CN110346493B - Method for detecting content of midkine antisense oligonucleotide in macaque plasma - Google Patents
Method for detecting content of midkine antisense oligonucleotide in macaque plasma Download PDFInfo
- Publication number
- CN110346493B CN110346493B CN201910432682.6A CN201910432682A CN110346493B CN 110346493 B CN110346493 B CN 110346493B CN 201910432682 A CN201910432682 A CN 201910432682A CN 110346493 B CN110346493 B CN 110346493B
- Authority
- CN
- China
- Prior art keywords
- plasma
- antisense oligonucleotide
- macaque
- midkine
- solution
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N30/00—Investigating or analysing materials by separation into components using adsorption, absorption or similar phenomena or using ion-exchange, e.g. chromatography or field flow fractionation
- G01N30/02—Column chromatography
- G01N30/04—Preparation or injection of sample to be analysed
- G01N30/06—Preparation
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N30/00—Investigating or analysing materials by separation into components using adsorption, absorption or similar phenomena or using ion-exchange, e.g. chromatography or field flow fractionation
- G01N30/02—Column chromatography
- G01N30/88—Integrated analysis systems specially adapted therefor, not covered by a single one of the groups G01N30/04 - G01N30/86
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N30/00—Investigating or analysing materials by separation into components using adsorption, absorption or similar phenomena or using ion-exchange, e.g. chromatography or field flow fractionation
- G01N30/02—Column chromatography
- G01N30/04—Preparation or injection of sample to be analysed
- G01N2030/042—Standards
- G01N2030/045—Standards internal
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N30/00—Investigating or analysing materials by separation into components using adsorption, absorption or similar phenomena or using ion-exchange, e.g. chromatography or field flow fractionation
- G01N30/02—Column chromatography
- G01N30/88—Integrated analysis systems specially adapted therefor, not covered by a single one of the groups G01N30/04 - G01N30/86
- G01N2030/8809—Integrated analysis systems specially adapted therefor, not covered by a single one of the groups G01N30/04 - G01N30/86 analysis specially adapted for the sample
- G01N2030/8813—Integrated analysis systems specially adapted therefor, not covered by a single one of the groups G01N30/04 - G01N30/86 analysis specially adapted for the sample biological materials
- G01N2030/8827—Integrated analysis systems specially adapted therefor, not covered by a single one of the groups G01N30/04 - G01N30/86 analysis specially adapted for the sample biological materials involving nucleic acids
Abstract
The invention discloses a method for detecting the content of midkine antisense oligonucleotide in macaque plasma, which comprises the following steps: taking macaque plasma to be detected containing midkine antisense oligonucleotide, adding influenza tide into the macaque plasma to serve as an internal standard solution, adding a proper amount of ammonia water solution and phenol/dichloromethane mixed solution, and then sequentially carrying out vortex and centrifugation to obtain a processed blood sample; taking the supernatant of the blood sample and performing LC/MS/MS analysis; and drawing a standard curve, and quantitatively analyzing the content of the midkine antisense oligonucleotide in the plasma of the macaque to be detected according to a standard curve method. The method has high specificity, and the parameters of accuracy, precision, recovery rate, sample freeze-thaw stability and the like all meet the detection requirements.
Description
Technical Field
The invention belongs to the field of drug analysis, and particularly relates to a method for detecting the content of midkine antisense oligonucleotide in macaque plasma.
Background
The direct intervention of pathogenic RNA by using foreign nucleic acid fragments is a very important class of gene therapy strategies, and various functional nucleic acids have been developed in recent 40 years as candidate structures of the gene therapy strategies, including antisense nucleic acids, ribozymes, deoxyribozymes, small interfering RNAs (siRNAs), miRNAs and the like. They have shown great application potential in the treatment of tumors, infection resistance, cardiovascular system diseases, nervous system diseases, metabolic disorders, inflammation, immunotherapy, diseases and rare diseases which can not be treated by traditional small molecule drugs.
For the pathogenic genes of many diseases, in vitro synthesized nucleic acid drugs are a good choice. With the development of molecular biology, people have more knowledge about disease-related gene network regulation and related functional proteins, especially the self-regulation system of various endogenous nucleic acids for gene transcription and expression, which is beneficial to selecting key pathogenic genes as the target of gene therapy and appropriate gene therapy schemes, including implementing replacement or eliminating the pathogenic genes by using gene editing technology; the antisense nucleic acid is utilized to cut or close the expression of the antisense nucleic acid, or regulate and control the skipping and splicing of exons, so as to achieve the aim of down-regulating or up-regulating the expression of functional protein; target RNA is degraded by adopting a siRNA method and a ribozyme method; the expression of target RNA is regulated against the miRNA network. Therefore, there are many candidates for mutations in genes associated with a disease or class of diseases, which is a great advantage of gene therapy. Nucleic acid drugs in preclinical and clinical trials reach hundreds of drugs one after another, but the nucleic acid structures are far from the drug requirements (polar macromolecules, multiple negative charges, easiness in degradation by nuclease, clearance by liver and kidney, immunogenicity, difficulty in transportation and the like), and great challenges are encountered in the development process. Chemical modification plays a great role in the druggability optimization strategy of nucleic acid drugs, and has achieved considerable success. In the progress of 1 st generation, 2 nd generation and 2.5 nd generation, an important experience is obtained that a chemical modification cannot solve all the problems, and the combination of multiple modifications is the most effective solution and the modification mode adopted by all the nucleic acid drugs at present. Of course, the type and mechanism of action of the nucleic acid drug is of great importance for the selection of the mode and site of modification.
Through the development of recent 40 years, from antisense drugs which have been successfully used in clinical treatment to siRNA drugs which are full of expectations, nucleic acid drugs have accumulated abundant experience in chemical modification, transport vectors, sequence-dependent and independent pharmaceutical properties, in vitro and in vivo evaluation methods, and the like. Provides theoretical basis and practical experience for expanding the range of gene therapy and developing more nucleic acid medicaments in future. Therefore, China is expected to vigorously develop basic research and application development of nucleic acid drugs, and especially to obtain more intellectual property rights on the innovative optimization research of nucleic acid drugs, so that China plays a good place in the future research and development of huge application markets of nucleic acid gene drugs.
The similarity between antisense nucleic acid medicine and endogenous substance and the molecular mass are large. Therefore, the biggest challenge faced by the research methods and techniques of pharmacokinetics of antisense nucleic acids is how to efficiently extract, enrich and identify drugs from biological matrices and avoid interference of endogenous substances, and accurately identify and quantitatively analyze antisense nucleic acids. Currently, the radioactive isotope tracing technology, high performance liquid chromatography, high performance thin layer chromatography, capillary electrophoresis, mass spectrometry and the like are used for the pharmaceutical analysis of antisense nucleic acid drugs. However, there are few reports on the quantitative analysis of antisense oligonucleotides in biological matrices (blood, urine, feces, etc.). Only the capillary electrophoresis detection method is reported, and the capillary electrophoresis method comprises electrophoresis, chromatography and cross content thereof. The method has poor specificity and low sensitivity. In order to overcome the above limitations, an alternative method for quantitative analysis of antisense nucleic acid drugs in biological matrices must be developed to meet the requirements of quantitative analysis of antisense nucleic acid drugs in biological matrix samples with high accuracy, strong specificity and high sensitivity.
Disclosure of Invention
The present invention is directed to solving, at least to some extent, one of the technical problems in the related art. Therefore, one objective of the invention is to provide a method for detecting the content of midkine antisense oligonucleotide in macaque plasma, which has high specificity and meets the detection requirements on the parameters such as accuracy, precision, recovery rate, sample freeze-thaw stability and the like.
According to one aspect of the invention, the invention provides a method for detecting the content of midkine antisense oligonucleotide in the plasma of cynomolgus monkeys, which according to an embodiment of the invention comprises:
(1) taking macaque plasma to be detected containing midkine antisense oligonucleotide, adding influenza tide into the macaque plasma to serve as an internal standard solution, adding a proper amount of ammonia water solution and phenol/dichloromethane mixed solution, and then sequentially carrying out vortex and centrifugation to obtain a processed blood sample;
(2) taking the supernatant of the blood sample and performing LC/MS/MS analysis;
wherein, the LC/MS/MS analysis adopts the following chromatographic conditions:
a chromatographic column: waters MS C18 column, 2.1mm X50 mm;
mobile phase A: a mixed aqueous solution of HFIP and TEA;
mobile phase B: mixed aqueous methanol solution of HFIP and TEA;
flow rate: 200 mu L/min;
elution procedure:
the LC/MS/MS analysis uses the following mass spectrum conditions:
high-purity nitrogen is used as collision gas, gas curtain gas and ESI source negative ion scanning and MRM scanning modes;
the mass spectrum conditions are as follows: collision gas: 12; air curtain air: 10; the ion source 1: 40; the ion source 2: 70; ion ionization voltage: -4500; temperature: 200 of a carrier; mode (2): ESI (-);
parameters of the test object
(3) And drawing a standard curve, and quantitatively analyzing the content of the midkine antisense oligonucleotide in the plasma of the macaque to be detected according to a standard curve method.
In addition, the method for detecting the content of the midkine antisense oligonucleotide in the cynomolgus monkey plasma according to the above embodiment of the invention may also have the following additional technical features:
in some embodiments of the invention, the concentration of influenza tide is 100 μ g/mL and the amount of influenza tide added is 25% by volume of the macaque plasma to be tested.
In some embodiments of the present invention, the concentration of the ammonia water is 5%, and the addition amount of the ammonia water is 2.5 volumes of the macaque plasma to be tested.
In some embodiments of the present invention, the volume ratio of phenol to dichloromethane in the phenol/dichloromethane mixed solution is 1: 1, and the volume ratio of the added amount of the phenol/dichloromethane mixed solution to the macaque plasma to be tested is 1: 1.
In some embodiments of the invention, the vortex time is 10 min; the centrifugation was carried out at 15000rpm/min for 5 min.
In some embodiments of the invention, the mobile phase a is a mixed aqueous solution of 200mM HFIP and 2.85mM TEA.
In some embodiments of the invention, the mobile phase B is an aqueous methanol solution of 200mM HFIP and 2.85mM TEA, wherein the volume ratio of methanol to water in the aqueous methanol solution is 60: 40.
In some embodiments of the invention, the linear range of the standard curve is 0.18-200 μ g/mL.
In some embodiments of the invention, the method has a minimum detection limit of 0.18 μ g/mL.
In some embodiments of the invention, the midkine antisense oligonucleotide in the plasma of the cynomolgus monkey to be tested is obtained by injecting a midkine antisense oligonucleotide nano-formulation into the cynomolgus monkey.
Drawings
FIG. 1A scan of factor antisense oligonucleotide Q1;
FIG. 2 is a scan of factor midkine antisense oligonucleotide Q2;
figure 3 internal standard influenza tide Q1 scan;
figure 4 internal standard influenza tide Q2 scan;
FIG. 5 is a blank plasma extract negative ion scan chromatogram;
FIG. 6 is a macaque plasma extraction chromatogram;
FIG. 7 is a standard curve of midkine antisense oligonucleotides in cynomolgus monkey plasma to be tested.
Detailed Description
The following describes embodiments of the present invention in detail. The following described embodiments are exemplary and are intended to be illustrative of the invention and are not to be construed as limiting the invention.
According to one aspect of the invention, the invention provides a method for detecting the content of midkine antisense oligonucleotide in the plasma of cynomolgus monkeys, which according to an embodiment of the invention comprises:
(1) taking macaque plasma to be detected containing midkine antisense oligonucleotide, adding influenza tide into the macaque plasma to serve as an internal standard solution, adding a proper amount of ammonia water solution and phenol/dichloromethane mixed solution, and then sequentially carrying out vortex and centrifugation to obtain a processed blood sample;
(2) taking the supernatant of the blood sample and performing LC/MS/MS analysis;
wherein, the LC/MS/MS analysis adopts the following chromatographic conditions:
a chromatographic column: waters MS C18 column, 2.1mm X50 mm;
mobile phase A: a mixed aqueous solution of HFIP and TEA;
mobile phase B: mixed aqueous methanol solution of HFIP and TEA;
flow rate: 200 mu L/min;
elution procedure:
the LC/MS/MS analysis uses the following mass spectrum conditions:
high-purity nitrogen is used as collision gas, gas curtain gas and ESI source negative ion scanning and MRM scanning modes;
the mass spectrum conditions are as follows: collision gas: 12; air curtain air: 10; the ion source 1: 40; the ion source 2: 70; ion ionization voltage: -4500; temperature: 200 of a carrier; mode (2): ESI (-);
parameters of the test object
(3) And drawing a standard curve, and quantitatively analyzing the content of the midkine antisense oligonucleotide in the plasma of the macaque to be detected according to a standard curve method.
Therefore, the content of the midkine antisense oligonucleotide in the macaque plasma can be detected in a targeted manner by the method, and the linear range, the lower limit of quantification, the accuracy, the precision, the recovery rate, the freeze-thaw stability and other parameters of the method meet the detection requirements.
The method for detecting the content of midkine antisense oligonucleotide in the plasma of cynomolgus monkey of the above embodiment of the present invention will be described in detail below.
According to an embodiment of the present invention, first, macaque plasma to be tested is treated. Specifically, macaque plasma to be detected containing midkine antisense oligonucleotide is taken, influenza tide is added into the macaque plasma to serve as an internal standard solution, a proper amount of ammonia water solution and phenol/dichloromethane mixed solution are added, and then centrifugation is performed after vortex in sequence so as to obtain a processed blood sample.
Wherein the concentration of the internal standard influenza tide can be 100 mug/mL, and the addition amount of the influenza tide is 25 vol% of the macaque plasma to be detected. Thus selecting influenza tide as an internal standard can make the internal standard have similar mass spectrum chromatographic behavior with the test substance, and the inventor finds that selecting the concentration and the added amount of influenza tide can make the internal standard have more appropriate peak height area for reference.
According to the embodiment of the invention, the pH value of the object to be detected can be adjusted by adding a proper amount of ammonia water, so that the extraction is more beneficial, specifically, the concentration of the ammonia water can be 5%, and the adding amount of the ammonia water is 2.5 volume of the macaque plasma to be detected. Thereby, the extraction recovery rate can be optimized.
According to the embodiment of the invention, the to-be-detected substance can be extracted from the blood plasma by adding the phenol/dichloromethane mixed solution into the blood plasma of the macaque to be detected. The volume ratio of phenol to dichloromethane in the phenol/dichloromethane mixed solution is 1: 1, and the volume ratio of the addition amount of the phenol/dichloromethane mixed solution to the macaque plasma to be detected is 1: 1. Therefore, the extraction rate of the midkine antisense oligonucleotide can be further improved, and the sensitivity and the accuracy of detection are further improved.
According to an embodiment of the invention, the vortex time is 10 min; the centrifugation was carried out at 15000rpm/min for 5 min.
According to the embodiment of the present invention, the mobile phase A is a mixed aqueous solution of 200mM HFIP and 2.85mM TEA. Thereby, the midkine antisense oligonucleotide can be eluted efficiently and the peak pattern is optimized.
According to the embodiment of the invention, the mobile phase B is a methanol aqueous solution of 200mM HFIP and 2.85mM TEA, and the volume ratio of methanol to water in the methanol aqueous solution is 60: 40. Thereby, the midkine antisense oligonucleotide can be eluted efficiently and the peak pattern is optimized.
In addition, in the LC/MS/MS analysis of the supernatant of the blood sample, the following elution procedure is adopted, so that the elution effect can be obviously improved, and the sensitivity and the accuracy of detection can be improved.
Meanwhile, the mass spectrum conditions adopted by the LC/MS/MS analysis are as follows:
high-purity nitrogen is used as collision gas, gas curtain gas and ESI source negative ion scanning and MRM scanning modes;
the mass spectrum conditions are as follows: collision gas: 12; air curtain air: 10; the ion source 1: 40; the ion source 2: 70; ion ionization voltage: -4500; temperature: 200 of a carrier; mode (2): ESI (-);
parameters of the test object
Thus, the antisense oligonucleotide can be specifically and highly sensitively quantified by using the above-mentioned mass spectrometry conditions.
According to an embodiment of the invention, the linear range of the standard curve is 0.18-200. mu.g/mL. The method has a minimum detection limit of 0.18. mu.g/mL. This can significantly improve the detection sensitivity. And chromatographic analysis shows that endogenous substances in serum do not interfere with the determination of the midkine antisense oligonucleotide and the internal standard. Specifically, as mentioned above, the linear range of midkine antisense oligonucleotides in the cynomolgus monkey plasma to be tested is 0.18-200 μ g/mL. If the lowest concentration of the standard curve is used as the lowest detection limit, the lowest quantitative limit of the midkine antisense oligonucleotide in the plasma is 0.18 mu g/mL. The recovery rate of midkine antisense oligonucleotide is between 74.76 and 75.28 percent, and the RSD is between 3.67 and 4.79 percent. The content of the sample is kept stable in 3 times of freeze thawing.
According to the embodiment of the invention, the midkine antisense oligonucleotide in the cynomolgus monkey plasma to be detected is obtained by injecting a midkine antisense oligonucleotide nano-preparation into the cynomolgus monkey
Examples
1 test Material
1.1 drugs and reagents
Midkine antisense oligonucleotide (MK-ASODN): synthesized by Beijing DNA chem. biotechnology, Inc., sequence 5' CCCCGGGCCGCCCTTCTTCA, purity: 96.19%, batch number: 20100819, and storing at-20 ℃.
Nanoliposome (Nano-liposome): huzhou city central hospital, lot number: 20110119, and storing at-20 ℃.
Internal standard: synthesized by the institute of radiology and medicine of military medical academy of sciences, the sequence is 5' CCTTGTTTCTACT, and the purity is as follows: 98%, and storing at-20 ℃.
Normal macaque blank plasma was provided by the Bioresource institute of synixin, Beijing.
Methanol and acetonitrile used in the experiment were purchased from Fisher Scientific (usa) and chromatographically pure.
Hexafluoroisopropanol (HFIP) was purchased from Acros, USA, and the purity was 99.5% or more.
Triethylamine (TEA) was purchased from Sigma-Aldrich, USA, and has a purity of 99% or more
Formic acid is purchased from Tedia, USA, and the purity is more than or equal to 96%.
1.2 instruments
The Agilent 1100(Wilmington, DE, USA) liquid phase system includes a vacuum degasser, a quaternary pump, an autosampler and a column oven
API4000 triple quadrupole tandem Mass Spectrometry (Applied Biosystems, Toronta, Canada)
A centrifuge: sigma Laboratory Centrifuges
2 Experimental methods and procedures
2.1 chromatographic conditions:
a chromatographic column: waters MS C18 column, 2.1mm X50 mm,
mobile phase: a: 200mM HFIP/2.85mM aqueous TEA;
b: 200mM HFIP/2.85mM TEAMeOH H H2O (60: 40, V: V) solution;
flow rate: 200 μ L/min. The elution method comprises the following steps:
elution procedure
2.2 Mass Spectrometry conditions
High-purity nitrogen is used as Curtain gas, collision gas ESI source negative ion scanning and MRM scanning modes, and mass spectrum conditions are as follows:
Collision Gas：12Curtain Gas：10Ion Source Gas1：40
Ion Source Gas2：70IonSpray Voltage：-4500Temperature：200
Scan Mode：ESI(-)
optimized parameters of detected object
First and second scans of midkine antisense oligonucleotides and internal standard influenza tide are shown in figures 1-4. FIG. 1: midkine antisense oligonucleotide Q1 scan; FIG. 2: midkine antisense oligonucleotide Q2 scan; FIG. 3: an internal standard influenza tide Q1 scan; FIG. 4: internal standard influenza tide Q2 scan.
2.3 macaque plasma Standard Curve and quality control sample preparation
50 mu L of macaque blank plasma is respectively added into each centrifuge tube, then 50 mu L of midkine antisense oligonucleotide standard series solution and 25uL of internal standard influenza tide (100 mu g/mL) are respectively added to prepare standard plasma samples containing midkine antisense oligonucleotides with series concentrations and internal standards with the same concentration, and the final concentrations of the midkine antisense oligonucleotides are respectively 0.18, 0.39, 0.78, 1.56, 3.13, 6.25, 12.5, 25 and 200 mu g/mL. QC samples are operated in the same way, and are divided into low, medium and high concentrations, and the final concentrations are 0.39, 3.13 and 25 mu g/mL respectively.
2.4 macaque plasma sample processing
Taking 100 μ L of macaque plasma to be tested, adding 25 μ L of I.S. working solution (influenza tide 100 μ g/mL), adding 250 μ L of 5% ammonia water solution, 100 μ L of phenol/dichloromethane (1: 1, w/v), vortexing for 10min, and centrifuging for 5min (15000 rpm/min). 50 μ L of the supernatant was taken for LC/MS/MS analysis.
3 results of the test
3.1 specificity
Taking blank macaque plasma, and operating according to the method under the item of 'plasma sample processing' to obtain a chromatogram of the blank sample; diluting a plasma sample obtained by using blank plasma of a normal macaque to dilute the midkine antisense oligonucleotide and the internal standard reference substance with certain concentration, and operating according to the same method to obtain a corresponding chromatogram, wherein typical chromatograms are shown in fig. 5 and fig. 6, and fig. 5 is a blank plasma extract negative ion scanning chromatogram: fig. 6 is a macaque plasma extraction chromatogram.
The results show that endogenous substances in the serum do not interfere with the determination of the midkine antisense oligonucleotide and the internal standard.
3.2 Linear Range and quantitative lower bound
Samples of the prepared standard curve were taken at final concentrations of 0.18, 0.39, 0.78, 1.56, 3.13, 6.25, 12.5, 25, 200. mu.g/mL, respectively.
Working curves were established operating under the term "plasma sample treatment" and the curves were quantitatively analyzed with analyst1.5 in an API4000 mass spectrometer and fitted linearly with a minimum weight of 1/x 2. The standard curve of midkine antisense oligonucleotide is shown in FIG. 7, and the linear range of midkine antisense oligonucleotide in cynomolgus monkey plasma is 0.18-200. mu.g/mL. If the lowest concentration of the standard curve is used as the lowest detection limit, the lowest quantitative limit of the midkine antisense oligonucleotide in the plasma is 0.18 mu g/mL.
3.3 accuracy and precision
The QC samples with low, medium and high concentrations in the macaque plasma are prepared according to the method under the item of 'standard curve and quality control sample preparation', each concentration is analyzed by 5 samples, the measurement is continuously carried out for 3 days, the measured concentration of the QC sample is respectively calculated according to the working curve of the day, the measured concentration is compared with the prepared concentration, the accuracy and precision of the measurement method are obtained, and the results are respectively shown in the table 1 and the table 2.
TABLE 1 accuracy and precision of midkine antisense oligonucleotide LC/MS/MS assay in macaque plasma samples
3.4 recovery
Respectively preparing low, medium and high QC samples with concentrations of 0.39, 3.13 and 5 parts of each solution with concentration of 25 mu g/mL in macaque plasma according to a method under the item of 'standard curve and quality control sample preparation', carrying out LC/MS/MS sample injection for 50 mu L according to the item of 'treatment of plasma samples', and recording peak areas of midkine antisense oligonucleotide and internal standard. The extraction recovery rate was calculated from the ratio of the peak area of the plasma sample to the peak area of the standard sample with the same concentration of the blank plasma extract solution, and the results are shown in table 2. The recovery rate of midkine antisense oligonucleotide is between 74.76 and 75.28 percent, and the RSD is between 3.67 and 4.79 percent.
TABLE 2 midkine antisense oligonucleotide recovery
3.5 sample Freeze thaw stability
Respectively preparing QC samples with low, medium and high concentrations in macaque plasma according to a method under the item of 'standard curve and quality control sample preparation', wherein each concentration is 5 parts, freezing the QC samples in a refrigerator at the temperature of-70 ℃, taking out the QC samples, thawing the QC samples at room temperature, repeating the operation for 3 times, operating according to the item of 'processing of plasma samples', calculating the concentration of a midkine, and obtaining a stable sample in the process of 3 times of freezing and thawing. See table 3.
TABLE 3 stability test results for midkine antisense oligonucleotides
4 conclusion of the test
The study establishes and confirms the LC-MS/MS detection method of the midkine antisense oligonucleotide by taking the influenza tide antisense oligonucleotide as an internal standard, and the confirmation result of the method shows that endogenous substances in plasma do not interfere with the determination of the midkine antisense oligonucleotide and the internal standard. The lowest limit of quantitation of midkine antisense oligonucleotides in cynomolgus monkey plasma is 0.18. mu.g/mL, the linear range is 0.18-200. mu.g/mL. The intra-day accuracy and the precision variation coefficient are respectively 95.9-101 and 4.42-8.99, the inter-day accuracy and the precision variation coefficient are respectively 97.2-103 and 6.36-12.3, the recovery rate of the method is 74.76-75.28%, and the RSD is 3.67-4.79%.
The LC/MS/MS method established in the test can sensitively and effectively detect the content of the midkine antisense oligonucleotide in the macaque plasma, and the parameters of specificity, linear range, lower limit of quantification, accuracy, precision, recovery rate, sample freeze-thaw stability and the like all meet the detection requirements.
In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, various embodiments or examples and features of different embodiments or examples described in this specification can be combined and combined by one skilled in the art without contradiction.
Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.
Claims (8)
1. A method for detecting the content of midkine antisense oligonucleotide in the plasma of a macaque, which is characterized by comprising the following steps:
(1) taking macaque plasma to be detected containing midkine antisense oligonucleotide, adding influenza tide into the macaque plasma to serve as an internal standard solution, adding a proper amount of ammonia water solution and phenol/dichloromethane mixed solution, and then sequentially carrying out vortex and centrifugation to obtain a processed blood sample;
(2) taking the supernatant of the blood sample and performing LC/MS/MS analysis;
wherein, the LC/MS/MS analysis adopts the following chromatographic conditions:
a chromatographic column: waters
MS C18 chromatography column, 2.1mm × 50 mm;
mobile phase A: a mixed aqueous solution of hexafluoroisopropanol HFIP and triethylamine TEA;
mobile phase B: mixed methanol aqueous solution of hexafluoroisopropanol HFIP and triethylamine TEA;
flow rate: 200 mu L/min;
elution procedure:
0min 5% phase B, 3min 100% phase B, 7min 100% phase B, 7.5min 5% phase B, 12min 5% phase B;
the LC/MS/MS analysis uses the following mass spectrum conditions:
high-purity nitrogen is used as collision gas, gas curtain gas and ESI source negative ion scanning and MRM scanning modes;
the mass spectrum conditions are as follows: collision gas: 12; air curtain air: 10; the ion source 1: 40; the ion source 2: 70; ion ionization voltage: -4500; temperature: 200 of a carrier;
parameters of the test object
Middle antisense factor MRM: 695.8 → 304.2, internal standard MRM: 675.8 → 319.0, both DP: -85; EP: -11; CE: -45; CXP: -18;
(3) drawing a standard curve, and carrying out quantitative analysis on the content of the midkine antisense oligonucleotide in the macaque plasma to be detected according to a standard curve method;
the mobile phase A is a mixed aqueous solution of 200mM HFIP and 2.85mM TEA;
the mobile phase B is a methanol aqueous solution of 200mM HFIP and 2.85mM TEA, and the volume ratio of methanol to water in the methanol aqueous solution is 60: 40.
2. The method according to claim 1, wherein the concentration of influenza tide is 100 μ g/mL and the addition amount of influenza tide is 25% by volume of the macaque plasma to be tested.
3. The method according to claim 1, wherein the concentration of the ammonia water is 5%, and the amount of the ammonia water added is 2.5 volume of the macaque plasma to be tested.
4. The method according to claim 1, wherein the volume ratio of phenol to dichloromethane in the phenol/dichloromethane mixed solution is 1: 1, and the volume ratio of the added amount of the phenol/dichloromethane mixed solution to the macaque plasma to be detected is 1: 1.
5. The method of claim 1, wherein the vortex time is 10 min; the centrifugation was carried out at 15000rpm/min for 5 min.
6. The method of claim 1, wherein the linear range of the standard curve is 0.18-200 μ g/mL.
7. The method of claim 1, wherein the method has a minimum detection limit of 0.18 μ g/mL.
8. The method of any one of claims 1-7, wherein said midkine antisense oligonucleotide in the plasma of said cynomolgus monkey to be tested is obtained by injecting a nanopreparation of midkine antisense oligonucleotide into a cynomolgus monkey.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910432682.6A CN110346493B (en) | 2019-05-23 | 2019-05-23 | Method for detecting content of midkine antisense oligonucleotide in macaque plasma |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910432682.6A CN110346493B (en) | 2019-05-23 | 2019-05-23 | Method for detecting content of midkine antisense oligonucleotide in macaque plasma |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110346493A CN110346493A (en) | 2019-10-18 |
| CN110346493B true CN110346493B (en) | 2021-01-05 |
Family
ID=68174707
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910432682.6A Active CN110346493B (en) | 2019-05-23 | 2019-05-23 | Method for detecting content of midkine antisense oligonucleotide in macaque plasma |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110346493B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116539702B (en) * | 2023-04-25 | 2023-10-31 | 国科赛赋河北医药技术有限公司 | Method for detecting antisense oligonucleotide content in macaque plasma |
| CN117269402B (en) * | 2023-11-20 | 2024-02-23 | 中国医学科学院北京协和医院 | Liquid phase mass spectrum combination method for quantitatively detecting norcinnabar in human cerebrospinal fluid |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| SE0203521D0 (en) * | 2002-11-28 | 2002-11-28 | Amersham Biosciences Ab | Isolation of antisense oligonucleotides |
| CA2817002C (en) * | 2010-11-05 | 2019-01-15 | Miragen Therapeutics | Base modified oligonucleotides |
| CN102351932A (en) * | 2011-07-07 | 2012-02-15 | 中国人民解放军军事医学科学院放射与辐射医学研究所 | Structure, preparation method and purpose of anti-influenza virus oligonucleotide |
| CA2878945A1 (en) * | 2012-07-13 | 2014-01-16 | Wave Life Sciences Pte. Ltd. | Chiral control |
| GB201322692D0 (en) * | 2013-12-20 | 2014-02-05 | Philochem Ag | Production of encoded chemical libraries |
| CA2976427C (en) * | 2015-03-02 | 2021-08-03 | Axolabs Gmbh | Simultaneous detection of oligonucleotides, a kit and a use related thereto |
-
2019
- 2019-05-23 CN CN201910432682.6A patent/CN110346493B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN110346493A (en) | 2019-10-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Studzińska | Review on investigations of antisense oligonucleotides with the use of mass spectrometry | |
| Apffel et al. | Analysis of oligonucleotides by HPLC− electrospray ionization mass spectrometry | |
| Gong et al. | Comparing ion‐pairing reagents and sample dissolution solvents for ion‐pairing reversed‐phase liquid chromatography/electrospray ionization mass spectrometry analysis of oligonucleotides | |
| Gaston et al. | The identification and characterization of non-coding and coding RNAs and their modified nucleosides by mass spectrometry | |
| van Dongen et al. | Bioanalytical LC–MS of therapeutic oligonucleotides | |
| Kim et al. | Metabolite profiling of the antisense oligonucleotide eluforsen using liquid chromatography-mass spectrometry | |
| Kaczmarkiewicz et al. | Analysis of antisense oligonucleotides and their metabolites with the use of ion pair reversed-phase liquid chromatography coupled with mass spectrometry | |
| CN110346493B (en) | Method for detecting content of midkine antisense oligonucleotide in macaque plasma | |
| Santos et al. | Recent developments in the characterization of nucleic acids by liquid chromatography, capillary electrophoresis, ion mobility, and mass spectrometry (2010–2020) | |
| Guo et al. | Succinic acid enhanced quantitative determination of blood modified nucleosides in the development of diabetic nephropathy based on hydrophilic interaction liquid chromatography mass spectrometry | |
| Chen et al. | Determination of therapeutic oligonucleotides using capillary gel electrophoresis | |
| Thomas et al. | Detection of small interfering RNA (siRNA) by mass spectrometry procedures in doping controls | |
| Fekete et al. | Challenges and emerging trends in liquid chromatography-based analyses of mRNA pharmaceuticals | |
| Trefely et al. | Crosstalk between cellular metabolism and histone acetylation | |
| Liu et al. | Determination of five nucleosides by LC‐MS/MS and the application of the method to quantify N6‐methyladenosine level in liver messenger ribonucleic acid of an acetaminophen‐induced hepatotoxicity mouse model | |
| Takebayashi et al. | Application of ion mobility-mass spectrometry to microRNA analysis | |
| CN111505099A (en) | Diagnostic marker for NASH and application thereof | |
| Wei et al. | Development of an ion pairing reversed-phase liquid chromatography-mass spectrometry method for characterization of clustered regularly interspaced short palindromic repeats guide ribonucleic acid | |
| CN106970176B (en) | A kind of method of Paeoniflorin metabolite in measurement hepatomicrosome | |
| Kim et al. | In vitro metabolism of 2′‐ribose unmodified and modified phosphorothioate oligonucleotide therapeutics using liquid chromatography mass spectrometry | |
| Kohler et al. | Mass spectrometric detection of siRNA in plasma samples for doping control purposes | |
| Wei et al. | Analysis of therapeutic nucleic acids by capillary electrophoresis | |
| Murphy et al. | Development of an ion-pair reverse-phase liquid chromatographic/tandem mass spectrometry method for the determination of an 18-mer phosphorothioate oligonucleotide in mouse liver tissue | |
| Li et al. | A label-free mass spectrometry detection of microRNA by signal switching from high-molecular-weight polynucleotides to highly sensitive small molecules | |
| Lin-Sen et al. | Investigation of library input on aptamers selection efficiency using capillary electrophoresis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |