WO2012054919A2 - Control of pathogens and parasites - Google Patents
Control of pathogens and parasites Download PDFInfo
- Publication number
- WO2012054919A2 WO2012054919A2 PCT/US2011/057476 US2011057476W WO2012054919A2 WO 2012054919 A2 WO2012054919 A2 WO 2012054919A2 US 2011057476 W US2011057476 W US 2011057476W WO 2012054919 A2 WO2012054919 A2 WO 2012054919A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- microalgae
- expression
- rna
- sense
- target gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K20/00—Accessory food factors for animal feeding-stuffs
- A23K20/10—Organic substances
- A23K20/153—Nucleic acids; Hydrolysis products or derivatives thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8214—Plastid transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Definitions
- the present invention relates to the genetic control of parasites and pathogens via the expression of silencing RNA in transgenic plants, including microalgae.
- the invention exploits the ability of plants to express the silencing RNA in a form within chloroplasts that is efficiently taken up, after ingestion by various pathogens or parasites, invasive species, or a host, or vector of the pathogen or parasite, where it can act to suppress the expression of target genes within the pathogen, parasite or invasive species.
- Pathogens and parasites are widely dispersed in the environment and have a direct impact on human and animal health While chemical pesticides have generally been very effective in controlling the spread and damage caused by pathogens and parasites, these agents are not selective, are often harmful to other organisms, and in many cases persist in the environment and accumulate in the food chain. Accordingly there remains the need for environmentally friendly methods for controlling pathogens or parasites, and protecting host organisms from such pathogens and parasites.
- Bacillus thuringiensis ssp. israelensis (Bti) and Bacillus sphaericus (Bs) are the two species of Bacillus that are known to produce parasporal crystalline inclusion bodies that are toxic to mosquito larvae (Baumann, et al., (1991) Microbiol Rev 55:425-36) and are very popular biological control agents. Spore preparations of Bti and Bs are available as commercial formulations for mosquito control (Poopathi, S. and B. K. Tyagi (2006) Biotechnology and Molecular Biology Review 1 :51-65). However, application of these spores have some limitations, such as sedimentation of spores out of larval feeding zone (Karch, S., and J. F. Charles. (1987) Ann Inst Pasteur Microbiol 138:485-92) and inactivation of toxins by UV light.
- dsRNA duplex RNAs
- This strategy has several advantages including 1) it does not involve expression of foreign proteins, which can be an issue 2) the RNAi elements are very specific, inhibiting expression of gene(s) of interest and 3) only a small amount of dsRNA of target gene is required as a trigger to initiate production of RNAi elements like siRNAs by the evolutionarily conserved gene silencing machinery.
- Chlamydomonas rienhardtii was selected for mosquito control because 1) it can be genetically manipulated 2) being an alga it grows on stagnant water, which serve as breeding grounds for mosquitoes, 3) unicellular algae is the natural food for mosquito larvae 4) it can grow photosynthetically and 5) has low cost of production.
- chloroplast expression of silencing RNA in plants and microalgae appears to represent a novel approach for the delivery of RNA, and for the targeted control of gene expression in insects, as well as other parasites, pathogens and pests. Moreover the data suggests that the approach can be successfully applied to other pathogens or parasites that consume microalgae, or plants, or that infect host organisms such as fish and shrimp that feed on microalgae or plants.
- the present invention includes a method of delivering siRNA to a host organism, comprising the steps of i) providing a plant that comprises a silencing ribonucleic acid that is expressed in a chloroplast of the plant, and ii) feeding the plant to the host organism.
- the present invention includes a method of modulating the expression of a target gene in a host organism, comprising the steps of i) providing a plant that comprises a silencing ribonucleic acid that is expressed in a chloroplast of the plant, wherein the silencing RNA is specific for the target gene of the host organism; and ii) feeding the plant to the host organism.
- the present invention includes a method of protecting a host organism from a parasite or pathogen, comprising the steps of; i) providing a plant that comprises a silencing ribonucleic acid that is expressed in a chloroplast of the plant, wherein the silencing RNA is specific for a target gene of the parasite or pathogen; ii) feeding the plant to the host organism.
- the present invention includes a method for controlling pests that eat plants, comprising the steps of i) providing a plant that comprises a silencing ribonucleic acid that is expressed in a chloroplast of the plant, wherein the silencing RNA is specific for a target gene of the pest; and ii) providing the plant to the pest.
- the present invention includes a transgenic plant comprising a silencing ribonucleic acid, wherein the silencing RNA is expressed in a chloroplast of the plant, and wherein the silencing RNA is specific for either a target gene of an organism that can eat the transgenic plant, or a target gene of a pathogen or parasite of a second organism.
- the present invention includes a method for controlling insects, comprising; i) providing microalgae that comprise a silencing ribonucleic acid that functions after ingestion of the microalgae to inhibit the expression of a target gene of the insect, wherein the expression of the target gene is essential to the functioning, growth, development, infectivity or reproduction of the insect, wherein the silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of at least about 20 contiguous nucleotides in the target gene; and ii) introducing the microalgae into a habitat of the insect where the insect, or its larval form, ingests the microalgae.
- the present invention includes a method for inhibiting the expression of a target gene in an insect, comprising; i) providing microalgae that comprise a silencing ribonucleic acid that functions after ingestion of the microalgae to inhibit the expression of a target gene of the parasite or pathogen, wherein the expression of the target gene is essential for survival of the insect, wherein the silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of at least about 20 contiguous nucleotides in the target gene; and ii) feeding the microalgae to the insect, or its larval form.
- the present invention includes a method for controlling invasive species, comprising; i) providing microalgae that comprise a silencing ribonucleic acid that functions after ingestion of the microalgae to inhibit the expression of a target gene of the invasive species wherein the expression of the target gene is essential to the functioning, growth, development, infectivity or reproduction of the invasive species, wherein the silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of at least about 20 contiguous nucleotides in the target gene; and ii) introducing the microalgae into a habitat of the invasive species where the invasive species, or its larval form, ingests the microalgae.
- the present invention includes a method for inhibiting the expression of a target gene in an invasive species, comprising; i) providing microalgae that comprise a silencing ribonucleic acid that functions after ingestion of the microalgae to inhibit the expression of a target gene of the parasite or pathogen, wherein the expression of the target gene is essential for survival of the invasive species, wherein the silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of at least about 20 contiguous nucleotides in the target gene; and ii) feeding the microalgae to the invasive species, or its larval form.
- the present invention includes a method for protecting host organisms that feed on microalgae from infection by parasites and pathogens, comprising; i) providing microalgae that comprises a silencing ribonucleic acid that functions after ingestion of the microalgae by the host organism, or the parasite or pathogen, to inhibit the expression of a target gene of the parasite or pathogen, wherein the expression of the target gene is essential to the functioning, growth, development, infectivity or reproduction of the parasite or pathogen, wherein the silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of at least about 20 contiguous nucleotides in the target gene; and ii) feeding the microalgae to the host organism.
- the present invention includes a method for inhibiting the expression of a target gene in a pathogen or parasite afflicting a host organism comprising; i) providing microalgae that comprises a silencing ribonucleic acid that functions after ingestion of the microalgae by the host organism, or the parasite or pathogen, to inhibit the expression of the target gene of the parasite or pathogen, wherein the expression of the target gene is essential to functioning, growth, development, infectivity or reproduction of the parasite or pathogen, wherein the silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of at least about 20 contiguous nucleotides in the target gene; and ii) feeding the microalgae to the host organism.
- microalgae that comprises a sile
- the present invention includes a microalgae comprising a silencing ribonucleic acid that functions after ingestion of the microalgae by an insect, to inhibit the expression of a target gene of the insect vector; wherein the expression of the target gene is essential to the functioning, growth, development, infectivity or reproduction of the parasite or pathogen, wherein the silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of at least about 20 contiguous nucleotides in the target gene, and wherein the silencing RNA is expressed within the chloroplast of the microalgae.
- a microalgae comprising a silencing ribonucleic acid that functions after ingestion of the microalgae by an insect, to inhibit the expression of a target gene of the insect
- the present invention includes an isolated silencing ribonucleic acid that functions upon ingestion by an insect, to inhibit the expression of a target gene of the insect vector, wherein the silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and
- the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of at least about 20 contiguous nucleotides in the target gene.
- the present invention includes an isolated polynucleotide that functions when expressed in a microalgae to form a silencing ribonucleic acid which functions upon ingestion of the microalgae by an insect vector to inhibit the expression of a target gene of the insect vector, wherein the silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of at least about 20 contiguous nucleotides in the target gene.
- the present invention includes an isolated polynucleotide that functions when expressed in a host organism to form a silencing ribonucleic acid which functions upon ingestion of the silencing ribonucleic acid by a parasite or pathogen of the host organism, to inhibit the expression of a target gene of the parasite or pathogen, wherein the silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of at least about 20 contiguous nucleotides in the target gene.
- the present invention includes a feed additive for a host organism to protect the organism from one or more parasites or parasites, comprising a silencing ribonucleic acid that functions upon ingestion of the feed additive by the host organism, to inhibit the expression of a target gene of the parasite or pathogen, wherein the expression of the target gene is essential to the functioning, growth, development, infectivity or reproduction of the parasite or pathogen, wherein the silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of at least about 20 contiguous nucleotides in the target gene.
- the present invention includes a method for selectively controlling mosquitoes, comprising; i) providing microalgae that comprises a silencing ribonucleic acid that functions after ingestion of the microalgae by mosquito larvae to inhibit the expression of 3-hydroxykynurenine transaminase in the larvae, wherein the silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical of at least about 20 contiguous nucleotides of SEQ. ID. No 1 ; and ii) introducing the microalgae into a habitat of the mosquito larvae, where the mosquito larvae can ingest the microalgae.
- the present invention includes a method for preventing the spread of a pathogen or parasite transmitted by mosquitoes , comprising; i) providing microalgae that comprises a silencing ribonucleic acid that functions after ingestion of the microalgae by mosquito larvae to inhibit the expression of 3-hydroxykynurenine transaminase in the larvae, wherein the silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical of at least about 20 contiguous nucleotides of SEQ. ID. No 1 ; and ii) introducing the microalgae into a habitat of the mosquito larvae, where the mosquito larvae can ingest the microalgae.
- the present invention includes a method for making a silencing RNA that will be effective for controlling insects comprising;
- iii) transforming a plurality of microalgae host cells with the expression library, so as to form a population of transformed microalgae; wherein the transformed microalgae produces a sense RNA strand and an antisense RNA strand from the expression vector, and wherein the sense and antisense RNA strands form an RNA duplex; iv) identifying a cell or cells within the population of transformed microalgae which expresses a silencing RNA that is capable of controlling the functioning, growth, development, infectivity or reproduction of the insect vector;
- step iv) establishing one or more clonal populations of cells from the cell or cells identified in step iv).
- the present invention includes a method for making a silencing RNA that will be effective for protecting host organisms that feed on microalgae from infection by parasites and pathogens, comprising;
- step iv) establishing one or more clonal populations of cells from the cell or cells identified in step iv).
- the present invention includes a method for selecting a nucleotide sequence for use in a silencing RNA for use in expression in microalgae to control insect vectors that can transmit parasites and pathogens, comprising the steps of;
- the present invention includes a method for selecting a nucleotide sequence for use in a silencing RNA for use in protecting host organisms that feed on microalgae from infection by parasites and pathogens, comprising the steps of;
- the plant is a microalgae.
- the silencing RNA is expressed within the chloroplast.
- the plant is a microalgae selected from the group consisting of Chlamydomonas perigranulata, Chlamydomonas moewusii, Chlamydomonas reinhardtii and Chlamydomonas sp.
- the host organism is selected from the group consisting of Shrimps and prawns of the family Penaeidae, Carp of the Family Cyprinidae and Tilapia, from the tilapine cichlid tribe.
- the host organism is selected from the group consisting of Pacific white shrimp (Penaeus vannamei), Giant tiger prawn (Penaeus monodon), Western blue shrimp (P. stylirostris), Chinese white shrimp (P. chinensis), Kuruma shrimp (P. japonicus), Indian white shrimp (P. indicus) and Banana shrimp (P. merguiensis).
- the pathogen or parasite is selected from the group consisting of viruses including Taura Syndrome Virus (TSV), Infectious Hypodermal and Hematopoietic Necrosis Virus (IHHNV) , the nimavirus (WSSV), roni viruses (YHV, GAV, LOV), occluded enteric baculovirus (BP), occluded enteric baculovirus (MBV ), nonoccluded enteric baculovirus (BMN), enteric parvovirus (HPV), bacteria including a-proteobacteria (NHP) and protozoans including Microsporidians, Haplosporidians and Gregarines.
- TSV Taura Syndrome Virus
- IHHNV Infectious Hypodermal and Hematopoietic Necrosis Virus
- WSSV nimavirus
- roni viruses YHV, GAV, LOV
- BP occluded enteric baculovirus
- MN nonoccluded enteric bac
- the host organism is selected from the group consisting of grass carp ⁇ Ctenopharyngodon idella), common carp ⁇ Cyprinus carpio), silver carp ⁇ Hypophthalmichthys molitrix), largescale silver carp ⁇ Hypophthalmichthys harmandi), bighead carp ⁇ Hypophthalmichthys nobilis), black carp ⁇ Mylopharyngodon piceus), common goldfish ⁇ Carassius auratus) and crucian carp ⁇ Carassius carassius).
- the pathogen or parasite is selected from the group consisting of Ichthyophthirius multifilis (Ich:), Trichodina, Costia, Chilodonella, Argulus foliaceus, Lernaea cyprinacea, Ergasilus sieboldi, Dactylogyrus vastator and Piscicola geometra.
- the host organism is selected from the group consisting of Oreochromis spp. Sarotherodon spp and Tilapia spp.
- the pathogen or parasite is selected from the group consisting of streptococcus, aeromonas, trichodina, columnaris and Iridovirus.
- the pathogen or parasite is selected from the group consisting of Ciliates Dinoflagellates, Trematodes, Crustaceans Copepods and Hirudidae.
- the invasive species is selected from mussels of the family Mytilidae, and clams of the family Veneridae.
- the invasive species is a zebra mussel, Dreissena polymorpha.
- insect is selected from the group consisting of Anopheles sps, Culex, Mansonia, and Aedes aegypti .
- pathogen or parasite is selected from the group consisting of St.
- FIG. 1 shows schematic representations of three HKT inverted repeat constructs used to produce double stranded HKT specific silencing RNAs from Chlamydomonas nuclear genome.
- construct pCVAC150 expression of HKT inverted repeat construct is driven by Chlamydomonas actin promoter.
- construct pCVAC153 the HKT inverted repeat has Chlamydomonas actin intronl as the spacer and the expression of the HKT inverted repeat is driven by Chlamydomonas psaD promoter.
- Construct pCVAC145 has expression of HKT driven by Chlamydomonas psaD and Actin promoters from either ends resulting in bidirectional transcription of HKT.
- Figure 2 shows the results of PCR analysis of CC424/pCVAC150 clones to check integration of HKT inverted repeat construct in the nuclear genome of Chlamydomonas. Binding sites of the four primers used for PCR confirmation are shown in the schematic of pCVAC150.
- Figure 3 shows the results of PCR analysis of CC424/pCVAC153 clones to check integration of HKT inverted repeat construct in the nuclear genome of Chlamydomonas. Binding sites of the four primers used for PCR confirmation are shown in the schematic of pCVAC153.
- Figure 4 shows the results of PCR analysis of CC424/pCVAC145 clones to check integration of HKT construct in the nuclear genome of Chlamydomonas. Binding sites of the two primers used for PCR confirmation are shown in the schematic of pCVAC145. Wild type control (C), water control (-ve) and plasmid control (+ve).
- Figure 5 shows the results of PCR analysis of CC4147/pCVAC108 clones to check integration of HKT construct in the Chlamydomonas chloroplast genome. Binding sites of the primers used for PCR analysis are shown in the schematic of pCVAC108. The results of the PCR reaction confirm integration of HKT inverted repeat expression cassette. Wild type control (C), water control (-ve) and plasmid control (+ve).
- Figure 6 shows RT PCR results confirming the transcription of 3-HKT dsRNA in Chlamydomonas chloroplast transformants.
- Lane 1 100 bp ladder
- Lane 2 Parent strain CC4147 no RT, PCR with psbD primers
- Lane 3 CC4147/pCVAC108-13 no RT, PCR with psbD primers
- Lane 4 CC4147/pCVAC108-15 no RT, PCR with psbD primers
- Lane 5 Parent strain CC4147 cDNA, PCR with psbD primers
- Lane 6 CC4147/pCVAC108-13 cDNA, PCR with psbD primers
- Lane 7 CC4147/pCVAC108- 15 cDNA, PCR with psbD primers
- Lane 8 Parent strain CC4147 no RT, PCR with 3-HKT primers
- Lane 9 CC4147/pCVAC108-13 no RT, PCR with 3-HKT primers
- Figure 7 shows the different phenotypes exhibited by Anopheles stephensi larvae following feeding on transgenic algae producing 3HKT dsRNA.
- stephensi larvae were reared on algae plus l/3 rd yeast+ sera micron (l/3 rd amount of yeast+micron mixture fed to control larvae) in 12- well plates (transferred into 6- well plates on day 7). Mosquito death and molting were recorded daily through day 12.
- Figure 9 shows Anopheles stephensi larval mortality observed with CC424/pCVAC150 clones expressing 3-HKT dsRNAs.
- Figure 10 Shows Anopheles stephensi larval mortality observed with CC424/pCVAC145 clones expressing 3-HKT dsRNAs.
- stephensi larvae were reared on algae plus l/3rd yeast+ sera micron (l/3rd amount of yeast+micron mixture fed to control larvae) in 12- well plates
- Figure 11 shows Anopheles stephensi larval mortality observed with Chlamydomonas chloroplast transformants (CC4147/pCVAC108) expressing 3-HKT dsRNAs.
- Figure 12 shows Chloroplast transformants 108-13 and 108-15 were consistently found to be toxic to Anopheles stephensi larva.
- Figure 13 shows the results of Real time PCR analysis to check 3-HKT transcript levels among surviving/dead A. stephensi larvae and pupae reared on transgenic Chlamydomonas expressing 3-HKT.
- Figure 13A shows 3-HKT transcript levels observed among surviving larvae reared on clones 108-13 and 108-15.
- Figure 13B shows 3-HKT transcript levels observed among dead pupae from larvae reared on 108-13.
- Figure 13C shows 3 -HKT transcript levels observed among dead pupae from larvae reared on 108-13, 108-15 and 153-15 transgenic Chlamydomonas clones.
- cell As used herein, the terms "cell,” “cells,” “cell line,” “host cell,” and “host cells,” are used interchangeably and, encompass animal cells and include plant, invertebrate, non- mammalian vertebrate, insect, and mammalian cells. All such designations include cell populations and progeny. Thus, the terms “transformants” and “transfectants” include the primary subject cell and cell lines derived therefrom without regard for the number of transfers.
- the phrase "conservative amino acid substitution” or “conservative mutation” refers to the replacement of one amino acid by another amino acid with a common property.
- a functional way to define common properties between individual amino acids is to analyze the normalized frequencies of amino acid changes between corresponding proteins of homologous organisms (Schulz, G. E. and R. H. Schirmer, Principles of Protein Structure, Springer- Verlag). According to such analyses, groups of amino acids can be defined where amino acids within a group exchange preferentially with each other, and therefore resemble each other most in their impact on the overall protein structure (Schulz, G. E. and R. H. Schirmer, Principles of Protein Structure, Springer- Verlag).
- amino acid groups defined in this manner include: a "charged / polar group,” consisting of Glu, Asp, Asn, Gin, Lys, Arg and His; an "aromatic, or cyclic group,” consisting of Pro, Phe, Tyr and Trp; and an "aliphatic group” consisting of Gly, Ala, Val, Leu, lie, Met, Ser, Thr and Cys.
- subgroups can also be identified, for example, the group of charged / polar amino acids can be sub-divided into the sub-groups consisting of the "positively-charged sub-group,” consisting of Lys, Arg and His; the negatively-charged subgroup,” consisting of Glu and Asp, and the "polar sub-group” consisting of Asn and Gin.
- the aromatic or cyclic group can be sub-divided into the sub-groups consisting of the "nitrogen ring sub-group,” consisting of Pro, His and Trp; and the "phenyl sub-group” consisting of Phe and Tyr.
- the aliphatic group can be sub-divided into the sub-groups consisting of the "large aliphatic non-polar sub-group,” consisting of Val, Leu and He; the "aliphatic slightly-polar sub-group,” consisting of Met, Ser, Thr and Cys; and the "small- residue sub-group,” consisting of Gly and Ala.
- Examples of conservative mutations include substitutions of amino acids within the sub-groups above, for example, Lys for Arg and vice versa such that a positive charge can be maintained; Glu for Asp and vice versa such that a negative charge can be maintained; Ser for Thr such that a free -OH can be maintained; and Gin for Asn such that a free -N3 ⁇ 4 can be maintained.
- control in the context of controlling insects, pests, or invasive species, or other organisms, refers to any or all of the following; i) the inhibition of the organism's ability to function; ii) a reduction in the viability of the organism; iii) a reduction in the reproduction rate of the organism; iv) the reduction in the infectivity of the organism; v) the inhibition of the normal development rate of the organism; or vi) a reduction in the growth rate of the organism.
- the term “inhibit” or the related terms “inhibition,” “reduce” or “reduced” refers to a statistically significant decrease.
- the terms generally refer to at least a 10% decrease in a given parameter, and can encompass at least a 20% decrease, 30% decrease, 40% decrease, 50% decrease, 60% decrease, 70% decrease, 80% decrease, 90% decrease, 95% decrease, 97% decrease, 99% or even a 100% decrease (i.e., the measured parameter is at zero).
- epitope tag refers to any antigenic determinant, or any biological structure or sequence which is fused to the coding region of a protein of interest to enable the detection or purification of the protein of interest. Such fusion proteins can be identified and purified for example by using epitope tag specific antibodies.
- epitope tags include without limitation His tag (6-Histidine), HA tag (Hemagglutinin), V5- tag, c-Myc tag, GST tag, and DYKDDDDK.
- the term "expression" as used herein refers to transcription and/or translation of a nucleotide sequence within a host cell.
- the level of expression of a desired product in a host cell may be determined on the basis of either the amount of corresponding mRNA that is present in the cell, or the amount of the desired polypeptide encoded by the selected sequence.
- mRNA transcribed from a selected sequence can be quantified by Northern blot hybridization, ribonuclease RNA protection, in situ hybridization to cellular RNA or by PCR.
- Proteins encoded by a selected sequence can be quantified by various methods including, but not limited to, e.g., ELISA, Western blotting, radioimmunoassays, immunoprecipitation, assaying for the biological activity of the protein, or by immunostaining of the protein followed by FACS analysis.
- the term “sense” RNA refers to an RNA transcript corresponding to a sequence or segment that, when produced by the target gene, is in the form of an mRNA that is capable of being translated into protein by the target cell.
- the term “antisense RNA” refers to an RNA transcript that is complementary to all or a part of an mRNA that is normally produced in a cell of a target organism. The complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e., at the 5' non-coding sequence, 3' non- translated sequence, introns, or the coding sequence.
- “Expression control sequences” are DNA regulatory sequences, such as promoters, enhancers, polyadenylation signals, terminators, internal ribosome entry sites (IRES) and the like, that provide for the expression of a coding sequence in a host cell. Exemplary expression control sequences are described in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990).
- heterologous DNA refers to DNA which has been introduced into a cell, or a nucleic acid molecule, that is derived from another source, or which is from the same source but is located in a different (i.e. non native) context.
- the term "homology” describes a mathematically based comparison of sequence similarities which is used to identify genes or proteins with similar functions or motifs.
- Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402.
- the default parameters of the respective programs e.g., XBLAST and BLAST
- homologous refers to the relationship between two proteins that possess a "common evolutionary origin", including proteins from superfamilies (e.g., the immunoglobulin superfamily) in the same species of animal, as well as homologous proteins from different species of animal (for example, myosin light chain polypeptide, etc.; see Reeck et al., Cell, 50:667, 1987).
- proteins and their encoding nucleic acids
- sequence homology as reflected by their sequence similarity, whether in terms of percent identity or by the presence of specific residues or motifs and conserved positions.
- “enhanced” refers to a statistically significant increase.
- the terms generally refer to at least a 10% increase in a given parameter, and can encompass at least a 20% increase, 30% increase, 40% increase, 50% increase, 60% increase, 70% increase, 80% increase, 90% increase, 95% increase, 97% increase, 99% or even a 100% increase over the control value.
- isolated when used to describe a protein or nucleic acid, means that the material has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that would typically interfere with research, diagnostic or therapeutic uses for the protein or nucleic acid, and may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes.
- the protein or nucleic acid will be purified to at least 95% homogeneity as assessed by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or, preferably, silver stain.
- Isolated protein includes protein in situ within recombinant cells, since at least one component of the protein of interest's natural environment will not be present. Ordinarily, however, isolated proteins and nucleic acids will be prepared by at least one purification step.
- identity means the percentage of identical nucleotide or amino acid residues at corresponding positions in two or more sequences when the sequences are aligned to maximize sequence matching, i.e., taking into account gaps and insertions. Identity can be readily calculated by known methods, including but not limited to those described in (Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H.
- Optimal alignment of sequences for comparison can be conducted, for example, by the local homology algorithm described in Smith & Waterman 1981, by the homology alignment algorithm described in Needleman & Wunsch 1970, by the search for similarity method described in Pearson & Lipman 1988, by computerized implementations of these algorithms (GAP, BESTFIT, PASTA, and TFASTA in the GCG Wisconsin Package, available from Accelrys, Inc., San Diego, California, United States of America), or by visual inspection. See generally, (Altschul, S. F. et al., J. Molec. Biol. 215: 403-410 (1990) and Altschul et al. Nuc. Acids Res. 25: 3389-3402 (1997)).
- One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in (Altschul, S., et al., NCBI NLM NIH Bethesda, Md. 20894; & Altschul, S., et al., J. Mol. Biol. 215: 403- 410 (1990).
- Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information.
- This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold.
- HSPs high scoring sequence pairs
- Extension of the word hits in each direction are halted when the - 27 cumulative alignment score falls off by the quantity X from its maximum achieved value, the cumulative score goes to zero or below due to the accumulation of one or more negative- scoring residue alignments, or the end of either sequence is reached.
- the BLAST algorithm parameters W. T. and X determine the sensitivity and speed of the alignment.
- the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix.
- the BLAST algorithm In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences.
- One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
- P(N) the smallest sum probability
- a test nucleic acid sequence is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid sequence to the reference nucleic acid sequence is in one embodiment less than about 0.1, in another embodiment less than about 0.01, and in still another embodiment less than about 0.001.
- a nucleic acid molecule according to the invention includes one or more DNA elements capable of opening chromatin and/or maintaining chromatin in an open state operably linked to a nucleotide sequence encoding a recombinant protein.
- a nucleic acid molecule may additionally include one or more nucleotide sequences chosen from: (a) a nucleotide sequence capable of increasing translation; (b) a nucleotide sequence capable of increasing secretion of the recombinant protein outside a cell; and (c) a nucleotide sequence capable of increasing the mRNA stability, where such nucleotide sequences are operatively linked to a nucleotide sequence encoding a recombinant protein.
- the nucleotide sequences that are operably linked are contiguous and, where necessary, in reading frame.
- an operably linked DNA element capable of opening chromatin and/or maintaining chromatin in an open state is generally located upstream of a nucleotide sequence encoding a recombinant protein; it is not necessarily contiguous with it.
- Operable linking of various nucleotide sequences is accomplished by recombinant methods well known in the art, e.g. using PCR methodology, by ligation at suitable restrictions sites or by annealing. Synthetic oligonucleotide linkers or adaptors can be used in accord with conventional practice if suitable restriction sites are not present.
- nucleotide refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. These terms include a single-, double- or triple- stranded DNA, genomic DNA, cDNA, RNA, DNA-RNA hybrid, or a polymer comprising purine and pyrimidine bases, or other natural, chemically, biochemically modified, non- natural or derivatized nucleotide bases.
- the backbone of the polynucleotide can comprise sugars and phosphate groups (as may typically be found in RNA or DNA), or modified or substituted sugar or phosphate groups.
- a double- stranded polynucleotide can be obtained from the single stranded polynucleotide product of chemical synthesis either by synthesizing the complementary strand and annealing the strands under appropriate conditions, or by synthesizing the complementary strand de novo using a DNA polymerase with an appropriate primer.
- a nucleic acid molecule can take many different forms, e.g., a gene or gene fragment, one or more exons, one or more introns, mRNA, tRNA, rRNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers.
- a polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl, other sugars and linking groups such as fluororibose and thioate, and nucleotide branches.
- a polynucleotide includes not only naturally occurring bases such as A, T, U, C, and G, but also includes any of their analogs or modified forms of these bases, such as methylated nucleotides, inter nucleotide modifications such as uncharged linkages and thioates, use of sugar analogs, and modified and/or alternative backbone structures, such as poly amides.
- a "promoter” is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence.
- the promoter sequence is bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background.
- a transcription initiation site (conveniently defined by mapping with nuclease SI) can be found within a promoter sequence, as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
- Prokaryotic promoters contain Shine-Dalgarno sequences in addition to the -10 and -35 consensus sequences.
- promoters including constitutive, inducible and repressible promoters, from a variety of different sources are well known in the art.
- Representative sources include for example, viral, mammalian, insect, plant, yeast, and bacterial cell types, and suitable promoters from these sources are readily available, or can be made synthetically, based on sequences publicly available on line or, for example, from depositories such as the ATCC as well as other commercial or individual sources.
- Promoters can be unidirectional (i.e., initiate transcription in one direction) or bi-directional (i.e., initiate transcription in either a 3' or 5' direction).
- Non-limiting examples of promoters active in plants include, for example nopaline synthase (nos) promoter and octopine synthase (ocs) promoters carried on tumor-inducing plasmids of Agrobacterium tumefaciens and the caulimovirus promoters such as the Cauliflower Mosaic Virus (CaMV) 19S or 35S promoter (U.S. Pat. No. 5,352,605), CaMV 35S promoter with a duplicated enhancer (U.S. Pat. Nos.
- CaMV Cauliflower Mosaic Virus
- purified refers to material that has been isolated under conditions that reduce or eliminate the presence of unrelated materials, i.e., contaminants, including native materials from which the material is obtained.
- a purified protein is preferably substantially free of other proteins or nucleic acids with which it is associated in a cell. Methods for purification are well-known in the art.
- substantially free is used operationally, in the context of analytical testing of the material.
- purified material substantially free of contaminants is at least 50% pure; more preferably, at least 75% pure, and more preferably still at least 95% pure.
- Purity can be evaluated by chromatography, gel electrophoresis, immunoassay, composition analysis, biological assay, and other methods known in the art.
- the term "substantially pure” indicates the highest degree of purity, which can be achieved using conventional purification techniques known in the art.
- ribonucleic acid or "RNA” refers to a molecule comprising at least one ribonucleotide residue.
- ribonucleotide is meant a nucleotide with a hydroxyl group at the 2' position of a f-D-ribofuranose moiety.
- RNA encompass double stranded RNA, single stranded RNA, RNAs with both double stranded and single stranded regions, isolated RNA such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, as well as altered RNA, or analog RNA, that differs from naturally occurring RNA by the addition, deletion, substitution, and/or alteration of one or more nucleotides.
- Such alterations can include addition of non-nucleotide material, such as to the end(s) of the RNA or internally, for example at one or more nucleotides of the RNA.
- Nucleotides in the RNA molecules of the presently disclosed subject matter can also comprise non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleo tides. These altered RNAs can be referred to as analogs or analogs of a naturally occurring RNA.
- RNA transcript refers to the product resulting from RNA polymerase- catalyzed transcription of a DNA sequence.
- the primary transcript When the RNA transcript is a perfect complementary copy of the DNA sequence, it is referred to as the primary transcript or it may be an RNA sequence derived from post transcriptional processing of the primary transcript and is referred to as the mature RNA.
- double stranded RNA refers to an RNA molecule at least a part of which is in Watson-Crick base pairing forming a duplex.
- dsRNA double stranded RNA
- the term is to be understood to encompass an RNA molecule that is either fully or only partially double stranded.
- Exemplary double stranded RNAs include, but are not limited to molecules comprising at least two distinct RNA strands that are either partially or fully duplexed by intermolecular hybridization.
- the term is intended to include a single RNA molecule that by intramolecular hybridization can form a double stranded region (for example, a hairpin).
- the phrases “intermolecular hybridization” and “intramolecular hybridization” refer to double stranded molecules for which the nucleotides involved in the duplex formation are present on different molecules or the same molecule, 1 5 respectively.
- sequence similarity refers to the degree of identity or correspondence between nucleic acid or amino acid sequences that may or may not share a common evolutionary origin (see Reeck et al., supra).
- sequence similarity when modified with an adverb such as “highly”, may refer to sequence similarity and may or may not relate to a common evolutionary origin.
- two nucleic acid sequences are "substantially homologous" or “substantially similar” when at least about 85%, and more preferably at least about 90% or at least about 95% of the nucleotides match over a defined length of the nucleic acid sequences, as determined by a sequence comparison algorithm known such as BLAST, FASTA, DNA Strider, CLUSTAL, etc.
- BLAST Altschul et al.
- FASTA DNA Strider
- CLUSTAL etc.
- An example of such a sequence is an allelic or species variant of the specific genes of the present invention.
- Sequences that are substantially homologous may also be identified by hybridization, e.g., in a Southern hybridization experiment under, e.g., stringent conditions as defined for that particular system.
- the term "specific” is applicable to a situation in which one member of a specific binding pair will not show any significant binding to molecules other than its specific binding partner(s).
- the term is applicable to the situation where two complementary polynucleotide strands can anneal together, yet each single stranded polynucleotide exhibits little or no binding to other polynucleotide sequences under stringent hybridization conditions.
- two amino acid sequences are "substantially homologous” or “substantially similar” when greater than 90% of the amino acid residues are identical.
- Two sequences are functionally identical when greater than about 95% of the amino acid residues are similar.
- the similar or homologous polypeptide sequences are identified by alignment using, for example, the GCG (Genetics Computer Group, Version 7, Madison, Wis.) pileup program, or using any of the programs and algorithms described above.
- transformation refers to the transfer of one or more nucleic acid molecules into a host cell or organism.
- Methods of introducing nucleic acid molecules into host cells include, for instance, calcium phosphate transfection, DEAE- dextran mediated transfection, microinjection, cationic lipid-mediated transfection, electroporation, scrape loading, ballistic introduction or infection with viruses or other infectious agents.
- Transformed in the context of a cell, refers to a host cell or organism into which a recombinant or heterologous nucleic acid molecule (e.g., one or more DNA constructs or RNA, or siRNA counterparts) has been introduced.
- the nucleic acid molecule can be stably expressed (i.e. maintained in a functional form in the cell for longer than about three months) or non-stably maintained in a functional form in the cell for less than three months i.e. is transiently expressed.
- “transformed,” “transformant,” and “transgenic” cells have been through the transformation process and contain foreign nucleic acid.
- the term “untransformed” refers to cells that have not been through the transformation process.
- the present invention includes methods for the use of plants and microalgae for controlling parasites and pathogens.
- the present invention includes the following methods:
- a method of delivering siRNA to a host organism comprising the steps of i) providing a plant that comprises a silencing ribonucleic acid that is expressed in a chloroplast of the plant, and ii) feeding the plant to the host organism.
- a method of modulating the expression of a target gene in a host organism comprising the steps of i) providing a plant that comprises a silencing ribonucleic acid that is expressed in a chloroplast of the plant, wherein the silencing RNA is specific for the target gene of the host organism; and ii) feeding the plant to the host organism.
- a method of protecting a host organism from a parasite or pathogen comprising the steps of; i) providing a plant that comprises a silencing ribonucleic acid that is expressed in a chloroplast of the plant, wherein the silencing RNA is specific for a target gene of the parasite or pathogen; ii) feeding the plant to the host organism.
- a method for controlling pests that eat plants comprising the steps of i) providing a plant that comprises a silencing ribonucleic acid that is expressed in a chloroplast of the plant, wherein the silencing RNA is specific for a target gene of the pest; and ii) providing the plant to the pest.
- a method for controlling insects comprising; i) providing microalgae that comprise a silencing ribonucleic acid that functions after ingestion of the microalgae to inhibit the expression of a target gene of the insect, wherein the expression of the target gene is essential to the functioning, growth, development, infectivity or reproduction of the insect, wherein the silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of at least about 20 contiguous nucleotides in the target gene; and ii) introducing the microalgae into a habitat of the insect where the insect, or its larval form, ingests the microalgae.
- a method for inhibiting the expression of a target gene in an insect comprising; i) providing microalgae that comprise a silencing ribonucleic acid that functions after ingestion of the microalgae to inhibit the expression of a target gene of the parasite or pathogen, wherein the expression of the target gene is essential to the of the insect, wherein the silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of at least about 20 contiguous nucleotides in the target gene; and ii) feeding the microalgae to the insect, or its larval form.
- a method for protecting host organisms that feed on microalgae from infection by parasites and pathogens comprising; i) providing microalgae that comprises a silencing ribonucleic acid that functions after ingestion of the microalgae by the host organism, or the parasite or pathogen, to inhibit the expression of a target gene of the parasite or pathogen, wherein the expression of the target gene is essential to the functioning, growth, development, infectivity or reproduction of the parasite or pathogen, wherein the silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of at least about 20 contiguous nucleotides in the target gene; and ii) feeding the microalgae to the host organism.
- a method for inhibiting the expression of a target gene in a pathogen or parasite afflicting a host organism comprising; i) providing microalgae that comprises a silencing ribonucleic acid that functions after ingestion of the microalgae by the host organism, or the parasite or pathogen, to inhibit the expression of the target gene of the parasite or pathogen, wherein the expression of the target gene is essential to functioning, growth, development, infectivity or reproduction of the parasite or pathogen, wherein the silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of at least about 20 contiguous nucleotides in the target gene; and ii) feeding the microalgae to the host organism.
- a method for controlling invasive species comprising; i) providing microalgae that comprise a silencing ribonucleic acid that functions after ingestion of the microalgae to inhibit the expression of a target gene of the invasive species wherein the expression of the target gene is essential to the functioning, growth, development, infectivity or reproduction of the invasive species, wherein the silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of at least about 20 contiguous nucleotides in the target gene; and ii) introducing the microalgae into a habitat of the invasive species where the invasive species, or its larval form, ingests the microalgae.
- a method for inhibiting the expression of a target gene in an invasive species comprising; i) providing microalgae that comprise a silencing ribonucleic acid that functions after ingestion of the microalgae to inhibit the expression of a target gene of the parasite or pathogen, wherein the expression of the target gene is essential for survival of the invasive species, wherein the silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of at least about 20 contiguous nucleotides in the target gene; and ii) feeding the microalgae to the invasive species, or its larval form.
- RNA interference RNA interference
- PTGS post transcriptional gene silencing
- the present invention involves the use of plants including microalgae, expressing silencing ribonucleic acids to inhibit gene expression in a parasite or pathogen that ingests the plants.
- the silencing RNA is expressed in the chloroplast of the plant.
- RNA or "silencing ribonucleic acid” refers to any RNA molecule which upon introduction into a host cell, preferably in a pathogen or parasite, is capable of mediating RNA interference (RNAi) or post-transcriptional gene silencing to reduce the expression of a target gene in the pathogen or parasite, either directly or after cellular processing.
- RNAi RNA interference
- post-transcriptional gene silencing to reduce the expression of a target gene in the pathogen or parasite, either directly or after cellular processing.
- Such silencing RNA includes for example RNAi (inhibitory RNA), dsRNA
- silencing may e.g. be so-called "antisense RNA", whereby the RNA molecule comprises a sequence of at least about 20 consecutive nucleotides having at least 95% sequence identity to the complement of the sequence of the target nucleic acid, preferably the coding sequence of the target gene.
- antisense RNA may also be directed to regulatory sequences of target genes, including the promoter sequences and transcription termination and polyadenylation signals.
- Silencing RNA further includes so-called “sense RNA” whereby the RNA molecule comprises a sequence of at least about 20 consecutive nucleotides having at least 95% sequence identity to the sequence of the target nucleic acid.
- silencing RNA includes dsRNA comprising RNA capable of forming a double stranded RNA by base pairing between the antisense and sense RNA nucleotide sequences respectively complementary and homologous to the target sequences.
- dsRNA double stranded RNA
- hpRNA hairpin RNA
- DICER catalyzes the degradation of dsRNA into short stretches of dsRNA referred to as small interfering RNAs siRNA; (Hannon & Rossi, (2004) Nature 431 371-378).
- the small interfering RNAs that result from DICER- mediated degradation are typically about 21-23 nucleotides in length and contain about 19 base pair duplexes.
- the siRNA is incorporated into an endonuclease complex referred to as an RNA- induced silencing complex (RISC).
- RISC RNA- induced silencing complex
- the RISC is capable of mediating cleavage of single stranded RNA present within the cell that is complementary to the antisense strand of the siRNA duplex and mediating translational repression, or induce chromatin modification.
- the silencing RNA comprises a ribonucleotide having one or more loop structures and a stem comprising self complementary sense and antisense regions, wherein the antisense region comprises a sequence complementary to a region of a target nucleic acid molecule, and wherein the polynucleotide can be processed either in vivo or in vitro to generate an active siRNA capable of mediating RNAi.
- the silencing RNA can be processed in situ within the cells of a host organism, after ingestion of the plant or microalgae expressing the silencing RNA, to create siRNA molecules capable of inhibiting the expression of a target gene of a pathogen or parasite of the host organism.
- This enzymatic process may be accomplished by utilizing either the host cells, or pathogen's, or parasite's, endogenous DICER enzyme and / or RNAse III cellular machinery.
- the silencing RNA can be processed in situ within the cells of a pathogen or parasite, after ingestion of the plant or microalgae expressing the silencing RNA, to create siRNA molecules capable of inhibiting the expression of a target gene of the pathogen or parasite.
- This enzymatic process may be accomplished by utilizing the pathogen's, or parasite's endogenous DICER enzyme and / or RNAse III cellular machinery.
- the sequence complementary to a region of a target nucleic acid molecule may comprise a sequence of nucleotides of at least about 20-100 nucleotides in length, or alternatively at least about 100-200 nucleotides in length, at least 200-400 about nucleotides in length, or at least about 400-500 nucleotides in length, or at least about 500 -1000 bases, depending upon the length of the gene.
- a sequence of about 200 to 600 nucleotides may be used.
- the sequence complementary to a region of a target nucleic acid molecule is identical to a portion of the target gene. In another aspect, the sequence complementary to a region of a target nucleic acid molecule shares at least 80 percent sequence identity with a portion of the target gene. In another aspect, the sequence complementary to a region of a target nucleic acid molecule shares at least 85 percent sequence identity with a portion of the target gene. In another aspect, the sequence complementary to a region of a target nucleic acid molecule shares at least 90 percent sequence identity with a portion of the target gene. In another aspect, the sequence complementary to a region of a target nucleic acid molecule shares at least 95 percent sequence identity with a portion of the target gene. Thus in any of these inventions, the silencing RNA may not need be completely identical to the target gene, and need not be full length relative to the target gene mRNA.
- the silencing RNA of the present invention may comprise an inverted repeat separated by a "spacer sequence".
- the spacer sequence may be a region comprising any sequence of nucleotides that facilitates secondary structure formation between each repeat, where this is required.
- the spacer sequence is part of the sense or antisense coding sequence for mRNA.
- the spacer sequence may alternatively comprise any combination of nucleotides or homologues thereof that are capable of being linked covalently to a nucleic acid molecule.
- the spacer sequence may comprise a sequence of nucleotides of at least about 10-100 nucleotides in length, or alternatively at least about I 100-200 nucleotides in length, at least 200-400 about nucleotides in length, or at least about 400-500 nucleotides in length.
- the spacer may comprise an intron.
- the silencing RNA may be synthesized either in vivo or in vitro.
- the silencing RNA may be formed by a single self-complementary RNA strand or from two complementary RNA strands. Endogenous RNA polymerase of the cell may mediate transcription in vivo, or cloned RNA polymerase can be used for transcription in vivo or in vitro.
- the RNA strands may or may not be polyadenylated; the RNA strands may or may not be capable of being translated into a polypeptide by a cell's translational apparatus.
- RNA, dsRNA, siRNA, or miRNA of the present invention may also be produced chemically or enzymatically by one skilled in the art through manual or automated reactions or in vivo in another organism.
- RNA may also be produced by partial or total organic synthesis; any modified ribonucleotide can be introduced by in vitro enzymatic or organic synthesis.
- the RNA may be synthesized by a cellular RNA polymerase or a bacteriophage RNA polymerase (e.g., T3, T7, SP6).
- the use and production of an expression construct are known in the art (see, for example, WO 97/32016; U.S. Pat. No's. 5,593, 874, 5,698,425, 5,712,135, 5, 789,214, and 5,804,693).
- the RNA may be purified prior to introduction into the cell.
- RNA can be purified from a mixture by extraction with a solvent or resin, precipitation, electrophoresis, chromatography, or a combination thereof.
- the RNA may be used with no or a minimum of purification to avoid losses due to sample processing.
- the RNA may be dried for storage or dissolved in an aqueous solution.
- the solution may contain buffers or salts to promote annealing, and/or stabilization of the duplex strands.
- the silencing RNA may be modified to improve the stability or activity of the siRNA molecule via modifications of the sugar phosphate backbone or the substitution of the nucleoside with at least one nitrogen or sulfur heteroatom.
- modifications of the sugar phosphate backbone or the substitution of the nucleoside with at least one nitrogen or sulfur heteroatom See PCTs WO00/44914 and WO01/68836), or via the use of 2'-amino or 2'-0- methyl nucleotides, and nucleotides containing a 2'-0 or 4'-C methylene bridge (Canadian Patent Application No. 2,359,180).
- the silencing RNA is produced by transcription from a transgene in vivo or an expression construct, as more fully described below.
- Target genes for use in the present invention may include, for example, those that play important roles in the viability, growth, development, reproduction and infectivity of the pathogen, parasite or pest. These target genes may be one of the house keeping genes, transcription factors and pathogen specific genes or known lethal knockout mutations in one or more model organisms of the pathogen, parasite or pest.
- Target genes may also be selected based on their turnover rate, where RNAi mediated inhibition of expression would be expected to result in a rapid decrease in protein levels. In other situations, it is advantageous to select a gene for which a small drop in expression level results in deleterious effects. If it is desired to target a broad range of species a gene is selected that is highly conserved across these species. Conversely, for the purpose of conferring specificity, in certain embodiments of the invention, a gene is selected that contains regions that are poorly conserved between individual species, or between the pathogen and other organisms. In certain embodiments it is desirable to select a gene that has no known homologs in other organisms.
- a gene is selected that is expressed in the insect gut.
- Targeting genes expressed in the gut avoids the requirement for the dsRNA to spread within the insect.
- a gene is selected that is essentially involved in the function, growth, development, and reproduction of an insect.
- Exemplary genes include but are not limited to a CHD3 gene, a 13- tubulin gene, and a 3- hydroxykynurenine transaminase gene.
- a DNA segment for use in the present invention is at least from about 19 to about 23, or about 23 to about 100 nucleotides, but less than about 2000 nucleotides, in length. Typically under these conditions, inhibition is specific to the target genes, and the expression of unrelated genes is not affected. This specificity allows the selective targeting of pest species, resulting in no effect on other organisms exposed to the compositions of the present invention.
- the invention is not limited to the specific genes described herein but encompasses any gene, the inhibition of which exerts a deleterious effect on pathogen, parasite or pest.
- pathogens, parasites or pests that are potential targets for control by the present invention, there may be limited information regarding the sequences of most genes or the phenotype resulting from mutation of particular genes. Therefore, the present inventors contemplate that selection of appropriate genes from pathogen, parasite or pest for use in the present invention may be accomplished through the use of a random, semi- random or rational library screening approaches to identify nucleotide sequences which have the ability to suppress the growth, development, infectivity or reproduction of a pathogen, parasite, or vector thereof.
- the present invention also includes libraries of polynucleotides and methods for screening such libraries in microalgae to identify nucleotide sequences which have the ability to selectively inhibit the expression of a target gene located with a pathogen or parasite, or a vector the pathogen or parasite.
- the current invention includes a method for making a silencing RNA that will be effective for controlling organism that consume microalgae comprising;
- step iv) establishing one or more clonal populations of cells from the cell or cells identified in step iv).
- the current invention includes a method for making a silencing RNA that will be effective for protecting host organisms that feed on plants and / or microalgae from infection by parasites and pathogens, comprising; i) synthesizing a library of polynucleotides encoding a plurality of one or more RNA species of interest;
- ii) operably linking the library of polynucleotides to 2 convergent promoters in an expression vector to create an expression library; iii) transforming a plurality of microalgae host cells with the expression library, so as to form a population of transformed microalgae; wherein the transformed microalgae produces a sense RNA strand and an antisense RNA strand from the expression vector, and wherein the sense and antisense RNA strands form an RNA duplex;
- step iv) establishing one or more clonal populations of cells from the cell or cells identified in step iv).
- Also included in the present invention is a method for selecting a nucleotide sequence for use in a silencing RNA for use in expression in microalgae and / or plants to control insects, comprising the steps of; i) transforming a microalgae host cell with an expression vector comprising the nucleotide sequence, wherein the transformed microalgae produces a sense RNA strand and an antisense RNA strand from the expression vector, and wherein the sense and antisense RNA strands form an RNA duplex;
- a method for selecting a nucleotide sequence for use in a silencing RNA for use in protecting host organisms that feed on microalgae and plants from infection by parasites and pathogens comprising the steps of; i) transforming a microalgae host cell with an expression vector comprising the nucleotide sequence, wherein the transformed microalgae produces a sense RNA strand and an antisense RNA strand from the expression vector, and wherein the sense and antisense RNA strands form an RNA duplex;
- plasmid libraries containing all, or a subset of all possible permutations of a silencing RNA may be created using two convergent promoters to drive expression of both strands of the RNA from a single randomized nucleotide sequence.
- Numerous methods for creating and designing random, semi-random, and rationally designed polynucleotide libraries are known in the art (See for exampleTheis & Buchholz F.( 2010)J Vis Exp. 12;(39). pii: 2008. doi: 10.3791/2008.PMID; Mei et al., (2007). Curr Opin Chem Biol.;l l(4):388-93; Krausz E. (2007) Mol Biosyst. 3(4):232-40; Lutzelberger and Kjems (2006) Handb Exp Pharmacol. (173):243-59; Chen et al., PNAS 102(7) 2356-2361.
- the expression vector is transformed into a population of microalgae to create a microalgae expression library to enable efficient screening.
- the expression vector is transformed into the chloroplast of the microalgae.
- silencing RNA molecules are expressed from transcription units inserted into nucleic acid vectors (alternatively referred to generally as “recombinant vectors” or “expression vectors”).
- the nucleotide sequences for use in producing RNA molecules may be operably linked to one or more promoter sequences functional in a plant.
- the nucleotide sequences are placed under the control of an endogenous promoter, normally resident in the host genome.
- the ribonucleic acid of the present invention, under the control of an operably linked promoter sequence may further be flanked by additional sequences that advantageously affect its transcription and/or the stability of a resulting transcript. Such sequences are generally located upstream of the operably linked promoter and or downstream of the 3' end of the expression construct.
- the nucleotide sequence encoding the silencing RNA may operatively linked to, and flanked by two promoters to provide bidirectional transcription of the nucleotide sequence.
- the nucleotide sequence encoding the silencing RNA may be present in the form of an inverted repeat each copy of which is operatively coupled to a different promoter.
- the two inverted repeats may be separated by a spacer.
- the spacer may comprise an intron.
- a vector is used to deliver a nucleic acid molecule encoding a silencing RNA into a plant cell to enable the expression of the ribonucleic acid in the plant cell.
- the expression vector can target expression of the silencing RNA to a specific organelle, such as a chloroplast or the whole cell.
- the expression vector targets expression of the silencing RNA to the chloroplast of the microalgae. In one aspect the expression vector integrates into the chloroplast genome of the microalgae. In another aspect the expression vector targets expression of the silencing RNA to the entire cell of the microalgae. In one aspect, the expression vector integrates into the nuclear genome of the microalgae.
- the recombinant vectors can be, for example, DNA plasmids or viral vectors.
- Various expression vectors are known in the art. The selection of the appropriate expression vector can be made on the basis of several factors including, but not limited to the cell type wherein expression is desired.
- Agrobacterium-based expression vectors can be used to express the nucleic acids of the presently disclosed subject matter when stable expression of the vector insert is sought in a plant cell.
- Promoters The expression of the nucleotide sequence in the expression cassette can be under the control of a constitutive promoter or an inducible promoter that initiates transcription only when the host cell is exposed to some particular external stimulus.
- Basal promoters in plants typically comprise canonical regions associated with the initiation of transcription, such as CAAT and TATA boxes.
- the TATA box element is usually located approximately 20 to 35 nucleotides upstream of the initiation site of transcription.
- the CAAT box element is usually located approximately 40 to 200 nucleotides upstream of the start site of transcription. The location of these basal promoter elements result in the synthesis of an RNA transcript comprising nucleotides upstream of the translational ATG start site.
- RNA upstream of the ATG is commonly referred to as a 5' untranslated region or 5' UTR. It is possible to use standard molecular biology techniques to make combinations of basal promoters, that is regions comprising sequences from the CAAT box to the translational start site, with other upstream promoter elements to enhance or otherwise alter promoter activity or specificity.
- the promoters may be altered to contain "enhancer DNA” to assist in elevating gene expression.
- certain DNA elements can be used to enhance the transcription of DNA. These enhancers often are found 5' to the start of transcription in a promoter that functions in eukaryotic cells, but can often be inserted upstream (5') or downstream (3') to the coding sequence.
- these 5' enhancer DNA elements are introns.
- the introns that are particularly useful as enhancer DNA are the 5' introns from the rice actin 1 gene (see U.S. Pat. No. 5,641,876), the rice actin 2 gene, the maize alcohol dehydrogenase gene, the maize heat shock protein 70 gene (U.S. Pat. No. 5,593,874), the maize shrunken 1 gene, the light sensitive 1 gene of Solanum tuberosum, and the heat shock protein 70 gene of Petunia hybrida (U.S. Pat. No. 5,659,122).
- exemplary constitutive promoters include those derived from the CaMV 35S, rice actin, and maize ubiquitin genes, each described herein below.
- Exemplary promoters for microalgae production include the actin promoter, psaD promoter (US2002/0104119; Fischer and Rochaix (2001) Mol. Gen. Genet. 265, 888-894), B-tubulin, CAB, and rbcs promoters
- Exemplary inducible promoters for this purpose include the chemically inducible PR- la promoter and a wound- inducible promoter, also described herein below.
- Selected promoters can direct expression in specific cell types (such as leaf epidermal cells, mesophyll cells, root cortex cells) or in specific tissues or organs (roots, leaves or flowers, for example).
- tissue specific promoters include well- characterized root-, pith-, and leaf-specific promoters, each described herein below.
- the promoter can direct expression in the chloroplast.
- exemplary chloroplast promoters for green algae include the atpB, psbA, psbD, rbcl, and psal promoters, and appropriate 5' and 3' flanking sequences from microalgae.
- Other chloroplast expression systems for microalgae and plants are described in Fletcher et al., (2007) "Optimization of recombinant protein expression in the chloroplasts of green algae”. Adv. Exp. Med. Biol. 616 90-98; and Verma & Daniell (2007) "Chloroplast vector systems for biotechnology applications" Plant Physiology 145 1129-1143.
- promoter selection can be based on expression profile and expression level.
- the following are representative non-limiting examples of promoters that can be used in the expression cassettes.
- the CaMV 35S promoter can be used to drive constitutive gene expression. Construction of the plasmid pCGN1761 is described in the published patent application EP 0 392 225, which a CaMV 35S promoter and the tml transcriptional terminator with a unique EcoRI site between the promoter and the terminator and has a pUC- type backbone.
- Actin Promoter Several isoforms of actin are known to be expressed in most cell types and consequently the actin promoter is a good choice for a constitutive promoter. In particular, the promoter from the rice Act/ gene has been cloned and characterized (McElroy et a/., 1990).
- a 1.3 kb fragment of the promoter was found to contain inter ali the regulatory elements required for expression in rice protoplasts.
- numerous expression vectors based on the Act/ promoter have been constructed specifically for use in monocotyledons (McElroy et al. (1990) Plant Cell 2: 163-171). These incorporate the Act/- intron 1, Adbl 5' flanking sequence and Adbl-intron 1 (from the maize alcohol dehydrogenase gene) and sequence from the CaMV 35S promoter. Vectors showing highest expression were fusions of 35S and Act/ intron or the Act/ 5' flanking sequence and the AcV intron. Optimization of sequences around the initiating ATG (of the GUS reporter gene) also enhanced expression.
- Ubiquitin Promoter Ubiquitin is another gene product known to accumulate in many cell types and its promoter has been cloned from several species for use in transgenic plants (Christensen et al. (1989) Plant Mol. Biol. 12:619-632 and Christensen et al. (1992) Plant Mol. Biol. 18:675-689); pEMU (Last et al. (1991) Theor. Appl. Genet. 81 :581-588); MAS (Velten et al. (1984) EMBO J. 3:2723-2730).
- the maize ubiquitin promoter has been developed in transgenic monocot systems and its sequence and vectors constructed for monocot transformation are disclosed in the patent publication EP 0 342 926 which is herein incorporated by reference.
- Taylor et al., 1993 describe a vector (pAHC25) that comprises the maize ubiquitin promoter and first intron and its high activity in cell suspensions of numerous monocotyledons when introduced via microprojectile bombardment.
- the ubiquitin promoter is suitable for gene expression in transgenic plants, especially monocotyledons.
- Suitable vectors are derivatives of pAHC25 or any of the transformation vectors described in this application, modified by the introduction of the appropriate ubiquitin promoter and/or intron sequences.
- constitutive promoters include, for example those disclosed in, U.S. Pat. Nos. 5,608,149; 5,608, 144; 5,604,121 ; 5,569,597; 5,466,785; 5,399,680; 5,268,463; and 5,608,142.
- Tissue specific expression include those described in Yamamoto et al. (1997) Plant J. 12(2):255-265; Kawamata et al. (1997) Plant Cell Physiol. 38(7):792-803; Hansen et al. (1997) Mol. Gen. Genet. 254(3):337-343; Russell et al. (1997) Transgenic Res. 6(2): 157-168; Rinehart et al. (1996) Plant Physiol. 112(3): 1331-1341 ; Van Camp et al. (1996) Plant Physiol. 112(2):525-535; Canevascini et al. (1996) Plant Physiol. 112(2):513-524; Yamamoto et al.
- Root specific promoters include, for example, those disclosed in Hire, et al (1992) Plant Mol.
- Seed-preferred promoters includes both seed-specific promoters (those promoters active during seed development) as well as seed-germinating promoters (those promoters active during seed germination). Such promoters include beta conglycinin, (Fujiwara & Beachy (1994) Plant. Mol. Biol.
- promoters include phaseolin, napin, ⁇ - conglycinin, soybean lectin, and the like.
- particular promoters include maize 15 Kd zein, 22 KD zein, 27 kD zein, waxy, shrunken 1, shrunken 2, globulin 1, etc.
- the DNA constructs, transgenic plants and methods use the oleosin promoter and / or napin promoter.
- a chemically induced promoter element can be used to replace, or in combination with any of the foregoing promoters to enable the chemically inducible expression throughout an organism, or within a specific tissue.
- a trans factor comprising the ecdysone receptor operatively coupled to a GAL4 DNA binding domain and VP 16 activation domain can be used to regulate the expression of a second gene that is operatively coupled to a minimal promoter and GAL4 (5X UAS sequences) in a ligand depend fashion.
- GAL4 5X UAS sequences
- EcR based gene switches include for example those disclosed in US Patent Nos. US 6723531, US 5514578, US 6245531, US 6504082, US 7151168, US 7205455, US 7238859, US 7456315, US 7563928, US 7091038, US 7531326, US 7776587, US 7807417, US 7601508, US 7829676, US 7919269, US 7563879, US 7297781, US 7312322, US 6379945,US 6610828, US 7183061 and US 7935510.
- Various chemical regulators can be employed to induce expression of the selected coding sequence in the plants transformed according to the presently disclosed subject matter, including the benzothiadiazole, isonicotinic acid, and salicylic acid compounds disclosed in U.S. Patent Nos. 5,523,311 and 5,614,395, herein incorporated by reference.
- Transcriptional Terminators A variety of transcriptional terminators are available for use in expression cassettes. These are responsible for the termination of transcription beyond the transgene and its correct polyadenylation.
- RNA polymerase III terminators are those that are known to function in the relevant microalgae or plant system.
- Representative plant transcriptional terminators include the CaMV 35S terminator, the tml terminator, the nopaline synthase terminator, and the pea rbcS E9 terminator.
- these terminators typically comprise a - 52 run of 5 or more consecutive thymidine residues.
- an RNA polymerase III terminator comprises the sequence TTTTTTT. These can be used in both monocotyledons and dicotyledons.
- endogenous 5' and 3' elements from the genes listed above i.e. appropriate 5' and 3' flanking sequences from the atpB, psbA, psbD, rbcl, actin, psaD, B- tubulin, CAB, rbcs and psal genes may be used.
- intron sequences have been shown to enhance expression, particularly in monocotyledonous cells.
- the introns of the maize Adbl gene have been found to significantly enhance the expression of the wild-type gene under its cognate promoter when introduced into maize cells.
- Intron 1 was found to be particularly effective and enhanced expression in fusion constructs with the chloramphenicol acetyltransferase gene (Callis et a/., 1987).
- the intron from the maize bronzes gene had a similar effect in enhancing expression.
- Intron sequences have been routinely incorporated into plant transformation vectors, typically within the non-translated leader.
- leader sequences derived from viruses are also known to enhance expression, and these are particularly effective in dicotyledonous cells.
- TMV Tobacco Mosaic Virus
- MCMV Maize Chlorotic Mottle Virus
- AY Alfalfa Mosaic Virus
- Agrobacterium Transformation Vectors Many vectors are available for transformation using Agrobacterium tumefaciens and may be used for plant transformation. Exemplary vectors for expression using Agrobacterium tumefacie ns- ediated plant transformation include for example, pBin 19 (CLONETECH), Frisch et al, Plant Mol. Biol., 27:405-409, 1995; pCAMBIA 1200 and pCAMBIA 1201 (Center for the Application of Molecular Biology to International Agriculture, Canberra, Australia); pGA482, An et al, EMBO J., 4:277-284, 1985; pCGN1547, (CALGENE Inc.) McBride et al, Plant Mol. Biol., 14:269-276, 1990, and the like vectors, such as is described herein.
- Transformation without the use of Agrobacterium tumefaciens circumvents the requirement for T- DNA sequences in the chosen transformation vector and consequently vectors lacking these sequences can be utilized in addition to vectors such as the ones described above which contain T-DNA sequences. Transformation techniques that do not rely on Agrobacterium include transformation via particle bombardment, protoplast uptake (e.g. PEG and electroporation), vortexing with glass beads, and microinjection.
- the choice of vector can depend on the technique chosen for the species being transformed. In particular particle bombardment methods and the use of glass beads are preferred for microalgae.
- Exemplary expression vectors for expression in protoplasts or plant tissues include pUC 18/19 or pUC 118/119 (GIBCO BRL, Inc., MD); pBluescript SK (+/-) and pBluescript KS (+/-) (STRATAGENE, La Jolla, Calif.); pT7Blue T-vector (NOVAGEN, Inc., WI); pGEM-3Z/4Z (PROMEGA Inc., Madison, Wis.), and the like vectors, such as is described herein
- Selectable Markers For certain target species, different antibiotic or herbicide selection markers can be preferred. Selection markers used routinely in transformation include the nptll gene, which confers resistance to kanamycin and related antibiotics (Messing & Vierra, 1982; Bevan et al., 1983), the bar gene, which confers resistance to the herbicide phosphinothricin (White et a/., 1990; Spencer et a/., 1990), the hph gene, which confers resistance to the antibiotic hygromycin (Blochlinger & Diggelmann, 1984), the dhfr gene, which confers resistance to methotrexate (Bourouis & Jarry, 1983), and the EPSP synthase gene, which confers resistance to glyphosate (U.S. Patent Nos. 4, 940,935 and 5,188,642). IV Plants
- the present invention can be practiced with any plant or microalgae.
- the microalgae used with the invention can include any naturally occurring species or any genetically engineered microalgae.
- the microalgae used with the invention include any commercially available strain, any strain native to a particular region, or any proprietary strain. Additionally, the microalgae can be of any Division, Class, Order, Family, Genus, or Species, or any subsection thereof. In one aspect microalgae which possess chloroplasts are preferred.
- the microalgae used with the methods of the invention are members of one of the following divisions: Chlorophyta, Cyanophyta (Cyanobacteria), and Heteromonyphyta.
- the microalgae used with the methods of the invention are members of one of the following classes: Chlorophyceae, Bacillariophyceae, Eustigmatophyceae, and Chrysophyceae.
- the microalgae used with the methods of the invention are members of one of the following genera: Chlamydomonas, Nannochloropsis, Chlorella, Dunaliella, Scenedesmus, Selenastrum, Oscillatoria, Phormidium, Spirulina, Amphora, and Ochromonas.
- Chlamydomonas Nannochloropsis, Chlorella, Dunaliella, Scenedesmus, Selenastrum, Oscillatoria, Phormidium, Spirulina, Amphora, and Ochromonas.
- microalgae of the genus Chlamydomonas is preferred.
- Non-limiting examples of microalgae species that can be used with the methods of the present invention include for example, Achnanthes orientalis, Agmenellum spp., Amphiprora hyaline, Amphora coffeiformis, Amphora coffeiformis var. linea, Amphora coffeiformis var. punctata, Amphora coffeiformis var. taylori, Amphora coffeiformis var. tenuis, Amphora americanissima, Amphora strigissima var.
- Chlorella kessleri Chlorella lobophora
- Chlorella luteoviridis Chlorella luteoviridis var. aureoviridis
- Chlorella luteoviridis var. lutescens Chlorella miniata, Chlorella minutissima, Chlorella mutabilis, Chlorella nocturna, Chlorella ovalis, Chlorella parva, Chlorella photophila, Chlorella pringsheimii, Chlorella protothecoides, Chlorella protothecoides var. acidicola, Chlorella regularis, Chlorella regularis var. minima, Chlorella regularis var.
- Dunaliella sp. Dunaliella bardawil, Dunaliella bioculata, Dunaliella granulate, Dunaliella maritime, Dunaliella minuta, Dunaliella parva, Dunaliella peircei, Dunaliella primolecta, Dunaliella salina, Dunaliella terricola, Dunaliella tertiolecta, Dunaliella viridis, Dunaliella tertiolecta, Eremosphaera viridis, Eremosphaera sp., Ellipsoidon sp., Euglena spp., Franceia sp., Fragilaria crotonensis, Fragilaria sp., Gleocapsa sp., Gloeothamnion sp., Haematococcus pluvialis, Hymenomonas sp., Isochrysis off.
- microalgae of the following species are preferred, Chlamydomas perigranulata, Chlamydomonas moewusii, Chlamydomonas reinhardtii and Chlamydomonas sp.
- pathogen refers to insects, arachnids, crustaceans, fungi, bacteria, viruses, protozoa, nematodes, flatworms, roundworms, pinworms, hookworms, tapeworms, trypanosomes, schistosomes, botflies, fleas, ticks, mites, and lice and the like that can afflict a host organism.
- invasive species refers to non-indigenous species, plants or animals that adversely affect the habitats and bioregions they invade economically, environmentally, and/or ecologically.
- the host organism may be an insect selected from the order Diptera, suborder Nematicera, Infraorder culicomorpha, superfamily culicoidea. In one aspect of the present invention, the host organism is selected from a group consisting of culicidae, Tipulidae and Chironomidae. In one aspect, the insect is within the family culicidae.
- the pathogen or parasite is an insect, which includes at least one life cycle form that feeds on microalgae.
- the present invention includes a method for controlling insects, comprising;
- microalgae that comprise a silencing ribonucleic acid that functions after ingestion of the microalgae to inhibit the expression of a target gene of the insect
- silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and
- the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of at least about 20 contiguous nucleotides in the target gene;
- the invention includes a method for inhibiting the expression of a target gene in an insect, comprising;
- microalgae that comprises a silencing ribonucleic acid that functions after ingestion of the microalgae to inhibit the expression of a target gene of the insect
- silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and
- the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of at least about 20 contiguous nucleotides in the target gene;
- a pathogen or parasite may be transmitted or incubated in a host organism, such as an insect vector which aids in the transmission and spread of the pathogen or parasite to a secondary host.
- a host organism such as an insect vector which aids in the transmission and spread of the pathogen or parasite to a secondary host.
- the pathogen or parasite is transmitted by an insect which includes at least one life cycle form that feeds on microalgae.
- malaria and other diseases including for example, Encephalitis, filariasis, Yellow Fever, Dengue Fever, Rift Valley fever (RVF) and West Nile virus infection, are spread by insect vectors, including mosquitoes (Anopheles sps), Culex, Mansonia, and Aedes aegypti.
- insect vectors including mosquitoes (Anopheles sps), Culex, Mansonia, and Aedes aegypti.
- the present invention also includes methods for suppressing the transmission of a pathogen or parasite by insect vectors comprising the steps of;
- microalgae that comprise a silencing ribonucleic acid that functions after ingestion of the microalgae to inhibit the expression of a target gene of the insect vector
- the silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of at least about 20 contiguous nucleotides in the target gene;
- microalgae introducing the microalgae into a habitat of the insect vector where the insect, or its larval form, ingests the microalgae.
- the insect is selected from Anopheles sps, Culex, Mansonia, and Aedes aegypti.
- the pathogen or parasite is selected from the group consisting of St. Louis encephalitis (SLE), western equine encephalitis (WEE), Venezuelan equine encephalitis (VEE), eastern equine encephalitis (EEE), La Crosse virus (LACV), Eastern equine encephalitis virus (EEEV), Venezuelan equine encephalitis virus (VEEV), Japanese encephalitis (JE) virus, yellow fever virus, Rift Valley fever (RVF) virus, West nile virus, dengue viruses (DENV 1 , DENV 2, DENV 3, or DENV 4), and Plasmodium falciparum, P. vivax, P. ovale, and P. malariae.
- SLE St. Louis encephalitis
- WEE western equine encephalitis
- VEE Venezuelan equine ence
- the pathogen or parasite may directly attack the host organism.
- the host organism feeds on plants or microalgae.
- the present invention includes a method for protecting host organisms that feed on plants or microalgae from infection by parasites and pathogens, comprising;
- a plant or microalgae that comprise a silencing ribonucleic acid that functions after ingestion of the microalgae by the host organism, or the parasite or pathogen, to inhibit the expression of a target gene of the parasite or pathogen, wherein the expression of the target gene is essential to the growth, development or reproduction of the parasite or pathogen,
- silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and
- the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of at least about 20 contiguous nucleotides in the target gene;
- the present invention also includes a method for inhibiting the expression of a target gene in a pathogen or parasite afflicting a host organism comprising; i) providing microalgae that comprises a silencing ribonucleic acid that functions after ingestion of the microalgae by the host organism, or the parasite or pathogen, to inhibit the expression of the target gene of the parasite or pathogen, wherein the expression of the target gene is essential to the growth, development or reproduction of the parasite or pathogen,
- silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and
- the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of at least about 20 contiguous nucleotides in the target gene;
- the host organism feeds on microalgae.
- the host organism is selected from the group consisting of Shrimps and prawns of the family Penaeidae and within it the genus Penaeus, Carp and fresh water fish of the Order Cypriniformes and Family Cyprinidae and Tilapia, including Cichlid fish from the tilapine cichlid tribe.
- the host organism is selected from the group consisting of Pacific white shrimp ⁇ Penaeus vannamei), Giant tiger prawn ⁇ Penaeus monodon), Western blue shrimp (P. stylirostris), Chinese white shrimp (P. chine mis), Kuruma shrimp (P. japonicus), Indian white shrimp (P. indicus) and Banana shrimp (P. merguiensis).
- the pathogen or parasite is a pathogen or parasite of Shrimps and prawns.
- a pathogen or parasite is selected from the group consisting of viruses including Taura Syndrome Virus (TSV), Infectious Hypodermal and Hematopoietic Necrosis Virus (IHHNV) , the nimavirus (WSSV), roniviruses (YHV, GAV, LOV), occluded enteric baculovirus (BP), occluded enteric baculovirus (MBV ), nonoccluded enteric baculovirus (BMN), enteric parvovirus (HPV), bacteria including a- proteobacteria (NHP) and protozoans including Microsporidians, Haplosporidians and Gregarines.
- TSV Taura Syndrome Virus
- IHHNV Infectious Hypodermal and Hematopoietic Necrosis Virus
- WSSV nimavirus
- roniviruses YHV, G
- the host organism is selected from asian carp, and Indian carp.
- the host organism is selected from grass carp ⁇ Ctenopharyngodon idella), common carp ⁇ Cyprinus carpio), silver carp ⁇ Hypophthalmichthys molitrix), largescale silver carp ⁇ Hypophthalmichthys harmandi), bighead carp ⁇ Hypophthalmichthys nobilis), black carp (Mylopharyngodon piceus), common goldfish (Carassius auratus) and crucian carp (Carassius carassius).
- the pathogen or parasite is a pathogen or parasite of carp.
- a pathogen or parasite is selected from the group consisting of Ichthyophthirius multifilis (Ich:), Trichodina, Costia, Chilodonella, Argulus foliaceus, Lernaea cyprinacea, Ergasilus sieboldi, Dactylogyrus vastator and Piscicola geometra.
- the host organism is selected from Oreochromis spp. Sarotherodon spp and Tilapia spp.
- the pathogen or parasite is a pathogen or parasite of Tilapia.
- a pathogen or parasite is selected from the group consisting of streptococcus, aeromonas, trichodina, columnaris and Iridovirus.
- the pathogen or parasite is selected from the group consisting of Ciliates Dinoflagellates, Trematodes, Crustaceans Copepods and Hirudidae.
- the host organism does not naturally eat microalgae. In such cases it is nevertheless possible to provide the microalgae to the host organism in the form of a food additive comprising microalgae.
- the present invention includes a feed additive comprising microalgae expressing a silencing ribonucleic acid that functions upon ingestion of the feed additive by the host organism, to inhibit the expression of a target gene of the parasite or pathogen,
- the expression of the target gene is essential to the growth, development or reproduction of the parasite or pathogen
- silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and
- the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of at least about 20 contiguous nucleotides in the target gene.
- the present invention includes a method for controlling invasive species, comprising; i) providing microalgae that comprise a silencing ribonucleic acid that functions after ingestion of the microalgae to inhibit the expression of a target gene of the invasive species wherein the expression of the target gene is essential to the functioning, growth, development, infectivity or reproduction of the invasive species, wherein the silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of at least about 20 contiguous nucleotides in the target gene; and ii) introducing the microalgae into a habitat of the invasive species where the invasive species, or its larval form, ingests the microalgae.
- the present invention includes a method for inhibiting the expression of a target gene in an invasive species, comprising; i) providing microalgae that comprise a silencing ribonucleic acid that functions after ingestion of the microalgae to inhibit the expression of a target gene of the parasite or pathogen, wherein the expression of the target gene is essential for survival of the invasive species, wherein the silencing ribonucleic acid comprises a sense RNA strand and an antisense RNA strand, wherein the sense and antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence substantially identical to a target sequence of at least about 20 contiguous nucleotides in the target gene; and ii) feeding the microalgae to the invasive species, or its larval form.
- the invasive species consumes microalgae in at least one stage of its life cycle.
- the invasive species is selected from mussels of the family Mytilidae, and clams of the family Veneridae.
- the invasive species is a zebra mussel, Dreissena polymorpha.
- Chlamydomonas strains CC424 (cwl5, arg2, sr-u-2-60 mt ) and CC 4147 (FUD7 mt+) were obtained from the Chlamydomonas culture collection at Duke University, USA. Strains were grown mixotrophically in liquid or on solid TAP Medium (Harris, et al., (1989) Genetics 123:281- 92) at 23 °C under continuous white light (40 ⁇ m ' V 1 ), unless otherwise stated. Medium was supplemented with 100 ⁇ g/mL of arginine when required.
- the 328 bp fragment of the 3HKT coding sequence was amplified with primers HKTFwd3 (5'- AGTCAGAGCTCCCATGGATGAACCAAAACGTTATCACCATAC-3') (SEQ. ID. No. 5) and HKTRev2 (above) and was cloned into Sacl/Xbal sites of vector pCVAC88 creating plasmid pCVAC99.
- HKT inverted repeat from pCVAC99 was excised as Ncol/SphI fragment and cloned into same sites of vector pGatpA creating plasmid pCVAClOl.
- the 3HKT inverted repeat from pC VAC 101 was excised as Xhol/Sphl fragment and cloned into Xhol/Sphl sites of vector pBA155 creating plasmid pCVAC108.
- 3HKT amplified with primers HKTFwd4 and HKTRev3 was digested with Notl/Spel restriction enzymes and cloned into same sites of pCVAC146 creating 3HKT IR.
- the new vector was designated as pCVAC150.
- 3HKT was amplified with the primers HKTFwd4 (above) and HKTRev3 (above) was cloned into Ndel/PstI sites of vector pCVAC131 creating plasmid pCVAC147.
- Actin intronl was amplified with primers Actinlntronl Fwd2 (5 ' - ATTATATGCATGTGAAGGTGAGC AGGTGTTC AGGGCGC-3 ') (SEQ. ID. No. 8) and Actinlntronl Rev 1 (5'-
- TAAGATACTAGTAGCCTGCGGACACGGCGACAC-3' (SEQ. ID. No. 9) and the product was digested with Nsil/Spel and cloned into Pstl/Spel sites of pCVAC147 creating plasmid pCVAC148.
- the new plasmid was named pCVAC153.
- 3HKT amplified with primers HKTFwd4 was cloned downstream of psaD promoter in Ndel/pstl sites of vector pSL18 creating plasmid pCVAC143.
- Chlamydomonas Actin promoter was amplified with primers ActinFwd4 (5'- ATCTATCTAGAAGGTGCATGCGCTCC ACGCATTAG-3 ' ) (SEQ. ID. No. 10) and ActinRev3 (5'- AAGATCTGCAGCATATGTTTGAATCCTGCGTGTCACGTCCGC-3') (SEQ. ID. No. 11) and was then cloned into Pstl/Xbal sites of vector pCVAC143 creating plasmid pCVAC145.
- Resuspended cells (300 ⁇ ) were transferred to a sterile micro-centrifuge tube containing 300mg of sterile glass beads (0.425-0.6 mm, Sigma, USA), ⁇ of sterile 20% PEG 6000 (Sigma, USA) was added to the cells along with ⁇ .5 ⁇ g of plasmid DNA. Prior to transformation, all the constructs were restriction digested either to linearize the construct or to excise the two expression cassettes carrying selection marker and gene of interest together, from the plasmid backbone.
- cells were vortexed for 20 seconds and plated on to TAP agar plates containing 50 ⁇ g/mL paromomycin and 100 ⁇ g/mL arginine or 10 ⁇ g/mL hygromycin and 100 ⁇ g/mL arginine.
- plasmids lacking any selection marker pSSCR7 backbone
- co- transformation was done.
- CC424 strain was transformed using glass beads method following addition of the linearized target plasmid (3 ⁇ g DNA) and the plasmid harboring the Arg7 gene, p389 ( ⁇ g DNA). Cells were plated on TAP agar plates without arginine.
- Gold particles ( ⁇ ) (InBio Gold, Eltham, Victoria, Australia) coated with plasmid DNAs were shot into Chlamydomonas cells on the agar plate using a Bio-Rad PDS lOOOHe Biolistic gun (Bio-Rad, Hercules, CA, USA) at HOOpsi under vaccum. Following shooting, cells were plated onto HS agar plates for selection.
- Genomic DNA was extracted from putative transformants growing on selection medium using a modified xanthine mini prep method described in Newman et al., (1990) Genetics 126(4):875-88.
- a half loop of algal cells were resuspended in 300 ⁇ . of xanthogenate buffer (12.5 mM potassium ethyl xanthogenate, 100 mM Tris-HCl pH 7.5, 80 mM EDTA pH 8.5, 700 mM NaCl) and incubated at 65° C water for 1.0 hour. Following incubation, the cell suspension was centrifuged for 10 minutes (14,000 rpm) to collect the supernatant.
- the supernatant was transferred to a fresh micro-centrifuge tube and 2.5 volume of cold 95% ethanol (750 ⁇ ) was added. The solution was mixed well by inverting the tube several times allowing DNA to precipitate. The samples were then centrifuged for 5 min (14,000 rpm) to pellet the DNA. The DNA pellet was washed with 700 ⁇ , of cold 70% ethanol and centrifuged for 3.0 min. The ethanol was removed by decanting and the DNA pellet was dried using a speedvac to get rid of any residual ethanol. The DNA pellet was then resuspended in ⁇ of sterile double distilled water and 2-5 ⁇ L ⁇ of the DNA sample was used as template for setting PCR.
- Realtime quantitative RT-PCR was carried out using an ABI - Step One Plus (Applied Biosystems, Foster City, CA, USA) using reagents sold under the trademarks PERFECTATM SYBR ® GREEN FASTMFXTM (ROX dye) (Quanta Biosciences, Gaithersburg, MD, USA) according to manufacturer's instructions.
- the Anopheles Actin gene (AS ActinRTFwdl (5'- GGTCGTAACCACCGGTATTG-3') (SEQ. ID. No. 12) and AS ActinRTRev2 (5'- GGTGGTGGTGAACGAGTAGC-3 ' ) (SEQ. ID. No. 13) was used as reference gene/internal control and was amplified in parallel with the target 3HKT gene (ASHKTRealFwd (5'- TTTAGCCTGGAAACGCTGAC-3')(SEQ. ID. No. 14) and ASHKTRealRev (5'- TC G ATTTCC C ATTTGTC C AT-3 ' ) (SEQ. ID. No.
- Example 1 Construction of Chlamydomonas expression vectors for silencing RNA specific to the mosquito 3HKT gene.
- 3-hydroxykynurenine transaminase (3HKT) is a unique protein found only in mosquitoes. This protein has evolved in mosquitoes to compensate for the absence of KAT found in humans and mammals. 3HKT catalyzes transamination of the reactive 3HK to more stable XA in tryptophan metabolic pathway (Han, et al., (2007) J Insect Physiol 53:254-63). Hence knocking down expression of 3HKT could lead to accumulation of 3HK, which can be lethal to mosquitoes.
- a 328bp region of Anopheles gambiae 3HKT gene not showing alignment of more than 11 contiguous bases to any sequence from other organisms in NCBI database was selected for creating 3HKT inverted repeat constructs.
- Three inverted repeat constructs were made for Chlamydomonas nuclear transformation as described above ( Figure 1).
- Construct pCVAC150 has 3HKT inverted repeat transcription under the control of Chlamydomonas Actin promoter.
- Chlamydomonas actin intronl forms the spacer region between the HKT inverted repeat regions and the transcription of the inverted repeat is regulated by the psaD promoter.
- Construct pCVAC145 has the 328bp region of 3HKT flanked by the psaD and Actin promoters from either ends, leading to bidirectional transcription of the 3HKT fragment. After confirmation of correct cloning each expression vector was tested in Chlamydomonas as more fully described below.
- Example 2 Nuclear transformation and initial characterization of 3HKT inverted repeat expression vectors.
- Example 3 Chloroplast transformation and initial characterization of 3HKT inverted repeat expression vectors.
- Chlamydomonas chloroplast lacks the machinery for processing of double stranded RNA (dsRNA) into siRNA. Therefore, we expect that the dsRNAs produced by Chlamydomonas chloroplast transformants would be available for processing by the RNAi machinery found in mosquito larvae.
- dsRNA double stranded RNA
- To directly test the difference in the effect of 3HKT siRNAs produced by nuclear transformants to dsRNAs produced by chloroplast transformants on mosquito larvae we therefore created a chloroplast specific expression cassette. This was accomplished by cloning the 3HKT inverted repeat downstream of the atpA promoter in vector pBA155, creating plasmid pCVAC108.
- Chloroplast transformation of CC4147 strain of Chlamydomonas was performed with construct pCVAC108 using a gene gun as described above. Integration of the 3HKT inverted repeat into chloroplast genome was confirmed by PCR ( Figure 5). These PCR positive clones were also tested in bioassays on mosquito larvae as more fully described below.
- Transgenic Chlamydomonas carrying HKT inverted repeats were used to carry out bioassays on larvae of Anopheles stephensi.
- the Bioassay was started on the first day of larval emergence.
- Assays were conducted in 12 well plates, carrying 2.0mL of 10% TAP medium in each well. Each well was inoculated with 10% inoculumn of log phase cultures of transgenic Chlamydomonas clones and 10 freshly emerged larvae (less than 24 hrs old) were transferred to each well. Each experiment was carried out in duplicate.
- Chlamydomonas chloroplast transformants CC741/pCVAC108
- two clones each from nuclear transformants CC424/pCVAC150, CC424/pCVAC153 and CC424/pCVAC145
- CC424/pCVAC150 two clones each from nuclear transformants
- CC424/pCVAC153 two clones each from nuclear transformants
- CC424/pCVAC145 also inhibited growth of the larvae indicating that the 3HKT inverted repeats expressed by Chlamydomonas (either chloroplast or nuclear genome) were effective in knocking down 3HKT expression in mosquito larvae.
- introns as the spacer element in the IR constructs are known to enhance efficiency of gene silencing (Lee, Y. S., and R. W. Carthew (2003) Methods 30:322-9; Smith, et al., (2000) Nature 407:319-20). Since the pCVAC153 construct additionally has the Chlamydomonas actin intronl as the spacer element between the 3HKT IR, it perhaps enhances the expression and stability of 3HKT dsRNA contributing to efficient 3HKT silencing.
- the chloroplast transformants producing 3HKT dsRNAs were more effective in inhibiting mosquito larvae when compared to nuclear transformants which are presumably capable of producing siRNA.
- the 3HKT dsRNA produced by the chloroplast transformants is either more effectively delivered and / or processed by the RNAi machinery of mosquito upon ingestion compared to nuclear expressed dsRNA.
- the siRNAs produced by the mosquito RNAi machinery from the chloroplast dsRNA are employed more efficiently by the RNA induced silencing complex (RISC) in mosquitoes compared to the siRNAs ingested upon feeding on Chlamydomonas nuclear transformants producing siRNAs.
- packaging the silencing RNA in the plastid may protect the chloroplast expressed dsRNA from degradation during ingestion, compared to the nuclear expressed RNA.
- Figure 13 shows the results of real time PCR analysis of 3-HKT transcript levels among surviving/dead A. stephensi larvae and pupae reared on transgenic Chlamydomonas expressing 3-HKT dsRNA.
- Figure 13A shows 3-HKT transcript levels observed among surviving larvae reared on Chlamydomonas clones 108-13 and 108-15.
- the mean AACT values from three experiments were subjected to analysis through single factor ANOVA. While the table F value is 3.12, the calculated F value was 42.08 at 3.06 x 10 "7 level of significance indicating that 3-HKT expression levels differed significantly among larvae.
- the calculated critical difference (CD) value was 0.88. Except for larvae 108-15C1, that did not differ significantly from control (less than 0.88 fold reduction in 3-HKT transcript levels), larvae from all other treatments showed significant reduction in 3-HKT transcript levels compared to control.
- Figure 13B shows 3-HKT transcript levels observed among dead pupae from larvae reared on 108-13.
- the mean AACT values from three experiments were subjected to analysis through single factor ANOVA. While the table F value is 5.14, the calculated F value was 75.66 at 5.55 x 10 "5 level of significance indicating that 3-HKT expression levels differed significantly among dead pupae compared to control.
- the calculated CD value was 0.41 indicating that the dead pupae from treatments had significantly lower 3-HKT transcript levels compared to control.
- Figure 13 C shows 3 -HKT transcript levels observed among dead pupae from larvae reared on 108-13, 108-15 and 153-15 transgenic Chlamydomonas clones.
- dsRNAs targeting essential mosquito genes produced in Chlamydomonas can be used as an effective strategy to selectively modulate gene expression and control mosquito populations.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Polymers & Plastics (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Virology (AREA)
- Pest Control & Pesticides (AREA)
- Animal Husbandry (AREA)
- Insects & Arthropods (AREA)
- Food Science & Technology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
Description
Claims
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA2820536A CA2820536A1 (en) | 2010-10-22 | 2011-10-24 | Control of pathogens and parasites |
| MX2013004522A MX2013004522A (en) | 2010-10-22 | 2011-10-24 | Control of pathogens and parasites. |
| CN2011800625619A CN103269579A (en) | 2010-10-22 | 2011-10-24 | Control of pathogens and parasites |
| US13/880,931 US20130315883A1 (en) | 2010-10-22 | 2011-10-24 | Control of pathogens and parasites |
| EP11835275.6A EP2629599A4 (en) | 2010-10-22 | 2011-10-24 | FIGHTING PATHOGENS AND PARASITES |
| AU2011316776A AU2011316776A1 (en) | 2010-10-22 | 2011-10-24 | Control of pathogens and parasites |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US40577010P | 2010-10-22 | 2010-10-22 | |
| US61/405,770 | 2010-10-22 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2012054919A2 true WO2012054919A2 (en) | 2012-04-26 |
| WO2012054919A3 WO2012054919A3 (en) | 2012-09-20 |
Family
ID=45975933
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2011/057476 Ceased WO2012054919A2 (en) | 2010-10-22 | 2011-10-24 | Control of pathogens and parasites |
Country Status (8)
| Country | Link |
|---|---|
| US (1) | US20130315883A1 (en) |
| EP (1) | EP2629599A4 (en) |
| CN (1) | CN103269579A (en) |
| AU (1) | AU2011316776A1 (en) |
| CA (1) | CA2820536A1 (en) |
| CL (1) | CL2013001102A1 (en) |
| MX (1) | MX2013004522A (en) |
| WO (1) | WO2012054919A2 (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015135039A1 (en) * | 2014-03-12 | 2015-09-17 | The University Of Sydney | Sirna production in plastids of higher plants |
| WO2016097331A1 (en) * | 2014-12-19 | 2016-06-23 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Plant protection from a pest or pathogen by expression of double-stranded rnas in the plastid |
| WO2017009838A1 (en) * | 2015-07-14 | 2017-01-19 | Transalgae Israel Ltd. | Transgenic microalgae and use thereof as a feed for delivery of interfering rna molecules |
| EP3512951A4 (en) * | 2016-09-16 | 2020-07-08 | Pebble Labs USA Inc. | Novel paratransgenic system for the biocontrol of disease-transmitting mosquitos |
| US20230272395A1 (en) * | 2022-02-28 | 2023-08-31 | The United States Of America, As Represented By The Secretary Of Agriculture | Engineered microalgae feed to improve honey bee pathogen resistance and nutrition |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9428425B2 (en) * | 2012-09-20 | 2016-08-30 | Core Intellectual Properties Holdings, Llc | Methods and compositions for treating soil and plants |
| CA2945736A1 (en) | 2014-05-04 | 2015-11-12 | Forrest Innovations Ltd. | Compositions for mosquito control and uses of same |
| CN104497118B (en) * | 2014-12-29 | 2017-08-11 | 清华大学 | A kind of insect protein Hig and its encoding gene and application |
| CN110241114B (en) * | 2019-03-20 | 2023-09-22 | 中国热带农业科学院热带生物技术研究所 | A kind of double-stranded RNA that can prevent and control mosquitoes and its application |
| CN110042102B (en) * | 2019-03-20 | 2022-12-06 | 中国热带农业科学院热带生物技术研究所 | Double-stranded RNA capable of preventing and controlling mosquitoes, expression vector and application thereof |
Family Cites Families (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB0306715D0 (en) * | 2003-03-24 | 2003-04-30 | Novartis Ag | Organic compounds |
| JP5183064B2 (en) * | 2003-07-02 | 2013-04-17 | エムユーエスシー ファウンデイション フォー リサーチ デべロップメント | Specific and non-specific immunity induced by dsRNA in crustaceans and other invertebrates, and biological delivery vehicles used therein |
| CN1860220A (en) * | 2003-07-02 | 2006-11-08 | 南卡罗来纳医科大学研究发展基金会 | Dsrna induced specific and non-specific immunity in crustaceans and other invertebrates and biodelivery vehicles for use therein |
| US20080194504A1 (en) * | 2004-02-06 | 2008-08-14 | Advanced Bionutrition Corporation | Rna-Mediated Interference to Control Disease in Terrestrial and Aquaculture Animals |
| DE102004024184A1 (en) * | 2004-05-13 | 2006-01-26 | Basf Plant Science Gmbh | Novel nucleic acid sequences and their use in methods for achieving pathogen resistance in plants |
| NZ582988A (en) * | 2004-10-21 | 2011-07-29 | Venganza Inc | Methods and materials for conferring resistance to pests and pathogens of plants |
| WO2006045591A2 (en) * | 2004-10-25 | 2006-05-04 | Devgen N.V. | Method and constructs for delivering double stranded rna to pest organisms |
| CN101048505A (en) * | 2004-10-25 | 2007-10-03 | 德福根有限公司 | Multidomain rna molecules comprising at least one aptamer for delivering double stranded rna to pest organisms |
| US8404927B2 (en) * | 2004-12-21 | 2013-03-26 | Monsanto Technology Llc | Double-stranded RNA stabilized in planta |
| US20080107652A1 (en) * | 2006-08-25 | 2008-05-08 | Science & Technology Corporation @ University Of New Mexico Stc.Unm | Methods and compositions for control of disease in aquaculture |
-
2011
- 2011-10-24 MX MX2013004522A patent/MX2013004522A/en unknown
- 2011-10-24 EP EP11835275.6A patent/EP2629599A4/en not_active Withdrawn
- 2011-10-24 CN CN2011800625619A patent/CN103269579A/en active Pending
- 2011-10-24 CA CA2820536A patent/CA2820536A1/en not_active Abandoned
- 2011-10-24 US US13/880,931 patent/US20130315883A1/en not_active Abandoned
- 2011-10-24 WO PCT/US2011/057476 patent/WO2012054919A2/en not_active Ceased
- 2011-10-24 AU AU2011316776A patent/AU2011316776A1/en not_active Abandoned
-
2013
- 2013-04-22 CL CL2013001102A patent/CL2013001102A1/en unknown
Non-Patent Citations (1)
| Title |
|---|
| See references of EP2629599A4 * |
Cited By (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015135039A1 (en) * | 2014-03-12 | 2015-09-17 | The University Of Sydney | Sirna production in plastids of higher plants |
| EP3719129A1 (en) | 2014-03-12 | 2020-10-07 | The University of Sydney | Rna production in higher plants |
| AU2018201526B2 (en) * | 2014-03-12 | 2020-05-21 | The University Of Sydney | RNA production in higher plants |
| WO2016097331A1 (en) * | 2014-12-19 | 2016-06-23 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Plant protection from a pest or pathogen by expression of double-stranded rnas in the plastid |
| JP2018520656A (en) * | 2015-07-14 | 2018-08-02 | トランサルガエ イスラエル リミテッド | Transgenic microalgae and their use as feed to deliver interfering RNA molecules |
| US20180195065A1 (en) * | 2015-07-14 | 2018-07-12 | Transalgae Israel Ltd. | Transgenic microalgae and use thereof as a feed for delivery of interfering rna molecules |
| US10781447B2 (en) | 2015-07-14 | 2020-09-22 | Transalgae Israel Ltd. | Transgenic microalgae and use thereof as a feed for delivery of interfering RNA molecules |
| WO2017009838A1 (en) * | 2015-07-14 | 2017-01-19 | Transalgae Israel Ltd. | Transgenic microalgae and use thereof as a feed for delivery of interfering rna molecules |
| US20210032625A1 (en) * | 2015-07-14 | 2021-02-04 | Transalgae Israel Ltd. | Transgenic microalgae and use thereof as a feed for delivery of interfering rna molecules |
| AU2016291813B2 (en) * | 2015-07-14 | 2022-09-01 | Transalgae Israel Ltd. | Transgenic microalgae and use thereof as a feed for delivery of interfering RNA molecules |
| IL256387B (en) * | 2015-07-14 | 2022-11-01 | Tarnsalgae Israel Ltd | Transgenic algae and their use for the administration of inhibitory RNA molecules |
| IL256387B2 (en) * | 2015-07-14 | 2023-03-01 | Tarnsalgae Israel Ltd | Transgenic microalgae and use thereof as a feed for delivery of interfering rna molecules |
| US11939576B2 (en) | 2015-07-14 | 2024-03-26 | Transalgae Israel Ltd. | Transgenic microalgae and use thereof as a feed for delivery of interfering RNA molecules |
| EP3512951A4 (en) * | 2016-09-16 | 2020-07-08 | Pebble Labs USA Inc. | Novel paratransgenic system for the biocontrol of disease-transmitting mosquitos |
| US11396653B2 (en) | 2016-09-16 | 2022-07-26 | Pebble Labs Inc. | System for the biocontrol of disease-transmitting mosquitoes and their eggs using horizontally transferable symbiotic bacteria to deliver pathogen specific interfering RNA polynucleotides |
| US20230272395A1 (en) * | 2022-02-28 | 2023-08-31 | The United States Of America, As Represented By The Secretary Of Agriculture | Engineered microalgae feed to improve honey bee pathogen resistance and nutrition |
Also Published As
| Publication number | Publication date |
|---|---|
| CL2013001102A1 (en) | 2014-04-04 |
| CN103269579A (en) | 2013-08-28 |
| EP2629599A4 (en) | 2014-04-02 |
| MX2013004522A (en) | 2013-08-27 |
| AU2011316776A1 (en) | 2013-06-06 |
| CA2820536A1 (en) | 2012-04-26 |
| US20130315883A1 (en) | 2013-11-28 |
| EP2629599A2 (en) | 2013-08-28 |
| WO2012054919A3 (en) | 2012-09-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20130315883A1 (en) | Control of pathogens and parasites | |
| US11459578B2 (en) | Carbon fixation systems in plants and algae | |
| ES2624276T3 (en) | A method for transient expression of nucleic acids in plants | |
| WO2012125737A2 (en) | Methods for increasing carbon fixation | |
| US20190367938A1 (en) | Plants with enhanced photosynthesis and methods of manufacture thereof | |
| WO2013016267A9 (en) | Plants and algae capable of modulating antenna size based on light intensity | |
| BR112013016876B1 (en) | method for transiently expressing one or more nucleotide sequences in one or more cells of an intact whole soybean plant | |
| US20130145495A1 (en) | Enhanced carbon fixation in photosynthetic hosts | |
| BR122018000387B1 (en) | ISOLATED NUCLEIC ACID MOLECLE, VECTOR, BACTERIAL HOST CELL, AND METHOD FOR PROTECTION OF A PEST PLANT | |
| CN107849568A (en) | Root-preferred and stress-inducible promoters and uses thereof | |
| CN104293802A (en) | Lotus japonicus ERF transcription factors as well as encoding gent, expression vector and application thereof | |
| UA124449C2 (en) | Transgenic plants with engineered redox sensitive modulation of photosynthetic antenna complex pigments and methods for making the same | |
| WO2017091309A2 (en) | Compositions and methods for enhanced plant growth and seed yield | |
| CN107406844A (en) | The transgenic rice plant of improvement | |
| ES3053124T3 (en) | Engineered pesticidal proteins and methods of controlling plant pests | |
| CN117210474B (en) | Late blight resistance genes, biological materials and applications | |
| WO2024238491A2 (en) | Engineered microalgae and use in aquaculture | |
| BR112019026301A2 (en) | genetically modified terrestrial plants that express a mitochondrial carrier protein similar to plant ccp1 | |
| BRPI0308659B1 (en) | Nucleic acid sequences, chimeric gene, vector, bacillus thuringiensis strain, as well as plant protection process against insect damage. | |
| KR102697695B1 (en) | Novel NtNDPK1 gene from Neopyropia sp. and Uses Thereof | |
| CN103190316B (en) | The method controlling insect | |
| CN120005896A (en) | Late blight resistance genes, biomaterials and applications | |
| CN109337885A (en) | Application of Beauveria bassiana calcineurin B subunit BbCNB and A subunit BbCNA in cotton and tobacco breeding | |
| BR112019011706B1 (en) | NUCLEIC ACID MOLECULE FOR EXPRESSION OF CHIMERIC INSECTICIDAL PROTEIN, VECTOR AND CELL THE SAME | |
| BR122025000889A2 (en) | CHIMERIC INSECTICIDAL PROTEIN AND INSECTICIDAL COMPOSITION |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11835275 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013001102 Country of ref document: CL Ref document number: 000892-2013 Country of ref document: PE Ref document number: MX/A/2013/004522 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2011835275 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2820536 Country of ref document: CA Ref document number: 2011316776 Country of ref document: AU Date of ref document: 20111024 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13880931 Country of ref document: US |