 0.4, 0.5, 0.6 0.7, 0.8, 1, 2, 3, 4, 5, or about 6 g/L/h or more of pentose (xylose, xylan, hemicellulose etc.). For example, either C. phytofermentans or C. sp. Q.D is capable of direct fermentation of C5 and C6 sugars.

[00170] In another embodiment, a product or process disclosed herein can produce about 15 g/L, about 20g/L, about 25g/L, about 30 g/L, about 35 g/L, about 40 g/L, about 45 g/L, about 50 g/L, about 60 g/L, about 70 g/L, about 80 g/L, or about 100 g/L production of ethanol. Such levels of ethanol can be observed in 10, 20, 30, 40, 50 or 60 hours of fermentation. In some embodiments the ethanol

productivities provided by a process of the disclosed herein is due to the simultaneous fermentation of hexose and pentose saccharides.

[00171] Production of high levels of alcohol from biomass requires the ability for the microorganism to thrive generally in the presence of elevated alcohol levels, the ability to continue to produce alcohol without undue inhibition or suppression by the alcohol and/or other components present, and the ability to efficiently convert the multitude of different hexose and pentose carbon sources found in a biomass feedstock.

[00172] Fermentation at reduced pH and/or with the addition of fatty acids can result in about a three to five to 10 fold or higher increase in the ethanol production rate. In some embodiments, simultaneous fermentation of both hexose and pentose saccharides can also enable increases in ethanol productivity and/or yield. In some cases, the simultaneous fermentation of hexose and pentose carbohydrate substrates can be used in combination with fermentation at reduced pH and/or with the addition of fatty acids to further increase productivity, and/or yield.

[00173] Biomass

[00174] In one embodiment, a microorganism (e.g., Clostridium phytofermentans) is contacted with pretreated or non-pretreated feedstock containing cellulosic, hemicellulosic, and/or lignocellulosic material. One or more additional nutrients can be present or added to the biomass material to be processed by the microorganism including nitrogen-containing compounds such as amino acids, proteins, hydrolyzed proteins, ammonia, urea, nitrate, nitrite, soy, soy derivatives, casein, casein derivatives, milk powder, milk derivatives, whey, yeast extract, hydrolyze yeast, autolyzed yeast, corn steep liquor, corn steep solids, monosodium glutamate, and/or other fermentation nitrogen sources, vitamins, and/or mineral supplements. In one embodiment, one or more additional lower molecular weight carbon sources can be added or be present such as glucose, sucrose, maltose, corn syrup, Distillers Dried Solubles (DDS), Distillers Dried Grains (DDG), Condensed Distillers Solubles (CDS), Distillers Wet Grains (DWG), Distillers Dried Grains with Solubles (DDGS), lactic acid, etc. Such lower molecular weight carbon sources can serve multiple functions including providing an initial carbon source at the start of the fermentation period, help build cell count, control the carbon/nitrogen ratio, remove excess nitrogen, or some other function.

[00175] In one embodiment, aerobic/anaerobic cycling is employed for the bioconversion of cellulosic/lignocellulosic material to fuels and chemicals. In one embodiment, the anaerobic

microorganism can ferment biomass directly without the need of a pretreatment. In one embodiment, feedstocks are contacted with biocatalysts capable of breaking down plant-derived polymeric material into lower molecular weight products that can subsequently be transformed by biocatalysts to fuels and/or other desirable chemicals. In some embodiments pretreatment methods can include treatment under conditions of high or low pH. High or low pH treatment includes, but is not limited to, treatment using concentrated acids or concentrated alkali, or treatment using dilute acids or dilute alkali. Alkaline compositions useful for treatment of biomass in the methods of the present disclosure include, but are not limited to, caustic, such as caustic lime, caustic soda, caustic potash, sodium, potassium, or calcium hydroxide, or calcium oxide. In one embodiment, suitable amounts of alkaline useful for the treatment of biomass ranges from O.Olg to 3g of alkaline (e.g. caustic) for every gram of biomass to be treated. In one embodiment, suitable amounts of alkaline useful for the treatment of biomass include, but are not limited to, about O.Olg of alkaline (e.g. caustic), 0.02g, 0.03g, 0.04g, 0.05g, 0.075g, O. lg, 0.2g, 0.3g, 0.4g, 0.5g, 0.75g, lg, 2g, or about 3g of alkaline (e.g. caustic) for every gram of biomass to be treated.

[00176] In another embodiment, pretreatment of biomass comprises dilute acid hydrolysis. Example of dilute acid hydrolysis treatment are disclosed in T. A. Lloyd and C. E Wyman, Bioresource Technology, (2005) 96, 1967), incorporated by reference herein in its entirety. In other embodiments, pretreatment of biomass comprises pH controlled liquid hot water treatment. Examples of pH controlled liquid hot water treatments are disclosed in N. Mosier et al., Bioresource Technology, (2005) 96, 1986, incorporated by reference herein in its entirety. In another embodiment, pretreatment of biomass comprises aqueous ammonia recycle process (ARP). Examples of aqueous ammonia recycle process are described in T. H. Kim and Y. Y. Lee, Bioresource Technology, (2005)96, 2007, incorporated by reference herein in its entirety.

[00177] In another embodiment, the above-mentioned methods have two steps: a pretreatment step that leads to a wash stream, and an enzymatic hydrolysis step of pretreated-biomass that produces a hydrolyzate stream. In the above methods, the pH at which the pretreatment step can be carried out increases progressively from dilute acid hydrolysis to hot water pretreatment to alkaline reagent based methods (AFEX, ARP, and lime pretreatments). Dilute acid and hot water treatment methods solubilize mostly hemicellulose, whereas methods employing alkaline reagents remove most lignin during the pretreatment step. As a result, the wash stream from the pretreatment step in the former methods contains mostly hemicellulose-based sugars, whereas this stream has mostly lignin for the high-pH methods. The subsequent enzymatic hydrolysis of the residual feedstock leads to mixed sugars (C5 and C6) in the alkali-based pretreatment methods, while glucose is the major product in the hydrolysate from the low and neutral pH methods. The enzymatic digestibility of the residual biomass is somewhat better for the high-pH methods due to the removal of lignin that can interfere with the accessibility of cellulase enzyme to cellulose. In some instances, pretreatment results in removal of 30%, 40%, 50%, 60%, 70% or more of the lignin component of the feedstock. In other instances, more than 40%, 50%, 60%, 70%, 80% or more of the hemicellulose component of the feedstock remains after pretreatment. In some embodiments, the microorganism (e.g., C. phytofermentans) is capable of fermenting both five-carbon and six-carbon sugars, which can be present in the feedstock, or can result from the enzymatic degradation of components of the feedstock.

[00178] In another embodiment, a two-step pretreatment is used to remove C5 polysaccharides and other components. After washing, the second step can comprise of an alkali treatment to remove lignin components. The pretreated biomass can then be washed prior to saccharification and fermentation.

[00179] In another embodiment, pretreatment of biomass comprises ionic liquid pretreatment. Biomass can be pretreated by incubation with an ionic liquid, followed by extraction with a wash solvent such as alcohol or water. The treated biomass can then be separated from the ionic liquid/wash-solvent solution by centrifugation or filtration, and sent to the saccharification reactor or vessel. Examples of ionic liquid pretreatment are disclosed in US publication No. 2008/0227162, incorporated herein by reference in its entirety.

[00180] Examples of pretreatment methods are disclosed in U.S. Patent No. 4600590 to Dale, U.S. Patent No. 4644060 to Chou, U.S. Patent No. 5037663 to Dale. U.S. Patent No. 5171592 to Holtzapple, et al., et al, U.S. Patent No. 5939544 to Karstens, et al, U.S. Patent No. 5473061 to Bredereck, et al, U.S. Patent No. 6416621 to Karstens., U.S. Patent No. 6106888 to Dale, et al, U.S. Patent No. 6176176 to Dale, et al, PCT publication WO2008/020901 to Dale, et al, Felix, A., et al, Anim. Prod. 51, 47-61 (1990)., Wais, A.C., Jr., et al, Journal of Animal Science, 35, No. 1,109-112 (1972), which are incorporated herein by reference in their entireties.

[00181] In one embodiment, after pretreatment by any of the above methods the feedstock contains cellulose, hemicellulose, soluble oligomers, simple sugars, lignins, volatiles and/or ash. The parameters of the pretreatment can be changed to vary the concentration of the components of the pretreated feedstock. For example, in some embodiments a pretreatment is chosen so that the concentration of hemicellulose and/or soluble oligomers is high and the concentration of lignins is low after pretreatment. Examples of parameters of the pretreatment include temperature, pressure, time, and pH.

[00182] In one embodiment, the parameters of the pretreatment are changed to vary the concentration of the components of the pretreated feedstock such that concentration of the components in the pretreated stock is optimal for fermentation with a microbe such as C. phytofermentans.

[00183] In one embodiment, the parameters of the pretreatment are changed such that concentration of accessible cellulose in the pretreated feedstock is 1%, 5%, 10%, 12%, 13%, 14%, 15%, 16%, 17%, 19%, 20%, 30%), 40%) or 50%>. In some embodiments, the parameters of the pretreatment are changed such that concentration of accessible cellulose in the pretreated feedstock is 5%> to 30%. In one embodiment, the parameters of the pretreatment are changed such that concentration of accessible cellulose in the pretreated feedstock is 10% to 20%.

[00184] In one embodiment, the parameters of the pretreatment are changed such that concentration of hemicellulose in the pretreated feedstock is 1%, 5%, 10%, 12%, 13%, 14%, 15%, 16%, 17%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 40% or 50%. In some embodiments, the parameters of the pretreatment are changed such that concentration of hemicellulose in the pretreated feedstock is 5%> to 40%>. In some embodiments, the parameters of the pretreatment are changed such that concentration of hemicellulose in the pretreated feedstock is 10%> to 30%>.

[00185] In one embodiment, the parameters of the pretreatment are changed such that concentration of soluble oligomers in the pretreated feedstock is 1%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%. Examples of soluble oligomers include, but are not limited to, cellobiose and xylobiose. In one embodiment, the parameters of the pretreatment are changed such that concentration of soluble oligomers in the pretreated feedstock is 30%> to 90%>. In one embodiment, the parameters of the pretreatment are changed such that concentration of soluble oligomers in the pretreated feedstock is 45% to 80%. In one embodiment, the parameters of the pretreatment are changed such that concentration of soluble oligomers in the pretreated feedstock is 45% to 80% and the soluble oligomers are primarily cellobiose and xylobiose.

[00186] In one embodiment, the parameters of the pretreatment are changed such that concentration of simple sugars in the pretreated feedstock is 1%, 5%, 10%, 12%, 13%, 14%, 15%, 16%, 17%, 19%, 20%, 30%), 40%) or 50%). In some embodiments, the parameters of the pretreatment are changed such that concentration of simple sugars in the pretreated feedstock is 0% to 20%. In one embodiment, the parameters of the pretreatment are changed such that concentration of simple sugars in the pretreated feedstock is 0% to 5%. Examples of simple sugars include, but are not limited to, C5 and C6 monomers and dimers.

[00187] In one embodiment, the parameters of the pretreatment are changed such that concentration of lignins in the pretreated feedstock is 1%, 5%, 10%, 12%, 13%, 14%, 15%, 16%, 17%, 19%, 20%, 30%, 40%) or 50%). In one embodiment, the parameters of the pretreatment are changed such that concentration of lignins in the pretreated feedstock is 0% to 20%. In one embodiment, the parameters of the pretreatment are changed such that concentration of lignins in the pretreated feedstock is 0% to 5%. In one embodiment, the parameters of the pretreatment are changed such that concentration of lignins in the pretreated feedstock is less than 1% to 2%. In one embodiment, the parameters of the pretreatment are changed such that the concentration of phenolics is minimized.

[00188] In one embodiment, the parameters of the pretreatment are changed such that concentration of furfural and low molecular weight lignins in the pretreated feedstock is less than 10%, 9%, 8%, 7%, 6%, 5%), 4%o, 3%), 2%o, or 1%. In one embodiment, the parameters of the pretreatment are changed such that concentration of furfural and low molecular weight lignins in the pretreated feedstock is less than 1% to 2%.

[00189] In one embodiment, the parameters of the pretreatment are changed such that concentration of accessible cellulose is 10% to 20 %, the concentration of hemicellulose is 10% to 30%, the concentration of soluble oligomers is 45% to 80%, the concentration of simple sugars is 0% to 5%, and the

concentration of lignins is 0% to 5% and the concentration of furfural and low molecular weight lignins in the pretreated feedstock is less than 1% to 2%.

[00190] In one embodiment, the parameters of the pretreatment are changed to obtain a high concentration of hemicellulose (e.g., 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% or higher) and a low concentration of lignins (e.g., 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, or 30%). In one embodiment, the parameters of the pretreatment are changed to obtain a high concentration of hemicellulose and a low concentration of lignins such that concentration of the components in the pretreated stock is optimal for fermentation with a microbe such as C. phytofermentans.

[00191] Certain conditions of pretreatment can be modified prior to, or concurrently with, introduction of a fermentative microorganism into the feedstock. For example, pretreated feedstock can be cooled to a temperature which allows for growth of the microorganism(s). As another example, pH can be altered prior to, or concurrently with, addition of one or more microorganisms.

[00192] Alteration of the pH of a pretreated feedstock can be accomplished by washing the feedstock (e.g., with water) one or more times to remove an alkaline or acidic substance, or other substance used or produced during pretreatment. Washing can comprise exposing the pretreated feedstock to an equal volume of water 2, 3, 4, 5, 6, 7 , 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more times. In another embodiment, a pH modifier can be added. For example, an acid, a buffer, or a material that reacts with other materials present can be added to modulate the pH of the feedstock. In one embodiment, more than one pH modifier can be used, such as one or more bases, one or more bases with one or more buffers, one or more acids, one or more acids with one or more buffers, or one or more buffers. When more than one pH modifiers are utilized, they can be added at the same time or at different times. Other non- limiting exemplary methods for neutralizing feedstocks treated with alkaline substances have been described, for example in U.S. Patent Nos. 4,048,341 ; 4,182,780; and 5,693,296.

[00193] In one embodiment, one or more acids can be combined, resulting in a buffer. Suitable acids and buffers that can be used as pH modifiers include any liquid or gaseous acid that is compatible with the microorganism. Non- limiting examples include peroxyacetic acid, sulfuric acid, lactic acid, citric acid, phosphoric acid, and hydrochloric acid. In some instances, the pH can be lowered to neutral pH or acidic pH, for example a pH of 7.0, 6.5, 6.0, 5.5, 5.0, 4.5, 4.0, or lower. In some embodiments, the pH is lowered and/or maintained within a range of about pH 4.5 to about 7.1, or about 4.5 to about 6.9, or about pH 5.0 to about 6.3, or about pH 5.5 to about 6.3, or about pH 6.0 to about 6.5, or about pH 5.5 to about 6.9 or about pH 6.2 to about 6.7. [00194] In another embodiment, biomass can be pre-treated at an elevated temperature and/or pressure. In one embodiment, biomass is pre treated at a temperature range of 20°C to 400°C. In another embodiment, biomass is pretreated at a temperature of about 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, 80°C, 90°C, 100°C, 120°C, 150°C, 200°C, 250°C, 300°C ,350°C, 400°C or higher. In another embodiment, elevated temperatures are provided by the use of steam, hot water, or hot gases. In one embodiment, steam can be injected into a biomass containing vessel. In another embodiment, the steam, hot water, or hot gas can be injected into a vessel jacket such that it heats, but does not directly contact the biomass.

[00195] In another embodiment, a biomass can be treated at an elevated pressure. In one embodiment, biomass is pre treated at a pressure range of about lpsi to about 30psi. In another embodiment, biomass is pre treated at a pressure or about lpsi, 2psi, 3psi, 4psi, 5psi, 6psi, 7psi, 8psi, 9psi, lOpsi, 12psi, 15psi, 18psi, 20psi, 22psi, 24psi, 26psi, 28psi, 30psi or more. In some embodiments, biomass can be treated with elevated pressures by the injection of steam into a biomass containing vessel. In one embodiment, the biomass can be treated to vacuum conditions prior or subsequent to alkaline or acid treatment or any other treatment methods provided herein.

[00196] In one embodiment, alkaline or acid pretreated biomass is washed (e.g. with water (hot or cold) or other solvent such as alcohol (e.g. ethanol)), pH neutralized with an acid, base, or buffering agent (e.g. phosphate, citrate, borate, or carbonate salt) or dried prior to fermentation. In one embodiment, the drying step can be performed under vacuum to increase the rate of evaporation of water or other solvents.

Alternatively, or additionally, the drying step can be performed at elevated temperatures such as about 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, 80°C, 90°C, 100°C, 120°C, 150°C, 200°C, 250°C, 300°C or more.

[00197] In one embodiment, the pretreatment step includes a step of solids recovery. The solids recovery step can be during or after pretreatment (e.g., acid or alkali pretreatment), or before the drying step. In one embodiment, the solids recovery step includes the use of a sieve, filter, screen, or a membrane for separating the liquid and solids fractions. In one embodiment, a suitable sieve pore diameter size ranges from about 0.001 microns to 8mm, such as about 0.005microns to 3mm or about 0.01 microns to lmm. In one embodiment, a sieve pore size has a pore diameter of about O.Olmicrons, 0.02 microns, 0.05 microns, 0.1 microns, 0.5 microns, 1 micron, 2 microns, 4 microns, 5 microns, 10 microns, 20 microns, 25 microns, 50 microns, 75 microns, 100 microns, 125 microns, 150 microns, 200 microns, 250 microns, 300 microns, 400 microns, 500 microns, 750 microns, lmm or more.

[00198] In one embodiment, biomass (e.g. corn stover) is processed or pretreated prior to fermentation. In one embodiment, a method of pre-treatment includes but is not limited to, biomass particle size reduction, such as for example shredding, milling, chipping, crushing, grinding, or pulverizing. In one embodiment, biomass particle size reduction can include size separation methods such as sieving, or other suitable methods known in the art to separate materials based on size. In one embodiment, size separation can provide for enhanced yields. In one embodiment, separation of finely shredded biomass (e.g. particles smaller than about 8 mm in diameter, such as, 8, 7.9, 7.7, 7.5, 7.3, 7, 6.9, 6.7, 6.5, 6.3, 6, 5.9, 5.7, 5.5, 5.3, 5, 4.9, 4.7, 4.5, 4.3, 4, 3.9, 3.7, 3.5, 3.3, 3, 2.9, 2.7, 2.5, 2.3, 2, 1.9, 1.7, 1.5, 1.3, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, or 0.1 mm) from larger particles allows the recycling of the larger particles back into the size reduction process, thereby increasing the final yield of processed biomass. In one embodiment, a fermentative mixture is provided which comprises a pretreated lignocellulosic feedstock comprising less than about 50% of a lignin component present in the feedstock prior to pretreatment and comprising more than about 60% of a hemicellulose component present in the feedstock prior to pretreatment; and a microorganism capable of fermenting a five-carbon sugar, such as xylose, arabinose or a combination thereof, and a six-carbon sugar, such as glucose, galactose, mannose or a combination thereof. In some instances, pretreatment of the lignocellulosic feedstock comprises adding an alkaline substance which raises the pH to an alkaline level, for example NaOH. In one embodiment, NaOH is added at a concentration of about 0.5%> to about 2%> by weight of the feedstock. In one embodiment, pretreatment also comprises addition of a chelating agent. In one embodiment, the microorganism is a bacterium, such as a member of the genus Clostridium, for example Clostridium phytofermentans or Clostridium sp. Q.D.

[00199] The present disclosure also provides a fermentative mixture comprising: a cellulosic feedstock pre-treated with an alkaline substance which maintains an alkaline pH, and at a temperature of from about 80°C to about 120°C; and a microorganism capable of fermenting a five-carbon sugar and a six-carbon sugar. In one embodiment, the five-carbon sugar is xylose, arabinose, or a combination thereof. In one embodiment, the six-carbon sugar is glucose, galactose, mannose, or a combination thereof. In one embodiment, the alkaline substance is NaOH. In some embodiments, NaOH is added at a concentration of about 0.5%) to about 2%> by weight of the feedstock. In one embodiment, the microorganism is a bacterium, such as a member of the genus Clostridium, for example Clostridium phytofermentans or Clostridium sp. Q.D. In still another embodiment, the microorganism is genetically modified to enhance activity of one or more hydrolytic enzymes.

[00200] Further provided herein is a fermentative mixture comprising a cellulosic feedstock pre-treated with an alkaline substance which increases the pH to an alkaline level, at a temperature of from about 80°C to about 120°C; and a microorganism capable of uptake and fermentation of an oligosaccharide. In one embodiment, the alkaline substance is NaOH. In some embodiments, NaOH is added at a concentration of about 0.5%> to about 2%> by weight of the feedstock. In one embodiment, the

microorganism is a bacterium, such as a member of the genus Clostridium, for example Clostridium phytofermentans or Clostridium sp. Q.D. In one embodiment, the microorganism is genetically modified to express or increase expression of an enzyme capable of hydro lyzing said oligosaccharide, a transporter capable of transporting the oligosaccharide, or a combination thereof.

[00201] Another aspect of the present disclosure provides a fermentative mixture comprising a cellulosic feedstock comprising cellulosic material from at least two sources, wherein said feedstock is pre-treated with a substance which increases the pH to an alkaline level, at a temperature of from about 80°C to about 120°C; and a microorganism capable of fermenting said cellulosic material from at least two different sources to produce a fermentive product at substantially a same yield coefficient. In one embodiment, the sources of cellulosic material are corn stover, bagasse, switchgrass or poplar. In one embodiment, the alkaline substance is NaOH. In one embodiment, NaOH is added at a concentration of about 0.5% to about 2% by weight of the feedstock. In one embodiment, the microorganism is a bacterium, such as a member of the genus Clostridium, for example Clostridium phytofermentans .

[00202] In one embodiment, a process for simultaneous saccharification and fermentation of cellulosic solids from biomass into biofuel or another end-product is provided. The process can comprise treating the biomass in a closed container with a microorganism under conditions where the microorganism produces saccharolytic enzymes sufficient to substantially convert the biomass into oligomers, monosaccharides and disaccharides. The organism can subsequently convert the oligomers,

monosaccharides and disaccharides into ethanol and/or another biofuel or product.

[00203] In an alternative embodiment, a process for saccharification and fermentation comprises treating the biomass in a container with the microorganism and adding one or more enzymes before, concurrent or after contacting the biomass with the microorganism, wherein the enzymes added aid in the breakdown or detoxification of carbohydrates or lignocellulosic material.

[00204] In one embodiment, enzymes added do not include a xylanase, a hemicellulase, a glucanase or glucosidase. In other embodiments, the amount of exogenous cellulase is greatly reduced, one-quarter or less of the amount normally added to a fermentation wherein the organism cannot saccharify the biomass.

[00205] Examples of second cultures include but are not limited to Saccharomyces cerevisiae, Clostridia species such as C. thermocellum, C. acetobutylicum, and C. cellovorans, and Zymomonas mobilis.

[00206] In one embodiment, a process of producing a biofuel from a lignin-containing biomass is provided. In one embodiment, the process comprises: 1) contacting the lignin-containing biomass with an aqueous alkaline solution at a concentration sufficient to hydrolyze at least a portion of the lignin- containing biomass; 2) neutralizing the treated biomass to a pH between 5 to 9 {e.g. 5.5, 6, 6.5, 7, 7.5, 8, 8.5, or 9); 3) treating the biomass in a closed container with a Clostridium phytofermentans or a

Clostridium sp. Q.D bacterium under conditions wherein the Clostridium phytofermentans or the Clostridium sp. Q.D, optionally with the addition of one or more enzymes to the container, substantially converts the treated biomass into oligomers, monosaccharides and disaccharides, and/or biofuel or other fermentation end-product; and 4) optionally, introducing a culture of a second microorganism wherein the second microorganism is capable of substantially converting the oligomers, monosaccharides and disaccharides into biofuel.

[00207] Biofuel plant and process of producing biofuel

[00208] In one aspect, provided herein is a fuel plant that includes a hydrolysis unit configured to hydrolyze a biomass material that includes a high molecular weight carbohydrate, and a fermentor configured to house a medium and contains microorganisms dispersed therein. In one embodiment, the microorganism is Clostridium phytofermentans. In another embodiment, it is Clostridium sp. Q.D. [00209] In another aspect, provided herein are methods of making a fuel or chemical end product that includes combining a microorganism (such as Clostridium phytofermentans cells,

Clostridium sp. Q.D cells, or a similar C5/C6 Clostridium species) and a lignocellulosic material (and/or other biomass material) in a medium, and fermenting the lignocellulosic material under conditions and for a time sufficient to produce a fermentation end-product, such as a fuel ( e.g., ethanol, propanol, methane or hydrogen).

[00210] In one embodiment, a process is provided for producing a fermentation end-product (such as ethanol or hydrogen) from biomass using acid hydrolysis pretreatment. In some embodiments, a process is provided for producing a fermentation end-product (such as ethanol or hydrogen) from biomass using enzymatic hydrolysis pretreatment. In another embodiment, a process is provided for producing a fermentation end-product (such as ethanol or hydrogen) from biomass using biomass that has not been enzymatically pretreated. In another embodiment, a process is provided for producing a fermentation end- product (such as ethanol or hydrogen) from biomass using biomass that has not been chemically or enzymatically pretreated, but is optionally steam treated.

[00211] In another aspect, provided herein are end-products made by any of the processes described herein.

[00212] Those skilled in the art will appreciate that a number of modifications can be made to the methods exemplified herein. For example, a variety of promoters can be utilized to drive expression of the heterologous genes in a recombinant microorganism (such as Clostridium phytofermentans or Clostridium sp. Q.D). The skilled artisan, having the benefit of the instant disclosure, will be able to readily choose and utilize any one of the various promoters available for this purpose. Similarly, skilled artisans, as a matter of routine preference, can utilize a higher copy number plasmid. In another embodiment, constructs can be prepared for chromosomal integration of the desired genes. Chromosomal integration of foreign genes can offer several advantages over plasmid-based constructions, the latter having certain limitations for commercial processes. Ethanologenic genes have been integrated chromosomally in is. coli B; see Ohta et al. (1991) Appl. Environ. Microbiol. 57:893-900. In general, this is accomplished by purification of a DNA fragment containing (1) the desired genes upstream from an antibiotic resistance gene and (2) a fragment of homologous DNA from the target organism. This DNA can be ligated to form circles without replicons and used for transformation. Thus, the gene of interest can be introduced in a heterologous host such as E. coli, and short, random fragments can be isolated and ligated in Clostridium phytofermentans or Clostridium sp. Q.D to promote homologous recombination.

[00213] Large Scale Fermentation End-Product Production from Biomass

[00214] In one aspect a fermentation end-product {e.g., ethanol) from biomass is produced on a large scale utilizing a microorganism, such as C. phytofermentans or Clostridium sp. Q.D . In one embodiment, one first hydrolyzes a biomass material that includes high molecular weight carbohydrates to lower molecular weight carbohydrates, and then ferments the lower molecular weight carbohydrates utilizing of microbial cells to produce ethanol. In another embodiment, one ferments the biomass material itself without chemical and/or enzymatic pretreatment. In the first method, hydrolysis can be accomplished using acids, e.g., Bronsted acids (e.g., sulfuric or hydrochloric acid), bases, e.g., sodium hydroxide, hydrothermal processes, steam explosion, ammonia fiber explosion processes ("AFEX"), lime processes, enzymes, or combination of these. Hydrogen, and other products of the fermentation can be captured and purified if desired, or disposed of, e.g., by burning. For example, the hydrogen gas can be flared, or used as an energy source in the process, e.g., to drive a steam boiler, e.g., by burning. Hydrolysis and/or steam treatment of the biomass can, e.g., increase porosity and/or surface area of the biomass, often leaving the cellulosic materials more exposed to the microbial cells, which can increase fermentation rate and yield. Removal of lignin can, e.g., provide a combustible fuel for driving a boiler, and can also, e.g., increase porosity and/or surface area of the biomass, often increasing fermentation rate and yield. In some embodiments, the initial concentration of the carbohydrates in the medium is greater than 20 mM, e.g., greater than 30 mM, 50 mM, 75 mM, 100 mM, 150 mM, 200 mM, or even greater than 500 mM.

[00215] Biomass processing plant and process of producing products from biomass

[00216] In one aspect, disclosed herein are fuel plants that include a hydrolysis unit configured to hydrolyze a biomass material that includes a high molecular weight carbohydrate, a fermentor configured to house a medium with a C5/C6 hydrolyzing microorganism (e.g., Clostridium phytofermentans or Clostridium sp. Q.D ) dispersed therein, and one or more product recovery system(s) to isolate an end- product or end- products and associated by-products and co-products.

[00217] In another aspect, disclosed herein are methods of making an end- product or end- products that include combining a C5/C6 hydrolyzing microorganism (e.g., Clostridium phytofermentans or

Clostridium sp. Q.D) and a biomass feed in a medium, and fermenting the biomass material under conditions and for a time sufficient to produce a biofuel, chemical product or fermentation end-products (e.g. ethanol, propanol, hydrogen, lignin, terpenoids, and the like).

[00218] In another aspect, disclosed herin are end-products made by any of the processes described herein.

[00219] Large Scale Production of Fermentation End- Products From Biomass

[00220] Generally, there are two basic approaches to producing one or more fermentation end-products from biomass on a large scale utilizing a C5/C6 hydrolyzing microorganism (e.g., Clostridium phytofermentans or Clostridium sp. Q.D). Depending on the type of biomass and its physical

manifestation, one of the processes can comprise a milling of the carbonaceous material, via wet or dry milling, to reduce the material in size and increase the surface to volume ratio (physical modification).

[00221] In one embodiment, a biomass material comprising includes high molecular weight carbohydrates is hydrolyzed to delignify it or to separate the carbohydrate compounds from

noncarbohydrate compounds. Using a combination of heat, chemical, and/or enzymatic treatment, the hydrolyzed material can be separated to form liquid and dewatered streams, which can be separately treated and kept separate or recombined, and then ferments the lower molecular weight carbohydrates utilizing a C5/C6 hydrolyzing microorganism (e.g., Clostridium phytofermentans or Clostridium sp. Q.D ) to produce one or more chemical products. In the second method, one ferments the biomass material itself without heat, chemical, and/or enzymatic pretreatment. In the first method, hydrolysis can be accomplished using acids (e.g. sulfuric or hydrochloric acids), bases (e.g. sodium hydroxide), hydrothermal processes, ammonia fiber explosion processes ("AFEX"), lime processes, enzymes, or combination of these. Hydrolysis and/or steam treatment of the biomass can, e.g., increase porosity and/or surface area of the biomass, often leaving the cellulosic materials more exposed to a C5/C6 hydrolyzing microorganism (e.g., Clostridium phytofermentans or Clostridium sp. Q.D), which can increase fermentation rate and yield. Hydrolysis and/or steam treatment of the biomass can, e.g., produce byproducts or co-products which can be separated or treated to improve fermentation rate and yield, or used to produce power to run the process, or used as products with or without further processing. Removal of lignin can, e.g., provide a combustible fuel for driving a boiler. Gaseous (e.g., methane, hydrogen or CO₂), liquid (e.g. ethanol and organic acids), or solid (e.g. lignin), products of the fermentation can be captured and purified if desired, or disposed of, e.g., by burning. For example, the hydrogen gas can be flared, or used as an energy source in the process, e.g., to drive a steam boiler, e.g., by burning. Products exiting the fermentor can be further processed, e.g. ethanol can be transferred to distillation and rectification, producing a concentrated ethanol mixture or solids can be separated for use to provide energy or as chemical products.

[00222] In one embodiment, the treatment includes a step of treatment with acid. In some embodiments, the acid is dilute. In one embodiment, the acid treatment is carried out at elevated temperatures of between about 85 and 140°C. In one embodiment, the method further comprises the recovery of the acid treated biomass solids, for example by use of a sieve. In one embodiment, the sieve comprises openings of approximately 150-250 microns in diameter. In one embodiment, the method further comprises washing the acid treated biomass with water or other solvents. In one embodiment, the method further comprises neutralizing the acid with alkali. In one embodiment, the method further comprises drying the acid treated biomass. In one embodiment, the drying step is carried out at elevated temperatures between about 15-45°C. In one embodiment, the liquid portion of the separated material is further treated to remove toxic materials. In one embodiment, the liquid portion is separated from the solid and then fermented separately. In one embodiment, a slurry of solids and liquids are formed from acid treatment and then fermented together.

[00223] Fig. 29 illustrates an example of a method for producing chemical products from biomass by first treating biomass with an acid at elevated temperature and pressure in a hydrolysis unit. The biomass can first be heated by addition of hot water or steam. The biomass can be acidified by bubbling gaseous sulfur dioxide through the biomass that is suspended in water, or by adding a strong acid, e.g., sulfuric, hydrochloric, or nitric acid with or without preheating/presteaming/water addition. During the acidification, the pH is maintained at a low level, e.g., below about 5. The temperature and pressure can be elevated after acid addition. In addition to the acid already in the acidification unit, optionally, a metal salt such as ferrous sulfate, ferric sulfate, ferric chloride, aluminum sulfate, aluminum chloride, magnesium sulfate, or mixtures of these can be added to aid in the hydrolysis of the biomass. The acid- impregnated biomass is fed into the hydrolysis section of the pretreatment unit. Steam is injected into the hydrolysis portion of the pretreatment unit to directly contact and heat the biomass to the desired temperature. The temperature of the biomass after steam addition is, e.g., between about 130° C and 220° C. The hydrolysate is then discharged into the flash tank portion of the pretreatment unit, and is held in the tank for a period of time to further hydrolyze the biomass, e.g., into oligosaccharides and monomeric sugars. Steam explosion can also be used to further break down biomass. Alternatively, the biomass can be subject to discharge through a pressure lock for any high-pressure pretreatment process. Hydrolysate is then discharged from the pretreatment reactor, with or without the addition of water, e.g., at solids concentrations between about 15% and 60%.

[00224] After pretreatment, the biomass can be dewatered and/or washed with a quantity of water, e.g. by squeezing or by centrifugation, or by filtration using, e.g. a countercurrent extractor, wash press, filter press, pressure filter, a screw conveyor extractor, or a vacuum belt extractor to remove acidified fluid. The acidified fluid, with or without further treatment, e.g. addition of alkali (e.g. lime) and or ammonia (e.g. ammonium phosphate), can be re-used, e.g., in the acidification portion of the pretreatment unit, or added to the fermentation, or collected for other use/treatment. Products can be derived from treatment of the acidified fluid, e.g., gypsum or ammonium phosphate. Enzymes or a mixture of enzymes can be added during pretreatment to assist, e.g. endoglucanases, exoglucanases, cellobiohydrolases (CBH), beta- glucosidases, glycoside hydrolases, glycosyltransferases, lyases, and esterases active against components of cellulose, hemicelluloses, pectin, and starch, in the hydrolysis of high molecular weight components.

[00225] The fermentor is fed with hydrolyzed biomass, any liquid fraction from biomass pretreatment, an active seed culture of Clostridium phytofermentans or Clostridium sp. Q.D cells, if desired a co- fermenting microbe, e.g., yeast or E. coli, and, if required, nutrients to promote growth of Clostridium phytofermentans or other microbes. Alternatively, the pretreated biomass or liquid fraction can be split into multiple fermentors, each containing a different strain of Clostridium phytofermentans or Clostridium sp. Q.D and/or other microbes, and each operating under specific physical conditions. Fermentation is allowed to proceed for a period of time, e.g., between about 15 and 150 hours, while maintaining a temperature of, e.g., between about 25° C and 50° C. Gas produced during the fermentation is swept from fermentor and is discharged, collected, or flared with or without additional processing, e.g. hydrogen gas can be collected and used as a power source or purified as a co-product.

[00226] After fermentation, the contents of the fermentor are transferred to product recovery. Products are extracted, e.g., ethanol is recovered through distilled and rectification.

[00227] Chemical Production From Biomass Without Pretreatment

[00228] Fig. 30 depicts a method for producing chemicals from biomass by charging biomass to a fermentation vessel. The biomass can be allowed to soak for a period of time, with or without addition of heat, water, enzymes, or acid/alkali. The pressure in the processing vessel can be maintained at or above atmospheric pressure. Acid or alkali can be added at the end of the pretreatment period for neutralization. At the end of the pretreatment period, or at the same time as pretreatment begins, an active seed culture of a C5/C6 hydrolyzing microorganism (e.g., Clostridium phytofermentans or Clostridium sp. Q.D) and, if desired, a co-fermenting microbe, e.g., yeast or E. coli, and, if required, nutrients to promote growth of a C5/C6 hydrolyzing microorganism (e.g., Clostridium phytofermentans or Clostridium sp. Q.D) are added. Fermentation is allowed to proceed as described above. After fermentation, the contents of the fermentor are transferred to product recovery as described above. Any combination of the chemical production methods and/or features can be utilized to make a hybrid production method. In any of the methods described herein, products can be removed, added, or combined at any step. A C5/C6 hydrolyzing microorganism (e.g., Clostridium phytofermentans or Clostridium sp. Q.D) can be used alone or synergistically in combination with one or more other microbes {e.g. yeasts, fungi, or other bacteria). In some embodiments different methods can be used within a single plant to produce different end-products.

[00229] In another aspect, the present disclosure provides fuel plants that includes a hydrolysis unit configured to hydrolyze a biomass material that includes a high molecular weight carbohydrate, and a fermentor configured to house a medium and contains a C5/C6 hydrolyzing microorganism {e.g., Clostridium phytofermentans or Clostridium sp. Q.D) dispersed therein.

[00230] In another aspect, the present disclosure provides methods of making a fuel or fuels that include combining a C5/C6 hydrolyzing microorganism (e.g., Clostridium phytofermentans or Clostridium sp. Q.D) and a hgnocellulosic material (and/or other biomass material) in a medium, and fermenting the hgnocellulosic material under conditions and for a time sufficient to produce a fuel or fuels, e.g., ethanol, propanol and/or hydrogen or another chemical compound.

[00231] In one embodiment, the present disclosure provides a process for producing ethanol and hydrogen from biomass using acid hydrolysis pretreatment. In some embodiments, the present disclosure provides a process for producing ethanol and hydrogen from biomass using enzymatic hydrolysis pretreatment. Other embodiments provide a process for producing ethanol and hydrogen from biomass using biomass that has not been enzymatically pretreated. Still other embodiments disclose a process for producing ethanol and hydrogen from biomass using biomass that has not been chemically or enzymatically pretreated, but is optionally steam treated.

[00232] Figure 31 discloses pretreatments that produce hexose or pentose saccharides or oligomers that are then unprocessed or processed further and either, fermented separately or together. Figure 31 A depicts a process (e.g., acid pretreatment) that produces a solids phase and a liquid phase which are then fermented separately. Figure 3 IB depicts a similar pretreatment that produces a solids phase and liquids phase. The liquids phase is separated from the solids and elements that are toxic to the fermenting microorganism are removed prior to fermentation. At initiation of fermentation, the two phases are recombined and cofermented together. This is a more cost-effective process than fermenting the phases separately. The third process (Figure 31 C) is the least costly. The pretreatment results in a slurry of liquids or solids that are then cofermented. There is little loss of saccharides component and minimal equipment required. [00233] Modification to Enhance Enzyme Activity

[00234] In one embodiment, one or more modifications hydrolysis and/or fermentation conditions can be implemented to enhance end-product production. Examples of such modifications include genetic modification to enhance enzyme activity in a microorganism that already comprises genes for encoding one or more target enzymes, introducing one or more heterogeneous nucleic acid molecules into a host microorganism to express and enhance activity of an enzyme not otherwise expressed in the host, modifying physical and chemical conditions to enhance enzyme function (e.g., modifying and/or maintaining a certain temperature, pH, nutrient concentration, temporal), or a combination of one or more such modifications.

[00235] Genetic Modification of Microorganisms

[00236] In one embodiment, a microorganism can be genetically modified to enhance enzyme activity of one or more enzymes, including but not limited to cellulase(s). Examples of such modifications include modifying endogenous nucleic acid regulatory elements to increase expression of one or more enzymes (e.g., operably linking a gene encoding a target enzyme to a strong promoter), introducing into a microorganism additional copies of endogenous nucleic acid molecules to provide enhanced activity of an enzyme by increasing its production, and operably linking genes encoding one or more enzymes to an inducible promoter or a combination thereof.

[00237] In another embodiment, a microorganism can be modified to enhance an activity of one or more cellulases, or enzymes associated with cellulose processing (e.g., Fig. 6). The classification of cellulases is usually based on grouping enzymes together that forms a family with similar or identical activity, but not necessary the same substrate specificity. One of these classifications is the CAZy system (CAZy stands for Carbohydrate- Active enZymes), for example, where there are 115 different Glycoside

Hydrolases (GH) listed, named GH1 to GH155. Each of the different protein families usually has a corresponding enzyme activity. This database includes both cellulose and hemicellulase active enzymes. Furthermore, the entire annotated genome of C. phytofermentans is available on the worldwide web at www. ncbi.nlm. nih. gov/ sites/ entrez.

[00238] Several examples of cellulase enzymes whose function can be enhanced for expression endogenously or for expression heterologously in a microorganism include one or more of the genes disclosed in Table 2.

Table 2

gi| 160427978 |gb | ABX41541.11[160427978] Cphy_1163

ABX43720 Cellulose 1,4-beta-cellobiosidase [Clostridium phytofermentans

ISDg]

gi|160430157|gb|ABX43720.1|[160430157] Cphy_3367

ABX41478 Cellulase M Cphy l lOO

ABX41884 Endo-l,4-beta-xylanase Cphy 1510

ABX43721 Cellulase 1,4-beta-cellobiosidase Cphy_3368

Mannan endo-l,4-beta-mannosidase, Cellulase 1,4-beta-

ABX42494 cellobiosidase Cphy_2128

[00239] The Glycosyl hydrolase family 9 (GH9): O-Glycosyl hydrolases are a widespread group of enzymes that hydrolyze the glycosidic bond between two or more carbohydrates, or between a carbohydrate and a non-carbohydrate moiety. A classification system for glycosyl hydrolases, based on sequence similarity, has led to the definition of 85 different families PUBMED:7624375,

PUBMED:8535779, PUBMED:. This classification is available on the CAZy (CArbohydrate-Active EnZymes) web site PUBMED. Because the fold of proteins is better conserved than their sequences, some of the families can be grouped in 'clans'. The Glycoside hydrolase family 9 comprises enzymes with several known activities, such as endoglucanase and cellobiohydrolase. In C. phytofermentans, a GH9 cellulase is ABX43720 (Table 2).

[00240] Cellulase enzyme activity can be enhanced in a microorganism. In one embodiment, a cellulase disclosed in Table 2 is enhanced in a microorganism.

[00241] In one embodiment, a hydrolytic enzyme is selected from the annotated genome of C.

phytofermentans for utilization in a product or process disclosed herein. In one embodiment, the hydrolytic enzyme is an endoglucanase, chitinase, cellobiohydrolase or endo-processive cellulases (either on reducing or non-reducing end).

[00242] In one embodiment, a microorganism, such as C. phytofermentans can be modified to enhance production of one or more cellulase or hydrolase enzymes. In another embodiment, one or more enzymes can be heterologous expressed in a host {e.g., a bacteria or yeast). For heterologous expression bacteria or yeast can be modified through recombinant technology, {e.g., Brat et al. Appl. Env. Microbio. 2009; 75(8):2304-2311, disclosing expression of xylose isomerase in S. cerevisiae and which is herein incorporated by reference in its entirety).

[00243] In another embodiment, other modifications can be made to enhance end-product (e.g., ethanol) production in a recombinant microorganism. For example, the host microorganism can further comprise an additional heterologous DNA segment, the expression product of which is a protein involved in the transport of mono- and/or oligosaccharides into the recombinant host. Likewise, additional genes from the glycolytic pathway can be incorporated into the host. In such ways, an enhanced rate of ethanol production can be achieved. [00244] A variety of promoters (e.g., constitutive promoters, inducible promoters) can be used to drive expression of the heterologous genes in a recombinant host microorganism.

[00245] Promoter elements can be selected and mobilized in a vector (e.g., pIMPCphy). For example, a transcription regulatory sequence is operably linked to gene(s) of interest (e.g., in a expression construct). The promoter can be any array of DNA sequences that interact specifically with cellular transcription factors to regulate transcription of the downstream gene. The selection of a particular promoter depends on what cell type is to be used to express the protein of interest. In one embodiment, a transcription regulatory sequences can be derived from the host microorganism. In various embodiments, constitutive or inducible promoters are selected for use in a host cell. Depending on the host cell, there are potentially hundreds of constitutive and inducible promoters which are known and that can be engineered to function in the host cell.

[00246] Promoters typically used in recombinant technology, such as E. coli lac and trp operons, the tac promoter, the bacteriophage pL promoter, bacteriophage T7 and SP6 promoters, beta-actin promoter, insulin promoter, baculo viral polyhedrin and plO promoter, can be used to initiate transcription..

[00247] In one embodiment, a constitutive promoter can be used including, but not limited to the int promoter of bacteriophage lamda, the bla promoter of the beta- lactamase gene sequence of pBR322, hydA or thlA in Clostridium, S. coelicolor hrdB, or whiE, the CAT promoter of the chloramphenicol acetyl transferase gene sequence of pPR325, Staphylococcal constitutive promoter blaZ and the like.

[00248] In another embodiment, an inducible promoter can be used that regulates the expression of downstream gene in a controlled manner, such as under a specific condition of a cell culture. Examples of inducible prokaryotic promoters include, but are not limited to, the major right and left promoters of bacteriophage, the trp, reca, lacZ, AraC and gal promoters of E. coli, the alpha-amylase (Ulmanen Ett at., J. Bacteriol. 162:176-182, 1985, which is herein incorporated by reference in its entirety) and the sigma- 28-specific promoters of B. subtilis (Gilman et al., Gene sequence 32:11-20 (1984) , which is herein incorporated by reference in its entirety), the promoters of the bacteriophages of Bacillus (Gryczan, In: The Molecular Biology of the Bacilli, Academic Press, Inc., NY (1982) , which is herein incorporated by reference in its entirety), Streptomyces promoters (Ward et at., Mol. Gen. Genet. 203:468-478, 1986, which is herein incorporated by reference in its entirety), and the like. Exemplary prokaryotic promoters are reviewed by Glick (J. Ind. Microtiot. 1 :277-282, 1987, which is herein incorporated by reference in its entirety); Cenatiempo (Biochimie 68:505-516, 1986, which is herein incorporated by reference in its entirety); and Gottesrnan (Ann. Rev. Genet. 18:415-442, 1984, which is herein incorporated by reference in its entirety).

[00249] A promoter that is constitutively active under certain culture conditions, can be inactive in other conditions. For example, the promoter of the hydA gene from Clostridium acetobutylicum, wherein expression is known to be regulated by the environmental pH. Furthermore, temperature-regulated promoters are also known and can be used. In some embodiments, depending on the desired host cell, a pH-regulated or temperature-regulated promoter can be used with an expression constructs to initiate transcription. Other pH-regulatable promoters are known, such as PI 70 functioning in lactic acid bacteria, as disclosed in US Patent Application No. 20020137140, which is herein incorporated by reference in its entirety.

[00250] In general, to express the desired gene/nucleotide sequence efficiently, various promoters can be used; e.g., the original promoter of the gene, promoters of antibiotic resistance genes such as for instance kanamycin resistant gene of Tn5, ampicillin resistant gene of pBR322, and promoters of lambda phage and any promoters which can be functional in the host cell. For expression, other regulatory elements, such as for instance a Shine-Dalgarno (SD) sequence (e.g., AGGAGG and so on including natural and synthetic sequences operable in a host cell) and a transcriptional terminator (inverted repeat structure including any natural and synthetic sequence) which are operable in a host cell (into which a coding sequence is introduced to provide a recombinant cell) can be used with the above described promoters.

[00251] Examples of promoters that can be used with a product or process disclosed herein include those disclosed in the following patent documents: US20040171824, US 6410317, WO 2005/024019 , which are herein incorporated by reference in their entirety. Several promoter-operator systems, such as lac, (D. V. Goeddel et al., "Expression in Escherichia coli of Chemically Synthesized Genes for Human Insulin", Proc. Nat. Acad. Sci. U.S.A., 76:106-110 (1979) , which is herein incorporated by reference in its entirety); trp (J. D. Windass et al. "The Construction of a Synthetic Escherichia coli Trp Promoter and Its Use in the Expression of a Synthetic Interferon Gene", Nucl. Acids. Res., 10:6639-57 (1982), which is herein incorporated by reference in its entirety) and λ PL operons (R. Crowl et al., "Versatile Expression Vectors for High-Level Synthesis of Cloned Gene Products in Escherichia coi , Gene, 38:31-38 (1985), which is herein incorporated by reference in its entirety) in E. coli and have been used for the regulation of gene expression in recombinant cells. The corresponding repressors are the lac repressor, trpR and cl, respectively.

[00252] Repressors are protein molecules that bind specifically to particular operators. For example, the lac repressor molecule binds to the operator of the lac promoter-operator system, while the cro repressor binds to the operator of the lambda pR promoter. Other combinations of repressor and operator are known in the art. See, e.g., J. D. Watson et al., Molecular Biology Of The Gene, p. 373 (4th ed. 1987), which is herein incorporated by reference in its entirety. The structure formed by the repressor and operator blocks the productive interaction of the associated promoter with RNA polymerase, thereby preventing transcription. Other molecules, termed inducers, bind to repressors, thereby preventing the repressor from binding to its operator. Thus, the suppression of protein expression by repressor molecules can be reversed by reducing the concentration of repressor (depression) or by neutralizing the repressor with an inducer.

[00253] Analogous promoter-operator systems and inducers are known in other microorganisms. In yeast, the GALIO and GALl promoters are repressed by extracellular glucose, and activated by addition of galactose, an inducer. Protein GAL80 is a repressor for the system, and GAL4 is a transcriptional activator. Binding of GAL80 to galactose prevents GAL80 from binding GALA Then, GAL4 can bind to an upstream activation sequence (UAS) activating transcription. See Y. Oshima, "Regulatory Circuits For Gene Expression: The Metabolisms Of Galactose And Phosphate" in The Molecular Biology Of The Yeast Saccharomyces, Metabolism And Gene Expression, J. N. Strathern et al. eds. (1982), which are herein incorporated by reference in their entirety.

[00254] Transcription under the control of the PH05 promoter is repressed by extracellular inorganic phosphate, and induced to a high level when phosphate is depleted. R. A. Kramer andN. Andersen, "Isolation of Yeast Genes With mRNA Levels Controlled By Phosphate Concentration", Proc. Nat. Acad. Sci. U.S.A., 77:6451-6545 (1980), which is herein incorporated by reference in its entirety. A number of regulatory genes for PH05 expression have been identified, including some involved in phosphate regulation.

[00255] Mata2 is a temperature-regulated promoter system in yeast. A repressor protein, operator and promoter sites have been identified in this system. A. Z. Sledziewski et al., "Construction Of

Temperature-Regulated Yeast Promoters Using The Mata2 Repression System", Bio/Technology, 6:411- 16 (1988), which is herein incorporated by reference in its entirety.

[00256] Another example of a repressor system in yeast is the CUPl promoter, which can be induced by Cu 2 ions. The CUPl promoter is regulated by a metallothionine protein. J. A. Gorman et al., "Regulation Of The Yeast Metallothionine Gene", Gene, 48:13-22 (1986), which is herein incorporated by reference in its entirety.

[00257] Similarly, to obtain a desired expression level of one or more cellulases, a higher copy number plasmid can be used. Constructs can be prepared for chromosomal integration of the desired genes.

Chromosomal integration of foreign genes can offer several advantages over plasmid-based constructions. Ethanologenic genes have been integrated chromosomally in E. coli B; see Ohta et al. (1991) Appl.

Environ. Microbiol. 57:893-900, which is herein incorporated by reference in its entirety. In general, this is accomplished by purification of a DNA fragment containing (1) the desired genes upstream from an antibiotic resistance gene and (2) a fragment of homologous DNA from the target microorganism. This DNA can be ligated to form circles without replicons and used for transformation. Thus, the gene of interest can be introduced in a heterologous host such as E. coli, and short, random fragments can be isolated and operably linked to target genes {e.g., genes encoding cellulase enzymes) to promote homologous recombination.

[00258] In one embodiment, a microorganism can be obtained without the use of recombinant DNA techniques that exhibit desirable properties such as increased productivity, increased yield, or increased titer. For example, mutagenesis, or random mutagenesis can be performed by chemical means or by irradiation of the microorganism. The population of mutagenized microorganisms can then be screened for beneficial mutations that exhibit one or more desirable properties. Screening can be performed by growing the mutagenized microorganisms on substrates that comprise carbon sources that will be used during the generation of end-products by fermentation. Screening can also include measuring the production of end-products during growth of the microorganism, or measuring the digestion or assimilation of the carbon source(s). The isolates so obtained can further be transformed with

recombinant polynucleotides or used in combination with any of the methods and compositions provided herein to further enhance biofuel production.

[00259] In one embodiment, a host cell (e.g., a microorganism) can be transformed with multiple genes encoding one or more enzymes. For example, a single transformed cell can contain exogenous nucleic acids encoding an entire biodegradation pathway. One example of a pathway can include genes encoding an εχο-β-glucanase, and endo- -glucanase, and an endoxylanase. Such cells transformed with entire pathways and/or enzymes extracted from them, can saccharify certain components of biomass more rapidly than the naturally- occurring organism. A construct can contain multiple copies of the same gene, and/or multiple genes encoding the same enzyme from different organisms, and/or multiple genes with mutations in one or more parts of the coding sequences. For example, multiple copies of Cphy_3367 or Cphy_3368 (SEQ ID NO:5 or SEQ ID NO:8, respectively) can increase saccharification, thus increasing the rate and yield of fermentation products. In some embodiments, the nucleic acid sequences encoding the genes can be similar or identical to the endogenous gene. There can be a percent similarity of 70% or more in comparing the base pairs of the sequences.

[00260] In another embodiment, more effective biomass degradation pathways can be created by transforming host cells with multiple copies of enzymes of the pathway and then combining the cells producing the individual enzymes. This approach allows for the combination of enzymes to more particularly match the biomass of interest by altering the relative ratios of the multiple-transformed strains. In one embodiment, two times as many cells expressing the first enzyme of a pathway can be added to a mix where the first step of the reaction pathway is a limiting step of the overall reaction pathway.

[00261] In one embodiment, biomass-degrading enzymes are made by transforming host cells (e.g., microbial cells such as bacteria, especially Clostridial cells, algae, and fungi) and/or organisms comprising host cells with nucleic acids encoding one or more different biomass degrading enzymes (e.g., cellulolytic enzymes, hemicellulolytic enzymes, xylanases, lignases and cellulases). In some

embodiments, a single enzyme can be produced. For example, a cellulase which breaks down pretreated cellulose fragments into cellodextrins or double glucose molecules (cellobiose) or a cellulase which splits cellobiose into glucose, can be produced. In other embodiments, multiple copies of an enzyme can be transformed into an organism to overcome a rate- limiting step of a reaction pathway.

EXAMPLES

Example 1. Cellulase Enzyme Addition

[00262] To study the effects of exogenous enzyme supplementation, hydrolytic enzyme mixtures and individual hydrolytic enzymes were added during the fermentation of a corn stover biomass. [00263] The following operating conditions and process parameters for C. phytofermentans were followed for fermentation of NaOH-pretreated corn stover with enzyme augmentation in 250 ml shake flasks with 100 ml of culture medium (Table 3).

[00264] Table 3

Operating conditions

pH 6.5; range of from about 6.0 to about 7.0

35° C Shake flasks were incubated in temperature controlled

Temperature

cabinets

Agitation 175 rpm

Degassing Sparging with N₂ to achieve redox potential less than -300 mV

Base for pH control 4N NaOH

Mode of operation Batch

Inoculation size 0.5 g/L on dry wt. (2x10⁹ CFU) use dfo reach flask

[00265] Seed propagation media (QM1) recipe:

OM Base Media: g/L:

Ammonium sulfate 4.60

Sodium citrate tribasic * 2H₂0 3.00

Bacto yeast extract 6.00

Cysteine 2.00

20x Substrate Stock g/L:

Maltose 400.00

100X OM Salts solution:

MgCl₂-6H₂0 100

CaCl₂2H₂0 15

FeS0₄7H₂0 0.125

[00266] The seed propagation media was prepared according to the recipe above. Base media, salts and substrates were degassed with nitrogen prior to autoclave sterilization. Following sterilization, 94 ml of base media was combined with 1ml of 100X salts and 5mls of 20X substrate to achieve a final concentrations. All additions were prepared anaerobically and aseptically.

[00267] Fermentation media: (FM media)

[00268] Base media (g/L) was prepared with: 50g/l NaOH pretreated corn stover, yeast extract 10, corn steep powder 5, K₂HP0₄ 3, KH₂P0₄ 1.6, TriSodium citrate2H₂0₂2, Citric acidH₂0 1.2, (NH₄)₂S0₄ 0.5, NaCl 1, Cysteine.HCl 1, dissolved in deionized water to achieve final volume, adjusted to pH to 6.5, degassed with nitrogen and autoclaved 121°C for 30 min. [00269] 100X Salt Stock (g/L) :

[00270] MgCl₂.6H₂0 80, CaCl₂.2H₂0 10, FeS0₄.7H₂0 0.125, TriSodium citrate.2H₂0₂3.0

[00271] Culturing procedure:

[00272] The fermentation media was prepared according to the protocol above. Components of the Base media were combined to a single vessel and degassed with nitrogen prior to sterilization. A 100X salts stock was prepared and sterilized separately. After sterilization base media was supplemented with a 1% v/v dose of 100X salts to achieve a final concentration. All additions were prepared anaerobically and aseptically.

[00273] Enzymes were obtained from Novozymes and mixtures (cocktails) were prepared separately and sterilized by sterile filtration using 0.2μηι filters. The prepared enzymes were then added to the FM corn stover media immediately prior to time of inoculation. Other enzymes and mixtures of enzymes from several different manufacturers were also tested with similar results.

[00274] Inoculum of Clostridium phytofermentans was prepared by propagation in QM media 24 hrs to an active cell density of 2X10⁹ cells per ml. The cells were concentrated by centrifugation and then transferred into the FM media bottles to achieve an initial cell density of 2x 10⁹ cells per ml for the start of fermentation.

[00275] Cultures were then incubated at pH 6.5 and at 35°C for 120 hr or until fermentations were complete. Product formation was determined by HPLC analysis using refractive index detection.

Compositional analysis for the NaOH-treated corn stover was obtained via NREL standard methods using two-stage acid hydrolysis procedures.

[00276] The addition of cellulase mixtures exhibiting as little as 0.4 FPU per gram of glucan supplemented with B-glucosidase, hemicellulase, pectinase and xylanase resulted in >95% theoretical yields of ethanol from fermentation of 50g/l NaOH-treated corn stover. The addition of a single endo- cellulase complex at 1.68FPU per gram of glucan resulted in greater than 90% theoretical saccharification and greater than 70% fermentation yield. (Table 4.) Addition of B-glucosidase, xylanase, or hemicellulase alone had little to no impact to the rate, titer or yield of Q fermentations. Based on the microorganism's metabolism of cellulose in the conditions studied, these enzymes were not observed to impact the fermentation process. For fermentation, addition of B-glucosidase does not significantly impact the fermentation process.

[00277] The table below shows the adjusted loadings in terms of FPU/gram of glucan as a standard enzyme unit. The activities were adjusted based on the reduction in the enzyme-reduced activity at the lowered temperature and higher pH ranges. Experiments were performed at pH 6.5 and temperature of 35°C, which resulted in more than 80%> loss of cellulase activity. This factor was figured into the loading calculations - FPU: filter paper unit, CBU cellobiosidase unit, FBG fungal glucanase unit, FXU: fungal xylanase unit. Table 4

[00278] Carbohydrate analysis for NaOH-treated corn stover; Glucan: 53.37%; Xylan: 27.5 %;

Arabinan: 3.6%. Total sugar equivalents: 95.4%>.

[00279] The difference in the fermentation profiles for the cultures with enzyme mixture additions from 0.25 to 2X result in the theoretical ethanol conversions described in Fig. 1 A. The curves for individual enzyme augmentations illustrate the impact of cellulase additions and also clearly demonstrate the ineffectiveness of B-glucosidase, xylanase and hemicelluloses additions described in Fig. IB.

[00280] Conversion efficiency of SSF fermentations for Corn stover with various enzyme loadings and individual enzyme loadings is further provided in Table 5.

[00281] Table 5

No exogenous

NaOH treated com stover glacari xylart arabinari Total Sugar eqaivalents

[00282] Fig. 2 and Fig. 4 show the synergistic effect of hydro lytic enzyme on C. phytofermentans saccharification efficiency. Fig. 3A demonstrates the reduced amount of enzyme mixture necessary for peak ethanol yield during C phytofermentans saccharification and fermentation of corn stover. Fig. 3B shows that cellulase alone is the hydrolytic enzyme responsible for the higher ethanol yield during C. phytofermentans saccharification and fermentation of corn stover. During these fermentations, significantly lower amounts of hydrolytic enzymes than normally used during bio fuel production with other organisms resulted in high rates and yield of ethanol with C. phytofermentans (Fig. 5).

Example 2. Microorganism Modification

[00283] Constitutive Expression of Cellulases I

[00284] pIMPCphy

[00285] Plasmids suitable for use in Clostridium phytofermentans were constructed using portions of plasmids obtained from bacterial culture collections (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, InhoffenstraBe 7 B, 38124 Braunschweig, Germany, hereinafter "DSMZ"). Plasmid pIMPl is a non-conjugal shuttle vector that can replicate in Escherichia coli and C phytofermentans; additionally, pIMPl (Fig. 7) encodes for resistance to erythromycin (Em^R). The origin of transfer for the RK2 conjugal system was obtained from plasmid pRK290 (DSMZ) as DSM 3928, and the other conjugation functions of RK2 were obtained from pRK2013 (DSMZ) as DSM 5599. The polymerase chain reaction (PCR) was used to amplify the 112 base pair origin of transfer region (oriT) from pRK290 using primers that added Clal restriction sites flanking the oriT region. This DNA fragment was inserted into the Clal site on pIMPl to yield plasmid pIMPT. pIMPT was shown to able to be transferred from one strain of E. coli to another when pRK2013 was also present to supply other conjugation functions. PCR was used to amplify the promoter of the alcohol dehydrogenase (Adh) gene Cphy_1029 from the C. phytofermentans chromosome and it was used to replace the promoter of the erythromycin gene in pIMPT to create pIMPTCphy (Fig. 8). The successful transfer of pIMPTCphy into C. phytofermentans via electroporation was demonstrated by the ability to grow in the presence of 10 μg/mL erythromycin. In addition to phenotypic proof of electroporation provided by the growth on erythromycin, successive plasmid isolations from C. phytofermentans confirmed that the same plasmid was isolated from

Clostridium phytofermentans and transferred into E. coli and recovered.

[00286] The method of conjugal transfer of pIMPTCphy from E. coli to C. phytofermentans involved constructing an E. coli strain (DH5alpha) that contains both pIMPTCphy and pRK2013. Fresh cells E. coli culture and fresh cells of the C. phytofermentans recipient culture were obtained by growth to mid-log phase using appropriate growth media (L broth and QMl media respectively). The two bacterial cultures were then centrifuged to yield cell pellets and the pellets resuspended in the same media to obtain cell suspensions that were concentrated about ten-fold having cell densities of about 10¹⁰ cells per ml. These concentrated cell suspensions were then mixed to achieve a donor-to-recipient ratio of five-to-one, then the cell suspension was spotted onto QMl agar plates and incubated anaerobically at 30° C for 24 hours. The cell mixture was removed from the QMl plate and placed on solid or in liquid QMl media containing antibiotics that allow the survival of C. phytofermentans recipient cells expressing erythromycin resistance. This was accomplished by using a combination of antibiotics consisting of trimethoprim (20 μg/ml), cycloserine (250 μg/ml), and erythromycin (10 μg/ml). The E. coli donor was unable to survive exposure to these concentrations of trimethoprim and cycloserine, while the C.

phytofermentans recipient was unable to survive exposure to this concentration of erythromycin (but could tolerate trimethoprim and cycloserine at these concentrations). Accordingly, after anaerobic incubation on antibiotic-containing plates or liquid media for 5 to 7 days at 30° C, derivatives of C.

phytofermentans were obtained that were erythromycin resistant and these C. phytofermentans derivatives were subsequently shown to contain plMPCphy as demonstrated by PCR analyses.

[00287] A map of the plasmid plMPCphy is shown in Figure 8, and the DNA sequence of this plasmid is provided as SEQ ID NO:l .

[00288] SEQ ID NO: 1 :

gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggc agtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaat tgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgccaaagctttggctaacacacacgccattccaaccaata gttttctcggcataaagccatgctctgacgcttaaatgcactaatgccttaaaaaaacattaaagtctaacacactagacttatttacttcg

taattaagtcgttaaaccgtgtgctctacgaccaaaagtataaaacctttaagaactttcttttttcttgtaaaaaaagaaactagataaa

tctctcatatcttttattcaataatcgcatcagattgcagtataaatttaacgatcactcatcatgttcatatttatcagagctccttatatttt

atttcgatttatttgttatttatttaacatttttctattgacctcatcttttctatgtgttattcttttgttaattgtttacaaataatctacgataca

tagaaggaggaaaaactagtatactagtatgaacgagaaaaatataaaacacagtcaaaactttattacttcaaaacataatatagat

aaaataatgacaaatataagattaaatgaacatgataatatctttgaaatcggctcaggaaaagggcattttacccttgaattagtaca

gaggtgtaatttcgtaactgccattgaaatagaccataaattatgcaaaactacagaaaataaacttgttgatcacgataatttccaagt

tttaaacaaggatatattgcagtttaaatttcctaaaaaccaatcctataaaatatttggtaatataccttataacataagtacggatataa

tacgcaaaattgtttttgatagtatagctgatgagatttatttaatcgtggaatacgggtttgctaaaagattattaaatacaaaacgctca

ttggcattatttttaatggcagaagttgatatttctatattaagtatggttccaagagaatattttcatcctaaacctaaagtgaatagctca

cttatcagattaaatagaaaaaaatcaagaatatcacacaaagataaacagaagtataattatttcgttatgaaatgggttaacaaaga

atacaagaaaatatttacaaaaaatcaatttaacaattccttaaaacatgcaggaattgacgatttaaacaatattagctttgaacaatt

cttatctcttttcaatagctataaattatttaataagtaagttaagggatgcataaactgcatcccttaacttgtttttcgtgtacctattttttg

tgaatcgatccggccagcctcgcagagcaggattcccgttgagcaccgccaggtgcgaataagggacagtgaagaaggaacacccg ctcgcgggtgggcctacttcacctatcctgcccggatcgattatgtcttttgcgcattcacttcttttctatataaatatgagcgaagcgaat aagcgtcggaaaagcagcaaaaagtttcctttttgctgttggagcatgggggttcagggggtgcagtatctgacgtcaatgccgagcga aagcgagccgaagggtagcatttacgttagataaccccctgatatgctccgacgctttatatagaaaagaagattcaactaggtaaaat cttaatataggttgagatgataaggtttataaggaatttgtttgttctaatttttcactcattttgttctaatttcttttaacaaatgttcttttttt tttagaacagttatgatatagttagaatagtttaaaataaggagtgagaaaaagatgaaagaaagatatggaacagtctataaaggct ctcagaggctcatagacgaagaaagtggagaagtcatagaggtagacaagttataccgtaaacaaacgtctggtaacttcgtaaagg catatatagtgcaattaataagtatgttagatatgattggcggaaaaaaacttaaaatcgttaactatatcctagataatgtccacttaag taacaatacaatgatagctacaacaagagaaatagcaaaagctacaggaacaagtctacaaacagtaataacaacacttaaaatctt agaagaaggaaatattataaaaagaaaaactggagtattaatgttaaaccctgaactactaatgagaggcgacgaccaaaaacaaa aatacctcttactcgaatttgggaactttgagcaagaggcaaatgaaatagattgacctcccaataacaccacgtagttattgggaggtc aatctatgaaatgcgattaagcttagcttggctgcaggtcgacggatccccgggaattcactggccgtcgttttacaacgtcgtgactgg gaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcg cccttcccaacagttgcgcagcctgaatggcgaatggcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatat ggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggct tgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgc gcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggg gaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaa taatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcaccc agaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagat ccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccg ggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggc atgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccga aggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaac gacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggca acaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatc tggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacgg ggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagt ttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatc ccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctg ctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggctt cagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacct cgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataa ggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagc gtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcg cacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgct cgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttcttt cctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgccgagcgcagc gagtcagtgagcgaggaagcggaaga. [00289] The vector pIMPCphy was constructed as a shuttle vector for C. phytofermentans . It has an Ampicillin-resistance cassette and an Origin of Replication (ori) for selection and replication in E.coli. It contains a Gram-positive origin of replication that allows the replication of the plasmid in C.

phytofermentans. In order to select for the presence of the plasmid, the pIMPCphy carries an

erythromycin resistance gene under the control of the C. phytofermentans promoter of the gene

Cphyl029. This plasmid can be transferred to C. phytofermentans by electrop oration or by

transconjugation with an E.coli strain that has a mobilizing plasmid, for example pRK2030. A plasmid map of pIMPCphy is depicted in Fig. 8. pIMPCphy is an effective replicative vector system for all microbes, including all gram⁺ and gram^" bacteria, and fungi (including yeasts).

[00290] Constitutive Promoter

[00291] In a first step, several promoters from C. phytofermentans were chosen that show high expression of their corresponding genes in all growth stages as well as on different substrates. A promoter element can be selected by selecting key genes that would necessarily be involved in constitutive pathways {e.g., ribosomal genes, or for ethanol production, alcohol dehydrogenase genes). Examples of promoters from such genes include but are not limited to:

[00292] Cphy_1029: iron-containing alcohol dehydrogenase

[00293] Cphy_3510: Ig domain-containing protein

[00294] Cphy_3925: bifunctional acetaldehyde-CoA/alcohol dehydrogenase

[00295] Cloning of Promoter

[00296] The different promoters in the upstream regions of the genes were amplified by PCR. The primers for this PCR reaction were chosen in a way that they include the promoter region but do not include the ribosome binding sites of the downstream gene. The primers were engineered to introduce restriction sites at the end of the promoter fragments that are present in the multiple cloning site of pIMPCphy but are otherwise not present in the promoter region itself, for example Sail, BamHI, Xmal, Smal, EcoRI.

[00297] The PCR reaction was performed with a commercially available PCR Kit, e.g. GoTaq® Green Master Mix (Promega Corporation, 2800 Woods Hollow Road, Madison, WI 53711 USA), according to the manufacturer's conditions. The reaction is run in a thermal cycler, e.g. Gene Amp System 2400 (PerkinElmer, 940 Winter St., Waltham MA 02451 USA). The PCR products were purified with the GenElute™ PCR Clean-Up Kit (Sigma- Aldrich Corp., St. Louis, MO, USA). Both the purified PCR products as well as the plasmid pIMPCphy were then digested with the corresponding enzymes with the appropriate amounts according to the manufacturer's conditions (restriction enzymes from New England Biolabs, 240 County Road, Ipswich, MA 01938 USA and Promega). The PCR products and the plasmid were then analyzed and gel-purified on a Recovery FlashGel (Lonza Biologies, Inc., 101 International Drive, Portsmouth, NH 03801 USA). The PCR products were subsequently ligated to the plasmid with the Quick Ligation Kit (New England Biolabs) and competent cells of E.coli (DH5a) are transformed with the ligation mixtures and plated on LB plates with 100 μg/ml ampicillin. The plates are incubated overnight at 37°C.

[00298] Ampicillin resistant E.coli colonies were picked from the plates and restreaked on new selective plates. After growth at 37°C, liquid LB medium with 100 μg/ml ampicillin was inoculated with a single colony and grown overnight at 37°C. Plasmids were isolated from the liquid culture with the Gene Elute™ Plasmid isolation kit.

[00299] Miniprep Kit (Sigma- Aldrich) .

[00300] Plasmids were checked for the right insert by PCR reaction and restriction digest with the appropriate primers and by restriction enzymes respectively. To ensure the sequence integrity, the insert is sequenced at this step.

[00301] Cloning of Cellulase genes

[00302] One or more genes disclosed in Table 2, which can include each gene's own ribosome binding sites, were amplified via PCR and subsequently digested with the appropriate enzymes as described previously under Cloning of Promoter. Resulting plasmids were also treated with the corresponding restriction enzymes and the amplified genes are mobilized into plasmids through standard ligation. E.coli were transformed with the plasmids and correct inserts were verified from transformants selected on selection plates.

[00303] Transconjugation

[00304] E.coli DH5a along with the helper plasmid pRK2030, were transformed with the different plasmids discussed above. E.coli colonies with both of the foregoing plasmids were selected on LB plates with 100 μg/ml ampicillin and 50 μg/ml kanamycin after growing overnight at 37°C. Single colonies were obtained after re-streaking on selective plates at 37°C. Growth media for E.coli (e.g. LB or LB supplemented with 1% glucose and 1% cellobiose) was inoculated with a single colony and either grown aerobically at 37°C or anaerobically at 35°C overnight. Fresh growth media was inoculated 1 : 100 with the overnight culture and grown until mid log phase. A C. phytofermentans strain was also grown in the same media until mid log.

[00305] The two different cultures, C. phytofermentans and E.coli with pRK2030 and one of the plasmids, were then mixed in different ratios, e. g. 1 :1000, 1 :100, 1 :10, 1 :1, 10:1, 100:1, 1000:1. The mating was performed in either liquid media, on plates or on 25 mmNucleopore Track-Etch Membrane (Whatman, Inc., 800 Centennial Avenue, Piscataway, NJ 08854 USA) at 35°C. The time was varied between 2h and 24h, and the mating media was the same growth media in which the culture was grown prior to the mating. After the mating procedure, the bacteria mixture was either spread directly onto plates or first grown on liquid media for 6h to 18h and then plated. The plates contain 10μg/ml erythromycin as selective agent for C. phytofermentans and 10 μg/ml Trimethoprim, 150 μg/ml Cyclosporin and 100 μg/ml Nalidixic acid as counter selectable media for E .coli. [00306] After 3 to 5 days incubation at 35°C, erythromycin-resistant colonies were picked from the plates and restreaked on fresh selective plates. Single colonies were picked and the presence of the plasmid is confirmed by PCR reaction.

[00307] Cellulase gene expression

[00308] The expression of the cellulase genes on the different plasmids was then tested under conditions where there is little to no expression of the corresponding genes from the chromosomal locus. Positive candidates showed constitutive expression of the cloned cellulases.

[00309] Constitutive Expression of Cellulases I

[00310] pCphyP3510-1163

[00311] Two primers were chosen to amplify Cphy l 163 using C. phytofermentans genomic DNA as template. The two primers were: cphy l 163F: 5' -CCG CGG AGG AGG GTT TTG TAT GAG TAA AAT CAG AAG AAT AGT TTC-3 (SEQ ID NO: 3), which contained a SacII restriction enzyme site and ribosomal site; and cphy l 163R: CCC GGG TTA GTG GTG GTG GTG GTG GTG TTT TCC ATA ATA TTG CCC TAA TGA (SEQ ID NO: 4), which containing a Xmal site and His-tag (SEQ ID NO: 31). The amplified gene was cloned into Topo-TA first, then digested with SacII and Xmal, the cphy l 163 fragment was gel purified and ligated with pCPHY3510 digested with SacII and Xmal, respectively. The plasmid was transformed into E.coli, purified and then transformed into C.

phytofermentans by electrop oration. The plasmid map is shown in Figure 11.

[00312] The transformants from the QM plate, which contained 20 μg/ml of erythromycin, were transformed into QM liquid medium, which contained 2% cellobiose and 20 μg/ml of erythromycin. The enzyme activities from the supernatant of overnight culture were assayed by CMC-congo red plate assay and Cellazyme T assay kit (Megazyme International Ireland, Ltd., Bray Business Park, Bray, Co., Wicklow, Ireland). The CMC-congo plate and the Cellazyme T assays indicated the transformant of C. phytofermentans /pCphy3510_l 163 showed increased activity than that of the control strain (Figure 10). The CEL-T assay showed the tranformant had an activity level of 54.5 mU/ml (left box "3") whereas the control activity was only 3.7 mU/ml (right box "2").

[00313] Using the methods above and the primers described in Figs. 13, 14, 15, and 16, respectively, genes encoding Cphy_3367, Cphy_3368, Cphy_3202 and Cphy_2058 were cloned into pCphy3510 to produce pCphy3510_3367, pCphy3510_3368, pCphy3510_3202, and pCphy3510_2058 respectively. These vectors were transformed into C. phytofermentans via electrop oration as described supra. In addition, genes encoding the heat shock chaperonin proteins, Cphy_3289 (GroES, Fig. 15) and

Cphy_3290 (GroEL, Fig. 15) were incorporated into pCphy3510. In another embodiment, an endogenous or exogenous gene can be cloned into this vector and used to transform C. phytofermentans, another bacteria or fungal cell.

Example 3. Plant modification to regulate cellulase activity

[00314] Increased cellulase activity in plant matter from a genetically modified plant. [00315] In one example, methods of the present disclosure can be used to generate a plant expressing an exogenous sequence which encodes for a cellulase enzyme. Expression of the cellulase enzyme in the plant can promote cell wall break down. The plant matter can then be used as biomass source for generating a fermentation end-product. Low severity pretreatment of the plant matter biomass, such as with a dilute acid, can be conducted followed by compositional analysis of the pretreated matter. The plant matter can then be subject to hydrolysis by an exogenous enzyme, such as a cellulase, to produce a hydrolysis product. Small scale (shake flask) fermentation of the hydrolysis product can be conducted at 5-10% solids. Fermentation can include the addition of a microorganism incubating at pH 6.5 and 35 degrees C°. The microorganism can be Clostridium phytofermentans or Clostridium sp. Q.D which is capable of direct fermentation of C5 and C6 carbohydrates. Following fermentation, a fermentation end- product can then be separated from the byproducts.

[00316] While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein can be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.

Claims

WHAT IS CLAIMED IS:

1 A process for producing one or more fermentation end-products comprising:

contacting a biomass derived from a genetically modified plant or algae comprising one or more genetic modifications with one or more microorganisms, wherein at least one of said microorganisms can hydro lyze and/or ferment said biomass; and allowing sufficient time for said microorganisms to hydrolyze and/or ferment said biomass to produce said fermentation end-products.

2. A process for producing one or more fermentation end-products comprising:

contacting a biomass derived from a genetically modified plant or algae comprising one or more genetic modifications with:

i. one or more microorganisms, wherein at least one of said microorganisms can hydrolyze and/or ferment said biomass; and

ii. an external source of one or more enzymes that are capable of enhancing said hydrolysis; and

allowing sufficient time for said microorganisms to hydrolyze and/or ferment said biomass to produce said fermentation end-products.

3. The process of claims 1 or 2, wherein said genetically modified plant or algae is genetically

modified kelp, seaweed, microalgae, macroalgae, maize, wheat, rice, barley, soybean, cotton, sorghum, sweet sorghum, oats, tobacco, miscanthus, switchgrass, alfalfa, rye, sugarcane, sugar beet, corn, or byproducts thereof.

4. The process of claims 1 or 2, wherein said genetically modified plant is a genetically modified switchgrass, sorghum, miscanthus, sugarcane, corn, or byproducts thereof.

5. The process of claims 1 or 2, wherein at least one of said genetic modifications results in altered expression and/or activity of proteins involved in cell wall degradation.

6. The process of claims 1 or 2, wherein at least one of said genetic modifications comprises a

heterologous polynucleotide than encodes for one or more heterologous polysaccharide-degrading enzymes.

7. The process of claim 6, wherein said polysaccharide-degrading enzymes comprise an amylase, protease, pullulanase, isoamylase, cellulase, hemicellulase, xylanase, cyclodextrin glycotransferase, lipase, phytase, laccase, oxidase, peroxidase, esterase, cutinase, pectinase, glucuronidase, amyloglucosidase, glucoamylase, starch debranching enzyme, glucanase, glucosidase, arabinases, arabinosidase, galactanase, galactanase, galactosidase, mannanase, mannosidase, xylosidase, fucosidase, rhamnosidase, levanase, inulanase, or a combination thereof.

8. The process of claim 6, wherein said enzymes comprise a cellulase or a hemicellulase.

9. The process of claim 1 or 2, wherein at least one of said genetic modifications enables said genetically modified plant or algae to grow faster than an unmodified plant or algae of the same species.

10. The process of claim 1 or 2, wherein at least one of said genetic modifications enables said

genetically modified plant or algae to grow larger than an unmodified plant or algae of the same species.

11. The process of claim 1 or 2, wherein at least one of said genetic modifications enables said

genetically modified plant to grow a larger root structure than an unmodified plant of the same species.

12. The process of claim 1 or 2, wherein at least one of said genetic modifications alters the chemical composition of said genetically modified plant or algae in comparison to an unmodified plant or algae of the same species.

13. The process of claim 12, wherein said genetically modified plant or algae comprises more cellulose per gram of mass than the unmodified plant or algae.

14. The process of claim 12, wherein said genetically modified plant or algae comprises more

hemicellulose per gram of mass than the unmodified plant or algae.

15. The process of claim 12, wherein said genetically modified plant or algae comprises less lignin per gram of mass than the unmodified plant or algae.

16. The process of claim 1 or 2, wherein at least one of said genetic modifications increases said

genetically modified plant or algae's resistance to a stress in comparison to an unmodified plant or algae of the same species.

17. The process of claim 16, wherein said stress is dehydration.

18. The process of claim 16, wherein said stress is heat.

19. The process of claim 16, wherein said stress is cold.

20. The process of claim 1 or 2, wherein said microorganisms comprise one or more bacteria, one or more yeasts, one or more non-yeast fungi, or a combination thereof.

21. The process of claim 1 or 2, wherein at least one of said microorganisms is a mesophile.

22. The process of claims 1 or 2, wherein at least one of said microorganisms is capable of

fermentation of C5 and C6 carbohydrates.

23. The process of claim 1 or 2, wherein at least one of said microorganisms can hydrolyze and ferment hemicellulosic or lignocellulosic material.

24. The process of claims 1 or 2, wherein at least one of said microorganisms is genetically modified to have altered expression of one or more hydrolase enzymes.

25. The process of claim 24, wherein said one or more hydrolase enzymes comprise an enzyme that catalyzes the hydrolysis of an oligomeric sugar target.

26. The process of claim 1 or 2, wherein at least one of said microorganisms can hydrolyze and ferment hexose and pentose oligosaccharides.

27. The process of claims 1 or 2, wherein at least one of said microorganisms is a Clostridium strain.

28. The process of claim 25, wherein said Clostridium strain is Clostridium phytofermentans ,

Clostridium sp. Q.D, Clostridium algidixylanolyticum, Clostridium xylanolyticum, Clostridium cellulovorans, Clostridium cellulolyticum, Clostridium thermocellum, Clostridium josui,

Clostridium papyrosolvens, Clostridium cellobioparum, Clostridium hungatei, Clostridium cellulosi, Clostridium stercorarium, Clostridium termitidis, Clostridium thermocopriae,

Clostridium celerecrescens, Clostridium polysaccharolyticum, Clostridium populeti, Clostridium lentocellum, Clostridium chartatabidum, Clostridium aldrichii, Clostridium herbivorans, or a variant thereof.

29. The process of claim 25, wherein said Clostridium strain is Clostridium phytofermentans,

Clostridium sp. Q.D, or a variant thereof.

30. The process of claims 1 or 2, wherein said fermentation end-products comprise one or more

alcohols, one or more organic acids, one or more carbonyl compounds, one or more saccharides, or a combination thereof.

31. The process of claims 1 or 2, wherein said fermentation end-products comprise one or more

alcohols.

32. The process of claims 1 or 2, wherein said fermentation end-products comprise ethanol, methanol, butanol, propanol, or a combination thereof.

33. The process of claims 32, wherein at least one of said fermentation end-products is ethanol.

34. A system for producing one or more fermentation end-products comprising:

a. a biomass derived from a genetically modified plant or algae that comprises one or more genetic modifications;

b. one or more microorganisms, wherein at least one of said microorganisms can

hydro lyze and/or ferment said biomass; and

c. a vessel.

35. The system of claim 34, further comprising an external source of one or more enzymes that is capable of enhancing said hydrolysis.

36. The system of claim 34, wherein said genetically modified plant or algae is genetically modified kelp, seaweed, microalgae, macroalgae, maize, wheat, rice, barley, soybean, cotton, sorghum, sweet sorghum, oats, tobacco, miscanthus, switchgrass, alfalfa, rye, sugarcane, sugar beet, corn, or byproducts thereof.

37. The system of claim 34, wherein said genetically modified plant is a genetically modified

switchgrass, sorghum, miscanthus, sugarcane, or corn, or byproducts thereof.

38. The system of claim 34, wherein at least one of said genetic modifications results in altered

expression and/or activity of proteins involved in cell wall degradation.

39. The system of claim 34, wherein at least one of said genetic modifications comprises a heterologous polynucleotide than encodes for one or more heterologous polysaccharide-degrading enzymes.

40. The system of claim 39, wherein said polysaccharide-degrading enzymes comprise an amylase, protease, pullulanase, isoamylase, cellulase, hemicellulase, xylanase, cyclodextrin glycotransferase, lipase, phytase, laccase, oxidase, peroxidase, esterase, cutinase, pectinase, glucuronidase, amyloglucosidase, glucoamylase, starch debranching enzyme, glucanase, glucosidase, arabinases, arabinosidase, galactanase, galactanase, galactosidase, mannanase, mannosidase, xylosidase, fucosidase, rhamnosidase, levanase, inulanase, or a combination thereof.

41. The system of claim 39, wherein said enzymes comprise a cellulase or a hemicellulase.

42. The system of claim 34, wherein at least one of said genetic modifications enables said genetically modified plant or algae to grow faster than an unmodified plant or algae of the same species.

43. The system of claim 34, wherein at least one of said genetic modifications enables said genetically modified plant or algae to grow larger than an unmodified plant or algae of the same species.

44. The system of claim 34, wherein at least one of said genetic modifications enables said genetically modified plant to grow a larger root structure than an unmodified plant of the same species.

45. The system of claim 34, wherein at least one of said genetic modifications alters the chemical composition of said genetically modified plant or algae in comparison to an unmodified plant or algae of the same species.

46. The system of claim 45, wherein said genetically modified plant or algae comprises more cellulose per gram of mass than the unmodified plant or algae.

47. The system of claim 45, wherein said genetically modified plant or algae comprises more

hemicellulose per gram of mass than the unmodified plant or algae.

48. The system of claim 45, wherein said genetically modified plant or algae comprises less lignin per gram of mass than the unmodified plant or algae.

49. The system of claim 34, wherein at least one of said genetic modifications increases said

50. The system of claim 49, wherein said stress is dehydration.

51. The system of claim 49, wherein said stress is heat.

52. The system of claim 49, wherein said stress is cold.

53. The system of claim 34, wherein said microorganisms comprise one or more bacteria, one or more yeasts, one or more non-yeast fungi, or a combination thereof.

54. The system of claim 34, wherein at least one of said microorganisms is a mesophile.

55. The system of claim 34, wherein at least one of said microorganisms is capable of fermentation of C5 and C6 carbohydrates.

56. The system of claim 34, wherein at least one of said microorganisms can hydrolyze and ferment hemicellulosic or lignocellulosic material.

57. The system of claim 34, wherein at least one of said microorganisms is genetically modified to have altered expression of one or more hydrolase enzymes.

58. The system of claim 57, wherein said one or more hydrolase enzymes comprise an enzyme that catalyzes the hydrolysis of an oligomeric sugar target.

59. The system of claim 34, wherein at least one of said microorganisms can hydrolyze and ferment hexose and pentose oligosaccharides.

60. The system of claim 34, wherein at least one of said microorganisms is a Clostridium strain.

61. The system of claim 60, wherein said Clostridium strain is Clostridium phytofermentans ,

Clostridium sp. Q.D, Clostridium algidixylanolyticum, Clostridium xylanolyticum, Clostridium cellulovorans, Clostridium cellulolyticum, Clostridium thermocellum, Clostridium josui, Clostridium papyrosolvens, Clostridium cellobioparum, Clostridium hungatei, Clostridium cellulosi, Clostridium stercorarium, Clostridium termitidis, Clostridium thermocopriae, Clostridium celerecrescens, Clostridium polysaccharolyticum, Clostridium populeti, Clostridium lentocellum, Clostridium chartatabidum, Clostridium aldrichii, Clostridium herbivorans, or a variant thereof.

62. The system of claim 60, wherein said Clostridium strain is Clostridium phytofermentans,

Clostridium sp. Q.D, or a variant thereof.

63. The system of claim 34, wherein said fermentation end-products comprise one or more alcohols, one or more organic acids, one or more carbonyl compounds, one or more saccharides, or a combination thereof.

64. The system of claim 34, wherein said fermentation end-products comprise one or more alcohols.

65. The system of claim 34, wherein said fermentation end-products comprise ethanol, methanol, butanol, propanol, or a combination thereof.

66. The system of claim 34, wherein at least one of said fermentation end-products is ethanol.

67. A process for producing one or more fermentation end-products comprising:

a. contacting a biomass derived from a genetically modified plant or algae comprising one or more genetic modifications with a Clostridium species that can hydrolyze and/or ferment hemicellulosic or lignocellulosic material; and b. allowing sufficient time for said Clostridium species hydrolyze and/or ferment said biomass to produce said fermentation end-products, wherein said fermentation end- products comprise one or more alcohols.

68. The process of claim 67, further comprising an external source of one or more enzymes that is capable of enhancing said hydrolysis.

69. The process of claim 67, further comprising one or more other other microorganisms, wherein said other microorganisms comprise yeast, non-yeast fungi, or bacteria different than said Clostridium species.

70. The process of claim 67, wherein said Clostridium species is Clostridium phytofermentans ,

Clostridium sp Q.D, or a variant thereof.

71. The process of claim 67, wherein said genetically modified plant or algae is genetically modified kelp, seaweed, microalgae, macroalgae, maize, wheat, rice, barley, soybean, cotton, sorghum, sweet sorghum, oats, tobacco, miscanthus, switchgrass, alfalfa, rye, sugarcane, sugar beet, corn, or byproducts thereof.

72. The process of claim 67, wherein said genetically modified plant is a genetically modified

switchgrass, sorghum, miscanthus, sugarcane, corn, or byproducts thereof.

73. The process of claim 67, wherein at least one of said genetic modifications results in altered

expression and/or activity of proteins involved in cell wall degradation.

74. The process of claim 67, wherein at least one of said genetic modifications comprises a

75. The process of claim 67, wherein said polysaccharide-degrading enzymes comprise an amylase, protease, pullulanase, isoamylase, cellulase, hemicellulase, xylanase, cyclodextrin glycotransferase, lipase, phytase, laccase, oxidase, peroxidase, esterase, cutinase, pectinase, glucuronidase, amyloglucosidase, glucoamylase, starch debranching enzyme, glucanase, glucosidase, arabinases, arabinosidase, galactanase, galactanase, galactosidase, mannanase, mannosidase, xylosidase, fucosidase, rhamnosidase, levanase, inulanase, or a combination thereof.

76. The process of claim 67, wherein said enzymes comprise a cellulase or a hemicellulase.

77. The process of claim 67, wherein said alcohols comprise ethanol.

78. A process for producing ethanol comprising:

a. providing a genetically modified biomass derived from a genetically modified plant or algae wherein said genetically modified plant or algae comprises a heterologous polynucleotide that encodes for one or more heterologous polysaccharide degrading enzymes;

b. contacting said genetically modified biomass with Clostridium phytofermentans, Clostridium sp Q.D, or a variant thereof; and,

c. allowing sufficient time for said Clostridium phytofermentans , Clostridium sp Q.D, or a variant thereof to hydro lyze and/or ferement said genetically modified biomass to produce said ethanol.

79. The process of claim 78, further comprising an external source of one or more enzymes that is capable of enhancing said hydrolysis.

80. The process of claim 78, further comprising one or more other microorganisms, wherein said other microorganisms comprise yeast, non-yeast fungi, or bacteria different than said Clostridium phytofermentans , Clostridium sp Q.D, or a variant thereof.

81. The process of claim 78, wherein said genetically modified plant or algae is genetically modified kelp, seaweed, microalgae, macroalgae, maize, wheat, rice, barley, soybean, cotton, sorghum, sweet sorghum, oats, tobacco, miscanthus, switchgrass, alfalfa, rye, sugarcane, sugar beet, corn, or byproducts thereof.

82. The process of claim 78, wherein said genetically modified plant is a genetically modified

switchgrass, sorghum, miscanthus, sugarcane, corn, or byproducts thereof.

83. The process of claim 78, wherein said polysaccharide-degrading enzymes comprise an amylase, protease, pullulanase, isoamylase, cellulase, hemicellulase, xylanase, cyclodextrin glycotransferase, lipase, phytase, laccase, oxidase, peroxidase, esterase, cutinase, pectinase, glucuronidase, amyloglucosidase, glucoamylase, starch debranching enzyme, glucanase, glucosidase, arabinases, arabinosidase, galactanase, galactanase, galactosidase, mannanase, mannosidase, xylosidase, fucosidase, rhamnosidase, levanase, inulanase, or a combination thereof.

84. The process of claim 78, wherein said enzymes comprise a cellulase or a hemicellulase.