WO2012061810A1 - Base modified oligonucleotides - Google Patents

Base modified oligonucleotides Download PDF

Info

Publication number
WO2012061810A1
WO2012061810A1 PCT/US2011/059588 US2011059588W WO2012061810A1 WO 2012061810 A1 WO2012061810 A1 WO 2012061810A1 US 2011059588 W US2011059588 W US 2011059588W WO 2012061810 A1 WO2012061810 A1 WO 2012061810A1
Authority
WO
WIPO (PCT)
Prior art keywords
oligonucleotide
base
nucleotides
modification
modified
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2011/059588
Other languages
French (fr)
Inventor
Kurt Vagle
Christina Dalby
William S. Marshall
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Viridian Therapeutics Inc
Original Assignee
Miragen Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Miragen Therapeutics Inc filed Critical Miragen Therapeutics Inc
Priority to CN201180064239.XA priority Critical patent/CN103492569B/en
Priority to AU2011323085A priority patent/AU2011323085B2/en
Priority to CA2817002A priority patent/CA2817002C/en
Priority to US13/883,363 priority patent/US9416360B2/en
Priority to EP11838938.6A priority patent/EP2635681B8/en
Priority to JP2013537906A priority patent/JP5995855B2/en
Publication of WO2012061810A1 publication Critical patent/WO2012061810A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • C12N2310/141MicroRNAs, miRNAs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3521Methyl
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3523Allyl
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3525MOE, methoxyethoxy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3527Other alkyl chain
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3529Aromatic substituent
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/50Methods for regulating/modulating their activity
    • C12N2320/52Methods for regulating/modulating their activity modulating the physical stability, e.g. GC-content

Definitions

  • the present invention relates to modified oligonucleotides with enhanced binding affinity towards complementary polynucleotides.
  • miRs have been implicated in a number of biological processes including regulation and maintenance of cardiac function (Van Rooij et al., "'MicroRNAs: Powerful New Regulators of Heart Disease and Proactive Therapeutic Targets," J. Clin. Invest. 117(9):2369-2376 (2007); Chien KR, "Molecular Medicine: MicroRNAs and the Tell-tale Heart,” Nature 447:389-390 (2007)). Therefore, miRs represent a relatively new class of therapeutic targets for conditions such as cardiac hypertrophy, myocardial infarction, heart failure, vascular damage, and pathologic cardiac fibrosis, among others.
  • miRs are small, non-protein coding RNAs of about, 18 to about 25 nucleotides in length, and act as repressors of target mRNAs by promoting their degradation, when their sequences are perfectly complementary, or by inhibiting translation, when their sequences contain mismatches.
  • the mechanism involves incorporation of the mature miRNA. strand into the RNA-induced silencing complex (RISC), where it associates with its target RNAs by base-pair complementarity.
  • RISC RNA-induced silencing complex
  • miRNA function may be targeted therapeutically by antisense polynucleotides or by polynucleotides that mimic miRNA. function ("miRNA mimetic").
  • miRNA mimetic targeting miRNAs therapeutically with oligomieleoti de-based agents poses several challenges, including RNA-binding affinity and specificity, efficiency of cel lular uptake, and nuclease resistance. For example, when polynucleotides are introduced into intact cells they are attacked and degraded by nucleases leading to a loss of activity.
  • Oligonucleotide chemistry patterns or motifs for miRNA inhibitors have the potential to improve the delivery, stability, potency, specificity, and/or toxicity profile of the inhibitors, and as such are needed for effectively targeting miRNA function in a therapeutic context.
  • the present invention relates to oligonucleotides comprising at least one nucleotide having a 2' modification and at least one nucleotide having an amino carbonyl modified base, as well as pharmaceutical compositions comprising the modified oligonucleotides, and methods of use and synthesis for these oligonucleotides.
  • the present invention provides oligonucleotides comprising at least one nucleotide having a 2' modification and at least one nucleotide having an amino carbonyl modified base.
  • the oligonucleotides provide advantages in duplex binding affinity, among other advantages, such as efficiency in RNA knockdown.
  • the oligonucleotide comprises a nucleotide sequence that is at least substantially complementary to a nucleotide sequence of human miRNA .
  • the oligonucleotide is at least substantially complementary to a mammalian transcript, other than a miRNA, and is therefore useful for antisense inhibition of gene expression, in still other embodiments, the oligonucleotide comprises the sequence of a human miRNA, and thereby mimics miRNA function, in still other embodiments, the oligonucleotide is a detection probe for in vitro detection or quantification of nucleic acids in a sample, using any conventional platform.
  • the base modification is an amino carbonyl, such as a carboxamino, carbamoyl, or carbamide group.
  • the modification in various embodiments is at the C-5 position of a pyrimidine base or C-8 of a purine base.
  • the modifying amino carbonyl group of the instant oligonucleotide contains a radical or substituent which can be, without limitation, C-.-C] 8 alkyl, C-.-Cjg alkenyl, cycloalkyl, aryl, heteroaryi, heterocyclyl, and -(C33 ⁇ 4) n -NRiR 2 , wherein n is an integer from 1 to 6 and R 3 ⁇ 4 and R 2 are independently H or Ci -Cealkyi.
  • moieties include piperidine, piperazine, morpholino, or imidazole, each of which may be substituted or unsubstituted.
  • the substituent is from C4 to C20 alkyl or alkenyl, phenyl, or an amine,
  • the oligonucleotide further comprises at least one nucleotide with a 2' modification.
  • the 2' modifications may be independently selected from CI -6 alkyl, 2' 0-aikyl(Cl -C6), F, CI, N3 ⁇ 4, CN, or Si I.
  • Other potential 2' modifications are described elsewhere herein.
  • An exemplary 2' modification is 2' Q-Me, which may provide synergistic enhancements of the oligonucleotide's T m , together with the base modification.
  • at least, one nucleotide has a 2' modification that is a 2' - 4' bridge locking the sugar in the C3 endo configuration. Unmodified 2' positions may be hydrogen.
  • the number of nucleotides having a modified base may vary, but in certain embodiments is at least 25% of nucleotides, or at least 50% of nucleotides, or at least 75% of nucleotides or 100% of nucleotides.
  • the enhancement of T m may be accomplished with relatively few base-modified nucleotides, such as less than 50% of nucleotides or less than 25% of nucleotides.
  • the oligonucleotide contains only 1 , 2, 3, or 4 base-modified nucleotides.
  • the base modified nucleotides in these embodiments may be pyrimidine bases, such as uridine or thymine, and/or may contain a modification such as 2' O'Me. That is, the oligonucleotide (e.g., of about 16 nucleotides) may have a sragle incorporation of a nucleotide having the base modification and 2' OMe modification, with unmodified 2' positions being hydrogen, or alternatively independently selected from LNA.
  • a modification such as 2' O'Me. That is, the oligonucleotide (e.g., of about 16 nucleotides) may have a sragle incorporation of a nucleotide having the base modification and 2' OMe modification, with unmodified 2' positions being hydrogen, or alternatively independently selected from LNA.
  • the oligonucleotide further comprises backbone chemistries such as cap modifications and phosphorothioate linkages.
  • the invention includes the discovery that novel base modified 2 '-OMe-pyrimidines show enhancements of duplex binding affinity with their complementary sequences when incorporated into antisense oligonucleotides. Additionally, these pyrimidine base modified 2'-OMe nucleotides with phosphorothioate backbone modifications show biological activity against their microRNA target sequences in cell culture, even without the use of transfection reagents. In vivo activity is also demonstrated herein using a model in vivo system showing knockdown of target miRNA in cardiac tissue.
  • the present invention provides a method of reducing or inhibiting RNA expression or activity in a ceil, a method of preventing or treating a condition in a subject associated with or mediated by RNA or expression thereof, the method using the base modified oligonucleotides described herein.
  • Figure 1 is a table showing the amount of T m enhancement for various base modifications of 2'-OMe-uridine oligonucleotides. Base modifications were carboxamido linkages at C5.
  • Figure 2 illustrates the synthesis of modified monomeric nucleosides and corresponding phosphoramidites for incorporation into oligonucleotides.
  • Figure 3 illustrates hydrophilic and hydrophobic nucleoside modifications synthesized via the scheme in Figure 2 and shows some example incorporation patterns in oligonucleotides.
  • Figure 4 compares T M measurements for several base modifications against LNA/DI A, 2'-OMe phoshorothioate, and DNA oligonucleotide. The base modification pattern is shown.
  • Figure 5 is a table of experimental T m measurements for modified anti-miR-208a when duplexed with unmodified miR-208a RNA. All oligonucleotides contain phosphorothioate linkages; +U stands for base modified nucleotide with 2'OMe; m stands for 2'OMe, yU stands for C 18 base modification and 2'OMe ribose; 1 stands for LNA modification; d stands for DNA.
  • Figure 6 shows a miR-208a knockdown by modified antimiR-208a in rat primary neonatal cardiomyocytes without lipid transfection reagent.
  • Figure 7 shows the miR-2()8a knockdown data in Figure 6 superimposed on bMHC levels.
  • Figure 8 is a plot of in vivo efficacy of base modified oligonucleotides in C57BL/6 mice. The plot shows the fold-change relative to saline injections for some modified oligonucleotides.
  • Figure 10 is a graph of AT m against number of base modifications and 2' modifications, and shows the synergistic effect.
  • Figure 1 1 is a graph of T m effect of a select base modification with respect to number of modifications and backbone chemistry.
  • the present invention relates to oligonucleotides comprising at least one nucleotide having a 2' modification and at least one nucleotide having an amino carbonvl modified base.
  • the present invention further relates to methods of use and synthesis for these oligonucleotides.
  • nucleoside base modification has been largely limited to investigations of effects on gene expression.
  • Certain nucleobase derivatives, especially C-5 propynylated pyrimidines have exhibited only modest gains in affinity/duplex stability for DNA'RNA duplexes (Znosko et al, J. Am. Chem. Soc.,125(20):6090-6097 2003)).
  • More complex pendant functional groups are considered less likely to increase oligonucleotide affinity, given the potential competing effects of hydrophobicity or steric effects (Hashimoto et al, J. Am.Chem.Soc, 115( 16): 7128-7134 (1993)).
  • base modification may potentially change the overall hydrophobicity and hydrogen bonding characteristic of an oligonucleotide bearing the modification, and might even lead to non-canonical base pairing interactions (Vaught et al, J, Am. Chem. Soc, 132(12):4141-4151 (2010)), an effect that is not desirable for sequence-specific RNA inhibition.
  • the present invention provides oligonucleotides comprising at least one nucleotide having a 2' modification and at least one nucleotide having an amino carbonyl modified base.
  • the oligonucleotides provide advantages in duple binding affinity, among other advantages, such as efficiency in RNA knockdown.
  • the oligonucleotide comprises a nucleotide sequence that is at least substantially complementary to a nucleotide sequence of human miRNA.
  • the oligonucleotide is substantially complementary or fully complementary to a mammalian transcript, other than a miRNA, and is therefore useful for antisense inhibition of gene expression.
  • the oligonucleotide comprises a sequence of a human miRNA sufficient to mimic of miRNA function.
  • the oligonucleotide is a detection probe for in vitro detection or quantification of nucleic acids in a sample, using any conventional platform, such as a microarray or other hybridization-based platform.
  • the oligonucleotide is from about 6 to about 22 nucleotides in length.
  • the oligonucleotides having one or more of the base, sugar, and/or backbone modifications disclosed herein can be, for example, from 8 to 18 nucleotides in length, or from 12 to 16 nucleotides in length.
  • the oligonucleotide is about 8 nucleotides in length, about 9 nucleotides in length, about 10 nucleotides in length, about 11 nucleotides in length, about 12 nucleotides in length, about 13 nucleotides in length, about 14 nucleotides in length, about 15 nucleotides in length, or about 16 nucleotides in length.
  • the oligonucleotide may have the sequence CTTTTTGCTCGTCTTA (SEQ ID O:64).
  • the base modification is generally an amino carbonyl, such as a. carboxamino, carbamoyl, or carbamide group.
  • the modification in various embodiments is at the C-5 position of one or more pyrimidine bases, and/or at C-8 of one or more purine bases.
  • the modifying amino carbonyl group of the instant oligonucleotide contains a radical or substituent which can be, without limitation, Ci-Qs alkyl, Ci-Cjg alkenyl, cycloalkyl, aryl, heteroaryl, heterocyclyl, and -(CH2) r .- RiR.2, wherein n is an integer from 1 to 6 and Rj and R 2 are independently H or Cj-Cealkyl.
  • the radical or substituent is a nitrogen- containing heterocyele, such as, for example, piperidine, piperazine, morpholino, or imidazole, each of which may be substituted or unsubstituted with one, two, or three alkyl or alkenyl substituents (e.g., Cl -8 or Cl-4).
  • heterocyele such as, for example, piperidine, piperazine, morpholino, or imidazole, each of which may be substituted or unsubstituted with one, two, or three alkyl or alkenyl substituents (e.g., Cl -8 or Cl-4).
  • alkyl or alkenyl substituents e.g., Cl -8 or Cl-4
  • Examples include 2-ethyl, 1-methyl- imidazole, 3-propyl imidazole, and propyl morpholino, which are depicted in Figure 1.
  • the radical or substituent is a carbocyclic group, such as a cycloalkyl (e.g., C5 to C8) or phenyl, which may optionally be substituted with one or more (e.g., 1, 2, or 3) alkyl or alkenyl substituents (e.g., CI -8 or Cl-4).
  • a cycloalkyl e.g., C5 to C8
  • phenyl which may optionally be substituted with one or more (e.g., 1, 2, or 3) alkyl or alkenyl substituents (e.g., CI -8 or Cl-4).
  • examples include Benzyl as shown in Figure 6,
  • the radical or substituent is a secondary or tertiary amine, for example, having one or two alkyl or alkenyl substituents (e.g., Cl -8, or Cl-4).
  • Examples include propyl dimethyl amino, and ethyl dimethyl amino, as shown in Figure 1.
  • the modifying amino carbonyl group contains a lipophilic or hydrophilic substituent, and in some embodiments, the substituent is cationic. Examples include C6 and CI 8 alkyl as shown in Figure 1.
  • the radical or substituent is bound to the C5 position of a pyrimidine base through a carboxamino linkage, optionally having a linking group of from 1 to 4 carbon units. The radical or substituent may be as described elsewhere herein.
  • the base modification contains a group that is positively charged, and optionally having multiple positive charges, under physiological conditions, such as a pipirazine.
  • Primary, secondary and quaternary amines can also be used as suitable base modifications.
  • the base modification contains a peptide linkage, which are more likely to be metabolized into less toxic iiucleobases.
  • the base modified nucleotides are incorporated in the middle of the sequence.
  • the modified nucleotides are not incorporated at the last 1 , 2, or 3 nucleotides on the 5' and 3 ' ends.
  • Moieties that are cationic under physiological conditions can provide substantial increases in T m .
  • imidazole and morpholine derivatives that have pKa's in the range of 6,5-7.5 provide substantial binding and biological activity.
  • Trialkylamines are also shown herein to be effective.
  • Other cationic species of interest include guanidine type derivatives and hydrazines or hydroxylamines.
  • substituted piperazmes moieties that often act pharmacologically similar to morpholines due to similar pKa's, but that have two cationic centers.
  • Hydrophobic substitutions such as benzyl and alkyl moieties may also enhance T m , provide nuclease resistance, and/or aid in cytosolic delivery.
  • the biological activity and T m enhancement may be due in-part to an increase in enthalpic binding, and therefore, the modified oligonucleotides have the potential to enhance mismatch discrimination, and are thus useful as probes for diagnostic applications.
  • the oligonucleotide further comprises at least one nucleotide with a 2' modification.
  • the term "2' modification” includes any 2' group other than H or OH.
  • the 2' modifications may be independently selected from Cl-6 alkyl, 2' 0-alkyl(Cl-C6), F, CI, NH 2 , CN, or SH.
  • Other potential 2' modifications are described elsewhere herein.
  • An exemplar ⁇ ' 2' modification is 2' O-Me, which may provide synergistic enhancements of the oligonucleotide's T in , together with the base modification (e.g., when incorporated in the same nucleotide).
  • at least one nucleotide has a 2' modification that is a 2' - 4' bridge locking the sugar in the C3 endo configuration.
  • the oligonucleotide contains a 2' modification selected from alkyl, alkenyl, alkynyl, and alkoxvalkyl, where the alkyl (including the alkyl portion of alkoxy), alkenyl and alkynyl may be substituted or unsubstituted.
  • the alkyl, alkenyl, and alkynyl may be CI to CIO alkyl, alkenyl, or alkynyl, such as CI, C2, or C3,
  • the hydrocarbon substituents may include one or two or three non-carbon atoms, which may be independently selected from N, O, and/or S.
  • the 2' modifications may further include the alkyl, alkenyl, and alkynyl as O-aikyl, O-alkenyl, and O-alkynyl.
  • exemplary 2' modifications in accordance with the invention include 2'-0- alkyl (Cl-3 alkyl, such as 2'OMe or 2'OEt), 2'-0-methoxyethyl (2'-0-MOE), 2'-0- aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMAOE), 2'-0- dimethylaminopropyl (2'-0-DMAP), 2'-0-dimethylaminoethyloxyethyI (2'-G-DMAEGE), or 2'-0-N-methylacetamido (2'-Q-NMA) substitutions,
  • the oligonucleotide may have several nucleotides with the base modification as described, such as from 1 to about 10, or about 2 to about 9 nucleotides.
  • the oligonucleotide contains (exactly) 1 , 2 or 3 nucleotides having the modified base.
  • the oligonucleotide may also, independently, have several nucleotides modified at the 2' position. That is, the base modified nucleotides may also contain a 2' modification as described, such as a 2'OMe modification.
  • at least one or two nucleotides have both a modified base and modified 2' position, each as described above.
  • the oligonucleotide comprises a nucleotide with a base modification shown in Figure 1, together with a 2'OMe modification.
  • the oligonucleotide in certain embodiments has exactly one, two, or three of such modified nucleotides.
  • the 2' modification may be locked nucleic acid (LNA).
  • LNAs are described, for example, in US Provisional Application Serial No. 61 /495,224, US Patent 6,268,490, US Patent 6,316,198, US Patent 6,403,566, US Patent 6,770,748, US Patent 6,998,484, US Patent 6,670,461, and US Patent 7,034,133, all of which are hereby incorporated by reference in their entireties.
  • LNAs are modified nucleotides or ribonucleotides that contain an extra bridge between the 2' and 4' carbons of the ribose sugar moiety resulting in a "locked" conformation, and/or bicvclic structure.
  • the oligonucleotide contains one or more LNAs having the structure shown by structure A below.
  • the oligonucleotide may contain one or more LNAs having the structure shown by structure B below.
  • the oligonucleotide contains one or more LNAs having the structure shown by structure C below.
  • Suitable locked nucleotides that can be incorporated in the oligonucleotides of the invention include those described in US Patent 6,403,566 and US Patent, 6,833,361, both of which are hereby incorporated by reference in their entireties.
  • the oligonucleotide may contain at, least 3, at least 5, or at least 7 locked nucleotides, and in various embodiments is not fully comprised of locked nucleotides.
  • the number and position of locked nucleotides may be as described in 61/495,224, which is hereby incorporated by reference, and particularly for miR-208 family inhibitors.
  • the oligonucleotide may have one or more 2'-deoxy nucleotides, and in some embodiments, contains from 2 to about 10 2'-deoxy nucleotides, in some embodiments, at least one, or all, base-modified nucleotides are 2' deoxy.
  • the number of nucleotides having a modified base may vary, but in certain embodiments is at least 25% of nucleotides, or at least 50% of nucleotides, or at least 75% of nucleotides, or 100% of nucleotides.
  • the enhancement of T m may be accomplished with relatively few base-modified nucleotides, such as less than 50% of nucleotides or less than 25% of nucleotides in some embodiments.
  • the oligonucleotide contains only 1 , 2, 3, or 4 base-modified nucleotides (e.g., as shown in Figure 1), and such base-modified nucleotides may also contain a 2' modification such as 2'OMe.
  • the base modified nucleotides in these embodiments may be pyrimidine bases, such as uridine or thymine in some embodiments.
  • the oligonucleotide contains a single incorporation of a base-modified oligonucleotide having a 2'OMe.
  • the oligonucleotide contains at least 6, or at least 9 nucleotides having a. 2'-QMe.
  • all nucleotides may be 2' O-Me.
  • the cationic class of C-5 modified bases exhibited substantial T m enhancement (as shown herein), in addition to some lipophillic enhancements to the C-5 position of 2'- OMe-Uridine.
  • T m enhancement as shown herein
  • mixtures of modifications containing both lipophillic and cationic moieties may have a larger effect on miRNA 's already associated with intracellular enzymes and proteins that regulate the miRNA's activity.
  • These chimeric nucleotides may not only associate with their complementary target sequence, but also interact with hydrophobic or hydrophilic regions of the protein associated with the miRNA.
  • the oligonucleotide further comprises at least one terminal modification or "cap”.
  • the cap may be a 5' and/or a 3 '-cap structure.
  • the terms "cap” or “end-cap” include chemical modifications at either terminus of the oligonucleotide (with respect to terminal ribonucleotides), and including modifications at the linkage between the last two nucleotides on the 5 ' end and the last two nucleotides on the 3' end.
  • the cap structure as described herein may increase resistance of the oligonucleotide to exonucleases without compromising molecular interactions with the RNA target or cellular machinery. Such modifications may be selected on the basis of their increased potency in vitro or in vivo.
  • the cap can be present at the 5'-terminus (5'-cap) or at the 3'-terminus (3 - cap) or can be present on both ends.
  • the 5' ⁇ and/or 3 '-cap is independently selected from phosphorothioate monophosphate, abasic residue (moiety), phosphorothioate linkage, 4' ⁇ thio nucleotide, carbocyclic nucleotide, phosphorodithioate linkage, inverted nucleotide or inverted abasic moiety (2'-3' or 3'-3'), phosphorodithioate monophosphate, and methylphosphonate moiety.
  • the phosphorothioate or phosphorodithioate Imkage(s), when part of a cap structure, are generally positioned between the two terminal nucleotides on the 5' end and the two terminal nucleotides on the 3' end.
  • the oligonucleotide has at, least one terminal phosphorothioate monophosphate.
  • the phosphorothioate monophosphate may be at the 5' and/or 3' end of the oligonucleotide.
  • a phosphorothioate monophosphate is defined by the following structures, where B is base, and R is a 2' modification as described above:
  • Phosphorothioate linkages may be present in some embodiments, such as between the last two nucleotides on the 5' and the 3' end (e.g., as part of a cap structure), or as alternating with phosphodiester bonds.
  • the oligonucleotide may contain at least one terminal abasic residue at either or both the 5' and 3' ends.
  • An abasic moiety does not contain a commonly recognized purine or pyrimidine nucleotide base, such as adenosine, guanine, cytosine, uracil or thymine.
  • abasic moieties lack a nucleotide base or have other non-nucleotide base chemical groups at the ⁇ position.
  • the abasic nucleotide may be a reverse abasic nucleotide, e.g., where a reverse abasic phosphoramidite is coupled via a 5' amidite (instead of 3' amidite) resulting in a 5 '-5' phosphate bond.
  • the stmcture of a reverse abasic nucleoside for the 5' and the 3' end of a polynucleotide is shown below.
  • the oligonucleotide may contain one or more phosphorothioate linkages. Phosphorothioate linkages have been used to render oligonucleotides more resistant to nuclease cleavage.
  • the polynucleotide may be partially phosphorothioate- linked, for example, phosphorothioate linkages may alternate with phophodiester linkages. In certain embodiments, however, the oligonucleotide is fully phosphorothioate-linked. In other embodiments, the oligonucleotide has from one to five or one to three phosphate linkages.
  • the invention includes the discovery that novel base modified 2'-OMe-pyrimidines show enhancements of duplex binding affinity with their complementary sequences when incorporated into 2'-GMe nucleotides (See Figure 1). Additionally, these pyrimidine base modified 2'-OMe nucleotides with phosphorothioate backbone modifications show biological activity against their microRNA. target, sequences in cell culture, even without the use of transfection reagents, a characteristic that unconjugated 2'-OMe phosphorothioate nucleotides do not exhibit without the use of special 3' and 5' ⁇ conjugates.
  • pyrimidine base modified 2'-OMe nucleotides with phosphorothioate backbone modifications exhibit knockdown of target rniRN.A in cardiac tissue following saline injection ( Figure 8).
  • Figure 8 A series of model compounds were synthesized where the pendant modification on the C-5 base position were either hydrophobic or hydrophilic. Structures are included in Figures 1 -3.
  • Anti-miRNA oligonucleotides containing only C-5 hydrophobic modifications of ail of the 2'-OMe-uridine nucleosides modestly increases the T m of a duplex compared to the nucleotides with unmodified 2'-OMe-uridine.
  • nucleotides did not provide substantial benefit with respect to miRNA inhibition in cell culture experiments, both with and without lipid transfection reagents ( Figures 6 and 7).
  • anti-miRNA nucleotides containing hydrophilic, amine (catioiiic) containing pendant, groups alone on C-5 of all uridines showed large increases in T m ( Figures 4-6).
  • cell culture experiments with nucleotides containing these modifications show unique biological properties such as the ability to inhibit, miRNA. targets, even in the absence of lipid transfection reagents or conjugates. It should also be noted that some nucleotides with combinations of hydrophobic and cationic base modifications showed good anti-miRNA activity.
  • pyrimidine base modifications enhance binding affinity through interaction with the polar major groove of the resulting RNA.
  • duplexes The nucleosides described herein are modified, for example, via carboxamido modifications that are cross conjugated to the pyrimidine base and provide additional hydrogen bonding sites, either to another nucleobase or to the polar major groove. This is a distinct mode of duplex stabilization than commonly used sugar modifications, such as bridged nucleosides and 2 '-modifications, that favor A-form conformations of the nucleobase which enhance binding to RNA.
  • C-5 carboxamido-modified nucleobases will act at least additively to the binding enhancement provided by sugar modification.
  • C-5 carboxamido-modified nucleosides that also contain a 2'-4'-bridged sugar can also be employed to achieve enhanced binding of the oligonucleotides to their target, including the bridge structure shown below.
  • Oligonucleotides incorporating the 2'-CBBN nucleosides are described in US Provisional Application No. 61/532,738, which is hereby incorporated by reference.
  • R represents the carboxamido modification described herein
  • R' and R" represent the 5' and 3 ' ends.
  • Nucleotides incorporating the modified nucleobases described herein display enhanced binding affinity to their complementary nucleotides. Increases in T m have been measured as high as 5 °C/incorporation ( Figure 5), comparable to the bicyciic LNA monomers that, to this point, have been observed to be the most effective and widely used affinity enhancing modification. The enhancement of T m may be especially effective in creating more active and potent microRNA inhibitors.
  • nucleobase modifications likely enhance cellular uptake by either masking some of the negatively charged phosphates, in the case of cationic moieties, or, in the case of lipophillie modifications, by shielding the backbone from nucleases and creating an aniphiphiliic nucleotide ( Figures 6, 7, and 8).
  • the modifications may be used in oligonucleotides designed to mimic miRNA sequences, and may comprise any one of the mature miRNA sequences in Table 1 below.
  • Such antisense and sense sequences may be incorporated into shRNAs or other R A structures containing stem and loop portions, for example.
  • Such sequences are useful for, among other things, mimicking or targeting miRN A function for treatment or ameliorating cardiac hypertrophy, myocardial infarction, heart failure (e.g., congestive heart failure), vascular damage, and/or pathologic cardiac fibrosis, among others.
  • Exemplary miRNA therapeutic utilities are disclosed in the US and PCT patent references listed in Table 1 below, each of which is hereby incorporated by reference in its entirety.
  • the mature and pre-processed forms of miRNAs are disclosed in the patent references listed below, and such descriptions are also hereby incorporated by reference.
  • the oligonucleotide targets a miR-208 family miRNA, such as miR-208a or miR-208b, or alternatively miR- 15b or miR-21 .
  • the oligonucleotide has a sequence and structure shown in Figure 5. "m” refers to 2'OMe modification, and “+” refers to base-modified nucleotide with 2'OMe. Descriptions of abbreviations are found in Figure 1 and Figure 5.
  • the oligonucleotide may be incorporated within a variety of macromolecular assemblies or compositions.
  • Such complexes for delivery may include a variety of liposomes, nanopartic!es, and micelles, formulated for delivery to a patient.
  • the complexes may include one or more fusogenic or lipophilic molecules to initiate cellular membrane penetration.
  • fusogenic or lipophilic molecules to initiate cellular membrane penetration.
  • the oligonucelotide may further comprise a pendant lipophilic group to aid cellular delivery, such as those described in WO 2010/129672, which is hereby incorporated by reference.
  • the present invention relates to a pharmaceutical composition which comprises an effective amount of the oligonucleotide of the present invention or a its pharmaceutically-acceptable, and a pharmaceutically-acceptable carrier or diluent.
  • the composition or formulation may employ a plurality of therapeutic oligonucleotides, including at least one described herein.
  • the composition or formulation may employ at least 2, 3, 4, or 5 miRNA inhibitors described herein.
  • the oligonucleotides of the invention may be formulated as a variety of pharmaceutical compositions. Pharmaceutical compositions will be prepared in a form appropriate for the intended application. Generally, this will entail preparing compositions that are essentially free of pyrogens, as well as other impurities that could be harmful to humans or animals.
  • Exemplary delivery/ formulation systems include colloidal dispersion systems, macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.
  • Commercially available fat emulsions that are suitable for delivering the nucleic acids of the invention to cardiac and skeletal muscle tissues include Intralipid®, liposyn®, Liposyn® II, Liposyn® III, Nutrilipid, and other similar lipid emulsions.
  • a preferred colloidal system for use as a delivery vehicle in vivo is a liposome (i.e., an artificial membrane vesicle). The preparation and use of such systems is well known in the art.
  • Exemplary formulations are also disclosed in LIS 5,981 ,505; US 6,217,900; US 6,383,512; US 5,783,565; US 7,202,227; US 6,379,965; US 6,127,170; US 5,837,533; US 6,747,014; and WO03/093449, which are hereby incorporated by reference in their entireties,
  • compositions and formulations may employ appropriate salts and buffers to render delivery vehicles stable and allow for uptake by target cells.
  • Aqueous compositions of the present invention comprise an effective amount of the delivery vehicle comprising the inhibitor oligonucleotide (e.g. liposomes or other complexes), dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium.
  • pharmaceutically acceptable or “pharmacologically acceptable” refers to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to an animal or a human.
  • pharmaceutically acceptable carrier may include one or more solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like acceptable for use in formulating pharmaceuticals, such as pharmaceuticals suitable for administration to humans.
  • pharmaceuticals such as pharmaceuticals suitable for administration to humans.
  • the use of such media and agents for pharmaceutically active substances is well known in the art.
  • Supplementary active ingredients also can be incorporated into the compositions.
  • Administration or deliver ⁇ ' of the pharmaceutical compositions according to the present invention may be via any route so long as the target tissue is available via that route.
  • administration may be by intradermal, subcutaneous, intramuscular, intraperitoneal or intravenous injection, or by direct injection into target tissue (e.g., cardiac tissue).
  • target tissue e.g., cardiac tissue.
  • the stability and/or potency of the oligonucleotides disclosed herein allows for convenient routes of administration, including subcutaneous, intradermal, and intramuscular.
  • Pharmaceutical compositions comprising miRNA inhibitors may also be administered by catheter systems or systems that isolate coronary circulation for delivering therapeutic agents to the heart.
  • catheter systems for delivering therapeutic agents to the heart and coronary vasculature are known in the art.
  • compositions or formulations may also be administered parenterally or intraperitoneally.
  • solutions of the conjugates as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose.
  • Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations generally contain a preservative to prevent the growth of microorganisms.
  • the pharmaceutical forms suitable for injectable use or catheter delivery include, for example, sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • these preparations are sterile and fluid to the extent that easy injectabiiity exists.
  • Preparations should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
  • Appropriate solvents or dispersion media may contain, for example, water, ethanol, polyoi (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
  • the proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • a coating such as lecithin
  • surfactants for example, sodium sulfate, sodium sulfate, sodium sulfate, sodium sulfate, sodium sulfate, sodium sulfate, sodium sulfate, sodium sorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions may be prepared by incorporating the conjugates in an appropriate amount into a solvent along with any other ingredients (for example as enumerated above) as desired.
  • dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the desired other ingredients, e.g., as enumerated above.
  • the preferred methods of preparation include vacuum-drying and freeze-drying techniques which yield a powder of the active ingredients) plus any additional desired ingredient from, a previously sterile-filtered solution thereof.
  • solutions are preferably administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective.
  • the formulations may easily be administered in a variety of dosage forms such as injectable solutions, drug release capsules and the like.
  • the solution generally is suitably buffered and the liquid diluent first rendered isotonic for example with sufficient saline or glucose.
  • aqueous solutions may be used, for example, for intravenous, intramuscular, subcutaneous and intraperitoneal administration.
  • sterile aqueous media are employed as is known to those of skill in the art, particularly in light of the present disclosure.
  • a single dose may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclvsis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences” 15th Edition, pages 1035-1038 and 1570-1580).
  • Some variation in dosage will necessarily occur depending on the condition of the subject being treated.
  • the person responsible for administration will, in any event, determine the appropriate dose for the individual subject.
  • preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biologies standards,
  • the present invention provides a method of reducing or inhibiting RNA expression or activity in a cell.
  • the method comprises contacting the ceil with a modified oligonucleotide (or pharmaceutical composition thereof) having a chemistry pattern described herein, where the oligonucleotide hybridizes (e.g., is at least substantially complementary to) an RNA transcript expressed by the cell.
  • the RN A is a miRNA.
  • the present invention provides a method of preventing or treating a condition in a subject associated with or mediated by RNA or expression thereof.
  • the RNA is a miRNA.
  • the method of prevention or treatment according to the present invention involves administering to the subject a pharmaceutical composition which comprises an effective amount of the base-modified oligonucleotide or a its pharmaceutically-acceptable composition thereof.
  • the invention provides a method for delivering the modified oligonucleotides to a mammalian cell (e.g., as part of a composition or formulation described herein), and methods for treating, ameliorating, or preventing the progression of a condition in a mammalian patient.
  • a mammalian cell e.g., as part of a composition or formulation described herein
  • the oligonucleotide or pharmaceutical composition may be contacted in vitro or in vivo with a target cell (e.g., a mammalian cell).
  • the cell may be a heart, cell.
  • the method generally comprises administering the oligonucleotide or composition comprising the same to a mammalian patient or population of target cells.
  • the oligonucleotide may be a miRNA inhibitor (e.g., having a nucleotide sequence designed to inhibit expression or activity of a miRNA).
  • the miRNA inhibiter is an inhibitor of a miR-208 family miRNA
  • the patient may have a condition associated with, mediated by, or resulting from, miR-208 family expression.
  • Such conditions include, for example, cardiac hypertrophy, myocardial infarction, heart failure (e.g., congestive heart failure), vascular damage, restenosis, or pathologic cardiac fibrosis, cancer, or other miRNA associated disorder, including those disorders described in the patent publication listed in Table L
  • heart failure e.g., congestive heart failure
  • vascular damage e.g., vascular damage, restenosis, or pathologic cardiac fibrosis, cancer, or other miRNA associated disorder, including those disorders described in the patent publication listed in Table L
  • the invention provides a use of the modified oligonucleotides and compositions of the invention for treating such conditions, and for the preparation of medicaments for such treatments.
  • the patient e.g., human patient
  • the patient has one or more risk factors including, for example, long standing uncontrolled hypertension, uncorrected valvular disease, chronic angina, recent myocardial infarction, congestive heart failure, congenital predisposition to heart disease and pathological hypertrophy.
  • the patient may have been diagnosed as having a. genetic predisposition to, for example, cardiac hypertrophy, or may have a familial history of, for example, cardiac hypertrophy.
  • the present invention may provide for an improved exercise tolerance, reduced hospitalization, better quality of life, decreased morbidity, and/or decreased mortality in a patient with heart failure or cardiac hypertrophy.
  • the activity of micoRNA in cardiac tissue, or as determined in patient serum, is reduced or inhibited.
  • the pharmaceutical composition is administered by parenteral administration or by direct injection into heart tissue.
  • the parenteral administration may be intravenous, subcutaneous, or intramuscular.
  • the composition is administered by oral, transdermal, sustained release, controlled release, delayed release, suppository, catheter, or sublingual administration.
  • the oligonucleotide is administered at, a dose of 25 mg/kg or less, or a dose of 10 mg/kg or less, or a dose of 5 mg/kg or less.
  • the oligonucleotide or composition may be administered by intramuscular or subcutaneous injection, or intravenously.
  • the methods further comprise scavenging or clearing the miR A inhibitors following treatment.
  • a oligonucleotide having a nucleotide sequence that is complementary to the inhibitor may be administered after therapy to attenuate or stop the function of the inhibitor.
  • Example 1 Gesseral Procedure For Preparation of S-posltioo-modified 2'-0- methyhiridine ssiic!eoside phosphoramidites
  • 5-Iodo-2'-0-methyluridine was readily synthesized by known methods, and is also commercially available.
  • the 5'- and 3 '-hydroxy 1 groups of the nucleoside are protected by standard 4,4'-Dimethoxytritylation and acetylation methods, respectively.
  • This doubly protected nucleoside was then subjected to carboxamidation by dissolving the nucleoside in a 1 : 1 mixture of anhydrous THF and ⁇ , ⁇ -dimethylacetamide in a 50 mL borosiiicate boston round bottle.
  • 5 equivalents of TEA and 3 equivalents of a primary amine or amine hydrochloride were added to the mixture followed by addition of 0.1 equiv.
  • the Bottle is placed into a 250 mL Parr Bomb, which is sealed and evacuated through the needle valve.
  • the Bomb is then pressurized to 60 psi with Carbon Monoxide.
  • the bomb is then evacuated under high vacuum and re-charged with Carbon Monoxide (60psi).
  • the bomb is resealed and placed in an oil bath heated to 70 °C For 17h.
  • the bomb is cooled to rt and the pressure released slowly.
  • the bottle is removed from the bomb and the solvent is removed in vacuo (Vaught et al., J. Am. Chem. Soc, 132(12):4141 -4151 (2010) which is hereby incorporated by reference in its entirety).
  • TLC revealed that the reaction was complete.
  • the reaction mixture was diluted with sat NaHC0 3 ( 100 mL) and the aqueous phase was extracted with DC (3 x 50 mL).
  • the organic phases were combined and dried with a brine wash (1 x 50 mL) and addition of Na S0 4 .
  • the organic phase was filtered and concentrated.
  • Carboxamido-substituents for modifications were chosen from both hydrophilic and hydrophobic groups.
  • Hydrophilic groups were preferentially chosen for the following reasons: Their ability to create new hydrogen bonding interactions with other nucleobases; the lack of exchangeable protons or sensitive functional groups that would require extra protecting groups under standard oligonucleotide synthesis; the cationic nature of these groups at physiological pH.
  • Hydrophobic groups were chosen to attempt to exploit pi- stacking interactions between nucleobases and to create new hydrophobic regions in the nucleotide. Creating new hydrophobic and cationic/hydrophilic regions on a nucleotide may also create enhanced binding to serum proteins that enhance cell permeability.
  • Pendant hydrophobic groups such as sterols and straight chain lipids
  • nucleotides with 2 '-hydrophobic modifications can enhance cellular uptake by increasing interaction with serum lipoprotein particles.
  • counteracting the very anionic nucleotide backbone with highly charged cationic species also enhances cellular uptake.
  • Short strands of oligonucleotides bearing sugar and base modifications can be prepared once the modified nucleoside is synthesized and the free 5' and 3 '-hydroxy! groups are masked with appropriate reactive groups to become a nucleotide monomer.
  • oligonucleotide synthesis a series of nucleotide monomers are sequentially attached, via their phosphoramidite derivatives, in a predetermined order to either, depending on the direction of chain extension, the 5'-funetional group or the 3'- functional group of the growing oligonucleotide strand.
  • the oligonucleotide strand is anchored to an insoluble moiety such as controlled pore glass or polystyrene resin beads.
  • the method of attachment of each monomer is generally comprised of the following steps 1-5.
  • Step 1 involves the protection of the reactive functionality.
  • the common reactive functionality is the 5 -hydroxyl group of the terminal nucleoside. This functionality is usually protected with a 4,4'-dimethoxytrityl (DMT) moiety that can be removed via acid treatment.
  • DMT 4,4'-dimethoxytrityl
  • One of the attractive features of the DMT moiety is that it forms a bright orange DMT cation during acid deprotection.
  • Step 2 involves the coupling by addition of a phosphoramidite derivative and an activator.
  • the phosphoramidite derivative is usually a nucleoside phosphoramidite, however, it may also be a phosphoramidite derivatized with a different organic moiety.
  • Step 3 involves the capping of unreacted terminal functional groups. This step introduces an inert protective group that prevents further coupling to failure sequences.
  • Step 4 involves oxidation of the newly formed phosphorous nucleotide backbone linkage from the trivending phosphite to the stable pentavalent state.
  • This oxidation step can be performed with either an oxygen-based oxidant that results in a phosphate nucleotide or a sulfurizing oxidant that results in a phosphorothioate nucleotide.
  • Step 5 involves a repetition of the process the after a washing step.
  • Truncated, 16 nucleotide sequence complementary to a nucleotide sequence of human mi -208a was synthesized in 1 iimol scale on an ABI Expedite 8909 Automated Nucleic Acid Synthesis System, The synthesizer was operated using standard detritylation and capping solutions, known to those skilled in the art, single couplings of 420 seconds for each base and oxidation with 0.2M PADS oxidation solution after each coupling cycle.
  • the unmodified anti-208a RNA sequence incorporates nine uridine residues which were fully replaced with nine modified nucleobases.
  • the balance of the nucleotides were comprised of 2'-0-methyl-nueleotides.
  • One exception was the incorporation of oieyl- carboxamido derivative, where there is a single incorporation on base position 15 of 16 where the nucleoside amidite was incorporated via a double coupling of 420 seconds each.
  • Phosphoramidite Reagent (3c) in the Synthesis of the Base Modified Oligonucleotide was used.
  • the oligodeoxynucleotide was synthesized using an ABI Expedite (Model 8909) DNA'RNA synthesizer. The synthesis was performed according to the manufacturer's recommendations in DMT-ON mode employing commercial synthesis reagents, exchanging 0.2M PADS in 1 : 1 Pyridine/ ACN for the oxidizing solution.
  • the phosphoramidite reagent was added as a 0.1 M solution in acetonitrile during the appropriate coupling cycle.
  • the cleavage of the oligonucleotide from the support was accomplished either by the method of described in US Patent 5,750,672 (which is hereby incorporated by reference in its entirety) or via heating of the CPG bound oligonucleotide with a solution of 40% aqueous methyl amine at 55 °C for 30 minutes.
  • the resultant aqueous solution of oligonucleotide was further purified by loading the crude DMT-ON oligonucleotide solution on a Waters Sep-Pak® Vac CI 8 cartridge and eluting using a standard DMT-ON oligonucleotide desalting procedure known to those knowledgeable in the art.
  • the characterization of product was performed by MALDI-TOF mass spectrometry utilizing 3-hydroxypieoiinie acid as matrix and standard methods known to those knowledgeable in the art: calcd 6922.4, found 6920.7.
  • Compound M- 10708 ( Figure 5) was synthesized with amidite 3e in the uridine position in exactly the manner described above. The characterization of product was performed by ESI mass spectrometry on a Waters SQD mass detector in 200 niM HFIP/8.15 niM TEA buffer gradient with MeOH: calcd 6597.6, found 6599.1.
  • Compound M- 10768 ( Figure 5) was synthesized with 2'-0-methyluridine in its amidite position and amidite 3d in the auxiliary amidite position in exactly the manner described above.
  • the characterization of product was performed by ESI mass spectrometry (negative mode) on a Waters SQD mass detector in 200 mM HFIP/8.15 mM TEA buffer gradient with MeOH: calcd 6003.9, found 6005.2.
  • Compound M- 10772 ( Figure 5) was synthesized with amidite 3i in the uridine position in exactly the manner described above. The characterization of product was performed by ESI mass spectrometry (negative mode) on a Waters SQD mass detector in 200 mM HFIP/8.15 mM TEA buffer gradient with MeOH: calcd 6552.8, found 6553.4.
  • Compound M- 10774 ( Figure 5) was synthesized with 2'-0-methyluridine in its amidite position and amidite 3i in the auxiliary amidite position in exactly the manner described above.
  • the characterization of product was performed by ES mass spectrometry (negative mode) on a Waters SQL ) mass detector in 200 mM HFIP/8.15 mM TEA buffer gradient with MeOH: calcd 5912.0, found 5912.8.
  • Compound M- 10876 ( Figure 5) was synthesized with amidite 3b in the uridine position in exactly the manner described above. The characterization of product was performed by ESI mass spectrometry (negative mode) on a Waters SQD mass detector in 200 mM HFIP/8.15 mM TEA buffer gradient with MeOH: calcd 6931.2, found 6931.9.
  • the characterization of product was performed by ESI mass spectrometry (negative mode) on a Waters SQD mass detector in 200 mM HFIP/8.15 mM TEA buffer gradient with MeOH: calcd 7056.0, found 7056.5.
  • Compound M- 10878 ( Figure 5) was synthesized with 2'-0-methyluridine in its amidite position and amidite 3b in the auxiliary amidite position in exactly the manner described above.
  • the characterization of product was performed by ESI mass spectrometry (negative mode) on a Waters SQD mass detector in 200 mM HFIP/8. 5 mM TEA buffer gradient with MeOH: calcd 6080.1, found 6081.
  • T m Melting temperature enhancement was determined on a per incorporation basis by determining the difference between the melting temperature of the modified strand and that of the identical sequence utilizing either a phosphorothioate DNA nucleotide or a phosphorothioate 2'-0-methyl RNA nucleotide.
  • the modified anti-208a oligonucleotides were annealed to the complementary sequence, twenty-two nucleotides in length, comprised of RNA nucleosides and a phosphate backbone.
  • the complementary sequence was identical to the endogenous miRNA.
  • Thermal denaturation temperatures (T m ) were measured as a maximum of the first derivative plot of melting curvex (A 260 vs. Temp).
  • the duplexes were constituted at ⁇ in a 0.9% NaCl buffer. Temperature was ramped from 25 °C to 95 °C at 4 °C/min and OD's at 260 nm were read once per minute. T m values are averages of at least two measurements.
  • Duplex melting temperatures for various modifications of a 16 nucleotide sequence complementary to a nucleotide sequence of human miR-208a Modifications included a mixed 9 LNA/7 DNA phosphorothioate, fully substituted 2'-0-methyl- nucleotide phosphorothioate, fully 2'-deoxynucleotide phosphorothioate and various substitution patterns of fully 2'-0-methyl-nucieotides with 5-carboxamide substituents.
  • the 5-(2-(2 -methyl- lH-imidazo 1-1 -yi)- ethylca.rboxamido)-2'-0-methyluridine nucleotide variant shows inhibition of miR-208a when incorporated in a 16-nucieotide 2'-0-methyl phosphorothioate anti-208a nucleotide sequence where either 4 or 9 of the total 9 natural uridine nucleotide positions are substituted. It is only the oligonucleotide that has 4 substitutions that shows effective bMHC mRN A regulation.
  • oligonucleotides were studied in vivo in C57BL/6 mice (10941 , 10876, 10711). A scrambled control containing the comparable bases of each oligo were also injected (11091, 11087, 1 108(5). The oligonucleotides were dosed with a 25 nig/kg delivered via subcutaneous injection on Day 1. Cardiac tissue was harvested 4 days after dosing and miR-208a levels were determined via. real time PCR. There was neither injection site reaction nor any visible organ damage following take down of the mice.
  • Figure 10 presents data from figure 9 as AT m / er modification, counting both sugar and base modifications.
  • Multiple incorporations of 5-carboxyamido-2'-0- methyl uridine nucleosides unexpectedly give a greater stabilization per sugar and base modification than either the base or sugar do alone.
  • This evidence indicates that 5- carboxamido in conjunction with modifications that favor a 3'-endo sugar pucker of nucleosides are more than additive. They work synergistically to give greater duplex stabilit than either modification alone. Increased duplex stability, subject to limits, is likely desirable for certain oligonucleotide based therapeutics, such as mieroRNA inhibitors.
  • these types of modifications may also protect from enzymatic degradation, cellular delivery due to decreased electrostatic charge and enhanced pharmacokinetic and/or pharmacodynamic properties.
  • modifications disclosed in this invention can be used alone, as single or multiple incorporations, or in conjunction with other sugar modifications, as single or multiple incorporations, to obtain a therapeutic oligonucleotide with desirable duplexing properties, duplex-protein binding properties, or along with desirable pharmacokinetic and/or pharmacodynamic properties.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Urology & Nephrology (AREA)
  • Vascular Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicinal Preparation (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Saccharide Compounds (AREA)

Abstract

The present invention relates to oligonucleotides with base modified nucleosides for enhancement of binding affinity.

Description

BASE MODIFIED OLIGONUCLEOTIDES
[0001] This application claims priority to U.S. Provisional Application No. 61/410,672, filed November 05, 2010, which is hereby incorporated by reference in its entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to modified oligonucleotides with enhanced binding affinity towards complementary polynucleotides.
BACKGROUND
[0003] MicroRNAs (miRs) have been implicated in a number of biological processes including regulation and maintenance of cardiac function (Van Rooij et al., "'MicroRNAs: Powerful New Regulators of Heart Disease and Proactive Therapeutic Targets," J. Clin. Invest. 117(9):2369-2376 (2007); Chien KR, "Molecular Medicine: MicroRNAs and the Tell-tale Heart," Nature 447:389-390 (2007)). Therefore, miRs represent a relatively new class of therapeutic targets for conditions such as cardiac hypertrophy, myocardial infarction, heart failure, vascular damage, and pathologic cardiac fibrosis, among others. miRs are small, non-protein coding RNAs of about, 18 to about 25 nucleotides in length, and act as repressors of target mRNAs by promoting their degradation, when their sequences are perfectly complementary, or by inhibiting translation, when their sequences contain mismatches. The mechanism involves incorporation of the mature miRNA. strand into the RNA-induced silencing complex (RISC), where it associates with its target RNAs by base-pair complementarity.
[0004] miRNA function may be targeted therapeutically by antisense polynucleotides or by polynucleotides that mimic miRNA. function ("miRNA mimetic"). However, targeting miRNAs therapeutically with oligomieleoti de-based agents poses several challenges, including RNA-binding affinity and specificity, efficiency of cel lular uptake, and nuclease resistance. For example, when polynucleotides are introduced into intact cells they are attacked and degraded by nucleases leading to a loss of activity. While polynucleotide analogues have been prepared in an attempt to avoid their degradation, e.g., by means of 2' substitutions (Sproat et al, Nucleic Acids Research 17:3373-3386 (1989)), the modifications often affect the polynucleotide's potency for its intended biological action. Such reduced potency, in each case, may be due to an inability of the modified polynucleotide to form a stable duplex with the target RNA and/or a loss of interaction with the cellular machinery . Other modifications include the use of locked nucleic acid, which has the potential to improve RNA-binding affinity (Veedu et aL, "Locked Nucleic Acid as a Novel Class of Therapeutic Agent," RNA Biology 6:3, 321-323 (2009)).
[0005] Oligonucleotide chemistry patterns or motifs for miRNA inhibitors have the potential to improve the delivery, stability, potency, specificity, and/or toxicity profile of the inhibitors, and as such are needed for effectively targeting miRNA function in a therapeutic context.
SUMMARY OF THE INVENTION
[0006] The present invention relates to oligonucleotides comprising at least one nucleotide having a 2' modification and at least one nucleotide having an amino carbonyl modified base, as well as pharmaceutical compositions comprising the modified oligonucleotides, and methods of use and synthesis for these oligonucleotides.
[0007] In one aspect, the present invention provides oligonucleotides comprising at least one nucleotide having a 2' modification and at least one nucleotide having an amino carbonyl modified base. In various embodiments, the oligonucleotides provide advantages in duplex binding affinity, among other advantages, such as efficiency in RNA knockdown. In some embodiments, the oligonucleotide comprises a nucleotide sequence that is at least substantially complementary to a nucleotide sequence of human miRNA . In other embodiments, the oligonucleotide is at least substantially complementary to a mammalian transcript, other than a miRNA, and is therefore useful for antisense inhibition of gene expression, in still other embodiments, the oligonucleotide comprises the sequence of a human miRNA, and thereby mimics miRNA function, in still other embodiments, the oligonucleotide is a detection probe for in vitro detection or quantification of nucleic acids in a sample, using any conventional platform.
[0008] The base modification is an amino carbonyl, such as a carboxamino, carbamoyl, or carbamide group. The modification in various embodiments is at the C-5 position of a pyrimidine base or C-8 of a purine base. The modifying amino carbonyl group of the instant oligonucleotide contains a radical or substituent which can be, without limitation, C-.-C] 8 alkyl, C-.-Cjg alkenyl, cycloalkyl, aryl, heteroaryi, heterocyclyl, and -(C3¾)n-NRiR2, wherein n is an integer from 1 to 6 and R¾ and R2 are independently H or Ci -Cealkyi. Exemplary moieties include piperidine, piperazine, morpholino, or imidazole, each of which may be substituted or unsubstituted. In other embodiments, the substituent is from C4 to C20 alkyl or alkenyl, phenyl, or an amine,
[0009] The oligonucleotide further comprises at least one nucleotide with a 2' modification. In some embodiments, the 2' modifications may be independently selected from CI -6 alkyl, 2' 0-aikyl(Cl -C6), F, CI, N¾, CN, or Si I. Other potential 2' modifications are described elsewhere herein. An exemplary 2' modification is 2' Q-Me, which may provide synergistic enhancements of the oligonucleotide's Tm, together with the base modification. In still other embodiments, at least, one nucleotide has a 2' modification that is a 2' - 4' bridge locking the sugar in the C3 endo configuration. Unmodified 2' positions may be hydrogen.
[0010] The number of nucleotides having a modified base may vary, but in certain embodiments is at least 25% of nucleotides, or at least 50% of nucleotides, or at least 75% of nucleotides or 100% of nucleotides. In some embodiments, the enhancement of Tm may be accomplished with relatively few base-modified nucleotides, such as less than 50% of nucleotides or less than 25% of nucleotides. In some embodiments, the oligonucleotide contains only 1 , 2, 3, or 4 base-modified nucleotides. The base modified nucleotides in these embodiments may be pyrimidine bases, such as uridine or thymine, and/or may contain a modification such as 2' O'Me. That is, the oligonucleotide (e.g., of about 16 nucleotides) may have a sragle incorporation of a nucleotide having the base modification and 2' OMe modification, with unmodified 2' positions being hydrogen, or alternatively independently selected from LNA.
[0011] In certain embodiments, the oligonucleotide further comprises backbone chemistries such as cap modifications and phosphorothioate linkages.
[0012] The invention includes the discovery that novel base modified 2 '-OMe-pyrimidines show enhancements of duplex binding affinity with their complementary sequences when incorporated into antisense oligonucleotides. Additionally, these pyrimidine base modified 2'-OMe nucleotides with phosphorothioate backbone modifications show biological activity against their microRNA target sequences in cell culture, even without the use of transfection reagents. In vivo activity is also demonstrated herein using a model in vivo system showing knockdown of target miRNA in cardiac tissue.
[0013 ] In another aspect, the present invention provides a method of reducing or inhibiting RNA expression or activity in a ceil, a method of preventing or treating a condition in a subject associated with or mediated by RNA or expression thereof, the method using the base modified oligonucleotides described herein.
DESCRIPTION OF THE FIGURES
[0014] Figure 1 is a table showing the amount of Tm enhancement for various base modifications of 2'-OMe-uridine oligonucleotides. Base modifications were carboxamido linkages at C5.
[0015] Figure 2 illustrates the synthesis of modified monomeric nucleosides and corresponding phosphoramidites for incorporation into oligonucleotides.
[0016] Figure 3 illustrates hydrophilic and hydrophobic nucleoside modifications synthesized via the scheme in Figure 2 and shows some example incorporation patterns in oligonucleotides. [0017] Figure 4 compares TM measurements for several base modifications against LNA/DI A, 2'-OMe phoshorothioate, and DNA oligonucleotide. The base modification pattern is shown.
[0018] Figure 5 is a table of experimental Tm measurements for modified anti-miR-208a when duplexed with unmodified miR-208a RNA. All oligonucleotides contain phosphorothioate linkages; +U stands for base modified nucleotide with 2'OMe; m stands for 2'OMe, yU stands for C 18 base modification and 2'OMe ribose; 1 stands for LNA modification; d stands for DNA.
[0019] Figure 6 shows a miR-208a knockdown by modified antimiR-208a in rat primary neonatal cardiomyocytes without lipid transfection reagent.
[0020] Figure 7 shows the miR-2()8a knockdown data in Figure 6 superimposed on bMHC levels.
[0021] Figure 8 is a plot of in vivo efficacy of base modified oligonucleotides in C57BL/6 mice. The plot shows the fold-change relative to saline injections for some modified oligonucleotides.
[0022 J Figure 9 shows the cumulative effect of base and sugar modifications, with both phosphate and phosphorothioate backbones.
[0023 ] Figure 10 is a graph of ATm against number of base modifications and 2' modifications, and shows the synergistic effect.
[0024] Figure 1 1 is a graph of Tm effect of a select base modification with respect to number of modifications and backbone chemistry.
DETAILED DESCRIPTION OF THE INVENTION
[0025] The present invention relates to oligonucleotides comprising at least one nucleotide having a 2' modification and at least one nucleotide having an amino carbonvl modified base. The present invention further relates to methods of use and synthesis for these oligonucleotides.
[0026] Studies of nucleoside base modification have been largely limited to investigations of effects on gene expression. Certain nucleobase derivatives, especially C-5 propynylated pyrimidines, have exhibited only modest gains in affinity/duplex stability for DNA'RNA duplexes (Znosko et al, J. Am. Chem. Soc.,125(20):6090-6097 2003)). More complex pendant functional groups (except as to known inter calators), are considered less likely to increase oligonucleotide affinity, given the potential competing effects of hydrophobicity or steric effects (Hashimoto et al, J. Am.Chem.Soc, 115( 16): 7128-7134 (1993)). Similarly to sugar alterations, base modification may potentially change the overall hydrophobicity and hydrogen bonding characteristic of an oligonucleotide bearing the modification, and might even lead to non-canonical base pairing interactions (Vaught et al, J, Am. Chem. Soc, 132(12):4141-4151 (2010)), an effect that is not desirable for sequence-specific RNA inhibition.
[0027] In one aspect, the present invention provides oligonucleotides comprising at least one nucleotide having a 2' modification and at least one nucleotide having an amino carbonyl modified base. In various embodiments, the oligonucleotides provide advantages in duple binding affinity, among other advantages, such as efficiency in RNA knockdown.
[0028] In some embodiments, the oligonucleotide comprises a nucleotide sequence that is at least substantially complementary to a nucleotide sequence of human miRNA. In other embodiments, the oligonucleotide is substantially complementary or fully complementary to a mammalian transcript, other than a miRNA, and is therefore useful for antisense inhibition of gene expression. In still other embodiments, the oligonucleotide comprises a sequence of a human miRNA sufficient to mimic of miRNA function. In other embodiments, the oligonucleotide is a detection probe for in vitro detection or quantification of nucleic acids in a sample, using any conventional platform, such as a microarray or other hybridization-based platform. [0029] In some embodiments, the oligonucleotide is from about 6 to about 22 nucleotides in length. The oligonucleotides having one or more of the base, sugar, and/or backbone modifications disclosed herein can be, for example, from 8 to 18 nucleotides in length, or from 12 to 16 nucleotides in length. In certain embodiments, the oligonucleotide is about 8 nucleotides in length, about 9 nucleotides in length, about 10 nucleotides in length, about 11 nucleotides in length, about 12 nucleotides in length, about 13 nucleotides in length, about 14 nucleotides in length, about 15 nucleotides in length, or about 16 nucleotides in length. For example, where the oligonucleotide targets miR-208a, the oligonucleotide may have the sequence CTTTTTGCTCGTCTTA (SEQ ID O:64).
[0030] The base modification is generally an amino carbonyl, such as a. carboxamino, carbamoyl, or carbamide group. The modification in various embodiments is at the C-5 position of one or more pyrimidine bases, and/or at C-8 of one or more purine bases. The modifying amino carbonyl group of the instant oligonucleotide contains a radical or substituent which can be, without limitation, Ci-Qs alkyl, Ci-Cjg alkenyl, cycloalkyl, aryl, heteroaryl, heterocyclyl, and -(CH2)r.- RiR.2, wherein n is an integer from 1 to 6 and Rj and R2 are independently H or Cj-Cealkyl.
[0031] For example, in some embodiments, the radical or substituent, is a nitrogen- containing heterocyele, such as, for example, piperidine, piperazine, morpholino, or imidazole, each of which may be substituted or unsubstituted with one, two, or three alkyl or alkenyl substituents (e.g., Cl -8 or Cl-4). Examples include 2-ethyl, 1-methyl- imidazole, 3-propyl imidazole, and propyl morpholino, which are depicted in Figure 1. In other embodiments, the radical or substituent is a carbocyclic group, such as a cycloalkyl (e.g., C5 to C8) or phenyl, which may optionally be substituted with one or more (e.g., 1, 2, or 3) alkyl or alkenyl substituents (e.g., CI -8 or Cl-4). Examples include Benzyl as shown in Figure 6, In still other embodiments, the radical or substituent is a secondary or tertiary amine, for example, having one or two alkyl or alkenyl substituents (e.g., Cl -8, or Cl-4). Examples include propyl dimethyl amino, and ethyl dimethyl amino, as shown in Figure 1. In some embodiments, the modifying amino carbonyl group contains a lipophilic or hydrophilic substituent, and in some embodiments, the substituent is cationic. Examples include C6 and CI 8 alkyl as shown in Figure 1. In some embodiments, the radical or substituent is bound to the C5 position of a pyrimidine base through a carboxamino linkage, optionally having a linking group of from 1 to 4 carbon units. The radical or substituent may be as described elsewhere herein.
[0032] In some embodiments, the base modification contains a group that is positively charged, and optionally having multiple positive charges, under physiological conditions, such as a pipirazine. Primary, secondary and quaternary amines can also be used as suitable base modifications. In various embodiments, the base modification contains a peptide linkage, which are more likely to be metabolized into less toxic iiucleobases.
[0033] In some embodiments, the base modified nucleotides are incorporated in the middle of the sequence. For example, in some embodiments, the modified nucleotides are not incorporated at the last 1 , 2, or 3 nucleotides on the 5' and 3 ' ends. Moieties that are cationic under physiological conditions can provide substantial increases in Tm. Notably, imidazole and morpholine derivatives that have pKa's in the range of 6,5-7.5 provide substantial binding and biological activity. Trialkylamines are also shown herein to be effective. Other cationic species of interest include guanidine type derivatives and hydrazines or hydroxylamines. Also of note are substituted piperazmes, moieties that often act pharmacologically similar to morpholines due to similar pKa's, but that have two cationic centers. Hydrophobic substitutions such as benzyl and alkyl moieties may also enhance Tm, provide nuclease resistance, and/or aid in cytosolic delivery.
[0034] In accordance with the present invention, the biological activity and Tm enhancement may be due in-part to an increase in enthalpic binding, and therefore, the modified oligonucleotides have the potential to enhance mismatch discrimination, and are thus useful as probes for diagnostic applications.
[0035] The oligonucleotide further comprises at least one nucleotide with a 2' modification. As used herein, the term "2' modification" includes any 2' group other than H or OH. For example, the 2' modifications may be independently selected from Cl-6 alkyl, 2' 0-alkyl(Cl-C6), F, CI, NH2, CN, or SH. Other potential 2' modifications are described elsewhere herein. An exemplar}' 2' modification is 2' O-Me, which may provide synergistic enhancements of the oligonucleotide's Tin, together with the base modification (e.g., when incorporated in the same nucleotide). In still other embodiments, at least one nucleotide has a 2' modification that is a 2' - 4' bridge locking the sugar in the C3 endo configuration.
[0036] In these or other embodiments, the oligonucleotide contains a 2' modification selected from alkyl, alkenyl, alkynyl, and alkoxvalkyl, where the alkyl (including the alkyl portion of alkoxy), alkenyl and alkynyl may be substituted or unsubstituted. The alkyl, alkenyl, and alkynyl may be CI to CIO alkyl, alkenyl, or alkynyl, such as CI, C2, or C3, The hydrocarbon substituents may include one or two or three non-carbon atoms, which may be independently selected from N, O, and/or S. The 2' modifications may further include the alkyl, alkenyl, and alkynyl as O-aikyl, O-alkenyl, and O-alkynyl.
[0037] Other exemplary 2' modifications in accordance with the invention include 2'-0- alkyl (Cl-3 alkyl, such as 2'OMe or 2'OEt), 2'-0-methoxyethyl (2'-0-MOE), 2'-0- aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMAOE), 2'-0- dimethylaminopropyl (2'-0-DMAP), 2'-0-dimethylaminoethyloxyethyI (2'-G-DMAEGE), or 2'-0-N-methylacetamido (2'-Q-NMA) substitutions,
[0038] The oligonucleotide may have several nucleotides with the base modification as described, such as from 1 to about 10, or about 2 to about 9 nucleotides. In some embodiments, the oligonucleotide contains (exactly) 1 , 2 or 3 nucleotides having the modified base. The oligonucleotide may also, independently, have several nucleotides modified at the 2' position. That is, the base modified nucleotides may also contain a 2' modification as described, such as a 2'OMe modification. In some embodiments, at least one or two nucleotides have both a modified base and modified 2' position, each as described above. In certain embodiments, the oligonucleotide comprises a nucleotide with a base modification shown in Figure 1, together with a 2'OMe modification. The oligonucleotide in certain embodiments has exactly one, two, or three of such modified nucleotides.
[0039] Where the 2' modification is a 2' - 4' bridge, the 2' modification may be locked nucleic acid (LNA). LNAs are described, for example, in US Provisional Application Serial No. 61 /495,224, US Patent 6,268,490, US Patent 6,316,198, US Patent 6,403,566, US Patent 6,770,748, US Patent 6,998,484, US Patent 6,670,461, and US Patent 7,034,133, all of which are hereby incorporated by reference in their entireties. LNAs are modified nucleotides or ribonucleotides that contain an extra bridge between the 2' and 4' carbons of the ribose sugar moiety resulting in a "locked" conformation, and/or bicvclic structure. In one embodiment, the oligonucleotide contains one or more LNAs having the structure shown by structure A below. Alternatively or in addition, the oligonucleotide may contain one or more LNAs having the structure shown by structure B below. Alternatively or in addition, the oligonucleotide contains one or more LNAs having the structure shown by structure C below.
Figure imgf000011_0001
C
[0040] Other suitable locked nucleotides that can be incorporated in the oligonucleotides of the invention include those described in US Patent 6,403,566 and US Patent, 6,833,361, both of which are hereby incorporated by reference in their entireties.
[0041] The oligonucleotide may contain at, least 3, at least 5, or at least 7 locked nucleotides, and in various embodiments is not fully comprised of locked nucleotides. In some embodiments, the number and position of locked nucleotides may be as described in 61/495,224, which is hereby incorporated by reference, and particularly for miR-208 family inhibitors.
[0042] The oligonucleotide may have one or more 2'-deoxy nucleotides, and in some embodiments, contains from 2 to about 10 2'-deoxy nucleotides, in some embodiments, at least one, or all, base-modified nucleotides are 2' deoxy.
[0043] The number of nucleotides having a modified base may vary, but in certain embodiments is at least 25% of nucleotides, or at least 50% of nucleotides, or at least 75% of nucleotides, or 100% of nucleotides. As shown herein, the enhancement of Tm may be accomplished with relatively few base-modified nucleotides, such as less than 50% of nucleotides or less than 25% of nucleotides in some embodiments. However, in some embodiment, the oligonucleotide contains only 1 , 2, 3, or 4 base-modified nucleotides (e.g., as shown in Figure 1), and such base-modified nucleotides may also contain a 2' modification such as 2'OMe. The base modified nucleotides in these embodiments may be pyrimidine bases, such as uridine or thymine in some embodiments. In some embodiments, the oligonucleotide contains a single incorporation of a base-modified oligonucleotide having a 2'OMe.
[0044] In some embodiments, the oligonucleotide contains at least 6, or at least 9 nucleotides having a. 2'-QMe. Alternatively, all nucleotides (or all purines or all pyrimidines in some embodiments) may be 2' O-Me.
[004S] The cationic class of C-5 modified bases exhibited substantial Tm enhancement (as shown herein), in addition to some lipophillic enhancements to the C-5 position of 2'- OMe-Uridine. Beyond simple Watson-Crick base pairing to miR A's of interest, mixtures of modifications containing both lipophillic and cationic moieties may have a larger effect on miRNA 's already associated with intracellular enzymes and proteins that regulate the miRNA's activity. These chimeric nucleotides may not only associate with their complementary target sequence, but also interact with hydrophobic or hydrophilic regions of the protein associated with the miRNA. [0046] In certain embodiments, the oligonucleotide further comprises at least one terminal modification or "cap". The cap may be a 5' and/or a 3 '-cap structure. The terms "cap" or "end-cap" include chemical modifications at either terminus of the oligonucleotide (with respect to terminal ribonucleotides), and including modifications at the linkage between the last two nucleotides on the 5 ' end and the last two nucleotides on the 3' end. The cap structure as described herein may increase resistance of the oligonucleotide to exonucleases without compromising molecular interactions with the RNA target or cellular machinery. Such modifications may be selected on the basis of their increased potency in vitro or in vivo. The cap can be present at the 5'-terminus (5'-cap) or at the 3'-terminus (3 - cap) or can be present on both ends. In certain embodiments, the 5'~ and/or 3 '-cap is independently selected from phosphorothioate monophosphate, abasic residue (moiety), phosphorothioate linkage, 4'~thio nucleotide, carbocyclic nucleotide, phosphorodithioate linkage, inverted nucleotide or inverted abasic moiety (2'-3' or 3'-3'), phosphorodithioate monophosphate, and methylphosphonate moiety. The phosphorothioate or phosphorodithioate Imkage(s), when part of a cap structure, are generally positioned between the two terminal nucleotides on the 5' end and the two terminal nucleotides on the 3' end.
[0047] In certain embodiments, the oligonucleotide has at, least one terminal phosphorothioate monophosphate. The phosphorothioate monophosphate may be at the 5' and/or 3' end of the oligonucleotide. A phosphorothioate monophosphate is defined by the following structures, where B is base, and R is a 2' modification as described above:
Figure imgf000014_0001
Figure imgf000014_0002
3( phosphorothioate monophosphate
[0048] Phosphorothioate linkages may be present in some embodiments, such as between the last two nucleotides on the 5' and the 3' end (e.g., as part of a cap structure), or as alternating with phosphodiester bonds. In these or other embodiments, the oligonucleotide may contain at least one terminal abasic residue at either or both the 5' and 3' ends. An abasic moiety does not contain a commonly recognized purine or pyrimidine nucleotide base, such as adenosine, guanine, cytosine, uracil or thymine. Thus, such abasic moieties lack a nucleotide base or have other non-nucleotide base chemical groups at the Γ position. For example, the abasic nucleotide may be a reverse abasic nucleotide, e.g., where a reverse abasic phosphoramidite is coupled via a 5' amidite (instead of 3' amidite) resulting in a 5 '-5' phosphate bond. The stmcture of a reverse abasic nucleoside for the 5' and the 3' end of a polynucleotide is shown below.
Figure imgf000014_0003
3' eiid of oiigo
Figure imgf000015_0001
[0049] The oligonucleotide may contain one or more phosphorothioate linkages. Phosphorothioate linkages have been used to render oligonucleotides more resistant to nuclease cleavage. For example, the polynucleotide may be partially phosphorothioate- linked, for example, phosphorothioate linkages may alternate with phophodiester linkages. In certain embodiments, however, the oligonucleotide is fully phosphorothioate-linked. In other embodiments, the oligonucleotide has from one to five or one to three phosphate linkages. 00S0] The synthesis of oligonucleotides, including modified polynucleotides, by solid phase synthesis is well known and is reviewed by Caruthers et al., "New Chemical Methods for Synthesizing Polynucleotides," Nucleic Acids Symp. Ser., (7):215-23 (1980) which is hereby incorporated by reference in its entirety.
[0051] The invention includes the discovery that novel base modified 2'-OMe-pyrimidines show enhancements of duplex binding affinity with their complementary sequences when incorporated into 2'-GMe nucleotides (See Figure 1). Additionally, these pyrimidine base modified 2'-OMe nucleotides with phosphorothioate backbone modifications show biological activity against their microRNA. target, sequences in cell culture, even without the use of transfection reagents, a characteristic that unconjugated 2'-OMe phosphorothioate nucleotides do not exhibit without the use of special 3' and 5'~ conjugates. Further, as shown herein, pyrimidine base modified 2'-OMe nucleotides with phosphorothioate backbone modifications exhibit knockdown of target rniRN.A in cardiac tissue following saline injection (Figure 8). [0052] A series of model compounds were synthesized where the pendant modification on the C-5 base position were either hydrophobic or hydrophilic. Structures are included in Figures 1 -3. Anti-miRNA oligonucleotides containing only C-5 hydrophobic modifications of ail of the 2'-OMe-uridine nucleosides, modestly increases the Tm of a duplex compared to the nucleotides with unmodified 2'-OMe-uridine. These nucleotides did not provide substantial benefit with respect to miRNA inhibition in cell culture experiments, both with and without lipid transfection reagents (Figures 6 and 7). In contrast, anti-miRNA nucleotides containing hydrophilic, amine (catioiiic) containing pendant, groups alone on C-5 of all uridines showed large increases in Tm (Figures 4-6). Furthermore, cell culture experiments with nucleotides containing these modifications show unique biological properties such as the ability to inhibit, miRNA. targets, even in the absence of lipid transfection reagents or conjugates. It should also be noted that some nucleotides with combinations of hydrophobic and cationic base modifications showed good anti-miRNA activity.
[0053] Without being bound by theory, it is believed that these pyrimidine base modifications enhance binding affinity through interaction with the polar major groove of the resulting RNA. duplexes. The nucleosides described herein are modified, for example, via carboxamido modifications that are cross conjugated to the pyrimidine base and provide additional hydrogen bonding sites, either to another nucleobase or to the polar major groove. This is a distinct mode of duplex stabilization than commonly used sugar modifications, such as bridged nucleosides and 2 '-modifications, that favor A-form conformations of the nucleobase which enhance binding to RNA. Therefore, it is believed that these C-5 carboxamido-modified nucleobases will act at least additively to the binding enhancement provided by sugar modification. C-5 carboxamido-modified nucleosides that also contain a 2'-4'-bridged sugar can also be employed to achieve enhanced binding of the oligonucleotides to their target, including the bridge structure shown below. Oligonucleotides incorporating the 2'-CBBN nucleosides are described in US Provisional Application No. 61/532,738, which is hereby incorporated by reference. As shown in the structure below, R represents the carboxamido modification described herein, and R' and R" represent the 5' and 3 ' ends.
Figure imgf000017_0001
2 -CBBN Uridine Nucleoside
with C-5 Base Modification
[0054] The carboxamido-modifications of the C-5 position of uridine, and the chemistry and stabilization characteristics, can be extended to the cytidine base. Similar modifications can be employed for purine bases via carboxamido-type modifications described herein.
[0055] Nucleotides incorporating the modified nucleobases described herein display enhanced binding affinity to their complementary nucleotides. Increases in Tm have been measured as high as 5 °C/incorporation (Figure 5), comparable to the bicyciic LNA monomers that, to this point, have been observed to be the most effective and widely used affinity enhancing modification. The enhancement of Tm may be especially effective in creating more active and potent microRNA inhibitors. Additionally, some of these new nucleobase modifications likely enhance cellular uptake by either masking some of the negatively charged phosphates, in the case of cationic moieties, or, in the case of lipophillie modifications, by shielding the backbone from nucleases and creating an aniphiphiliic nucleotide (Figures 6, 7, and 8).
[0056] The modifications may be used in oligonucleotides designed to mimic miRNA sequences, and may comprise any one of the mature miRNA sequences in Table 1 below. Such antisense and sense sequences may be incorporated into shRNAs or other R A structures containing stem and loop portions, for example. Such sequences are useful for, among other things, mimicking or targeting miRN A function for treatment or ameliorating cardiac hypertrophy, myocardial infarction, heart failure (e.g., congestive heart failure), vascular damage, and/or pathologic cardiac fibrosis, among others. Exemplary miRNA therapeutic utilities are disclosed in the US and PCT patent references listed in Table 1 below, each of which is hereby incorporated by reference in its entirety. The mature and pre-processed forms of miRNAs are disclosed in the patent references listed below, and such descriptions are also hereby incorporated by reference.
Table 1
Figure imgf000018_0001
miRNA miRNA Sequence Reference
16 UAGCAGCACGUAAAUAUUGGCG (SEQ ID No. 14) WO 2009/062169
181b AACAUUCAUUGCUGUCGGUGGGU (SEQ ID No. 15) WO 2009/012468
195 UAGCAGCACAGAAAUAUUGGC (SEQ ID No. 16) WO 2009/012468
197 UUCACCACCUUCUCCACCCAGC (SEQ ID No. 17) WO 2009/012468
199a CCCAGUGUUCAGACUACCUGIJ UC (SEQ ID No. 18) WO 2009/012468
199b miR-199b-5p US 61/047,005
CCCAGUGUUUAGACUAUCUGUUC (SEQ ID No. 19) miR-199b-3p
ACAGUAGUCUGCACAUUGGUUA (SEQ ID No. 20) 06 UGGAAUGUAAGGAAGUGUGUGG (SEQ ID No. 21) WO 2007/070483 08a AUAAGACGAGCAAAAAGCUUGU (SEQ ID No. 22) WO 2008/016924 08b AUAAGACGAACAAAAGGUUUGU (SEQ ID No. 23) WO 2009/018492 0a UAAAGUGCUUAUAGUGCAGGUAG (SEQ ID No. 24) US 60/950,565 1 UAGCUUAUCAGACUGAUGUUGA (SEQ ID No. 25) WO 2009/058818 14 ACAGCAGGCACAGACAGGCAGU (SEQ ID No. 26) US 61/047,005 2 AAGCUGCCAGUUGAAGAACUGU (SEQ ID No. 27) WO 2009/012468 21 AGCUACAUUGUCUGCUGGGUUIJC (SEQ ID No. 28) WO 2009/012468 miRNA miRNA Sequence Reference
222 AGCUACAUCUGGCUACUGGGU (SEQ ID No. 29) WO 2009/012468
224 CAAGUCACIJAGUGGUUCCGUU (SEQ ID No. 30) WO 2009/012468
23a AUCACAUUGCCAGGGAUUUCC (SEQ ID No. 31 ) WO 2009/012468
26a UUCAAGUAAUCCAGGAUAGGCU (SEQ ID No. 32) WO 2007/070483
26b UUCAAGUAAUUCAGGAUAGGU (SEQ ID No. 33) WO 2009/012468
28 AAGGAGCUCACAGUCUAUUGAG (SEQ ID No. 34) WO 2009/012468
29a UAGCACCAUCUGAAAUCGGUUA (SEQ ID No. 35) WO 2009/018493
29 b UAGCACCAUUUGAAAUCAGUGUU (SEQ ID No. 36) WO 2009/018493
29c UAGCACCAUUUGAAAUCGGUUA (SEQ ID No. 37) WO 2009/018493
30a UGUAAACAUCCUCGACUGGAAG (SEQ ID No. 38) PCT/US2010/031147
30 b UGUAAACAUCCUACACUCAGCU (SEQ ID No. 39) PCT/US2010/031147
30c UGUAAACAUCCUACACUCUCAGC (SEQ ID No. 40) WO 2009/012468
30d UGUAAACAUCCCCGACUGGAAG (SEQ ID No. 41) PCT/US2010/031 147
30e UGUAAACAUCCUUGACUGGAAG (SEQ ID No. 42) PCT/US2010/031 147
342-3p UCUCACACAGAAAUCGCACCCGU (SEQ ID No. 43) WO 2009/012468
382 GAAGUUGUUCGUGGUGGAUUCG (SEQ ID No. 44) WO 2009/012468 miRNA miRNA Sequence Reference
422a ACUGGACUUAGGGUCAGAAGGC (SEQ ID No. 45) US 2009/0226375
378 ACUGGACUUGGAGUCAGAAGG (SEQ ID No. 46) WO 2009/012468
424 CAGCAGCAAUUCAUGUUUUGAA (SEQ ID No. 47) WO 2009/062169
4 S3 -op IjCACUCCtJClJCCljCCCGUCtJlj (SEQ ID No. 48) WO 2009/012468
484 UCAGGCUCAGUCCCCUCCCGAU (SEQ ID No. 49) WO 2009/012468
486-5p UCCUGUACUGAGCUGCCCCGAG (SEQ ID No. 50) WO 2009/012468
497 CAGCAGCACACUGUGGUUUGU (SEQ ID No. 51) WO 2009/062169
499 UUAAGACUUGCAGUGAUGUUU (SEQ ID No. 52) WO 2009/018492
542-5p IJCGGGGAUCAIJCAUGUCACGAGA (SEQ ID No. 53) WO 2009/012468
92a UAUUGCACUUGUCCCGGCCUGU(SEQ ID No. 54) WO 2009/012468
92b U UUGCACUCGUCCCGGCCUCC (SEQ ID No. 55) WO 2009/012468 let-7a UGAGGUAGUAGGUUGUAUAGUU (SEQ ID No. 56) WO 2009/012468 iet-7b UGAGGUAGUAGGUUGUGUGGUU (SEQ ID No. 57) WO 2009/012468 let-7e UGAGGUAGUAGGUUGUAUGGUU (SEQ ID No. 58) WO 2009/012468 let-7d AGAGGUAGUAGGUUGCAUAGUU (SEQ ID No. 59) WO 2009/012468 let-7e UGAGGUAGGAGGUUGUAUAGLTLT (SEQ ID No. 60) WO 2009/012468 miRNA miRNA Sequence Reference let-7f UG AG QUA G UAG AUUG UAUAG UU (SEQ ID No. 61) WO 2009/012468 let-7g UG AG QUA G UAG UUUG UAC AGUU (SEQ ID No. 62) WO 2009/012468
451 AAACCGUUACCAUUACUGAGUU (SEQ ID No. 63) PCT/US2010/034227
[0057] In some embodiments, the oligonucleotide targets a miR-208 family miRNA, such as miR-208a or miR-208b, or alternatively miR- 15b or miR-21 . In some embodiments, the oligonucleotide has a sequence and structure shown in Figure 5. "m" refers to 2'OMe modification, and "+" refers to base-modified nucleotide with 2'OMe. Descriptions of abbreviations are found in Figure 1 and Figure 5.
[0058] The oligonucleotide may be incorporated within a variety of macromolecular assemblies or compositions. Such complexes for delivery may include a variety of liposomes, nanopartic!es, and micelles, formulated for delivery to a patient. The complexes may include one or more fusogenic or lipophilic molecules to initiate cellular membrane penetration. Such molecules are described, for example, in US Patent 7,404,969 and US Patent 7,202,227, which are hereby incorporated by reference in their entireties. Alternatively, the oligonucelotide may further comprise a pendant lipophilic group to aid cellular delivery, such as those described in WO 2010/129672, which is hereby incorporated by reference.
[0059] In another aspect, the present invention relates to a pharmaceutical composition which comprises an effective amount of the oligonucleotide of the present invention or a its pharmaceutically-acceptable, and a pharmaceutically-acceptable carrier or diluent.
[006Θ] The composition or formulation may employ a plurality of therapeutic oligonucleotides, including at least one described herein. For example, the composition or formulation may employ at least 2, 3, 4, or 5 miRNA inhibitors described herein. [0061] The oligonucleotides of the invention may be formulated as a variety of pharmaceutical compositions. Pharmaceutical compositions will be prepared in a form appropriate for the intended application. Generally, this will entail preparing compositions that are essentially free of pyrogens, as well as other impurities that could be harmful to humans or animals. Exemplary delivery/ formulation systems include colloidal dispersion systems, macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. Commercially available fat emulsions that are suitable for delivering the nucleic acids of the invention to cardiac and skeletal muscle tissues include Intralipid®, liposyn®, Liposyn® II, Liposyn® III, Nutrilipid, and other similar lipid emulsions. A preferred colloidal system for use as a delivery vehicle in vivo is a liposome (i.e., an artificial membrane vesicle). The preparation and use of such systems is well known in the art. Exemplary formulations are also disclosed in LIS 5,981 ,505; US 6,217,900; US 6,383,512; US 5,783,565; US 7,202,227; US 6,379,965; US 6,127,170; US 5,837,533; US 6,747,014; and WO03/093449, which are hereby incorporated by reference in their entireties,
[0062] The pharmaceutical compositions and formulations may employ appropriate salts and buffers to render delivery vehicles stable and allow for uptake by target cells. Aqueous compositions of the present invention comprise an effective amount of the delivery vehicle comprising the inhibitor oligonucleotide (e.g. liposomes or other complexes), dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium. The phrases "pharmaceutically acceptable" or "pharmacologically acceptable" refers to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to an animal or a human. As used herein, "pharmaceutically acceptable carrier" may include one or more solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like acceptable for use in formulating pharmaceuticals, such as pharmaceuticals suitable for administration to humans. The use of such media and agents for pharmaceutically active substances is well known in the art. Supplementary active ingredients also can be incorporated into the compositions.
11 [0063] Administration or deliver}' of the pharmaceutical compositions according to the present invention may be via any route so long as the target tissue is available via that route. For example, administration may be by intradermal, subcutaneous, intramuscular, intraperitoneal or intravenous injection, or by direct injection into target tissue (e.g., cardiac tissue). The stability and/or potency of the oligonucleotides disclosed herein allows for convenient routes of administration, including subcutaneous, intradermal, and intramuscular. Pharmaceutical compositions comprising miRNA inhibitors may also be administered by catheter systems or systems that isolate coronary circulation for delivering therapeutic agents to the heart. Various catheter systems for delivering therapeutic agents to the heart and coronary vasculature are known in the art. Some non-limiting examples of catheter-based delivery methods or coronary isolation methods suitable for use in the present invention are disclosed in U.S. Patent No. 6,416,510; U.S. Patent No. 6,716,196; U.S. Patent No. 6,953,466, WO 2005/082440, WO 2006/089340, U.S. Patent Publication No. 2007/0203445, U.S. Patent Publication No. 2006/0148742, and U.S. Patent Publication No. 2007/0060907, which are all hereby incorporated by reference in their entireties.
[0064] The compositions or formulations may also be administered parenterally or intraperitoneally. By way of illustration, solutions of the conjugates as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations generally contain a preservative to prevent the growth of microorganisms.
[0065] The pharmaceutical forms suitable for injectable use or catheter delivery include, for example, sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Generally, these preparations are sterile and fluid to the extent that easy injectabiiity exists. Preparations should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms, such as bacteria and fungi. Appropriate solvents or dispersion media may contain, for example, water, ethanol, polyoi (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial an antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
[0066] Sterile injectable solutions may be prepared by incorporating the conjugates in an appropriate amount into a solvent along with any other ingredients (for example as enumerated above) as desired. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the desired other ingredients, e.g., as enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation include vacuum-drying and freeze-drying techniques which yield a powder of the active ingredients) plus any additional desired ingredient from, a previously sterile-filtered solution thereof.
[0067] Upon formulation, solutions are preferably administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations may easily be administered in a variety of dosage forms such as injectable solutions, drug release capsules and the like. For parenteral administration in an aqueous solution, for example, the solution generally is suitably buffered and the liquid diluent first rendered isotonic for example with sufficient saline or glucose. Such aqueous solutions may be used, for example, for intravenous, intramuscular, subcutaneous and intraperitoneal administration. Preferably, sterile aqueous media are employed as is known to those of skill in the art, particularly in light of the present disclosure. By way of illustration, a single dose may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclvsis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biologies standards,
[0068] In another aspect, the present invention provides a method of reducing or inhibiting RNA expression or activity in a cell. In such embodiments, the method comprises contacting the ceil with a modified oligonucleotide (or pharmaceutical composition thereof) having a chemistry pattern described herein, where the oligonucleotide hybridizes (e.g., is at least substantially complementary to) an RNA transcript expressed by the cell. In some embodiments, the RN A is a miRNA.
[0069] In another aspect, the present invention provides a method of preventing or treating a condition in a subject associated with or mediated by RNA or expression thereof. In some embodiments, the RNA is a miRNA. The method of prevention or treatment according to the present invention involves administering to the subject a pharmaceutical composition which comprises an effective amount of the base-modified oligonucleotide or a its pharmaceutically-acceptable composition thereof.
[0070] The invention provides a method for delivering the modified oligonucleotides to a mammalian cell (e.g., as part of a composition or formulation described herein), and methods for treating, ameliorating, or preventing the progression of a condition in a mammalian patient. The oligonucleotide or pharmaceutical composition may be contacted in vitro or in vivo with a target cell (e.g., a mammalian cell). The cell may be a heart, cell.
[0071] The method generally comprises administering the oligonucleotide or composition comprising the same to a mammalian patient or population of target cells. The oligonucleotide, as already described, may be a miRNA inhibitor (e.g., having a nucleotide sequence designed to inhibit expression or activity of a miRNA). For example, where the miRNA inhibiter is an inhibitor of a miR-208 family miRNA, the patient may have a condition associated with, mediated by, or resulting from, miR-208 family expression. Such conditions include, for example, cardiac hypertrophy, myocardial infarction, heart failure (e.g., congestive heart failure), vascular damage, restenosis, or pathologic cardiac fibrosis, cancer, or other miRNA associated disorder, including those disorders described in the patent publication listed in Table L Thus, the invention provides a use of the modified oligonucleotides and compositions of the invention for treating such conditions, and for the preparation of medicaments for such treatments.
[0072] In certain embodiments, the patient (e.g., human patient) has one or more risk factors including, for example, long standing uncontrolled hypertension, uncorrected valvular disease, chronic angina, recent myocardial infarction, congestive heart failure, congenital predisposition to heart disease and pathological hypertrophy. Alternatively or in addition, the patient may have been diagnosed as having a. genetic predisposition to, for example, cardiac hypertrophy, or may have a familial history of, for example, cardiac hypertrophy.
[0073] In this aspect, the present invention may provide for an improved exercise tolerance, reduced hospitalization, better quality of life, decreased morbidity, and/or decreased mortality in a patient with heart failure or cardiac hypertrophy.
[0074] In certain embodiments, the activity of micoRNA in cardiac tissue, or as determined in patient serum, is reduced or inhibited.
[0075] In various embodiments, the pharmaceutical composition is administered by parenteral administration or by direct injection into heart tissue. The parenteral administration may be intravenous, subcutaneous, or intramuscular. In some embodiments, the composition is administered by oral, transdermal, sustained release, controlled release, delayed release, suppository, catheter, or sublingual administration. In certain embodiments, the oligonucleotide is administered at, a dose of 25 mg/kg or less, or a dose of 10 mg/kg or less, or a dose of 5 mg/kg or less. In these embodiments, the oligonucleotide or composition may be administered by intramuscular or subcutaneous injection, or intravenously. [0076] In some embodiments, the methods further comprise scavenging or clearing the miR A inhibitors following treatment. For example, a oligonucleotide having a nucleotide sequence that is complementary to the inhibitor may be administered after therapy to attenuate or stop the function of the inhibitor.
[0077] Ail references cited herein, including those in Table 1, are hereby incorporated by reference for all purposes.
EXAMPLES
Example 1: Gesseral Procedure For Preparation of S-posltioo-modified 2'-0- methyhiridine ssiic!eoside phosphoramidites
[0078| 5-Iodo-2'-0-methyluridine was readily synthesized by known methods, and is also commercially available. The 5'- and 3 '-hydroxy 1 groups of the nucleoside are protected by standard 4,4'-Dimethoxytritylation and acetylation methods, respectively. This doubly protected nucleoside was then subjected to carboxamidation by dissolving the nucleoside in a 1 : 1 mixture of anhydrous THF and ΐ ,Ν-dimethylacetamide in a 50 mL borosiiicate boston round bottle. 5 equivalents of TEA and 3 equivalents of a primary amine or amine hydrochloride were added to the mixture followed by addition of 0.1 equiv. of tetrakis(triphenylphosphine)palladium(0). The bottle wras placed in a. 300 mL Parr Bomb fitted with a scalable inlet and pressure gauge. The apparatus wras flushed with carbon monoxide by charging to 60 psi with carbon monoxide then releasing the pressure to 10 psi and repeating twice. 'The apparatus was then charged to 60 psi,sealed and placed in a 70 CC oil bath for 17h. The solvent wras removed in vacuo, the residue re-dissolved in MeOH and de-acetylated at 55 °C under Zemplen or similar conditions. The resultant nucleoside was converted to the nucleoside phosphoramidite using the monochloridite method.
[0079] The 2'-deoxynueleosides can be synthesized in a similar manner as described in Vaught et a!., J, Am. Chem. Soc, 132(12):4141-4151 (2010) which are hereby incorporated by reference in their entireties.
Example 2: Preparation of 5'-0~DMTr-3'~0-Ac-5~(2~(N4-methylpiperaziiiylethyl) carbamoyl)-! '-O-methy iridiiie (2c)
[0080] In a 50 mL Boston Round Bottle was 5'-0-DMTr-3'-0-Ac-5-Iodo Uridine (1 g, 1.373 mmol) in THF (Volume: 10 ml) and DMA (Volume: 10 ml) to give a colorless solution. Tetrakis(triphenylphosphine)palladium(0) (0,159 g, 0.137 mmol) is weighed out and added to the bottle followed by addition of triethylamine (0.694 g, 6.86 mmol) and 2- (4-met,hylpiperazin-l ~yl)ethanamine (0.413 g, 2.88 mmol). The Bottle is placed into a 250 mL Parr Bomb, which is sealed and evacuated through the needle valve. The Bomb is then pressurized to 60 psi with Carbon Monoxide. The bomb is then evacuated under high vacuum and re-charged with Carbon Monoxide (60psi). The bomb is resealed and placed in an oil bath heated to 70 °C For 17h. The bomb is cooled to rt and the pressure released slowly. The bottle is removed from the bomb and the solvent is removed in vacuo (Vaught et al., J. Am. Chem. Soc, 132(12):4141 -4151 (2010) which is hereby incorporated by reference in its entirety).
[0081] The dried product is re-dissolved in MeOH (10 mL) and 1 pellet of NaOH (~40mg) is added along with a small stir bar. The bottle is fitted with a septum and the mixture is stirred at 50 °C overnight. TLC (3% TEA in Hexanes treated plate, 5% MeOH in DCM developing solvent, visualized via UV and Hannessians Stain w/charring) reveals a single trityl bearing product. The reaction mixture is concentrated to dryness and applied to a 80g ISCO silica cartridge that is equilibrated with DCM and 1% TEA. The product is e luted from the column with a 0-10% MeOH in DCM (1% TEA) solvent gradient over 2 L @ 60 ml/min. The pure fractions are collected, combined and concentrated to dryness to give 5'- 0-DMTr-3'-0-Ac-5~(2-(N4-rnethy]piperazinylethyl)carboxamidoUridine (0.93 g, 1 .274 mmol, 93 % yield) as a white foam. 1H NMR. δ 2.33 (s, 3H), 2.50-2.65 (m, 10H); 3.44- 3.52 (m, 4H); 3.54 (s, 3H); 3.79 (s, 6H); 3.87-3.92 (m, 1 H); 4.00-4.08 (m, 1H); 4.10-4.17 (m, 1 H); 5.90 (d, j=3.2 Hz, 1H); 6.85 (dd, J=9.0, 1 .3 Hz, 4H); 7.27-7.49 (m, 9H); 8.52 (s, 1H); 8.77 (t, J=5.4 Hz, 1H). MS (ESI) M+ 1=730, calcd, 729.
[0082] Below are the experimental details for selected 5-carboxamido base modifications shown in Figure 2. Each compound was synthesized in the same manner using the appropriate primary amine. All compounds gave yields between 60-95%.
Compo u d 2 , Pr opyl-irmdazo le derivative
[0083] Using 3 equivalents of l-(3-aminopropyl)imidazole as the primary amine gave the desired product as an off white foam in 64% yield. *H NMR (300 MHz) δ 2.00-2.10 (m, 2H); 3.21-3.37 (m, 2H), 3.46 (d, .! 4.2! !;···. 2H), 3.57 (s, 3H), 3.78 (s, 6H), 3.92 (dd, i 5.6. 3.2Hz, 1H), 3.95-4.10 (in, 4H), 4.15-4.22 (m, 1H), 5.92 (d, .) 3. Hz. 1H), 6.08 (bs, 1H), 6.84 (dd, j 9.0. 1.4Hz, 4H), 6.93-7.50 (m, 10H), 7.63 (s, 1H), 7.76 (s, 1H), 8.58 (s, 1H), 8.74 (t, .! 6.0! i .. 1H). MS (ESI+) calc'd 71 1.76, found 712.6.
Compound 2b, Propyl-morpholine derivative [0084] Using 3 equivalents of 3-Morpholinopropylamine as the primary amine gave the desired product as a white foam in 64% yield. 1HNMR (300MHz) δ 1.76 (quin, J=7.0Hz, 2H), 2.41 -2.50 (m, 4H), 3.40-3.47 (m, 4H), 3.53 (s, 3H), 3.70-3.75 (m, 8H), 3.79 (s, 6H), 3.89 (dd, .! 5.7. 3.2! !/. I H), 3.98-4.15 Or, 21 1 ). 5.90 (d, J 3.21 1/. I I I ). 6.84 (dd, J=9.0, 0.9Hz, 4H), 7.15-7.48 (m, 9H), 8.48 (s, 1 H), 8.75(t, i 5.8! iz. IH). MS (ESI+) calc'd 730.8, found 731.5.
Compound 2e, Benzyl derivative
[0085] Using 3 equivalents of benzylamine as the primary amine gave the desired product as a white foam in 87% yield. 3HNMR (300MHz) δ 3.45-3.49 (m, 21 1 . 3.56 (s, 3H), 3.78 (s, 6H), 3.89 (dd, J=5.6, 3.1Hz, H), 4.03-4.17 (m, 2H), 4.58 (dd, J=5.7, 4.6Hz, 2H), 5.90 (d, J=3.1Hz, IH), 6.85 (dd, J=9.0, 1.3Hz, 4H), 7.1 5-7.60 (m, 15 H), 8.59 (s, IH), 8.87 (t, J=5.9Hz, I H).
Compound 2h, 2-efhvi-N.N-dimethviamine derivative
[0086] Using 3 equivalents of N,N-dimethylethylenediamine as the primary amine gave the desired product as a white foam in 91 % yield. 'HNMR (300MHz) δ 2.31 (s, 6H), 2.54 (t, .1 6.5 Hz. 2H), 3.40-3.50 (m, 3H), 3.52 is. 3H), 3.79 (s, 6H), 3.88 (dd, J 5.6. 3.1Hz), 3.95-4.10 (m, 4H), 5.86 id. .! 3. l ! !z. IH), 6.84 (dd, .1 9.0. 1.4Hz, 4H), 7.17-7.49 (m, 9H), 8.46 (s, I H), 8.79 (t, J 5.61 1 ;·-. I H).
Example 3: Preparation of5'-0-DMTr-5-((2-(N4-methylpiperazinylethyI)carbamoyl)-
Figure imgf000031_0001
Amidite (3c)
[0087] In a 100 mL round-bottomed flask was DiEA (0.364 ml, 2.084 mmol) and 5-(3-(4- mefhylpiperazin-l -yi)propan- l-earboxamido)-5!-0-DMTr-3'-0-Ac-2'-0-Me-Uridine (1.55 g, 2.084 mmol) dissolved in DCM (Volume: 15 ml) to give a colorless solution. The flask was flushed with argon and set to stir. 3- ((chloro(diisopropylamino)phosphine)oxy)propanenitrile (or "monochloridite") (0.451 g, 2.084 mmol) was added dropwise and the reaction mixture allowed to stir for 3 hours.
[0088] TLC revealed that the reaction was complete. The reaction mixture was diluted with sat NaHC03 ( 100 mL) and the aqueous phase was extracted with DC (3 x 50 mL). The organic phases were combined and dried with a brine wash (1 x 50 mL) and addition of Na S04. The organic phase was filtered and concentrated.
[0089] Purification was done via column chromatography on a 40g silica cartridge pretreated with 3% TEA in Hexanes. Product was e luted with a 0-5% MeOH in DCM (over 1L @ 40 mL/min). Pure fractions were combined and concentrated to give a white amorphous foam. The product was co-evaporated with DCM (3 x 30 mL) and dried under high vacuum overnight before use in automated oligonucleotide synthesis. 5'-0-DMTr-5- ((2~(N4-methylpiperazinyiethyl)carbamoyl)-2,-0-methyluridine Amidite (1.47 g, 1.557 mmol, 74.7 % yield). IH NMR δ 1.15-1.25 (m, 12! !): 2.31 (s, 3H); 2.36 (t, J 6.5 Hz, 2H); 2.41-2.69 (m, 12H); 3.34-3.72 (m, 9H); 3.76-4.06 (m, 8H); 4.18-4.36 (m, IH); 5.90 (dd, j=5.4, 5.0 Hz, IH); 6.80-6.92 (m, j=9.0, 4H); 7.15-7.51 (m, 9H); 8.51 (ds, IH); 8.78- 8.90 (m, IH). MS (ESI) M+ 1=931, calcd, 930.
[0090] Experimental details for selected 5-carboxamido base modifications in Figure 2, Each compound was synthesized in the same manner using 1 ,00 equivalents of 3- (((diisopropylamino)(methyl)phosphino)oxy)propanenitrile. All compounds gave yields between 75-95%.
Compound 3b, Phosphoramidite of Propyl-morpholine derivative
[0091] White foam obtained in 82%> yield after column chromatography (DCM/MeOH/TEA), A 1 : 1 mixture (determined by Ή NMR) of diastereomers was measured by NMR. The protons that were resolved are described before the tabulated results and denoted by an asterisk. 3IP NMR (121.5 MHz) δ 150.15*, 150.89*. In the proton spectra, the mixture gives rise to the following resolved diastereomeric peaks: A singlet at 3.45ppm* and 3.47ppm* corresponding to 3H of the 2'-0-methyl group; Two singlets at 3.80ppm* and 3.81ppm* correspond to 6H of the methoxy groups on the trityl; two doublets at 5.92ppm* and 5.96ppm*with coupling constants of 5.0Hz and 5.4Hz, respectively, and corresponding to IH at the Cl '-position; 'Two singlets at 8.49ppm* and 8.56ppm* corresponding to IH at the C-6 position of the base. The balance of peaks are as follows: 1H-NMR (300MHz) δ 1.044.22 (m, 12H), 1.69-1.82 (m, 2H), 2.41-2.49 (m, 6H), 2,58-2.67 (m, 2H), 3.33-3.44 (m, 4H), 3.51-3.65 (m, 3H), 3.70-3.76 (m, 4H), 3.83-3.95 (m, 1H), 3.95-4.07 (m, 1H), 4.17-4.36 (m, 2H), 6.82-6.89 (m, 4H), 7.15-7.51 (m, 9H), 8.63- 8.76 (m, IH). MS (ESI+) calc'd 931.0, found 931.8.
Compound 3a, Phosphoramidite of Propyl- imidazole derivative
[0092] White amorphous foam obtained in 80% yield after column chromatography (DCM/MeOH/'TEA). A 55:45 mixture (determined by 3H NMR) of diastereomers was measured by NMR. The protons that were resolved are described before the tabulated results and denoted by an asterisk. 3JP NMR (121.5 MHz) δ 150.26*, 150.81*. In the proton spectra, the mixture gives rise to the following resolved diastereomeric peaks: Two doublets of triplets with the major diastereomer at at 2.63ppm* (J==6.1, 1.3 Hz) and the minor signal at 2.37 (J-6.3, 1.4Hz) corresponding to 2H; Two singlets, both at 3.49ppm* correspond to 3H of the 2'-0-methyl groups; two doublets at 5.92ppm*(minor, J-4.5Hz) and 5.99ppm*(major, J==5.2Hz) corresponding to 5 H at the CI '-position; Two singlets at 8.55ppm* (major) and 8.63ppm* (minor) corresponding to IH at the C-6 position of the base. The balance of peaks are as follows: 1H-NMR (300MHz) δ 1.04-1.22 (m, 12H), 1.97-2.10 (m, 2H), 2.80-2.94 (m, IH), 3.23-3.47 (m, 4H), 3.52-3.74 (m, 3H), 3.75-3.95 (m, 7H), 3.96-4.13 (m, 3H), 4.22-4.41 (m, 2H), 6.79-6.89 (m, 4H), 6.96 (s, IH), 7.10 (s, I H), 7.15-7.53 (m, 9H), 7.59 (s, IH), 8.69-8.80 (m, I H). MS (ESI+) calc'd 912.0, found 912.3.
Compound 3h, Phosphoramidite of 2-ethyj-N,N-dimethylamine derivative
[0093] White amorphous foam, obtained in 87% yield after column chromatography (DCM/MeOH/'TEA) . A 55:45 mixture (determined by 3H NMR) of diastereomers was measured by NMR. The protons that were resolved are described before the tabulated results and denoted by an asterisk. 31P NMR (121.5 MHz) δ 150.12*, 150.71 *. In the proton spectra, the mixture gives rise to the following resolved diastereomeric peaks: two doublets at 5.90ppm*(minor, J=4.8Hz) and 5.93ppm*(major, .) 5. Hz) corresponding to IH at the Cl '-position; Two singlets at 8.46ppm* (major) and 8.53ppm* (minor) corresponding to I H at, the C-6 position of the base. The balance of peaks are as follows: 1H-NMR (300MHz) δ 1.04-1 .22 (m, 12H), 2.31 (s, 6H), 2.52-3.06 (m, 4H), 3.33-3.49 (m, 5H), 3.52-3.74 (m, 4H), 3.75-3.94 (m, 7H), 3.95-4.07 (m, IH), 4.16-4.34 (m, 2H), 6.80- 6.90 (m, 4H), 7.15-7.53 (m, 10H), 8.68-8.82 (m, IH). Compound 3e, Phosphoramidite of Benzyl derivative
[0094] White amorphous foam obtained in 89% yield after column chromatography (EtOAc/Hex). A 55:45 mixture (determined by Ή NMR) of diastereomers was measured by NMR. The protons that were resolved are described before the tabulated results and denoted by an asterisk. 3 ,P NMR (121.5 MHz) δ 150.26*, 150.81 *. In the proton spectra, the mixture gives rise to the following resolved diastereomeric peaks: Two doublets of triplets with the major diastereomer at at 2.64ppm* (1=6.5, 2.1 Hz) and the minor signal at 2.38 (J-6.5, 1 .5Hz) corresponding to 2H; Two doublets at 5,93ppm*(minor, J=4.7Hz) and 5.98ppm*(major, J=5.3Hz) corresponding to 1H at the CI '-position; Two singlets at 8.57ppm* (major) and 8.64ppm* (minor) corresponding to 1 H at the C-6 position of the base. The balance of peaks are as follows: !H-NMR (300MHz) δ 1.04-1.22 (m, 12H), 3.36-3.46 (m, 2H), 3.50-3.76 (m, 4H), 3.77-3.93 (m, 7H), 3.95-4.10 (m, 1 H), 4, 1 7-4.36 (m, 2H), 4.45-4.67 (m, 2H), 6.82-6.90 (m, 4H), 7.15-7.54 (m, 14H), 8.83-8.95 (m, 1H). MS (ES1+) calc'd 912.0, found 912.3.
Example 4: General Synthetic Methodology of Truncated Nucleotides
[0095] Carboxamido-substituents for modifications were chosen from both hydrophilic and hydrophobic groups. Hydrophilic groups were preferentially chosen for the following reasons: Their ability to create new hydrogen bonding interactions with other nucleobases; the lack of exchangeable protons or sensitive functional groups that would require extra protecting groups under standard oligonucleotide synthesis; the cationic nature of these groups at physiological pH. Hydrophobic groups were chosen to attempt to exploit pi- stacking interactions between nucleobases and to create new hydrophobic regions in the nucleotide. Creating new hydrophobic and cationic/hydrophilic regions on a nucleotide may also create enhanced binding to serum proteins that enhance cell permeability. Pendant hydrophobic groups (such as sterols and straight chain lipids) as well as nucleotides with 2 '-hydrophobic modifications (such as alkyl, aryl and 2 '-4 '-linkers) can enhance cellular uptake by increasing interaction with serum lipoprotein particles. Likewise, counteracting the very anionic nucleotide backbone with highly charged cationic species also enhances cellular uptake. [0096] Short strands of oligonucleotides bearing sugar and base modifications can be prepared once the modified nucleoside is synthesized and the free 5' and 3 '-hydroxy! groups are masked with appropriate reactive groups to become a nucleotide monomer. The current state of the art in oligonucleotide synthesis is automated solid phase synthesis using phosphoramidite chemistry, which, in particular, is based on the developments of McBride et al, Tetrahedron Letters 24:245-248 (1983) and Sinha et al, Tetrahedron Letters 24:5843-5846 (1983). Phosphoramidite chemistry, together with related methods such as hydrogen phosphonate chemistry, has been extensively reviewed with respect to their uses in oligonucleotide chemistry by Beaucage et al., Tetrahedron 48:2223-231 1 (1992). During solid phase oligonucleotide synthesis, a series of nucleotide monomers are sequentially attached, via their phosphoramidite derivatives, in a predetermined order to either, depending on the direction of chain extension, the 5'-funetional group or the 3'- functional group of the growing oligonucleotide strand.
[0097] The oligonucleotide strand is anchored to an insoluble moiety such as controlled pore glass or polystyrene resin beads. The method of attachment of each monomer is generally comprised of the following steps 1-5. Step 1 involves the protection of the reactive functionality. The common reactive functionality is the 5 -hydroxyl group of the terminal nucleoside. This functionality is usually protected with a 4,4'-dimethoxytrityl (DMT) moiety that can be removed via acid treatment. One of the attractive features of the DMT moiety is that it forms a bright orange DMT cation during acid deprotection. This cation serves effectively as reporter group that can be easily monitored at a wavelength between 480 and 500 nm for the purpose of judging the completeness the previous coupling step. Most commercially available automated synthesizers have the capability to monitor the released DMT cation. This data gives the operator an instant indication of whether or not the synthesis failed at any given step. Step 2 involves the coupling by addition of a phosphoramidite derivative and an activator. The phosphoramidite derivative is usually a nucleoside phosphoramidite, however, it may also be a phosphoramidite derivatized with a different organic moiety. Step 3 involves the capping of unreacted terminal functional groups. This step introduces an inert protective group that prevents further coupling to failure sequences. Step 4 involves oxidation of the newly formed phosphorous nucleotide backbone linkage from the trivaient phosphite to the stable pentavalent state. This oxidation step can be performed with either an oxygen-based oxidant that results in a phosphate nucleotide or a sulfurizing oxidant that results in a phosphorothioate nucleotide. Step 5 involves a repetition of the process the after a washing step.
[0098] Truncated, 16 nucleotide sequence complementary to a nucleotide sequence of human mi -208a was synthesized in 1 iimol scale on an ABI Expedite 8909 Automated Nucleic Acid Synthesis System, The synthesizer was operated using standard detritylation and capping solutions, known to those skilled in the art, single couplings of 420 seconds for each base and oxidation with 0.2M PADS oxidation solution after each coupling cycle. The unmodified anti-208a RNA sequence incorporates nine uridine residues which were fully replaced with nine modified nucleobases. The balance of the nucleotides were comprised of 2'-0-methyl-nueleotides. One exception was the incorporation of oieyl- carboxamido derivative, where there is a single incorporation on base position 15 of 16 where the nucleoside amidite was incorporated via a double coupling of 420 seconds each.
Example St Preparation of Oligonucleotide miR A Inhibitors
[0099] Preparation of compound 10941
(mCs;ppTs;ppTs;ppTs;ppTs;ppTs;mGs;mCs;ppTs;mCs;mGs;ppTs;mCs;ppTs;ppTs;mA). Phosphoramidite Reagent (3c) in the Synthesis of the Base Modified Oligonucleotide was used. The oligodeoxynucleotide was synthesized using an ABI Expedite (Model 8909) DNA'RNA synthesizer. The synthesis was performed according to the manufacturer's recommendations in DMT-ON mode employing commercial synthesis reagents, exchanging 0.2M PADS in 1 : 1 Pyridine/ ACN for the oxidizing solution. The phosphoramidite reagent was added as a 0.1 M solution in acetonitrile during the appropriate coupling cycle. The cleavage of the oligonucleotide from the support was accomplished either by the method of described in US Patent 5,750,672 (which is hereby incorporated by reference in its entirety) or via heating of the CPG bound oligonucleotide with a solution of 40% aqueous methyl amine at 55 °C for 30 minutes. The resultant aqueous solution of oligonucleotide was further purified by loading the crude DMT-ON oligonucleotide solution on a Waters Sep-Pak® Vac CI 8 cartridge and eluting using a standard DMT-ON oligonucleotide desalting procedure known to those knowledgeable in the art. The characterization of product was performed by MALDI-TOF mass spectrometry utilizing 3-hydroxypieoiinie acid as matrix and standard methods known to those knowledgeable in the art: calcd 6922.4, found 6920.7.
100100] Compound M- 10708 (Figure 5) was synthesized with amidite 3e in the uridine position in exactly the manner described above. The characterization of product was performed by ESI mass spectrometry on a Waters SQD mass detector in 200 niM HFIP/8.15 niM TEA buffer gradient with MeOH: calcd 6597.6, found 6599.1.
[00101 ] Compound M-10713 (Figure 5) was synthesized with amidite 3f in the uridine position in exactly the manner described above. The characterization of product was performed by ESI mass spectrometry on a Waters SQD mass detector in 200 niM HFIP/8.15 niM TEA buffer gradient with MeOH: calcd 6543.9, found 6543.9.
[00102] Compound M- 10711 (Figure 5) was synthesized with amidite 3a in the uridine position in exactly the manner described above. The characterization of product was performed by ESI mass spectrometry (negative mode) on a Waters SQD mass detector in 200 mM HFIP/8.15 roM TEA buffer gradient with MeOH: calcd 6759.8, found 6759.6.
[00103] Compound M-10712 (Figure 5) was synthesized with amidite 3d in the uridine position in exactly the manner described above. The characterization of product was performed by ESI mass spectrometry (negative mode) on a Waters SQD mass detector in 200 mM HFIP/8.15 mM TEA buffer gradient with MeOH: calcd 6759.8, found 6760.6.
[00104] Compound M- 10768 (Figure 5) was synthesized with 2'-0-methyluridine in its amidite position and amidite 3d in the auxiliary amidite position in exactly the manner described above. The characterization of product was performed by ESI mass spectrometry (negative mode) on a Waters SQD mass detector in 200 mM HFIP/8.15 mM TEA buffer gradient with MeOH: calcd 6003.9, found 6005.2.
[00105] Compound M- 10772 (Figure 5) was synthesized with amidite 3i in the uridine position in exactly the manner described above. The characterization of product was performed by ESI mass spectrometry (negative mode) on a Waters SQD mass detector in 200 mM HFIP/8.15 mM TEA buffer gradient with MeOH: calcd 6552.8, found 6553.4. [00106] Compound M- 10774 (Figure 5) was synthesized with 2'-0-methyluridine in its amidite position and amidite 3i in the auxiliary amidite position in exactly the manner described above. The characterization of product was performed by ES mass spectrometry (negative mode) on a Waters SQL) mass detector in 200 mM HFIP/8.15 mM TEA buffer gradient with MeOH: calcd 5912.0, found 5912.8.
100107] Compound M- 10876 (Figure 5) was synthesized with amidite 3b in the uridine position in exactly the manner described above. The characterization of product was performed by ESI mass spectrometry (negative mode) on a Waters SQD mass detector in 200 mM HFIP/8.15 mM TEA buffer gradient with MeOH: calcd 6931.2, found 6931.9.
[00108] Compound M-10877 (Figure 5) was synthesized with amidite 3b in the uridine position and amidite 3g in an auxiliary amidite position on the ABI Expedite (Model 8909) DNA/R A synthesizer. The oligonucleotide was handled in exactly the manner described above, except amidite 3g was the first coupling to 2'-0-Me-adenosine funetionaiized CPG, Incorporation of 3g is denoted by the precursor "y" in figure 5. The characterization of product was performed by ESI mass spectrometry (negative mode) on a Waters SQD mass detector in 200 mM HFIP/8.15 mM TEA buffer gradient with MeOH: calcd 7056.0, found 7056.5.
[00109] Compound M- 10878 (Figure 5) was synthesized with 2'-0-methyluridine in its amidite position and amidite 3b in the auxiliary amidite position in exactly the manner described above. The characterization of product was performed by ESI mass spectrometry (negative mode) on a Waters SQD mass detector in 200 mM HFIP/8. 5 mM TEA buffer gradient with MeOH: calcd 6080.1, found 6081.
[00110] Compound M-10881 (Figure 5) was synthesized with 2'~0-methyluridme in its amidite position and amidite 3b in the auxiliary amidite position in exactly the manner described above. The characterization of product was performed by ESI mass spectrometry (negative mode) on a Waters SQD mass detector in 200 mM HFIP/8.15 mM TEA buffer gradient with MeOH: calcd 6250.3, found 6251.5. Example 6: Determination of Melting Temperature
[00111 ] Melting temperature (Tm) enhancement was determined on a per incorporation basis by determining the difference between the melting temperature of the modified strand and that of the identical sequence utilizing either a phosphorothioate DNA nucleotide or a phosphorothioate 2'-0-methyl RNA nucleotide.
[00112] For example, the modified anti-208a oligonucleotides were annealed to the complementary sequence, twenty-two nucleotides in length, comprised of RNA nucleosides and a phosphate backbone. The complementary sequence was identical to the endogenous miRNA. Thermal denaturation temperatures (Tm) were measured as a maximum of the first derivative plot of melting curvex (A 260 vs. Temp). The duplexes were constituted at ΙμΜ in a 0.9% NaCl buffer. Temperature was ramped from 25 °C to 95 °C at 4 °C/min and OD's at 260 nm were read once per minute. Tm values are averages of at least two measurements.
[00113] Duplex melting temperatures for various modifications of a 16 nucleotide sequence complementary to a nucleotide sequence of human miR-208a. Modifications included a mixed 9 LNA/7 DNA phosphorothioate, fully substituted 2'-0-methyl- nucleotide phosphorothioate, fully 2'-deoxynucleotide phosphorothioate and various substitution patterns of fully 2'-0-methyl-nucieotides with 5-carboxamide substituents. While hydrophobic substitutions did not provide substantial gains in affinity enhancement versus the unmodified 2'-0-methyI parent compound, all of the cationic species provided significant duplex stabilization on the order of 2-3 ^/Modification over the unmodified 2'- OMe nucleotide. Duplexes were constituted at 1 uM in 0.9% NaCl. Temperature was ramped from 25 °C to 95 °C at 4 °C/mm and OD's at 260 nm were read once per minute on a Gary 100 Bio UV -Visible Spectrophotometer. See Figure 4 and Figure 5.
Example 7: Cardiomyocytes Data
[00114] Cell culture experiments conducted with primary neonatal rat cardiomyocytes demonstrate that many of the 5-carboxamido-base modified oligonucleotides not only bind to miR-208a, but also effect the downstream regulation of bMHC in a manner expected for effective, intracellular rniR-208a inhibitors. As shown in Figures 6 and 7, two known positive controls that contain LNA/DNA or LNA/2'-0-Me mixtures of nucleotides show both miR-208a inhibition and a dose dependent regulation of bMHC. All oligonucleotides were passively (no trans fection reagent) put onto the ceils in 2% serum containing media. The cells were lysed using Cells to Ct (Ambion) buffer after 72 hour incubation at 37°C. MiR-208a and the mRNA bMHC were analyzed by Taqman based RT-PCR (Applied Biosystems). Ail experiments were performed in triplicate and shown as average +/- standard deviation. Base modifications that feature pendant cationic species with pKa values in the 7-8 range, those most likely to be mostly protonated at physiological H, were more likely to show a positive correlation between miR-208a inhibition and bMHC. This correlation suggests that the miR-208a inhibition occurs pre-lysis of the primary cardiomyocytes. it should also be noted that nucleotide substitution patterns can affect the potency of inhibitors having the same sequence. The 5-(2-(2 -methyl- lH-imidazo 1-1 -yi)- ethylca.rboxamido)-2'-0-methyluridine nucleotide variant shows inhibition of miR-208a when incorporated in a 16-nucieotide 2'-0-methyl phosphorothioate anti-208a nucleotide sequence where either 4 or 9 of the total 9 natural uridine nucleotide positions are substituted. It is only the oligonucleotide that has 4 substitutions that shows effective bMHC mRN A regulation.
Example 8: In Vivo Testing
[0100] Three base modified oligonucleotides were studied in vivo in C57BL/6 mice (10941 , 10876, 10711). A scrambled control containing the comparable bases of each oligo were also injected (11091, 11087, 1 108(5). The oligonucleotides were dosed with a 25 nig/kg delivered via subcutaneous injection on Day 1. Cardiac tissue was harvested 4 days after dosing and miR-208a levels were determined via. real time PCR. There was neither injection site reaction nor any visible organ damage following take down of the mice. As seen in Figure 8, all targeting oligos showed some inhibition of miR-208a, and the 1071 1 oligonucleotide was able to inhibit miR 208a, in cardiac tissue in a statistically significant, manner compared to saline. None of the controls were statistically different than saline. This demonstrated the ability of systeniically administered base modified oligonucleotides to act as potent inhibitors of cardiac specific miRNA's without the use of conjugates or drug delivery systems. Example 9: Tm Differences Between 2'-deoxy and 2'-0-Me Base Modifications
[01011 Tm effects of both base and sugar modifications when visualized on a scale from least modified to most modified. Base modifications alone are expected to have only a modest effect on 2'-deoxyribonucleosides with phosphate backbones (see examples of Ahmadian et al, Nucleic Acids Res., 1998, 26(13):3127-3135 (1998); Znosko et al., J. Am. Chem. Soc, 125(20):6090-6097 (2003) which are hereby incorporated by reference in their entireties), and even then, substituents larger than C3-aikynes tend to destabilize DNA:DNA duplex stabilities. Even multiple incorporations of uridine based nucleosides with non-caxboxamido-linked hexylamines, protonated under physiological pH, showed no net DNA:DNA duplex stabilization (see Hashimoto et al., J. Am. Chem. Soc, 115(16):7128-7134 (1993) which is hereby incorporated by reference in its entirety). Sugar modifications, in this case, 2'-0-methylated ribonucieosides, have been shown in our hands to stabilize this particular duplex with mi.R-208a RNA at about 1 °C/modification. The 2 '-deoxynucleosides with base modifications taught in this invention, when fully incorporated (9-substitutions for uridine) in a 16-mer, anti-208a oligonucleotide with a phosphorothioate backbone, give little increased duplex stabilization against mi -208a RNA. See Figure 9. However, when the base modified 2'- deoxynucleosides were incorporated into a nucleotide that also contained 2'-0-methyIated nucleosides for all bases excluding uridine, the stabilization of the base modification became apparent. Even though there were nine fewer sugar modifications, the duplex had the same Tm as the oligonucleotide with sixteen 2'-0-methyl sugar modifications. 2'-0- Methylated anti-208a substituting each uridine with a uridine -based nucleoside that have both a 5-carboxamido-base modification and a 2'-0-methyl sugar modification show an unexpected increase in Tm of more than 2 °C/modification over the oligonucleotide with just sugar modifications.
[0102] These enhanced affinities likely are greatest when coupled with A-form nucleosides that have a 3'-endo sugar pucker. This effect may be more pronounced when the 5-carboxamido modified base is combined with 2'-4'-bridged bicyciic nucleoside sugar that locks the ribose in the A-form with a pronounced 3'-endo sugar pucker. Example 10: Synergistic Effect of 5-Carboxamido- and 2'-0-Methyl Modifications is the Nucleotide.
[0103] Figure 10 presents data from figure 9 as ATm/ er modification, counting both sugar and base modifications. Multiple incorporations of 5-carboxyamido-2'-0- methyl uridine nucleosides unexpectedly give a greater stabilization per sugar and base modification than either the base or sugar do alone. This evidence indicates that 5- carboxamido in conjunction with modifications that favor a 3'-endo sugar pucker of nucleosides are more than additive. They work synergistically to give greater duplex stabilit than either modification alone. Increased duplex stability, subject to limits, is likely desirable for certain oligonucleotide based therapeutics, such as mieroRNA inhibitors. Furthermore, these types of modifications may also protect from enzymatic degradation, cellular delivery due to decreased electrostatic charge and enhanced pharmacokinetic and/or pharmacodynamic properties.
Example 11: Effect of Multiple Incorporations of Base Modified Nucleotides in the
Oligonucleotide
[0104] Multiple incorporations (i.e. 9 bases out of 16 total) of a cationic 5-carboxamido- modified cleoxyuridine seems to give minimal boosts to duplex stability for both phosphorothioate and phosphate backbone 16-mer oligonucleotides. See Figure 11. This may be due to perturbations in hydrating the bases or steric bulk of the substituents. It is surprising to note, though, that a single incorporation can increase the duplex stability of a 16-mer anti-208a deoxyoligonucleotide with either phosphorothioate or phosphate backbones with its target, miR-208a RNA, by more than 10 °C and 17 °C, respectively. The modifications disclosed in this invention can be used alone, as single or multiple incorporations, or in conjunction with other sugar modifications, as single or multiple incorporations, to obtain a therapeutic oligonucleotide with desirable duplexing properties, duplex-protein binding properties, or along with desirable pharmacokinetic and/or pharmacodynamic properties.
[0105] Although preferred embodiments have been depicted and described in detail herein, it will be apparent to those skilled in the relevant art that various modifications, additions, substitutions, and the like can be made without departing from the spirit of the invention and these are therefore considered within the scope of the present invention as defined in the claims which follow.

Claims

1 . An oligonucleotide comprising at least one nucleotide having a 2' modification and at least one nucleotide having an amino carbonyl modified base.
2. The oligonucleotide of claim 1 , wherein the oligonucleotide hybridizes to a human microR A with high affinity,
3. The oligonucleotide of claim 1 or 2, wherein the oligonucleotide is from about 6 to about 22 nucleotides in length.
4. The oligonucleotide of claim. 3, wherein the oligonucleotide is from about 10 to about 18 nucleotides in length.
5. The oligonucleotide of any one of claims 1 to 4, wherein each amino carbonyl group is independently selected from a carboxamino, a carbamoyl, or a carbamide group.
6. The oligonucleotide of claim 5, wherein the base is modified at C-5 for pyrimidine or C-8 for purine.
7. The oligonucleotide of claim 5, wherein the base modification is a carboxamino group.
8. The oligonucleotide of any one of claims 1 to 7, wherein the base modification contains a substituent selected from Ci-Cis alkyl, Cj-Cis alkenyl, cycloalkyl, aryl, heterorayl, heterocyclyl, and -(CH2)n-NR.]R.2, wherein n is an integer from 1 to 6 and R¾ and R2 are independently H or C]-C6alkyl.
9. The oligonucleotide of any one of claims 1 to 7, wherein the base modification contains a pendent lipophilic substituent.
10. The oligonucleotide of any one of claims 1 to 7, wherein the base modification contains a pendent hydrophiiic substituent.
1 1. The oligonucleotide of claim 10, wherein the base modification is cationic.
12. The oligonucleotide of claim 6, wherein the base modification contains a substituent selected from phenyl, C4 to C20 alkyl or alkenyl, substituted or unsubstituted imidazole, substituted or unsubstituted morphoiino, substituted or unsubstituted piperidine, substituted or unsubstituted piperazine, or tertiary amine.
13. The oligonucleotide of claim 12, wherein the base modification is bound to the C5 position of a pyrirnidine base through a carbox.ami.no linkage, optionally having a linking group of from 1 to 4 carbon units.
14. The oligonucleotide of any one of claims 1 to 13, wherein the 2 ' modification is a 2'- 4' bridge locking the sugar in the C3 endo configuration,
15. The oligonucleotide of claim 14, wherein the 2'-4'bridge has the following structure:
Figure imgf000045_0001
16. The oligonucleotide of any one of claims 1 to 13, wherem the 2' modification is 2' 0-aLkyl(Cl-C6), F, CI, M l -, CN, or SH.
17. The oligonucleotide of any one of claims 1 to 13, comprising 2 or more nucleotides with a 2' modification, and 2 or more nucleotides having the base modification, the 2' modifications being independently selected from 2" 0-alkyl(Cl-C6), F, CI, NH2, CN, SH, and a 2'- 4' bridge locking the sugar in the C3 endo configuration.
18. The oligonucleotide of claim 17, wherein the alkyl is Ci-Ce alkyl.
19. The oligonucleotide of claim 17, wherein the 2' modification is 2'-QMe,
20. The oligonucleotide of any one of claims 1 to 19, having from 2 to about 10 nucleotides having both the 2' modification and the amino carbonyl modified base.
21. The oligonucleotide of claim 1 , wherein at least, 25% of nucleotides have an amino carbonyl modified base.
22. The oligonucleotide of claim 21 , wherein at least 50% of nucleotides have an amino carbonyl modified base.
23. The oligonucleotide of claim 21 , wherein at least 75% of nucleotides have an amino carbonyl modified base.
24. The oligonucleotide of claim 1 , wherein less than 50% or less than 25% of nucleotides have an amino carbonyl modified base.
25. The oligonucleotide of claim 24, wherein the oligonucleotide has a single incorporation of a base-modified nucleotide with 2'OMe.
26. The oligonucleotide of any one of claims 21 to 25, wherein the oligonucleotide contains at least 6, or at least 9 nucleotides having a 2' -QMe.
27. The oligonucleotide of any one of claims 1 to 26, wherein the oligonucleotide has one or more 2'deoxy nucleotides.
28. The oligonucleotide of any one of claims 21 to 27, wherein uridine or thymine bases are modified by amino carbonyl.
29. The oligonucleotide of any one of claims 21 to 27, wherein pyrimi dines are modified by amino carbonyl.
30. The oligonucleotide of any one of claims 1 to 29, having a 5' a.nd''or 3' cap structure.
31 . The oligonucleotide of any one of claims 1 to 30, containing one or more phosphorothioate linkages.
32. The oligonucleotide of claim 31 , wherein the oligonucleotide is fully
phosphoroth io ate- li nked.
33. The oligonucleotide of claim 31 , having from one to five phosphate linkages.
34. The oligonucleotide of any one of claims 1 to 33, wherein the nucleotide sequence is substantially complementar}' to a sequence of miR-208a, miR~208h, miR-15b, or miR- 21.
35. The oligonucleotide of any one of claims 1 to 34, wherein the nucleotide sequence is substantially complementar}' to a sequence of a human miRN A listed in Table 1.
36. The oligonucleotide of claim 35, having the sequence and structure of an oligonucleotide of Figure 5.
37. A pharmaceutical composition comprising an effective amount of the
oligonucleotide of any one of claims 1 to 36, or a pharmaceutically-acceptable salt thereof, and a. pharmaceutically-acceptable carrier or diluent.
38. The pharmaceutical composition of claim 37, wherein the pharmaceutically- acceptable carrier comprises saline, a colloidal dispersion system, macromoiecular complex, nanoeapsuie, microsphere, bead, oil-in-water emulsion, micelle, mixed micelle, or liposome.
39. A method of reducing or inhibiting microR A activity in a cell comprising contacting the cell with the oligonucleotide of any one of claims 1 to 36 or the composition of claim 37 or 38.
40. The method of claim 39, wherein the cell is a mammalian cell.
41 . The method of claim 40, wherein the cell is a heart cell.
42. The method of claim 39, wherein the cell is in vivo or ex vivo.
43. A method of preventing or treating a condition in a subject associated with or mediated by expression of a microRNA, comprising administering to the subject the pharmaceutical composition of claim 37 or 38.
44. The method of claim 43, wherein the condition is a heart or cardiovascular condition.
45. The method of claim 43, wherein the heart condition is pathologic cardiac hypertrophy, myocardial infarction, or heart failure, and the miRNA is miR-208a or b.
46. The method of any one of claims 43 to 45, wherein said pharmaceutical composition is administered by parenteral administration or by direct injection into heart tissue,
47. The method of claim 46, wherein said parenteral administration is intravenous, subcutaneous, intraperitoneal, or intramuscular.
48. The method of any one of claims 43 to 47, wherein said composition is administered by oral, transdermal, sustained release, controlled release, delayed release, suppository, catheter, or sublingual administration.
49. The method of any one of claims 43 to 48, wherein said subject is human.
PCT/US2011/059588 2010-11-05 2011-11-07 Base modified oligonucleotides Ceased WO2012061810A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
CN201180064239.XA CN103492569B (en) 2010-11-05 2011-11-07 Base-modified oligonucleotides
AU2011323085A AU2011323085B2 (en) 2010-11-05 2011-11-07 Base modified oligonucleotides
CA2817002A CA2817002C (en) 2010-11-05 2011-11-07 Base modified oligonucleotides
US13/883,363 US9416360B2 (en) 2010-11-05 2011-11-07 Base modified oligonucleotides
EP11838938.6A EP2635681B8 (en) 2010-11-05 2011-11-07 Base modified oligonucleotides
JP2013537906A JP5995855B2 (en) 2010-11-05 2011-11-07 Base-modified oligonucleotide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US41067210P 2010-11-05 2010-11-05
US61/410,672 2010-11-05

Publications (1)

Publication Number Publication Date
WO2012061810A1 true WO2012061810A1 (en) 2012-05-10

Family

ID=46024863

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2011/059588 Ceased WO2012061810A1 (en) 2010-11-05 2011-11-07 Base modified oligonucleotides

Country Status (7)

Country Link
US (1) US9416360B2 (en)
EP (1) EP2635681B8 (en)
JP (1) JP5995855B2 (en)
CN (1) CN103492569B (en)
AU (1) AU2011323085B2 (en)
CA (1) CA2817002C (en)
WO (1) WO2012061810A1 (en)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013093870A1 (en) 2011-12-23 2013-06-27 International Centre For Genetic Engineering And Biotechnology - Icgeb microRNAs FOR CARDIAC REGENERATION THROUGH INDUCTION OF CARDIAC MYOCYTE PROLIFERATION
EP2558478A4 (en) * 2010-04-12 2013-10-23 Somalogic Inc MODIFIED PYRIMIDINES IN POSITION 5 AND THEIR USE
WO2013192576A3 (en) * 2012-06-21 2014-04-03 Miragen Therapeutics Oligonucleotide-based inhibitors comprising locked nucleic acid motif
AU2013202528B2 (en) * 2010-04-12 2015-07-30 Somalogic Operating Co., Inc. 5-position modified pyrimidines and their use
WO2015121323A1 (en) * 2014-02-11 2015-08-20 Institut Pasteur Treatment of cardiac diseases with modulators of the hippo pathway
US9885042B2 (en) 2015-01-20 2018-02-06 MiRagen Therapeutics, Inc. miR-92 inhibitors and uses thereof
US9932582B2 (en) 2014-01-14 2018-04-03 The University Court Of The University Of Glasgow Materials and methods for modulation of tendon healing
US9938314B2 (en) 2013-11-21 2018-04-10 Somalogic, Inc. Cytidine-5-carboxamide modified nucleotide compositions and methods related thereto
US10011833B2 (en) 2013-03-15 2018-07-03 MiRagen Therapeutics, Inc. Bridged bicyclic nucleosides
WO2020033791A1 (en) 2018-08-09 2020-02-13 Verseau Therapeutics, Inc. Oligonucleotide compositions for targeting ccr2 and csf1r and uses thereof
WO2024186176A1 (en) * 2023-03-09 2024-09-12 주식회사 압타머사이언스 Method for preparing modified nucleosides from thymidine

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110346493B (en) * 2019-05-23 2021-01-05 中国人民解放军军事科学院军事医学研究院 Method for detecting midkine antisense oligonucleotide content in rhesus monkey plasma
WO2023246935A1 (en) * 2022-06-23 2023-12-28 安沛治疗有限公司 Target-specific nucleic acid molecule having quinoline modification
IL326586A (en) * 2023-08-17 2026-04-01 Adarx Pharmaceuticals Inc Oligonucleotides containing a ligand at a nucleobase, 2' position, or 3' position

Citations (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5750672A (en) 1996-11-22 1998-05-12 Barrskogen, Inc. Anhydrous amine cleavage of oligonucleotides
US5783565A (en) 1994-12-09 1998-07-21 Genzyme Corporation Cationic amphiphiles containing spermine or spermidine cationic group for intracellular delivery of therapeutic molecules
US5837533A (en) 1994-09-28 1998-11-17 American Home Products Corporation Complexes comprising a nucleic acid bound to a cationic polyamine having an endosome disruption agent
US5981505A (en) 1993-01-26 1999-11-09 The Trustees Of The University Of Pennsylvania Compositions and methods for delivery of genetic material
US6217900B1 (en) 1997-04-30 2001-04-17 American Home Products Corporation Vesicular complexes and methods of making and using the same
US6268490B1 (en) 1997-03-07 2001-07-31 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogues
US6316198B1 (en) 1999-03-18 2001-11-13 Exiqon A/S Detection of mutations in genes by specific LNA primers
US6403566B1 (en) 1998-05-26 2002-06-11 Icn Pharmaceuticals, Inc. Nucleosides having bicyclic sugar moiety
US6416510B1 (en) 1997-03-13 2002-07-09 Biocardia, Inc. Drug delivery catheters that attach to tissue and methods for their use
WO2003093449A2 (en) 2002-05-06 2003-11-13 Nucleonics, Inc. Methods for delivery of nucleic acids
US6670461B1 (en) 1997-09-12 2003-12-30 Exiqon A/S Oligonucleotide analogues
US6716196B2 (en) 1993-07-30 2004-04-06 The Regents Of The University Of California Catheter system for delivery of Therapeutic compounds to cardiac tissue
US6747014B2 (en) 1997-07-01 2004-06-08 Isis Pharmaceuticals, Inc. Compositions and methods for non-parenteral delivery of oligonucleotides
US6770748B2 (en) 1997-03-07 2004-08-03 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogue
US6833361B2 (en) 1998-05-26 2004-12-21 Ribapharm, Inc. Nucleosides having bicyclic sugar moiety
WO2005082440A1 (en) 2004-02-26 2005-09-09 V-Kardia Pty Ltd Isolating cardiac circulation
US6953466B2 (en) 1997-11-04 2005-10-11 Boston Scientific Scimed, Inc. Methods for delivering a therapeutic implant to tissue
US6998484B2 (en) 2000-10-04 2006-02-14 Santaris Pharma A/S Synthesis of purine locked nucleic acid analogues
US20060148742A1 (en) 2004-02-26 2006-07-06 Kaye David M Polynucleotide delivery to cardiac tissue
US20070060907A1 (en) 2004-02-26 2007-03-15 Shapland James E Regional cardiac tissue treatment
US20070203445A1 (en) 2004-02-26 2007-08-30 V-Kardia Pty Ltd Isolating cardiac circulation
US7404969B2 (en) 2005-02-14 2008-07-29 Sirna Therapeutics, Inc. Lipid nanoparticle based compositions and methods for the delivery of biologically active molecules
US20090137506A1 (en) * 2007-05-02 2009-05-28 Sirna Therapeutics, Inc. RNA Interference Mediated Inhibition of Cyclic Nucleotide Type 4 Phosphodiesterase (PDE4B) Gene Expression Using Short Interfering Nucleic Acid (siNA)
WO2010129672A1 (en) 2009-05-05 2010-11-11 Miragen Therapeutics Lipophilic polynucleotide conjugates

Family Cites Families (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5945527A (en) 1996-05-30 1999-08-31 Nexstar Pharmaceuticals, Inc. Palladium catalyzed nucleoside modification methods using nucleophiles and carbon monoxide
CA2562151C (en) * 2004-04-30 2016-09-06 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising a c5-modified pyrimidine
WO2006026485A2 (en) * 2004-08-25 2006-03-09 Isis Pharmaceuticals, Inc. Modulation of hif1-beta expression
WO2006093157A1 (en) 2005-02-28 2006-09-08 Tokyo Institute Of Technology Oligonucleotide derivative, probe for detection of gene, and dna chip
US20070213292A1 (en) * 2005-08-10 2007-09-13 The Rockefeller University Chemically modified oligonucleotides for use in modulating micro RNA and uses thereof
WO2007051303A1 (en) 2005-11-02 2007-05-10 Protiva Biotherapeutics, Inc. MODIFIED siRNA MOLECULES AND USES THEREOF
CN101448942B (en) * 2005-12-12 2014-04-23 北卡罗来纳大学查珀尔希尔分校 MICRORNAs that Regulate Myocyte Proliferation and Differentiation
US20100184209A1 (en) * 2006-02-17 2010-07-22 Dharmacon, Inc. Compositions and methods for inhibiting gene silencing by rna interference
BRPI0714794A2 (en) 2006-08-01 2013-05-21 Univ Texas identification of a micro-rna that activates beta-myosin heavy chain expression
US7947447B2 (en) * 2007-01-16 2011-05-24 Somalogic, Inc. Method for generating aptamers with improved off-rates
DK2172566T4 (en) * 2007-07-17 2022-06-13 Somalogic Inc Method for generating aptamers with improved off-rates
KR20100049079A (en) 2007-07-18 2010-05-11 더 리젠트스 오브 더 유니버시티 오브 콜로라도 Differential expression of micrornas in nonfailing versus failing human hearts
ES2621161T3 (en) 2007-07-31 2017-07-03 The Board Of Regents Of The University Of Texas System Family of micro-RNA that modulates fibrosis and its uses
NZ583025A (en) 2007-07-31 2012-06-29 Univ Texas Micro-rnas that control myosin expression and myofiber identity
WO2009058818A2 (en) 2007-10-29 2009-05-07 The Board Of Regents Of The University Of Texas System Compositions comprising a micro-rna and methods of their use in regulating cardiac remodeling
MX2010005166A (en) 2007-11-09 2010-10-07 Univ Texas Micro-rnas of the mir-15 family modulate cardiomyocyte survival and cardiac repair.
CN102083980A (en) 2008-02-21 2011-06-01 得克萨斯系统大学董事会 Micro-RNAs that modulate smooth muscle proliferation and differentiation and uses thereof
AU2010210605B2 (en) 2009-02-04 2015-08-13 Board Of Regents, The University Of Texas System Dual targeting of miR-208 and miR-499 in the treatment of cardiac disorders
WO2010120969A1 (en) 2009-04-15 2010-10-21 Board Of Regents, The University Of Texas System Targeting of the mir-30 family and let-7 family as a treatment for heart disease
WO2010129950A1 (en) 2009-05-08 2010-11-11 Board Of Regents, The University Of Texas System Micro-rna that regulates cardiac remodeling
AU2011240774B2 (en) 2010-04-12 2014-04-10 Otsuka Pharmaceutical Co., Ltd. Aptamers to beta-NGF and their use in treating beta-NGF mediated diseases and disorders
AR084319A1 (en) 2010-12-15 2013-05-08 Miragen Therapeutics MicroRNA INHIBITORS (miRNA OR miR) THAT INCLUDE BLOCKED NUCLEOTIDES

Patent Citations (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5981505A (en) 1993-01-26 1999-11-09 The Trustees Of The University Of Pennsylvania Compositions and methods for delivery of genetic material
US6716196B2 (en) 1993-07-30 2004-04-06 The Regents Of The University Of California Catheter system for delivery of Therapeutic compounds to cardiac tissue
US6379965B1 (en) 1994-09-28 2002-04-30 American Home Products Corporation Multifunctional complexes for gene transfer into cells comprising a nucleic acid bound to a polyamine and having an endosome disruption agent
US5837533A (en) 1994-09-28 1998-11-17 American Home Products Corporation Complexes comprising a nucleic acid bound to a cationic polyamine having an endosome disruption agent
US6127170A (en) 1994-09-28 2000-10-03 American Home Products Corporation Multifunctional complexes for gene transfer into cells comprising a nucleic acid bound to a polyamine and having a endosome disruption agent
US7202227B2 (en) 1994-09-28 2007-04-10 Wyeth Multifunctional molecular complexes for gene transfer to cells
US5783565A (en) 1994-12-09 1998-07-21 Genzyme Corporation Cationic amphiphiles containing spermine or spermidine cationic group for intracellular delivery of therapeutic molecules
US5750672A (en) 1996-11-22 1998-05-12 Barrskogen, Inc. Anhydrous amine cleavage of oligonucleotides
US6268490B1 (en) 1997-03-07 2001-07-31 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogues
US6770748B2 (en) 1997-03-07 2004-08-03 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogue
US6416510B1 (en) 1997-03-13 2002-07-09 Biocardia, Inc. Drug delivery catheters that attach to tissue and methods for their use
US6383512B1 (en) 1997-04-30 2002-05-07 American Home Products Corporation Vesicular complexes and methods of making and using the same
US6217900B1 (en) 1997-04-30 2001-04-17 American Home Products Corporation Vesicular complexes and methods of making and using the same
US6747014B2 (en) 1997-07-01 2004-06-08 Isis Pharmaceuticals, Inc. Compositions and methods for non-parenteral delivery of oligonucleotides
US7034133B2 (en) 1997-09-12 2006-04-25 Exiqon A/S Oligonucleotide analogues
US6670461B1 (en) 1997-09-12 2003-12-30 Exiqon A/S Oligonucleotide analogues
US6953466B2 (en) 1997-11-04 2005-10-11 Boston Scientific Scimed, Inc. Methods for delivering a therapeutic implant to tissue
US6833361B2 (en) 1998-05-26 2004-12-21 Ribapharm, Inc. Nucleosides having bicyclic sugar moiety
US6403566B1 (en) 1998-05-26 2002-06-11 Icn Pharmaceuticals, Inc. Nucleosides having bicyclic sugar moiety
US6316198B1 (en) 1999-03-18 2001-11-13 Exiqon A/S Detection of mutations in genes by specific LNA primers
US6998484B2 (en) 2000-10-04 2006-02-14 Santaris Pharma A/S Synthesis of purine locked nucleic acid analogues
WO2003093449A2 (en) 2002-05-06 2003-11-13 Nucleonics, Inc. Methods for delivery of nucleic acids
WO2005082440A1 (en) 2004-02-26 2005-09-09 V-Kardia Pty Ltd Isolating cardiac circulation
US20070060907A1 (en) 2004-02-26 2007-03-15 Shapland James E Regional cardiac tissue treatment
US20060148742A1 (en) 2004-02-26 2006-07-06 Kaye David M Polynucleotide delivery to cardiac tissue
US20070203445A1 (en) 2004-02-26 2007-08-30 V-Kardia Pty Ltd Isolating cardiac circulation
US7404969B2 (en) 2005-02-14 2008-07-29 Sirna Therapeutics, Inc. Lipid nanoparticle based compositions and methods for the delivery of biologically active molecules
WO2006089340A2 (en) 2005-02-23 2006-08-31 V-Kardia Pty Ltd Polynucleotide delivery to cardiac tissue
US20090137506A1 (en) * 2007-05-02 2009-05-28 Sirna Therapeutics, Inc. RNA Interference Mediated Inhibition of Cyclic Nucleotide Type 4 Phosphodiesterase (PDE4B) Gene Expression Using Short Interfering Nucleic Acid (siNA)
WO2010129672A1 (en) 2009-05-05 2010-11-11 Miragen Therapeutics Lipophilic polynucleotide conjugates

Non-Patent Citations (21)

* Cited by examiner, † Cited by third party
Title
A. OSOL: "Remington's Pharmaceutical Sciences 15th Edition,", pages: 1035 - 1038,157
AHMADIAN ET AL., NUCLEIC ACIDS RES., vol. 26, no. 13, 1998, pages 3127 - 3135
CARUTHERS ET AL.: "New Chemical Methods for Synthesizing Polynucleotides", NUCLEIC ACIDS SYMP. SER., 1980, pages 215 - 23
CHIEN KR: "Molecular Medicine: MicroR-NAs and the Tell-tale Heart", NATURE, vol. 447, 2007, pages 389 - 390
COTTEN ET AL.: "2'-O-methyl, 2'-O-ethyl oligoribonucleotides and phosphorothioate oligodeoxyribonucleotides as inhibitors of the in vitro U7 snRNP-dependent mRNA processing event.", NUCLEIC ACIDS RESEARCH, vol. 19, no. 10, 1991, pages 2629 - 2635, XP002229545 *
EL SAFADI ET AL.: "5-Modified-2'-dU and 2'-dC as mutagenic anti HIV-1 proliferation agents: synthesis and activity.", J MED CHEM., vol. 53, no. 4, 25 February 2010 (2010-02-25), pages 1534 - 1545, XP055079739 *
GOLD ET AL.: "Aptamer-based multiplexed proteomic technology for biomarker discovery.", NATURE PRECEDINGS, 14 June 2010 (2010-06-14), pages 1 - 31 + 22PP, XP055089415, Retrieved from the Internet <URL:http://precedings.nature.com/documents/4538/version/1/files/npre20104538-1.pdf> [retrieved on 20120128] *
HASHIMOTO ET AL., J. AM. CHEM.SOC., vol. 115, no. 16, 1993, pages 7128 - 7134
HASHIMOTO ET AL., J. AM.CHEM.SOC., vol. 115, no. 16, 1993, pages 7128 - 7134
ITO ET AL., NUCLEIC ACIDS RESEARCH, vol. 31, no. 1, 2003, pages 2514 - 2523
JUAN ET AL., NUCLEIC ACIDS RESEARCH, vol. 35, no. 6, 2007, pages 1969 - 1977
KOROLEVA ET AL.: "Synthesis and applications of 2-aminopyrimidine derivatives as key intermediates in chemical synthesis of biomolecules.", RUSSIAN CHEMICAL REVIEWS, vol. 79, no. 8, October 2010 (2010-10-01), pages 655 - 681, XP008168149 *
ONO ET AL.: "Nucleosides and nucleotides. 127. A novel and convenient post-synthetic modification method for the synthesis of oligodeoxyribonucleotides carrying amino linkers at the 5-position of 2'-deoxyuridine", BIOORGANIC & MEDICINAL CHEMISTRY LETTERS, vol. 4, no. 2, 1994, pages 361 - 366, XP026679111 *
ROOIJ ET AL., CIRCULATION RESEARCH, vol. 103, 2008, pages 919 - 928
See also references of EP2635681A4
SPROAT ET AL., NUCLEIC ACIDS RESEARCH, vol. 17, 1989, pages 3373 - 3386
VAN ROOIJ ET AL.: "MicroRNAs: Powerful New Regulators of Heart Disease and Proactive Therapeutic Targets", J. CLIN. INVEST., vol. 117, no. 9, 2007, pages 2369 - 2376, XP002516874, DOI: doi:10.1172/JCI33099
VAUGHT ET AL., J. AM. CHEM. SOC., vol. 132, no. 12, 2010, pages 4141 - 4151
VAUGHT ET AL.: "Expanding the chemistry of DNA for in vitro selection", J AM CHEM SOC., vol. 132, no. 12, 31 March 2010 (2010-03-31), pages 4141 - 4151, XP055047152 *
VEEDU ET AL.: "Locked Nucleic Acid as a Novel Class of Therapeutic Agent", RNA BIOLOGY, vol. 6, no. 3, 2009, pages 321 - 323, XP055016056, DOI: doi:10.4161/rna.6.3.8807
ZNOSKO ET AL., J. AM. CHEM. SOC., vol. 125, no. 20, 2003, pages 6090 - 6097

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2013202528B2 (en) * 2010-04-12 2015-07-30 Somalogic Operating Co., Inc. 5-position modified pyrimidines and their use
EP2558478A4 (en) * 2010-04-12 2013-10-23 Somalogic Inc MODIFIED PYRIMIDINES IN POSITION 5 AND THEIR USE
US10221207B2 (en) 2010-04-12 2019-03-05 Somalogic, Inc. 5-position modified pyrimidines and their use
EP3345915A1 (en) * 2010-04-12 2018-07-11 Somalogic, Inc. 5-position modified pyramidines and their use
AU2011240677B2 (en) * 2010-04-12 2015-05-14 Somalogic Operating Co., Inc. 5-position modified pyrimidines and their use
US9163056B2 (en) 2010-04-12 2015-10-20 Somalogic, Inc. 5-position modified pyrimidines and their use
WO2013093870A1 (en) 2011-12-23 2013-06-27 International Centre For Genetic Engineering And Biotechnology - Icgeb microRNAs FOR CARDIAC REGENERATION THROUGH INDUCTION OF CARDIAC MYOCYTE PROLIFERATION
JP2015521626A (en) * 2012-06-21 2015-07-30 ミラゲン セラピューティクス, インコーポレイテッド Oligonucleotide-based inhibitors containing locked nucleic acid motifs
KR101928418B1 (en) * 2012-06-21 2018-12-12 미라젠 세러퓨틱스 인코포레이티드 Oligonucleotide-Based Inhibitors Comprising Locked Nucleic Acid Motif
CN104685056A (en) * 2012-06-21 2015-06-03 米拉根医疗股份有限公司 Oligonucleotide-based inhibitors comprising locked nucleic acid motifs
EP2864482A4 (en) * 2012-06-21 2016-02-10 Miragen Therapeutics Inc Oligonucleotide-based inhibitors comprising locked nucleic acid motif
US9388408B2 (en) 2012-06-21 2016-07-12 MiRagen Therapeutics, Inc. Oligonucleotide-based inhibitors comprising locked nucleic acid motif
CN107236735A (en) * 2012-06-21 2017-10-10 米拉根医疗股份有限公司 The inhibitor based on oligonucleotides comprising lock nucleic acid motif
US9803202B2 (en) 2012-06-21 2017-10-31 MiRagen Therapeutics, Inc. Oligonucleotide-based inhibitors comprising locked nucleic acid motif
US10337005B2 (en) 2012-06-21 2019-07-02 MiRagen Therapeutics, Inc. Oligonucleotide-based inhibitors comprising locked nucleic acid motif
WO2013192576A3 (en) * 2012-06-21 2014-04-03 Miragen Therapeutics Oligonucleotide-based inhibitors comprising locked nucleic acid motif
EP3354734A1 (en) 2012-06-21 2018-08-01 Miragen Therapeutics, Inc. Oligonucleotide-based inhibitors comprising locked nucleic acid motif
KR20150023687A (en) * 2012-06-21 2015-03-05 미라젠 세러퓨틱스 인코포레이티드 Oligonucleotide-Based Inhibitors Comprising Locked Nucleic Acid Motif
US10011833B2 (en) 2013-03-15 2018-07-03 MiRagen Therapeutics, Inc. Bridged bicyclic nucleosides
US9938314B2 (en) 2013-11-21 2018-04-10 Somalogic, Inc. Cytidine-5-carboxamide modified nucleotide compositions and methods related thereto
US10239908B2 (en) 2013-11-21 2019-03-26 Somalogic, Inc. Cytidine-5-carboxamide modified nucleotide compositions and methods related thereto
US9932582B2 (en) 2014-01-14 2018-04-03 The University Court Of The University Of Glasgow Materials and methods for modulation of tendon healing
US10472631B2 (en) 2014-01-14 2019-11-12 The University Court Of The University Of Glasgow Materials and methods for modulation of tendon healing
WO2015121323A1 (en) * 2014-02-11 2015-08-20 Institut Pasteur Treatment of cardiac diseases with modulators of the hippo pathway
US9885042B2 (en) 2015-01-20 2018-02-06 MiRagen Therapeutics, Inc. miR-92 inhibitors and uses thereof
WO2020033791A1 (en) 2018-08-09 2020-02-13 Verseau Therapeutics, Inc. Oligonucleotide compositions for targeting ccr2 and csf1r and uses thereof
WO2024186176A1 (en) * 2023-03-09 2024-09-12 주식회사 압타머사이언스 Method for preparing modified nucleosides from thymidine

Also Published As

Publication number Publication date
EP2635681B1 (en) 2017-08-23
JP5995855B2 (en) 2016-09-21
CN103492569A (en) 2014-01-01
US9416360B2 (en) 2016-08-16
EP2635681A4 (en) 2015-01-14
CN103492569B (en) 2020-04-07
US20130296402A1 (en) 2013-11-07
AU2011323085A1 (en) 2013-03-21
CA2817002A1 (en) 2012-05-10
JP2014503192A (en) 2014-02-13
EP2635681A1 (en) 2013-09-11
CA2817002C (en) 2019-01-15
AU2011323085B2 (en) 2014-10-30
EP2635681B8 (en) 2017-10-04

Similar Documents

Publication Publication Date Title
EP2635681B1 (en) Base modified oligonucleotides
AU2021203383B2 (en) Antisense nucleic acid
US10011833B2 (en) Bridged bicyclic nucleosides
KR101310569B1 (en) Antisense nucleic acid
JP7798836B2 (en) Nucleic acid molecules for reducing PAPD5 and PAPD7 mRNA for the treatment of hepatitis B infection
JP6832285B2 (en) Antisense-oligonucleotide as a TGF-R signaling inhibitor
JP2005522997A (en) Oligonucleotides containing alternating segments and uses thereof
EA031110B1 (en) Boronic acid conjugates of oligonucleotide analogues
JP2025156522A (en) Modified heterogeneous nucleic acid
CA3165961A1 (en) Antisense nucleic acid that induces skipping of exon 50
JP2025166835A (en) Use of SCAMP3 inhibitors to treat hepatitis B virus infection
CN114901821A (en) Use of SEPT9 inhibitors for treating hepatitis B virus infection
EP4112083A1 (en) Antisense nucleic acid inducing skipping of exon 51
CN114829601A (en) Use of SBDS inhibitors for the treatment of hepatitis b virus infection
HK40078456A (en) Use of sbds inhibitors for treating hepatitis b virus infection
HK40071185A (en) Use of sept9 inhibitors for treating hepatitis b virus infection
WO2020007826A1 (en) Antisense oligonucleotides targeting mbtps1
WO2019038228A1 (en) Oligonucleotides for modulating tom1 expression
NZ728103B2 (en) Antisense nucleic acids

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11838938

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2011323085

Country of ref document: AU

Date of ref document: 20111107

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2013537906

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2817002

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2011838938

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2011838938

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 13883363

Country of ref document: US