WO2012052953A1 - MiRNA - Google Patents
MiRNA Download PDFInfo
- Publication number
- WO2012052953A1 WO2012052953A1 PCT/IB2011/054686 IB2011054686W WO2012052953A1 WO 2012052953 A1 WO2012052953 A1 WO 2012052953A1 IB 2011054686 W IB2011054686 W IB 2011054686W WO 2012052953 A1 WO2012052953 A1 WO 2012052953A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- mir
- mirna
- cells
- protein
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
- C12N2310/113—Antisense targeting other non-coding nucleic acids, e.g. antagomirs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
- C12N2310/141—MicroRNAs, miRNAs
Definitions
- the present invention relates to methods and compositions involving microRNA (miR As) molecules. Certain aspects of the invention relate to applications of miRNA therapy for diseases or conditions that involve angiogenesis. Certain aspects of the invention relate to applications of miRNA therapy for diseases or conditions associated with tumours.
- angiogenesis (also referred to as “neovascularisation”) is a general term used to denote the growth of new blood vessels both in normal and pathological conditions.
- Angiogenesis is an important natural process that occurs during embryogenesis, fetal and post-natal growth and in the adult healthy body in the process of wound healing, and in restoration of blood flow back into injured tissues. In females, angiogenesis also occurs during the monthly reproductive cycle to build up the uterus lining and to support maturation of oocytes during ovulation, and in pregnancy when the placenta is formed, in the process of the establishment of circulation between the mother and the fetus.
- the aim was to control or diminish excessive and pathological angiogenesis that occurs in diseases such as cancer, diabetic blindness, age related macular degeneration, rheumatoid arthritis, psoriasis, and additional conditions.
- diseases such as cancer, diabetic blindness, age related macular degeneration, rheumatoid arthritis, psoriasis, and additional conditions.
- the new blood vessels feed the diseased tissue, for example the tumor tissue, providing it with essential oxygen and nutrients thus enabling its pathological growth.
- the pathological angiogenesis may destroy the normal tissue.
- the new blood vessels, formed for example in the tumor tissue enable the tumor cells to escape into the circulation and metastasize in other organs.
- excessive angiogenesis occurs when diseased cells produce abnormal amounts of angiogenetic growth factors, overwhelming the effect of the natural angiogenesis inhibitors present in the body.
- Anti-angiogenetic therapies developed recently, are aimed at preventing new blood vessel growth through the targeting and neutralization of any of the stimulators that encourage the formation of new bl ood vessels.
- a contrasting indication of regulating angiogenesis is the stimulation of production of neovascularization in conditions where insufficient angiogenesis occurs.
- these conditions are diseases such as coronary artery diseases, stroke, and delayed wound healing (for example in ulcer lesions).
- insufficient angiogenesis occurs when the tissues do not produce adequate amounts of angiogenetic growth-factors, and therapeutic angiogenesis is aimed at stimulating new blood vessels' growth by the use of growth factors or their mimics.
- the present invention seeks to provide a solution to the aforementioned needs.
- TAMs downregulates Rock2; (ii) reduces their expression of several ECM genes, including collagens and other fibrous proteins; (iii) broadly and specifically attenuates the expression of genes that define the protumoral gene signature of MRC1 + TAMs; (iv) reduces tumor growth in mice.
- constitutive ROCK activation in epithelial cells induces ⁇ -catenin stabilization, cell hyperproliferation, and enhanced collagen synthesis and ECM stiffening, leading to increased tumor incidence and progression 1 .
- TAMs represent a major component of the tumor stroma, their modulation of ROCK2 and ECM-protein synthesis by miR-5 l l-3p may have the potential to influence stromal dynamics in the tumor microenvironment.
- a method for stimulating angiogenesis in a subject or tissue comprising administering to the subject or tissue an effective amount of an inhibitor of miR-511, preferably an inhibitor of miR-511 -3 -p, or an inhibitor of a nucleic acid molecule comprising an miRNA sequence that is or comprises miR-511-3-p.
- a method for reducing angiogenesis in a subject or tissue comprising administering to the subject or tissue an effective amount of a nucleic acid molecule comprising a miRNA sequence that is or comprises miR-511-3-p.
- a method for inhibiting tumor growth in a subject or tissue comprising administering to the subject or tissue an effective amount of a nucleic acid molecule comprising a miRNA sequence that is or comprises miR-511 -3-p.
- the present invention is directed to and relates to uses of miR-511-3-p, and not miR- 51 l-5p and modulators, including inhibitors thereof.
- the miR-51 1 -3p active strand of the present invention is:
- AAUGUGUAGCAAAAGACAGAAU human miR-51 l-3p sequence, or hsa-miR- 511-3p
- AAUGUGUAGCAAAAGACAGGAU (mouse miR-51 l-3p sequence, or mmu-miR- 511-3p)
- a method for selecting an angiogenesis therapy for a patient comprising: measuring an expression profile of miR-511 of the invention, optionally in a sample; and selecting a therapy based on a comparison of the miRNA expression profile in the patient sample to an expression profile of a normal or nonpathogenic sample, wherein a difference between the expression profiles is indicative of a pathological condition.
- An altered expression for the miRNA may indicate that the patient should be treated with a coiTesponding therapeutic directed towards the altered miRNA or condition indicated by such altered miRNA.
- the method includes a step of generating a miRNA profile for a sample.
- miRNA profile refers to data regarding the expression pattern of a miRJSTA(s) in the sample (including the miRNA of the invention).
- the miRNA profile can be obtained using known hybridization techniques.
- a miRNA profile is generated by steps that include one or more of: (a) labeling miRNA in the sample; (b) hybridizing miRNA to a number of probes, or amplifying a number of miRNAs, and/or (c) determining miRNA hybridization to the probes or detecting miRNA amplification products, wherein miRNA expression levels are determined or evaluated.
- Methods of the invention include determining a diagnosis or prognosis for a patient based on miRNA expression or expression levels, hi certain embodiments, the elevation or reduction in the level of expression of the miRNA of the present invention or set of miRNAs including the miRNA of the present invention in a cell is correlated with a disease state as compared to the expression level of that miRNA or set of miRNAs in a normal cell or a reference sample or digital reference. This correlation allows for diagnostic methods to be carried out when the expression level of a miRNA is measured in a biological sample being assessed.
- Methods can further comprise normalizing the expression levels of miRNA. Normalizing includes, but is not limited to adjusting expression levels of miRNA relative to expression levels of one or more nucleic acid in the sample.
- Embodiments of the invention include methods for diagnosing, assessing a condition, and/or prognosing a disease or condition associated with or having an accompanying aberrant vascularization in a patient comprising evaluating or determining the expression or expression levels of one or more mi ' RNAs, including the miRNA of the present invention, in a sample from the patient.
- the difference in the expression in the sample from the patient and a reference, such as expression in a normal or non-pathologic sample is indicative of a pathologic or diseased condition associated with neovascularization and/or angiogenesis.
- the miRNA expression level is compared to the expression level of a normal cell or a reference sample or a digital reference. Comparing miRNA expression levels includes comparing miRNA expression levels in a sample to miRNA expression levels in a normal tissue sample or reference tissue sample.
- a normal tissue sample can be taken from the patient being evaluated and can be a normal adjacent tissue to the area being assessed or evaluated.
- Embodiments of the invention include kits for analysis of a pathological sample by assessing a miRNA profile for a sample comprising, in suitable container means, one or more miRNA probes and/or amplification primers, wherein the miRNA probes detect or primer amplify one or more miRNA described herein.
- the invention also relates to a recombinant expression vector comprising a recombinant nucleic acid operatively linked to an expression control sequence, wherein expression, i.e. transcription and optionally further processing results in a miRNA-molecule or miRNA precursor molecule as described above.
- the vector is preferably a DNA-vector, e.g. a viral vector or a plasmid, particularly an expression vector suitable for nucleic acid expression in eukaryotic, more particularly mammalian cells.
- the recombinant nucleic acid contained in said vector may be a sequence which results in the transcription of the miRNA-molecule as such, a precursor or a primary transcript thereof, which may be further processed to give the miRNA-molecule .
- the present invention also includes compositions comprising the miRNA of the invention or inhibitors thereof.
- the miRNA molecules of the present invention may act as target for therapeutic screening procedures, e.g. inhibition or activation of miRNA molecules might modulate a cellular differentiation process, e.g. apoptosis.
- the present invention further relates to a method for identifying a proangiogenic cell comprising detecting the expression of the miRNA of the present invention.
- miRNA microRNA
- Mrcl mannose receptor
- miR-511 -3p targeted Rho-dependent- kinase2 (Rock2), decreased TAM expression of extra-cellular matrix (ECM) genes, and tuned-down the protumoral "gene signature" of MRC1 + TAMs.
- ECM extra-cellular matrix
- the composition and biophysical properties of the ECM influence tumor growth. Increased collagen deposition and ECM density/stiffness stimulate tumor cell proliferation, invasion and malignancy 2 3 .
- ECM fibrous proteins are mainly produced by epithelial cells and fibroblasts in tumors 2 ' 4 , there is also evidence that several collagen genes are robustly expressed by in vitro cultured macrophages 5 . Macrophage deficiency impairs tissue remodeling, angiogenesis and growth both during organ healing 6 and tumor progression 7 ' 8 .
- TAMs The protumoral functions of TAMs are thought to depend, at least in part, on their production of growth, proangiogenic and ECM-remodeling factors (e.g., collagenases), which enhance tumor cell motility, activate fibroblasts and facilitate angiogenesis 7 ' 8 .
- ECM-remodeling factors e.g., collagenases
- TAMs may exert either pro- or antitumoral functions 7 ' 8 .
- TAMs can be divided into at least two main subsets: MRCl + CDl lc ⁇ and CDl lc + MRCl low macrophages.
- MRC1 + TAMs express a gene signature that is consistent with enhanced proangiogenic, protumoral and tissue-remodelling activity and lower proinflammatory activity compared to CDl lc 1 TAMs 7,9,10 .
- These MRC1 + TAMs are reminiscent of M2 -polarized, "alternatively activated" macrophages u .
- CDl lc + TAMs express higher levels of proinflammatory mediators and angiostatic cytokines than MRC1 + TAMs 7 ' 9,10 , have antiangiogenic and antitumoral activity 12 ' 13 , and display features of Ml-polarized, "classically activated" macrophages 11 .
- M2-like TAMs 1 Although several bioeffector molecules have been identified that may account for the protumoral activity of M2-like TAMs 1 , little is known of the intrinsic signals that modulate TAM' s pro- vs. antitumoral functions.
- miRNAs are single stranded RNAs of -22 nt in length that are generated from endogenous hairpin-shaped transcripts (primary miRNAs).
- miRNAs expressed in each cell type determines the fine tuning of hundreds of mRNAs, thus regulating gene expression and cell function 14 .
- miRNAs are highly expressed in human macrophages cultured in vitro 15 ' 16 , little is known of the miRNA expression profile of TAMs and their subsets.
- miR-511-3p a novel miRNA, miR-511-3p, that is embedded within the fifth intron of the mouse/human Mrcl/MRCl gene and that is specifically and highly expressed in MRC1 + TAMs among tumor-infiltrating myeloid cells.
- RNAi small interfering RNAs
- siRNAs small interfering RNAs
- RISC RNA-induced silencing complex
- miRNA short hairpin RNA
- shRNA short hairpin RNA
- miRNA microRNAs
- pri-miRNAs long primary transcripts
- the pri-miRNA is cleaved by the nuclear Drosha-DGCR8 complex to produce pre-miRNA, which are further processed in the cytoplasm to mature miRNA duplex.
- the expression of many of these miRNAs is restricted to specific cell lineages and developmental stages, and recent data suggest that they exert profound influence on gene regulation in a wide range of conditions and diseases including cancer (Skaftnesmo et al (2007) Curr Pharm Biotechnol 8, 320-5).
- miRNAs are single stranded RNAs (ssRNAs) of -22 nt in length that are generated from endogenous hairpin-shaped transcripts 14 ' 17 .
- miRNAs function as guide molecules in post-transcriptional gene regulation by base pairing with target mRNAs, which are generally located in the 3' untranslated region (UTR) of the gene. Binding of a miRNA to the target mRNA generally leads to translational repression and mRNA degradation. Over one third of human genes are predicted to be directly targeted by miRNAs 17 .
- the unique combination of miRNAs in each cell type determines the fine tuning of thousands of mRNAs' 4 ' 7 .
- miRNAs are generated from noncoding transcription units (TUs), whereas others are encoded in protein coding TUs 17 .
- TUs noncoding transcription units
- Approximately 50% of all miRNA loci are located either in the intronic or exonic region of noncoding TUs.
- -40% of all miRNA loci are found in intronic regions of protein-coding TUs 17 .
- the miRNA is under the transcriptional control of the hosting gene promoter, although there may be rare cases in which individual miRNAs are derived from separate gene promoters located within introns 18 .
- the expression of the miRN A most often correlates with that of the host gene 19 .
- the present invention also encompasses the use of modified miRNA.
- modified is used to indicate that the genomic miRNA-encoding sequence comprises one or more mutations, such that it produces a modified pre-miRNA which is different from the pre- miRNA sequence which would have been produced, had the genomic sequence not been mutated.
- the genomic pre-miRNA-encoding sequence is endogenous, in the sense that its sequence, prior to modification, occurs naturally within the genome.
- the present invention involves methods which employ the detection of miRNA expression.
- a number of techniques have been developed to determine miRNA expression and any appropriate technique may be employed in the present invention.
- miRNA array technology offers a powerful high-throughput tool to monitor the expression of thousands of miRNAs at once.
- Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) is another reliable and highly sensitive technique for miRNA detection, which only requires very small amounts of input total RNA.
- Northern blotting has also been employed to detect and validate miRNA expression levels.
- techniques are available to detect miRNAs by in situ hybridization. Although various miRNAs have been detected from tissue sources, these methods require invasive techniques to collect the starting material. Therefore, procedures have also been established to measure miRNA expression in blood products to enable clinical feasibility of miRNA measurement (Chen X et al Cell Res 2008, 7:2643-2646). Recently, the advent of next generation sequencing technologies allows for the measurement of the absolute abundance.
- the miRNA of the present invention may be used for the diagnosis of diseases associated with angiogensis, such as cancer.
- miRNA expression profiles can be used to distinguish tumor from normal samples, identification of tissue of origin for tumors of unknown origin or in poorly differentiated tumors and to distinguish different subtypes of tumors.
- Sample datasets can be stratified to show that certain alterations of miR As occur in patients at an early stage of cancer and other angiogenesis-related disease and thus may be useful for early detection of disease. Large tissue specimens are not needed for accurate miRNA detection since their expression can be easily measured in biopsy specimens.
- studies may be conducted on tissue, recent studies have shown that miRNAs can be measured in formalin fixed paraffin embedded (FFPE) tissues.
- FFPE formalin fixed paraffin embedded
- miRNAs can be detected in serum, thus screening can be carried out via less invasive blood-based mechanisms.
- the miRNA of the present invention may also be used in other clinical measures such as prognosis and treatment response.
- the miRNA of the present invention may be useful as an indicator of clinical outcome in a number of angiogenesis-related diseases, such as cancer types.
- the miRNA of the present invention may be used to predict the tendency for recurrence of disease.
- a method of use that involves inhibiting or reducing the miRNA levels or their effect.
- This may be achieved through a number of approaches.
- anti-miRNA oligonucleotides AMOs
- AMOs conjugated to cholesterol AMOs conjugated to cholesterol (antagomirs) have been also been generated and have been described to efficiently inhibit miRNA activity in vivo.
- LNAs locked-nucleic-acid antisense oligonucleotides
- Another method for reducing the interaction between miRNAs and their targets is the use of microRNA sponges. These sponges are synthetic mRNAs that contain multiple binding sites for an endogenous miRNA. Sponges designed with multimeric seed sequences have been shown to effectively repress miRNA families sharing the same seed sequence.
- miRmasking uses a sequence with perfect complementarity to the target gene such that duplexing will occur with higher affinity than that between the target gene and its endogenous miRNA. The caveat of this approach is that the choice of target gene must be specific in order to effectively reduce the interaction.
- Another strategy to increase specificity of effects is the use of small molecule inhibitors against specific microRNAs.
- a method that involves overexpressing or increasing the miRNA levels or their effect. This can be achieved e.g. through techniques such as the use of viral or liposomal delivery mechanisms.
- Other delivery systems include non-viral methods of gene transfer such as cationic liposome mediated systems.
- MicroRNA mimics have also been used to increase miRNA expression. These small, chemically modified double-stranded RNA molecules mimic endogenous mature microRNA. These mimics are now commercially available and promising results have been reported with systemic delivery methods using lipid and polymer-based nanoparticles.
- 'Treating' refers to treatment of a subject having a disease in order to ameliorate, cure or reduce the symptoms of the disease, or reduce or halt the progression of the disease.
- the term 'preventing' is intended to refer to averting, delaying, impeding or hindering the contraction of a disease.
- the present invention relates to' the treatment (including prevention) of angiogenesis or angiogenesis-related diseases.
- Angiogenesis occurs in the healthy body for healing wounds and for restoring blood flow to tissues after injury or insult. In females, angiogenesis also occurs during the monthly reproductive cycle (to rebuild the uterus lining, to mature the egg during ovulation) and during pregnancy (to build the placenta, the circulation between mother and fetus).
- Angiogenesis-dependent diseases result when new blood vessels either grow excessively or insufficiently.
- Occurs in diseases such as cancer, diabetic blindness, age-related macular degeneration, rheumatoid arthritis, psoriasis, and more than 70 other conditions.
- Antiangiogenic therapies aimed at halting new blood vessel growth, are used to treat these conditions.
- the angiogenesis may be associated with, for example, tumor vascularization, retinopathies (e.g., diabetic retinopathy), rheumatoid arthritis, Crohn's disease, atherosclerosis, hyperstimulation of the ovary, psoriasis, endometriosis associated with neovascularization, restenosis due to balloon angioplasty, tissue overproduction due to cicatrization, peripheral vascular disease, hypertension, vascular inflammation, Raynaud's disease and phenomena, aneurism, arterial restenosis, thrombophlebitis, lymphangitis, lymphedema, tissue cicatrization and repair, ischemia, angina, myocardial infarction, chronic heart disease, cardiac insufficiencies such as congestive heart failure, age-related macular degeneration and osteoporosis.
- retinopathies e.g., diabetic retinopathy
- Crohn's disease Crohn's disease
- Suitable pathological disorders include cardiac ischemia, atherosclerosis, renal vascular disease, stroke, a wound, placental insufficiency, unvascularized tissue related to grafts and transplants, disorders relating to endothelial cell apoptosis or necrosis, hemangiomas, proliferative retinopathy, and cancer.
- the present invention also relates to a method for treating a pathological disorder in a patient which includes administering the miRNA of the invention in an amount effective to treat the pathological disorder by inducing angiogenesis in the manner described above.
- the pathological disorder is ischemic cardiopathy and/or cerebrovascular disorders caused by insufficient cerebral circulation.
- Thrombi or emboli due to atherosclerotic or other disorders commonly cause ischemic arterial obstruction.
- the pathological disorder is a non-cardiac vascular disorder including atherosclerosis, renal vascular disease, and stroke.
- the pathological disorder is a wound.
- wounds include, but are not limited to, chronic stasis ulcers, diabetic complications, complications of sickle cell disease, thalassemia and other disorders of hemoglobin, and post-surgical wounds.
- the pathological disorder is a condition of placental insufficiency. Such conditions include, but are not limited to, intrauterine growth retardation.
- the pathological disorder unvascularized tissue related to grafts and transplants (see, e. g., PCT International Application No, WO 99/06073 to Isner, which is hereby incorporated by reference).
- Another aspect of the present invention is a method of promoting vessel growth or stabilization which includes delivering an effective amount of an inhibitor of miRNA of the present invention in an amount effective to promote vessel growth or stabilization in the manner described above.
- Yet another aspect of the present invention is a method for treating a pathological disorder in a patient which includes administering an inhibitor of miRNA of the invention in an amount effective to treat the pathological disorder by promoting vessel growth or stabilization in the manner described above.
- the pathological disorder relates to endothelial cell apoptosis or necrosis.
- An example of such a pathological disorder is vasculitis.
- the pathological disorder of the present invention is a vascular proliferative disease.
- Suitable vascular proliferative diseases include hemangiomas and proliferative retinopathy.
- the pathological disorder is cancer.
- non-Hodgkin's lymphoma Hodgkin's lymphoma
- leukemia e.g., acute leukemia such as acute lymphocytic leukemia, acute myelocytic leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma
- colon carcinoma rectal carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, cervical cancer, testicular cancer, lung carcinoma, bladder carcinoma, melanoma, head and neck cancer, brain cancer, cancers of unknown primary site, neoplasms, cancers of the peripheral nervous system, cancers of the central nervous system, tumors (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordom
- tumors e.g., fibros
- the subject of the invention may be a mammalian subject, such as a human.
- the technology may also be used in model animals, such as mouse models of a disease.
- the claimed miRNA molecules or its inhibitors are preferably provided as a pharmaceutical composition.
- This pharmaceutical composition comprises as an active agent at least one nucleic acid molecule as described above and optionally a pharmaceutically acceptable carrier.
- the administration of the pharmaceutical composition may be carried out by known methods, wherein a nucleic acid is introduced into a desired target cell in vitro or in vivo.
- the composition may be in form of a solution, e.g. an injectable solution, a cream, ointment, tablet, suspension or the like.
- the composition may be administered in any suitable way, e.g. by injection, by oral, topical, nasal, rectal application etc.
- the carrier may be any suitable pharmaceutical carrier.
- a carrier is used, which is capable of increasing the efficacy of the miRNA molecules to enter the target-cells.
- Suitable examples of such carriers are liposomes, particularly cationic liposomes.
- the choice of delivery system may depend of the number and type of subjects to be treated.
- the method and pharmaceutical composition of the invention may be used to treat a human or animal subject. Typically, a physician will determine the actual dosage which will be most suitable for an individual subject and it will vary with the age, weight and response of the particular subject.
- the routes for administration (delivery) in mammalian subjects may include, but are not limited to, one or more of oral (e.g. as a tablet, capsule, or as an ingestable solution), topical, mucosal (e.g. as a nasal spray or aerosol for inhalation), nasal, parenteral (e.g.
- an injectable form by an injectable form), gastrointestinal, intraspinal, intraperitoneal, intramuscular, intravenous, intrauterine, intraocular, intradermal, intracranial, intratracheal, intratumoural, intravaginal, intracerebro ventricular, intracerebral, subcutaneous, ophthalmic (including intravitreal or intracameral), transdermal, rectal, buccal, vaginal, epidural, sublingual or systemic.
- composition administered may optionally comprise a pharmaceutically acceptable carrier, diluent, excipient or adjuvant.
- a pharmaceutically acceptable carrier diluent, excipient or adjuvant.
- the choice of pharmaceutical carrier, excipient or diluent can be selected with regard to the intended route of administration and standard pharmaceutical practice.
- the pharmaceutical compositions may comprise as (or in addition to) the carrier, excipient or diluent, any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s), and other carrier agents known in the art.
- the compositions are best used in the form of a sterile aqueous solution which may contain other agents, for example enough salts or monosaccharides to make the solution isotonic with blood.
- miR-511-3p is the active strand of mouse pre-miR-511
- A Genomic region comprising the mouse miR-51 1 locus and the surrounding Mrcl gene on mouse chromosome 2, as retrieved by the UCSC (NCBB7/mm9) genome browser.
- B Stem-loop structure of the mouse pre-miR-511. miR-511 -5p and -3p sequences are shown.
- C Schematic of the proviral LV used to measure miR-511 activity (miRT-511 LV). The miRT sequences are cloned downstream to the GFP expression cassette, which is regulated by a bidirectional PGK promoter.
- D Schematic of the proviral LV used to overexpress miR-511 (SFFV.miR-51 1 LV). The sequence of the primary miR-511 is cloned within the EFla intron, downstream to a SFFV promoter.
- E miR-511 -5p and -3p activity in 293T cells overexpressing miR-511.
- the cells are transduced with the SFFV.miR-511 (overexpressing) LV and subsequently with the miRT- 511-5p, -3p or no-miRT (GFP-reporter) LVs.
- Dot plots show GFP and ALNGFR expression from the indicated GFP-reporter LVs.
- F Stem-loop structures of the mouse pre-miR-511 and pre-miR-511-mut.
- miR-511 -5p and - 3p sequences are shown together with mutated nucleotides. Note that both pre-miR-511 and pre-miR-511-mut generate a wild-type miR-511 -5p sequence upon processing of the pre- miRNA.
- ROCK2 is a direct target of both mouse and human miR-511-3p
- A Firefly luciferase activity in 293T cells untransduced or overexpressing either mouse miR- 511 or -511-mut.
- the 3'-UTR of mouse Pdpn, Sema3a, Rock2 (miR-511-3p target genes) and CD 163 (a miR-511-3p non-target gene) were tested, together with a UTR-less plasmid (miRGLO).
- the Rock2 UTR was split into 2 fragments (Rock2(l) and Rock2(2)).
- E miR-511 -3p and -5p activity in U937 cells either overexpressing human miR-511 or -511 - mut.
- Statistical analysis of the data was performed on fold- repression values by Two-Way ANOVA with Bonferroni post-test. ***: p ⁇ 0.001.
- F Western blot analysis of ROCK2 in U937 cells either overexpressing human miR-511 or - 511-mut. One representative blot is shown on the left. The scatter plot shows intensity of ROCK2 signal (arbitrary units [a.u.] vs. GAPDH; 9 independent experiments). Statistical analysis of the data by paired Student's t-test. *: p ⁇ 0.05.
- A: LLC growth in mice either overexpressing miR-51 lor -511-mut in hematopoietic cells. Data show tumor volumes (mean values ⁇ SEM; n 11 mice/group). Statistical analysis of the data by unpaired Student's t-test. **: p ⁇ 0.01; ***: p ⁇ 0.001. One representative experiment of two performed is shown.
- G-I Cumulative distribution of fold-changes in the whole transcriptome (13,747 genes; transcripts with less than 10 reads and miR-51 l-3p predicted targets were excluded) of TAMs overexpressing miR-511 (vs. -511-mut). Also shown are the cumulative distribution of fold- changes in transcripts that contain M8-A1 8mer target sites for miR-511-3p, -5p or -3p-mut. Also shown are the cumulative distribution of fold-changes in transcripts that contain M8 7mer target sites for miR-511-3p, -5p or -3p-mut. Note the global repression of miR-511-3p target genes.
- J Cumulative distribution of fold-changes in the whole transcriptome (16,355 genes) of TAMs overexpressing miR-511 (vs. -51 1 -mut). Also shown are the cumulative distribution of fold-changes in the transcripts that are upregulated in MRC1 + TAMs (vs. CDl lc + TAMs; 1,365 genes); also shown are the cumulative distribution of fold-changes in the transcripts that are upregulated in CDl lc + TAMs (vs. MRC1 + TAMs; 1,596 genes).
- FIG. 5 (related to Figure 1). Immunophenotyping of P388D1 and RAW monocytic cells and gene expression in MRC1 + and CDllc + TAMs.
- P388D1 cells were stained with the indicated antibodies to measure the expression of myeloid (CDl lb, CDl lc), monocyte-macrophage (F4/80), B-cell (CD19) and T-cell (CD3) markers (top row). Unstained cells (fluorescence-minus one, FMO) are shown in the bottom row. RAW cells were stained with the indicated antibodies to measure the expression of myeloid (CDl lb, CDl lc), monocyte-macrophage (F4/80) and T-cell (CD3) markers (top row). Unstained cells (FMO) are shown in the bottom row. Note that both P388D1 and RAW cells express the monocyte-macrophage-specific marker, F4/80.
- FIG. 6 (Related to Figure 2). Identification of tumor-infiltrating hematopoietic cells in LLCs.
- CDl lb + MRC CDl lc ⁇ GR ⁇ TAMs CDl lb + CDl lc + MRCrGR ⁇ TAMs
- Figure 7 (Related to Figure 3). Stem-loop structures of the human pre-miR-511 and pre- miR-51 l-mut.
- niiR-511-5p and -3p The sequence of niiR-511-5p and -3p are shown. Mutated nucleotides are shown. Note that both pre-miR-511 and pre-miR-51 l-mut generate a wild-type miR-511-5p sequence upon processing of the miRNA.
- FIG 8 (Related to Figure 4). Hematopoietic chimerism in the blood and identification of tumor-infiltrating hematopoietic cells in LLCs of miR-511-overexpressing mice.
- Predicted mmu-miR-511-3p target genes Predicted mouse miR-511-3p target genes were retrieved by using two distinct bioinformatics tools, Targetscan 20 and Diana microT 21 .
- Predicted miR-511-3p target genes human
- Predicted human miR-5 l l-3p target genes were retrieved by using two distinct bioinformatics tools, Targetscan 20 and Diana microT 21 .
- Table 4 Clusterization of predicted miR-511-3p target genes by DAVID Bioinformatic Resources 6.7 (human). Terms correspond to biological processes annotated in the UniProtKB-GoA group (EMBL) gene ontology database (QuickGO). Table 5. Genes differentially expressed in the TAMs of SFFV.miR-511 and SFFV.miR- 511-mut mice.
- C57BL/6 and CD45.1/C57BL/6 mice were purchased by Charles River Laboratory (Calco, Milan, Italy).
- FVB/MMTV-PyMT mice were obtained from the NCI-Frederick Mouse Repository (MD) and established as a colony at the San Raffaele animal facility. All procedures were performed according to protocols approved by the Animal Care and Use Committee of the Fondazione San Raffaele del Monte Tabor (IACUC 324, 335 and 447) and communicated to the Ministry of Health and local authorities according to the Italian Law.
- miR-511 target (miRT) sequences were designed based on miRNA sequences obtained from the miRNA Registry (http ://microrna. Sanger, ac.uk/) . Oligonucleotides used to generate miRT sequences are shown in the Supplemental experimental procedures.
- miR-511 we designed (GenArt Invitrogen) DNA fragments encompassing mmu-miR-511, hsa-miR-51 1, or their mutated forms.
- MFI is the mean fluorescence activity of either GFP or ALNGFR measured by flow cytometry.
- Human 293T, mouse RAW264.7, mouse P388D1 and mouse LLC cells were maintained in Iscove's modified Dulbecco's medium (MDM; Sigma) supplemented with 10% fetal bovine serum (FBS; Gibco) and a combination of penicillin-streptomycin and glutamine.
- Human U937 cells were maintained in RPMI supplemented as above.
- RAW cells were polarized by culturing them in the presence of IL4 (20 ng/ml, Peprotech) for hrs before analysis.
- P388D1 cells were polarized by LPS (100 ng/ml, Sigma) + EFN- ⁇ (200 U/ml, Peprotech) for 7 hrs before analysis.
- miRNA sequences Human and mouse miR-511 target (miRT) sequences were designed based on miRNA sequences obtained from the miRNA Registry (http://microrna.sanger.ac.uk/). Oligonucleotides used for generating miRT sequences are shown below.
- the Sense 1 (S I), Sense 2 (S2), Antisense 1 (AS1), and Antisense 2 (AS2) oligonucleotides were annealed and ligated into the 3'-UTR of the GFP gene contained in a LV co-expressing ALNGFR and GFP from a bidirectional PGK promoter 23 .
- S I Sense 1
- S2 Sense 2
- AS1 Antisense 1
- AS2 Antisense 2
- the light grey box identifies the miR-511-5p sequence;
- the darker grey box identifies the miR-511-3p sequence;
- the mutated nucleotides are highlighted in dark grey.
- Vescicular stomatitis virus (VSV)-pseudotyped, third-generation LVs were produced by transient four-plasmid cotransfection into 293T cells and concentrated by ultracentrifugation, as described 24 .
- Expression titers of OFP- or ALNGFR-expressing LVs were determined on HeLa cells by limiting dilution.
- Vector particle content was measured by HTV-1 Gag p24 antigen immunocapture (NEN Life Science Products; Waltham, MA).
- Vector infectivity was calculated as the ratio between titer and particle content.
- Titer of 293T conditioned medium ranged from 10 6 to 10 7 transducing units/ml and infectivity from 10 4 to 10 5 transducing units/ng of p24.
- 293T, RAW264.7, P388D1, and U937 cells were transduced with LV doses ranging from 10 4 to 10 5 transducing units/ml.
- the fraction of ALNGFR + or OFP + cells was always greater than 80% (miRT reporter LVs) or 90% (overexpressing LVs) in each experiment.
- Sequential transduction was performed by (i) transducing the cells with the first LV for 12 hrs; (ii) washing and replating the cells; (iii) transducing the cells with the second LV (superinfection) on day 5-7 after the first transduction, for 12 hrs in standard conditions.
- HS PC Hematopoietic stem/progenitor cell
- BM-lin " cells) enriched in HS/PCs were isolated from BM using a cell purification kit (StemCell Technologies) and transduced by concentrated LVs, as described 25 .
- 10 6 cells/ml were pre-stimulated for 6 hours in serum-free StemSpan medium (StemCell Technologies) containing a cocktail of cytokines (IL-3 (20 ng/ml), SCF (100 ng/ml), TPO (100 ng/ml) and FLT-3L (100 ng/ml), all from Peprotech) and then transduced with miRT-reporter or miR- 511-overexpressing LVs with a dose equivalent to 10 s LV Transducing Units/ml, for 12 hours in medium containing cytokines, as described 2S . After transduction, 10 6 cells were infused into the tail vein of lethally irradiated, 5.5-week-old, female C57BL/6 mice (radiation dose: 1150 cGy split in 2 doses).
- IL-3 20 ng/ml
- SCF 100 ng/ml
- TPO 100 ng/ml
- FLT-3L 100 ng/ml
- Targetscan 20 We used two distinct bioinformatics tools, Targetscan 20 and Diana microT 21 to search for miR-511-3p target genes.
- the analysis retrieved a list of putative target genes that we analyzed by using David Bioinformatic resources 6.7 .
- Sema3A Fw primer: TGCGCCACCTCCCAAAACCTC; Rv primer:
- Pdpn Fw primer: ACAGGTTGTTCTCCCAACACATCTG; Rv primer:
- CD 163 Fw primer: GCCTTGACAGGACAGCCAGCT; Rv primer:
- Untransduced 293T cells or cells expressing exogenous miR-511 sequences were transfected using Lipofectamine 2000 (Invitrogen) with 50 ng of the pmir-GLO-bsLsed plasmids. Cells were lysed after 24 hours using the Dual-Luciferase Reporter Assay protocol (Promega). Renilla luciferase was used to normalize firefly luciferase activity.
- Mouse (P388D1, RAW) and human (U937) monocytic cell lines were transduced with the SFFV-miR-511 and -511-mut LVs, expanded in culture for at least 2 weeks, collected and directly stored at -80°C.
- Each cell line was homogenized in lOx volume of RTF A lysis buffer (lOmM Tris-Cl, pH 7.2, 150mM NaCl, lmM EDTA pH 8) with 1% Triton X-100, 1% deoxycholate, 0,1% SDS, protease and phosphatase inhibitor mixture (Roche). Samples were then diluted in Laemmli's SDS-sample buffer.
- Proteins (-60 ⁇ g) were separated by electrophoresis on 8% polyacrilamide (Sigma) gels and transferred onto trans-blot nitrocellulose membranes (Amersham). Ponceau staining (Sigma) was performed to confirm that the samples were loaded equally. The membranes were blocked in 5% nonfat dry milk in TBS-T (pH 7.4, with 0.1% Tween 20) for lh at room temperature. Primary antibodies were diluted in 3% bovine serum albumine (BSA, Sigma) in TBS-T, and the membranes were incubated overnight at 4°C.
- BSA bovine serum albumine
- the primary antibody was removed, and the blots washed in TBS- T and then incubated for 1 hr at room temperature in horseradish peroxidase-conjugated secondary antibodies (Amersham).
- the primary antibodies used were: mouse anti-ROCK2 (BD, Transduction Laboratories); mouse anti-GAPDH (Sigma). Reactive proteins were visualized using LiteBlot (Euroclone, Celbio) or SuperSignal West Femto chemiluminescence reagent (Pierce Biotechnology, Rockford, EL) and exposure to x-ray film (BioMax MR; Kodak, Rochester, NY). Each experiment was performed with samples from at least 3 independent experiments and 7 independent loadings. Results for ROCK2 were quantitated by scanning densitometry and analyzed by ImageJ software using GAPDH as an internal loading control. The intensity levels were expressed in arbitrary units (a.u.).
- LLC/3LL cells (5 x 10 6 ) were injected s.c. in syngenic C57BL76 mice, and tumors grown for 3-4 weeks. Tumor size was determined by caliper measurements, and tumor volume calculated by a rational ellipse formula (mi x mi ⁇ m 2 x 0.5236, where mi is the shorter axis and m 2 is the longer axis), as described 27 .
- tumors were taken by careful dissection, and placed in a 50% mixture of water and glycerin. At successive 24-hour intervals, the glycerin concentration was raised to 75%, then 85%, and finally pure glycerin.
- the analysis of the tumor-associated vasculature was performed on 200 ⁇ -thick slices obtained from the tumor periphery (4 slices) and inner tumor mass (4 slices) of each tumor. The whole tumor slice was photographed at low magnification (4x). Pictures for morphometric analysis were taken using a Zeiss Axio Imager connected to an Axiocam MRc5 camera (Zeiss) and analysis was performed using Neuron J application of Image J software.
- Flow cytometry used a BD FACSCanto (BD Bioscience) apparatus. All cell suspensions were incubated with rat anti-mouse FcyUm receptor (CD16/CD32) blocking antibodies (4 ⁇ ; BD Inc.) together with the antibodies listed above. After antibody staining, the cells were washed, stained with fluorochrome-labeled streptavidin (if required) and re-suspended in 7- ammo-actinomycin D (7-AAD)-containing buffer, to exclude nonviable cells from further analyses. OFP was acquired as direct fluorescence in the FL2 channel.
- Peripheral blood cells Peripheral blood cells. Peripheral blood was collected from the tail vein. After red blood cell lysis and 7-AAD vital staining, cells were immunostained with the appropriate antibodies.
- Inflammatory monocytes 7-AADXD1 lb + CDl 15 + GR1 + cells ( Figures 2 and 6);
- Granulocytes 7-AAD " CDl lb + CDl 15 ⁇ GR1 + cells ( Figures 2 and 6).
- Donor-derived hematopoietic cells 7-AAD ⁇ CD45.1 + or 7-AADXD45.1 + OFP + cells ( Figure 8).
- Tumors. LLCs were excised and made into single cell suspensions by collagenase IV (0.2 mg/ml, Worthington), dispase (2 mg/inl, Gibco) and DNasel (0.1 mg/ml, Roche) treatment in IMDM medium.
- collagenase IV 0.2 mg/ml, Worthington
- dispase 2 mg/inl, Gibco
- DNasel 0.1 mg/ml, Roche
- MRCl + TAMs 7AAD7CD45 + / GR17F4/80 " 7MRCl7CD 11C " cells ( Figures 2, 6 and 8);
- CDl lc + TAMs 7AAD7CD45 + / GR17F4/80 + /MRC17CDl lc + cells ( Figures 2, 6 and 8); Granulocytes/iMCs: 7AAD7 CD45 + / GR17F4/807MRC17CD1 lc " cells ( Figures 2, 6 and 8); Total TAMs: 7AAD7CD45 + /F4/807Grr cells ( Figure 8);
- B-cells 7AAD7CD457CD19 + ( Figure 8);
- T-cells 7AAD7CD457CD3 + ( Figure 8);
- NK-cells 7AAD7CD45 + NKl.r ( Figure 8);
- Tumors were excised, made into single-cell suspensions and stained with the antibodies listed above.
- To sort cells we used a MoFlo apparatus (Dako). After sorting, purity of the cells was always > 90%. Five-50 x 10 4 cells were obtained from each sorting session.
- Sorted TAMs were washed and lysed in QiaZol or RLT buffer (Qiagen) for total RNA extraction.
- qPCR For qPCR of mRNAs, we retrotranscribed RNA with Superscript ⁇ (Vilo kit, Invitrogen). All qPCR analyses used TaqMan probes from Applied Biosystems. qPCR (miRNA and mRNA) was run for 40 cycles in standard mode using an ABI7900HT apparatus (Applied Biosystems). The SDS 2.2.1 software was used to extract raw data (C T ) and to perform gene expression analysis. To determine gene expression, the difference (AC T ) between the threshold cycle (C T ) of each mRNA/miRNA and that of the reference gene was calculated by applying an equal threshold (0.02).
- Sequencing was performed on a HiSeq 2000 (Illumina) using paired- end cBot v2 and TraSeq SBS reagents. Libraries were sequenced using 2 x 50 bp paired-end reads, with two indexed samples run per lane, yielding 89-115 million reads (4.4-5.8 Gb) per sample. The sequencing was setup and monitored by HiSeq Control Software (HCS) version 1.1.37.19. Image analysis and base calling was performed using Illumina's real time analysis (RTA) software version 1.7.48. Reads were filtered to remove those with low base call quality using Illumina's default chastity criteria. The results were then demultiplexed and converted to fastq format files by CASAVA version 1.7.
- HCS HiSeq Control Software
- RTA real time analysis
- RNA isolated from MRC1 + and CDl lc + TAMs of LLC tumors did not undergo rRNA depletion, but was processed using the poly-T oligonucleotide coated magnetic beads provided with the Illumina TruSeq RNA Sample Preparation kit as directed by the manufacturer. RNA fragmentation with "Elute, Prime, Fragment Mix” was again performed for 4 minutes at 94°C. Sequencing was performed as above, except that 100 bp paired-end reads were generated, yielding 69-84 million reads (6.9- 8.4 Gb) per sample.
- TAMs Tumor-associated macrophages support tumor progression in mouse models of cancer 7 ' 8 .
- the protumoral functions of TAMs are thought to depend, at least in part, on their production of growth, proangiogenic and ECM-remodeling factors, which enhance tumor cell motility, activate fibroblasts, facilitate angiogenesis, and suppress antitumor activity 7 ' 8 ' 29 .
- TAMs comprise distinct subsets, which appear to contribute differentially to tumor progression.
- MRC1 + TAMs express a gene signature that is consistent with proangiogenic, tissue-remodelling and protumoral functions.
- CDl lc + TAMs express a proinflammatory and angiostatic phenotype, and perhaps exert antitumoral functions 9 ' 10 ' 12 - 13 .
- TAM phenotypes 7 ' 8,29 the intrinsic signals that modulate pro- vs. antitumoral functions of the distinct TAM subsets are poorly defined.
- the mouse Mrcl gene which is highly expressed by protumoral TAMs 7 , contains a precursor miRNA sequence, pre-miR-511, located within the fifth intron of the gene ( Figure 1A).
- the pre-miR-511 is processed by Dicer into both miR-51 1-5p (located at the 5 '-end of the pre- miRNA) and miR-51 l-3p (located at the 3 '-end of the pre-miRNA) mature miRNAs ( Figure IB).
- LV lentiviral vector
- the microRNA machinery will degrade the miRT-containing GFP transcript only in cells that express the cognate miRNA, in a manner that is dependent on miRNA abundance and/or activity.
- expression of ALNGFR is independent on miRNA activity and is used as an internal normalizer to calculate GFP suppression by the miRNA of interest 30 .
- HS/PC hematopoietic stem/progenitor cell
- miR-511 -3p is the active strand of the mouse pre-miR-511, and demonstrate that endogenous miR-511 -3p is preferentially active in MRC1 + TAMs among tumor-infiltrating and circulating myeloid cells.
- Targetscan 20 and Diana microT 31 to identify miR-511 -3p predicted targets.
- the analysis retrieved a list of 145 genes (Table 1) that we analyzed by David Bioinformatic resources 6.7 26 . A significant proportion of these genes are involved in biological processes related to "cell morphogenesis" (Table 2).
- Table 2 We then validated a panel of miR-51 l-3p predicted targets by dual-luciferase assays performed on miR-511-overexpressing RAW cells.
- ROCK2 is a serine/threonine kinase that regulates actin stress fibers and focal adhesions; it was recently shown to play important mechanoregulatory functions by linking the contractility of the cell cytoskeleton to external forces generated by the ECM, and to regulate collagen biosynthesis 1,s2 .
- miR-511 -3p downregulated ROCK2 both at the protein ( Figure 3B) and mRNA ( Figure 3C) level. Together, these data strongly suggest that ROCK2 is a direct target of mouse miR-51 l-3p.
- the human MRC1 gene also contains a miR-511 sequence (hsa-miR-511) located in the fifth intron of the gene.
- miR-511 sequence hsa-miR-5111 located in the fifth intron of the gene.
- the mature miR-511 -3p but not -5p sequence is conserved in M. musculus and H. sapiens ( Figure 3D).
- Figure 3D We then asked whether miR-511 -3p activity is conserved in the two species.
- miR-511- 3p is the active strand of the human pre-miR-511 (Figure 7).
- predicted targets of the human miR-511 -3p (Table 3) comprise genes involved in biological processes related to "cell morphogenesis” (Table 4).
- human miR-511 -3p downregulated ROCK2 in U937 cells ( Figure 3F).
- miR-51 1-3p overexpression neither affected the recruitment of F4/80 + TAMs (which represent up to 60% of all tumor-infiltrating hematopoietic cells in this tumor model), GR1 + neutrophils, NEC, T and B-cells to the tumors (Figure 8B), nor the relative frequency of MRC1 + and CD1 lc + TAM subsets (Figure 8C).
- miRNA seed/3'-UTR interactions comprise M8-A1 8mers (the mRNA sequence binds to the miRNA from position 2 to 8 and contains an Adenosine in position 1) and M8 7mers (the mRNA sequence matches the miRNA from position 2 to 8) I4 .
- Serpinhl a chaperon protein for collagen export, and caveolin-1 ⁇ Cavl
- a component of the endocytic caveolae and important regulator of ECM remodeling 33 were also downregulated.
- Downregulated genes further included genes that regulate the synthesis and remodeling of the ECM, such as TGFb-family proteins ⁇ gfbrS, Bmpl, Bmprla, Ltbpl) and macrophage scavenger receptors ⁇ Sparc, Mrc2 and ScaraS).
- MRC1 + TAMs are protumoral and express a distinguishing gene signature in mouse models of cancer 7,9 ''°.
- miR- 51 l-3p overexpression in TAMs inhibited tumor growth by decreasing their protumoral activity.
- CDl lc + TAMs Figure 4J; Table 9.
- genes globally upregulated in MRC1 + vs. CDl lc + TAMs identify the protumoral gene signature of TAMs 7 ' 29 , these findings may imply that miR-51 l-3p negatively regulates the protumoral genetic programs of MRC1 + TAMs - at least in part - by decreasing their production of ECM/ECM-remodeling proteins.
- ECM fibrous proteins are mainly produced by epithelial cells and fibroblasts in tumors 2 ' 4 , there is also evidence that several ECM genes, such as collagens, are robustly expressed by in vitro cultured macrophages 5 . However, the significance of TAM-produced ECM fibrous proteins for tumor progression and vascularization has been largely ignored.
- miR-51 1 -3p upregulation in TAMs (i) downregulates Rock2; (ii) reduces the expression of several genes involved in ECM synthesis and remodelling, including collagens, other fibrous proteins, proteases and scavenger receptors; (iii) broadly and specifically attenuates the expression of genes that define the protumoral gene signature of MRC1 + TAMs; (iv) dysregulates tumor blood vessel morphogenesis; and (v) reduces tumor growth.
- ROCK2 has been identified recently as a key mechanoregulatory element that integrates physical cues from the ECM (e.g., extra-cellular tension) with cell's cytoskeletal contractility to regulate cell behaviour 1 ' 32 .
- constitutive ROCK activation in epithelial cells induces ⁇ -catenin stabilization, cell hyperproliferation, enhanced collagen synthesis and ECM stiffening, leading to increased tumor incidence and progression 2 ' 3 .
- the composition and biophysical properties of the ECM also influence vascular morphogenesis in tumors 34 . Indeed, ECM density regulates the extension speed of vascular sprouts, and a high matrix- fiber anisotropy (i.e., directional tension) provides strong contact guidance cues for endothelial cells and stimulates sprout branching 34 .
- Certain tumor or T-cell cytokines can upregulate the expression of Mrcl in TAMs 7 ' 29 and induce them to acquire protumoral functions 35 .
- the contextual upregulation of miR-51 l-3p in MRC1 + TAMs may thus function as a cell-autonomous, negative feed-back mechanism that limits their protumoral functions.
- MRC1 + TAMs mostly reside around angiogenic blood vessels and regulate vascular growth by yet poorly defined paracrine signals likely involving cell-to-cell contacts with endothelial cells and their "guidance" to form complex vascular networks 36 ' 37 .
- MRC1 + TAMs represent a major component of the perivascular tumor stroma and support vascular morphogenesis in tumors 7 ' 36 , intrinsic modulation of ROCK2 and ECM-protein synthesis/remodeling by miR-511 -3p in MRC1 + TAMs may have the potential to influence loco-regional ECM dynamics and blood vessel morphogenesis in the tumor microenvironment.
- Table 1
- Dcun1d3 DCN1 defective in cullin neddylation 1 , domain containing 3 (S. cerevisiae)
- GABA Gabrb3 gamma-aminobutyric acid
- Galnt7 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)
- Gjb1 gap junction protein beta 1 , 32kDa
- Grm1 glutamate receptor metabotropic 1 Gtdd glycosyltransferase-like domain containing 1
- H22ra2 interleukin 22 receptor, alpha 2
- Map3k12 mitogen-activated protein kinase kinase kinase 12
- Met met proto-oncogene hepatocyte growth factor receptor
- Mfap3 microfibrillar-associated protein 3 [Source:MGI Acc:MGI:1924068]
- Necabl EF hand calcium binding protein 1 [Source:MGI Acc:MGI:1916602]
- Nrf1 nuclear respiratory factor 1 Nrf1 nuclear respiratory factor 1
- Pcsk2 proprotein convertase subtilisin/kexin type 2
- RNA III DNA directed polypeptide K [Source:MGI Acc:MGI:1914255]
- Prpf40a PRP40 pre-mRNA processing factor 40 homolog A S. cerevisiae
- Rabgapll RAB GTPase activating protein 1 -like [Source: GI Acc: GI:1352507]
- Sema3a sema domain immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A
- Slc29a3 solute carrier family 29 (nucleoside transporters)
- Slc4a4 solute carrier family 4 sodium bicarbonate cotransporter, member 4
- Slc7a2 solute carrier family 7 (cationic amino acid transporter
- Slc8a1 solute carrier family 8 sodium/calcium exchanger
- Spry2 sprouty homolog 2 (Drosophila)
- Tfap2b transcription factor AP-2 beta activating enhancer binding protein 2 beta
- Tjp1 tight junction protein 1 [Source:MGI Acc:MGI:98759]
- Tnfrsf21 tumor necrosis factor receptor superfamily member 21
- Treml2 triggering receptor expressed on myeloid cells-like 2 [Source:MGI Acc: GI:2147038]
- Tsc22d3 TSC22 domain family member 3
- Predicted mmu-miR-511-3p target genes were retrieved by using two distinct bioinformatics tools, Targetscan (Lewis et al., 2005) and Diana microT (Maragkakis et al., 2009).
- cell projection organization 12 9,1 2.70E-05 5 neuron projection development 10 7,6 3.80E-05 6,1 cell projection morphogenesis 9 6,8 1 ,40E-04 5,9 cell part morphogenesis 9 6,8 1 ,90E-04 5,6 axonogenesis 8 6,1 2.20E-04 6,5 cellular component morphogenesis 1 1 8,3 3.00E-04 4,1 neuron projection morphogenesis 8 6,1 3,60E-04 6 cell morphogenesis involved in neuron differentiation 8 6,1 4,40E-04 5,8 cell morphogenesis 10 7,6 5.20E-04 4,3 regulation of cell migration 6 4,5 6.30E-04 8,6
- Alcohol dehydrogenase 1 B (EC 1.1.1.1) (Alcohol dehydrogenase beta subunit).
- ADH1B,ADH1C [Source:Uniprot/SWISSPROT Acc:P00325]
- Annexin A11 (Annexin-11 ) (Annexin XI) (Calcyclin-associated annexin 50) (CAP-50) (56
- ARPP-21 cyclic A P-regulated phosphoprotein, 21 kD
- CALM1 calmodulin 1 (phosphorylase kinase, delta)
- Catenin delta-2 (Delta-catenin) (Neural plakophilin-related ARM-repeat protein) (NPRAP)
- DCUN1D3 DCN1 defective in cullin neddylation 1 , domain containing 3 (S. cerevisiae)
- DRP Density-regulated protein
- DIP2B DIP2 disco-interacting protein 2 homolog B Disks large-associated protein 2 (DAP-2) (SAP90/PSD-95-associated protein 2) (SAPAP2) (PSD-95/SAP90-binding protein 2) (Fragment).
- EGR-3 Early growth response protein 3 (EGR-3) (Zinc finger protein pilot).
- EIF1B eukaryotic translation initiation factor 1 B
- ETF1 eukaryotic translation termination factor 1
- Heparin-binding growth factor 2 precursor (HBGF-2) (Basic fibroblast growth factor)
- FGF2 FGF2 (BFGF) (Prostatropin). [Source:Uniprot/SWISSPROT Acc:P09038]
- GABA gamma-aminobutyric acid
- GALNT7 (GalNAc-T7)
- GJB1 gap junction protein beta 1 , 32kDa
- GLI3 GLI-Kruppel family member GLI3 (Greig cephalopolysyndactyly syndrome)
- Glutamate [NMDA] receptor subunit epsilon-1 precursor N-methyl D- aspartate receptor
- GRIN2A subtype 2A (NR2A) (NMDAR2A) (hNR2A).
- GRM1 glutamate receptor, metabotropic 1
- GTDC1 glycosyltransferase-like domain containing 1
- HMG2L1 high-mobility group protein 2-like 1
- Heterogeneous nuclear ribonucleoprotein AO (hnRNP AO).
- MAML1 mastermind-like 1 (Drosophila)
- MAP3K12 mitogen-activated protein kinase kinase kinase 12
- MAP4K3 mitogen-activated protein kinase kinase kinase kinase kinase 3
- NEGRI neuronal growth regulator 1 NEGRI neuronal growth regulator 1
- NUAK1 NUA family SNF1-like kinase
- PAPOLB poly(A) polymerase beta (testis specific)
- Protocadherin-11 X-linked precursor Protocadherin-11 ) (Protocadherin on the X
- PCDH11X chromosome PCDH-X
- PCDH-S Protocadherin-S
- PCGF5 [Source:Uniprot/SWISSPROT Acc:Q86SE9]
- PCSK2 proprotein convertase subtilisin/kexin type 2
- PIK3CD phosphoinositide-3-kinase catalytic, delta polypeptide
- PPARGC1A peroxisome proliferator-activated receptor gamma coactivator 1 alpha PPP1R2 protein phosphatase 1 , regulatory (inhibitor) subunit 2
- PRKAG2 protein kinase AMP-activated, gamma 2 non-catalytic subunit
- PRPF40A PRP40 pre-mRNA processing factor 40 homolog A S. cerevisiae
- Receptor-type tyrosine-protein phosphatase T precursor (EC 3.1.3.48) (R-PTP-T) (RPTP-
- RAB3A-interacting protein (Rabin-3) (SSX2-interacting protein).
- Rho-related GTP-binding protein RhoQ precursor (Ras-related GTP-binding protein
- ROB02 roundabout axon guidance receptor
- homolog 2 homolog 2 (Drosophila)
- SLC12A6 solute carrier family 12 (potassium/chloride transporters), member 6
- SLC2A12 solute carrier family 2 (facilitated glucose transporter), member 12
- ADIP alpha-actinin-binding protein
- SV2B Synaptic vesicle glycoprotein 2B. [SourceiUniprot/SWISSPROT Acc:Q7L112]
- TBC1 domain family member 23 HCV non-structural protein 4A- transactivated protein 1 .
- TFAP2B transcription factor AP-2 beta activating enhancer binding protein 2 beta
- TNFRSF21 tumor necrosis factor receptor superfamily member 21
- TSC22D3 TSC22 domain family member 3
- TSHZ1 teashirt zinc finger homeobox 1
- TTC39A tetratricopeptide repeat domain 39A
- UBP1 upstream binding protein 1 (LBP-1 a)
- ZNF248 zinc finger protein 248
- ZNF518B zinc finger protein 518B
- ZNF536 zinc finger protein 536
- Predicted miR-511-3p target genes (human).
- Predicted human miR-511- 3p target genes were retrieved by using two distinct bioinformatics tools, Targetscan (Lewis et al., 2005) and Diana microT (Maragkakis et al., 2009).
- transcription 40 23,4 4J0E-05 1 ,9 regulation of transcription 44 25,7 2,60E-04 1 ,7
- Bioinformatic Resources 6.7 human. Terms correspond to biological processes annotated in the UniProtKB-GoA group (EMBL) gene ontology database (QuickGO).
- Rhobtb3 0.5 3.1E-04 3.0E-02
- Nrxnl Acot3 Mtap2 Cstf2 Heatr5a Mstn
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
A method for reducing angiogenesis or tumor growth in a subject or tissue comprising administering to the subject or tissue an effective amount of miR-511-3-p.
Description
MiR A
Field of the Invention
The present invention relates to methods and compositions involving microRNA (miR As) molecules. Certain aspects of the invention relate to applications of miRNA therapy for diseases or conditions that involve angiogenesis. Certain aspects of the invention relate to applications of miRNA therapy for diseases or conditions associated with tumours.
Background
The term "angiogenesis" (also referred to as "neovascularisation") is a general term used to denote the growth of new blood vessels both in normal and pathological conditions.
Angiogenesis is an important natural process that occurs during embryogenesis, fetal and post-natal growth and in the adult healthy body in the process of wound healing, and in restoration of blood flow back into injured tissues. In females, angiogenesis also occurs during the monthly reproductive cycle to build up the uterus lining and to support maturation of oocytes during ovulation, and in pregnancy when the placenta is formed, in the process of the establishment of circulation between the mother and the fetus.
In the therapeutic field, there has been in recent years a growing interest in the control of angiogenesis. In one aspect, the aim was to control or diminish excessive and pathological angiogenesis that occurs in diseases such as cancer, diabetic blindness, age related macular degeneration, rheumatoid arthritis, psoriasis, and additional conditions. In these pathological conditions the new blood vessels feed the diseased tissue, for example the tumor tissue, providing it with essential oxygen and nutrients thus enabling its pathological growth. In addition, the pathological angiogenesis may destroy the normal tissue. Furthermore, the new blood vessels, formed for example in the tumor tissue, enable the tumor cells to escape into the circulation and metastasize in other organs.
Typically, excessive angiogenesis occurs when diseased cells produce abnormal amounts of angiogenetic growth factors, overwhelming the effect of the natural angiogenesis inhibitors present in the body.
Anti-angiogenetic therapies developed recently, are aimed at preventing new blood vessel growth through the targeting and neutralization of any of the stimulators that encourage the formation of new bl ood vessels.
A contrasting indication of regulating angiogenesis is the stimulation of production of neovascularization in conditions where insufficient angiogenesis occurs. Typically, these conditions are diseases such as coronary artery diseases, stroke, and delayed wound healing (for example in ulcer lesions). In these conditions, when adequate blood vessels growth and circulation is not properly restored, there is a risk of tissue death due to insufficient blood flow. Typically, insufficient angiogenesis occurs when the tissues do not produce adequate amounts of angiogenetic growth-factors, and therapeutic angiogenesis is aimed at stimulating new blood vessels' growth by the use of growth factors or their mimics.
There is a continuing need to provide treatments for disorders associated with excessive angiogenesis or for promoting new blood vessel growth.
There is also a continuing need to kill cells, inhibit cell growth, inhibit metastatis, decrease tumor or tissue size, and/or reduce the malignancy of cells.
The present invention seeks to provide a solution to the aforementioned needs.
Summary of the Invention
In summary, we show that miR-511 -3p upregulation in TAMs (i) downregulates Rock2; (ii) reduces their expression of several ECM genes, including collagens and other fibrous proteins; (iii) broadly and specifically attenuates the expression of genes that define the protumoral gene signature of MRC1+ TAMs; (iv) reduces tumor growth in mice. Of note, constitutive ROCK activation in epithelial cells induces β-catenin stabilization, cell hyperproliferation, and enhanced collagen synthesis and ECM stiffening, leading to increased tumor incidence and
progression1. Because TAMs represent a major component of the tumor stroma, their modulation of ROCK2 and ECM-protein synthesis by miR-5 l l-3p may have the potential to influence stromal dynamics in the tumor microenvironment.
Statements of the Invention
According to one aspect of the present invention there is provided a method for stimulating angiogenesis in a subject or tissue comprising administering to the subject or tissue an effective amount of an inhibitor of miR-511, preferably an inhibitor of miR-511 -3 -p, or an inhibitor of a nucleic acid molecule comprising an miRNA sequence that is or comprises miR-511-3-p.
According to another aspect of the present invention there is provided a method for reducing angiogenesis in a subject or tissue comprising administering to the subject or tissue an effective amount of a nucleic acid molecule comprising a miRNA sequence that is or comprises miR-511-3-p.
According to another aspect of the present invention there is provided a method for inhibiting tumor growth in a subject or tissue comprising administering to the subject or tissue an effective amount of a nucleic acid molecule comprising a miRNA sequence that is or comprises miR-511 -3-p.
Thus, the present invention is directed to and relates to uses of miR-511-3-p, and not miR- 51 l-5p and modulators, including inhibitors thereof. The miR-51 1 -3p active strand of the present invention is:
AAUGUGUAGCAAAAGACAGAAU (human miR-51 l-3p sequence, or hsa-miR- 511-3p)
AAUGUGUAGCAAAAGACAGGAU (mouse miR-51 l-3p sequence, or mmu-miR- 511-3p)
In yet another aspect of the present invention there is provided a method for selecting an angiogenesis therapy for a patient comprising: measuring an expression profile of miR-511 of the invention, optionally in a sample; and selecting a therapy based on a comparison of the
miRNA expression profile in the patient sample to an expression profile of a normal or nonpathogenic sample, wherein a difference between the expression profiles is indicative of a pathological condition. An altered expression for the miRNA may indicate that the patient should be treated with a coiTesponding therapeutic directed towards the altered miRNA or condition indicated by such altered miRNA.
In another aspect of the present invention there is provided a method for assaying a cell or a sample for the presence of the miR-511 of the present invention. In some embodiments, the method includes a step of generating a miRNA profile for a sample. The term "miRNA profile" refers to data regarding the expression pattern of a miRJSTA(s) in the sample (including the miRNA of the invention). The miRNA profile can be obtained using known hybridization techniques.
In one embodiment of the invention, a miRNA profile is generated by steps that include one or more of: (a) labeling miRNA in the sample; (b) hybridizing miRNA to a number of probes, or amplifying a number of miRNAs, and/or (c) determining miRNA hybridization to the probes or detecting miRNA amplification products, wherein miRNA expression levels are determined or evaluated.
Methods of the invention include determining a diagnosis or prognosis for a patient based on miRNA expression or expression levels, hi certain embodiments, the elevation or reduction in the level of expression of the miRNA of the present invention or set of miRNAs including the miRNA of the present invention in a cell is correlated with a disease state as compared to the expression level of that miRNA or set of miRNAs in a normal cell or a reference sample or digital reference. This correlation allows for diagnostic methods to be carried out when the expression level of a miRNA is measured in a biological sample being assessed.
Methods can further comprise normalizing the expression levels of miRNA. Normalizing includes, but is not limited to adjusting expression levels of miRNA relative to expression levels of one or more nucleic acid in the sample.
Embodiments of the invention include methods for diagnosing, assessing a condition, and/or prognosing a disease or condition associated with or having an accompanying aberrant
vascularization in a patient comprising evaluating or determining the expression or expression levels of one or more mi'RNAs, including the miRNA of the present invention, in a sample from the patient. The difference in the expression in the sample from the patient and a reference, such as expression in a normal or non-pathologic sample, is indicative of a pathologic or diseased condition associated with neovascularization and/or angiogenesis. In certain aspects the miRNA expression level is compared to the expression level of a normal cell or a reference sample or a digital reference. Comparing miRNA expression levels includes comparing miRNA expression levels in a sample to miRNA expression levels in a normal tissue sample or reference tissue sample. A normal tissue sample can be taken from the patient being evaluated and can be a normal adjacent tissue to the area being assessed or evaluated.
Embodiments of the invention include kits for analysis of a pathological sample by assessing a miRNA profile for a sample comprising, in suitable container means, one or more miRNA probes and/or amplification primers, wherein the miRNA probes detect or primer amplify one or more miRNA described herein.
The invention also relates to a recombinant expression vector comprising a recombinant nucleic acid operatively linked to an expression control sequence, wherein expression, i.e. transcription and optionally further processing results in a miRNA-molecule or miRNA precursor molecule as described above. The vector is preferably a DNA-vector, e.g. a viral vector or a plasmid, particularly an expression vector suitable for nucleic acid expression in eukaryotic, more particularly mammalian cells. The recombinant nucleic acid contained in said vector may be a sequence which results in the transcription of the miRNA-molecule as such, a precursor or a primary transcript thereof, which may be further processed to give the miRNA-molecule .
The present invention also includes compositions comprising the miRNA of the invention or inhibitors thereof.
Further, the miRNA molecules of the present invention may act as target for therapeutic screening procedures, e.g. inhibition or activation of miRNA molecules might modulate a cellular differentiation process, e.g. apoptosis.
The present invention further relates to a method for identifying a proangiogenic cell comprising detecting the expression of the miRNA of the present invention.
Detailed Description
The practice of the present invention will employ, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA and immunology, which are within the capabilities of a person of ordinary skill in the art. Such techniques are explained in the literature. See, for example, J. Sambrook, E. F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, F. M. et al. (1995 and periodic supplements; Current Protocols in Molecular Biology, ch. 9, 13, and 16, John Wiley & Sons, New York, N.Y.); B. Roe, J. Crabtree, and A. Kahn, 1996, DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons; J. M. Polak and James O'D. McGee, 1990, In Situ Hybridization: Principles and Practice; Oxford University Press; M. J. Gait (Editor), 1984, Oligonucleotide Synthesis: A Practical Approach, Irl Press; D. M. J. Lilley and J. E. Dahlberg, 1992, Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology, Academic Press; and E. M. Shevach and W. Strober, 1992 and periodic supplements, Current Protocols in Immunology, John Wiley & Sons, New York, NY. Each of these general texts is herein incorporated by reference.
Background
The intrinsic signals that regulate pro- versus antitumoral activity of macrophages are poorly defined. By measuring microRNA (miRNA) activity in live cells, here we show that miR- 511-3p, a previously uncharacterized miRNA contained within the mannose receptor (Mrcl) gene, is the active strand of both mouse and human miR-511 and is specifically upregulated in protumoral, MRC1+ tumor-associated macrophages (TAMs). Unexpectedly, miR-511 -3p overexpression in TAMs inhibited tumor growth. miR-511 -3p targeted Rho-dependent- kinase2 (Rock2), decreased TAM expression of extra-cellular matrix (ECM) genes, and tuned-down the protumoral "gene signature" of MRC1+ TAMs. These data suggest that miR- 51 l-3p may function as a gate-keeper of protumoral-TAM's genetic programs.
The composition and biophysical properties of the ECM influence tumor growth. Increased
collagen deposition and ECM density/stiffness stimulate tumor cell proliferation, invasion and malignancy 2 3. Although ECM fibrous proteins are mainly produced by epithelial cells and fibroblasts in tumors 2'4, there is also evidence that several collagen genes are robustly expressed by in vitro cultured macrophages 5. Macrophage deficiency impairs tissue remodeling, angiogenesis and growth both during organ healing 6 and tumor progression 7'8. The protumoral functions of TAMs are thought to depend, at least in part, on their production of growth, proangiogenic and ECM-remodeling factors (e.g., collagenases), which enhance tumor cell motility, activate fibroblasts and facilitate angiogenesis 7'8. The significance of TAM-produced collagens for ECM homeostasis in cancer is currently unknown.
TAMs may exert either pro- or antitumoral functions 7'8. In the mouse, TAMs can be divided into at least two main subsets: MRCl+CDl lc~ and CDl lc+MRCllow macrophages. MRC1+ TAMs express a gene signature that is consistent with enhanced proangiogenic, protumoral and tissue-remodelling activity and lower proinflammatory activity compared to CDl lc1 TAMs 7,9,10. These MRC1+ TAMs are reminiscent of M2 -polarized, "alternatively activated" macrophages u. On the other hand, CDl lc+ TAMs express higher levels of proinflammatory mediators and angiostatic cytokines than MRC1+ TAMs 7'9,10, have antiangiogenic and antitumoral activity 12'13, and display features of Ml-polarized, "classically activated" macrophages 11. Although several bioeffector molecules have been identified that may account for the protumoral activity of M2-like TAMs 1 , little is known of the intrinsic signals that modulate TAM' s pro- vs. antitumoral functions. miRNAs are single stranded RNAs of -22 nt in length that are generated from endogenous hairpin-shaped transcripts (primary miRNAs). The unique combination of miRNAs expressed in each cell type determines the fine tuning of hundreds of mRNAs, thus regulating gene expression and cell function 14. Although several miRNAs are highly expressed in human macrophages cultured in vitro 15'16, little is known of the miRNA expression profile of TAMs and their subsets. Here, we describe and characterize a novel miRNA, miR-511-3p, that is embedded within the fifth intron of the mouse/human Mrcl/MRCl gene and that is specifically and highly expressed in MRC1+ TAMs among tumor-infiltrating myeloid cells.
miRNA
There are two major classes of small RNAs that are characteristic of RNAi: (i) first is the small interfering RNAs (siRNAs) which are 21-23 fully base-paired duplexes which interact
with perfect base-pairing with a region of the messenger RNA transcript triggering its specific degradation through the RNA-induced silencing complex (RISC) (Rana, T. M. (2007)Nat Rev Mol Cell Biol 8, 23-36). The technology and application of silencing of specific genes and viruses using siRNAs is progressing steadily and several trials are in progress (Aagaard, L. & Rossi, J. J. (2007) Adv Drug Deliv Rev 59, 75-86; de Fougerolles et al (2007) Nat Rev Drug Discov 6, 443-53). These are usually induced by polymerase ΠΙ promoters (e.g. U6, HI etc) from short hairpin RNA (shRNA) expression vectors, (ii) Second is the microRNAs (miRNA) which are 21-23 base duplexes that are usually base-paired incompletely forming partial duplexes within the 3' untranslated region (UTR) of targeted transcripts through RISC resulting in the inhibition of translation. Several miRNAs have been identified in different species (Griffiths-Jones et al (2008) Nucleic Acids Res 36, D154-8). These are thought to be expressed and regulated similar to the protein-coding genes from polymerase Π promoters, first as long primary transcripts (pri-miRNAs) (Lagos-Quintana, M. et al. (2002) Curr Biol 12, 735-9). The pri-miRNA is cleaved by the nuclear Drosha-DGCR8 complex to produce pre-miRNA, which are further processed in the cytoplasm to mature miRNA duplex. The expression of many of these miRNAs is restricted to specific cell lineages and developmental stages, and recent data suggest that they exert profound influence on gene regulation in a wide range of conditions and diseases including cancer (Skaftnesmo et al (2007) Curr Pharm Biotechnol 8, 320-5).
Thus it is now established that the unique combination of miRNAs expressed in each cell type determines the fine tuning of thousands of mRNAs14'17, thus regulating gene expression and cell function. miRNAs are single stranded RNAs (ssRNAs) of -22 nt in length that are generated from endogenous hairpin-shaped transcripts14'17. miRNAs function as guide molecules in post-transcriptional gene regulation by base pairing with target mRNAs, which are generally located in the 3' untranslated region (UTR) of the gene. Binding of a miRNA to the target mRNA generally leads to translational repression and mRNA degradation. Over one third of human genes are predicted to be directly targeted by miRNAs17. Consequently, the unique combination of miRNAs in each cell type determines the fine tuning of thousands of mRNAs'4 '7. Approximately 50% of mammalian miRNAs are generated from noncoding transcription units (TUs), whereas others are encoded in protein coding TUs17. Approximately 50% of all miRNA loci are located either in the intronic or exonic region of noncoding TUs. On the other hand, -40% of all miRNA loci are found in intronic regions of protein-coding TUs17. In the latter case, the miRNA is under the transcriptional control of the hosting gene promoter, although there may be rare cases in which individual miRNAs are derived from
separate gene promoters located within introns18. Thus, in the case of miRNAs embedded in coding genes, the expression of the miRN A most often correlates with that of the host gene19.
Modified miRNA
The present invention also encompasses the use of modified miRNA. The term "modified" is used to indicate that the genomic miRNA-encoding sequence comprises one or more mutations, such that it produces a modified pre-miRNA which is different from the pre- miRNA sequence which would have been produced, had the genomic sequence not been mutated. The genomic pre-miRNA-encoding sequence is endogenous, in the sense that its sequence, prior to modification, occurs naturally within the genome.
Detection of miRNA Expression
As set out above the present invention involves methods which employ the detection of miRNA expression. A number of techniques have been developed to determine miRNA expression and any appropriate technique may be employed in the present invention. For example, miRNA array technology offers a powerful high-throughput tool to monitor the expression of thousands of miRNAs at once. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) is another reliable and highly sensitive technique for miRNA detection, which only requires very small amounts of input total RNA. Northern blotting has also been employed to detect and validate miRNA expression levels. In addition, techniques are available to detect miRNAs by in situ hybridization. Although various miRNAs have been detected from tissue sources, these methods require invasive techniques to collect the starting material. Therefore, procedures have also been established to measure miRNA expression in blood products to enable clinical feasibility of miRNA measurement (Chen X et al Cell Res 2008, 7:2643-2646). Recently, the advent of next generation sequencing technologies allows for the measurement of the absolute abundance.
Diagnostic miRNA
As discussed above, the miRNA of the present invention may be used for the diagnosis of diseases associated with angiogensis, such as cancer. For example miRNA expression profiles
can be used to distinguish tumor from normal samples, identification of tissue of origin for tumors of unknown origin or in poorly differentiated tumors and to distinguish different subtypes of tumors. Sample datasets can be stratified to show that certain alterations of miR As occur in patients at an early stage of cancer and other angiogenesis-related disease and thus may be useful for early detection of disease. Large tissue specimens are not needed for accurate miRNA detection since their expression can be easily measured in biopsy specimens. Although studies may be conducted on tissue, recent studies have shown that miRNAs can be measured in formalin fixed paraffin embedded (FFPE) tissues. Given the invasive nature of fresh/frozen tissue collection and the availability of FFPE, this serves as a major advance in the feasibility of measuring microRNA levels for the purposes of diagnosis. miRNAs can be detected in serum, thus screening can be carried out via less invasive blood-based mechanisms.
Prognostic MiRNAs
The miRNA of the present invention may also be used in other clinical measures such as prognosis and treatment response. The miRNA of the present invention may be useful as an indicator of clinical outcome in a number of angiogenesis-related diseases, such as cancer types. In addition, the miRNA of the present invention may be used to predict the tendency for recurrence of disease.
miRNA reduction/inhibition
In one aspect of the present invention there is provided a method of use that involves inhibiting or reducing the miRNA levels or their effect. This may be achieved through a number of approaches. For example, in order to prevent the binding of miRNAs to their target sites, anti-miRNA oligonucleotides (AMOs) have been generated to directly compete with endogenous miRNAs. In addition, several modifications of AMOs have been generated to improve their effectiveness and stability such as the addition of 2'-0- methyl and 2'-Omethoxyethyl groups to the 5' end of the molecule. AMOs conjugated to cholesterol (antagomirs) have been also been generated and have been described to efficiently inhibit miRNA activity in vivo. In addition, locked-nucleic-acid antisense oligonucleotides (LNAs) have been designed to increase stability and have been shown to be highly aqueous and exhibit low toxicity in vivo. Another method for reducing the
interaction between miRNAs and their targets is the use of microRNA sponges. These sponges are synthetic mRNAs that contain multiple binding sites for an endogenous miRNA. Sponges designed with multimeric seed sequences have been shown to effectively repress miRNA families sharing the same seed sequence. Another technique is called miRmasking which uses a sequence with perfect complementarity to the target gene such that duplexing will occur with higher affinity than that between the target gene and its endogenous miRNA. The caveat of this approach is that the choice of target gene must be specific in order to effectively reduce the interaction.
Another strategy to increase specificity of effects is the use of small molecule inhibitors against specific microRNAs.
miRNA overexpression/promotion
In another aspect of the present invention there is provided a method that involves overexpressing or increasing the miRNA levels or their effect. This can be achieved e.g. through techniques such as the use of viral or liposomal delivery mechanisms. Other delivery systems include non-viral methods of gene transfer such as cationic liposome mediated systems.
MicroRNA mimics have also been used to increase miRNA expression. These small, chemically modified double-stranded RNA molecules mimic endogenous mature microRNA. These mimics are now commercially available and promising results have been reported with systemic delivery methods using lipid and polymer-based nanoparticles.
Diseases
'Treating' as used herein refers to treatment of a subject having a disease in order to ameliorate, cure or reduce the symptoms of the disease, or reduce or halt the progression of the disease.
The term 'preventing' is intended to refer to averting, delaying, impeding or hindering the contraction of a disease.
The present invention relates to' the treatment (including prevention) of angiogenesis or angiogenesis-related diseases.
Angiogenesis occurs in the healthy body for healing wounds and for restoring blood flow to tissues after injury or insult. In females, angiogenesis also occurs during the monthly reproductive cycle (to rebuild the uterus lining, to mature the egg during ovulation) and during pregnancy (to build the placenta, the circulation between mother and fetus).
In many serious diseases states the body loses control over angiogenesis. Angiogenesis- dependent diseases result when new blood vessels either grow excessively or insufficiently.
Excessive angiogenesis:
• Occurs in diseases such as cancer, diabetic blindness, age-related macular degeneration, rheumatoid arthritis, psoriasis, and more than 70 other conditions.
• In these conditions, new blood vessels feed diseased tissues, destroy normal tissues, and in the case of cancer, the new vessels allow tumor cells to escape into the circulation and lodge in other organs (tumor metastases).
• Excessive angiogenesis occurs when diseased cells produce abnormal amounts of angiogenic growth factors, overwhelming the effects of natural angiogenesis inhibitors.
• Antiangiogenic therapies, aimed at halting new blood vessel growth, are used to treat these conditions.
Insufficient angiogenesis:
• Occurs in diseases such as coronary artery disease, stroke, and chronic wounds.
• In these conditions, blood vessel growth is inadequate, and circulation is not properly restored, leading to the risk of tissue death.
• Insufficient angiogenesis occurs when tissuse cannot produce adequate amounts of angiogenic growth factors.
• Therapeutic angiogenesis, aimed at stimulating new blood vessel growth with growth factors, is being developed to treat these conditions.
The angiogenesis may be associated with, for example, tumor vascularization, retinopathies (e.g., diabetic retinopathy), rheumatoid arthritis, Crohn's disease, atherosclerosis, hyperstimulation of the ovary, psoriasis, endometriosis associated with neovascularization, restenosis due to balloon angioplasty, tissue overproduction due to cicatrization, peripheral vascular disease, hypertension, vascular inflammation, Raynaud's disease and phenomena, aneurism, arterial restenosis, thrombophlebitis, lymphangitis, lymphedema, tissue cicatrization and repair, ischemia, angina, myocardial infarction, chronic heart disease, cardiac insufficiencies such as congestive heart failure, age-related macular degeneration and osteoporosis.
Suitable pathological disorders include cardiac ischemia, atherosclerosis, renal vascular disease, stroke, a wound, placental insufficiency, unvascularized tissue related to grafts and transplants, disorders relating to endothelial cell apoptosis or necrosis, hemangiomas, proliferative retinopathy, and cancer.
The present invention also relates to a method for treating a pathological disorder in a patient which includes administering the miRNA of the invention in an amount effective to treat the pathological disorder by inducing angiogenesis in the manner described above.
In one embodiment, the pathological disorder is ischemic cardiopathy and/or cerebrovascular disorders caused by insufficient cerebral circulation.
Thrombi or emboli due to atherosclerotic or other disorders (e. g., arteritis or rheumatic heart disease) commonly cause ischemic arterial obstruction.
Γη another embodiment, the pathological disorder is a non-cardiac vascular disorder including atherosclerosis, renal vascular disease, and stroke.
In yet another embodiment, the pathological disorder is a wound. Such wounds include, but are not limited to, chronic stasis ulcers, diabetic complications, complications of sickle cell disease, thalassemia and other disorders of hemoglobin, and post-surgical wounds.
In a further embodiment, the pathological disorder is a condition of placental insufficiency. Such conditions include, but are not limited to, intrauterine growth retardation.
In yet a further embodiment, the pathological disorder unvascularized tissue related to grafts and transplants (see, e. g., PCT International Application No, WO 99/06073 to Isner, which is hereby incorporated by reference).
Another aspect of the present invention is a method of promoting vessel growth or stabilization which includes delivering an effective amount of an inhibitor of miRNA of the present invention in an amount effective to promote vessel growth or stabilization in the manner described above.
Yet another aspect of the present invention is a method for treating a pathological disorder in a patient which includes administering an inhibitor of miRNA of the invention in an amount effective to treat the pathological disorder by promoting vessel growth or stabilization in the manner described above.
In a preferred embodiment, the pathological disorder relates to endothelial cell apoptosis or necrosis. An example of such a pathological disorder is vasculitis.
In one embodiment, the pathological disorder of the present invention is a vascular proliferative disease. Suitable vascular proliferative diseases include hemangiomas and proliferative retinopathy.
In another embodiment, the pathological disorder is cancer.
Examples of types of cancer, include, but are not limited to, non-Hodgkin's lymphoma, Hodgkin's lymphoma, leukemia (e.g., acute leukemia such as acute lymphocytic leukemia, acute myelocytic leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma), colon carcinoma, rectal carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, cervical cancer, testicular cancer, lung carcinoma, bladder carcinoma,
melanoma, head and neck cancer, brain cancer, cancers of unknown primary site, neoplasms, cancers of the peripheral nervous system, cancers of the central nervous system, tumors (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, seminoma, embryonal carcinoma, Wilms' tumor, small cell lung carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, neuroblastoma, and retinoblastoma.
Subject
The subject of the invention may be a mammalian subject, such as a human.
The technology may also be used in model animals, such as mouse models of a disease.
Administration
For diagnostic or therapeutic applications, the claimed miRNA molecules or its inhibitors are preferably provided as a pharmaceutical composition. This pharmaceutical composition comprises as an active agent at least one nucleic acid molecule as described above and optionally a pharmaceutically acceptable carrier.
The administration of the pharmaceutical composition may be carried out by known methods, wherein a nucleic acid is introduced into a desired target cell in vitro or in vivo.
Commonly used gene transfer techniques include calcium phosphate, DEAE-dextran, electroporation and microinjection and viral methods [30, 31, 32, 33, 34]. A recent addition to this arsenal of techniques for the introduction of DNA into cells is the use of cationic liposomes.
Commercially available cationic lipid formulations are e.g. Tfx 50 (Promega) or Lipofectamin 2000 (Life Technologies).
The composition may be in form of a solution, e.g. an injectable solution, a cream, ointment, tablet, suspension or the like. The composition may be administered in any suitable way, e.g. by injection, by oral, topical, nasal, rectal application etc. The carrier may be any suitable pharmaceutical carrier. Preferably, a carrier is used, which is capable of increasing the efficacy of the miRNA molecules to enter the target-cells. Suitable examples of such carriers are liposomes, particularly cationic liposomes.
The choice of delivery system may depend of the number and type of subjects to be treated. The method and pharmaceutical composition of the invention may be used to treat a human or animal subject. Typically, a physician will determine the actual dosage which will be most suitable for an individual subject and it will vary with the age, weight and response of the particular subject.
The routes for administration (delivery) in mammalian subjects may include, but are not limited to, one or more of oral (e.g. as a tablet, capsule, or as an ingestable solution), topical, mucosal (e.g. as a nasal spray or aerosol for inhalation), nasal, parenteral (e.g. by an injectable form), gastrointestinal, intraspinal, intraperitoneal, intramuscular, intravenous, intrauterine, intraocular, intradermal, intracranial, intratracheal, intratumoural, intravaginal, intracerebro ventricular, intracerebral, subcutaneous, ophthalmic (including intravitreal or intracameral), transdermal, rectal, buccal, vaginal, epidural, sublingual or systemic.
The composition administered may optionally comprise a pharmaceutically acceptable carrier, diluent, excipient or adjuvant. The choice of pharmaceutical carrier, excipient or diluent can be selected with regard to the intended route of administration and standard pharmaceutical practice. The pharmaceutical compositions may comprise as (or in addition to) the carrier, excipient or diluent, any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s), and other carrier agents known in the art.
For parenteral administration, the compositions are best used in the form of a sterile aqueous solution which may contain other agents, for example enough salts or monosaccharides to make the solution isotonic with blood.
Further, the invention shall be explained in more detail by the following Figures, Tables and Examples:
Figure 1. miR-511-3p is the active strand of mouse pre-miR-511
A: Genomic region comprising the mouse miR-51 1 locus and the surrounding Mrcl gene on mouse chromosome 2, as retrieved by the UCSC (NCBB7/mm9) genome browser.
B: Stem-loop structure of the mouse pre-miR-511. miR-511 -5p and -3p sequences are shown. C: Schematic of the proviral LV used to measure miR-511 activity (miRT-511 LV). The miRT sequences are cloned downstream to the GFP expression cassette, which is regulated by a bidirectional PGK promoter.
D: Schematic of the proviral LV used to overexpress miR-511 (SFFV.miR-51 1 LV). The sequence of the primary miR-511 is cloned within the EFla intron, downstream to a SFFV promoter.
E: miR-511 -5p and -3p activity in 293T cells overexpressing miR-511. The cells are transduced with the SFFV.miR-511 (overexpressing) LV and subsequently with the miRT- 511-5p, -3p or no-miRT (GFP-reporter) LVs. Dot plots show GFP and ALNGFR expression from the indicated GFP-reporter LVs. The histogram on the right shows quantification of GFP repression (mean values ± SEM vs. no-miRT control; n = 2 independent experiments). F: Stem-loop structures of the mouse pre-miR-511 and pre-miR-511-mut. miR-511 -5p and - 3p sequences are shown together with mutated nucleotides. Note that both pre-miR-511 and pre-miR-511-mut generate a wild-type miR-511 -5p sequence upon processing of the pre- miRNA.
G: GFP repression in RAW cells transduced with the SFFV. miR-51 1 or -511-mut LVs and superinfected with the miRT-51 l-5p or -3p LVs (mean values ± SEM vs. untransduced [UT] cells; n = 3 independent experiments). Statistical analysis of the data was performed on fold- repression values by Two-Way ANOVA with Bonferroni post-test. ***: p < 0.001.
H: Expression of the Mrcl gene in P388D1 and RAW cells, the latter either unstimulated or stimulated with IL4 (mean ACt values ± SEM vs. β2τη; n = 3 independent experiments). Statistical analysis of the data was performed on actual ACt values by unpaired Student's t- test. ***: p < 0.001.
I: Endogenous miR-5 l l-5p and -3p activity in RAW and P388D1 cells. RAW cells were either unstimulated or stimulated with BL4. Following IL4 stimulation, MRC1+ and MRC1"
RAW cells were analyzed separately. The histogram shows GFP repression (mean values ± SEM vs. no-miRT control; n = 3-8 independent experiments). Statistical analysis of the data was performed on fold-repression values by Two-Way ANOVA with Bonferroni post-test. ***: _p < 0.001.
J: qPCR of selected miRNAs in MRC1+ and CDl lc+ TAMs isolated from MMTV-PyMT mammary tumors. The data show relative abundance of each miRNA (mean values ± SEM vs. Let7a; n = 3 biological samples). Statistical analysis of the data was performed on actual ACt values by unpaired Student's t-test. ***: p < 0.001.
Figure 2. miR-511-3p is preferentially active in MRC1+ TAMs
A: Flow cytometry analysis of GFP and ALNGFR expression in MRC1+ and CD1 lc+ TAMs from LLCs.
B: GFP repression in the indicated cell types (vs. no-miRT control; n = 4-6 mice/group). iMCs, immature myeloid cells. Each dot in the scatter plot corresponds to one mouse. Statistical analysis of the data was performed on fold-repression values by Two-Way ANOVA with Bonferroni post-test. **: p < 0.01; ***: p < 0.001.
Figure 3. ROCK2 is a direct target of both mouse and human miR-511-3p
A: Firefly luciferase activity in 293T cells untransduced or overexpressing either mouse miR- 511 or -511-mut. The 3'-UTR of mouse Pdpn, Sema3a, Rock2 (miR-511-3p target genes) and CD 163 (a miR-511-3p non-target gene) were tested, together with a UTR-less plasmid (miRGLO). The Rock2 UTR was split into 2 fragments (Rock2(l) and Rock2(2)). The box- and-whisker graph shows Log2 of luciferase activity (median ± min/max values vs. miRGLO; n = 6-9 technical replicates from 3 independent experiments). Statistical analysis of the data by Two-Way ANOVA with Bonferroni post-test. ***: p < 0.001.
B: Western blot analysis of ROCK2 in RAW and P388D1 cells either overexpressing mouse miR-511 or -511-mut. Representative blots are shown. The scatter plots show intensity of ROCK2 signal (arbitrary units [a.u.] vs. GAPDH; 7-9 independent experiments). Statistical analysis of the data by paired Student's t-test. *: p < 0.05.
C: qPCR of Rock2 expression in P388D1 and RAW cells either overexpressing miR-51 lor - 511-mut. Data show fold change (mean values ± SEM vs. Hprt [P388D1] or 2m [RAW]; n = 3 biological samples, 4 technical replicates/each). Statistical analysis of the data was performed on actual AC, values by unpaired Student's t-test. *: p < 0.05; **:/? < 0.01.
D: Conservation of miR-51 l-5p and -3p sequence among species. The shading indicates 100% identity.
E: miR-511 -3p and -5p activity in U937 cells either overexpressing human miR-511 or -511 - mut. The histogram shows GFP repression (mean values ± SEM versus untransduced cells; n
= 3 independent experiments). Statistical analysis of the data was performed on fold- repression values by Two-Way ANOVA with Bonferroni post-test. ***: p < 0.001.
F: Western blot analysis of ROCK2 in U937 cells either overexpressing human miR-511 or - 511-mut. One representative blot is shown on the left. The scatter plot shows intensity of ROCK2 signal (arbitrary units [a.u.] vs. GAPDH; 9 independent experiments). Statistical analysis of the data by paired Student's t-test. *: p < 0.05.
Figure 4. miR-51 l-3p overexpression in TAMs tunes down their protumoral gene signature, dysregulates blood vessel morphogenesis and inhibits tumor growth
A: LLC growth in mice either overexpressing miR-51 lor -511-mut in hematopoietic cells. Data show tumor volumes (mean values ± SEM; n = 11 mice/group). Statistical analysis of the data by unpaired Student's t-test. **: p < 0.01; ***: p < 0.001. One representative experiment of two performed is shown.
B: Whole-mount visualization of blood vessels in LLCs (n = 5/group) grown in mice either overexpressing miR-51 lor -511-mut in hematopoietic cells.
C: Representative 200 um-thick tumor sections (of 8 sections/tumor and n = 5 tumors/group). The inset in rightmost panel shows blood vessels with the morphology of saccular structures in a LLC from a mouse overexpressing miR-51 1 in hematopoietic cells. Scale bar: 150 μηι. D: Morphometric analysis of blood vessels in LLCs (n = 5/group) grown in mice either overexpressing miR-511 or -511-mut in hematopoietic cells. Data were obtained by analyzing 8 sections/tumor (4 from the tumor periphery and 4 from the central tumor mass) and n = 5 tumors/group. Data are expressed as arbitrary units. Statistical analysis of the data by unpaired Student's t-test. ***: p < 0.001.
E: qPCR of selected miRNAs in F4/80+OFP+ TAMs isolated from LLCs grown in mice either overexpressing miR-511 or -511-mut in hematopoietic cells. The data show the relative abundance of each miRNA (mean values ± SEM vs. Let7a; n = 4 biological samples). Statistical analysis of the data was performed on actual AC, values by unpaired Student's t- test. *: p < 0.05.
F: Cumulative distribution of fold-changes in the whole transcriptome (13,747 genes; transcripts with less than 10 reads and miR-511 -3p predicted targets were excluded from the analysis) of TAMs overexpressing miR-511 (vs. -511-mut; red). Also shown are the cumulative distribution of fold-changes in transcripts that are miR-511 -3p predicted targets (145 genes). Note the global repression of miR-511 -3p target genes. Statistical analysis by one-sided Kolmogorov-Smirnov test; p < 0.000001.
G-I: Cumulative distribution of fold-changes in the whole transcriptome (13,747 genes; transcripts with less than 10 reads and miR-51 l-3p predicted targets were excluded) of TAMs overexpressing miR-511 (vs. -511-mut). Also shown are the cumulative distribution of fold-
changes in transcripts that contain M8-A1 8mer target sites for miR-511-3p, -5p or -3p-mut. Also shown are the cumulative distribution of fold-changes in transcripts that contain M8 7mer target sites for miR-511-3p, -5p or -3p-mut. Note the global repression of miR-511-3p target genes. Statistical analysis by one-sided Kolmogorov-Smirnov test (miR-511-3p: p < 10~8 for M8-A1 8mers and p < 10'9 for M8 7mers; miR-511-5p: p = 0.01 for M8-A1 8mers and p = 0.06 for M8 7mers; miR-511 -3p-mut: p = 0.01 for M8-A1 8mers and p = 0.36 for M8 7mers).
J: Cumulative distribution of fold-changes in the whole transcriptome (16,355 genes) of TAMs overexpressing miR-511 (vs. -51 1 -mut). Also shown are the cumulative distribution of fold-changes in the transcripts that are upregulated in MRC1+ TAMs (vs. CDl lc+ TAMs; 1,365 genes); also shown are the cumulative distribution of fold-changes in the transcripts that are upregulated in CDl lc+ TAMs (vs. MRC1+ TAMs; 1,596 genes). Statistical analysis by one-sided Kolmogorov-Smirnov test: p < 10~15).
Figure 5 (related to Figure 1). Immunophenotyping of P388D1 and RAW monocytic cells and gene expression in MRC1+ and CDllc+ TAMs.
A: P388D1 cells were stained with the indicated antibodies to measure the expression of myeloid (CDl lb, CDl lc), monocyte-macrophage (F4/80), B-cell (CD19) and T-cell (CD3) markers (top row). Unstained cells (fluorescence-minus one, FMO) are shown in the bottom row. RAW cells were stained with the indicated antibodies to measure the expression of myeloid (CDl lb, CDl lc), monocyte-macrophage (F4/80) and T-cell (CD3) markers (top row). Unstained cells (FMO) are shown in the bottom row. Note that both P388D1 and RAW cells express the monocyte-macrophage-specific marker, F4/80.
B: qPCR of selected mRNAs in MRC1+ and CDl lc+ TAMs isolated from MMTV-PyMT mammary tumors. The data show fold change (= 2ACt; mean values ± SEM; n = 3 biological samples) vs. inflammatory TAMs (reference population). Normalization was performed by interpolating Gapdh and fi2m. Statistical analysis of the data was performed on actual ACt values by unpaired Student's t-test. *: p < 0.05; **: p < 0.01.
Figure 6 (Related to Figure 2). Identification of tumor-infiltrating hematopoietic cells in LLCs.
Left panel: Identification by flow cytometry of the following 3 cell populations in the blood of transplanted mice: CDl lb+CD115+GR~ resident monocytes; CDl lb+CD115+GRl+ inflammatory monocytes; and CDl lb+CD115~GRr granulocytes. Right panels: LLCs were harvested and reduced to single cell suspensions. Among the 7-AAD Dl lb+ cells, we identified the following 3 cell populations: CDl lb+MRC CDl lc~GR~ TAMs; CDl lb+CDl lc+MRCrGR~ TAMs; and CDl lb+GRl+ granulocytes / immature myeloid cells
(iMCs).
Figure 7 (Related to Figure 3). Stem-loop structures of the human pre-miR-511 and pre- miR-51 l-mut.
The sequence of niiR-511-5p and -3p are shown. Mutated nucleotides are shown. Note that both pre-miR-511 and pre-miR-51 l-mut generate a wild-type miR-511-5p sequence upon processing of the miRNA.
Figure 8 (Related to Figure 4). Hematopoietic chimerism in the blood and identification of tumor-infiltrating hematopoietic cells in LLCs of miR-511-overexpressing mice.
A: Proportions of CD45.L and CD45.1+OFP+ leukocytes in the blood of mice either overexpressing miR-511-3p (SFFV.miR-511) or miR-511 -3p-mut (SFFV.miR-51 l-mut) in hematopoietic cells. Data show the percentage of marker4- cells (mean values ± SEM; n = 4 mice/group).
B: Proportions of B-cells (CD19+), NK cells (ΝΚ1.Γ), CD8+ T cells, total TAMs (F4/80+), granulocytes (GR1+) among the total tumor-infiltrating CD45+ hematopoietic cells. Data show the percentage of marker+ cells (mean values ± SEM; n = 4 mice/group).
C: Proportion of MRC1+ and CD1 lc+ TAMs among the total F4/80+ TAMs in LLCs grown in mice either overexpressing miR-51 lor - 1 l-mut in hematopoietic cells. Data show the percentage of marker-positive cells (mean values ± SEM; n = 4 mice/group).
Table 1. Predicted mmu-miR-511-3p target genes. Predicted mouse miR-511-3p target genes were retrieved by using two distinct bioinformatics tools, Targetscan 20 and Diana microT 21.
Table 2. Clusterization of predicted mmu-miR-511-3p target genes by DAV ID Bioinformatic Resources 6.7 (mouse). Terms correspond to biological processes annotated in the UniProt B-GoA group (EMBL) gene ontology database (QuickGO).
Table 3. Predicted miR-511-3p target genes (human). Predicted human miR-5 l l-3p target genes were retrieved by using two distinct bioinformatics tools, Targetscan 20 and Diana microT 21.
Table 4. Clusterization of predicted miR-511-3p target genes by DAVID Bioinformatic Resources 6.7 (human). Terms correspond to biological processes annotated in the UniProtKB-GoA group (EMBL) gene ontology database (QuickGO).
Table 5. Genes differentially expressed in the TAMs of SFFV.miR-511 and SFFV.miR- 511-mut mice.
Table 6. M8-A1 8mer or M8 7mer binding sites for either miR-511-3p, 5p or -3p-mut as retrieved by TargetRank 22.
Table 7. Clusterization of genes differentially expressed in the TAMs of SFFV.miR-511 and SFFV.miR-511-mut mice by DAVID Bioinformatic Resources 6.7 (mouse). Terms correspond to biological processes annotated in the UniProtKB-GoA group (EMBL) gene ontology database (QuickGO).
Table 8. Genes differentially expressed in MRC1+ and CDllc+ TAMs.
Table 9. Genes that are differentially expressed both in TAMs of SFFV.miR-511 versus SFFV.miR-511-mut mice, and in MRC1+ versus CDllc+ TAMs.
EXPERIMENTAL PROCEDURES
Mice
C57BL/6 and CD45.1/C57BL/6 mice were purchased by Charles River Laboratory (Calco, Milan, Italy). FVB/MMTV-PyMT mice were obtained from the NCI-Frederick Mouse Repository (MD) and established as a colony at the San Raffaele animal facility. All procedures were performed according to protocols approved by the Animal Care and Use Committee of the Fondazione San Raffaele del Monte Tabor (IACUC 324, 335 and 447) and communicated to the Ministry of Health and local Authorities according to the Italian Law. miRNA/miRT sequences
Mouse and human miR-511 target (miRT) sequences were designed based on miRNA sequences obtained from the miRNA Registry (http ://microrna. Sanger, ac.uk/) . Oligonucleotides used to generate miRT sequences are shown in the Supplemental experimental procedures. To overexpress miR-511, we designed (GenArt Invitrogen) DNA fragments encompassing mmu-miR-511, hsa-miR-51 1, or their mutated forms.
Calculation of miRNA activity
We calculated miR-511 -mediated GFP repression (fold-repression) in live cells by using the following equation:
where MFI is the mean fluorescence activity of either GFP or ALNGFR measured by flow cytometry.
Cell cultures
Human 293T, mouse RAW264.7, mouse P388D1 and mouse LLC cells were maintained in Iscove's modified Dulbecco's medium (MDM; Sigma) supplemented with 10% fetal bovine serum (FBS; Gibco) and a combination of penicillin-streptomycin and glutamine. Human U937 cells were maintained in RPMI supplemented as above. RAW cells were polarized by culturing them in the presence of IL4 (20 ng/ml, Peprotech) for hrs before analysis. P388D1 cells were polarized by LPS (100 ng/ml, Sigma) + EFN-γ (200 U/ml, Peprotech) for 7 hrs before analysis.
Lentiviral vector (LV) construction and production
Human and mouse miR-511 target (miRT) sequences were designed based on miRNA sequences obtained from the miRNA Registry (http://microrna.sanger.ac.uk/). Oligonucleotides used for generating miRT sequences are shown below.
To generate the miRT LVs, the Sense 1 (S I), Sense 2 (S2), Antisense 1 (AS1), and Antisense 2 (AS2) oligonucleotides were annealed and ligated into the 3'-UTR of the GFP gene contained in a LV co-expressing ALNGFR and GFP from a bidirectional PGK promoter 23. In order to overexpress mouse and human miR-511, or their mutated forms, we designed (GenArt Invitrogen) DNA sequences encompassing the miR-511 intronic sequence of the Mrcl gene, shown below.
The light grey box identifies the miR-511-5p sequence; The darker grey box identifies the miR-511-3p sequence; The mutated nucleotides are highlighted in dark grey. We then cloned the DNA fragment into the multicloning site present in the EFla intron of a LV containing the SFFV promoter, exon 1 and intron 1 of the EFla gene, and the OFP reporter gene.
Vescicular stomatitis virus (VSV)-pseudotyped, third-generation LVs were produced by transient four-plasmid cotransfection into 293T cells and concentrated by ultracentrifugation, as described 24. Expression titers of OFP- or ALNGFR-expressing LVs were determined on HeLa cells by limiting dilution. Vector particle content was measured by HTV-1 Gag p24 antigen immunocapture (NEN Life Science Products; Waltham, MA). Vector infectivity was calculated as the ratio between titer and particle content. Titer of 293T conditioned medium (before ultracentrifugation) ranged from 106 to 107 transducing units/ml and infectivity from 104 to 105 transducing units/ng of p24.
LV transduction of cell lines
293T, RAW264.7, P388D1, and U937 cells were transduced with LV doses ranging from 104 to 105 transducing units/ml. The fraction of ALNGFR+ or OFP+ cells was always greater than 80% (miRT reporter LVs) or 90% (overexpressing LVs) in each experiment. Sequential transduction was performed by (i) transducing the cells with the first LV for 12 hrs; (ii)
washing and replating the cells; (iii) transducing the cells with the second LV (superinfection) on day 5-7 after the first transduction, for 12 hrs in standard conditions.
Hematopoietic stem/progenitor cell (HS PC) isolation, transduction and transplantation
Six-old female CD45.1/C57BL/6 or C57BL/6 transgenic mice were killed with C02 and their BM was harvested by flushing the femurs and the tibias. Lineage-negative cells (BM-lin" cells) enriched in HS/PCs were isolated from BM using a cell purification kit (StemCell Technologies) and transduced by concentrated LVs, as described 25. Briefly, 106 cells/ml were pre-stimulated for 6 hours in serum-free StemSpan medium (StemCell Technologies) containing a cocktail of cytokines (IL-3 (20 ng/ml), SCF (100 ng/ml), TPO (100 ng/ml) and FLT-3L (100 ng/ml), all from Peprotech) and then transduced with miRT-reporter or miR- 511-overexpressing LVs with a dose equivalent to 10s LV Transducing Units/ml, for 12 hours in medium containing cytokines, as described 2S. After transduction, 106 cells were infused into the tail vein of lethally irradiated, 5.5-week-old, female C57BL/6 mice (radiation dose: 1150 cGy split in 2 doses).
Antibodies
Target gene prediction
We used two distinct bioinformatics tools, Targetscan 20 and Diana microT 21 to search for miR-511-3p target genes. The analysis retrieved a list of putative target genes that we
analyzed by using David Bioinformatic resources 6.7 . We retrieved the rnRNAs that contain either M8-A1 8mer or M8 7mer miRNA binding sites in their 3' -UTR by TargetRank
22
Luciferase assays
In order to validate miR-511 predicted targets, we cloned the 3' -UTR of Sema3A, Pdpn, CD163 and Rock2 downstream to the Firefly luciferase of the pmir-GLO construct (Promega). The Rock2 UTR was split into 2 fragments (Rock2(l): 1537 bp and Rock2(2): 1771 bp). The Rock2 \) fragment contains three closely spaced, effective miRNA sites; the Rock2(2) fragment contains only one effective miRNA site (by RNAhybrid bioinformatic tool). To amplify the selected 3'-UTRs we used the following primers:
Sema3A: Fw primer: TGCGCCACCTCCCAAAACCTC; Rv primer:
TCCTGACTCTGGTTCTCGAAGGCT;
Pdpn: Fw primer: ACAGGTTGTTCTCCCAACACATCTG; Rv primer:
TGGCCTCATTCTTGGACACAATCAGG.
CD 163: Fw primer: GCCTTGACAGGACAGCCAGCT; Rv primer:
TCCCAACTAGCTTTTCACCTCCCC;
Rock2(l): Fw primer: CGCGCATGCTTGCCCTACCT; Rv primer:
CCCAACCAGAGCACAGCTGCT;
Rock2(2): Fw primer: ACCTTCAGATGGCCCAGTTTGCA; Rv primer:
ACCCAAAGTGAATCGGAGGCGG;
In order to clone the PCR products directly downstream to the firefly luciferase expression cassette within the pmiR-GLO construct, we incorporated a restriction site for Nhel at the 5'- end of all Fw-primer sequences, and a restriction site for Sail at the 3 '-end of all Rv primers.
Untransduced 293T cells or cells expressing exogenous miR-511 sequences (by SFFV.miR- 51 1 or -511-mut LVs) were transfected using Lipofectamine 2000 (Invitrogen) with 50 ng of the pmir-GLO-bsLsed plasmids. Cells were lysed after 24 hours using the Dual-Luciferase Reporter Assay protocol (Promega). Renilla luciferase was used to normalize firefly luciferase activity.
Western blot
Mouse (P388D1, RAW) and human (U937) monocytic cell lines were transduced with the SFFV-miR-511 and -511-mut LVs, expanded in culture for at least 2 weeks, collected and directly stored at -80°C. Each cell line was homogenized in lOx volume of RTF A lysis buffer (lOmM Tris-Cl, pH 7.2, 150mM NaCl, lmM EDTA pH 8) with 1% Triton X-100, 1% deoxycholate, 0,1% SDS, protease and phosphatase inhibitor mixture (Roche). Samples were
then diluted in Laemmli's SDS-sample buffer. Proteins (-60 μg) were separated by electrophoresis on 8% polyacrilamide (Sigma) gels and transferred onto trans-blot nitrocellulose membranes (Amersham). Ponceau staining (Sigma) was performed to confirm that the samples were loaded equally. The membranes were blocked in 5% nonfat dry milk in TBS-T (pH 7.4, with 0.1% Tween 20) for lh at room temperature. Primary antibodies were diluted in 3% bovine serum albumine (BSA, Sigma) in TBS-T, and the membranes were incubated overnight at 4°C. The primary antibody was removed, and the blots washed in TBS- T and then incubated for 1 hr at room temperature in horseradish peroxidase-conjugated secondary antibodies (Amersham). The primary antibodies used were: mouse anti-ROCK2 (BD, Transduction Laboratories); mouse anti-GAPDH (Sigma). Reactive proteins were visualized using LiteBlot (Euroclone, Celbio) or SuperSignal West Femto chemiluminescence reagent (Pierce Biotechnology, Rockford, EL) and exposure to x-ray film (BioMax MR; Kodak, Rochester, NY). Each experiment was performed with samples from at least 3 independent experiments and 7 independent loadings. Results for ROCK2 were quantitated by scanning densitometry and analyzed by ImageJ software using GAPDH as an internal loading control. The intensity levels were expressed in arbitrary units (a.u.).
Tumor growth experiments
LLC/3LL cells (5 x 106) were injected s.c. in syngenic C57BL76 mice, and tumors grown for 3-4 weeks. Tumor size was determined by caliper measurements, and tumor volume calculated by a rational ellipse formula (mi x mi χ m2 x 0.5236, where mi is the shorter axis and m2 is the longer axis), as described 27.
Analysis of tumor-associated vasculature
All animals were thoracotomized under deep anaesthesia. The entire vasculature of the animal was thoroughly rinsed by perfusing with saline (20-30 ml) via left ventricle injection. When perfusion was complete, 20 ml of yellow silicone rubber Microfill MV 122 (Flow Tech, Inc., Carver, Massachusetts) were infused through the left ventricle at 1 mL/min flow rate. When filling was complete, all organs had a rich, yellow coloration. The heart was then clamped and the animal placed under refrigeration at 4°C overnight, to allow polymerization.
On the following day, tumors were taken by careful dissection, and placed in a 50% mixture of water and glycerin. At successive 24-hour intervals, the glycerin concentration was raised to 75%, then 85%, and finally pure glycerin.
The analysis of the tumor-associated vasculature was performed on 200 μπι-thick slices obtained from the tumor periphery (4 slices) and inner tumor mass (4 slices) of each tumor.
The whole tumor slice was photographed at low magnification (4x). Pictures for morphometric analysis were taken using a Zeiss Axio Imager connected to an Axiocam MRc5 camera (Zeiss) and analysis was performed using Neuron J application of Image J software.
Flow cytometry of blood leukocytes and tumor-derived cells
Flow cytometry used a BD FACSCanto (BD Bioscience) apparatus. All cell suspensions were incubated with rat anti-mouse FcyUm receptor (CD16/CD32) blocking antibodies (4 μ^ητΐ; BD Inc.) together with the antibodies listed above. After antibody staining, the cells were washed, stained with fluorochrome-labeled streptavidin (if required) and re-suspended in 7- ammo-actinomycin D (7-AAD)-containing buffer, to exclude nonviable cells from further analyses. OFP was acquired as direct fluorescence in the FL2 channel.
Peripheral blood cells. Peripheral blood was collected from the tail vein. After red blood cell lysis and 7-AAD vital staining, cells were immunostained with the appropriate antibodies.
The different cell types/subsets were identified as follows:
Resident monocytes: 7-AADTD1 lb+CDl 15+GR1~ cells (Figures 2 and 6);
Inflammatory monocytes: 7-AADXD1 lb+CDl 15+GR1+ cells (Figures 2 and 6);
Granulocytes: 7-AAD"CDl lb+CDl 15~GR1+ cells (Figures 2 and 6).
Donor-derived hematopoietic cells: 7-AAD~CD45.1+ or 7-AADXD45.1+OFP+ cells (Figure 8).
Tumors. LLCs were excised and made into single cell suspensions by collagenase IV (0.2 mg/ml, Worthington), dispase (2 mg/inl, Gibco) and DNasel (0.1 mg/ml, Roche) treatment in IMDM medium. The different cell types/subsets were identified as follows:
MRCl+ TAMs: 7AAD7CD45+/ GR17F4/80"7MRCl7CD 11C" cells (Figures 2, 6 and 8);
CDl lc+ TAMs: 7AAD7CD45+/ GR17F4/80+/MRC17CDl lc+ cells (Figures 2, 6 and 8); Granulocytes/iMCs: 7AAD7 CD45+/ GR17F4/807MRC17CD1 lc" cells (Figures 2, 6 and 8); Total TAMs: 7AAD7CD45+/F4/807Grr cells (Figure 8);
B-cells: 7AAD7CD457CD19+ (Figure 8);
T-cells: 7AAD7CD457CD3+ (Figure 8);
NK-cells: 7AAD7CD45+ NKl.r (Figure 8);
Note that cell sorting used different gating strategies (see Supplemental Experimental Procedures below).
Sorting of TAMs and qPCR-based gene expression studies
Tumors were excised, made into single-cell suspensions and stained with the antibodies listed above. To sort cells, we used a MoFlo apparatus (Dako). After sorting, purity of the cells was
always > 90%. Five-50 x 104 cells were obtained from each sorting session.
MRC1+ and CDl lc+ TAMs of MMTV-PyMT mammary tumors were isolated as 7-ΑΑΙΓ CD45+F4/80¾IRCl+CDl lc- cells (n = 3) and 7-AAD"CD45^F4/80+MRCrCDl lc+ cells (n = 3), respectively. For each mouse, we obtained 4-5 small biopsies from as many tumors and pooled them together before processing. OFP+ TAMs, MRC1+ and CDl lc+ TAMs of LLCs were isolated as 7-AAETF4/80+OFPH cells (n = 4/group), 7-AADXDl lb+GRl~CD3r MRCl+CDl lc_ cells (n = 3), and 7-AAD Dl
lc- cells (n = 3), respectively. Sorted TAMs were washed and lysed in QiaZol or RLT buffer (Qiagen) for total RNA extraction.
For qPCR of miRNAs, we retrotranscribed small RNAs using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and small RNA reverse transcription primers specific for the mature form of Let7a, miR-16, miR-142-3p, miR-155, miR-511-5p, miR-511- 3p, miR-146a, miR-15a, or miR-51 l-3p-mut. We then performed qPCR on retrotranscribed small RNAs, either using custom (for miR-511 -3p and miR-511 -3p-mut) or inventoried (other miRNAs) TaqMan small RNA assays (Applied Biosystems). For qPCR of mRNAs, we retrotranscribed RNA with Superscript ΓΠ (Vilo kit, Invitrogen). All qPCR analyses used TaqMan probes from Applied Biosystems. qPCR (miRNA and mRNA) was run for 40 cycles in standard mode using an ABI7900HT apparatus (Applied Biosystems). The SDS 2.2.1 software was used to extract raw data (CT) and to perform gene expression analysis. To determine gene expression, the difference (ACT) between the threshold cycle (CT) of each mRNA/miRNA and that of the reference gene was calculated by applying an equal threshold (0.02).
RNA-seq
Total RNA was extracted from sorted TAMs using Qiazol reagent (Qiagen), following manufacturer's instructions. RNA isolated from sorted F4/80+OFP÷ TAMs was then depleted for rRNA using the Ribo-Zero RNA removal kit (Epicentre Biotechnologies), followed by concentration using RNA Clean & Concentrator -5 columns (Zymo Research), with in-tube DNase (Epicentre Biotechnologies) digestion. Illumina sequencing libraries were prepared according to the TraSeq RNA Sample Preparation Guide (Revision A), starting at the RNA fragmentation step. RNA fragmentation with "Elute, Prime, Fragment Mix" was performed for 4 minutes at 94°C. Sequencing was performed on a HiSeq 2000 (Illumina) using paired- end cBot v2 and TraSeq SBS reagents. Libraries were sequenced using 2 x 50 bp paired-end reads, with two indexed samples run per lane, yielding 89-115 million reads (4.4-5.8 Gb) per
sample. The sequencing was setup and monitored by HiSeq Control Software (HCS) version 1.1.37.19. Image analysis and base calling was performed using Illumina's real time analysis (RTA) software version 1.7.48. Reads were filtered to remove those with low base call quality using Illumina's default chastity criteria. The results were then demultiplexed and converted to fastq format files by CASAVA version 1.7. RNA isolated from MRC1+ and CDl lc+ TAMs of LLC tumors did not undergo rRNA depletion, but was processed using the poly-T oligonucleotide coated magnetic beads provided with the Illumina TruSeq RNA Sample Preparation kit as directed by the manufacturer. RNA fragmentation with "Elute, Prime, Fragment Mix" was again performed for 4 minutes at 94°C. Sequencing was performed as above, except that 100 bp paired-end reads were generated, yielding 69-84 million reads (6.9- 8.4 Gb) per sample.
RNAseq analysis
Paired-end sequence reads were aligned to the mouse genome (mm9; www.ensembl.org') using Bowtie (doi: 10.1186/gb-2009-10-3-r25) and TopHat
(doi: 10.1093^ioinformatics/btpl20). Reads were mapped to known genes and splice junctions by providing TopHat with an annotation file (Mus_musculus.NCBIM37.62.gtf; www.ensembl.org). Samtools (doi: 10.1093/bioinformatics/btp352) was then used to remove PCR-generated duplicate reads. Count data for each exon was generated using htseq-count from the HTseq package (http://www-huber.embl.de/users anders/HTSeq/).
Differential expression between sample groups was identified from the sequence count data using the R package DEseq (doi: 10.1186/gb-2010-l l-10-rl06). Expression differences were considered significant at a false discovery rate (FDR) of 5%.
Cumulative distribution analyses of fold-changes in the whole transcriptome and transcripts that contain M8-A1 8mer and M8 7mer target sites were generated in R (www.r-proiect.org), as described 28. Statistical analysis by one-sided Kolmogorov-Smirnov test.
RESULTS
Tumor-associated macrophages (TAMs) support tumor progression in mouse models of cancer 7'8. The protumoral functions of TAMs are thought to depend, at least in part, on their production of growth, proangiogenic and ECM-remodeling factors, which enhance tumor cell motility, activate fibroblasts, facilitate angiogenesis, and suppress antitumor activity 7'8'29.
However, TAMs comprise distinct subsets, which appear to contribute differentially to tumor progression. In the mouse, mannose receptor (MRC1)+ TAMs express a gene signature that is consistent with proangiogenic, tissue-remodelling and protumoral functions. Conversely, CDl lc+ TAMs express a proinflammatory and angiostatic phenotype, and perhaps exert antitumoral functions 9'10'12-13. Whereas several tumor-derived, extrinsic factors have been identified that can influence TAM phenotypes 7'8,29, the intrinsic signals that modulate pro- vs. antitumoral functions of the distinct TAM subsets are poorly defined.
Several miRNAs are highly expressed in human macrophages cultured in vitro 15,16. However, little is known of the miRNA expression profile of TAMs and their subsets. We noted that the mouse Mrcl gene, which is highly expressed by protumoral TAMs 7, contains a precursor miRNA sequence, pre-miR-511, located within the fifth intron of the gene (Figure 1A). The pre-miR-511 is processed by Dicer into both miR-51 1-5p (located at the 5 '-end of the pre- miRNA) and miR-51 l-3p (located at the 3 '-end of the pre-miRNA) mature miRNAs (Figure IB). To investigate whether mir-511 is active in live cells, we used a lentiviral vector (LV) reporter system for miRNA activity 30. We incorporated 4 target sequences with perfect complementarity to either miR-51 l-5p or -3p (termed miRT-511-5p and miRT-511-3p, respectively) into the 3 '-untranslated region (3'-UTR) of a GFP transgene expressed from a ubiquitously active bidirectional promoter, which also controls the expression of the reporter gene, ALNGFR (Figure 1C). We also generated a control LV expressing a GFP sequence not containing miRT sequences in its 3'-UTR (termed no-miRT). Following LV cell transduction, the microRNA machinery will degrade the miRT-containing GFP transcript only in cells that express the cognate miRNA, in a manner that is dependent on miRNA abundance and/or activity. On the other hand, expression of ALNGFR is independent on miRNA activity and is used as an internal normalizer to calculate GFP suppression by the miRNA of interest 30.
In order to artificially overexpress the pre-miR-511, we cloned a fragment of the Mrcl intron encompassing the miR-511 locus, downstream to the spleen focus forming virus (SFFV) promoter and upstream to an orange fluorescence protein (OFP) reporter gene (Figure ID). We termed the resultant vector SFFV.miR-511 LV. We then transduced 293T cells, which do not express miR-511 endogenously (data not shown), with the SFFV.miR-511 LV, and superinfected the transduced cells with miRT-511-5p, -3p or no-miRT reporter LVs. As shown in Figure IE, exogenous miR-511 repressed GFP expression much more efficiently in cells transduced with the miRT-51 l-3p than -5p reporter LV, suggesting that the active strand of the pre-miR-51 1 is miR-51 l-3p. We then generated a mutated miR-51 l-3p by substituting 4 nucleotides, of which 3 in the miRNA seed sequence (Figure IF). We termed the resultant vector SFFV.miR-511-mut LV. The mutated nucleotides were selected that did not involve
the complementary miR-511-5p sequence and should not perturb the stem-loop structure of the pre-miRNA. We then transduced RAW264.7 monocytic cells with the SFFV.miR-511 or - 51 1-mut LVs, and superinfected them with the miRT-51 l-5p or -3p LV. As shown in Figure 1G, the 4 mutated nucleotides in the miR-51 l-3p sequence completely abrogated its activity.
In order to analyze the activity of endogenous miR-511, we used the mouse monocytic cell lines RAW264.7 and P388D1 (Figure S1A). RAW cells express negligible amounts of the Mrcl gene but upregulate it upon IL4 stimulation; P388D1 cells express Mrcl to a significantly higher extent than IL4-stimulated RAW cells (Figure 1H). We then hypothesized that endogenous miR-511 activity would mirror Mrcl expression levels. As shown in Figure II, GFP repression paralleled the expression level of the Mrcl gene or protein in monocytic cells. As seen in overexpression experiments (Figure IE and 1G above), endogenous miR-511 repressed GFP expression much more efficiently in cells transduced with the miRT-51 l-3p than -5p reporter LV (Figure II).
We then measured by qPCR the expression of a panel of selected miRNAs, including miR- 51 l-5p and -3p, in both MRC1+ and CDl lc+ TAMs isolated from MMTV-PyMT mammary tumors (Figure IT). Although both miR-51 l-5p and -3p were significantly upregulated in MRCT vs. CDl lc1 TAMs (> 10-fold), miR-51 l-3p was more highly expressed than -5p in either TAM subset. Of note, Mcrl expression was ~10-fold higher in MRC1+ than CDl lc"1" TAMs (Figure 5B). Together, these data indicate that miR-51 l-3p is the active strand of the mouse pre-miR-511 and strongly suggest that the Mrcl gene and the miRNA are transcriptionally co-regulated.
In order to analyze the expression pattern and activity of miR-511 in vivo, we implemented the aforementioned reporter system in a model of hematopoietic stem/progenitor cell (HS/PC) transplantation. We transduced HS/PCs obtained from the bone marrow of C57B1/6 mice with the miRT-511 -5p, -3p or no-miRT LVs, and transplanted the transduced cells into irradiated, syngenic mice. Five weeks after the transplant, we inoculated Lewis Lung Carcinoma (LLC) cells subcutaneously in the mice. Tumors grew homogeneously (data not shown) and were harvested at 3 weeks post-tumor injection. We did not detect GFP repression in blood cells (granulocytes, inflammatory and resident monocytes) and tumor-infiltrating granulocytes/immature myeloid cells (iMCs), indicating that neither miR-511 -3p nor -5p are detectably active in these cells (Figure 2A-B and 6). Conversely, GFP repression was clearly measurable in MRC1+ and, to a lesser extent, CD1 lc+ TAMs carrying miRT-51 l-3p but not - 5p target sequences (Figure 2A and B). These in vivo data confirm that miR-511 -3p is the active strand of the mouse pre-miR-511, and demonstrate that endogenous miR-511 -3p is
preferentially active in MRC1+ TAMs among tumor-infiltrating and circulating myeloid cells.
We used Targetscan 20 and Diana microT 31 to identify miR-511 -3p predicted targets. The analysis retrieved a list of 145 genes (Table 1) that we analyzed by David Bioinformatic resources 6.7 26. A significant proportion of these genes are involved in biological processes related to "cell morphogenesis" (Table 2). We then validated a panel of miR-51 l-3p predicted targets by dual-luciferase assays performed on miR-511-overexpressing RAW cells. We observed robust suppression of Roc£2-UTR-dependent luciferase activity in SFFV.miR-511- but not -511-mut-overexpressing RAW cells (Figure 3 A). ROCK2 is a serine/threonine kinase that regulates actin stress fibers and focal adhesions; it was recently shown to play important mechanoregulatory functions by linking the contractility of the cell cytoskeleton to external forces generated by the ECM, and to regulate collagen biosynthesis 1,s2. We then analyzed the expression of ROCK2 in RAW and P388D1 cells either overexpressing miR- 511-3p or its mutated sequence. miR-511 -3p downregulated ROCK2 both at the protein (Figure 3B) and mRNA (Figure 3C) level. Together, these data strongly suggest that ROCK2 is a direct target of mouse miR-51 l-3p.
The human MRC1 gene also contains a miR-511 sequence (hsa-miR-511) located in the fifth intron of the gene. Of note, the mature miR-511 -3p but not -5p sequence is conserved in M. musculus and H. sapiens (Figure 3D). We then asked whether miR-511 -3p activity is conserved in the two species. To identify the active strand of the human miR-511, we generated both reporter and overexpressing LVs (Figure S3), as described above for the mouse miR-511. We then transduced human U937 monocytic cells with the overexpressing LVs and, 5 days later, superinfected the cells with the reporter LVs. We found that miR-511- 3p is the active strand of the human pre-miR-511 (Figure 7). As in the mouse system, predicted targets of the human miR-511 -3p (Table 3) comprise genes involved in biological processes related to "cell morphogenesis" (Table 4). Furthermore, human miR-511 -3p downregulated ROCK2 in U937 cells (Figure 3F). These findings are consistent with the remarkably high conservation of the miR-51 l-3p sequence in mice and humans and suggest a conserved biological function of this miRNA in the two species.
To study the biological function of mouse miR-51 l-3p, we overexpressed it in hematopoietic cells. To this aim, we transduced HS/PCs obtained from CD45.1/C57B1/6 mice with either SFFV.miR-511 or -511-mut LV, and transplanted the transduced cells into irradiated, congenic CD45.2/C57B1/6 mice, to obtain SFFV.miR-511 and SFFV.miR-511 -mut mice, respectively. Four weeks after the transplant, we inoculated LLC cells subcutaneously in the transplanted mice and monitored tumor growth for 3-4 weeks.
miR-511-3p overexpression in hematopoietic cells inhibited LLC growth (Figure 4A). Furthermore, it altered the architecture of the tumor microvascular network by augmenting blood vessel tortuosity and the occurrence of enlarged, saccular structures (Figure 4B-C). Accordingly, morphometric analysis of thick tumor sections showed similar vascular area but significantly decreased total and mean length of blood vessels in SFFV.miR-51 1 than -511- mut mice (Figure 4D). These tumor/vascular phenotypes could not be attributed to altered hematopoiesis and/or recruitment of hematopoietic cells to the tumors, as miR-511-3p overexpression in hematopoietic cells did not affect the repopulating activity of the transduced HS/PCs, as shown by the similarly high frequency of CD45.1+OFP+, donor/transduced hematopoietic cells in the blood of both groups of mice at 4 weeks post- transplant (Figure 8A). Furthermore, miR-51 1-3p overexpression neither affected the recruitment of F4/80+ TAMs (which represent up to 60% of all tumor-infiltrating hematopoietic cells in this tumor model), GR1+ neutrophils, NEC, T and B-cells to the tumors (Figure 8B), nor the relative frequency of MRC1+ and CD1 lc+ TAM subsets (Figure 8C).
Because the genetic programs of TAMs may influence tumor growth, angiogenesis and progression 7'8, we asked whether miR-511-3p overexpression had modulated TAM's gene expression. To address this question, we sorted F4/80+OFP+ TAMs from LLCs grown in SFFV.miR-511 and -511-mut mice. qPCR analysis of selected miRNAs showed that the SFFV.miR-511 LV upregulated the expression of miR-511-3p by ~5-fold in the F4/80+OFP+ TAMs of SFFV.miR-511 compared to -511-mut mice, which only express the endogenous miR-511-3p sequence (Figure 4E). As expected, the miR-511-3p-mut sequence was only detected in the TAMs of SFFV.miR-511-mut mice. As seen in the TAMs of MMTV-PyMT mice (Figure 1J above), miR-511-5p was expressed at much lower level than miR-511-3p, strongly suggesting that - even when overexpressed (Figure 4E) - it is rapidly degraded in vivo.
We then performed RNA-seq analyses of the transcriptome of sorted F4/80+OFP+ TAMs. We used the Illumina HiSeq 2000 platform and retrieved 249 genes (out of 16,355; 1.5%; p < 0.05 adjusted for false discovery rate) that were differentially expressed in the TAMs of SFFV.miR-511 vs. -511-mut mice (Table 5). Remarkably, it was found that the predicted targets of miR-511-3p (Table 1 above) were globally downregulated by miR-511-3p overexpression in TAMs (Figure 4F). Furthermore, we investigated whether genes containing in their 3'-UTR at least one sequence with perfect complementarity to the seed sequence of the miRNA (i.e., to positions 2-8) were modulated by rniR-51 l-3p overexpression in vivo. miRNA seed/3'-UTR interactions comprise M8-A1 8mers (the mRNA sequence binds to the miRNA
from position 2 to 8 and contains an Adenosine in position 1) and M8 7mers (the mRNA sequence matches the miRNA from position 2 to 8) I4. We then retrieved by TargetRank 22 the mRNAs that contain either M8-A1 8mer or M8 7mer miR-511-3p binding sites in their 3'- UTR (Table 6), and found that such transcripts were significantly downregulated by miR-51 1- 3p overexpression (Figure 4G). Conversely, genes containing M8-A1 8mer or M8 7mer binding sites for either miR-51 1 -5p or -3p-mut were either not modulated or only slightly modulated by miRNA overexpression (Figure 4H-I).
Although the vast majority of differentially expressed genes were downregulated by miR-51 1- 3p overexpression in TAMs (Table 5 above), they could not be identified as direct miR-51 l-3p targets by Targetscan, Diana microT and TargetRank, and possibly represent indirect targets of the miRNA. Interestingly, the downregulated genes are primarily involved in biological processes related to cell adhesion, morphogenesis and ECM organization (Table 7). In addition to Rock2 (a direct miR-51 l-3p target), the downregulated genes comprised several ECM genes. These include type-VI {Col6al, Col6a2, Col6a3), type-TV {CoUal, Col4a2), type-m (Col3al), type-VHI (Col8al) and type-XVm {Coll Sal) collagens; the proteoglycans perlecan {Hspg2) and syndecan {Sdc2) the basal lamina proteins lamininl {Lambl) and entactin {Nidi); and several proteases {Adamstl, Adamstll, Mmpll, Mmp3). Serpinhl, a chaperon protein for collagen export, and caveolin-1 {Cavl), a component of the endocytic caveolae and important regulator of ECM remodeling 33, were also downregulated. Downregulated genes further included genes that regulate the synthesis and remodeling of the ECM, such as TGFb-family proteins { gfbrS, Bmpl, Bmprla, Ltbpl) and macrophage scavenger receptors {Sparc, Mrc2 and ScaraS). These data suggest that miR- 11 -3p tunes down the expression of ECM and ECM-remodeling genes in MRC1+ TAMs.
We and others previously showed that MRC1+ TAMs are protumoral and express a distinguishing gene signature in mouse models of cancer 7,9''°. We then hypothesized that miR- 51 l-3p overexpression in TAMs inhibited tumor growth by decreasing their protumoral activity. We therefore sorted MRCl ' and CDl lc+ TAMs from LLC tumors grown for 3-4 weeks in wild-type, nontransplanted C57B1/6 mice, and subjected the isolated cells to RNA- seq analyses. About 14% of the identified genes were differentially expressed in MRC1+ and CDl lc+ TAMs (Table 8; p < 0.05 adjusted for false discoveiy rate), corroborating the notion that MRC1+ and CDl lc+ TAMs represent distinct cell subsets 9. Strikingly, when we compared the genes differentially expressed in MRC1+ vs. CDl lc+ TAMs (Table 8) with the genes differentially expressed in SFFV.miR-511 vs. -511-mut TAMs (Table 5 above), we found that miR-511 -3p overexpression in TAMs significantly and specifically tuned down the expression of genes upregulated in MRC1+ vs. CDl lc+ TAMs (Figure 4J; Table 9). Of these,
several represented ECM genes. Because genes globally upregulated in MRC1+ vs. CDl lc+ TAMs identify the protumoral gene signature of TAMs 7'29, these findings may imply that miR-51 l-3p negatively regulates the protumoral genetic programs of MRC1+ TAMs - at least in part - by decreasing their production of ECM/ECM-remodeling proteins.
Although ECM fibrous proteins are mainly produced by epithelial cells and fibroblasts in tumors 2'4, there is also evidence that several ECM genes, such as collagens, are robustly expressed by in vitro cultured macrophages 5. However, the significance of TAM-produced ECM fibrous proteins for tumor progression and vascularization has been largely ignored. We have shown that miR-51 1 -3p upregulation in TAMs (i) downregulates Rock2; (ii) reduces the expression of several genes involved in ECM synthesis and remodelling, including collagens, other fibrous proteins, proteases and scavenger receptors; (iii) broadly and specifically attenuates the expression of genes that define the protumoral gene signature of MRC1+ TAMs; (iv) dysregulates tumor blood vessel morphogenesis; and (v) reduces tumor growth.
ROCK2 has been identified recently as a key mechanoregulatory element that integrates physical cues from the ECM (e.g., extra-cellular tension) with cell's cytoskeletal contractility to regulate cell behaviour 1'32. Furthermore, constitutive ROCK activation in epithelial cells induces β-catenin stabilization, cell hyperproliferation, enhanced collagen synthesis and ECM stiffening, leading to increased tumor incidence and progression 2'3. Of note, the composition and biophysical properties of the ECM also influence vascular morphogenesis in tumors 34. Indeed, ECM density regulates the extension speed of vascular sprouts, and a high matrix- fiber anisotropy (i.e., directional tension) provides strong contact guidance cues for endothelial cells and stimulates sprout branching 34.
Certain tumor or T-cell cytokines, such as IL-4, can upregulate the expression of Mrcl in TAMs 7'29 and induce them to acquire protumoral functions 35. The contextual upregulation of miR-51 l-3p in MRC1+ TAMs may thus function as a cell-autonomous, negative feed-back mechanism that limits their protumoral functions. MRC1+ TAMs mostly reside around angiogenic blood vessels and regulate vascular growth by yet poorly defined paracrine signals likely involving cell-to-cell contacts with endothelial cells and their "guidance" to form complex vascular networks 36'37. Because MRC1+ TAMs represent a major component of the perivascular tumor stroma and support vascular morphogenesis in tumors 7'36, intrinsic modulation of ROCK2 and ECM-protein synthesis/remodeling by miR-511 -3p in MRC1+ TAMs may have the potential to influence loco-regional ECM dynamics and blood vessel morphogenesis in the tumor microenvironment.
Table 1
mmu-miR-511-3p predicted target genes (mouse)
Target gene Gene name
Acvr2b activin A receptor, type IIB
Add3 adducin 3 (gamma)
A†f4 AF4/FMR2 family, member 4
Akt2 v-akt murine thymoma viral oncogene homolog 2
Arhgef9 Cdc42 guanine nucleotide exchange factor (GEF) 9
Arnt aryl hydrocarbon receptor nuclear translocator
Arpp-21 cyclic AMP-regulated phosphoprotein, 21 kD
B3galt6 UDP-Gal:betaGal beta 1 ,3-galactosyltransferase polypeptide 6
Bach2 BTB and CNC homology 1 , basic leucine zipper transcription factor 2
Bnc2 basonuclin 2
Bptf bromodomain PHD finger transcription factor
C11orf61 chromosome 11 open reading frame 61
C2orf67 chromosome 2 open reading frame 67
C4orf46 chromosome 4 open reading frame 46
Camk2n1 ca!cium/calmodulin-dependent protein kinase II inhibitor 1
Cbx4 chromobox homolog 4 (Pc class homolog, Drosophila)
Ccdc64 coiled-coil domain containing 64
Cdc14a CDC14 cell division cycle 14 homolog A (S. cerevisiae)
Cdk6 cyclin-dependent kinase 6
Cenpo centromere protein O [Source: GI Acc:MGI:1923800]
CldnW claudin IO
Cplx2 complexin 2 [Source:MGI Acc:MGI:104726]
Criml cysteine rich transmembrane BMP regulator 1 (chordin-like)
D19Wsu162e Outcome predictor in acute leukemia 1 homolog. [Source:Uniprot/SWISSPROT Acc:Q8BGW2]
D730040F13Rik RIKEN cDNA D730040F13 gene (D730040F13Rik)
Dcun1d3 DCN1 , defective in cullin neddylation 1 , domain containing 3 (S. cerevisiae)
Dip2b DIP2 disco-interacting protein 2 homolog B (Drosophila)
Dnajc21 DnaJ (Hsp40) homolog, subfamily C, member 21
Efnb2 ephrin-B2
Epha4 EPH receptor A4
Erbb4 v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian)
Eya4 eyes absent homolog 4 (Drosophila)
Fam120c family with sequence similarity 120C
Fech ferrochelatase [Source:MGI Acc: GI:95513]
Fmnl3 formin-like 3
Foxkl forkhead box K1
Fubpl far upstream element (FUSE) binding protein 1
Gabrb3 gamma-aminobutyric acid (GABA) A receptor, beta 3
Galnt7 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)
Gfpt2 glutamine-fructose-6-phosphate transaminase 2
Gjb1 gap junction protein, beta 1 , 32kDa
Gk5 glycerol kinase 5 (putative)
Grm1 glutamate receptor, metabotropic 1
Gtdd glycosyltransferase-like domain containing 1
Gtpbp2 GTP binding protein 2
Hipk3 homeodomain interacting protein kinase 3
Hmg2l1 high-mobility group protein 2-like 1
Hrbl HIV-1 Rev binding protein-like
Igflr insulin-like growth factor 1 receptor
H22ra2 interleukin 22 receptor, alpha 2
Jmjd2c jumonji domain containing 2C [Source:MGI Acc:MGI: 1924054]
Kiaa0831 KIAA0831
Kiaa1370 KIAA1370
KIN9 kelch-like 9 (Drosophila)
Kpnal karyopherin alpha 1 (importin alpha 5)
Kpna6 karyopherin alpha 6 (importin alpha 7)
Lifr leukemia inhibitory factor receptor alpha
Lrrcd leucine rich repeat and coiled-coil domain containing 1
Lrrn3 leucine rich repeat neuronal 3
Mamll mastermind-like 1 (Drosophila)
Map3k12 mitogen-activated protein kinase kinase kinase 12
Mapk6 mitogen-activated protein kinase 6
March 1 membrane-associated ring finger (C3HC4) 1
Mastl microtubule associated serine/threonine kinase 1
Matr>3 matrilin 3
Mbd6 methyl-CpG binding domain protein 6
Mbnl2 muscleblind-like 2 (Drosophila)
Mef2d myocyte enhancer factor 2D
Met met proto-oncogene (hepatocyte growth factor receptor)
Mfap3 microfibrillar-associated protein 3 [Source:MGI Acc:MGI:1924068]
Mnt MAX binding protein
Ms4a14 membrane-spanning 4-domains, subfamily A, member 14
Mycbp c-myc binding protein
Ncam2 neural cell adhesion molecule 2
Necabl EF hand calcium binding protein 1 [Source:MGI Acc:MGI:1916602]
Ngfr nerve growth factor receptor (TNFR superfamily
Nlgn2 neuroligin 2
Nrf1 nuclear respiratory factor 1
Nrn1 neuritin 1
Nuakl NUAK family, SNF1 -like kinase, 1
Nufip2 nuclear fragile X mental retardation protein interacting protein 2
Onecut2 one cut domain
Otc ornithine transcarbamylase [Source:MGI Acc:MGI:97448]
Papola poly(A) polymerase alpha
Pax5 paired box 5
Pax6 paired box 6
Pcsk2 proprotein convertase subtilisin/kexin type 2
Pdpn podoplanin
Pfn1 profilin 1
Pik3cd phosphoinositide-3-kinase, catalytic, delta polypeptide
Pofutl protein O-fucosyltransferase 1 [Source:MGI Acc:MGI:2153207]
Poir3g polymerase (RNA) III (DNA directed) polypeptide G (32kD)
Polr3k polymerase (RNA) III (DNA directed) polypeptide K [Source:MGI Acc:MGI:1914255]
Ppargda peroxisome proliferator-activated receptor gamma, coactivator 1 alpha
Ppmll protein phosphatase 1 (formerly 2C)-like [Source: GI Acc:MGI:2139740]
Ppp1r9a protein phosphatase 1
Prpf40a PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)
Ptch 1 patched homolog 1 (Drosophila)
Pten phosphatase and tensin homolog [Source:MGI Acc:MGI:109583]
Ptgfr prostaglandin F receptor [Source: GI Acc:MGI:97796]
Pus7 pseudouridylate synthase 7 homolog (S. cerevisiae)
Rabgapll RAB GTPase activating protein 1 -like [Source: GI Acc: GI:1352507]
Rc3h1 ring finger and CCCH-type zinc finger domains 1
Ric8b resistance to inhibitors of cholinesterase 8 homolog B (C. elegans)
Robo2 roundabout, axon guidance receptor, homolog 2 (Drosophila)
Rock2 Rho-associated coiled-coil containing protein kinase 2 [Source: GI Acc: GI: 107926]
Rrbpl ribosome binding protein 1 homolog 180kDa (dog)
Sec23ip SEC23 interacting protein
Sema3a sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A
Sema5a sema domain
Slc25a43 solute carrier family 25, member 43
Slc29a3 solute carrier family 29 (nucleoside transporters)
Slc39a9 solute carrier family 39 (zinc transporter)
Slc4a4 solute carrier family 4, sodium bicarbonate cotransporter, member 4
Slc4a8 solute carrier family 4 (anion exchanger)
Slc7a2 solute carrier family 7 (cationic amino acid transporter
Slc8a1 solute carrier family 8 (sodium/calcium exchanger), member 1
Slco3a1 solute carrier organic anion transporter family, member 3A1
Spry2 sprouty homolog 2 (Drosophila)
Sspn sarcospan [Source:MGI Acc: GI:1353511]
Stard8 StAR-related lipid transfer (START) domain containing 8
Stx17 syntaxin 17 [SourceiMGI Acc:MGI:1914977]
Tcf4 transcription factor 4
Tfap2b transcription factor AP-2 beta (activating enhancer binding protein 2 beta)
Tjp1 tight junction protein 1 [Source:MGI Acc:MGI:98759]
Tmeff2 transmembrane protein with EGF-like and two follistatin-like domains 2
Tnfrsf21 tumor necrosis factor receptor superfamily, member 21
Tnrc6b trinucleotide repeat containing 6B
Top2b topoisomerase (DNA) II beta 180kDa
Treml2 triggering receptor expressed on myeloid cells-like 2 [Source:MGI Acc: GI:2147038]
Tsc22d3 TSC22 domain family, member 3
Tsga 14 testis specific, 14
Tshzl teashirt zinc finger homeobox 1
Ttc39a tetratricopeptide repeat domain 39A
Txlnb taxilin beta [Source:MGI Acc:MGI:2671945]
Ube2b ubiquitin-conjugating enzyme E2B (RAD6 homolog)
Ube2j1 ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast)
Unc5c unc-5 homolog C (C. elegans) [Source:MGI Acc:MGI:1095412]
Whsd Wolf-Hirschhorn syndrome candidate 1
Xpo7 exportin 7 [Source:MGI Acc:MGI:1929705]
Zc3h12a zinc finger CCCH-type containing 12A
Zfand3 zinc finger, AN1 -type domain 3
Zfx zinc finger protein, X-linked
Znf518b zinc finger protein 518B
Znf536 zinc finger protein 536
Table 1. Predicted mmu-miR-511-3p target genes. Predicted mouse miR-511-3p target genes were retrieved by using two distinct bioinformatics tools, Targetscan (Lewis et al., 2005) and Diana microT (Maragkakis et al., 2009).
Table 2
Biological process Count % p value Fold
Enrichment
Cell morphogenesis
cell projection organization 12 9,1 2.70E-05 5 neuron projection development 10 7,6 3.80E-05 6,1 cell projection morphogenesis 9 6,8 1 ,40E-04 5,9 cell part morphogenesis 9 6,8 1 ,90E-04 5,6 axonogenesis 8 6,1 2.20E-04 6,5 cellular component morphogenesis 1 1 8,3 3.00E-04 4,1 neuron projection morphogenesis 8 6,1 3,60E-04 6 cell morphogenesis involved in neuron differentiation 8 6,1 4,40E-04 5,8 cell morphogenesis 10 7,6 5.20E-04 4,3 regulation of cell migration 6 4,5 6.30E-04 8,6
6J0E-05
2,30E-04
2.30E-04
Total genes input: 145
Total genes clusterized: 132
Table 2. Clusterization of predicted mmu-miR-511-3p target genes by DAVID
Bioinformatic Resources 6.7 (mouse). Terms correspond to biological processes
annotated in the UniProtKB-GoA group (EMBL) gene ontology database (QuickGO).
Table 3 hsa-miR-511-3p predicted target genes (human)
Target gene Gene name
ACTL7B actin-like 7B
ACVR2B activin A receptor, type IIB
ADD3 adducin 3 (gamma)
Alcohol dehydrogenase 1 B (EC 1.1.1.1) (Alcohol dehydrogenase beta subunit).
ADH1B,ADH1C [Source:Uniprot/SWISSPROT Acc:P00325]
AFF4 AF4/FMR2 family, member 4
Annexin A11 (Annexin-11 ) (Annexin XI) (Calcyclin-associated annexin 50) (CAP-50) (56
ANXA11 kDa autoantigen). [Source:Uniprot/SWISSPROT Acc:P50995]
ARPP-21 cyclic A P-regulated phosphoprotein, 21 kD
BACH1 BTB and CNC homology 1 , basic leucine zipper transcription factor 1
BACH2 BTB and CNC homology , basic leucine zipper transcription factor 2
BNC2 basonuclin 2
BPTF bromodomain PHD finger transcription factor
C11orf61 chromosome 11 open reading frame 61
C12or†36 Putative uncharacterized protein C12orf36. [Source:Uniprot/SWISSPROT Acc:Q495D7]
Uncharacterized potential DNA-binding protein C14orf106 (P243).
C14orf106 [Source:Uniprot/SWISSPROT Acc:Q6P0N0]
C1D nuclear DNA-binding protein
Uncharacterized protein C1orf21 (Proliferation-inducing gene 13 protein).
C1orf21 [Source:Uniprot SWISSPROT Acc:Q9H246]
C2orF67 chromosome 2 open reading frame 67
C4orf46 chromosome 4 open reading frame 46
C6orf103 Uncharacterized protein C6orf103. [Source:Uniprot/SWISSPROT Acc:Q8N7X0]
CALM1 calmodulin 1 (phosphorylase kinase, delta)
CAMK2N1 calcium/calmodulin-dependent protein kinase II inhibitor 1
CBX4 chromobox homolog 4 (Pc class homolog, Drosophila)
CCDC149 coiled-coil domain containing 149
CCDC4 Coiled-coil domain-containing protein 4. [Source:Uniprot SWISSPROT Acc:Q6ZU67]
CDC14A CDC 14 cell division cycle 14 homolog A (S. cerevisiae)
CENTB2 Centaurin-beta 2 (Cnt-b2). [Source:Uniprot/SWISSPROT Acc:Q15057]
CEP76 centrosomal protein 76kDa
CRIM1 cysteine rich transmembrane BMP regulator 1 (chordin-like)
CRKRS Cdc2-related kinase, arginine/serine-rich
CSMD1 CUB and Sushi multiple domains 1
Catenin delta-2 (Delta-catenin) (Neural plakophilin-related ARM-repeat protein) (NPRAP)
CTNND2 (Neurojungin) (GT24). [Source:Uniprot/SWISSPROT Acc:Q9UQB3]
CUL3 cullin 3
DCTD dCMP deaminase
DCUN1D3 DCN1 , defective in cullin neddylation 1 , domain containing 3 (S. cerevisiae)
DENND2C DENN/MADD domain containing 2C
Density-regulated protein (DRP) (Protein DRP1 ) (Smooth muscle cell- associated protein
DENR 3) (SMAP-3). [Source:Uniprot/SWISSPROT Acc:043583]
DIP2B DIP2 disco-interacting protein 2 homolog B (Drosophila)
Disks large-associated protein 2 (DAP-2) (SAP90/PSD-95-associated protein 2) (SAPAP2) (PSD-95/SAP90-binding protein 2) (Fragment). [Source:Uniprot/SWISSPROT
DLGAP2 Acc:Q9P1A6]
EFNB2 ephrin-B2
Early growth response protein 3 (EGR-3) (Zinc finger protein pilot).
EGR3 [Source:Uniprot/SWISSPROT Acc:Q06889]
EIF1B eukaryotic translation initiation factor 1 B
ENTPD5 ectonucleoside triphosphate diphosphohydrolase 5
EPHA4 EPH receptor A4
EPN2 epsin 2
ERBB4 v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian)
ETF1 eukaryotic translation termination factor 1
EYA4 eyes absent homolog 4 (Drosophila)
FAM120C family with sequence similarity 120C
Heparin-binding growth factor 2 precursor (HBGF-2) (Basic fibroblast growth factor)
FGF2 (BFGF) (Prostatropin). [Source:Uniprot/SWISSPROT Acc:P09038]
FLJ20309 hypothetical protein FLJ20309
FOXK1 forkhead box K1
FOXN3 forkhead box N3
FUBP1 far upstream element (FUSE) binding protein 1
FUT4 Alpha-(1
G3BP2 GTPase activating protein (SH3 domain) binding protein 2
GABRB3 gamma-aminobutyric acid (GABA) A receptor, beta 3
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7
GALNT7 (GalNAc-T7)
GFPT2 glutamine-fructose-6-phosphate transaminase 2
GJB1 gap junction protein, beta 1 , 32kDa
GK5 glycerol kinase 5 (putative)
GLI3 GLI-Kruppel family member GLI3 (Greig cephalopolysyndactyly syndrome)
GNB4 guanine nucleotide binding protein (G protein), beta polypeptide 4
Glutamate [NMDA] receptor subunit epsilon-1 precursor (N-methyl D- aspartate receptor
GRIN2A subtype 2A) (NR2A) (NMDAR2A) (hNR2A). [SourceiUniprot/SWISSPROT Acc:Q12879]
GRM1 glutamate receptor, metabotropic 1
GTDC1 glycosyltransferase-like domain containing 1
GTPBP2 GTP binding protein 2
HIPK3 homeodomain interacting protein kinase 3
HIST1H2AE histone cluster 1 , H2ae
Krueppel-related zinc finger protein 1 (Protein HKR1 ). [SourcetUniprot SWISSPROT
HKR1 Acc:P10072]
HMG2L1 high-mobility group protein 2-like 1
Heterogeneous nuclear ribonucleoprotein AO (hnRNP AO). [Source:Uniprot/SWISSPROT
HNRNPAO Acc:Q13151]
HOMER 1 Homer protein homolog 1. [Source:Uniprot/SWISSPROT Acc:Q86YM7]
IGF1R insulin-like growth factor 1 receptor
KIAA0423 Uncharacterized protein KIAA0423. [Source:Uniprot/SWISSPROT Acc:Q9Y4F4]
Brefeldin A-inhibited guanine nucleotide-exchange protein 3.
KIAA1244 [Source:Uniprot/SWISSPROT Acc:Q5TH69]
KIAA 1370 KIAA1370
KIAA 1486 KIAA1486 protein
KIAA1598 Shootinl . [Source:Uniprot/SPTRE BL Acc:A0MZ66]
Krueppel-like factor 12 (Transcriptional repressor AP-2rep). [Source:Uniprot SWISSPROT
KLF12 Acc:Q9Y4X4]
KPNA 1 karyopherin alpha 1 (importin alpha 5)
KPNA6 karyopherin alpha 6 (importin alpha 7)
LIFR leukemia inhibitory factor receptor alpha
LOC162073 hypothetical protein LOC 162073
LOXL2 lysyl oxidase-like 2
LRRN3 leucine rich repeat neuronal 3
MAML1 mastermind-like 1 (Drosophila)
MAP3K12 mitogen-activated protein kinase kinase kinase 12
MAP4K3 mitogen-activated protein kinase kinase kinase kinase 3
MAPK1 mitogen-activated protein kinase 1
MAPK6 mitogen-activated protein kinase 6
MAST1 microtubule associated serine/threonine kinase 1
MATN3 matrilin 3
MBD6 methyl-CpG binding domain protein 6
MBNL1 muscleblind-like (Drosophila)
MBNL2 muscleblind-like 2 (Drosophila)
MEF2D myocyte enhancer factor 2D
MEGF10 multiple EGF-like-domains 10
MKLN1 Muskelin. [Source:Uniprot/SWISSPROT Acc:Q9UL63]
MOCS3 molybdenum cofactor synthesis 3
MYCBP c-myc binding protein
NCAM2 neural cell adhesion molecule 2
NEGRI neuronal growth regulator 1
NLGN2 neuroligin 2
NLGN4X neuroligin 4, X-linked
NRF1 nuclear respiratory factor 1
NUAK1 NUA family, SNF1-like kinase, 1
NUFIP2 nuclear fragile X mental retardation protein interacting protein 2
OSBPL9 oxysterol binding protein-like 9
PALLD palladin [Source: RefSeq_peptide Acc:NP_057165]
PAP2D phosphatide acid phosphatase type 2
PAPOLA poly(A) polymerase alpha
PAPOLB poly(A) polymerase beta (testis specific)
PAX6 paired box 6
Protocadherin-11 X-linked precursor (Protocadherin-11 ) (Protocadherin on the X
PCDH11X chromosome) (PCDH-X) (Protocadherin-S). [Source:Uniprot/SWISSPROT Acc:Q9BZA7]
Polycomb group RING finger protein 5 (RING finger protein 159).
PCGF5 [Source:Uniprot/SWISSPROT Acc:Q86SE9]
PCSK2 proprotein convertase subtilisin/kexin type 2
PDE10A cA P and cAMP-inhibited cGMP 3'
PDPN podoplanin
PDS5A PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)
PHACTR2 phosphatase and actin regulator 2
PIK3CD phosphoinositide-3-kinase, catalytic, delta polypeptide
PLAG1 pleiomorphic adenoma gene 1
PLCXD3 phosphatidylinositol-specific phospholipase C
PMP2 Myelin P2 protein. [Source:Uniprot/SWISSPROT Acc:P02689]
POLR3G polymerase (RNA) III (DNA directed) polypeptide G (32kD)
PPARGC1A peroxisome proliferator-activated receptor gamma, coactivator 1 alpha
PPP1R2 protein phosphatase 1 , regulatory (inhibitor) subunit 2
PRKAG2 protein kinase, AMP-activated, gamma 2 non-catalytic subunit
PRPF40A PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)
PTCH1 patched homolog 1 (Drosophila)
Receptor-type tyrosine-protein phosphatase T precursor (EC 3.1.3.48) (R-PTP-T) (RPTP-
PTPRT rho). [SourceiUniprot/SWISSPROT Acc:014522]
RAB11FIP3 RAB11 family interacting protein 3 (class II)
RAB22A Ras-related protein Rab-22A (Rab-22). [SourcerUniprot/SWISSPROT Acc:Q9UL26]
RAB3A-interacting protein (Rabin-3) (SSX2-interacting protein).
RAB3IP [Source:Uniprot/SWISSPROT Acc:Q96QF0]
RC3H1 ring finger and CCCH-type zinc finger domains 1
Rho-related GTP-binding protein RhoQ precursor (Ras-related GTP- binding protein
RHOQ TC10). [Source:Uniprot/SWISSPROT Acc:P17081]
ROB02 roundabout, axon guidance receptor, homolog 2 (Drosophila)
RRBP1 ribosome binding protein 1 homolog 180kDa (dog)
SEC23IP SEC23 interacting protein
SEMA3A sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A
SH3 domain and tetratricopeptide repeats-containing protein 2.
SH3TC2 [Source.-Uniprot/SWISSPROT Acc:Q8TF17]
SLC12A6 solute carrier family 12 (potassium/chloride transporters), member 6
SLC25A43 solute carrier family 25, member 43
SLC2A12 solute carrier family 2 (facilitated glucose transporter), member 12
SLC03A1 solute carrier organic anion transporter family, member 3A1
SLC04C1 solute carrier organic anion transporter family
SPRY2 sprouty homolog 2 (Drosophila)
SPRY3 Sprouty homolog 3 (Spry-3). [Source.-Uniprot SWISSPROT Acc:O43610]
Afadin- and alpha-actinin-binding protein (ADIP) (Afadin DIL domain- interacting protein)
SSX2IP (SSX2-interacting protein). [SourceiUniprot/SWISSPROT Acc:Q9Y2D8]
STARD8 StAR-related lipid transfer (START) domain containing 8
SV2B Synaptic vesicle glycoprotein 2B. [SourceiUniprot/SWISSPROT Acc:Q7L112]
SYNGAP1 synaptic Ras GTPase activating protein 1 homolog (rat)
TBC1 domain family member 23 (HCV non-structural protein 4A- transactivated protein 1 ).
TBC1D23 [Source:Uniprot/SWISSPROT Acc:Q9NUY8]
TCF4 transcription factor 4
TFAP2B transcription factor AP-2 beta (activating enhancer binding protein 2 beta)
TMEFF2 transmembrane protein with EGF-like and two follistatin-like domains 2
TMEM1 transmembrane protein 1
TMEM106B Transmembrane protein 106B. [Source:Uniprot/SWISSPROT Acc:Q9NUM4]
TNFRSF21 tumor necrosis factor receptor superfamily, member 21
TNRC6B trinucleotide repeat containing 6B
TNRC6B Trinucleotide repeat-containing 6B protein. [SourceiUniprot/SWISSPROT Acc:Q9UPQ9]
TOP2B topoisomerase (DNA) II beta 180kDa
TSC22D3 TSC22 domain family, member 3
TSGA14 testis specific, 14
TSHZ1 teashirt zinc finger homeobox 1
TTC39A tetratricopeptide repeat domain 39A
UBE2B ubiquitin-conjugating enzyme E2B (RAD6 homolog)
UBP1 upstream binding protein 1 (LBP-1 a)
WHSC1 Wolf-Hirschhorn syndrome candidate 1
WWC3 WWC family member 3
XKR4 XK-related protein 4. [Source:Uniprot/SWISSPROT Acc:Q5GH76]
ZC3H12A zinc finger CCCH-type containing 12A
ZFAND3 zinc finger, AN 1 -type domain 3
ZFP91 zinc finger protein 91 homolog (mouse)
ZFX zinc finger protein, X-linked
ZMYND12 zinc finger, YND-type containing 12
ZNF208 Zinc finger protein 208. [Source:Uniprot SWISSPROT Acc:043345]
ZNF248 zinc finger protein 248
ZNF518B zinc finger protein 518B
ZNF536 zinc finger protein 536
ZNF543 Zinc finger protein 543. [Source:Uniprot SWISSPROT Acc:Q08ER8]
ZNF626 Zinc finger protein 626. [Source:Uniprot SWISSPROT Acc:Q68DY1]
junction-mediating and regulatory protein [Source:RefSeq_peptide Acc:NP_689618]
Table 3. Predicted miR-511-3p target genes (human). Predicted human miR-511- 3p target genes were retrieved by using two distinct bioinformatics tools, Targetscan (Lewis et al., 2005) and Diana microT (Maragkakis et al., 2009).
Table 4
Biological processes Count % p value Fold
Enrichment
Morphogenesis
cellular component morphogenesis 12 7 2.00E-03 3 cell morphogenesis 11 6,4 2.90E-03 3,1 cell projection morphogenesis 9 5,3 3.00E-03 3,7 cell part morphogenesis 9 5,3 4.00E-03 3,5 neuron projection morphogenesis 8 4,7 5,30E-03 3,8 cell morphogenesis involved in differentiation 8 4,7 1.10E-02 3,3 cell projection organization 10 5,8 1.10E-02 2,7
Metabolism
protein amino acid phosphorylation 15 8,8 6.30E-03 2,3
Protein localization
protein import into nucleus 5 2,9 1 ,00E-02 5,8 protein localization in organelle 7 4,1 3.30E-03 4,8
Transcription
transcription 40 23,4 4J0E-05 1 ,9 regulation of transcription 44 25,7 2,60E-04 1 ,7
Total genes inputed: 183
Total genes clusterized: 171
Table 4. Clusterization of predicted miR-511-3p target genes by DAVID
Bioinformatic Resources 6.7 (human). Terms correspond to biological processes annotated in the UniProtKB-GoA group (EMBL) gene ontology database (QuickGO).
Table 5
Differentially expressed genes
MGI symbol Fold change p val p adj
Fcer2a 0 1.1 E-04 1.3E-02
Sycel 0 1.7E-81 1.9E-77
Sctr 0 7.6E-05 9.4E-03
Cd19 0 6.9E-09 2.2E-06
Pou2af1 0 6.8E-08 1.8E-05
Gm16797 0 4.4E-04 4.1 E-02
Gm 16634 0 5.1 E-06 9.6E-04 lgkv10-94 0 2.8E-11 1.4E-08
Gm16849 0 1.1 E-11 6.1 E-09
Igkv8-21 0 9.8E-07 2.1 E-04 lgkv3-4 0 2.3E-16 2.7E-13
Ighgl 0 3.1E-65 2.3E-61
Gm 16891 0 2.0E-07 5.0E-05
Gm 16609 0 2.8E-04 2.8E-02
Gm 16996 0 1.5E-06 3.0E-04
Gm16697 0 3.3E-09 1.2E-06 lghv1-59 0 4.4E-07 1.0E-04
Gm16900 0 3.4E-06 6.6E-04
Iglvl 0 1 -8E-05 2.8E-03
AdamtsH 0.0 3.6E-203 7.9E-199
Art5 0.0 5.7E-13 3.9E-10
Gm156 0.0 4.9E-05 6.7E-03
Faim3 0.0 3.1 E-05 4.4E-03
Igkc 0.1 3.2E-25 8.9E-22
Bcl11b 0.1 5.6E-06 1.0E-03 igj 0.1 2.2E-08 6.5E-06
Cr2 0.1 1.6E-04 1.7E-02
Tcf7 0.1 2.9E-09 1.1 E-06
Trpal 0.1 2.4E-04 2.5E-02
Arhgef26 0.1 1.8E-05 2.8E-03
Siitrkl 0.1 3.4E-04 3.3E-02
Cd6 0.1 6.0E-06 1.1 E-03
Itk 0.1 8.7E-07 1.9E-04
Col4a6 0.2 3.9E-04 3.7E-02
Trbc2 0.2 5.2E-05 6.9E-03
Gm10451 0.2 4.5E-10 2.0E-07
Zfp57 0.2 3.4E-04 3.3E-02
Tnfsf11 0.2 7.4E-05 9.3E-03
Cd79a 0.2 2.1E-04 2.2E-02
Cd3e 0.2 3.7E-05 5.2E-03
Cd8a 0.2 9.2E-08 2.4E-05
Cd3g 0.2 8.1 E-05 9.9E-03
Btla 0.2 9.7E-05 1.1 E-02
Tinagll 0.2 2.3E-05 3.3E-03
PpplrWb 0.2 1.3E-05 2.1 E-03
Col 24a 1 0.2 2.9E-04 2.9E-02
Sema5a 0.2 1.8E-07 4.7E-05
Gimap3 0.2 2.0E-04 2.1 E-02
Gimap8 0.2 6.4E-05 8.3E-03
Gimap4 0.2 1.2E-05 2.0E-03
Irx2 0.2 2.5E-04 2.5E-02
Klrd 0.2 1.4E-04 1.6E-02
Osr2 0.2 1.2E-05 2.0E-03
Srnod 0.2 2.0E-04 2.1 E-02 igf2 0.2 2.6E-05 3.8E-03
Sh2d2a 0.2 6.5E-06 1.2E-03
Nkg7 0.2 6.8E-05 8.7E-03
Ighg2b 0.2 7.9E-05 9.7E-03 lpo11 0.2 1.OE-08 3.3E-06
Ptn 0.3 7.2E-10 2.9E-07
Aspn 0.3 9.6E-05 1.1 E-02
Cacna2d1 0.3 1.2E-05 2.0E-03 lcos 0.3 1.3E-04 1.5E-02
Tmem47 0.3 3.3E-05 4.6E-03
Lrch2 0.3 7.7E-05 9.5E-03
Ncaml 0.3 2.1 E-05 3.2E-03
Fb!nl 0.3 1.8E-05 2.8E-03
SparcH 0.3 4.3E-04 4.0E-02
Ednra 0.3 2.9E-06 5.8E-04
Lck 0.3 3.1 E-04 3.0E-02
Gzmb 0.3 1.4E-05 2.3E-03
Peg3 0.3 4.2E-09 1.5E-06
Sema3a 0.3 1.6E-11 8.6E-09
Col4a5 0.3 7.0E-06 1.2E-03
Syt13 0.3 2.0E-06 4.1 E-04
H2rb 0.3 6.4E-07 1.4E-04
Sox9 0.3 7.6E-05 9.4E-03
Trib2 0.3 3.6E-04 3.4E-02
S100a9 0.3 6.6E-13 4.4E-10
Osmr 0.3 7.0E-06 1.2E-03
H19 0.3 2.8E-07 6.8E-05
Lum 0.3 9.6E-11 4.4E-08
Ace 0.3 5.1 E-06 9.6E-04
Dkk2 0.3 2.9E-11 1.4E-08
Lgi2 0.3 1.4E-08 4.4E-06
Coi6a3 0.3 1.4E-24 3.2E-21
Ddx3y 0.3 9.7E-05 1.1 E-02
Apc2 0.3 2.4E-04 2.5E-02
Cyr61 0.3 2.0E-07 5.0E-05
Evc2 0.3 5.1 E-04 4.6E-02
Yes1 0.3 3.6E-04 3.4E-02
IgsflO 0.3 4.6E-04 4.2E-02
Rgma 0.3 5.3E-04 4.8E-02
Pearl 0.3 3.1 E-04 3.1 E-02
Ano1 0.3 2.7E-04 2.7E-02
Plod2 0.3 3.9E-14 3.0E-11
Dpt 0.3 2.5E-09 9.4E-07
Clu 0.3 2.2E-05 3.3E-03
Apcddl 0.3 6.8E-09 2.2E-06
Ccbel 0.3 6.6E-08 1.8E-05
Nidi 0.4 4.0E-28 1.5E-24
Cd28 0.4 4.4E-04 4.1E-02
Prrxl 0.4 2.4E-13 1.8E-10
Bdnf 0.4 5.0E-04 4.5E-02
Pdgfra 0.4 3.7E-13 2.7E-10
Lambl 0.4 9.8E-25 2.4E-21
Dnm3os 0.4 6.9E-05 8.7E-03
Pdgfrb 0.4 5.0E-05 6.8E-03
Sdc2 0.4 2.7E-10 1.2E-07
Adamtsl 0.4 3.7E-14 3.0E-11
Scara5 0.4 6.4E-06 1.2E-03
Ltbp1 0.4 7.3E-13 4.7E-10
Csgalnacti 0.4 9.3E-05 1.1 E-02
Col16a1 0.4 1.4E-11 7.8E-09
Npdrf 0.4 1.8E-04 1.9E-02
Aebpl 0.4 1.3E-14 1.2E-11
Sema3e 0.4 1.6E-06 3.2E-04
Den 0.4 2.1 E-16 2.6E-13
Mrc2 0.4 3.9E-06 7.5E-04
Spry4 0.4 2.1 E-05 3.2E-03
Tgfbr3 0.4 1.1 E-11 6.1 E-09
Maspl 0.4 2.1 E-04 2.2E-02
Serpinh 1 0.4 2.3E-15 2.3E-12
Pcdhb22 0.4 5.2E-05 6.9E-03
Lrigl 0.4 3.3E-12 2.0E-09
Tm4sf1 0.4 7.6E-06 1.3E-03
Sertad4 0.4 1.5E-04 1.7E-02
Col23a1 0.4 2.6E-04 2.6E-02
Col5a1 0.4 2.1 E-16 2.6E-13
Ptprg 0.4 4.2E-04 3.9E-02
Acapl 0.4 2.7E-05 3.9E-03
Mxra8 0.4 2.8E-09 1.0E-06
Ank3 0.4 4.2E-06 8.1 E-04
Hspg2 0.4 1.1 E-21 1.8E-18
Npbrt 0.4 5.1 E-10 2.1 E-07
Rgs16 0.4 5.5E-07 1.2E-04
Col8a1 0.4 1.2E-05 1.9E-03
Pard3 0.4 1.3E-04 1.4E-02
Col6a1 0.4 1.6E-16 2.2E-13
Pxdn 0.4 2.5E-10 1.1 E-07
Thbs2 0.4 1.5E-17 2.2E-14
Mmp3 0.4 1 JE-08 5.2E-06
FkbpIO 0.4 1.0E-05 1.8E-03
Kirrel 0.4 4.7E-09 1.6E-06
FstH 0.4 1.4E-15 1.5E-12
Itga3 0.4 1.4E-04 1.6E-02
Mmp11 0.4 6.0E-05 7.8E-03
Col6a2 0.4 3.9E-12 2.3E-09
Grb10 0.4 4.4E-05 6.1 E-03
Ntn1 0.4 2.4E-08 6.8E-06
GH3 0.4 1.0E-05 1.8E-03
Ereg 0.4 2.0E-08 6.1 E-06
Farpl 0.4 2.3E-07 5.6E-05
Odz4 0.4 4.5E-08 1.3E-05
Did 0.4 5.4E-06 1.OE-03
Ghr 0.4 1.0E-06 2.2E-04
Bmprla 0.4 1.5E-05 2.4E-03
Scd1 0.4 9.5E-09 3.0E-06
111 rl 0.4 5.1 E-07 1.1 E-04
Gpr153 0.4 1.4E-04 1.6E-02
Col3a1 0.4 2.4E-22 4.7E-19
Loxl2 0.4 8.4E-14 6.4E-11
Hid 0.4 1.9E-04 2.0E-02
Fbn1 0.4 2.6E-16 2.9E-13
Lhfp 0.4 6.4E-05 8.3E-03
Arhgef25 0.4 2.2E-04 2.3E-02
C1s 0.4 1.2E-05 2.0E-03
Lama5 0.4 3.8E-09 1.3E-06
AmotH 0.4 2.9E-08 8.3E-06
Tspan9 0.4 5.4E-07 1.2E-04
Dlg5 0.4 1.0E-04 1.2E-02
Scara3 0.4 1.8E-04 1.9E-02
Pcolce 0.4 1.1 E-11 6.1 E-09
Pcdh19 0.4 2.4E-04 2.5E-02
Fermt2 0.4 2.8E-06 5.5E-04
Col4a2 0.4 9.1 E-11 4.3E-08
Tnxb 0.4 5.4E-05 7.1 E-03
Wwtrl 0.4 1.5E-05 2.4E-03
Bmp1 0.4 6.4E-10 2.7E-07
Ppic 0.4 2.9E-05 4.2E-03
Teadl 0.4 5.7E-05 7.5E-03
F2r 0.4 4.8E-07 1.1 E-04
Nedd4 0.4 4.8E-18 7.6E-15
Ddr2 0.4 6.8E-09 2.2E-06
Yap1 0.4 8.8E-06 1.5E-03
Col4a1 0.5 3.0E-14 2.5E-11
Dppa3 0.5 4.8E-05 6.5E-03
Gpr124 0.5 1.0E-05 1.7E-03
Parva 0.5 3.5E-07 8.2E-05
Egfr 0.5 1.9E-05 2.8E-03
Rhobtb3 0.5 3.1E-04 3.0E-02
Caldl 0.5 1.8E-14 1.6E-11
Fine 0.5 1.3E-08 4.0E-06
Ltbp4 0.5 6.7E-05 8.6E-03
Cdon 0.5 1.0E-04 1.2E-02
Ptges 0.5 2.4E-08 6.8E-06
Serpinfl 0.5 8.6E-08 2.3E-05
Csf1 0.5 7.4E-13 4.7E-10
Epb4.1l3 0.5 8.7E-05 1.1 E-02
Steap2 0.5 3.9E-06 7.5E-04
Bgn 0.5 1.5E-09 5.8E-07
Sparc 0.5 1.4E-09 5.5E-07
S100a8 0.5 4.2E-05 5.8E-03
Mtaplb 0.5 1.1 E-09 4.3E-07
Fscnl 0.5 1.6E-07 4.1 E-05
Rbfox2 0.5 1.8E-07 4.5E-05
Htral 0.5 2.9E-07 7.0E-05
Unc5b 0.5 1.8E-04 2.0E-02
Fgfr1 0.5 4.4E-07 1.OE-04
Dock9 0.5 1.4E-04 1.6E-02
Eya4 0.5 1.1 E-05 1.9E-03
Tend 0.5 4.4E-04 4.1 E-02
Heg1 0.5 2.6E-04 2.6E-02
Tjp1 0.5 9.5E-05 1.1 E-02
Vcan 0.6 8.3E-10 3.3E-07
Nuakl 0.6 3.2E-04 3.2E-02
Matn2 0.6 4.6E-04 4.2E-02
Hmga2 0.6 2.9E-05 4.2E-03
Chst11 0.6 2.3E-04 2.3E-02
Colec12 0.6 2.2E-04 2.3E-02
Ptrf 0.6 7.4E-07 1.6E-04
Nckapl 0.6 3.5E-04 3.4E-02
Mamdc2 0.6 9.5E-05 1.1 E-02
Ehd2 0.6 5.0E-04 4.5E-02
Erbb3 0.6 5.3E-04 4.8E-02
Col18a1 0.7 1.3E-04 1.5E-02
Cav1 0.7 1.8E-05 2.8E-03
Cadml 0.7 1.4E-05 2.2E-03
Gm13139 0.7 4.8E-04 4.4E-02
Cbr2 1.3 3.6E-04 3.4E-02
Hmoxl 1.5 1.5E-04 1.6E-02
Lipg 1.5 7.0E-05 8.8E-03
Arap2 2.0 3.6E-04 3.4E-02
Slc7a2 2.2 4.0E-15 3.9E-12
Etl4 2.6 4.4E-05 6.0E-03
H2-M2 3.4 1.5E-06 3.0E-04
Sorbs2 3.6 5.6E-04 4.9E-02
Bcl2 3.8 3.6E-35 1.6E-31
Nrcam 4.3 3.3E-05 4.7E-03
Retnla 4.8 3.3E-22 6.1 E-19
Prdm16 7.1 1.3E-06 2.7E-04
Capn11 7.4 3.5E-04 3.3E-02
Atp9a 7.5 6.9E-08 1.9E-05
Mir511 11.7 2.3E-11 1.2E-08
Cryab 14.4 3.5E-11 1.7E-08
Hspb2 42.0 1.7E-06 3.4E-04
Pkhd1l1 147.4 9.6E-26 3.0E-22
Slc35f1 159.5 8.1 E-42 4.5E-38
Table 5. Genes differentially expressed in the TAMs of SFFV.miR-511 and SFFV.miR-511 -mut mice.
Table 6 miR-511-3p miR-511-5p miR-511-3p-mut
M8-A1 8 mer M8 7mer M8-A1 8 mer M8 7mer M8-A1 8 mer M8 7mer
Treml2 Slc4a4 Nufip2 Zfp704 Vps37a Rab9b
Fech Stx17 Npr3 Pldn Ier3ip1 Rnpc3
Onecut2 AmotH Trtpol Fmn1 Irf4 Ccdc41
Fmn2 Slc8a1 Suv39h1 Itgb3bp Foxp2 Podxl
Slc7a11 Slc6a19 Fbxo32 Socs7 Ptpdd Sla2
Txlnb Sema3a Zfp191 Tmem33 Calml Sgpp2
Pofutl Ankrd44 Fgf10 Tmem33 Sox6 Zfp148
Ngfr 9430020K01Rik Zfp295 Adam22 Slc6a6 Onecut2
Gabrb3 Cap2 Sox6 Txndc13 Mrpl17 Zfp354b
Papss2 P2rx3 Pdelc 2810002O09Rik Prpf39 Synel
Vamp5 4933407118Rik Mbd3l2 Neu4 Nadk Chrnb3
Vamp5 Otc D5Ertd579e Tceal Slc8a1 Akt3
Galnt13 Unc5c A830091H5Rik Gpr64 Ha lnl Ywhab
ColerfO Mlstdl Olr1 Zfp711 4932441K18Rik Gypa
Rps6kb1 Dcx Opa3 Ncald Rin2 BCI2I11
Ncoa4 Ywhaz Crkl Nanosl Exoc3 Zmat4
Mrgpre Lig3 Klhdc7a Gm944 Fyttdl Zfp385
Zscan12 Ppp2r1b C030014M07Rik Slc35a3 0610010F05Rik NlrplO
Rock2 Neto2 Sox 11 Zfp46 Ctdspl2 Mrps25
Ppp1r9a Leng4 Pftkl Invs Cdo1 Centb2
Nbeall Trhde Fzd7 Bmprla Stam Elp4
6332401019Rik Psme3 Snx30 PcdhalO Stxbp6 RsbnH
C330019G07Rik Prkch Kcnabl Slc8a1 Nrxr>3 Rgs7bp
Car10 D19Wsu162e Zcchc7 Lca5 Macrod2 Ube2n
Npal2 Sult1b1 Col19a1 Taptl Hdgfrp3 Spire 1
Aphlb Gpr45 H22ra2 AI597479 Cacnb4 Smarcal
Εηρρβ Ptp4a1 Crk Plcxd3 Med28 Klf12
A730069N07Rik Kcnvl OTTMUSG00000008561 Galnact2 Cdh12 4933426K21Rik
Akap2 Stxbp6 Pdikll Arl5b 1500031L02Rik Zfp704
Akap2 St18 Mbtps2 Arpp21 Adamts Ap3m1
Pnma2 Brwd3 Slc37a2 AmotH Adck2 B4galt1
Agtrla Arhgef9 Mex3a Sema3d 4933403F05Rik Zfp708
Gm237 Adamts5 Onecut2 Prr8 Cstf2 Cd302
ORF34 Spock3 Nif3l1 Fads3 9530066K23Rik Thbd
Hnrpa2b1 Larp4 Gpr152 Emx2 Rex2 C1qtnf7
Cdc a A530054K11Rik Slco5a1 AU023871 Zfp820 Dcun1d4
Tjp1 Lin7a Mecp2 Csf1 Erc2 Usp46
Tank Rspol D430041D05Rik Syt1 Snx30 Armrf
Ddx17 Mrvi1 Star 4933427D06Rik 1200015N20Rik BC035537
Wnt7a Frasl Cbx3 Mxi1 Abcal Magix
Zfp641 Slc6a6 Hpse Jazfl Pcdh9 Tub
Ube2j1 Pbx1 Slco3a1 Tpx2 Fat3 Npal2
Pbrml Sema5a Rnf152 Trim2 Ppp1r9a Stxbp5
Mfap3 Acsl4 Ptchdl AbcaS Stx17 Edg2
Rnpc3 Cacng5 Suhw3 Lmln Osbpl8 1110020G09Rik
Calcr Arhgap15 Grem2 Rfxank Ppig KctdS
AI597479 Shroom2 Vapb Ankrd13a Slc1a3 Isl1
Plscr4 Oxctl Clec5a Pbx1 1110007M04Rik Thsd7b
Tmepai Slc5a8 Rbpj 3110049 J23Rik St8sia2 Klhl4
Bclafl Gria3 Luzpl Cdanl EG436240 Acadsb
Polr3d Zhx1 Tpm1 Arhgef15 2610305D13Rik Gfral
Ampd3 Opcml Pmaipl Zrsr2 Vdr Lritl
Zfp449 Met Rhbddl Entpd7 Mor†4l1 Stk39
Kcnal Frmd6 Kcna2 Mllt3 Fadsl TmemWe
B3gnt5 Zfp810 Triobp Hmgcsl Cgnl1 A030009H04Rik
Gcntl PafaMbl Triobp Rp23-45p4.1 Prokrl LOC433791
Adamts12 Dlg2 Corolc LztfH MSK4 Ifrg15
Sfmbt2 EG433634 Antxrl Atp8a1 Igfbp5 Hip2
Pnpla8 Bicd2 Pcnx Fbxo45 Grem2 Tsn
Sh3md4 Sdpr Ppap2a Stk38 EG210853 Fhl4
Gpr116 Ctdspl2 Mix Magi3 Rcbtbl Cenpn
Slco3a1 Fmnl2 Sash1 Rnf19 Usp12 Il15ra
Extl3 Btla 2610301B20Rik 2810055F11Rik Rps6kb1 Spnb1
Alcam Trib2 Abat Lrrc39 Slain2 Slc2a9
Gnb4 Cnksr3 Stx1 Rad54l2 Slc2a13 Fmn2
Nlgn3 Slitrk6 Centb2 Yipf6 C130060K24Rik Aff1
Zfp Kits Asph RlbplH Phactr3 Dpp8
Igf2 Lrrc16 Galnt13 Lamp2 Lcp1 Mtap4
Bicd2 Edeml Tacrl Ak3l1 ORF34
Ceacam20 Pou4f2 Ppap2a Six6 Cnksr2 Saps3
Slc22a8 Casp12 Gpr146 Ptp4a2 Smekl Kif3c
Mbnl2 Gm50 Gpr146 Ab\2 Sox11 Cadml
Edil3 Ostml Ldhc Amot PcdMO Gsk3b
Nox4 Smc2 Camkld Sftpal Fgfrlop Atp6ap2
D3Bwg0562e Ankrd1 V2r8 Tdrd3 Rnf170 Pik3r1
Kpnal Tbx22 Sprn D11Wsu99e Lin7c Med13
Gng12 AI747699 Slc5a8 Nt5e Zfp365 Enox2
Ccnc Dpy19l4 Havcr2 Fgf13 Mex3c Syt6
Lbr Acaca Esrrb MapklO Rybp Dsc3
V2r15 Fgf16 Rbm9 Dtx4 Ctsk Has3
1110028C15Rik Gda Em/5 Tnpo2 Gria2 Crebzf
Dclk1 Kiflb Vcl Fkbp9 9430010O03Rik Arl4a
PH5 Has2 Frmpd4 MapklO 4930579C12Rik Gdf6
Shoc2 Lad1 2310028N02Rik Kcnfl 3110001 l20Rik Tmem131
4732479N06Rik Cgnl1 Hmgcs2 Calu Daxx Tmem188
ClecUa Cdh12 Xpr1 Dcx Foxal Snurf
Adam12 EG235327 Inpp4b Asb1 Pcdhb7 Fut9
Abcc9 ArhgefW Sox2 Reep1 Rmnd5a 9130227C08Rik
Abcc9 Hrasls3 Ptgs2 4932701A20Rik Slc2a12 Frmpd3
Hars2 Tmem19 Rab6b Cldn18 BC049806 Wo/4
Sept3 Dclrelc Hdgfrp3 Vash2 Abhd13 Rras2
Ms4a1 Nek10 Arrnd Map1lc3b Bdp1 Fgl2
Tspan12 Prdm2 1200014J11Rik 2810006K23Rik Efna5 Cede 16
Nrxnl Acot3 Mtap2 Cstf2 Heatr5a Mstn
Ints8 Calr3 Opcml Wispl 0610013E23Rik ΕΙονΙδ
Slamfl Ski Pter Igsfl Tmem161b Yipf4
V2rU Pknox2 Ccdc104 Serpinil Sfrp4 Cd2ap
4631426E05Rik Diras2 Gpr158 D4Wsu132e Gnai3 Slc35a3
Ankrd6 Impact Slc16a12 Dec Ccnd2 Cntnl
MobkHa Phf20 Gata5 Ankrd28 Npal1 Prss23
Zfp334 Pex19 Iigp1 AM IkzfS Tmem165
Tppp Igflr Gne Ammecrl Dazl Usp30
Cntn3 Svil Hoxd13 Phf20H Fzd2 Igsfl 1
Phkal Efcbpl Adam12 FH1 Grpel2 Rassf5
Rnmt Lrrc19 V1ra2 Zbtb39 i 4631427C17Rik
Serpinb9 Agpat5 Ankrdl Usp30 Zfp512 Ankrd15
Olfr77 Fndc3b Iqce Cxxc4 Gpr64 Hivep2
IHrap Zfp148 Speg Bdnf Meox2 Rsf1
Pogk Phip Speg Cnksr2 Gm1337 Actl6a
Nrp2 Asah3l Nr2f2 8430427H17Rik Zfp518 Dock4
Teadl Robo2 St18 Ptpnl Cggbpl Foxj3
Zfp709 1810054D07Rik Rai2 KcnjW Gpr150 Fndc3b
WhsdH Calu Zbtb7a Dlg3 Slco5a1 Smad4
Oprdl Rab6 Kras Trim33 Ap1s2 Tmem64
Sec14l4 Aebp2 Btbd a Clock Cd200 Ccarl
7530404M11Rik Phf6 Ppmle Lamp3 Ttc9 Zbtb44
Pcsk2 Tmeffl Acaca Tacstd2 F2r Ubn1
Kcnhl Taokl Gm879 Foxa3 Ing1 Taptl
Tcbal Col15a1 Blr1 Vezfl Neurod4 Arl8b
Elavil Gosrl Myo5a Sema6a Foxdl Sel1l
Ccdc88a 1200016B10Rik Nfic Gda Adamts5 Socs5
Tmem142b Tln2 Nfic Zfp710 Zfp105 6330406l15Rik
Fmn1 AkapIO Plxna2 Zfp91 Enpp3 Myo5a
Dtx4 Frmd4a Chchd3 Eifla 4932438H23Rik Csnk1g1
Aspn Hmg20a Rapgefe Zfp397 Rbm25 Eml4
Zfx OTTMUSG00000008561 Clcn4-2 Zfp189 Agps Mpegl
Ppp2r2a Klf9 2900006K08Rik 9030425E11Rik Glo1 Ap3b1
Hisppdl Fgf Grm5 Hoxd9 Prkab2 lltifb
Brsk2 Api5 GH3 TaH Nudt4 Galnt4
E2f8 E130309F12Rik Tex2 Ap3s1 Blzfl Dnmt3a
Mtap2 Rsbnl AW049604 Zeb2 Cyp39a1 Ppp3r2
Osbpl6 Skp2 SfrslO Mstn 2610034B18Rik Utp18
Col4a3 Htr4 Tardbp Tceal8 Bzw2 Tmem71
5730455P16Rik 5033414K04Rik Gucy1b3 Tox3 Vezfl Ccr2
Ms4a4c Clec5a Prdxl Herpud2 Ccdc70 Rlbp1l2
Cnn3 2700049P18Rik Actr3 H1rapl2 Gpc3 LOC435023
Rnf138 Tspan2 Msx2 Edn3 Insm2 Pmaipl
Matn3 Irf4 Tardbp Med1 BC048502 Lrch1
Asb4 Camk4 Tardbp Pygol Slamf7 Dnmt3a
Aktip 8430410K20Rik Golgal Brwd3 Golga5 Prkaal
Pgm3 BC035537 Map2k4 Kbtbd7 Nufip2 Gabrgl
Lhfpl2 Fcho2 Spry4 Rad21 Rif1 Tmem27
Antxrl Kctd12 Tardbp Barx2 Cdanl Zfp817
Pum1 Asah2 Spinl Hs3st1 Slc31a2 Gimap9
290002401 ORik Mnatl Tlk1 Ptpn21 Nik Rrh
Limsl 2610209M04Rik Arpp19 Fubp3 Sertad4
Cartpt Sdccagl Pld1 Lrigl Smarca5
Usp38 C1d Pacsin2 Clpx Titf1
Dcun1d3 Phf21b Tef Cerk Myrip
Ak2 Tmem30a Cptla Mtusl Pigh
Pdikll 1700023B02Rik Cask Pofutl Snx4
Dhtkdl 1110012J17Rik Tef lpo11 Col3a1
Arhgap11a E130014J05Rik Sptlc2 Slc39a8 Gsptl
TmedS a Dhdds Rgag4 MgeaS
EII2 0910001A06Rik Ednrb Lrig2 Caprinl
Slc4a7 Mum1l1 Lrrc19 Tgfa Cacna2d3
Hsd17b13 Serpinb2 KIN20 Fbln5 Gspt2
Psma3 Ptprg Nbr1 Cacnb4 Gnail
Gbp4 Rab23 4930534B04Rik Slc7a8 Lhfpl3
Xkr4 Iqck Lypd6 Tanc2 Pdela
Plcel Zfhx4 Sept2 Tgfbrl Zbtbl
Rfesd Hoxal Fusipl Ilf3 Pdrgl
Mtapla Pank3 Abhd3 Clec4a2 Sorcs3
Uty Nudcdl Dpp8 Steap4 Slfn9
Chd9 Sbnol Gpc5 Tm7sf3 TnfaipG
Swap70 Scn3b Samd5 Dmrtc2 Commd2
Rbm13 Akt3 Vcan Chm Slc41a1
Sorbs2 Scn3b Mdfic UspU Cep76
Angptl2 Kcnq2 Wdr51b Plekhbl 6720456H20Rik
Myo5a C1ql3 Ralgps2 BC064033 V1ra1
Ptger2 Scn9a 1500005l02Rik 2900010J23Rik Casp12
Stk32a Col19a1 Sh3bp4 Gpn b Ugt1a1
KbtbdB Cugbp2 T Xrcc4 Ddx19a
Svs3a 8030462N17Rik T mem 135 Lin52 Mns1
Pla2g4a Man1c1 Calcr Wdr68 2610209M04Rik
Gtpbp2 Clock Fert2 C130090K23Rik Socs6
Sap30 Smarcadl Mtmr6 Ankrd43 Gapvdl
Gtl3 Arhgap6 Aldh1a7 Gpr23 1700029G01Rik
Mapkl Lrrc8d Gbx2 Ttc19 Fbxo30
Tpp1 Rab12 ArhgeflOI 4933434l20Rik Usp38
Hrbl App Zfp68 5730596K20Rik Phf7
Cd24a Icall Tsga14 Zfp62 E230019M04Rik
Ablim2 Eif5a2 2810405J04Rik Usp13 Scn11a
Hps3 Pipox Ehf Sorcs3 Slc16a5
Kpna4 ΙΠ204 Sorbsl 4921517N04Rik Ube2h
Rassf5 Xirp2 Lrrkl Socs4 Atp2a3
Col9a3 6530403A03Rik Rab2b Mrps25 Utp b
Edg7 P2ry10 Six4 Map3k1 Col19a1
Zfand5 CN716893 Denndlb Mapk1ip1 Acsm2
Wdr47 Slc16a7 AI593442 St6galnac3
Pou2f1 Crispldl Faf1 Cxcl12
Huwel Adam2 Fert2 Ggtal
Kcnipl Kera Dusp16 Adam19
Cdgap Sf3b4 Mtapla Usp48
Csprs Rbm44 Ppm2c Cysltrl
Cfl2 Cobl Lrrtm4 Krtap6-2
Txn1 Eea1 Antxr2 Josdl
Spink5 Sacs Abcblb Cxcl12
Tmem26 Baiap2l1 Usp7 Efcab2
Dnpep Neil3 Npc1 Vav3
3000004C01Rik Nov Magil Btnll
Asb13 Ccngl Rnf12 Rassf3
Col4a4 Zfp655 Prokr2 Gpr116
4732454E20Rik Cdc73 Foxp2 1600012H06Rik
Tmem77 Stk3 Tslp Txlna
Ccl11 Dcun1d1 Hfe2 PiwiH
Olfr658 Bcor Trip13 7420426K07Rik
Lnp Serbpl E430004N04Rik Zhx3
Sdro Hip2 B230118H07Rik D8Ertd587e
Phca Nhs Gvinl Arcnl
Ube2v2 Mut Clca5 Slc25a14
Dixdd Kcnc3 Lcorl Prkar2b
Fuca2 Ccne2 Scube2 Tjp2
Asb13 Polr3g Metap2 Hsd17b12
Kcnjl Lox/3 Aim Cxxc4
Klf8 D030056L22Rik Lmo3 Map3k1
V2r4 B230339M05Rik Sic1a5 Rbm22
Zdhhc3 Dbc1 Aebp2 Galnact2
Ugt1a1 Fusipl Rab31 BC013672
Tgm5 Myolc F83004SP16Rik Zfp770
Rif1 Dyx1c1 Met Ugt2b34
Prokrl A830006F12Rik Gm440 Zfp275
Zfp364 Rtn3 Ivd Slc39a13
Olfm3 2210010L05Rik Zbtb40 Ypel5
Wdr72 Slc4a10 AK162044 BC056474
Nhs Trmt6 RelH Nktr
Mut Casc4 Pcdh15 Otud4
Kcnc3 Slc22a8 Fzd10 Mbip
Ccne2 Smad9 Frmd4a D5Wsu178e
Polr3g Casc4 S!amf8 Ddx6
Lox/3 Lmtk2 Klhl15 Tcbal
D030056L22Rik Ppp2r5e BC029169 Slc5a1
B230339M05Rik AW554918 Eps8 iftao
Dbc1 Lss 1700016C15Rik Ddx6
Fusipl Pura Zfp300 Osmr
Myolc Eif2s1 Rsad2 GalntIO
Dyx1c1 Tnfsf4 Spn Gpr110
A830006F12Rik Tacr3 Crbn Matn2
Rtn3 Ugcgl2 Fancc AU021838
2210010L05Rik Bche Fmo2 Zfp758
Slc4a10 Pou2af1 Ep400 E130304F04Rik
Trmte Fgd4 Nkd2 Zic2
Casc4 Oprdl Pknox2 Nidi
Smad9 Mad2l1 SemaSa Baz2a
Casc4 Gucy2f Tsr2 Lingol
Lmtk2 Tek UspH Mbtdl
Ppp2r5e Adam23 583045701 ORik Sp8
AW554918 Src Uncx4.1 Apln
Lss Oaslg Ube2v1 Aplpl
Pura Sppl3 HoxdO D630040G17Rik
Eif2s1 Ulk2 Fgfr3 Ntrk2
Tnfsf4 9330182L06Rik Nanp Phf20
Tacr3 Tsc22d3 Ypel2 T
Ugcgl2 Gpr61 Bmprlb D4Ertd429e
Bche Gpa33 Pde4b
Pou2af1 Serpinb5 Prmte
Fgd4 2610301F02Rik 111 rap
Mad2l1 itch Gpr82
Gucy2f Sec14l4 Cdk7
Tek 7530404M11Rik Slc25a25
Adam23 Olfr78 Pgr
Src Abcbla Rab11fip2
Oaslg Cdc27 Galnt4
Sppl3 Cdv3 G430022H21Rik
Ulk2 Vhlh Ppp2r1b
9330182L06Rik Zxdc Tspan2
Tsc22d3 Mc2r Kctd21
Gpr61 Qrfp Lritl
Gpa33 Ank1 G/fp
Serpinb5 AU021838 Cul4a
2610301F02Rik Cyb5r3 Gdpd4
Itch Sorcs3 Wsb2
Olfr78 Gpr152 Betll
Abcbla Fbxo5 5330401 P04Rik
Cdc27 Thnsl2 Ripk5
Cdv3 Mxi1 Edg2
Vhlh Ccne2 Nhs
Zxdc 2010003K11Rik Plscr3
Mc2r Fn3k Rnf122
Qrfp BC022623 Odz3
Ank1 Acatl Slc16a6
AU021838 Yme1l1 Vnn3
Cyb5r3 Bcap31 OTTMUSG00000000421
Sorcs3 Gstt3 Tmed6
Gpr152 Zfp68 Cpe
Fbxo5 Rab37 Sardh
Thnsl2 AtplOb
Mxi1 Olfr1443 Rabgapl
Ccne2 Jak1 Ptpladl
2010003K11Rik Ncbp2 Gm323
Fn3k Slc35a5 Cdh4
BC022623 Zfp354c Mrp63
Acatl Tirap OTTMUSG00000015743
YmeW Cox15 Fxrlh
Bcap31 Synpo2l Zfp563
Gstt3 Fzd10 Amacr
Zfp68 Naalad2 Col10a1
Rab37 Nrn1 OTTMUSG00000010433
AtplOb 111a Traf3
Olfr1443 Matr3 AW146242
Jak1 Trip12 D2hgdh
Ncbp2 Dachl Spc25
Slc35a5 Cede 128 Samd3
Zfp354c Heca Ap1g2
Tirap Odz2 Oraovl
Cox15 Sema6a Dlst
Synpo2l Pdzd4
Fzd10 Golph3
Naalad2 Fzd4
Nrn1 Sema3a
a Sec22a
Matr3 Rp23-297j14.5
Trip12 3230401 D17Rik
Dachl Atp1b4
Ccdc128 3110004L20Rik
Heca Urod
Odz2 Irgq
Sema6a Gcntl
Cdc25a
Mesdd
Table 6. M8-A1 8mer or 8 7mer binding sites for either miR-511-3p, 5p or -3p- mut as retrieved by TargetRank (Nielsen et al., 2007).
Table 7
Biological rocess Count % value Fold Enrichment Bonferroni
Cell adhesion
Cell adhesion 32 12.9 2.0E-11 4.2 3.2E-08
Biological adhesion 32 12.9 2.1 E-11 4.2 3.4E-08
ECM
Extracellular structure organization 16 6.5 1.6E-09 7.9 2.6E-06
Extracellular matrix organization 13 5.2 1.1 E-08 9.5 1.8E-05
Development
Skeletal system development 18 7.3 3.3E-07 4.6 5.4E-04
Kidney development 1 1 4.4 1.8E-06 7.6 3.0E-03
Neuron projection development 14 5.6 8.4E-06 4.7 1.4E-02
Urogenital system development 12 4.8 4.7E-06 6.0 7.6E-03
Cell morphogenesis
Cell morphogenesis 18 7.3 1.0E-06 4.3 1.6E-03
Cellular component morphogenesis 18 7.3 5.7E-06 3.8 9.3E-03
Cell projection organization 17 6.9 7.0E-06 3.9 1.1 E-02
Proliferation
Regulation of cell proliferation 32 12.9 6.8E-12 4.4 1.1 E-08
Immune responses
Positive regulation of immune response 13 5.2 3.1 E-07 7.0 5.1 E-04
Total genes input 249
Total genes clusterized 248
Table 7. Clusterization of genes differentially expressed in the TAMs of
SFFV.miR-511 and SFFV.miR-511 -mut mice by DAVID Bioinformatic Resources
6.7 (mouse). Terms correspond to biological processes annotated in the UniProtKB- GoA group (EMBL) gene ontology database (QuickGO).
Table 8
Genes upregulated in MRC1+CD11c- Genes upregulated in MRC1-CD11c+
TAMs TAMs
Gene Fold Gene Fold
symbol change p val symbol change p val adj
Lyvel 41.34 1.11 E-128 3.71 E-125 Ccl17 0.02 3.35E-103 5.62E- 00
Cd209f 40.19 1.50E-54 5.67E-52 Gjb2 0.02 3.52E-08 1.12E-06
Cd209g 38.44 1.07E-25 1.33E-23 Adamded 0.03 8.41 E-34 1.48E-31
Vsig4 21.28 6.45E-39 1.48E-36 Ccr7 0.03 3.26E-215 4.37E-211
Cd163 20.67 1.63E-102 2.43E-99 Cd209a 0.03 2.44E-156 1.31 E-152
Kcnt2 18.47 2.61 E-06 5.85E-05 F†ar2 0.03 3.68E-37 7.97E-35
Bmp2 16.93 2.84E-35 5.72E-33 Ccl22 0.04 2.96E-150 1.32E-146
Col19a1 16.51 O.OOE+00 2.00E-02 Dpp4 0.04 8.09E-133 3.10E-129
Cxcl13 15.96 1.04E-41 2.49E-39 Fgf13 0.04 3.74E-06 8.11 E-05
Ednrb 12.3 6.98E-81 5.67E-78 Flt3 0.05 1.96E-87 2.02E-84
Cbr2 11.48 1.13E-76 8.22E-74 Gpr114 0.05 2.38E-76 1.64E-73
Rgs7bp 11.28 7.24E-15 4.59E-13 H2-Eb2 0.05 2.22E-81 1.86E-78
Cd209b 10.58 1.97E-09 7.49E-08 Hepacam2 0.05 2.63E-37 5.72E-35
Enpep 10.57 6.36E-10 2.54E-08 H1r2 0.05 1.08E-193 9.63E-190
Coro2b 10.33 3.79E-11 1.77E-09 Ear2 0.06 1.13E-84 .05E-81
Gm14461 9.68 1.84E-06 4.25E-05 Ear-ps9 0.06 O.OOE+00 2.00E-02
Hsf3 9.37 O.OOE+00 O.OOE+00 ExtH 0.06 1.30E-07 3.80E-06
HoxalO 9.29 O.OOE+00 2.00E-02 H2-Oa 0.06 8.64E-35 1.69E-32
Reps2 9.17 4.69E-44 1.27E-41 lgkv3-4 0.06 O.OOE+00 O.OOE+00
Mirlet7c-1 8.62 O.OOE+00 3.00E-02 Adam23 0.07 2.63E-54 9.79E-52
Ascl2 8.45 .47E-05 O.OOE+00 Cd7 0.07 1.84E-08 6.20E-07
Fgf9 8.25 1.06E-08 3.70E-07 Epcam 0.07 9.13E-11 4.06E-09
Msx3 8.23 O.OOE+00 4.00E-02 Gm16415 0.07 O.OOE+00 4.00E-02
Sel1l3 8.05 2.01 E-20 1.91 E-18 Gm16894 0.07 2.23E-58 9.82E-56
Foxc2 7.79 O.OOE+00 1.00E-02 Gm8817 0.07 O.OOE+00 2.00E-02
Cd55 7.78 1.98E-35 4.01 E-33 Gm9733 0.07 3.15E-69 .72E-66
TmprssS 7.74 O.OOE+00 1.00E-02 1112b 0.07 8.36E-72 5.10E-69
Nrap 7.62 2.84E- 3 1.60E-11 H28ra 0.07 0.00E+00 4.00E-02
Gas6 7.57 3.32E-58 1.43E-55 CdM 0.08 1.77E-111 3.96E-108
Trnpl 7.42 O.OOE+00 1.00E-02 Cyp7b1 0.08 1.79E-14 1.10E-12
Kbtbd12 7.23 O.OOE+00 1.00E-02 Gm7676 0.08 1.37E-96 1.68E-93
Npl 6.87 3.32E-50 1.13E-47 Grap2 0.08 2.19E-65 1.13E-62
Ctla2b 6.86 6.30E-42 1.53E-39 Haao 0.08 2.75E-36 5.72E-34
Slco2b1 6.4 1.58E-24 1.83E-22 Htr7 0.08 4.18E-100 5.91 E-97
Cd5l 6.25 2.84E-19 2.48E-17 Ceacam15 0.09 3.25E-07 8.92E-06
Rxrg 6.05 O.OOE+00 1.00E-02 Cyp2a4 0.09 7.56E-10 3.00E-08
Pcdha9 5.9 O.OOE+00 1.00E-02 Ace 0.1 1.67E-78 .28E-75
Slc10a6 5.81 8.30E-12 4.08E-10 Bcl2a1c 0.1 1.62E-05 O.OOE+00
Tppp 5.81 3.89E-15 2.52E-13 Bex6 0.1 6.18E-28 8.81 E-26
F13a1 5.74 8.63E-27 1.18E-24 FutJ 0.1 3.33E-25 4.02E-23
Stk32a 5.71 O.OOE+00 1.OOE-02 Hr 0.1 2.86E-42 7.16E-40
Hormad2 5.62 O.OOE+00 1.OOE-02 Ifitml 0.1 1.04E-109 2.15E- 06
S1pr1 5.55 4.07E-31 6.61 E-29 Bcl2l14 0.1 1 1.66E-25 2.04E-23
C4b 5.49 5.51 E-45 1.54E-42 Cardl 1 0.1 1 1.06E- 9 9.54E-18 igfi 5.43 2.87E-40 6.76E-38 Cd300e 0.1 1 1.07E-57 4.56E-55
Cckar 5.31 O.OOE+00 2.00E-02 Dgkg 0.1 1 2.64E-16 1.83E-14
Saa3 5.21 9.53E-26 1.19E-23 Grm5 0.1 1 O.OOE+00 2.00E-02
Celal 5.1 1 2.69E-17 2.03E-15 H31ra 0.1 1 3.60E-15 2.34E-13
Slc39a12 5.08 8.36E-14 4.88E-12 Irgd 0.1 1 6.69E- 3 3.65E-11
Liph 4.96 1.29E-07 3.78E-06 Btla 0.12 3.51 E-34 6.49E-32
C4a 4.94 1.06E-26 1.42E-24 Cbfa2t3 0.12 1.58E-25 1.95E-23
Slc39a8 4.94 1.81 E-17 1.39E-15 Fam40b 0.12 1.81 E-50 6.31 E-48
Lama3 4.92 O.OOE+OO 4.00E-02 Fcrl5 0.12 4.03E-22 4.21 E-20
Adig 4.89 1.00E-02 5.00E-02 H2-DMb2 0.12 1.78E-96 2.07E-93
Fam167b 4.87 1.64E-05 O.OOE+OO H2-Ob 0.12 2.25E-70 1.31 E-67
Mir511 4.85 O.OOE+00 1. OOE-02 ApoUc 0.13 5.67E-53 2.06E-50
C6 4.84 1.55E-21 1.56E-19 Cd209c 0.13 1.36E-12 7.19E-11
Tmodl 4.73 6.48E-07 1.65E-05 Galnt9 0.13 1.28E-10 5.59E-09
Car11 4.68 O.OOE+OO 2.00E-02 Gpr141 0.13 6.32E-103 9.98E-100
Cpne8 4.68 9.22E-09 3.24E-07 Gucy2c 0.13 1.70E-09 6.50E-08
Rasgrp3 4.6 1.46E-10 6.35E-09 Cede 158 0.14 O.OOE+00 1.OOE-02
Cyp2j6 4.54 6.11 E-13 3.35E-11 Cd1d2 0.14 O.OOE+00 O.OOE+OO
Dmpk 4.54 1.17E-15 7.88E-14 Emr4 0.14 3.84E-82 3.33E-79
Klkbl 4.54 O.OOE+OO 4.00E-02 Gabbr2 0.14 5.11 E-13 2.83E-11
Stard8 4.4 1.90E-36 3.98E-34 Gm9740 0.14 O.OOE+OO 1. OOE-02
Vldlr 4.4 8.69E-16 5.90E-14 1123a 0.14 6.92E-38 1.53E-35
Stabl 4.38 5.71 E-26 7.19E-24 Adora2a 0.15 7.13E-34 1.27E-31
Ccl8 4.36 4.14E-34 7.60E-32 Asb2 0.15 1. 7E-21 1.19E-19
Pmp22 4.36 7.20E-37 1.53E-34 Bcl11a 0.15 5.61 E-15 3.58E-13
Eltd1 4.33 1.41 E-05 O.OOE+OO Btnl3 0.15 O.OOE+00 2.00E-02
Tspan18 4.28 O.OOE+00 4.00E-02 Coro2a 0.15 1.84E-71 1.10E-68
Fetub 4.27 O.OOE+00 4.00E-02 Cytip 0.15 2.58E-73 1.68E-70
Grap 4.24 2.42E-12 1.25E-10 Dscam 0.15 2.67E-08 8.72E-07
Gprc5b 4.17 1.75E-21 1.75E-19 Earl 0.15 O.OOE+00 4.00E-02
Fbln5 4.1 1 5.94E-05 O.OOE+OO Galnt3 0.15 6.04E-50 2.00E-47
NaaladH 4.1 O.OOE+OO 2.00E-02 Gm5424 0.15 2.68E-87 2.66E-84
MrvH 4.09 4.10E-09 1.50E-07 Gm9530 0.15 2.64E-12 1.36E-10
Folr2 4.07 1.83E-33 3.18E-31 Gm9847 0.15 2.63E-06 5.88E-05
Mid2 4.03 9.07E-07 2.25E-05 Gpr171 0.15 1.43E-86 1.37E-83
Prl2c1 4.02 4.15E-05 O.OOE+OO Ifng 0.15 O.OOE+00 3.00E-02
Trpml 3.99 1.87E-10 8.06E-09 Itgad 0.15 4.66E-34 8.50E-32
Gm11710 3.94 6.25E-07 1.60E-05 B3gnt5 0.16 5.62E-70 3.21 E-67
Slc24a3 3.93 2.66E-06 5.94E-05 Cd24a 0.16 4.33E-56 1.73E-53
Pnldd 3.91 1.00E-02 5.00E-02 F10 0.16 1.73E-80 1.36E-77
Celsr2 3.83 O.OOE+00 2.00E-02 I if 4 0.16 1.25E-76 8.82E-74
Table 8. Genes differentially expressed in WIRC1* and CD11c+ TAMs.
Table 9
MGI symbol Fold change Fold change
(miR-511-3p vs. (MRC1+ vs. miR-511-3p-mut) CD11c* TAMs) lgkv3-4 0 0.06
Ighgl 0 0.54
Igkc 0.05 0.55 igj 0.06 0.45
Cd6 0.13 0.26
Gm10451 0.15 1.8
Btla 0.20 0.12
Tinagll 0.20 1.95
Ppp1r16b 0.21 0.34
Irx2 0.23 2.02
Klrtf 0.23 0.3
Srnod 0.23 2.02
Ighg2b 0.25 0.39
Ncaml 0.27 1.68
Gzmb 0.29 0.48
Peg3 0.29 1.68
Sema3a 0.30 1.63
Sox9 0.31 1.94
H19 0.33 1.75
Ace 0.33 0.1
Dkk2 0.33 1.66
Lgi2 0.33 1.53
Ddx3y 0.33 1.62
Apc2 0.33 1.63
Cyr61 0.33 1.62
Evc2 0.33 1.84
Yes1 0.33 1.71
Rgma 0.34 2.21
Pearl 0.34 1.76
Ano1 0.34 1.82
Plod2 0.35 1.52
Apcddl 0.35 1.59
Ccbel 0.35 1.76
Nidi 0.35 1.65
Prnrf 0.35 1.78
Bdnf 0.35 1.85
Pdgfra 0.36 1.45
Lambl 0.36 1.57
Dnm3os 0.36 1.84
Sdc2 0.36 1.45
Scara5 0.36 1.67
Ltbpl 0.36 1.65
Csgalnactl 0.36 1.96
Col16a1 0.36 1.78
Npdd 0.37 1.94
Aebpl 0.37 1.75
Sema3e 0.37 1.49
Mrc2 0.37 1.76
Spry4 0.37 1.76
Tgfbr3 0.37 1.48
Serpinhl 0.38 1.7
Lrigl 0.38 1.62
Tm4sf1 0.38 2.02
Sertad4 0.38 1.72
Col5a1 0.38 1.56
Ptprg 0.39 1.64
Acapl 0.39 0.63
Mxra8 0.39 1.51
Ank3 0.39 1.79
Hspg2 0.39 1.69
Nptxl 0.39 1.99
Rgs16 0.39 1.78
Col8a1 0.39 1.72
Pard3 0.39 1.86
Col 6a 1 0.40 1.41
Pxdn 0.40 1.78
Mmp3 0.40 1.53
FkbpIO 0.40 1.77
Kirrel 0.40 1.65
FstH 0.40 1.58
Itga3 0.40 1.76
Mmp11 0.40 1.68
Grb10 0.41 1.66
Ntn1 0.41 1.58
GH3 0.41 1.78
Ereg 0.41 1.86
Farpl 0.41 1.79
Odz4 0.41 1.65
Did 0.41 1.67
Ghr 0.41 1.62
Bmprla 0.42 1.61
Scd1 0.42 1.45
Il1r1 0.42 1.45
Gpr153 0.42 1.7
Loxll 0.42 1.61
Hid 0.42 1.75
Lhfp 0.42 1.53
Arhgef25 0.42 1.78
Lama5 0.43 1.76
AmotH 0.43 1.78
Tspan9 0.43 1.4
DlgS 0.43 2.01
Scara3 0.43 1.67
Pcolce 0.43 1.59
Pcdh19 0.43 1.64
Fermt2 0.43 2
Col4a2 0.43 1.75
Tnxb 0.44 1.59
Wwtrl 0.44 1.78
Bmp1 0.44 1.72
Ppic 0.44 1.76
Teadl 0.44 1.92
F2r 0.45 1.44
Nedd4 0.45 1.63
Ddr2 0.45 1.73
Yap1 0.45 1.84
Col4a1 0.45 1.72
Gpr124 0.45 1.72
Parva 0.46 1.74
Egfr 0.46 1.63
Rhobtb3 0.46 1.8
Caldl 0.46 1.84
Fine 0.46 1.92
Ltbp4 0.47 1.75
Ptges 0.47 1.99
Serpinfl 0.47 1.69
Csf1 0.48 1.73
Epb4.1l3 0.48 1.48
Steap2 0.48 1.87
Bgn 0.48 1.59
Sparc 0.48 1.64
Map-lb 0.48 1.67
0.49 1.55
Rbfox2 0.50 1.75
Htral 0.51 1.59
Unc5b 0.52 1.8
Fgfr1 0.53 1.72
Dock9 0.53 1.91
Eya4 0.53 1.97
Tend 0.54 1.71
Tjp1 0.54 1.77
Vcan 0.56 0.54
Nuakl 0.56 1.66
Hmga2 0.58 2.01
Colec12 0.59 3.03
Ptrf 0.59 1.99
Nckapl 0.59 1.85
Ehd2 0.64 1.76
Col18a1 0.67 1.94
Cav1 0.69 1.61
Cadml 0.71 0.69
Cbr2 1.33 11.48
Hmoxl 1.48 1.38
Arap2 1.97 0.47
Slc7a2 2.16 0.51
Etl4 2.56 2.9
H2-M2 3.35 0.26
Nrcam 4.31 3.34
Retnla 4.76 1.9
Mir511 11.74 4.85
Genes: 150
Genes downregulated~by miR-511 -3p and upregulated in MRC1* vs CD11c+ TAWIs: 133
Table 9. Genes that are differentially expressed both in TAMs of SFFV.miR-511 versus SFFV.miR-511 -mut mice, and in MRC1+ versus CD11c+ TAMs.
REFERENCES
1. Samuel MS, Lopez JI, McGhee EJ, et al. Actomyosin-Mediated Cellular Tension Drives Increased Tissue Stiffness and beta-Catenin Activation to Induce Epidermal Hyperplasia and Tumor Growth. Cancer Cell;19:776-791.
2. Egeblad M, Nakasone ES, Werb Z. Tumors as organs: complex tissues that interface with the entire organism. Dev Cell;18:884-901.
3. Levental KR, Yu H, Kass L, et al. Matrix crosslinking forces tumor progression by enhancing integrin signaling. Cell. 2009;139:891-906.
4. Kalluri R, Zeisberg M. Fibroblasts in cancer. Nat Rev Cancer. 2006;6:392-401.
5. Schnoor M, Cullen P, Lorkowski J, et al. Production of type VI collagen by human macrophages: a new dimension in macrophage functional heterogeneity. J Immunol. 2008; 180:5707- 5719.
6. Nucera S, Biziato D, De Palma M. The interplay between macrophages and angiogenesis in development, tissue injury and regeneration. Int J Dev Biol.
7. Squadrito ML, De Palma M. Macrophage regulation of tumor angiogenesis: implications for cancer therapy. Mol Aspects Med;32: 123-145.
8. Qian BZ, Pollard JW. Macrophage diversity enhances tumor progression and metastasis. Cell;141:39-51.
9. Pucci F, Venneri MA, Biziato D, et al. A distinguishing gene signature shared by tumor- infiltrating Tie2-expressing monocytes, blood "resident" monocytes, and embryonic macrophages suggests common functions and developmental relationships. Blood. 2009;114:901-914.
10. Movahedi K, Laoui D, Gysemans C, et al. Different tumor microenvironments contain functionally distinct subsets of macrophages derived from Ly6C(high) monocytes. Cancer Res;70:5728-5739.
11. Sica A, Larghi P, Mancino A, et al. Macrophage polarization in tumour progression. Semin Cancer Biol. 2008;18:349-355.
12. Andreu P, Johansson M, Affara NI, et al. FcRgamma activation regulates inflammation- associated squamous carcinogenesis. Cancer Cell;17: 121-134.
13. Rolny C, Mazzone M, Tugues S, et al. HRG inhibits tumor growth and metastasis by inducing macrophage polarization and vessel normalization through downregulation of P1GF. Cancer Cell; 19:31-44.
14. Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell. 2009;136:215-233.
15. Luers AJ, Loudig OD, Berman JW. MicroRNAs are expressed and processed by human primary macrophages. Cell Immunol;263:l-8.
16. Tserel L, Runnel T, Kisand K, et al. microRNA expression profiles of human blood monocyte derived dendritic cells and macrophages reveal miR-511 as putative positive regulator of TLR4. J Biol Chem.
17. Kim VN, Han J, Siomi MC. Biogenesis of small RNAs in animals. Nat Rev Mol Cell Biol. 2009;10:126-139.
18. Xiong H, Qian J, He T, Li F. Independent transcription of miR-281 in the intron of ODA in Drosophila melanogaster. Biochem Biophys Res Commun. 2009;378:883-889.
19. Baskerville S, Bartel DP. Microarray profiling of microRNAs reveals frequent coexpression with neighboring miRNAs and host genes. RNA. 2005;11 :241-247.
20. Lewis BP, Burge CB, Bartel DP. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell. 2005;120:15-20.
21. Maragkakis M, Reczko M, Simossis VA, et al. DIANA-microT web server: elucidating microRNA functions through target prediction. Nucleic Acids Res. 2009;37:W273-276.
22. Nielsen CB, Shomron N, Sandberg R, Hornstein E, Kitzman J, Burge CB. Determinants of targeting by endogenous and exogenous microRNAs and siRNAs. RNA. 2007;13:1894-1910.
23. Amendola M, Venneri MA, Biffi A, Vigna E, Naldini L. Coordinate dual-gene transgenesis by lentiviral vectors carrying synthetic bidirectional promoters. Nat Biotechnol. 2005;23:108-116.
24. De Palma M, Naldini L. Transduction of a gene expression cassette using advanced generation lentiviral vectors. Methods Enzymol. 2002;346:514-529.
25. De Palma M, Mazzieri R, Politi LS, et al. Tumor-targeted interferon-alpha delivery by Tie2- expressing monocytes inhibits tumor growth and metastasis. Cancer Cell. 2008;14:299-311.
26. Huang da W, Sherman BT, Lempicki RA. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc. 2009;4:44-57.
27. De Palma M, Venneri MA, Galli R, et al. Tie2 identifies a hematopoietic lineage of proangiogenic monocytes required for tumor vessel formation and a mesenchymal population of pericyte progenitors. Cancer Cell. 2005;8:21 1-226.
28. Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP, Bartel DP. MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007;27:91-105.
29. Biswas SK, Mantovani A. Macrophage plasticity and interaction with lymphocyte subsets: cancer as a paradigm. Nat Immunol;l 1 :889-896.
30. Brown BD, Gentner B, Cantore A, et al. Endogenous microRNA can be broadly exploited to regulate transgene expression according to tissue, lineage and differentiation state. Nat Biotechnol. 2007;25: 1457-1467.
31. Maragkakis M, Alexiou P, Papadopoulos GL, et al. Accurate microRNA target prediction correlates with protein repression levels. BMC Bioinformatics. 2009; 10:295.
32. Paszek MJ, Zahir N, Johnson KR, et al. Tensional homeostasis and the malignant phenotype. Cancer Cell. 2005;8:241-254.
33. Goetz JG, Minguet S, Navarro-Lerida I, et al. Biomechanical remodeling of the microenvironment by stromal caveolin-1 favors tumor invasion and metastasis. Cell;146: 148-163.
34. Bauer AL, Jackson TL, Jiang Y. Topography of extracellular matrix mediates vascular morphogenesis and migration speeds in angiogenesis. PLoS Comput Biol. 2009;5:el000445.
35. DeNardo DG, Andreu P, Coussens LM. Interactions between lymphocytes and myeloid cells regulate pro- versus anti-tumor immunity. Cancer Metastasis Rev;29:309-316.
36. Mazzieri R, Pucci F, Moi D, et al. Targeting the ANG2/TIE2 axis inhibits tumor growth and metastasis by impairing angiogenesis and disabling rebounds of proangiogenic myeloid cells. Cancer Cell;19:512-526.
37. Fantin A, Vieira JM, Gestri G, et al. Tissue macrophages act as cellular chaperones for vascular anastomosis downstream of VEGF-mediated endothelial tip cell induction. Blood;l 16:829- 840.
Claims
1. A method for reducing angiogenesis in a subject or tissue comprising administering to the subject or tissue an effective amount of a nucleic acid molecule comprising a miRNA sequence that is or comprises miR-511-3 -p.
2. A method for inhibiting tumor growth in a subject or tissue comprising administering to the subject or tissue an effective amount of a nucleic acid molecule comprising a miRNA sequence that is or comprises miR-511-3 -p.
3. A method for stimulating angiogenesis in a subject or tissue comprising administering to the subject or tissue an effective amount of an inhibitor of a nucleic acid molecule comprising a miRNA sequence that is or comprises miR-511 -3 -p.
4. A method for selecting an angiogenesis therapy for a patient comprising: measuring an expression profile of a nucleic acid molecule comprising a miRNA sequence that is or comprises miR-511-3-p, optionally in a sample; and selecting a therapy based on a comparison of the miRNA expression profile in the patient sample to an expression profile of a normal or non-pathogenic sample, wherein a difference between the expression profiles is indicative of a pathological condition.
5. A method for assaying a cell or a sample containing a cell for the presence of a nucleic acid molecule comprising a miRNA sequence that is or comprises miR-511-3-p, optionally the method includes a step of generating a miRNA profile for a sample.
6. A method for determining a diagnosis or prognosis for a patient based on expression or expression levels of a nucleic acid molecule comprising a miRNA sequence that is or comprises miR-511-3-p.
7. A kit for analysis of a pathological sample by assessing a miRNA profile of the nucleic acid molecule comprising a miRNA sequence that is or comprises miR-51 1-3-p.
8. A nucleic acid molecule comprising a miRNA sequence that is or comprises miR-511-3-p
9. A composition comprising the nucleic acid molecule comprising a miRNA sequence that is or comprises miR-511-3-p as defined in any preceding claim or inhibitors thereof.
10. A method of screening for inhibitors of a nucleic acid molecule comprising a miRNA sequence that is or comprises miR-511-3-p comprising assessing the activity of the miRNA in the presence and absence of a potential inhibitor.
11. A method for identifying a proangiogenic cell comprising detecting the expression of a nucleic acid molecule comprising a miRNA sequence that is or comprises miR-511-3-p.
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US39499510P | 2010-10-20 | 2010-10-20 | |
| US61/394,995 | 2010-10-20 | ||
| US201161525476P | 2011-08-19 | 2011-08-19 | |
| US61/525,476 | 2011-08-19 | ||
| US201161527897P | 2011-08-26 | 2011-08-26 | |
| US61/527,897 | 2011-08-26 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2012052953A1 true WO2012052953A1 (en) | 2012-04-26 |
Family
ID=45002078
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2011/054686 Ceased WO2012052953A1 (en) | 2010-10-20 | 2011-10-20 | MiRNA |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2012052953A1 (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013093870A1 (en) | 2011-12-23 | 2013-06-27 | International Centre For Genetic Engineering And Biotechnology - Icgeb | microRNAs FOR CARDIAC REGENERATION THROUGH INDUCTION OF CARDIAC MYOCYTE PROLIFERATION |
| WO2018156945A1 (en) * | 2017-02-24 | 2018-08-30 | University Of South Florida | Prevention of preterm birth (ptb) by inhibition of fkbp51 |
| US10435757B1 (en) | 2016-06-15 | 2019-10-08 | University Of South Florida | Methods of measuring C19MC miRNA in a post-natal tissue and uses thereof |
| US11479802B2 (en) | 2017-04-11 | 2022-10-25 | Regeneron Pharmaceuticals, Inc. | Assays for screening activity of modulators of members of the hydroxy steroid (17-beta) dehydrogenase (HSD17B) family |
| US11485958B2 (en) | 2017-01-23 | 2022-11-01 | Regeneron Pharmaceuticals, Inc. | HSD17B13 variants and uses thereof |
| US11702700B2 (en) | 2017-10-11 | 2023-07-18 | Regeneron Pharmaceuticals, Inc. | Inhibition of HSD17B13 in the treatment of liver disease in patients expressing the PNPLA3 I148M variation |
| US12359201B2 (en) | 2018-03-21 | 2025-07-15 | Regeneron Pharmaceuticals, Inc. | 17ß-hydroxysteroid dehydrogenase type 13 (HSD17B13) iRNA compositions and methods of use thereof |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999006073A1 (en) | 1997-07-31 | 1999-02-11 | St. Elizabeth's Medical Center Of Boston, Inc. | Method for the treatment of grafts |
| WO2008103135A2 (en) * | 2007-02-16 | 2008-08-28 | The Johns Hopkins University | The micrornaome |
| WO2009062515A1 (en) * | 2007-11-14 | 2009-05-22 | Dandrit Biotech A/S | Micro rnas as markers of the functional state of a dendritic cell |
| WO2009080437A1 (en) * | 2007-12-21 | 2009-07-02 | Exiqon A/S | Micro-rna based drug resistance analysis method |
| WO2009137807A2 (en) * | 2008-05-08 | 2009-11-12 | Asuragen, Inc. | Compositions and methods related to mirna modulation of neovascularization or angiogenesis |
| WO2010129919A1 (en) * | 2009-05-08 | 2010-11-11 | Research Development Foundation | Mirna expression in allergic disease |
-
2011
- 2011-10-20 WO PCT/IB2011/054686 patent/WO2012052953A1/en not_active Ceased
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999006073A1 (en) | 1997-07-31 | 1999-02-11 | St. Elizabeth's Medical Center Of Boston, Inc. | Method for the treatment of grafts |
| WO2008103135A2 (en) * | 2007-02-16 | 2008-08-28 | The Johns Hopkins University | The micrornaome |
| WO2009062515A1 (en) * | 2007-11-14 | 2009-05-22 | Dandrit Biotech A/S | Micro rnas as markers of the functional state of a dendritic cell |
| WO2009080437A1 (en) * | 2007-12-21 | 2009-07-02 | Exiqon A/S | Micro-rna based drug resistance analysis method |
| WO2009137807A2 (en) * | 2008-05-08 | 2009-11-12 | Asuragen, Inc. | Compositions and methods related to mirna modulation of neovascularization or angiogenesis |
| WO2010129919A1 (en) * | 2009-05-08 | 2010-11-11 | Research Development Foundation | Mirna expression in allergic disease |
Non-Patent Citations (59)
| Title |
|---|
| "Oligonucleotide Synthesis: A Practical Approach", IRL PRESS |
| AAGAARD, L., ROSSI, J. J., ADV DRUG DELIV REV, vol. 59, 2007, pages 75 - 86 |
| AMENDOLA M, VENNERI MA, BIFFI A, VIGNA E, NALDINI L: "Coordinate dual-gene transgenesis by lentiviral vectors carrying synthetic bidirectional promoters", NAT BIOTECHNOL., vol. 23, 2005, pages 108 - 116, XP002389318, DOI: doi:10.1038/nbt1049 |
| ANDREU P, JOHANSSON M, AFFARA NI ET AL.: "FcRgamma activation regulates inflammation- associated squamous carcinogenesis", CANCER CELL, vol. 17, pages 121 - 134 |
| AUSUBEL, F. M. ET AL.: "Current Protocols in Molecular Biology", 1995, JOHN WILEY & SONS |
| B. ROE, J. CRABTREE, A. KAHN: "DNA Isolation and Sequencing: Essential Techniques", 1996, JOHN WILEY & SONS |
| BARTEL DP: "MicroRNAs: target recognition and regulatory functions", CELL, vol. 136, 2009, pages 215 - 233, XP055011377, DOI: doi:10.1016/j.cell.2009.01.002 |
| BASKERVILLE S, BARTEL DP: "Microarray profiling of microRNAs reveals frequent coexpression with neighboring miRNAs and host genes", RNA, vol. 11, 2005, pages 241 - 247, XP002421559, DOI: doi:10.1261/rna.7240905 |
| BAUER AL, JACKSON TL, JIANG Y: "Topography of extracellular matrix mediates vascular morphogenesis and migration speeds in angiogenesis", PLOS COMPUT BIOL., vol. 5, 2009, pages E1000445 |
| BISWAS SK, MANTOVANI A: "Macrophage plasticity and interaction with lymphocyte subsets: cancer as a paradigm", NAT IMMUNOL, vol. 11, pages 889 - 896 |
| BROWN BD, GENTNER B, CANTORE A ET AL.: "Endogenous microRNA can be broadly exploited to regulate transgene expression according to tissue, lineage and differentiation state", NAT BIOTECHNOL., vol. 25, 2007, pages 1457 - 1467, XP002471752, DOI: doi:10.1038/nbt1372 |
| CHEN X ET AL., CELL RES, vol. 7, 2008, pages 2643 - 2646 |
| CHO ET AL: "MicroRNAs: Potential biomarkers for cancer diagnosis, prognosis and targets for therapy", INTERNATIONAL JOURNAL OF BIOCHEMISTRY AND CELL BIOLOGY, EXETER, GB, vol. 42, no. 8, 1 August 2010 (2010-08-01), pages 1273 - 1281, XP027131521, ISSN: 1357-2725, [retrieved on 20100706] * |
| D. M. J. LILLEY, J. E. DAHLBERG: "Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology", 1992, ACADEMIC PRESS |
| DE FOUGEROLLES ET AL., NAT REV DRUG DISCOV, vol. 6, 2007, pages 443 - 53 |
| DE PALMA M, MAZZIERI R, POLITI LS ET AL.: "Tumor-targeted interferon-alpha delivery by Tie2- expressing monocytes inhibits tumor growth and metastasis", CANCER CELL, vol. 14, 2008, pages 299 - 3 11 |
| DE PALMA M, NALDINI L: "Transduction of a gene expression cassette using advanced generation lentiviral vectors", METHODS ENZYMOL., vol. 346, 2002, pages 514 - 529 |
| DE PALMA M, VENNERI MA, GALLI R ET AL.: "Tie2 identifies a hematopoietic lineage of proangiogenic monocytes required for tumor vessel formation and a mesenchymal population of pericyte progenitors", CANCER CELL, vol. 8, 2005, pages 211 - 226, XP055124188, DOI: doi:10.1016/j.ccr.2005.08.002 |
| DENARDO DG, ANDREU P, COUSSENS LM: "Interactions between lymphocytes and myeloid cells regulate pro- versus anti-tumor immunity", CANCER METASTASIS REV, vol. 29, pages 309 - 316 |
| E. M. SHEVACH, W. STROBER: "Current Protocols in Immunology", 1992, JOHN WILEY & SONS |
| EGEBLAD M, NAKASONE ES: "Werb Z. Tumors as organs: complex tissues that interface with the entire organism", DEV CELL, vol. 18, pages 884 - 901 |
| F. PUCCI ET AL: "A distinguishing gene signature shared by tumor-infiltrating Tie2-expressing monocytes, blood "resident" monocytes, and embryonic macrophages suggests common functions and developmental relationships", BLOOD, vol. 114, no. 4, 23 July 2009 (2009-07-23), pages 901 - 914, XP055019330, ISSN: 0006-4971, DOI: 10.1182/blood-2009-01-200931 * |
| FANTIN A, VIEIRA JM, GESTRI G ET AL.: "Tissue macrophages act as cellular chaperones for vascular anastomosis downstream of VEGF-mediated endothelial tip cell induction", BLOOD, vol. 116, pages 829 - 840 |
| GOETZ JG, MINGUET S, NAVARRO-LERIDA I ET AL.: "Biomechanical remodeling of the microenvironment by stromal caveolin-1 favors tumor invasion and metastasis", CELL, vol. 146, pages 148 - 163, XP028100091, DOI: doi:10.1016/j.cell.2011.05.040 |
| GRIFFITHS-JONES ET AL., NUCLEIC ACIDS RES, vol. 36, 2008, pages D154 - 8 |
| GRIMSON A, FARH KK, JOHNSTON WK, GARRETT-ENGELE P, LIM LP, BARTEL DP: "MicroRNA targeting specificity in mammals: determinants beyond seed pairing", MOL CELL, vol. 27, 2007, pages 91 - 105, XP002624728, DOI: doi:10.1016/j.molcel.2007.06.017 |
| H. R. CHIANG ET AL: "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes", GENES & DEVELOPMENT, vol. 24, no. 10, 15 May 2010 (2010-05-15), pages 992 - 1009, XP055019380, ISSN: 0890-9369, DOI: 10.1101/gad.1884710 * |
| HUANG DA W, SHERMAN BT, LEMPICKI RA: "Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources", NAT PROTOC., vol. 4, 2009, pages 44 - 57, XP009153774, DOI: doi:10.1038/nprot.2008.211 |
| J. M. POLAK, JAMES O'D. MCGEE: "Situ Hybridization: Principles and Practice", 1984, OXFORD UNIVERSITY PRESS |
| J. SAMBROOK, E. F. FRITSCH, T. MANIATIS: "Molecular Cloning: A Laboratory Manual", vol. 1-3, 1989, COLD SPRING HARBOR LABORATORY PRESS |
| KALLURI R, ZEISBERG M: "Fibroblasts in cancer", NAT REV CANCER, vol. 6, 2006, pages 392 - 401, XP002538033, DOI: doi:10.1038/NRC1877 |
| KARANTI SHAILAJA ET AL: "An atlas of the MicroRNA genome in human DLBCL", BLOOD, AMERICAN SOCIETY OF HEMATOLOGY, US, vol. 110, no. 11 Part 1, 11 December 2007 (2007-12-11), pages 173A, XP008149099, ISSN: 0006-4971, Retrieved from the Internet <URL:http://www.bloodjournal.org/> * |
| KIM VN, HAN J, SIOMI MC: "Biogenesis of small RNAs in animals", NAT REV MOL CELL BIOL., vol. 10, 2009, pages 126 - 139 |
| LAGOS-QUINTANA, M. ET AL., CURR BIOL, vol. 12, 2002, pages 735 - 9 |
| LEVENTAL KR, YU H, KASS L ET AL.: "Matrix crosslinking forces tumor progression by enhancing integrin signaling", CELL, vol. 139, 2009, pages 891 - 906, XP029533710, DOI: doi:10.1016/j.cell.2009.10.027 |
| LEWIS BP, BURGE CB, BARTEL DP: "Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets", CELL, vol. 120, 2005, pages 15 - 20, XP055009844, DOI: doi:10.1016/j.cell.2004.12.035 |
| LUERS AJ, LOUDIG OD, BERMAN JW: "MicroRNAs are expressed and processed by human primary macrophages", CELL IRNMUNOL, vol. 263, pages 1 - 8, XP027033656 |
| MARAGKAKIS M, ALEXIOU P, PAPADOPOULOS GL ET AL.: "Accurate microRNA target prediction correlates with protein repression levels", BMC BIOINFORMATICS, vol. 10, 2009, pages 295, XP021055729, DOI: doi:10.1186/1471-2105-10-295 |
| MARAGKAKIS M, RECZKO M, SIMOSSIS VA ET AL.: "DIANA-microT web server: elucidating microRNA functions through target prediction", NUCLEIC ACIDS RES., vol. 37, 2009, pages W273 - 276 |
| MARIO LEONARDO SQUADRITO ET AL: "miR-511-3p Modulates Genetic Programs of Tumor-Associated Macrophages", CELL REPORTS, vol. 1, 1 February 2012 (2012-02-01), pages 1 - 14, XP055019397, ISSN: 2211-1247, DOI: 10.1016/j.celrep.2011.12.005 * |
| MAZZIERI R, PUCCI F, MOI D ET AL.: "Targeting the ANG2/TIE2 axis inhibits tumor growth and metastasis by impairing angiogenesis and disabling rebounds of proangiogenic myeloid cells", CANCER CELL, vol. 19, pages 512 - 526, XP028202041, DOI: doi:10.1016/j.ccr.2011.02.005 |
| MIN HE ET AL: "MicroRNA-155 Regulates Inflammatory Cytokine Production in Tumor-associated Macrophages via Targeting C/EBPbeta", CELLULAR & MOLECULAR IMMUNOLOGY, vol. 6, no. 5, 1 October 2009 (2009-10-01), pages 343 - 352, XP055019729 * |
| MOVAHEDI K, LAOUI D, GYSEMANS C ET AL.: "Different tumor microenvironments contain functionally distinct subsets of macrophages derived from Ly6C(high) monocytes", CANCER RES, vol. 70, pages 5728 - 5739 |
| NIELSEN CB, SHOMRON N, SANDBERG R, HOMSTEIN E, KITZMAN J, BURGE CB: "Determinants of targeting by endogenous and exogenous microRNAs and siRNAs", RNA, vol. 13, 2007, pages 1894 - 1910 |
| NUCERA S, BIZIATO D, DE PALMA M: "The interplay between macrophages and angiogenesis in development, tissue injury and regeneration", INT J DEV BIOL |
| PASZEK MJ, ZAHIR N, JOHNSON KR ET AL.: "Tensional homeostasis and the malignant phenotype", CANCER CELL, vol. 8, 2005, pages 241 - 254 |
| PUCCI F, VENNERI MA, BIZIATO D ET AL.: "A distinguishing gene signature shared by tumor-infiltrating Tie2-expressing monocytes, blood ''resident'' monocytes, and embryonic macrophages suggests common functions and developmental relationships", BLOOD, vol. 114, 2009, pages 90 - 94 |
| QIAN BZ, POLLARD JW: "Macrophage diversity enhances tumor progression and metastasis", CELL, vol. 141, pages 39 - 51 |
| RANA, T. M., NAT REV MOL CELL BIOL, vol. 8, 2007, pages 23 - 36 |
| ROLNY C, MAZZONE M, TUGUES S ET AL.: "HRG inhibits tumor growth and metastasis by inducing macrophage polarization and vessel normalization through downregulation of PIGF", CANCER CELL, vol. 19, pages 31 - 44 |
| SAMUEL MS, LOPEZ JI, MCGHEE EJ ET AL.: "Actomyosin-Mediated Cellular Tension Drives Increased Tissue Stiffness and beta-Catenin Activation to Induce Epidermal Hyperplasia and Tumor Growth", CANCER CELL, vol. 19, pages 776 - 791, XP028232338, DOI: doi:10.1016/j.ccr.2011.05.008 |
| SCHNOOR M, CULLEN P, LORKOWSKI J ET AL.: "Production of type VI collagen by human macrophages: a new dimension in macrophage functional heterogeneity", J IMMUNOL., vol. 180, 2008, pages 5707 - 5719 |
| SICA A, LARGHI P, MANCINO A ET AL.: "Macrophage polarization in tumour progression", SEMIN CANCER BIOL., vol. 18, 2008, pages 349 - 355, XP023519773, DOI: doi:10.1016/j.semcancer.2008.03.004 |
| SKAFTNESMO ET AL., CURR PHARM BIOTECHNOL, vol. 8, 2007, pages 320 - 5 |
| SQUADRITO ML, DE PALMA M: "Macrophage regulation of tumor angiogenesis: implications for cancer therapy", MOL ASPECTS MED, vol. 32, pages 123 - 145, XP028385724, DOI: doi:10.1016/j.mam.2011.04.005 |
| SUNG-CHOU LI ET AL: "Intronic MicroRNA: Discovery and Biological Implications", DNA AND CELL BIOLOGY, MARY ANN LIEBERT, NEW YORK, NY, US, vol. 26, no. 4, 1 April 2007 (2007-04-01), pages 195 - 207, XP008124956, ISSN: 1044-5498 * |
| TOMBOL ZSOFIA ET AL: "Integrative molecular bioinformatics study of human adrenocortical tumors: microRNA, tissue-specific target prediction, and pathway analysis", ENDOCRINE-RELATED CANCER JOURNAL OF ENDOCRINOLOGY LTD, SOCIETY FOR ENDOCRINOLOGY, GB, vol. 16, no. 3, 1 September 2009 (2009-09-01), pages 895 - 906, XP002656495, ISSN: 1351-0088, DOI: 10.1677/ERC-09-0096 * |
| TSEREL L, RUNNEL T, KISAND K ET AL.: "microRNA expression profiles of human blood monocyte derived dendritic cells and macrophages reveal miR-511 as putative positive regulator of TLR4", J BIOL CHEM. |
| XIONG H, QIAN J, HE T, LI F: "Independent transcription of miR-281 in the intron of ODA in Drosophila melanogaster", BIOCHEM BIOPHYS RES COMMUN, vol. 378, 2009, pages 883 - 889, XP025841515, DOI: doi:10.1016/j.bbrc.2008.12.010 |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013093870A1 (en) | 2011-12-23 | 2013-06-27 | International Centre For Genetic Engineering And Biotechnology - Icgeb | microRNAs FOR CARDIAC REGENERATION THROUGH INDUCTION OF CARDIAC MYOCYTE PROLIFERATION |
| US10435757B1 (en) | 2016-06-15 | 2019-10-08 | University Of South Florida | Methods of measuring C19MC miRNA in a post-natal tissue and uses thereof |
| US12331362B2 (en) | 2016-06-15 | 2025-06-17 | University Of South Florida | Methods of measuring C19MC miRNA in a post-natal tissue and uses thereof |
| US11485958B2 (en) | 2017-01-23 | 2022-11-01 | Regeneron Pharmaceuticals, Inc. | HSD17B13 variants and uses thereof |
| US11753628B2 (en) | 2017-01-23 | 2023-09-12 | Regeneron Pharmaceuticals, Inc. | HSD17B13 variants and uses thereof |
| US11845963B2 (en) | 2017-01-23 | 2023-12-19 | Regeneron Pharmaceuticals, Inc. | HSD17B13 variants and uses thereof |
| WO2018156945A1 (en) * | 2017-02-24 | 2018-08-30 | University Of South Florida | Prevention of preterm birth (ptb) by inhibition of fkbp51 |
| US11197868B2 (en) | 2017-02-24 | 2021-12-14 | University Of South Florida | Prevention of preterm birth (PTB) by inhibition of FKBP51 |
| US11479802B2 (en) | 2017-04-11 | 2022-10-25 | Regeneron Pharmaceuticals, Inc. | Assays for screening activity of modulators of members of the hydroxy steroid (17-beta) dehydrogenase (HSD17B) family |
| US11702700B2 (en) | 2017-10-11 | 2023-07-18 | Regeneron Pharmaceuticals, Inc. | Inhibition of HSD17B13 in the treatment of liver disease in patients expressing the PNPLA3 I148M variation |
| US12286677B2 (en) | 2017-10-11 | 2025-04-29 | Regeneron Pharmaceuticals, Inc. | Inhibition of HSD17B13 in the treatment of liver disease in patients expressing the PNPLA3 I148M variation |
| US12359201B2 (en) | 2018-03-21 | 2025-07-15 | Regeneron Pharmaceuticals, Inc. | 17ß-hydroxysteroid dehydrogenase type 13 (HSD17B13) iRNA compositions and methods of use thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chen et al. | Circular RNA circRHOBTB3 represses metastasis by regulating the HuR-mediated mRNA stability of PTBP1 in colorectal cancer | |
| Wu et al. | CircIRAK3 sponges miR-3607 to facilitate breast cancer metastasis | |
| US20230295631A1 (en) | Micrornas and methods of their use | |
| Zhang et al. | Identification of the tumor‑suppressive function of circular RNA FOXO3 in non‑small cell lung cancer through sponging miR‑155 | |
| Zhang et al. | microRNA-21 promotes tumor proliferation and invasion in gastric cancer by targeting PTEN | |
| US20230285439A1 (en) | Methods for treating triple-negative breast cancer | |
| Yungang et al. | miR-370 targeted FoxM1 functions as a tumor suppressor in laryngeal squamous cell carcinoma (LSCC) | |
| Bian et al. | Novel circular RNA, hsa_circ_0025039 promotes cell growth, invasion and glucose metabolism in malignant melanoma via the miR-198/CDK4 axis | |
| Ouimet et al. | A childhood acute lymphoblastic leukemia-specific lncRNA implicated in prednisolone resistance, cell proliferation, and migration | |
| Yu et al. | MicroRNA-378 functions as an onco-miR in nasopharyngeal carcinoma by repressing TOB2 expression | |
| Shang et al. | LncRNA RNCR3 promotes Chop expression by sponging miR-185-5p during MDSC differentiation | |
| Zhi et al. | Circular RNA profiling identifies circ102049 as a key regulator of colorectal liver metastasis | |
| Wu et al. | circFBXO7/miR-96-5p/MTSS1 axis is an important regulator in the Wnt signaling pathway in ovarian cancer | |
| Jin et al. | MiR-182-5p inhibited proliferation and metastasis of colorectal cancer by targeting MTDH. | |
| Yu et al. | Circular RNA CircCCNB1 sponges micro RNA-449a to inhibit cellular senescence by targeting CCNE2 | |
| Cai et al. | Role of miR-15a in intervertebral disc degeneration through targeting MAP3K9 | |
| Yamamoto et al. | Uncovering direct targets of MiR-19a involved in lung cancer progression | |
| Liu et al. | miR-371-5p down-regulates pre mRNA processing factor 4 homolog B (PRPF4B) and facilitates the G1/S transition in human hepatocellular carcinoma cells | |
| Jiang et al. | MicroRNA-1468-5p inhibits glioma cell proliferation and induces cell cycle arrest by targeting RRM1 | |
| Li et al. | Mutant ACTB mRNA 3′-UTR promotes hepatocellular carcinoma development by regulating miR-1 and miR-29a | |
| Sato et al. | MicroRNAs as therapeutic targets in lung disease: prospects and challenges | |
| Wu et al. | XIAP 3′-untranslated region as a ceRNA promotes FSCN1 function in inducing the progression of breast cancer by binding endogenous miR-29a-5p | |
| Satake et al. | Nucleolin facilitates nuclear retention of an ultraconserved region containing TRA2β4 and accelerates colon cancer cell growth | |
| Wang et al. | hsa_circ0021347 as a Potential target regulated by B7‐H3 in modulating the malignant characteristics of osteosarcoma | |
| Xie et al. | Significance of a tumor microenvironment-mediated P65-miR-30a-5p-BCL2L11 amplification loop in multiple myeloma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11785480 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 11785480 Country of ref document: EP Kind code of ref document: A1 |


