WO2012050975A2 - Novel circular mammalian rna molecules and uses thereof - Google Patents

Abstract

This invention is directed to isolated and purified nucleic acids encoding circular RNA comprising one or more ANRIL exons, methods for detecting such nucleic acids, and uses thereof. The invention provides methods for detecting ANRIL associated disorders such as atherosclerosis, related kits, and methods of screening for compounds to prevent or treat such disorders.

Description

NOVEL CIRCULAR MAMMALIAN RNA MOLECULES AND USES THEREOF

RELATED APPLICATION

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 61/387,918, filed September 29, 2010 entitled "Novel Circular Mammalian RNA Molecules and Uses Thereof naming Sharpless et al. as inventors with Atty. Dkt. No. UNC10003USV. The entire contents of which are hereby incorporated by reference including all text, tables, and drawings.

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0002] This invention was made in part with government support under grant number AG024379 awarded by the National Institutes of Health (NIH). The United States Government has certain rights in the invention.

1. FIELD OF THE INVENTION

[0003] This invention relates generally to the discovery of novel circular mammalian RNA molecules made of exons from ANRIL (CDKN2BAS) and uses of these circular RNA molecules.

2. BACKGROUND OF THE INVENTION

2.1. Introduction

[0004] Atherosclerotic vascular disease (ASVD) is a leading cause of human mortality worldwide [1]. While there are well-recognized risk factors for ASVD such as tobacco use, obesity and hyperlipidemia, the identification of common genetic variants associated with the disease has proven difficult despite strong evidence that susceptibility is heritable. Recently, multiple unbiased genome-wide association studies (GWAS) have linked single nucleotide polymorphisms (SNPs) near the INK4/ARF (or CDKN2a/b locus) on chromosome 9p21 to ASVD and other related conditions (i.e., coronary artery disease, stroke, myocardial infarction and aortic aneurysm) [2-12]. These associations have been replicated in multiple independent studies and are not associated with "classical" ASVD risk factors such as hypertension, obesity, tobacco use or lipid levels.

[0005] Cancer is also an important cause of human mortality. The INK4/ARF tumor suppressor locus plays a principal role in human cancer resistance (reviewed in Kim and Sharpless, [15]). SNPs near this locus have been associated with human malignancies, as have germline polymorphisms associated with reduced function which predispose to several cancer including melanoma, glioblastoma and pancreatic adenocarcinoma. Somatic inactivation of this locus is one of the most frequent events in human malignancy, and regulation of the locus plays a major role in susceptibility to cancer.

[0006] Moreover, regulation of the INK4/ARF locus is associated with a variety of aging- associated diseases in addition to cancer and atherosclerotic conditions such as ischemic strike, aortic aneurysm and myocardial infarction. SNPs near the INK4/ARF locus have also been associated with susceptibility to Type 2 diabetes mellitus, frailty and human longevity; suggesting the regulation of the INK4/ARF locus plays a general role in the susceptibility to a variety of human diseases associated with aging.

2.2. INK4/ARF Locus and ANRIL (CDKN2BAS)

[0007] While causal variants within 9p21.3 have yet to be identified, the risk associated SNPs cluster for atherosclerotic disease together within a 53 kb region roughly 100 kb centromeric to the INK4/ARF tumor suppressor locus ([13] and Figure 8A, 8B, 8C). Congenic mapping using mice differentially susceptible to ASVD has identified syntenic susceptibility alleles near the murine Ink4/Arf locus [14], suggesting that this risk interval is conserved in mammals. The INK4/ARF locus encodes three archetypal tumor suppressor

INK4a INK4b ARF ARF

genes: pi 6 , pi 5 and ARF (pi 4 in humans, pi 9 in mice), as well as a long non- coding RNA called Antisense Non-coding RNA in the INK4_.Locus (ANRIL or CDKN2BAS). Other than a role for ARF in development of the optic vasculature, all of the INK4/ARF proteins are thought to be largely dispensable for normal mammalian development, but play important roles in restraining aberrant proliferation associated with cancer and other disease states (reviewed in: [15]). In purified T-cells from healthy individuals, we have shown a pronounced effect of ASVD-associated SNPs at 9p21 on INK4/ARF expression, with those

INK4b INK4a harboring the risk alleles demonstrating reduced levels of pi 5 , pi 6 , ARF and ANRIL [16]. Decreased expression of such anti-pro liferative molecules could promote pathologic monocytic or vascular proliferation, thus accelerating ASVD development

INK4a

(reviewed in [17, 18]). For example, mice lacking pi 6 exhibit increased vascular hyperplasia following intra-arterial injury [19] and ARF deficiency has been implicated in atherosclerotic plaque formation [20]. Additionally, TGF-β signaling, which induces the

INK4a INK4b

expression of pl6 and pl5 , is anti-atherogenic in some settings [21-23]. Most recently, excess proliferation of hematopoietic progenitor cells, which is in part controlled by pl6 expression during aging [24], has been associated with atherosclerosis in a murine model [25]. Moreover, targeted deletion of a region syntenic to the ASVD-risk interval in

INK4b INK4a

mice resulted in severely attenuated expression οΐρ15 and pi 6 [26]. Although these results suggest that the ASVD-associated 9p21 SNPs control INK4/ARF expression, and that decreased expression of the INK4/ARF tumor suppressors may promote ASVD, it is not known how polymorphisms located ~120kb away from the locus might influence INK4/ARF expression.

[0008] ANRIL was first uncovered in a genetic analysis of familial melanoma patients with neural system tumors [27]. Based upon EST assembly, ANRIL has 19 exons with no identified open reading frame [27] (Figure 9). Although cloning a full-length version of the predicted transcript has proven difficult, a growing number of alternatively spliced ANRIL transcripts have recently been reported in the literature [28,29]. Many of these reports suggest that multiple ANRIL isoforms can be expressed in a single cell type. For example, two ANRIL variants have been reported in testes, five in HUVECs and three in lung [27,28]. Further confounding the study of ANRIL, the majority of predicted exons are <100 nucleotides in length and many consist entirely of repetitive LINE, SINE and Alu elements (i.e. exons 7, 8, 12, 14 and 16) [30]. Without a firm understanding of ANRIL structure, deciphering the biological function of this non-coding RNA has become increasingly complicated.

[0009] More than a decade ago, elegant genetic work by Van Lohuizen, DePinho and colleagues demonstrated that the Ink4/Arf locus is potently repressed by Polycomb group (PcG) complexes [31]. Such repression appears critical for the persistence and proliferation of somatic stem cells and other self-renewing tissues such as pancreatic beta-cells [32,33]. Until recently little progress was made in understanding the biochemical basis for PcG- mediated INK4/ARF silencing, however two independent groups have since shown that the PcG complexes, PRC-1 and PRC-2, localize to the INK4/ARF locus and repress its activity through the establishment of repressive chromatin modifications such as H3K27 trimethylation [34-36]. Prior work has also shown that long, non-coding RNAs such as Xist, Kcnqlotl and HOTAIR can repress genes in cis- or trans- through interaction with PcG complexes [37-40]. Moreover, dysregulation of HOTAIR has been recently implicated in breast cancer progression, suggesting that long, non-coding RNAs play an important role in human disease [41]. Based on this evidence, we and others postulated that ANRIL could play a similar role in PcG-mediated repression of the INK4/ARF locus [16]. 3. SUMMARY OF THE INVENTION

[0010] In particular non-limiting embodiments, the present invention provides an isolated and purified nucleic acid encoding a circular RNA comprising two or more ANRIL exons. The circular RNA may comprise ANRIL exons 3i*, 4, 5, 6, 7, 10, 13, 14, 15, 16, 17, 18, or 19. The circular RNA may be a circle where exon 4 is linked to exon 14, e.g., -exon4- exonl3-exonl4- or represented as 4-13-14-4 in Fig. 4B and 4C. Additional examples include -exon4-exon5-exon6-exon3i*-, -exon6-exon5-exon3i*- -exon4-exon5-exon6-exon7-exonl4-, -exon4-exon5-exon6-exon7-, -exon4-exon5-exon6-, -exon6-exon7-exonl4-exon5-, -exon6- exon7-exonl0-exon5-, -exon6-exon7-exon5-, -exon6-exon5-, -exon6-exonl3-exonl4-, or -exonl 6-exonl 7-exon 18-exon 19-exon 13 -exon 14-exon 15-.

[0011] The invention also provides a method for detecting a level of a nucleic acid encoding a circular RNA comprising two or more ANRIL exons in a sample which comprises contacting the sample with a reagent that selectively enriches the circular RNA and measuring the level of the nucleic acid in the sample. The enriching may be performed by an exonuclease, such as RNase R or RNase H. Alternatively, the method further comprises detecting the nucleic acid encoding the circular RNA with a probe specific for a mis-ordered junction. The mis-ordered junction may be exon5-exon3i*, exon6-exon3i*, exon6-exon5, exon7-exon4, exon7-exon5, exonl0-exon5, exonl4-exon4, exonl4-exon5, or exon 19- exonl3. The method to detect the mis-ordered exon junction may utilize a mass spectrometer. Alternatively, the method may comprise PCR amplification using outward facing primers such only circular nucleic acids will produce an amplicon. Furthermore, the method alternatively may comprise detecting a polyadenonosine end or removing nucleic acids with polyadenosine ends.

[0012] The invention also provides a method for detecting risk of a vascular disease in a subject which comprises measuring a level of the circular nucleic acids and determining whether or not the subject is at risk for vascular disease. The vascular disease may be abdominal aortic aneurysm, arteriosclerosis, atherosclerosis, coronary artery disease, ischemic stroke, myocardial infarction, peripheral vascular disease, renal artery stenosis, stroke, or thoracic aortic aneurysm. The ischemic stroke may be cardioembolic stroke, large artery stroke, or small vessel stroke. The invention also provides a method for detecting risk of a metabolic disorder in a subject which comprises measuring a level of the circular nucleic acids and determining whether or not the subject is at risk for the metabolic disorder. The metabolic disorder may be diabetes mellitus, metabolic syndrome, or type 2 diabetes.

[0013] The invention also provides a method for detecting risk of a proliferative disorder in a subject which comprises measuring a level of the circular nucleic acids and determining whether or not the subject is at risk for the proliferative disorder. The proliferative disorder may be cancer or endometriosis. The cancer may be bladder carcinoma, breast cancer, colorectal cancer, endocrinologic cancer, thyroid cancer, glioblastoma, head and neck cancer, leukemia, melanoma, liver cancer, lung cancer, non-small cell lung cancer, pancreatic adenocarcinoma, or skin cancer. The invention also provides a method for detecting risk of an age-associated condition in a subject which comprises measuring a level of the circular nucleic acids and determining whether or not the subject is at risk for the age-associated condition. The age-associated condition may be frailty, life-expectancy or longevity.

[0014] Kits are also provided. The invention includes a kit comprising: (a) at least one reagent selected from the group consisting of: (i) a nucleic acid probe capable of specifically hybridizing with a nucleic acid encoding a circular RNA comprising two or more ANRIL exons; (ii) a pair of nucleic acid primers capable of PCR amplification of the nucleic acid; and (iii) a probe capable of specifically hybridizing with the nucleic acid; and (b) instructions for use in measuring the nucleic acid in a tissue sample from a subject suspected of having an ANRIL-associated disorder. The ANRIL-associated disorder may be a vascular disease, a metabolic disease, a proliferative disorder or an age-associated condition. The kits may also contain reagent that selectively enriches the circular RNA such as an exonuclease.

[0015] In addition, the invention provides a method of identifying a compound that prevents or treats an ANRIL-associated disorder, the method comprising the steps of: (a) contacting a compound with a sample comprising a cell or a tissue; (b) measuring a level of a nucleic acid encoding a circular RNA comprising two or more ANRIL exons; (c) determining a functional effect of the compound on the level of the nucleic acid; thereby identifying a compound that prevents or treats an ANRIL-associated disorder.

4. BRIEF DESCRIPTION OF THE FIGURES

[0016] Fig. 1A and IB. Identification and characterization of ANRIL splice variants. Fig. 1A, 3' and 5' RACE was performed using primers directed against exons 4 and 6 where long stretches of unique sequence were observed (top). The resulting PCR products were cloned and sequenced, revealing several novel exons (10a and 13b) and multiple non-colinear species (13-14-4-5, 13-14-4). Fig. IB, Equal quantities of total RNA were harvested from growing cell lines of various tissue types and absolute expression of the indicated transcript was determined. Expression levels are shown in a box- whisker plot on a log 10 scale in 11 of 27 analyzed cell lines which did not harbor homozygous 9p21 deletion. Validated TaqMan® detection strategies for the indicated ANRIL species are shown (top).

[0017] Fig. 2A and 2B. RNA Sequencing of ANRIL transcripts. Coverage plots of RNA sequencing reads derived from short read archive study SRP002274 [45]. Fig. 2A, Top,

INK4a

Read coverage across all ANRIL exons and nearby tumor suppressor genes pi 6 , ARF and

INK4b

pl5 is shown. Fig. 2A, Bottom, The grey regions in the top panel were graphed on a truncated scale to better depict ANRIL coverage. Annotations above the larger peaks show the maximum number of reads mapping to these areas. Fig. 2B, Maximum peak height at each exon (normalized by overall locus coverage) is displayed from three independent samples: SRP002274 (Brain) and two ENCODE RNA-sequencing replicates of the HeLa cell line (HeLa rep 1 and 2). The inset shows all ANRIL exons on y-axis with peak height of 150 reads.

[0018] Fig. 3A-3D. ANRIL 14-5 and 4-6 are circular RNAs. Fig. 3A, Schematic representation of the ANRIL14-5 TaqMan® detection strategy wherein the probe spans the exon 5-exon 14 boundary amplified with outward facing primers. Fig. 3B, Expression of the indicated transcripts was quantified in cDNA from Hs68 cells made using the indicate primers (-RT: no reverse transcriptase, H+dT: an equal mix of random hexamers and oligo dT, dT: oligo dT alone, and HEX: random hexamers alone). Error bars represent the standard deviation for three replicates. Fig. 3C, Total RNA harvested from growing Hs68 (top) and IMR90 (bottom) cells was incubated with, or without, RNase R, purified and reverse transcribed. The indicated transcripts were quantified in 'B'. Fig. 3D, The average fold enrichment by RNase R for each transcript is shown on a log 10 scale.

[0019] Fig. 4A-4C. ANRIL circular RNAs predominantly contain exons 4-14. Fig.

4A, cDNA generated in the presence (+R) or absence (-R) of RNase R as in Figure 3C was subjected to PCR using outward facing primers within the same exon as depicted (left) and separated by gel electrophoresis. Fig. 4B and Fig. 4C, The PCR products in 'A' were purified, cloned and sequenced. The resulting sequences are shown for each exon pair.

[0020] Fig. 5A-5B. ANRIL4-6 and 14-5 correlate with INK4/ARF expression and rsl0757278 genotype in human PBTLs. Fig. 5A, TaqMan® analysis of ANRIL and INK4/ARF transcripts was conducted and normalized as described in Materials and Methods. Correlations between ANRIL and INK4/ARF transcripts in 106 primary peripheral blood T- lymphocytes (PBTLs) were determined using linear regression. The R value for each pair- wise comparison is shown, with those achieving significance (p<0.05) depicted in gray. Due to limitations in sample availability, ANRIL 1-2 and ANRIL 14-5 levels were determined in only a subset of individuals (n=94 and 98, respectively). Fig. 5B, The relative expression of ANRIL1-2, 14-5 and 18-19 normalized as in 'A' is plotted versus rsl0757278 genotype, p- values were determined by a two-sided t-test.

[0021] Fig. 6A-6C. Deep sequencing of 9p21 in pools of rsl0757278 homozygotes. Fig. 6A, The region captured using DNA sequence capture technology is shown on the 'Tiling' track. The 'Unique' track shows the Duke 35bp Uniqueness information as provided in the UCSC Genome Browser. The bar at the top of the figure represents the 53 kb risk interval previously defined by Broadbent et al. [13]. Fig. 6B, Venn diagrams depicting SNP calls for the AA (left) and GG (right) samples using three different algorithms. Fig. 6C, Using the UCSC Genome Browser, SNPs identified by next-generation DNA sequencing are depicted across the captured region of 9p21. The 'Discovered' track shows the polymorphisms identified by two or more algorithms in either the pooled AA or GG sample. SNPs unique to each genotype are shown below. The 'Unique Splice' track depicts the location of the 4 SNPs, unique to the GG sample, which modify cz^'s-acting splice regulation sites (See also Table 1).

[0022] Fig. 7. Model showing how 9p21 polymorphisms influence ANRIL isoform production to modulate INK4/ARF gene transcription. PcG complexes (e.g., PRC-1) are targeted to the coding INK4/ARF locus by ANRIL, and modulate its repression. Nascent ANRIL transcripts are spliced to produce circular ANRIL species (cANRIL). Causal variants in the ASVD-risk interval modulate ANRIL transcription or splicing to influence INK4/ARF expression. See discussion for further description.

[0023] Fig. 8A-Fig. 8C. Polymorphisms within the INK4/ARF locus linked to age-related diseases. Fig. 8A, Schematic diagram of the 9p21 locus depicting the INK4/ARF tumor suppressors, ANRIL and the ASVD risk interval. The captured ("tiling") region for next generation DNA sequencing is indicated. Fig. 8B, The localization of SNPs linked in the literature to age-related diseases including T2D- type 2 diabetes, CAD- coronary artery disease, Ml-myocardial infarction, AD- Alzheimer's disease are shown. Fig. 8C, A heatmap depicting the SNP linkage disequilibrium (D'/LOD) was generated from the Hapmap CEU population using Haploview software [84]. The strength of linkage disequilibrium increases from white to light gray to gray to dark gray: white (disequilibrium coefficient (D') <1 and LOD score <2); light gray (D' = 1 and LOD score <2); gray (D'<1 and LOD score >2); and dark gray (D' = 1 and LOD score >2). The heatmap can be aligned to the depicted 9p21 image as shown in Fig. 8A-8C.

[0024] Fig. 9. Schematic of previously reported ANRIL variants. All Ensembl (blue) and GenBank (black) records for ANRIL (CDKN2BAS) are shown. Some sequences are derived from cDNA sequencing whereas others were inferred by EST assembly.

[0025] Fig. 10. Efficiency curves for TaqMan® probe strategies. Cloned cDNAs or PCR products corresponding to the TaqMan® target sequences were linearized and quantified. For each real-time PCR run, a standard curve of 5 independent dilutions was run in triplicate. Primer efficiency was calculated using the formula: Efficiency = 10^A(-l/slope)- 1. Shown are representative graphs from individual experiments.

[0026] Fig. 11. Expression of 9p21 transcripts in transformed and non-transformed cell lines. As described in Figure IB, R A was harvested, reverse transcribed and quantitative real-time PCR performed. Bars represent the logio of the average number of molecules detected. The error bars denote the standard deviation between three replicates. The letter 'D' denotes deletion events previously reported in the literature. 'M' indicates gene methylation. Breast cancer cell lines are T-47D, BT-549, BT-474, SUM149, MDA-MB- 231, MDA-MB-436, MDA-MB-468, and MCF7;, colorectal cancer cell lines are LS1034, SW480, LS174T, LoVo, T84, and COLO 205; melanoma cell lines are RPMI-8322, WM266- 4, UACC, A2058, and A375; hematological malignancies are Jurkat, Raji, and Ramos cell lines;, cervical carcinoma cell line is HeLa; glioblastoma cell line is U87 and non- transformed cells are Hs68, IMR90, and HUVEC.

[0027] Fig. 12. ANRIL14-5 expression is detected in a wide variety of cell types. cDNA generated as described in Figure IB was assayed for ANRIL14-5 expression using the TaqMan® strategy shown in Figure 3A. Bars represent the logio of the average number of molecules detected. The error bars denote the standard deviation between three replicates. Cell lines and associated diseases are described for Fig. 1 1.

[0028] Fig. 13. Correlation of ANRIL and INK4/ARF expression in primary peripheral blood T-lymphocytes. Diagram depicting the correlations between 9p21 transcripts in primary peripheral blood T-lymphocytes from 106 patients. Taqman anlaysis of ANRIL and INK4/ARF transcripts was conducted and normalized as described in Materials and Methods. Data for ANRIL4-6, pl6INK4a, pl5INK4b and ARF expression were previously reported [42]. Scatter plots, below the diagonal, show the relationships between all pairs of transcripts on a log2 scale. Linear regression is depicted in gray. Boxes above the diagonal list and are shaded by r-value. A star (*) indicates significant associations (p<0.05). Histograms along the diagonal show the distribution of expression for each transcript assayed. Due to limitations in sample availability, ANRIL 1-2 and ANRIL 14-5 levels were not determined for several individuals as indicated (n = 94 and 98, respectively).

[0029]

[0030] Fig. 14A and Fig. 14B are schematics of the location of linear murine ANRIL (mANRIL) and circular murine ANRIL (mcANRIL) products identified from late passage primary wild-type murine embryonic fibroblasts (MEFs) using next-generation sequencing of a cDNA library (RNA-seq). The sequencing included reads bridge several circular junctions. The circular junctions indicate the mcANRIL species. Fig. 14 A is a 493kb region of murine chromosome 4. Fig. 14B shows a region of approximately 250 kb.

[0031] Fig. 15 shows the PCR validation of mcANRIL circles 1 1, 25, 31, and 40. PCR amplification of mcANRIL circles from wild-type MEF cDNA. In the figure "·" dots represent validated mcANRIL circles. Additional products likely are due to extensive alternative splicing.

[0032] Fig. 16 shows quantitative real-time RT-PCR of mANRIL and mcANRIL splice junctions. cDNA was prepared from early passage (P3) and late passage (P8) wild-type (WT) C57B6 MEFs. Relative fold expression of pl6^INK4a with passage (Fig. 16A.) is shown as a positive control. (Fig. 16B.) Relative expression of a validated linear mANRIL RNA splice junction. (Fig. 16C- Fig. 16E) Relative fold expression of three non-colinear mcANRIL RNA splice junctions. Fold expression of each target was determined relative to 18S. A negative control (no cDNA template) yielded undetectable levels of all transcripts (not shown). X-axis label indicates the transcript measured.

5. DETAILED DESCRIPTION OF THE INVENTION

[0033] This invention is useful for detecting a target nucleic acid of interest present in a sample. The target nucleic acid is preferably a circular ANRIL RNA. The methods use relatively few and easily performed steps to isolate and/or concentrate the target nucleic acid from other sample components and to detect the target nucleic acid. Samples are typically one or more cells obtained as a specimen that can be used to determine the presence or abundance of a target nucleic acid that is a biomarker for a disorder. For example, the sample can be one or more blood cells that can be used for determining a disorder wherein a biomarker is present in blood cells. Another example, the sample can be one or more biopsied cells that can be used for determining the presence of a disorder wherein a biomarker is present in the tissue or organ from which the biopsy was taken. The methods include isolating the target nucleic acid from the sample. In some instances the target nucleic acid is released from a cell by lysing the cell in which the target nucleic acid is suspected of being present. In some instances, the released target nucleic acid is then isolated away from other components of the sample, which may include cellular debris is the target nucleic acid was released by cell lysis. Isolation can include general nucleic acid isolation, which can be done using kits like the mirVana kits (ABI, Foster City, CA); Trizol LS (Invitrogen, Carlsbad, CA); Micro RNA Isolation kits (Stratagene, La Jolla, CA) and High-Pure miRNA Isolation kits (Roche, Indianapolis, IN).

5.1. Definitions

[0034] The methods of the invention may be used to measure a level of any nucleic acid encoding a circular RNA comprising two or more ANRIL exons, including but not limited to, exons 4, 5, 6, 7, 10, 13, 14, 15, 16, 17, 18 or 19. For example, the methods of the invention may use at least a portion of (i) the nucleotide sequence of mammalian ANRIL (CDKN2BAS), e. g., as derived from whole blood leukocytes or lymphoblastoid cell lines (Pasmant et al., 2007, Cancer Res. 67(8): 3963-3969); (ii) the nucleotide sequences of any one or more of exons 4-7, 10, 13-19 of human ANRIL described herein; (iii) CDKN2B antisense RNA (non-protein coding), Ref. Seq. NR_003529, Entrez Gene ID 100048912 also known as RP1 1-145E5.4, NCRNA00089, pl5AS, ANRIL, "antisense RNA in the ΓΝΚ4 locus", "non-protein coding RNA 89", or "pl5 antisense RNA"; (iv) the murine linear or circular ANRIL sequences described in Section 6.4 (par. 123-130); or (v) other mammalian homologues found using the sequences disclosed herein. Included in the nucleic acids of the claimed invention are the single nucleotide polymorphisms (SNPs) such as the 130 SNPs that may be found in UCSC Genome Browser on Human Mar. 2006 (NCBI36/hgl8) Assembly or the 131 SNPs UCSC Genome Browser on Human Feb. 2009 (GRCh37/hgl9) Assembly (http://genome.ucsc.edu/).

[0035] The term "ANRIL-associated disorder" includes: (i) vascular diseases such as aortic aneurism, atherosclerosis, coronary artery disease, ischemic stroke, myocardial infarction, peripheral vascular disease, or stroke including cardioembolic stroke, large artery stroke or small vessel stroke; (ii) metabolic disorders such as diabetes mellitus, metabolic syndrome, or type 2 diabetes; (iii) proliferative disorders such as endometriosis or cancer, e.g., bladder carcinoma, glioblastoma, leukemia, melanoma, non-small cell lung cancer, or pancreatic adenocarcinoma.

[0036] "Frailty" refers to a specific and measurable geriatric syndrome as described by Fried and colleagues. See: Melzer D, Frayling TM, Murray A, Hurst AJ, Harries LW, et al. (2007) A common variant of the pl6(INK4a) genetic region is associated with physical function in older people. Mech Ageing Dev 128: 370-377. Walston J, McBurnie MA, Newman A, Tracy RP, Kop WJ, et al. (2002) Frailty and activation of the inflammation and coagulation systems with and without clinical comorbidities: results from the Cardiovascular Health Study. Arch Intern Med 162: 2333-2341 ; Morley JE, Haren MT, Rolland Y, Kim MJ (2006) Frailty. Med Clin North Am 90: 837-847; and Ershler WB, Keller ET (2000) Age- associated increased interleukin-6 gene expression, late-life diseases, and frailty. Annu Rev Med 51 : 245-270.

[0037] The terms "nucleic acid" and "nucleic acid molecule" may be used interchangeably throughout the disclosure. A reference to a particular nucleic acid or nucleic acid molecule, such as a "nucleic acid encoding a circular RNA comprising two or more ANRIL exons" or a "nucleic acid encoding SEQ ID No. X" includes nucleic acids of any composition from, such as DNA (e.g., complementary DNA (cDNA), genomic DNA (gDNA) and the like), RNA (e.g., message RNA (mRNA), short inhibitory RNA (siRNA), ribosomal RNA (rRNA), tRNA, microRNA, and the like), and/or DNA or RNA analogs (e.g., containing base analogs, sugar analogs and/or a non-native backbone and the like), RNA/DNA hybrids and polyamide nucleic acids (PNAs), all of which can be in single- or double-stranded form, and unless otherwise limited, can encompass known analogs of natural nucleotides. Examples of nucleic acids are SEQ ID Nos. 1-37 shown in Table 2; a specific circular ANRIL, exons, probes and primers, SEQ ID Nos. 38-45 in Figure 14; SEQ ID Nos 46-56 probes and primers for the murine ANRIL; or the portions of human Ref. Seq. or murine genome designated in Section 6.4 (par. 123-130). A template nucleic acid in some embodiments can be from a single chromosome (e.g., a nucleic acid sample may be from one chromosome of a sample obtained from a diploid organism). Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses methylated forms, conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, single nucleotide polymorphisms (SNPs), and complementary sequences as well as the sequence explicitly indicated. The term nucleic acid is used interchangeably with locus, gene, cDNA, and mRNA encoded by a gene. The term also may include, as equivalents, derivatives, variants and analogs of RNA or DNA synthesized from nucleotide analogs, single- stranded ("sense" or "antisense", "plus" strand or "minus" strand, "forward" reading frame or "reverse" reading frame) and double-stranded polynucleotides. Deoxyribonucleotides include deoxyadenosine, deoxycytidine, deoxyguanosine and deoxythymidine. For RNA, the base cytosine is replaced with uracil.

[0038] "Primers" as used herein refer to oligonucleotides that can be used in an amplification method, such as a polymerase chain reaction (PCR), to amplify a nucleotide sequence based on the polynucleotide sequence corresponding to a particular genomic sequence, e.g., one specific for a particular site in the circular ANRIL RNA. At least one of the PCR primers for amplification of a polynucleotide sequence is sequence-specific for the sequence.

[0039] The interchangeable terms "oligomer," "oligo" and "oligonucleotide" refer to a nucleic acid having generally less than 1,000 nucleotide (nt) residues, including polymers in a range having a lower limit of about 5 nt residues and an upper limit of about 500 to 900 nt residues. In some embodiments, oligonucleotides are in a size range having a lower limit of about 12 to 15 nt and an upper limit of about 50 to 600 nt, and other embodiments are in a range having a lower limit of about 15 to 20 nt and an upper limit of about 22 to 100 nt. Oligonucleotides may be purified from naturally occurring sources or may be synthesized using any of a variety of well-known enzymatic or chemical methods. The term oligonucleotide does not denote any particular function to the reagent; rather, it is used generically to cover all such reagents described herein. An oligonucleotide may serve various different functions. For example, it may function as a primer if it is specific for and capable of hybridizing to a complementary strand and can further be extended in the presence of a nucleic acid polymerase, it may provide a promoter if it contains a sequence recognized by an RNA polymerase and allows for transcription (e.g., a promoter-based oligomer), and it may function to prevent hybridization or impede primer extension if appropriately situated and/or modified.

[0040] By "complementary" or "complementarity of nucleic acids is meant that a nucleotide sequence in one strand of nucleic acid, due to orientation of the functional groups, will hydrogen bond to another sequence on an opposing nucleic acid strand. The complementary bases typically are, in DNA, A with T and C with G, and, in RNA, C with G, and U with A. "Substantially complementary" means that a sequence in one strand is not completely and/or perfectly complementary to a sequence in an opposing strand, but that sufficient bonding occurs between bases on the two strands to form a stable hybrid complex in set of hybridization conditions (e.g., salt concentration and temperature). Such conditions can be predicted by using the sequences and standard mathematical calculations known to those skilled in the art to predict the T_m of hybridized strands, or by empirical determination of T_m by using routine methods. T_m refers to the temperature at which a population of hybridization complexes formed between two nucleic acid strands are 50% denatured. At a temperature below the T_m, formation of a hybridization complex is favored, whereas at a temperature above the T_m, melting or separation of the strands in the hybridization complex is favored. T_m may be estimated for a nucleic acid having a known G+C content in an aqueous 1 M NaCl solution by using, e.g., T_m = 81.5 + 0.41(%G+C), although other T_m computations are known in the art which take into account nucleic acid structural characteristics. Nucleic acid sequences are identical when their contiguous nucleotide arrangements are the same. Identical sequences includes those that have a modified residue in one sequence, but not the other, so long as the residue is basically the same (e.g., a 2'-OMe residue in one sequence is still identical to a strand lacking the 2'OMe modification). Substantially identical sequences are those that contain sequence differences between the two strands, but the strands retain similar hybridization properties. Identity and substantial identity between sequences are understood and easily determined by ordinarily skilled artisans.

[0041] Sequences herein that are at least a certain percent identical or complementary to another sequence, means that the sequences includes all rational numbers from the referenced percent identity to 100%. For example, at least 80% means all natural number percentages 80, 81, 82, 82, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 and 100, as well as any fraction in between (e.g., 82.6, 91.1, 97.9, etc). Ordinarily skilled artisans can determine percent complementarity and percent identity.

[0042] "Hybridization condition" refers to the cumulative environment in which one nucleic acid strand bonds to a second nucleic acid strand by complementary strand interactions and hydrogen bonding to produce a hybridization complex. Such conditions include the chemical components and their concentrations (e.g., salts, chelating agents, formamide) of an aqueous or organic solution containing the nucleic acids, and the temperature of the mixture. Other well-known factors, such as the length of incubation time or reaction chamber dimensions may contribute to the environment (e.g., Sambrook et al, Molecular Cloning, A Laboratory Manual, 2nd ed., pp. 1.90-1.91, 9.47-9.51 , 11.47-1 1.57 (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989)),

[0043] The term "template" refers to any nucleic acid molecule that can be used for amplification in the technology. RNA or DNA that is not naturally double stranded can be made into double stranded DNA so as to be used as template DNA. Any double stranded DNA or preparation containing multiple, different double stranded DNA molecules can be used as template DNA to amplify a locus or loci of interest contained in the template DNA.

[0044] The term "amplification reaction" as used herein refers to a process for copying nucleic acid one or more times. In embodiments, the method of amplification includes, but is not limited to, polymerase chain reaction, self-sustained sequence reaction, ligase chain reaction, rapid amplification of cDNA ends, polymerase chain reaction and ligase chain reaction, Q-β replicase amplification, strand displacement amplification, rolling circle amplification, or splice overlap extension polymerase chain reaction. In some embodiments, a single molecule of nucleic acid may be amplified.

[0045] The term "sensitivity" as used herein refers to the number of true positives divided by the number of true positives plus the number of false negatives, where sensitivity (sens) may be within the range of 0 < sens < 1. Ideally, method embodiments herein have the number of false negatives equaling zero or close to equaling zero, so that no subject is wrongly identified as not having a disorder when they do indeed have a disorder. Conversely, an assessment often is made of the ability of a prediction algorithm to classify negatives correctly, a complementary measurement to sensitivity. The term "specificity" as used herein refers to the number of true negatives divided by the number of true negatives plus the number of false positives, where sensitivity (spec) may be within the range of 0 < spec < 1. Ideally, the methods described herein have the number of false positives equaling zero or close to equaling zero, so that no subject is wrongly identified as having an ANRIL- associated disorder when they do not in fact have one. Hence, a method that has both sensitivity and specificity equaling one, or 100%, is preferred.

[0046] "RNAi molecule" or "siRNA" refers to a nucleic acid that forms a double stranded RNA, which double stranded RNA has the ability to reduce or inhibit expression of a gene or target gene when the siRNA expressed in the same cell as the gene or target gene. "siRNA" thus refers to the double stranded RNA formed by the complementary strands. The complementary portions of the siRNA that hybridize to form the double stranded molecule typically have substantial or complete identity. In one embodiment, siRNA refers to a nucleic acid that has substantial or complete identity to a target gene and forms a double stranded siRNA. The sequence of the siRNA can correspond to the full length target gene, or a subsequence thereof. Typically, the siRNA is at least about 15-50 nucleotides in length (e.g., each complementary sequence of the double stranded siRNA is 15-50 nucleotides in length, and the double stranded siRNA is about 15-50 base pairs in length, preferably about 20-30 base nucleotides, preferably about 20-25 nucleotides in length, e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.

[0047] An "antisense" polynucleotide is a polynucleotide that is substantially complementary to a target polynucleotide and has the ability to specifically hybridize to the target polynucleotide.

[0048] The invention also includes genetically modified organisms that over-express or under-express mammalian circular ANRIL. Methods of making genetically modified model organisms for the study of disease are well-known. Examples include US Patent Nos. 4,736,866 (Leder et al. "oncomouse"), 6,187,991 (Soeller et al.), 6,359, 194 (Galvin et al.), 6,909,030 (Melmed and Wang), 7,288,385 (Ma et al), 7,560,610 (Roberts et al); PCT Patent Pubs. WO 1994/021 11 1 (Abraham et al); WO 2003/081996 (Fleischmann et al); WO 2004/072098 (Yang et al), the contents of which are hereby incorporated by reference in their entireties.

[0049] The phrase "functional effects" in the context of assays for testing means compounds that interfere or modulate the function of the circular ANRIL RNAs. This may also be a chemical or phenotypic effect such as altered translation of the circular ANRIL RNAs, or altered activities or the downstream effects cause by the non-coding circular ANRIL RNAs. A functional effect may include transcriptional activation or repression, the ability of cells to proliferate, expression in cells during disease progression, and other characteristics of an ANRIL-associated disorder. "Functional effects" include in vitro, in vivo, and ex vivo activities. By "determining the functional effect" is meant assaying for a compound that increases or decreases the transcription of genes or the translation of proteins that are indirectly or directly under the influence of a circular ANRIL RNA. Such functional effects can be measured by any means known to those skilled in the art, e.g., changes in spectroscopic characteristics (e.g., fluorescence, absorbance, refractive index); hydrodynamic (e.g., shape), chromatographic; or solubility properties for the protein; ligand binding assays, e.g., binding to antibodies; measuring inducible markers or transcriptional activation of the marker; measuring changes in enzymatic activity; the ability to increase or decrease cellular proliferation, apoptosis, cell cycle arrest, measuring changes in cell surface markers. Validation the functional effect of a compound on an ANRIL-associated disease progression can also be performed using assays known to those of skill in the art such as metastasis of cancer cells by tail vein injection of cancer cells in mice. The functional effects can be evaluated by many means known to those skilled in the art, e.g., microscopy for quantitative or qualitative measures of alterations in morphological features, measurement of changes in RNA or protein levels for other genes expressed in cells, measurement of RNA stability, identification of downstream or reporter gene expression (CAT, luciferase, β-gal, GFP and the like), e.g., via chemiluminescence, fluorescence, colorimetric reactions, antibody binding, inducible markers, etc.

[0050] "Inhibitors," "activators," and "modulators" of the markers are used to refer to activating, inhibitory, or modulating molecules identified using in vitro and in vivo assays of either the circular ANRIL RNAs, or the expression of genes or the translation proteins encoded thereby modulated by the circular ANRIL RNAs. Inhibitors, activators, or modulators also include naturally occurring and synthetic ligands, antagonists, agonists, antibodies, peptides, cyclic peptides, nucleic acids, antisense molecules, ribozymes, RNAi molecules, small organic molecules and the like. Such assays for inhibitors and activators include, e.g., (1) measuring levels of the circular ANRIL RNA, or (2) (a) measuring the mRNA expression, or (b) proteins expressed by genes modulated by circular ANRIL RNA in vitro, in cells, or cell extracts; (3) applying putative modulator compounds; and (4) determining the functional effects on activity, as described above.

[0051] Samples or assays comprising genes modulated by circular ANRIL RNA that are treated with a potential activator, inhibitor, or modulator are compared to control samples without the inhibitor, activator, or modulator to examine the extent of inhibition. Control samples (untreated with inhibitors) are assigned a relative activity value of 100%. Inhibition of expression, or proteins modulated by circular ANRIL RNA is achieved when the activity value relative to the control is about 80%, preferably 50%, more preferably 25-0%. Activation of expression, or proteins encoded by genes modulated by circular ANRIL RNA is achieved when the activity value relative to the control (untreated with activators) is 1 10%, preferably 150%, more preferably 200- 500% (i.e., two to five fold higher relative to the control), more preferably 1000-3000% higher. [0052] The term "test compound" or "drug candidate" or "modulator" or grammatical equivalents as used herein describes any molecule, either naturally occurring or synthetic, e.g., protein, oligopeptide, small organic molecule, polysaccharide, peptide, circular peptide, lipid, fatty acid, siR A, polynucleotide, oligonucleotide, etc., to be tested for the capacity to directly or indirectly affect genes modulated by circular ANRIL RNA. The test compound can be in the form of a library of test compounds, such as a combinatorial or randomized library that provides a sufficient range of diversity. Test compounds are optionally linked to a fusion partner, e.g., targeting compounds, rescue compounds, dimerization compounds, stabilizing compounds, addressable compounds, and other functional moieties. Conventionally, new chemical entities with useful properties are generated by identifying a test compound (called a "lead compound") with some desirable property or activity, e.g., inhibiting activity, creating variants of the lead compound, and evaluating the property and activity of those variant compounds. Often, high throughput screening (HTS) methods are employed for such an analysis. The compound may be "small organic molecule" that is an organic molecule, either naturally occurring or synthetic, that has a molecular weight of more than about 50 daltons and less than about 2500 daltons, preferably less than about 2000 daltons, preferably between about 100 to about 1000 daltons, more preferably between about 200 to about 500 daltons.

5.2. Samples

[0053] The sample may be from a patient or a subject suspected of having an ANRIL- associated disorder. The biological sample may also be from a subject with an ambiguous diagnosis in order to clarify the diagnosis. The sample may be obtained for the purpose of differential diagnosis, e.g., a healthy subject to confirm the diagnosis. The sample may also be obtained for the purpose of prognosis, i.e., determining the course of the disease and selecting primary treatment options. Tumor staging and grading are examples of prognosis. The sample may also be evaluated to select or monitor therapy, selecting likely responders in advance from non-responders or monitoring response in the course of therapy. In addition, the sample may be evaluated as part of post-treatment ongoing surveillance of patients who have an ANRIL-associated disorder.

[0054] Samples may be obtained using any of a number of methods in the art. A sample may also be a sample of muscosal surfaces, blood and blood fractions or products (e.g., serum, plasma, platelets, red blood cells, white blood cells, circulating tumor cells isolated from blood, free DNA isolated from blood, and the like), sputum, lymph and tongue tissue, cultured cells, e.g., primary cultures, explants, and transformed cells, stool, urine, etc. Additional examples of biological samples include those obtained from excised skin biopsies, such as punch biopsies, shave biopsies, fine needle aspirates (FNA), or surgical excisions; or biopsy from non- cutaneous tissues such as lymph node tissue, mucosa, conjuctiva, uvea, or other embodiments. The biological sample can be obtained by shaving, waxing, or stripping the region of interest on the skin. Representative biopsy techniques include, but are not limited to, excisional biopsy, incisional biopsy, needle biopsy, surgical biopsy. An "excisional biopsy" refers to the removal of an entire tumor mass with a small margin of normal tissue surrounding it. An "incisional biopsy" refers to the removal of a wedge of tissue that includes a cross-sectional diameter of the tumor. A diagnosis or prognosis made by endoscopy or fluoroscopy can require a "core-needle biopsy" of the tumor mass, or a "fine- needle aspiration biopsy" which generally contains a suspension of cells from within the tumor mass.

[0055] A sample is typically obtained from a eukaryotic organism, most preferably a mammal such as a primate e.g., chimpanzee or human; cow; dog; cat; a rodent, e.g., guinea pig; rat; mouse; rabbit.

[0056] A sample may be treated with a fixative such as formaldehyde and embedded in paraffin (FFPE) and sectioned for use in the methods of the invention. Alternatively, fresh or frozen tissue may be used. These cells may be fixed, e.g., in alcoholic solutions such as 100% ethanol or 3 : 1 methanokacetic acid. Nuclei can also be extracted from thick sections of paraffin-embedded specimens to reduce truncation artifacts and eliminate extraneous embedded material. Typically, biological samples, once obtained, are harvested and processed prior to hybridization using standard methods known in the art. Such processing typically includes protease treatment and additional fixation in an aldehyde solution such as formaldehyde.

5.2.1. Polynucleotide Sequence Amplification and Determination

[0057] The invention is also directed to methods to selectively enrich circular RNAs. Such methods are well-known in the art including: (i) deadenylation enzyme(s) followed by (ii) 3 '-> 5' exonuclease(s); or (i) decapping enzyme(s) followed by (ii) 5'-> 3' exonuclease(s). For a review, see Parker and Song, 2004, Nat. Struct. Mol. Biol. 11(2) 121- 126, the contents of which are hereby incorporated by reference in its entirety. Examples include RNase R available from EPICENTER Biotechnologies, Madison, WI. Alternatively, the nucleic acids of the present invention may be detected by primers or probes specific to the mis-ordered exon junction. In one embodiment a labeled probe, e.g., a biotinylated probe, is used to specifically bind the nucleic acid molecules. The resulting bound nucleic acid molecules may be detected using mass spectrometry or a next generation nucleic acid sequencing technology. In another embodiment, the nucleic acid molecules encoding the circular RNA are detected using two outward facing PCR primers.

[0058] In many instances, it is desirable to amplify a nucleic acid sequence using any of several nucleic acid amplification procedures which are well known in the art. Specifically, nucleic acid amplification is the chemical or enzymatic synthesis of nucleic acid copies which contain a sequence that is complementary to a nucleic acid sequence being amplified (template). The methods and kits of the invention may use any nucleic acid amplification or detection methods known to one skilled in the art, such as those described in U.S. Pat. Nos. 5,525,462 (Takarada et al); 6, 1 14, 117 (Hepp et al); 6, 127,120 (Graham et al); 6,344,317 (Urnovitz); 6,448,001 (Oku); 6,528,632 (Catanzariti et al); and PCT Pub. No. WO 2005/11 1209 (Nakajima et al); all of which are incorporated herein by reference in their entirety.

[0059] In some embodiments, the nucleic acids are amplified by PCR amplification using methodologies known to one skilled in the art. One skilled in the art will recognize, however, that amplification can be accomplished by any known method, such as ligase chain reaction (LCR), Q -replicase amplification, rolling circle amplification, transcription amplification, self-sustained sequence replication, nucleic acid sequence-based amplification (NASBA), each of which provides sufficient amplification. Branched-DNA technology may also be used to qualitatively demonstrate the presence of a circular ANRIL RNA, or to quantitatively determine the amount of this particular nucleic acid in a sample. Nolte reviews branched- DNA signal amplification for direct quantitation of nucleic acid sequences in clinical samples (Nolte, 1998, Adv. Clin. Chem. 33 :201-235).

[0060] The PCR process is well known in the art and is thus not described in detail herein. For a review of PCR methods and protocols, see, e.g., Innis et al, eds., PCR Protocols, A Guide to Methods and Application, Academic Press, Inc., San Diego, Calif. 1990; U.S. Pat. No. 4,683,202 (Mullis); which are incorporated herein by reference in their entirety. PCR reagents and protocols are also available from commercial vendors, such as Roche Molecular Systems. PCR may be carried out as an automated process with a thermostable enzyme. In this process, the temperature of the reaction mixture is cycled through a denaturing region, a primer annealing region, and an extension reaction region automatically. Machines specifically adapted for this purpose are commercially available.

5.2.2. High Throughput and Single Molecule Sequencing Technology

[0061] Suitable next generation sequencing technologies are widely available. Examples include the 454 Life Sciences platform (Roche, Branford, CT) (Margulies et al. 2005 Nature, 437, 376-380); lllumina's Genome Analyzer (Illumina, San Diego, CA); U.S. Pat. Nos. 6,306,597 and 7,598,035 (Macevicz); 7,232,656 (Balasubramanian et al.)); or DNA Sequencing by Ligation, SOLiD System (Applied Biosystems/Life Technologies; U.S. Pat. Nos. 6,797,470, 7,083,917, 7, 166,434, 7,320,865, 7,332,285, 7,364,858, and 7,429,453 (Barany et al); or the Helicos True Single Molecule DNA sequencing technology (Harris et al, 2008 Science, 320, 106-109; U.S. Pat. Nos. 7,037,687 and 7,645,596 (Williams et al); 7, 169,560 (Lapidus et al); 7,769,400 (Harris)), the single molecule, real-time (SMRT™) technology of Pacific Biosciences, and sequencing (Soni and Meller, 2007, Clin. Chem. 53, 1996-2001) which are incorporated herein by reference in their entirety. These systems allow the sequencing of many nucleic acid molecules isolated from a specimen at high orders of multiplexing in a parallel fashion (Dear, 2003, Brief Fund. Genomic Proteomic, 1(4), 397- 416 and McCaughan and Dear, 2010, J. Pathol, 220, 297-306). Each of these platforms allow sequencing of clonally expanded or non-amplified single molecules of nucleic acid fragments. Certain platforms involve, for example, (i) sequencing by ligation of dye-modified probes (including cyclic ligation and cleavage), (ii) pyrosequencing, and (iii) single-molecule sequencing.

[0062] Pyrosequencing is a nucleic acid sequencing method based on sequencing by synthesis, which relies on detection of a pyrophosphate released on nucleotide incorporation. Generally, sequencing by synthesis involves synthesizing, one nucleotide at a time, a DNA strand complimentary to the strand whose sequence is being sought. Study nucleic acids may be immobilized to a solid support, hybridized with a sequencing primer, incubated with DNA polymerase, ATP sulfurylase, luciferase, apyrase, adenosine 5' phosphsulfate and luciferin. Nucleotide solutions are sequentially added and removed. Correct incorporation of a nucleotide releases a pyrophosphate, which interacts with ATP sulfurylase and produces ATP in the presence of adenosine 5' phosphsulfate, fueling the luciferin reaction, which produces a chemiluminescent signal allowing sequence determination. Machines for pyrosequencing are available from Qiagen, Inc. (Valencia, CA). An example of a system that can be used by a person of ordinary skill based on pyrosequencing generally involves the following steps: ligating an adaptor nucleic acid to a study nucleic acid and hybridizing the study nucleic acid to a bead; amplifying a nucleotide sequence in the study nucleic acid in an emulsion; sorting beads using a picoliter multiwell solid support; and sequencing amplified nucleotide sequences by pyrosequencing methodology (e.g., Nakano et al, 2003, J. Biotech. 102, 117- 124). Such a system can be used to exponentially amplify amplification products generated by a process described herein, e.g., by ligating a heterologous nucleic acid to the first amplification product generated by a process described herein.

[0063] Certain single-molecule sequencing embodiments are based on the principal of sequencing by synthesis, and utilize single-pair Fluorescence Resonance Energy Transfer (single pair FRET) as a mechanism by which photons are emitted as a result of successful nucleotide incorporation. The emitted photons often are detected using intensified or high sensitivity cooled charge-couple-devices in conjunction with total internal reflection microscopy (TIRM). Photons are only emitted when the introduced reaction solution contains the correct nucleotide for incorporation into the growing nucleic acid chain that is synthesized as a result of the sequencing process. In FRET based single-molecule sequencing or detection, energy is transferred between two fluorescent dyes, sometimes polymethine cyanine dyes Cy3 and Cy5, through long-range dipole interactions. The donor is excited at its specific excitation wavelength and the excited state energy is transferred, non-radiatively to the acceptor dye, which in turn becomes excited. The acceptor dye eventually returns to the ground state by radiative emission of a photon. The two dyes used in the energy transfer process represent the "single pair", in single pair FRET. Cy3 often is used as the donor fluorophore and often is incorporated as the first labeled nucleotide. Cy5 often is used as the acceptor fluorophore and is used as the nucleotide label for successive nucleotide additions after incorporation of a first Cy3 labeled nucleotide. The fluorophores generally are within 10 nanometers of each other for energy transfer to occur successfully.

[0064] An example of a system that can be used based on single-molecule sequencing generally involves hybridizing a primer to a study nucleic acid to generate a complex; associating the complex with a solid phase; iteratively extending the primer by a nucleotide tagged with a fluorescent molecule; and capturing an image of fluorescence resonance energy transfer signals after each iteration (e.g., Braslavsky et al, PNAS 100(7): 3960-3964 (2003); U.S. Pat. No. 7,297,518 (Quake et al) which are incorporated herein by reference in their entirety). Such a system can be used to directly sequence amplification products generated by processes described herein. In some embodiments the released linear amplification product can be hybridized to a primer that contains sequences complementary to immobilized capture sequences present on a solid support, a bead or glass slide for example. Hybridization of the primer-released linear amplification product complexes with the immobilized capture sequences, immobilizes released linear amplification products to solid supports for single pair FRET based sequencing by synthesis. The primer often is fluorescent, so that an initial reference image of the surface of the slide with immobilized nucleic acids can be generated. The initial reference image is useful for determining locations at which true nucleotide incorporation is occurring. Fluorescence signals detected in array locations not initially identified in the "primer only" reference image are discarded as non-specific fluorescence. Following immobilization of the primer-released linear amplification product complexes, the bound nucleic acids often are sequenced in parallel by the iterative steps of, a) polymerase extension in the presence of one fluorescently labeled nucleotide, b) detection of fluorescence using appropriate microscopy, TIRM for example, c) removal of fluorescent nucleotide, and d) return to step (a) with a different fluorescently labeled nucleotide.

[0065] The technology may be practiced with digital PCR. Digital PCR was developed by Kalinina and colleagues (Kalinina et al., 1997, Nucleic Acids Res. 25; 1999-2004) and further developed by Vogelstein and Kinzler (1999, Proc. Natl. Acad. Sci. U.S.A. 96; 9236- 9241). The application of digital PCR is described by Cantor et al. (PCT Pub. Nos. WO 2005/023091A2 (Cantor et al.); WO 2007/092473 A2, (Quake et al.)), which are hereby incorporated by reference in their entirety. Digital PCR takes advantage of nucleic acid (DNA, cDNA or RNA) amplification on a single molecule level, and offers a highly sensitive method for quantifying low copy number nucleic acid. Fluidigm® Corporation offers systems for the digital analysis of nucleic acids.

[0066] In some embodiments, nucleotide sequencing may be by solid phase single nucleotide sequencing methods and processes. Solid phase single nucleotide sequencing methods involve contacting sample nucleic acid and solid support under conditions in which a single molecule of sample nucleic acid hybridizes to a single molecule of a solid support. Such conditions can include providing the solid support molecules and a single molecule of sample nucleic acid in a "microreactor." Such conditions also can include providing a mixture in which the sample nucleic acid molecule can hybridize to solid phase nucleic acid on the solid support. Single nucleotide sequencing methods useful in the embodiments described herein are described in PCT Pub. No. WO 2009/091934 (Cantor). [0067] In certain embodiments, nanopore sequencing detection methods include (a) contacting a nucleic acid for sequencing ("base nucleic acid," e.g., linked probe molecule) with sequence-specific detectors, under conditions in which the detectors specifically hybridize to substantially complementary subsequences of the base nucleic acid; (b) detecting signals from the detectors and (c) determining the sequence of the base nucleic acid according to the signals detected. In certain embodiments, the detectors hybridized to the base nucleic acid are disassociated from the base nucleic acid (e.g., sequentially dissociated) when the detectors interfere with a nanopore structure as the base nucleic acid passes through a pore, and the detectors disassociated from the base sequence are detected.

[0068] A detector also may include one or more regions of nucleotides that do not hybridize to the base nucleic acid. In some embodiments, a detector is a molecular beacon. A detector often comprises one or more detectable labels independently selected from those described herein. Each detectable label can be detected by any convenient detection process capable of detecting a signal generated by each label (e.g., magnetic, electric, chemical, optical and the like). For example, a CD camera can be used to detect signals from one or more distinguishable quantum dots linked to a detector.

[0069] The invention encompasses any method known in the art for enhancing the sensitivity of the detectable signal in such assays, including, but not limited to, the use of cyclic probe technology (Bakkaoui et ah, 1996, BioTechniques 20: 240-8, which is incorporated herein by reference in its entirety); and the use of branched probes (Urdea et ah, 1993, Clin. Chem. 39, 725-6; which is incorporated herein by reference in its entirety). The hybridization complexes are detected according to well-known techniques in the art.

[0070] Reverse transcribed or amplified nucleic acids may be modified nucleic acids. Modified nucleic acids can include nucleotide analogs, and in certain embodiments include a detectable label and/or a capture agent. Examples of detectable labels include, without limitation, fluorophores, radioisotopes, colorimetric agents, light emitting agents, chemiluminescent agents, light scattering agents, enzymes and the like. Examples of capture agents include, without limitation, an agent from a binding pair selected from antibody/antigen, antibody/antibody, antibody/antibody fragment, antibody/antibody receptor, antibody/protein A or protein G, hapten/anti -hapten, biotin/avidin, biotin/streptavidin, folic acid/folate binding protein, vitamin B 12/intrinsic factor, chemical reactive group/complementary chemical reactive group (e.g., sulfhydryl/maleimide, sulfhydryl/haloacetyl derivative, amine/isotriocyanate, amine/succinimidyl ester, and amine/sulfonyl halides) pairs, and the like. Modified nucleic acids having a capture agent can be immobilized to a solid support in certain embodiments.

[0071] Antibody reagents can be used in assays to detect levels of circular ANRIL RNA in patient samples using any of a number of immunoassays known to those skilled in the art. Immunoassay techniques and protocols are generally described in Price and Newman, "Principles and Practice of Immunoassay," 2nd Edition, Grove's Dictionaries, 1997; and Gosling, "Immunoassays: A Practical Approach." Oxford University Press, 2000. A variety of immunoassay techniques, including competitive and non-competitive immunoassays, can be used. See, e.g., Self et al, 1996, Curr. Opin. Biotechnol, 7, 60-65. The term immunoassay encompasses techniques including, without limitation, enzyme immunoassays (EIA) such as enzyme multiplied immunoassay technique (EMIT), enzyme-linked immunosorbent assay (ELISA), IgM antibody capture ELISA (MAC ELISA), and microparticle enzyme immunoassay (MEIA); capillary electrophoresis immunoassays (CEIA); radioimmunoassays (RIA); immunoradiometric assays (IRMA); fluorescence polarization immunoassays (FPIA); and chemiluminescence assays (CL). If desired, such immunoassays can be automated. Immunoassays can also be used in conjunction with laser induced fluorescence. See, e.g., Schmalzing et al, 1997, Electrophoresis, 18, 2184-2193; Bao, 1997, J. Chromatogr. B. Biomed. Sci., 699, 463-480. Liposome immunoassays, such as flow- injection liposome immunoassays and liposome immunosensors, are also suitable for use in the present invention. See, e.g., Rongen et al, 1997, J. Immunol Methods, 204, 105-133. In addition, nephelometry assays, in which the formation of protein/antibody complexes results in increased light scatter that is converted to a peak rate signal as a function of the marker concentration, are suitable for use in the methods of the present invention. Nephelometry assays are commercially available from Beckman Coulter (Brea, CA) and can be performed using a Behring Nephelometer Analyzer (Fink et al, 1989, J. Clin. Chem. Clin. Biochem., 27, 261-276).

[0072] Specific immunological binding of the antibody to nucleic acids can be detected directly or indirectly. Direct labels include fluorescent or luminescent tags, metals, dyes, radionuclides, and the like, attached to the antibody. An antibody labeled with iodine- 125 ¹²⁵I can be used. A chemiluminescence assay using a chemiluminescent antibody specific for the nucleic acid is suitable for sensitive, non-radioactive detection of protein levels. An antibody labeled with fluorochrome is also suitable. Examples of fluorochromes include, without limitation, DAPI, fluorescein, Hoechst 33258, R-phycocyanin, B-phycoerythrin, R- phycoerythrin, rhodamine, Texas red, and lissamine. Indirect labels include various enzymes well known in the art, such as horseradish peroxidase (HRP), alkaline phosphatase (AP), β- galactosidase, urease, and the like. A horseradish-peroxidase detection system can be used, for example, with the chromogenic substrate tetramethylbenzidine (TMB), which yields a soluble product in the presence of hydrogen peroxide that is detectable at 450 nm. An alkaline phosphatase detection system can be used with the chromogenic substrate p- nitrophenyl phosphate, for example, which yields a soluble product readily detectable at 405 nm. Similarly, a β-galactosidase detection system can be used with the chromogenic substrate o-nitrophenyl-/3-D-galactopyranoside (ONPG), which yields a soluble product detectable at 410 nm. An urease detection system can be used with a substrate such as urea- bromocresol purple (Sigma Immunochemicals; St. Louis, MO).

[0073] A signal from the direct or indirect label can be analyzed, for example, using a spectrophotometer to detect color from a chromogenic substrate; a radiation counter to detect radiation such as a gamma counter for detection of ¹²⁵I; or a fluorometer to detect fluorescence in the presence of light of a certain wavelength. For detection of enzyme-linked antibodies, a quantitative analysis can be made using a spectrophotometer such as an EMAX Microplate Reader (Molecular Devices; Menlo Park, CA) in accordance with the manufacturer's instructions. If desired, the assays of the present invention can be automated or performed robotically, and the signal from multiple samples can be detected simultaneously.

[0074] The antibodies can be immobilized onto a variety of solid supports, such as magnetic or chromatographic matrix particles, the surface of an assay plate (e.g., microtiter wells), pieces of a solid substrate material or membrane (e.g., plastic, nylon, paper), and the like. An assay strip can be prepared by coating the antibody or a plurality of antibodies in an array on a solid support. This strip can then be dipped into the test sample and processed quickly through washes and detection steps to generate a measurable signal, such as a colored spot. The antibodies may be in an array one or more antibodies, single or double stranded nucleic acids, proteins, peptides or fragments thereof, amino acid probes, or phage display libraries. Many protein/antibody arrays are described in the art. These include, for example, arrays produced by Ciphergen Biosystems (Fremont, CA), Packard Bioscience Company (Meriden CT), Zyomyx (Hayward, CA) and Phylos (Lexington, MA). Examples of such arrays are described in the following patents: U.S. Pat. Nos. 6,225,047 (Hutchens and Yip); 6,537,749 (Kuimelis and Wagner); and 6,329,209 (Wagner et al), all of which are incorporated herein by reference in their entirety.

5.2.3. Fluorescence in situ Hybridization (FISH)

[0075] In some embodiments, the invention may further encompass detecting and/or quantitating using fluorescence in situ hybridization (FISH) in a sample, preferably a tissue sample, obtained from a subject in accordance with the methods of the invention. FISH is a common methodology used in the art, especially in the detection of specific chromosomal aberrations in tumor cells, for example, to aid in diagnosis and tumor staging. For reviews of FISH methodology, see, e.g., Weier et al, 2002, Expert Rev. Mol Diagn. 2 (2): 109-1 19; Trask et al, 1991, Trends Genet. 7 (5): 149-154; and Tkachuk et al, 1991, Genet. Anal. Tech. Appl 8: 676-74; U.S. Pat. No. 6,174,681 (Hailing et al); all of which are incorporated herein by reference in their entirety.

[0076] Methods for making nucleic acid microarrays are known to the skilled artisan and are described, for example, in Lockhart et al, 1996, Nat. Biotech. 14, 1675-1680, 1996 Schena et al, 1996, Proc. Natl. Acad. Sci. USA, 93, 10614-10619, U.S. Pat. No. 5,837,832 (Chee et al.) and PCT Pub. No. WO 00/56934 (Englert et al), herein incorporated by reference. To produce a nucleic acid microarray, oligonucleotides may be synthesized or bound to the surface of a substrate using a chemical coupling procedure and an ink jet application apparatus, as described in U.S. Pat. No. 6,015,880 (Baldeschweiler et al), incorporated herein by reference. Alternatively, a gridded array may be used to arrange and link cDNA fragments or oligonucleotides to the surface of a substrate using a vacuum system, thermal, UV, mechanical or chemical bonding procedure.

5.3. Compositions and Kits

[0077] The invention provides compositions and kits for measuring nucleic acids encoding the circular ANRTL RNA. Kits for carrying out the diagnostic assays of the invention typically include, in suitable container means, (i) a probe that comprises an antibody or nucleic acid sequence that specifically binds to the polynucleotides of the invention, (ii) a label for detecting the presence of the probe and (iii) instructions for how to measure the level of the circular ANRTL polynucleotide. The container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe and/or other container into which a first antibody specific for one of the polypeptides or a first nucleic acid specific for one of the polynucleotides of the present invention may be placed and/or suitably aliquoted. Where a second and/or third and/or additional component is provided, the kit will also generally contain a second, third and/or other additional container into which this component may be placed. Alternatively, a container may contain a mixture of more than one antibody or nucleic acid reagent, each reagent specifically binding a different marker in accordance with the present invention. The kits of the present invention will also typically include means for containing the antibody or nucleic acid probes in close confinement for commercial sale. Such containers may include injection and/or blow-molded plastic containers into which the desired vials are retained.

[0078] The kits may further comprise positive and negative controls, as well as instructions for the use of kit components contained therein, in accordance with the methods of the present invention.

5.4. In Vivo Imaging

[0079] The various markers of the invention also provide reagents for in vivo imaging such as, for instance, the imaging of circular ANRIL RNAs using labeled reagents that detect them. In vivo imaging techniques may be used, for example, to detect atherosclerosis. For in vivo imaging purposes, reagents that detect the presence of these proteins or genes, such as antibodies, may be labeled with a positron-emitting isotope (e.g., 18F) for positron emission tomography (PET), gamma-ray isotope (e.g., 99mTc) for single photon emission computed tomography (SPECT), a paramagnetic molecule or nanoparticle (e.g.,Gd³⁺ chelate or coated magnetite nanoparticle) for magnetic resonance imaging (MRI), a near-infrared fluorophore for near- infra red (near-IR) imaging, a luciferase (firefly, bacterial, or coelenterate), green fluorescent protein, or other luminescent molecule for bioluminescence imaging, or a perfluorocarbon- filled vesicle for ultrasound.

[0080] Furthermore, such reagents may include a fluorescent moiety, such as a fluorescent protein, peptide, or fluorescent dye molecule. Common classes of fluorescent dyes include, but are not limited to, xanthenes such as rhodamines, rhodols and fluoresceins, and their derivatives; bimanes; coumarins and their derivatives such as umbelliferone and aminomethyl coumarins; aromatic amines such as dansyl; squarate dyes; benzofurans; fluorescent cyanines; carbazoles; dicyanomethylene pyranes, polymethine, oxabenzanthrane, xanthene, pyrylium, carbostyl, perylene, acridone, quinacridone, rubrene, anthracene, coronene, phenanthrecene, pyrene, butadiene, stilbene, lanthanide metal chelate complexes, rare-earth metal chelate complexes, and derivatives of such dyes. Fluorescent dyes are discussed, for example, in U.S. Pat. Nos. 4,452,720 (Harada et al); 5,227,487 (Haugland and Whitaker); and 5,543,295 (Bronstein et al). Other fluorescent labels suitable for use in the practice of this invention include a fluorescein dye. Typical fluorescein dyes include, but are not limited to, 5- carboxyfluorescein, fluorescein-5-isothiocyanate and 6-carboxyfluorescein; examples of other fluorescein dyes can be found, for example, in U.S. Pat. Nos. 4,439,356 (Khanna and Colvin); 5,066,580 (Lee), 5,750,409 (Hermann et al); and 6,008,379 (Benson et al). The kits may include a rhodamine dye, such as, for example, tetramethylrhodamine-6- isothiocyanate, 5- carboxytetramethylrhodamine, 5-carboxy rhodol derivatives, tetramethyl and tetraethyl rhodamine, diphenyldimethyl and diphenyldiethyl rhodamine, dinaphthyl rhodamine, rhodamine 101 sulfonyl chloride (sold under the tradename of TEXAS RED®, and other rhodamine dyes. Other rhodamine dyes can be found, for example, in U.S. Pat. Nos. 5,936,087 (Benson et al), 6,025,505 (Lee et al); 6,080,852 (Lee et al). The kits may include a cyanine dye, such as, for example, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5, Cy7. Phosphorescent compounds including porphyrins, phthalocyanines, polyaromatic compounds such as pyrenes, anthracenes and acenaphthenes, and so forth, may also be used.

5.5. Methods to Identify Compounds

[0081] A variety of methods may be used to identify compounds that modulate the levels of the circular ANRIL nucleic acids. Typically, an assay that provides a readily measured parameter is adapted to be performed in the wells of multi-well plates in order to facilitate the screening of members of a library of test compounds as described herein. Thus, in one embodiment, an appropriate number of cells can be plated into the cells of a multi-well plate, and the effect of a test compound on expression levels. The compounds to be tested can be any small chemical compound, or a macromolecule, such as a protein, sugar, nucleic acid or lipid. Typically, test compounds will be small chemical molecules and peptides. Essentially any chemical compound can be used as a test compound in this aspect of the invention, although most often compounds that can be dissolved in aqueous or organic (especially DMSO-based) solutions are used. The assays are designed to screen large chemical libraries by automating the assay steps and providing compounds from any convenient source to assays, which are typically run in parallel (e.g., in microtiter formats on microtiter plates in robotic assays). It will be appreciated that there are many suppliers of chemical compounds, including Sigma (St. Louis, MO), Aldrich (St. Louis, MO), Sigma- Aldrich (St. Louis, MO), Fluka Chemika-Biochemica Analytika (Buchs Switzerland) and the like.

[0082] In one preferred embodiment, high throughput screening methods are used which involve providing a combinatorial chemical or peptide library containing a large number of potential therapeutic compounds. Such "combinatorial chemical libraries" or "ligand libraries" are then screened in one or more assays, as described herein, to identify those library members (particular chemical species or subclasses) that display a desired characteristic activity. In this instance, such compounds are screened for their ability to modulate levels of circular ANRIL nucleic acids. A combinatorial chemical library is a collection of diverse chemical compounds generated by either chemical synthesis or biological synthesis, by combining a number of chemical "building blocks" such as reagents. For example, a linear combinatorial chemical library such as a polypeptide library is formed by combining a set of chemical building blocks (amino acids) in every possible way for a given compound length (i.e., the number of amino acids in a polypeptide compound). Millions of chemical compounds can be synthesized through such combinatorial mixing of chemical building blocks.

[0083] Preparation and screening of combinatorial chemical libraries are well known to those of skill in the art. Such combinatorial chemical libraries include, but are not limited to, peptide libraries (see, e.g., U.S. Pat. No. 5,010, 175 (Rutter and Santi), Furka, 1991, Int. J. Pept. Prot. Res., 37:487-493; and Houghton et al, 1991, Nature, 354:84-88). Other chemistries for generating chemical diversity libraries can also be used. Such chemistries include, but are not limited to: U.S. Pat. Nos. 6,075, 121 (Bartlett et al.) peptoids; 6,060,596 (Lerner et al.) encoded peptides; 5,858,670 (Lam et al.) random bio-oligomers; 5,288,514 (Ellman) benzodiazepines; 5,539,083 (Cook et al.) peptide nucleic acid libraries; 5,593,853 (Chen and Radmer) carbohydrate libraries; 5,569,588 (Ashby and Rine) isoprenoids; 5,549,974 (Holmes) thiazolidinones and metathiazanones; 5,525,735 (Takarada et al.) and 5,519, 134 (Acevado and Hebert) pyrrolidines; 5,506,337 (Summerton and Weller) morpholino compounds; 5,288,514 (Ellman) benzodiazepines; diversomers such as hydantoins, benzodiazepines and dipeptides (Hobbs et al, 1993, Proc. Nat. Acad. Sci. USA, 90, 6909-6913), vinylogous polypeptides (Hagihara et al, 1992, J. Amer. Chem. Soc., 1 14, 6568), nonpeptidal peptidomimetics with glucose scaffolding (Hirschmann et al, 1992, J. Amer. Chem. Soc, 114, 9217-9218), analogous organic syntheses of small compound libraries (Chen et al, 1994, J. Amer. Chem. Soc, 1 16:2661 (1994)), oligocarbamates (Cho et al, 1993, Science, 261, 1303 (1993)), and/or peptidyl phosphonates (Campbell et al, 1994, J. Org. Chem., 59:658), nucleic acid libraries (see Ausubel, Berger and Sambrook, all supra); antibody libraries (see, e.g., Vaughn et al, 1996, Nat. Biotech., 14(3):309-314, carbohydrate libraries, e.g., Liang et al, 1996, Science, 274: 1520-1522, small organic molecule libraries (see, e.g., benzodiazepines, Baum, 1993, C&EN, Jan 18, page 33. Devices for the preparation of combinatorial libraries are commercially available (see, e.g., 357 MPS, 390 MPS, Advanced Chem Tech, Louisville, KY; Symphony, Rainin, Woburn, MA; 433 A Applied Biosystems, Foster City, CA; 9050 Plus, Millipore, Bedford, MA). In addition, numerous combinatorial libraries are themselves commercially available (see, e.g., ComGenex (Princeton, NJ), Asinex (Moscow, RU), Tripos, Inc. (St. Louis, MO), ChemStar, Ltd., (Moscow, RU), 3D Pharmaceuticals (Exton, PA), Martek Biosciences (Columbia, MD), etc.).

5.6. Methods of Inhibition Using Nucleic Acids

[0084] A variety of nucleic acids, such as antisense nucleic acids, siRNAs or ribozymes, may be used to inhibit the function of the circular ANRIL RNAs. Ribozymes that cleave mRNA at site-specific recognition sequences can be used to destroy target mRNAs, particularly through the use of hammerhead ribozymes. Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA. Preferably, the target mRNA has the following sequence of two bases: 5'- UG-3'. The construction and production of hammerhead ribozymes is well known in the art. A composition of ribozyme molecules preferably includes one or more sequences complementary to a target mRNA, and the well-known catalytic sequence responsible for mRNA cleavage or a functionally equivalent sequence (see, e.g., U.S. Pat. Nos. 5,093,246 (Cech et al); 5,766,942 (Haseloff et al); 5,856, 188 (Hampel et al) which are incorporated herein by reference in their entirety). Ribozyme molecules designed to catalytically cleave target RNA transcripts can also be used to treat or prevent an ANRIL-associated disorder.

[0085] The following Examples further illustrate the invention and are not intended to limit the scope of the invention.

6. EXAMPLES

[0086] We sought to better determine ANRIL structure and expression in relation to ASVD-SNP genotype and INK4/ARF expression. Toward that end, we performed comprehensive DNA and RNA analyses of ANRIL using RACE and next-generation sequencing in primary and transformed cell lines. We showed that the expression of ANRIL isoforms containing exons 1-2 or 4-6 correlated with ASVD-SNP genotype, however those containing exons 18-19 did not. Surprisingly, we also uncovered circular ANRIL (cANRIL) RNA species whose expression correlated with ASVD-SNP genotype. These new data suggest that the causal variant(s) within 9p21 influence ASVD susceptibility through regulation of ANRIL expression and splicing, leading to differential PcG recruitment and INK4/ARF repression.

6.1. Results

6.1.1. ANRIL transcription produces multiple rare, non-coding RNA species

[0087] Multiple ANRIL isoforms have been proposed based upon the assembly of ESTs and the sequencing of cDNA libraries (See Figure 9). To determine which of these isoforms predominates in vivo, we performed RNA ligase mediated (RLM)-RACE in cell lines and primary human peripheral blood T-lymphocytes (PBTL). In addition to using the RLM procedure to maximize the detection of mRNA transcripts, we employed a high-fidelity Taq polymerase capable of amplifying complex DNAs such as those containing SINE, LINE and Alu elements. Primers for 3' and 5' RACE were designed within exons 1, 2, 4, 6, 9, 13, 16 and 18 of the originally reported transcript, NR_003529 [27], but only primers in exons 4 and 6 selectively amplified ANRIL sequences (data not shown). These amplicons were cloned and sequenced to verify the resulting DNA sequences. Using exon 4 and 6 primers, we identified multiple ANRIL variants, including novel splice isoforms that were not previously reported (Figure 1A, novel exons 10a, 13b). We also detected several transcripts with a peculiar, non-colinear exon sequence, most notably in the HeLa and primary PBTL populations (13-14-4-5, 13-14-4 in Figure 1A). Given that no particular ANRIL isoform appeared to predominate from our RACE data, we exploited the observation that ANRIL RNAs containing exon 15 frequently maintained the canonical exonic structure (e.g., 15-16- 17-18-19). We termed these exons as "distal" because they are located at the 3' end of ANRIL, and those prior to exon 15 as "proximal".

[0088] To examine the absolute abundance of transcripts containing the "proximal" or "distal" exons in a variety of cell types, we developed and validated quantitative TaqMan® primer-probe sets spanning ANRIL exons 1-2, 4-6 and 18-19 (See Materials and Methods and

INK4b

Figure IB). We also quantified the expression of other INK4/ARF transcripts (e.g., pl5

2

and pl6^INK4a, ARF in PBTLs (r =0.32, pO.0001 ; [42]). Importantly, none of these TaqMan® strategies amplify ANRIL exons containing repetitive sequences. Moreover, the products from these assays were gel-purified, cloned and sequenced to verify their identities. Equal amounts of RNA from a panel of 27 primary and transformed cell lines were subjected to reverse transcription using a combination of random hexamer and oligo dT primers. Deletion or methylation of the 9p21 tumor suppressors is a common event in cancer and was observed in 59% of our cell line panel (Figure 11). Even after exclusion of these lines from our analyses, all three ANRIL species (exon 1-2, 4-6 and 18-19) were rare: based on an estimate of 15 pg of total RNA per cell, expression of ANRIL species ranged between 0.01 to 1 copy per cell (Figure IB). For comparison, INK4/ARF expression is considered quite low in

INK4a INK4b

primary cells [43,44], yet pi 6 and pi 5 were more abundant than any ANRIL species in non-transformed Hs68, HUVEC and IMR90 cell lines (on average 155.9±18.9- and 14.5±5.5-fold, respectively; See Figure 11). These data indicate that ANRIL species are readily detectable but non-abundant in a wide variety of cell types.

6.1.2. Central ANRIL exons are weakly detected in cell line and RNA-seq analyses.

[0089] To further characterize 9p21 transcription in a manner unbiased by PCR primer choice, we analyzed publically available, next-generation RNA sequencing (RNA-seq) datasets of oligo dT -primed and reverse transcribed RNA from primary human brain or HeLa cells. ([45]; Genbank Short Read Archive Study ID: SRP002274 and ENCODE RNA-seq replicates, respectively). These datasets were solely chosen based upon the high-depth of sequencing provided (>368 million and >1 10 million reads, respectively), allowing for the study of non-abundant ncRNAs. In accord with the TaqMan-based analyses, reads mapping to ANRIL were rare in both the human brain and HeLa datasets (Figure 2). In fact, the peak

INK4a

height of reads mapping to pl6 was >40 times higher than that of any ANRIL exon, even

IN 4a

though brain expresses low levels of pl6 [44,46]. The level of ANRIL expression detected in both datasets (maximal peak height of 12) was comparable to that of other long, non-coding RNAs including HOT AIR and Kcnqlotl (maximal peak heights of 10 and 18, respectively).

[0090] Intriguingly, by both TaqMan® (Figure IB) and RNA-seq (Figure 2B), we observed a disparity in the number of molecules of each ANRIL exon detected, with those containing the 'central' ANRIL (4-12) exons being the least abundant when averaged across the entire locus. The most prevalent ANRIL peaks localized to the 5' and 3' ends of the transcript (i.e., exons 1-3 and 13-19). The relative excess of the more distal exons might be a consequence of 9p21 deletion, as we observed splicing between MTAP, a gene 100 kb telomeric to the INK4/ARF locus, and the 3' end of ANRIL in RNA-seq datasets from cell lines with INK4/ARF loss (i.e., SUM102 and MCF7, data not shown). Although such MTAP- ANRIL fusions have been previously described [47], using a highly sensitive TaqMan® strategy we only detected these fusions in cell lines with 9p21 deletion, and not in any primary cells or lines with two copies of an intact INK4/ARF locus (data not shown). Therefore, while exon deletions and/or MTAP splicing explain the relative excess transcription of distal ANRIL exons in some cancer cell lines harboring 9p21 deletion, these mechanisms do not explain the decreased transcription of exons 4-12 versus exons 1-3, in any cell line. Likewise, somatic deletions and MTAP splicing do not explain the uniform decrease of the central exons compared to the proximal and distal exons in cultures of primary cells (Figure 11). Together, these RNA-seq and TaqMan® analyses indicate that ANRIL is a rare, multi-variant RNA species in which transcripts containing exons 1-3 or 13— 19 predominate over those containing exons 4-12. Based on these findings as well as the observation of non-colinear RNA species by RACE (Figure 1A), we hypothesized that the reduced level of the central exons (4-12) in mature, polyadenylated RNA may be the result of alternative splicing events in which the central exons of ANRIL are frequently skipped.

6.1.3. Select ANRIL transcripts containing internal exons are circular.

[0091] We observed non-colinear RNA species in RACE analysis of several cell lines and primary cells (Figure 1A). We considered the possibility that this represented alterations of the germline DNA sequence (e.g., duplications or trans vers ions) but found no evidence for this using BreakDancer [48] to analyze next-generation DNA sequencing from 10 individuals. Given that cryptic germline DNA alterations did not appear to explain these non-colinear forms, we considered that non-canonical RNA splicing events such as trans- splicing or re-splicing of RNA lariats might occur as part of ANRIL processing. In the latter case, the splice sites of certain consecutive exons are not recognized by the splicing machinery, resulting in the inclusion of exonic sequences within the RNA lariat [49]. Internal splicing of this exon-containing lariat structure may then occur, leading to the production of exon-only RNA circles in which nonconsecutive exon junctions are generated by splicing across the branch site (e.g., exon 13-14-4-5).

[0092] To determine the structure of such non-colinear ANRIL RNAs, we designed and validated a TaqMan® strategy using outward facing primers to detect transcripts containing the non-colinear exon 14-5 junction (Figure 3 A). This detection scheme was chosen based upon preliminary PCR studies wherein amplification of the 14-5 splice junction predominated over that of the exon 14-4 junction. As lariat or circular RNAs would not be polyadenylated, we assayed the amount of each ANRIL species detected in RNA samples reverse transcribed with random hexamers (HEX), oligo dT (dT) or both (Figure 3B). As would be expected for polyadenylated RNAs, conversion of ANRIL1-2, ANRIL18-19,

INK4a

pl6 and pl5^1NK4b into cDNA was efficiently accomplished with either oligo dT or HEX primers alone. Conversely, ANRIL4-6 and 14-5 were effectively primed with HEX but not oligo dT, confirming that these transcripts were not polyadenylated.

[0093] To further examine the structure of these non-canonical transcripts, we determined transcript sensitivity to the RNA exonuclease, RNAse R. RNAse R specifically digests both structured and non-structured linear RNAs, but spares RNA circles and lariats [50]. Using equal amounts of RNA from normal and immortalized human fibroblasts (IMR90 and Hs68, respectively) treated with or without RNAse R, we generated cDNA and conducted TaqMan® analysis for ANRIL expression. As expected for linear species, RNAse R

INK4a INK4b treatment caused a marked reduction in the number of pi 6 and pi 5 transcripts detected (4.5- and 8.4-fold decrease, respectively), demonstrating that these coding transcripts are predominantly linear (Figures 3C and 3D). In contrast, we observed a 6-fold enrichment of ANRIL14-5 molecules with RNAse R treatment, confirming their circular nature. We were surprised to find that ANRIL4-6 expression also exhibited RNAse R- dependent enrichment in both cell lines. ANRIL1-2 levels decreased consistent with a predominantly linear species, and ANRIL18-19 demonstrated an intermediate behavior consistent with a mix of linear and circular forms (Figures 3C and 3D). Together, these data provide evidence that ANRIL4-6 and 14-5 are predominantly contained within non- polyadenylated, circular (or lariat) ANRIL (cANRIL) transcripts.

6.1.4. Circular ANRIL species are observed in a wide variety of cell types.

[0094] Based upon analysis of non-sequential cDNA and EST sequences, stable RNA circles have been hypothesized to represent <1% of the total transciptome [51]. To determine the ubiquity of cANRIL RNAs, we employed the Taqman-based strategy shown in Figure 3 A. Using this method, we observed amplification of ANRIL14-5 in 16 of 20 ANRIL expressing primary cultures and cell lines (Figure 12). The finding of cANRIL in diverse cell types is perhaps surprising given the low abundance of ANRIL transcripts and that RNA lariats are usually unstable intermediates which undergo rapid degradation. These data suggest that cANRIL is a stable, naturally occurring, circular RNA species produced in most INK4/ARF expressing cells.

[0095] To better define the structure of cANRIL RNAs, we used outward-facing primers located in five ANRIL exons to amplify cDNA produced using a mix of random hexamers and oligo dT (Figure 4A). In Hs68 and IM90 cells, PCR products specific to 9p21 were detected using primer sets targeting exons 4 and 6. These products were more efficiently amplified using cDNAs from RNase R-treated samples, suggesting that they arose from circular RNAs. In contrast, PCR products specific to chromosome 9 were not detected using primers internal to exons 1 and 18, and only detected in one instance with primers internal to exon 16, suggesting these exons were not commonly included in stable, circular ANRIL species. To determine the contents of the circular transcripts containing ANRIL exons 4 and 6, we cloned and sequenced the observed PCR products. The resulting sequences predominantly included ANRIL exons 4 to 14. Several exons were never observed in the looped structures (i.e., exons 1, 2, 3, 8, 9, 11, and 12) (Figures 4B and 4C). Novel sequences were also discovered within the products, most notably, regions intronic to the previously described ANRIL transcript (i.e., parts of intron 3). These data explain the paucity of expression of ANRIL exons 4 to 14 as determined by TaqMan® and RNA-seq (Figures IB and 2B), suggesting that ANRIL processing may involve exon skipping events which preferentially incorporate the central exons into lariats which may then be internally spliced to form cANRIL.

6.1.5. Expression of cANRIL and proximal ANRIL species correlate with INK4/ARF expression and ASVD-associated SNP genotype.

[0096] We have previously shown [42] a correlation between expression of the coding INK4/ARF transcripts and ANRIL4-6. We now recognize that the latter is largely contained in circular RNA species (Figures 3B and 3C). Next, we investigated correlations between other, newly identified ANRIL isoforms and the coding INK4/ARF transcripts (Figures 5 A and 13). We performed Taqman-based gene expression analyses in 106 primary human peripheral blood T-lymphocyte (PBTL) samples from two previously published cohorts [16,42]. Remarkably, cANRIL expression (ANRIL14-5 and ANRIL4-6) was observed in all PBTL samples. Expression of ANRIL18-19 did not correlate with any other ANRIL or INK4/ARF transcript (Figure 5A). In contrast, a strong correlation was observed between the expression

-15

of ANRIL4-6 and all of the INK4/ARF tumor suppressors (p< 1 * 10 for all pair-wise comparisons). Significant associations (p<0.05) were also observed between ANRIL1-2 and ARF, and between ANRIL 14-5 and pl6^INK4a.

[0097] We have also demonstrated an effect of a replicated SNP associated with atherosclerosis (rs 10757278) on the expression ipl5^INK4b , pl6^INK4a, ARF and ANRIL4-6 in PBTLs [16]. We therefore examined whether expression of other ANRIL isoforms correlated with ASVD SNP genotype (Figure 5B). While no significant correlation between ANRIL 18- 19 with SNP genotype was noted, expression of ANRIL 1-2 and ANRIL 14-5 showed significantly decreased expression in individuals harboring the risk (G) allele (pO.0001 and p<0.04, respectively). In aggregate, these data demonstrate that expression of both circular and linear transcripts containing the proximal but not distal ANRIL exons correlates with ASVD-SNP genotype and expression of the coding I K4/ARF transcripts.

6.1.6. Deep sequencing of the ASVD risk interval reveals ANRIL exon 15 variants predicted to influence cANRIL production.

[0098] We performed next-generation DNA sequencing of the ASVD-risk interval to identify polymorphisms that might influence ANRIL expression or splicing. To enhance detection of rare variants, we pooled DNA from 5 individuals of Asian and European descent who were homozygous for either the A or G allele of rsl0757278. To increase the chance that the analyzed DNAs would harbor causal variants that influence INK4/ARF expression,

INK4a

we selected individuals based on their age-adjusted expression οΐρΐό (i.e., AA donors with higher than average expression, GG donors with lower than average expression [16]). We performed sequence capture using an Illumina tiling array on the AA vs. GG pooled samples. The tiling array was designed to bind all non-repetitive human chromosome 9 regions from 22,054,888 to 22,134, 171 bp, a region chosen as it contains the previously identified ASVD and type 2 diabetes mellitus risk intervals (Figure 6A). The 9p21 enriched DNA was sequenced using both Roche 454 (400 bp reads) and Illumina GAII (35 bp reads) technologies. The resulting sequences were aligned to the UCSC reference genome (hgl 8) using three separate alignment algorithms: gsMapper, BWA and SOAP [52,53]. As shown in Figure 6B, SOAP identified the highest number of polymorphisms within each pooled sample; however, many of these were not recapitulated using other mapping techniques. Thus, for further analysis we focused our efforts on polymorphisms which were identified by at least two mapping algorithms. Employing these criteria, we discovered 101 SNPs that differed from the reference genome within our samples: 11 in the AA pool, 64 in the GG pool, and 26 in both (Figure 6C). As expected, more differences from the reference genome were identified in the GG sample, as the reference genome harbors the A allele, and most SNPs in the captured region are in moderate to strong linkage disequilibrium with rsl0757278 (Figure 8A, 8B, 8C). Therefore, using next generation sequencing of captured DNA from 10 informative individuals biased to harbor causal variants, the chosen sequencing approach found 75 (1 1 + 64) SNPs that differed between the two pooled samples.

[0099] Given the finding that cANRIL expression correlates with rs 10757278 genotype, we sought to determine if any of the identified SNPs might influence ANRIL splicing. For this analysis, we restricted the SNP list to include only those within 200 bp of an ANRIL intron-exon boundary, as genetic alterations in this region have the highest potential to influence RNA splicing [54]. Of the 75 SNPs present in only one of the two pooled samples, four were within 200 bp of an ANRIL intron-exon boundary (Figure 6C, Table 1). Using previously described prediction algorithms [54,55], we determined the likelihood of these variants near intron-exon boundaries to change cz^'s-regulatory splice elements including exon splicing enhancers (ESEs) and silencers (ESSs) as well as intronic splicing enhancers (ISEs) and silencers (ISSs). A score of -1 indicates that the minor allele destroys one cz^'s-element and +1 indicates that the minor allele creates one cz^'s-element (Table 1). ESEs and ISEs favor exon recognition by the spliceosome when they occur in exons or introns, respectively. However, ISSs and ESSs promote exon skipping irrespective of position [56]. A pair of SNPs (rs34660702 and NOVEL) 10 bp apart near the start of exon 12 were predicted to alter ANRIL splicing, but the effects of these SNPs worked in opposite directions, and both exhibited low frequencies in the CEU population (Figure 6C and Table 1). More provocatively, we also observed two SNPs (rs7341786 and rs7341791) in strong linkage disequalibrium with rsl0757278 and which bracketed exon 15. These SNPs demonstrated high minor allele (CC and GG, respectively) frequencies and with the major allele of both SNPs enhancing the "exon-ness" of exon 15. These results indentify common, linked SNPs whose major allele is likely to inhibit skipping of exon 15 and thereby promote the production of cANRIL species ending in exon 14 in individuals homozygous for the A (protective) allele of rs 10757278.

[00100] Due to the small number of pooled individuals for sequencing (n=5/group), we also sought to identify additional, rare polymorphisms with the potential to modulate ANRIL splicing. We analyzed all SNPs reported in the HapMap database in the chromosome 9 region 22,054,888 to 22,134, 171 within 200 bp of ANRIL intron-exon boundaries for their potential to alter RNA splicing in cis-. Using this method, we identified 31 additional SNPs in HapMap that modified ESE, ESS, ISE or ISS sequences (Table 1). Notably, the majority of these variants were rare and almost never reported in the CEU population [57]. Therefore, among all of the SNPs examined from the ASVD-risk interval, rs7341786 and rs7341791 appear most likely to influence ANRIL splicing. These SNPs are also in very strong linkage

2

disequilibrium with the ASVD-associated SNP, rsl0757278 (r >0.96, based upon the nearest database SNPs in CEU), and therefore would be expected to correlate with ANRIL and INK4/ARF expression. However, it is important to note that other classes of germline variants (e.g., complex insertion or deletion mutations, or alterations in repetitive elements) would not have been identified by our sequencing strategy, and therefore we are unable to exclude a role for other such variants in ANRIL expression and/or splicing.

6.2. DISCUSSION

[00101] Motivated by the role of other long, non-coding RNAs in PcG repression, we investigated whether ANRIL transcription and/or structure was SNP-dependent. In primary and cultured cell lines, we used RACE and RNA-seq to identify novel ANRIL variants (Figures 1 and 2). Intriguingly, the central ANRIL exons were underrepresented in these data (Figures IB and 2B). This observation, along with non-colinear products detected by RACE, led to the unexpected discovery of multiple circular RNAs emanating from the ANRIL locus. Sequencing of these circular species showed non-sequential linkages between various ANRIL exons, especially those from the central portion of the transcript (e.g., exons 4-14) (Figures 4B and 4C). Expression of both circular and linear ANRIL isoforms proximal to the INK4/ARF locus strongly correlated with INK4/ARF transcription and the ASVD risk genotype at rs 10757278 (Figures 5 and 8A-8C). In contrast, distal ANRIL variants containing exons 18 and 19 were expressed in a genotype-independent manner and did not correlate with the levels of any INK4/ARF transcript. Using next-generation sequencing to genotype captured DNA from the ASVD risk interval, we identified a common pair of linked SNPs near exon 15 predicted to influence ANRIL splicing (Figure 6 and Table 1). Together, these findings suggest that common polymorphisms in the ASVD-risk interval could modulate ANRIL transcription and/or splicing, thereby influencing PcGmediated INK4/ARF repression and atherosclerosis susceptibility.

6.2.1. ANRIL Encodes Multiple, Non-abundant Linear and Circular Species

[00102] Multiple ANRIL isoforms have been reported in the literature and EST databases, with some exhibiting differential expression patterns and SNP associations (Figures 8A-8C and 9 and [28,29]). Using RACE, RNA-seq and sensitive quantitative real-time PCR techniques, we now show that no single ANRIL species predominates in vivo, and that splicing to MTAP does not occur in cells with an intact 9p21 locus. Moreover, our analyses identified new ANRIL exons and variants, uncovering a novel group of circular ANRIL (cANRIL) species (Figure 4). Using independent approaches, we found that all ANRIL exons were expressed at very low levels, orders of magnitude lower than even the relatively rare

INK4b INK4a

INK4/ARF tumor suppressors, pi 5 and pi 6 (Figures IB, 2B and 11) . This low level of expression is comparable to what we observed for other regulatory non-coding RNAs (i.e., HOTAIR and Kcnqlotl) associated with PcG-mediated repression. [00103] The discovery of non-colinear ANRIL species whose expression correlated with INK4/ARF transcription suggested that alternative splicing events might modify ANRIL structure leading to changes in PcG-mediated INK4/ARF repression. There are two major mechanisms by which non-colinear RNAs are thought to arise: iraws-splicing and exon skipping [58]. During iraws-splicing, a Y-branched RNA structure is formed that is sensitive to RNase R digestion [50]. In contrast, exon skipping events generate large lariat structures, which can then undergo cis splicing to create RNase R-resistant circular RNAs. To confirm the circular nature of the ANRIL species, we showed that transcripts containing ANRIL4-6 and 14-5 were resistant to RNase R degradation, were not polyadenylated and could be PCR amplified using sets of outward facing primers (Figures 3 and 4). Therefore, cANRIL species appear to result from exon skipping events occurring during RNA splicing.

6.2.2. INK4/ARF Regulation and ASVD Genotype

[00104] Based on these observations, we propose a model suggesting that common polymorphisms in 9p21.3 modifiy INK4/ARF gene expression through cis -regulation of ANRIL transcription and/or splicing (Figure 7). In turn, such changes in ANRIL levels or structure influence the ability of these ncRNAs to repress the INK4/ARF locus. Specifically,

INK4b INK4a

changes in PcG-mediated repression of pl5 , pl6 and/or ARF occur, altering potentially atherogenic cellular proliferation and ASVD risk as previously suggested [16- 20,26].

[00105] Prior studies provide evidence for this model. For example, we and others have described an effect of ASVD-genotype on ANRIL transcription [16,30,59,60]. Moreover, meticulous allele-specific expression analyses by Cunnington et al. suggested that the cis- effects of 9p21 SNPs were stronger for ANRIL than for the coding INK4/ARF transcripts (20% vs. <8%)[60]. In contrast, the effect of these SNPs on expression of the coding INK4/ARF transcripts predominantly occurred in trans-. Such findings are consistent with our model whereby causal variants directly influence ANRIL structure in cis-, thereby controlling repression of the INK4/ARF locus, possibly in trans- (Figure 7). Likewise, recent work has supported a role for ncRNAs in INK4/ARF repression. Knockdown of the RNA helicase, MovlO, led to INK4/ARF deregulation, suggesting a role for RNA metabolism in regulation of the locus [61]. Supporting these data, Yap et al. recently demonstrated that the 5' end of ANRIL contains stem-loop structures capable of binding CBX7, a member of the PRC-1 complex [62]. Disruption of this interaction led to premature senescence marked by increased INK4/ARF expression. Therefore, strong evidence supports the notion that ANRIL expression correlates with ASVDSNP genotype and that PcG-mediated repression of the INK4/ARF locus is modulated by this expression.

[00106] The outstanding question of this model is the biochemical mechanism whereby causal variants at 9p21.3 located more than 100 kb distant from the proximal exons of ANRIL (Figure 8A-8C) modulate ANRIL expression and/or structure. Our data are consistent with a "transcriptional model" wherein distal cz^'s-regulatory elements within the ASVD risk interval directly influence ANRIL transcription. Jarinova et al. have identified an enhancer sequence within ANRIL intron 17, which in heterologous reporter assays, enhanced transcription in a genotype-specific manner [30]. Consistent with this view, we also observed a significant effect of ASVD-SNP genotype on the expression of the linear ANRIL1-2 transcript (Figure 5B). As such, the correlation of cANRIL expression with ASVD-SNP genotype would presumably reflect passive production of these circular species in the setting of increased or decreased in total ANRIL transcription. However, this model would not easily explain the positive correlation we observed between the expression of coding INK4/ARF transcripts and proximal ANRIL exons (Figures 5 A and 13), as the 5 'end of ANRIL is reported to foster INK4/ARF repression [62].

[00107] Alternatively, we believe our present data are more consistent with a "splicing model" in which causal variants in the ASVD risk interval influence ANRIL splicing by regulating exon skipping. Provocatively, the ASVD risk interval includes exon 15 where the termination of most exon skipping events that produce cANRIL occur (Figures 4B, 4C). Using next-generation sequencing of this region in individuals biased to harbor causal variants, we identified exon 15 SNPs (rs7341786 and rs7341791) which are in strong linkage

2

disequilibrium with the ASVD-associated SNP rs 10757278 (r >0.96; Table 1). These polymorphisms have high minor allele frequencies in our sample and the CEU population and are predicted to alter ANRIL splicing (Figure 6, Table 1). In particular, the major allele ('Α') of rs7341786, detected only in individuals homozygous for the A-allele at rsl0757278, is predicted to increase the strength of exon 15 as a splice acceptor, which would promote the expression of spliced RNA circles ending in exon 14, as observed (Figures 4B, C).

[00108] For the splicing model to explain the observed positive correlation between the expression of ANRIL and the coding INK4/ARF transcripts, distinct species of ANRIL would need to differ in their ability to repress the INK4/ARF locus. Supporting this possibility, PcG- mediated repression of the murine Kcnql locus is dependent upon the length of the long, ncRNA, Kcnqlotl [63,64]. Specifically, longer Kcnqlotl transcripts are associated with increased PcG recruitment and Kcnql silencing potential. Therefore, shorter ANRIL variants (i.e. those lacking exons 4-16) generated by exon skipping events may also be less efficient at repressing the INK4/ARF locus. Important predictions of the splicing model are that cANRIL expression (reflecting ANRIL splicing) should correlate with INK4/ARF expression (which it does, Figures 5A and 13), that individuals homozygous for the 'A' allele of rs7341786 (and rsl0757278) should exhibit increased production of cANRIL species containing exon 14 but not exon 15 (which they do, see Figure 4B, C) and that these individuals with increased propensity for splicing should exhibit de-repressed INK4/ARF expression (which they do, [16]).

[00109] A caveat to the splicing model is that the identified exon 15 SNPs need not be the true causal variant(s) influencing ANRIL splicing. It is possible that other polymorphisms not detected by our sequencing strategy could regulate ANRIL splicing. In particular, the sequencing strategy employed would not find differences between the pooled samples in

th

repetitive regions, such as the large LINE element in the 12 intron of ANRIL (Figure 6A). ANRIL harbors several LINE and SINE elements, and such repetitive motifs have been reported to modulate RNA splicing in other systems [65,66]. Therefore, while the exon 15 SNPs appear to be prime candidates to regulate ANRIL splicing, a variety of other classes of polymorphisms could also influence splicing and would not have been observed by the chosen sequencing approach.

[00110] Importantly, the splicing and transcriptional models are not mutually exclusive. A single causal variant may influence both processes or there may be multiple causal variants that influence either process within the ASVD risk interval. Finally, while we believe the correlation of cANRIL expression and ASVD-SNP genotype is most likely explained by an effect of common 9p21 polymorphisms on transcription and/or splicing, a third possibility also exists. While circular RNA byproducts of exon skipping have generally been regarded as inconsequential, circular RNAs with catalytic activities (e.g. group I and some group II introns) are well described in bacteria, lower eukaryotes, plants [67]. In addition, some viroids and the hepatitis delta satellite virus have circular RNA genomes [68,69]. Although we are not aware of any endogenously produced circular RNA with discrete function in mammals, clearly circular RNAs species can possess independent functions in non- mammalian species, and we remain open to the possibility that cANRIL itself can directly participate in INK4/ARF regulation. [00111] In summary, this work links ASVD-genotype to ANRIL structure and INK4/ARF regulation, providing evidence for what we believe is a first association between endogenous circular RNA expression and a mammalian phenotype (ASVD). Even were cANRIL expression merely a marker of exon skipping with no specific biologic function, we believe its expression may be a useful marker of ANRIL isoform selection, which our findings suggest is of pathogenic relevance to ASVD susceptibility. We believe this work has implications beyond ASVD, as altered ANRIL splicing could influence INK4/ARF expression, explaining the association of other nearby 9p21 SNPs with a variety of non-ASVD phenotypes in humans including longevity, type 2 diabetes, endometriosis and several tumors types [70-77].

6.3. MATERIALS AND METHODS

6.3.1. Ethics Statement

[00112] Research involving human subjects was approved by the University of North Carolina Institutional Review Board and all participants provided informed, written consent.

6.3.2. Cell Lines and Culture Conditions

[00113] WM266-4, UACC 257, A2058, A375, SUM-149, RRMI-8322 and telomerized Hs68 cells were obtained and grown as previously described [78-80]. MDA-MB-468, MDA- MB-436, MDAMB-231, MCF7, BT-474, BT-549, T-47D, COLO 205, T84, LoVo, LS 174T, SW480, LS 1034, HeLa, HUVEC, IMR90, Ramos, Raji, Jurkat and U-87 cells were originally obtained from ATCC and cultured as suggested.

6.3.3. 3' and 5' Rapid Amplification of cDNA ENDS (RACE)

[00114] CD3 positive T-cells were isolated from human peripheral blood samples as previously described [42]. RNA was generated from proliferating cell lines and isolated human T-cells using the RNAeasy system (Qiagen Inc., Valencia, CA). 3 ' and 5' RACE was performed as described in the Firstchoice RLM-RACE manual (Ambion Inc., Austin, TX). This procedure is optimized for the detection of rare transcripts and provides additional steps to improve the specificity of mRNA amplification. Gene-specific primers were designed within ANRIL exons 4 and 6 as shown in Figure 1A and Table 2; RACE primers for other ANRIL exons tested did not amplify chromosome 9 specific products. All PCR reactions were conducted using SuperTaq-Plus (Ambion) in a Bio-Rad DNA Engine thermocycler. SuperTaq-Plus is a high fidelity, long range polymerase with the capability to amplify complex DNAs such as repetitive SINE, LINE and Alu elements. Cycling conditions for 5'RACE were: 94°C 3 min, 34 x [94°C 30s, 60°C 30s, 68°C 3 min], 68°C 5 min (inner reaction) and 94°C 3 min, 34 x [94°C 30s, 62°C 30s, 68°C 3 min], 68°C 5 min (outer reaction). Cycling conditions for 3 'RACE were: 94°C 3 min, 34 x [94°C 30s, 57 or 60°C 30s, 68°C 3 min] (outer reaction) and 94°C 3 min, 34 x [94°C 30s, 60°C 30s, 68°C 3 min] (inner reaction). Cloning of the resulting PCR products was conducted using the TOPO-Blunt cloning kit (Invitrogen). Sequencing of the resulting clones was conducted using both M13F and M13R primers.

6.3.4. Quantitative Real-time PCR (qRT-PCR)

[00115] RNA was isolated using the Qiagen RNAeasy Kit and subjected to reverse transcription using the ImPromll reverse transcription system (Promega, Madison, WI). RNA samples from breast and colorectal cell lines were kindly provided by Drs. N. Mitin and J. Yeh (U C). TaqMan® primer and probe sets for the detection of ANRIL exons 1-2, 4-6,

14-5, and 18-19 as well as those for pl5 , pl6^INK4a, ARF and 18S rRNA are described in Table 2. The ANRIL primer sets were designed to span at least one intron and were shown to have high specificity with linear amplification efficiencies between 88 and 94% (Figure 10). Final primer and probe concentrations were 900 and 250nM, respectively. Products from the ANRIL 1-2, 4-6, 14-5 and 18-19 qRT-PCR reactions were cloned separately into the pBluntll- TOPO vector (Invitrogen) and verified. Real-time PCR was carried out in triplicate on an ABI 7900HT thermocyler.

[00116] For relative expression studies, differentials were first calculated between each sample and the average 18S cycle threshold (Ct) for the entire experiment. Transcript Ct values were normalized using the equation: Expression = Lower limit of detection (37 or 40) - (Ct target - Ct 18S differential) and plotted on a log2 scale. The relative expression of

INK4a

pi 6 , pi 5 ⁷ , ARF and ANRIL4-6 in PBTLs has been previously reported [42]; in this work, these same samples were reanalyzed for ANRILI-2, ANRILI4-5 and ANRILI8-I9 expression as shown in Figures 5 and 15. In Figures 5 and 13, data was corrected to account for batch effects between the pilot and verification datasets previously described [42]. To determine the absolute number of transcripts present, a standard curve of five dilutions was generated for each experimental plate using known amounts of linearized plasmid containing the target sequence. The number of molecules detected in each sample was calculated using the equation: #Molecules = 10^A((Ct - yintercept)/slope). Primer efficiencies were calculated using the equation: Efficiency = ( 10^Λ(1 /slope))- 1. Multiple comparison plots and statistical analysis appearing in Figures 5A and 13 was performed using the gpairs function of the R YaleToolkit library. 6.3.5. Analysis of RNA-seq Data

[00117] A total of 368,846,235 reads generated on the Illumina platform (study SRP002274) were downloaded from the NCBI Short Read Archive. The reads were first screened for unique 20mers deriving from chromosome 9:21,700,000-22,300,000 using the UCSC genome browser Duke uniqueness mapability table. The resulting reads were mapped using the TopHat spliced aligner (PMID: 19289445) to the reference human genome (hgl 8). The resulting coverage plot was imported into the UCSC genome browser for display. Also analyzed were two independent CalTech ENCODE mRNA-seq datasets (http://bit.ly/af3P4c) from HeLa cells. These datasets were chosen because they lacked deletion of 9p21 and showed the highest level oiANRIL expression of any publically available RNA-seq data we analyzed. For Figure 2B, the peak number of reads at a given base (SRP002274 data) or peak reads per kilobase mapping (CalTech HeLa data) were quantified and scaled relative to the average exonic coverage.

6.3.6. RNase R Digestion

[00118] Total RNA was isolated from proliferating Hs68 and IMR90 cells using a Qiagen RNAeasy kit. Equal amounts of RNA (43-50 μg, depending on the experiment) were incubated with or without 40U of Rnase R (RNR07250, Epicentre Biotechnologies) for 2.5 hours at 37°C. The resulting RNA was purified using the RNAeasy column and quantified. Equal amounts of RNA were then subjected to reverse transcription using the ImPromll reverse transcription system and a mixture of random hexamer and oligo dT primers (Promega, Madison, WI). Transcripts were quantified using Taqman-based real-time PCR.

6.3.7. Loop PCR

[00119] PCR primers pointing in opposite directions on ANRIL exons 1, 4, 6, 13, 16 and 18 were designed using Primer3 software and analyzed for hairpins using Netprimer (Premier Biosoft and http://frodo.wi.mit.edu/primer3/) (Table 2). PCR reactions were conducted using cDNA representing 15ng of mock or Rnase R-treated RNA. Reactions were performed using Apex Hot Start Taq DNA polymerase and Buffer 2 (Genesee Scientific) in a Bio-Rad DNA Engine thermocycler. The cycling conditions were as follows: 95°C 15 min, 40 x [94°C 30s, 59°C 30s, 72°C 1 min], 72°C 2 min. The resulting PCR products were cloned into the TOPO-Blunt cloning kit (Invitrogen) and sequenced using M13F and M13R primers.

6.3.8. Sequence Capture and Next-Generation Sequencing

[00120] Genomic DNA was generated from T-cells of healthy human volunteers of known

INK4a

rsl0757278 genotype, age and pl6 expression status using the Qiagen Peripheral Blood DNA isolation kit. For sequence capture, 2 lug of DNA was pooled from five individuals homozygous for the G-allele of rs 10757278 and another five individuals homozygous for the A-allele. Samples were sent to NimbleGen for sequence capture using a tiled array spanning human chromosome 9 (22,054,888-22, 134, 171). The resulting amplified DNA fragments were analyzed at the UNC Genome Analysis Facility using both Illumina GAII and Roche 454 technology. For sequencing on the Illumina platform, DNA was randomly sheered and appropriate adapters ligated. Resulting sequences were aligned to the entire human genome (hgl8) using MAQ, SOAP, and gsMapper software [52,53]. MAQ was run with default settings and output was translated into BAM format. SOAP alignment was performed allowing up to 10 gap bases and 2 mismatches and also translated into BAM format. Mapping with gsMapper was performed with default settings. SNP calls from MAQ and SOAP were generated using the pileup function of the SAMtools library [81]. Calls were culled to include only those SNPs appearing in > 20 percent of reads.

[00121] Table 1. Splice site analysis of polymorphisms in the ASVD risk interval near ANRIL exon-intron boundaries. SNPs within 200bp of an ANRIL inton-exon boundary were analyzed for their effects on putative exon splicing enhancer (ESE), exon splicing silencer (ESS), intron splicing enhancer (ISE), and intron splicing silencer (ISS) sequences as described ([56,57] and Z. Wang unpublished data). A score of -1 indicates that the minor allele destroys one cis-element and +1 indicates that the minor allele creates one cis-element. SNPs identified as unique to the AA or GG samples using sequence capture are shown in bold. Those identified in the HapMap database are depicted in black. The position of each intronic SNP relative to the nearest ANRIL exon is given under the 'ANRIL Position' column. Exonic SNPs in this column, list the exon in which they occur. If available, the minor allele frequency from Utah residents with ancestry from northern and western Europe (HapMap3, CEU) is given in the 'CEU Minor Allele' column. H- Hapmap3; GG- individuals homozygous for the 'G' allele at rsl0757278.

SNP ANRIL pos. Chr9 pos. UC Obs. CEU SN ESE ESS ISE/ISS

sc minor P

Ref Allele Oh

rs35368490 Ex13a 22,082,425 G C/G - H -1 rs7870178 Ex 13a +95 22,082,551 G A/G - H +1 +1 rs72652448 Ex13 +77 22,086,590 G A/G - H -2 rs72652449 Ex13 +87 22,086,600 G A/G - H -2 rs72652451 Ex14 -16 22,087,241 C C/G - H -1

rs73438867 Ex14 +73 22,087,436 T G/T - H +1 +1 +2 rs72654239 Ex15 +157 22,102,551 G G/T - H -1 +2 rs73441204 Ex16 -159 22,103,506 A A/G - H -1 +1 +1 rs72654244 Ex16 22,103,780 G C/G - H -1

rs72654245 Ex16 +107 22,103,905 G C/G - H -1 rs 16905652 Ex16 +126 22,103,924 T A/T 0.00 H +1 -1 rs72654246 Ex16 +130 22,103,928 A A/T - H +1 +1 rs73650051 Ex16 +159 22,103,957 A A/G - H -3 -1 rs4977758 Ex17 -162 22,108,481 T A/T 0.00 H -1 +1 rs72654267 Ex17 -124 22,108,519 A A/G - H +1 rs4977759 Ex17 +119 22,108,885 T C/T - H -1 -1 rs73441286 Ex18 -156 22,1 10,043 G A/G - H +1

rs72654275 Ex18 22,1 10,237 G A/G - H +1 -1 rs72654276 Ex18 +23 22,1 10,432 G A/G - H +1 -1 rs72654277 Ex19 22,110,626 T C/T - H -2

rs59052189 Ex19 22,1 10,815 CA H -1

- T /CAT

rs72654278 Ex19 22,1 10,828 A A/C - H +1

rs 12685422 Ex19 +74 22,1 1 1 , 167 A A/C - H -1

[00122] Table 2. Primers used for RACE, TaqMan® and PCR analysis.

5' RACE ADAPTER 5'-GCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGCUUUGAUGAAA-3'Incorp. into 3' end SEQ ID NO.1

RLM OUTER 5 '-GCTGATGGCGATGAATGAACACTG-3 ' Ambion 5' Adapter SEQ ID NO.2

RLM INNER 5 '-CGCGGATCCGAAC ACTGCGTTTGCTGGCTTTGATG-3 ' Ambion 5' Adapter SEQ ID NO.3

5' RACE OUTER 5'-TCCACCACACCTAACAGTGATGC-3' ANRIL Exon 6 SEQ ID NO.4

5' RACE INNER 5 '-GGAC ACTTAGCTGTTCCTCGAC A-3 ' ANRIL Exon 4 SEQ ID NO.5

3' RACE ADAPTER 5 '-GCGAGC AC AGAATTAATACGACTC ACTATAGGT 12 VN-3 ' Ligates to 5' end SEQ ID NO.6

3' RACE OUTER 5'-GGACTACCTGCCTGCCCTGT-3' ANRIL Exon 4 SEQ ID NO.7

3' RACE INNER 5 '-GC ATC ACTGTTAGGTGTGGTGGA-3 ' ANRIL Exon 6 SEQ ID NO.8

3' RACE R 5'-GCGAGCACAGAATTAATACGACT-3' Ambion 3' Adapter SEQ ID NO.9

ANRIL 1-2 ABI TaqMan # Hs01390879_ml ANRIL Exons 1-2

ANRIL 4/6 F 5'-TGTACTTAACCACTGGACTACCTGCC-3' ANRIL Exon 4 SEQ ID NO.10

ANRIL 4/6 R 5'-TCCACCACACCTAACAGTGATGCTTG-3' ANRIL Exon 6 SEQ ID NO.1 1

ANRIL 4/6 Probe 5 56FAM/TGCCCTGTCGAGGAACAGCTAAGTGTCCCT/3BHQ 1/-3' SEQ ID NO.12

ANRIL Q18F 5'-AATGAGGCTGAGAGCATGGGAGATAC-3' ANRIL Exon 18 SEQ ID N0.13

ANRIL Q19R 5'-GAGATATAGGTTCCAGTCCTGGTTCTG-3' ANRIL Exon 19 SEQ ID NO.14

ANRIL 18/19 Probe 5 '-/ 5HEX/TGTGTGTTTCCTTGTGAGCTACTGCA/3BHQ 2/-3 ' SEQ ID N0.15

ANRIL 14-5F 5'-AATTTGGGAATGAGGAGCAC-3' ANRIL Exon 14 SEQ ID NO.16

ANRIL 14-5R 5'-TGCTGTTGAATCAGAATGAGG-3' ANRIL Exon 5 SEQ ID N0.17 ANRIL 14-5 Probe 5 56FAM/AGGGACACTAAGTCACTGGTCTGAGTTCTTA/3BHQ 1/-3' SEQ ID NO.18

HUMP16-P162F 5 '-CC AACGCACCGAATAGTTACG-3 ' pi 6 Exon 1 SEQ ID NO.19

HUMP16-P162R 5'-GCGCTGCCCATCATCATG-3' pl6 Exon 2 SEQ ID NO.20

HUMP16-P162M2 5'-/FAM CCTGGATCGGCCTCCGAC NFQ/-3' SEQ ID N0.21

HUMP 14-ARF3F 5 '-CTGAGGAGCC AGCGTCTAG-3 ' ARF Exon 1 SEQ ID N0.22

HUMP 14-ARF3R 5'-CCCATCATCATGACCTGGTCTTCTA-3' ARF Exon 2 SEQ ID N0.23

HUMP14-ARF3M1 5'-/FAM CAGCAGCCGCTTCC NFQ/-3' SEQ ID N0.24

MT AP ANRIL 14_F 5 '- AACTACC AGGCGAACATCTG-3 ' SEQ ID N0.25

MTAP Exon 4 MTAP4 ANRIL 14_R 5'-CTCTACTGAAGTTCTCCACCTG-3' SEQ ID N0.26

ANRIL Exon 14 MTAP4 ANRIL 14_Probe 5V56FAM/TCCCTCAAGGAGCCACAAGCTG/3BHQJ/-3' SEQ ID N0.27 ANRIL Loop IF 5'-TCATTGCTCTATCCGCCAATC-3' ANRIL Exon 1 SEQ ID N0.28

ANRIL Loop 1R 5'-AGGAATAAAATAAGGGGAATAGG-3' ANRIL Exon 1 SEQ ID N0.29

ANRIL Loop 4F 5'-GACTACCTGCCTGCCCTGTC-3' ANRIL Exon 4 SEQ ID NO.30

ANRIL Loop 4R 5'-TATTTAACTTCTCTCTTTCTGTGGTTTC-3' ANRIL Exon 4 SEQ ID N0.31

ANRIL Loop 6F 5'-AATGTATCTAACTCCAAAGAAACCATC-3' ANRIL Exon 6 SEQ ID N0.32

ANRIL Loop 6R 5'-CACACCTAACAGTGATGCTTGAAC-3' ANRIL Exon 6 SEQ ID N0.33

ANRIL Loop 16F 5'-TACACACTTGAAGATGGTGAAGGA-3' ANRIL Exon 16 SEQ ID N0.34

ANRIL Loop 16R 5'-CTATTGCATTTGATCTTACGTCTATGTT-3' ANRIL Exon 16 SEQ ID N0.35

ANRIL Loop 18F 5'-GAGATACTAATGTGTGTTTCCTTGTGAG-3' ANRIL Exon 18 SEQ ID N0.36

ANRIL Loop 18R 5'-ATGTAGCAGAAAGCTGCAAAGG-3' ANRIL Exon 18 SEQ ID N0.37

SNP rsl0757278 ABI TaqMan # C_l 1841860 10 Risk SNP

18S rRNA ABI TaqMan # 4333760F 18S rRNA Control

pl5IN 4b ABI TaqMan # Hs00793225_ml pl5 Exons 1-2

6.3.9. Exemplary Circular ANRIL Sequence.

[00123] An exemplary circular ANRIL species 14-5 (-13-14-5-6-) and human ANRIL exons 5, 6, 13 and 14 may be found below. The human cANRIL (14-5) was cloned from the T47D cell line product. The coding is as follows: italic is exon 13, bold is exon 14, bold italic is exon 5, and large font is exon 6. The TaqMan® primers and probes used for quantitative reverse transcription polymerase PCR are also shown. An exemplary circular ANRIL species 14-5 (exons 13, 14, 5 and 6) and the cloning strategy include SEQ ID Nos. 38-45.

[00124] Circular ANRIL product (14-5) with TaqMan Strategy

[00125] TGGTATGGAAGGTGCTATGGACACAGTGCTCAAATCCATGATCTACATAGG TGGAGAACTTCAGTAGAGGAAGTGGCAGGAATTTGGGAATGAGGAGCACAG TGATTAAACTGGGGCC ATTC ATATGAGAG T T TAA GAA CTCA GA CCA GTGA CTTA GTGTCCCTTTTGA TGA GAA GAA TAA GCCTCA TTCTGA TTCAA CA GCA GA GA TCAAA GAAAA GA CTTCTGTTTTCTGGCCA CCA GA TA TA TGTTA TCTGTGCTTAAA GAA TTGA AAAA CA CA CA TCAAA GGA GAA TTTTCTTGGAAA GA GA GGGTTC AAGCATC ACT

GTTAGGTGTGGTGGA

[00126]

[00127] TaqMan Probe: GGACACTAAGTCACTGGTCTGAGTTCTTAAA

[00128] Forward: AATTTGGGAATGAGGAGCAC

[00129] Reverse: TGCTGTTGAATCAGAATGAGG

[00130] >ANRIL Exon 5 reference sequence

[00131] TGTCCCTTTTGA TGA GAA GAA TAA GCCTCA TTCTGA TTCAA CA GCA GA GA TCAAA GAAAA GA CTTCTGTTTTCTGGCCA CCA GA TA TA TGTTA TCTGTGCTTAAA GA A TTGAAAAA CA CA CA TCAAA GGA GAA TTTTCTTGGAAA GA GA G

[00132] >ANRIL Exon 6 reference sequence

[00133] GGTTCAAGCATCACTGTTAGGTGTGCTGGAATCCTTTCCCGAGT CAGTACTGCTTTCTAGAAGAAAACCGGGGAGATCTATTTGGAATGTATCTAACTC CAAAGAAACCATCAGAGGTAACAG

[00134] >ANRIL Exon 13 Reference Sequence

[00135] GTACCAGAGATATAATAATGAGAAACAGACATGCTCCCTCCCCTCATT GAGGTTACAGCTTAGTGTGGAGACACACAGATGCCTAACGCACTArGG∑4rGG 4 GGTGCTA TGGA CA CA GTGCTCAAA TCCA TGA TCTA CA TA G

[00136] >ANRIL Exon 14 Reference Sequence

[00137] GTGGAGAACTTCAGTAGAGGAAGTGGCAGGAATTTGGGAA TGAGGAGCACAGTGATTAAACTGGGGCCATTCATATGAGAGTTTAA GAACTCAGACCAGTGACTTAG

6.4. Murine ANRIL (mANRIL) Exons and Murine Circular ANRIL (mcANRIL)

[00138] The murine homolog of the human long non-coding RNA (IncRNA), ANRIL, and its associated non-colinear species (circular ANRIL (cANRIL) was discovered by performing next-generation RNA sequencing (RNA-seq) using an Illumina HiSeq 2000 sequencer on an enriched cDNA library from mouse embryonic fibroblasts (MEFs). Briefly, DNAse treated total RNA was purified from wild-type C57B6 MEFs and RNA quality was assessed using a BioAnalyzer (Agilent). The RNA was then depleted of ribosomal RNA using a RiboMinus Transcriptome Isolation Kit (Invitrogen). A cDNA library was prepared from the RiboMinus treated RNA using a TruSeq RNA Sample Preparation Kit (Illumina). Quality of the cDNA library was measured using a BioAnalyzer (Agilent). The cDNA library was then subjected to an enrichment procedure using a custom designed SureSelect Target Enrichment kit (Agilent). The custom kit selected for cDNA sequences that originated from a 500 kb region on mouse chromosome 4 (88,838,000-89,350,000) that is homologous to the human INK4/ARF locus. The enriched cDNA library was tested for quality on a BioAnalyzer (Agilent) and paired-end sequencing of the enriched cDNA library was performed on the Illumina HiSeq 2000.

[00139] Paired-end sequencing reads were mapped to the mm9 release of the murine genome. The mapped reads were analyzed using MapSplice (PMID: 20802226), an algorithm that analyzes next-generation RNA-seq data to identify splicing between annotated and novel exonic sequences. This analysis identified linear (murine ANRIL (mANRIL)) and non- colinear (murine circular ANRIL (mcANRIL)) RNA species that are similar in exonic architecture to human ANRIL and cANRIL. Using mouse embryonic stem fibroblasts and the methods described above, murine ANRIL exons and circular ANRIL were isolated (see the description of Fig. 14A and 14B). Table 3 below displays the identified exons that comprise mANRIL/mc ANRIL species. Table 4 displays intron/exon splice junctions associated with linear mANRIL splice variants, and Table 5 displays non-colinear splice junctions that comprise the four most predominant mcANRIL species. Cloning and Sanger sequencing of splice junctions from one linear transcript (shown in boldface in Table 4) and the four predominant non-colinear mANRIL/mcANRIL transcripts was performed to validate the MapSplice analysis. The murine circular ANRIL results (mcANRIL 25, 40, 31 and 11) were validated using standard PCR techniques. The results are shown in Figure 15. mcANRIL Circle_l 1 maps to exon 8 to exon 5; mcANRIL Circle_25 maps to exon 8 to exon 3a; mcANRIL Circle_31 maps to exon 8 to exon 6; and mcANRIL Circle_40 = exon 8 to exon 4. The complete structure for mcANRIL is -3a-3-8- (see Table 3 below for the locations of the mANRIL exons).

[00140] A Taqman probe was designed to span the validated linear mANRIL splice junction between exons 2 and 3. Three additional Taqman probes were designed which span three of the four validated non-colinear mcANRIL splice junctions that comprise mcANRIL_Circle_25, mcANRIL_Circle_40, and mcANRIL_Circle_31. Taqman quantitative RT-PCR was performed from freshly prepared cDNA from both early and late passage wild-type C57B6 MEFs to assess the relative difference in expression of each transcript with passage (Fig. 16). Relative expression of pl6^INK4a with passage (Fig. 16A) is shown as a positive control. This initial analysis indicates that the linear mANRIL splice junction product (Fig. 16B) moderately decreases with passage 0.3 fold, whereas the three non-colinear mcANRTL products measured (Fig. 16C-16E) increase with passage from 0.4 up to 3.2 fold. Table 6 displays the sequences of primers and probes used to clone and assay the mANRIL and mcANRIL RNA species described above.

[00141] Absolute abundance of mANRIL and mcANRIL transcript species has not been performed. However, the adjusted cycle time (ACt) for mANRIL and mcANRIL splice junctions shown in Figure 16 (relative to an 18S ribosomal cDNA control) ranged from 32-37 Ct. In contrast, the ACt for pl6^INK4a ranged from 20 to 27 Ct. This suggests mANRIL and mcANRIL transcripts are expressed at very low levels, which is consistent with the low expression levels reported for human ANRIL and cANRIL species (PMID: 21151960). The primer/probe set efficiencies that target the mANRIL/mc ANRIL species assayed are unknown that may impact the expression (Ct values) of their target transcripts.

[00142] Table 3: Exons identified from analysis of RNA-seq data that comprise mANRIL and mcANRIL species.

Nomenclature Chromosome Exon Start Exon End

mAN RILl chr4 88941050 88941101

mAN RIL2 chr4 88942456 88942614

mANRIL2a chr4 88942508 88942614

mANRIL2b chr4 88942456 88942508

mAN RIL3 chr4 89034368 89034504

mANRIL3a chr4 89033337 89033445

mAN RIL4 chr4 89047023 89047079

mAN RIL5 chr4 89049887 89050292

mAN RIL6 chr4 89053399 89053451

mANRIL6a chr4 89050704 89050754

mANRIL6b chr4 89051994 89052038

mAN RIL7 chr4 89053808 89053900

mAN RIL8 chr4 89066464 89066563

mANRIL8a chr4 89057806 89057967

mANRIL8b chr4 89055425 89055495

mAN RIL9 chr4 89119321 89119433

mANRIL9a chr4 89088485 89088634

mANRIL9b chr4 89089163 89089272

mANRILlO chr4 89126289 89126429

mANRILlOa chr4 89121538 89122080

mANRILll chr4 89127619 89127655

mANRILlla chr4 89127619 89127691

mANRILllb chr4 89127619 89127726

mANRIL12 chr4 89129945 89130031

mANRIL12a chr4 89129942 89130031

mANRIL13 chr4 89180704 89180909

mANRIL14 chr4 89181808 89182000

mANRIL15 chr4 89239641 89239725

mANRIL15a chr4 89235531 89235793

mANRIL15b chr4 89236206 89236316

mANRIL16 chr4 89240410 89240486

mANRIL17 chr4 89271557 89271607

[00143] Table 4: Intron/Exon splice junctions identified by MapSplice from RNA-seq data that associate with the linear splice variants of mANRIL. The validated linear mANRIL transcript is shown in bold. Chromosome 3' Splice Donor 5' Splice Acceptor chr4 88941101 88942456 chr4 88941101 88942508 chr4 88942508 89034368 chr4 88942508 89033337 chr4 88942614 89034368 chr4 88942614 89033337 chr4 88942614 89066464 chr4 88958124 88958230 chr4 89033445 89034368 chr4 89034504 89047023 chr4 89034504 89066464 chr4 89047079 89049887 chr4 89050292 89053399 chr4 89050292 89050704 chr4 89050292 89051994 chr4 89052038 89053399 chr4 89053451 89053808 chr4 89053451 89066464 chr4 89053451 89057806 chr4 89053900 89066464 chr4 89053900 89055425 chr4 89057967 89066464 chr4 89066563 89119321 chr4 89066563 89088485 chr4 89088634 89089163 chr4 89092689 89119321 chr4 89116103 89119321 chr4 89116141 89119321 chr4 89119433 89126289 chr4 89119433 89121538 chr4 89122080 89126289 chr4 89126429 89127619 chr4 89126429 89129942 chr4 89126429 89129945 chr4 89127655 89129945 chr4 89127691 89129945 chr4 89127726 89129945 chr4 89130031 89180704 chr4 89130031 89149182 chr4 89130031 89133059 chr4 89130031 89133062 chr4 89130031 89141481 chr4 89141129 89239414 chr4 89180909 89181808 chr4 89232793 89235531 chr4 89235793 89236206 chr4 89236316 89239641 chr4 89239725 89240410 chr4 89240486 89271557 [00144] Table 5: Non-colinear splice junctions identified from MapSplice that comprise mcANRIL species. The validated non-colinear mcANRIL transcripts are shown in bold.

Chromsome i 5' Splice Acceptor 3' Splice Donor; Nomenclature

chr4 88950198 88950283

chr4 88950250 88950342

chr4 88952266 88952384

chr4 88952773 88952845

chr4 89033337 89066562 mcANRIL Circle 25 chr4 89047023 89066562 mcANRIL_Circle_40 chr4 89049887 89066562 mcANRIL_Circle_ll chr4 89053399 89066562 mcANRIL Circle 31 chr4 89066464 89088633

chr4 89088485 89089271

chr4 89033337 89130030

chr4 89047023 89130030

chr4 89053399 89130030

chr4 89116043 89130030

chr4 89119321 89130030

chr4 89126289 89133308

chr4 89180704 89181999

[00145] Table 6: Sequences of primers and Taqman probes used to clone and measure mANRIL and mcANRIL species (SEQ ID NO.46-56).

Chromosome Start Stop Nomenclature Sequence 5' to 3'

chr4 89034424 89034443 mAN IL3 GGTTGCCATTTCCTCTGACA chr4 88942553 88942572 mANRILex2-3F i GCTGAGGCCTCTTTCTGTTG chr4 89066491 89066513 mcAN IL_AIILate_F i ACCTGAACTGAGCGTTGCTTTCC chr4 89033392 89033414 mcANRIL_lR TCCCAGTTGTGTACAAGGAAGAA chr4 89047041 89047060 mcANRIL_2R ILLAILLLI 11 ILLLAGl IL chr4 89053416 89053440 mcANRIL_3R CGATGTTAATTCAACAGTCAGCTTT i chr4 89049928 89049946 mcANRIL_4R GCCAGCCTTGGCTTTGTTA

Taqman Probe mcANRILl-Probe ; TTCAGCTCAAGCACGGAGTG

Taqman Probe mcANRIL2-Probe i TGAACAATGACTGAATCTAACTCCTTT i

Taqman Probe mcANRIL3-Probe i 1 IGIGI 11 lACAUGAAIUAAUCC j

Taqman Probe mANRIL2-3-Probe i GAAAGTCCCCAACAGTGACAA

7. REFERENCES

1. World Health Organization W (2009) Cardiovascular diseases Fact Sheet. 2. Biros E, Cooper M, Palmer LJ, Walker PJ, Norman PE, et al. (2010) Association of an allele on chromosome 9 and abdominal aortic aneurysm. Atherosclerosis. Jun 15. [Epub ahead of print].

3. Bown MJ, Braund PS, Thompson J, London NJ, Samani NJ, et al. (2008) Association between the coronary artery disease risk locus on chromosome 9p21.3 and abdominal aortic aneurysm. Circ Cardiovasc Genet 1 : 39-42.

4. Thompson AR, Golledge J, Cooper JA, Hafez H, Norman PE, et al. (2009) Sequence variant on 9p21 is associated with the presence of abdominal aortic aneurysm disease but does not have an impact on aneurysmal expansion. Eur J Hum Genet 17: 391-394.

5. Helgadottir A, Thorleifsson G, Manolescu A, Gretarsdottir S, Blondal T, et al. (2007) A common variant on chromosome 9p21 affects the risk of myocardial infarction. Science 316: 1491-1493.

6. Helgadottir A, Thorleifsson G, Magnusson KP, Gretarsdottir S, Steinthorsdottir V, et al. (2008) The same sequence variant on 9p21 associates with myocardial infarction, abdominal aortic aneurysm and intracranial aneurysm. Nat Genet 40: 217-224.

7. McPherson R, Pertsemlidis A, Kavaslar N, Stewart A, Roberts R, et al. (2007) A common allele on chromosome 9 associated with coronary heart disease. Science 316: 1488-1491.

8. Matarin M, Brown WM, Singleton A, Hardy JA, Meschia JF (2008) Whole genome analyses suggest ischemic stroke and heart disease share an association with polymorphisms on chromosome 9p21. Stroke 39: 1586-1589.

9. Gschwendtner A, Bevan S, Cole JW, Plourde A, Matarin M, et al. (2009) Sequence variants on chromosome 9p21.3 confer risk for atherosclerotic stroke. Ann Neurol 65: 531-539.

10. Smith JG, Melander O, Lovkvist H, Hedblad B, Engstrom G, et al. (2009) Common genetic variants on chromosome 9p21 confers risk of ischemic stroke: a large-scale genetic association study. Circ Cardiovasc Genet 2: 159-164.

11. Cluett C, McDermott MM, Guralnik J, Ferrucci L, Bandinelli S, et al. (2009) The 9p21 myocardial infarction risk allele increases risk of peripheral artery disease in older people. Circ Cardiovasc Genet 2: 347-353.

12. Ye S, Willeit J, Kronenberg F, Xu Q, Kiechl S (2008) Association of genetic variation on chromosome 9p21 with susceptibility and progression of atherosclerosis: a population-based, prospective study. J Am Coll Cardiol 52: 378-384.

13. Broadbent HM, Peden JF, Lorkowski S, Goel A, Ongen H, et al. (2008) Susceptibility to coronary artery disease and diabetes is encoded by distinct, tightly linked SNPs in the ANRIL locus on chromosome 9p. Hum Mol Genet 17: 806-814.

14. Seidelmann SB, Kuo C, Pleskac N, Molina J, Sayers S, et al. (2008) Athsql is an atherosclerosis modifier locus with dramatic effects on lesion area and prominent accumulation of versican. Arterioscler Thromb Vase Biol 28: 2180-2186. 15. Kim WY, Sharpless NE (2006) The regulation of INK4/ARF in cancer and aging. Cell 127: 265- 275.

16. Liu Y, Sanoff HK, Cho H, Burd CE, Torrice C, et al. (2009) INK4/ARF transcript expression is associated with chromosome 9p21 variants linked to atherosclerosis. PLoS One 4: e5027.

17. Wessely R (2010) Atherosclerosis and cell cycle: put the brakes on! Critical role for cyclin-'dependent kinase inhibitors. J Am Coll Cardiol 55: 2269-2271.

18. Boehm M, Nabel EG (2003) The cell cycle and cardiovascular diseases. Prog Cell Cycle Res 5: 19-30.

19. Gizard F, Amant C, Barbier O, Bellosta S, Robillard R, et al. (2005) PPAR alpha inhibits vascular smooth muscle cell proliferation underlying intimal hyperplasia by inducing the tumor suppressor pl6INK4a. J Clin Invest 115: 3228-3238.

20. Gonzalez -Navarro H, Abu Nabah YN, Vinue A, Andres-Manzano MJ, Collado M, et al. (2010) pl9(ARF) deficiency reduces macrophage and vascular smooth muscle cell apoptosis and aggravates atherosclerosis. J Am Coll Cardiol 55: 2258-2268.

21. Kalinina N, Agrotis A, Antropova Y, Ilyinskaya O, Smirnov V, et al. (2004) Smad expression in human atherosclerotic lesions: evidence for impaired TGF-beta/Smad signaling in smooth muscle cells of fibrofatty lesions. Arterioscler Thromb Vase Biol 24: 1391-1396.

22. Reynisdottir I, Polyak K, Iavarone A, Massague J (1995) Kip/Cip and Ink4 Cdk inhibitors cooperate to induce cell cycle arrest in response to TGF-beta. Genes Dev 9: 1831-1845.

23. Grainger DJ (2004) Transforming growth factor beta and atherosclerosis: so far, so good for the protective cytokine hypothesis. Arterioscler Thromb Vase Biol 24: 399-404.

24. Janzen V, Forkert R, Fleming HE, Saito Y, Waring MT, et al. (2006) Stem-cell ageing modified by the cyclin-dependent kinase inhibitor pl6INK4a. Nature 443: 421-426.

25. Yvan-Charvet L, Pagler T, Gautier EL, Avagyan S, Siry RL, et al. (2010) ATP-binding cassette transporters and HDL suppress hematopoietic stem cell proliferation. Science 328: 1689-1693.

26. Visel A, Zhu Y, May D, Afzal V, Gong E, et al. (2010) Targeted deletion of the 9p21 non-coding coronary artery disease risk interval in mice. Nature 464: 409-412.

27. Pasmant E, Laurendeau I, Heron D, Vidaud M, Vidaud D, et al. (2007) Characterization of a germ-line deletion, including the entire INK4/ARF locus, in a melanoma-neural system tumor family: identification of ANRIL, an antisense noncoding RNA whose expression coclusters with ARF. Cancer Res 67: 3963-3969.

28. Folkersen L, Kyriakou T, Goel A, Peden J, Malarstig A, et al. (2009) Relationship between CAD risk genotype in the chromosome 9p21 locus and gene expression. Identification of eight new ANRIL splice variants. PLoS One 4: e7677. 29. Kyriakou T, Pal A, Peden J, Green F, Gloyn A, et al. (2009) ANRIL, The non-coding RNA present in the chromosome 9 CAD associated locus, has multiple splice variants and a potential regulatory role in CDKN2B expression. Atherosclerosis 207: e3.

30. Jarinova O, Stewart AF, Roberts R, Wells G, Lau P, et al. (2009) Functional analysis of the chromosome 9p21.3 coronary artery disease risk locus. Arterioscler Thromb Vase Biol 29: 1671- 1677.

31. Jacobs JJ, Kieboom K, Marino S, DePinho RA, van Lohuizen M (1999) The oncogene and Polycomb-group gene bmi-1 regulates cell proliferation and senescence through the ink4a locus. Nature 397: 164-168.

32. Dhawan S, Tschen SI, Bhushan A (2009) Bmi-1 regulates the Ink4a/Arf locus to control pancreatic beta-cell proliferation. Genes Dev 23: 906-911.

33. Chen H, Gu X, Su IH, Bottino R, Contreras JL, et al. (2009) Poly comb protein Ezh2 regulates pancreatic beta-cell Ink4a/Arf expression and regeneration in diabetes mellitus. Genes Dev 23: 975- 985.

34. Kotake Y, Cao R, Viatour P, Sage J, Zhang Y, et al. (2007) pRB family proteins are required for H3K27 trimethylation and Polycomb repression complexes binding to and silencing pl6INK4alpha tumor suppressor gene. Genes Dev 21 : 49-54.

35. Bracken AP, Kleine-Kohlbrecher D, Dietrich N, Pasini D, Gargiulo G, et al. (2007) The Polycomb group proteins bind throughout the INK4A-ARF locus and are disassociated in senescent cells. Genes Dev 21 : 525-530.

36. Gil J, Peters G (2006) Regulation of the INK4b-ARF-INK4a tumour suppressor locus: all for one or one for all. Nat Rev Mol Cell Biol 7: 667-677.

37. Terranova R, Yokobayashi S, Stadler MB, Otte AP, van Lohuizen M, et al. (2008) Polycomb group proteins Ezh2 and Rnf2 direct genomic contraction and imprinted repression in early mouse embryos. Dev Cell 15: 668-679.

38. Rinn JL, Kertesz M, Wang JK, Squazzo SL, Xu X, et al. (2007) Functional demarcation of active and silent chromatin domains in human HOX loci by noncoding RNAs. Cell 129: 1311-1323.

39. Zhao J, Sun BK, Erwin JA, Song JJ, Lee JT (2008) Polycomb proteins targeted by a short repeat RNA to the mouse X chromosome. Science 322: 750-756.

40. Pandey RR, Mondal T, Mohammad F, Enroth S, Redrup L, et al. (2008) Kcnqlotl antisense noncoding RNA mediates lineage-specific transcriptional silencing through chromatin-level regulation. Mol Cell 32: 232-246.

41. Gupta RA, Shah N, Wang KC, Kim J, Horlings HM, et al. (2010) Long non-coding RNA HOT AIR reprograms chromatin state to promote cancer metastasis. Nature 464: 1071-1076.

42. Liu Y, Sanoff HK, Cho H, Burd CE, Torrice C, et al. (2009) Expression of pl6(INK4a) in peripheral blood T-cells is a biomarker of human aging. Aging Cell 8: 439-448. 43. Hara E, Smith R, Parry D, Tahara H, Stone S, et al. (1996) Regulation of l6CDKN2 expression and its implications for cell immortalization and senescence. Mol Cell Biol 16: 859-867.

44. Krishnamurthy J, Torrice C, Ramsey MR, Kovalev GI, Al-Regaiey K, et al. (2004) Ink4a/Arf expression is a biomarker of aging. J Clin Invest 114: 1299-1307.

45. Au KF, Jiang H, Lin L, Xing Y, Wong WH (2010) Detection of splice junctions from paired-end RNA-seq data by SpliceMap. Nucleic Acids Res.

46. Nielsen GP, Stemmer-Rachamimov AO, Shaw J, Roy JE, Koh J, et al. (1999) Immunohistochemical survey of pl6INK4A expression in normal human adult and infant tissues. Lab Invest 79: 1137-1143.

47. Schmid M, Sen M, Rosenbach MD, Carrera CJ, Friedman H, et al. (2000) A methylthioadenosine phosphorylase (MTAP) fusion transcript identifies a new gene on chromosome 9p21 that is frequently deleted in cancer. Oncogene 19: 5747-5754.

48. Chen K, Wallis JW, McLellan MD, Larson DE, Kalicki JM, et al. (2009) BreakDancer: an algorithm for high -resolution mapping of genomic structural variation. Nat Methods 6: 677-681.

49. Zaphiropoulos PG (1996) Circular RNAs from transcripts of the rat cytochrome P450 2C24 gene: correlation with exon skipping. Proc Natl Acad Sci U S A 93: 6536-6541.

50. Suzuki H, Zuo Y, Wang J, Zhang MQ, Malhotra A, et al. (2006) Characterization of RNase R- digested cellular RNA source that consists of lariat and circular RNAs from pre-mRNA splicing. Nucleic Acids Res 34: e63.

51. Dixon RJ, Eperon IC, Hall L, Samani NJ (2005) A genome-wide survey demonstrates widespread non-linear mRNA in expressed sequences from multiple species. Nucleic Acids Res 33: 5904-5913.

52. Li H, Durbin R (2009) Fast and accurate short read alignment with Burrows- Wheeler transform. Bioinformatics 25: 1754-1760.

53. Li R, Li Y, Kristiansen K, Wang J (2008) SOAP: short oligonucleotide alignment program. Bioinformatics 24: 713-714.

54. Wang Z, Rolish ME, Yeo G, Tung V, Mawson M, et al. (2004) Systematic identification and analysis of exonic splicing silencers. Cell 119: 831-845.

55. Fairbrother WG, Yeh RF, Sharp PA, Burge CB (2002) Predictive identification of exonic splicing enhancers in human genes. Science 297: 1007-1013.

56. Wang Z, Burge CB (2008) Splicing regulation: from a parts list of regulatory elements to an integrated splicing code. Rna 14: 802-813.

57. Frazer KA, Ballinger DG, Cox DR, Hinds DA, Stuve LL, et al. (2007) A second generation human haplotype map of over 3.1 million SNPs. Nature 449: 851-861.

58. Nigra JM, Cho KR, Fearon ER, Kern SE, Ruppert JM, et al. (1991) Scrambled exons. Cell 64: 607-613. 59. Holdt LM, Beutner F, Scholz M, Gielen S, Gabel G, et al. (2010) ANRIL expression is associated with atherosclerosis risk at chromosome 9p21. Arterioscler Thromb Vase Biol 30: 620-627.

60. Cunnington MS, Santibanez Koref M, Mayosi BM, Burn J, Keavney B (2010) Chromosome 9p21 SNPs Associated with Multiple Disease Phenotypes Correlate with ANRIL Expression. PLoS Genet 6: el000899.

61. Messaoudi-Aubert SE, Nicholls J, Maertens GN, Brookes S, Bernstein E, et al. (2010) Role for the MOV10 RNA helicase in polycomb-mediated repression of the INK4a tumor suppressor. Nat Struct Mol Biol 17: 862-868.

62. Yap KL, Li S, Munoz-Cabello AM, Raguz S, Zeng L, et al. (2010) Molecular interplay of the noncoding RNA ANRIL and methylated histone H3 lysine 27 by polycomb CBX7 in transcriptional silencing of INK4a. Mol Cell 38: 662-674.

63. Mancini-Dinardo D, Steele SJ, Levorse JM, Ingram RS, Tilghman SM (2006) Elongation of the Kcnqlotl transcript is required for genomic imprinting of neighboring genes. Genes Dev 20: 1268- 1282.

64. Kanduri C, Thakur N, Pandey RR (2006) The length of the transcript encoded from the Kcnqlotl antisense promoter determines the degree of silencing. Embo J 25: 2096^_,2106.

65. Dixon RJ, Eperon IC, Samani NJ (2007) Complementary intron sequence motifs associated with human exon repetition: a role for intragenic, inter-transcript interactions in gene expression. Bioinformatics 23: 150-155.

66. Cocquerelle C, Daubersies P, Majerus MA, Kerckaert JP, Bailleul B (1992) Splicing with inverted order of exons occurs proximal to large introns. Embo J 11 : 1095-1098.

67. Bonen L, Vogel J (2001) The ins and outs of group II introns. Trends Genet 17: 322-331.

68. Kos A, Dijkema R, Arnberg AC, van der Meide PH, Schellekens H (1986) The hepatitis delta (delta) virus possesses a circular RNA. Nature 323: 558-560.

69. Tsagris EM, Martinez de Alba AE, Gozmanova M, Kalantidis K (2008) Viroids. Cell Microbiol 10: 2168-2179.

70. Zeggini E, Weedon MN, Lindgren CM, Frayling TM, Elliott KS, et al. (2007) Replication of genome-wide association signals in UK samples reveals risk loci for type 2 diabetes. Science 316: 1336-1341.

71. Scott LJ, Mohlke KL, Bonny castle LL, Wilier CJ, Li Y, et al. (2007) A genome-wide association study of type 2 diabetes in Finns detects multiple susceptibility variants. Science 316: 1341-1345.

72. Shete S, Hosking FJ, Robertson LB, Dobbins SE, Sanson M, et al. (2009) Genome -wide association study identifies five susceptibility loci for glioma. Nat Genet 41 : 899-904.

73. Wrensch M, Jenkins RB, Chang JS, Yeh RF, Xiao Y, et al. (2009) Variants in the CDKN2B and RTEL1 regions are associated with high-grade glioma susceptibility. Nat Genet 41 : 905-908. 74. Uno S, Zembutsu H, Hirasawa A, Takahashi A, Kubo M, et al. (2010) A genome-wide association study identifies genetic variants in the CDKN2BAS locus associated with endometriosis in Japanese. Nat Genet 42: 707-710.

75. Bei JX, Li Y, Jia WH, Feng BJ, Zhou G, et al. (2010) A genome-wide association study of nasopharyngeal carcinoma identifies three new susceptibility loci. Nat Genet 42: 599-603.

76. Emanuele E, Fontana JM, Minoretti P, Geroldi D (2010) Preliminary evidence of a genetic association between chromosome 9p21.3 and human longevity. Rejuvenation Res 13: 23-26.

77. Sebastiani P, Solovieff N, Puca A, Hartley SW, Melista E, et al. (2010) Genetic Signatures of Exceptional Longevity in Humans. Science.

78. Hanker AB, Morita S, Repasky GA, Ross DT, Seitz RS, et al. (2008) Tools to study the function of the Ras-related, estrogen-regulated growth inhibitor in breast cancer. Methods Enzymol 439: 53- 72.

79. Brookes S, Rowe J, Ruas M, Llanos S, Clark PA, et al. (2002) INK4a-deficient human diploid fibroblasts are resistant to RAS-induced senescence. Embo J 21 : 2936-2945.

80. Shields JM, Thomas NE, Cregger M, Berger AJ, Leslie M, et al. (2007) Lack of extracellular signal-regulated kinase mitogen-activated protein kinase signaling shows a new type of melanoma. Cancer Res 67: 1502-1512.

81. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, et al. (2009) The Sequence Alignment/Map format and SAMtools. Bioinformatics 25: 2078-2079.

[00146] It is to be understood that, while the invention has been described in conjunction with the detailed description, thereof, the foregoing description is intended to illustrate and not limit the scope of the invention. Other aspects, advantages, and modifications of the invention are within the scope of the claims set forth below. All publications, patents, and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference.

Claims

CLAIMS What is claimed is:

1. An isolated and purified nucleic acid encoding a circular RNA comprising two or more ANRIL exons.

2. The nucleic acid of claim 1, wherein the circular RNA comprises ANRIL exons 3i, 4, 5, 6, 7, 10, 13, 14, 15, 16, 17, 18, or 19.

3. The nucleic acid of claim 2, wherein the circular RNA is -exon4-exonl3-exonl4-, -exon4-exon5-exon6-exon7-exonl4-, -exon4-exon5-exon6-exon7-, -exon4-exon5-exon6-, -exon6-exon7-exonl4-exon5-, -exon6-exon7-exonl0-exon5-, -exon6-exon7-exon5-, -exon6- exon5-, -exon6-exonl3-exonl4-, or -exonl6-exonl7-exonl8-exonl9-exonl3-exonl4- exonl5-.

4. A method for detecting a level of a nucleic acid encoding a circular RNA comprising two or more ANRIL exons in a sample which comprises contacting the sample with a reagent that selectively enriches the circular RNA and measuring the level of the nucleic acid in the sample.

5. The method of claim 4, wherein the enriching the sample with the circular RNA is performed by an exonuclease.

6. The method of claim 5, wherein the exonuclease is RNase R.

7. The method of claim 4, wherein the method further comprises detecting the nucleic acid encoding the circular RNA with a probe specific for a mis-ordered junction.

8. The method of claim 7, wherein the mis-ordered junction is exon5-exon3i, exon6- exon3i, exon6-exon5, exon7-exon4, exon7-exon5, exonl0-exon5, exonl4-exon4, exonl4- exon5, or exon 19-exonl3.

9. The method of claim 8, wherein the method utilizes a mass spectrometer.

10. The method of claim 4, wherein the method further comprises PCR amplification using outward facing primers such only circular nucleic acids will produce an amplicon.

1 1. The method of claim 4, wherein the method further comprises detecting a polyadenonosine end.

12. A method for detecting risk of a vascular disease in a subject which comprises measuring a level of the nucleic acid of claim 1 and determining whether or not the subject is at risk for vascular disease.

13. The method of claim 12, wherein the vascular disease is abdominal aortic aneurysm, arteriosclerosis, atherosclerosis, coronary artery disease, ischemic stroke, myocardial infarction, peripheral vascular disease, renal artery stenosis, stroke, or thoracic aortic aneurysm.

14. The method of claim 13, wherein the ischemic stroke is cardioembolic stroke, large artery stroke or small vessel stroke.

15. A method for detecting risk of a metabolic disorder in a subject which comprises measuring a level of the nucleic acid of claim 1 and determining whether or not the subject is at risk for the metabolic disorder.

16. The method of claim 15 wherein the metabolic disorder is diabetes mellitus, metabolic syndrome, or type 2 diabetes.

17. A method for detecting risk of a proliferative disorder in a subject which comprises measuring a level of the nucleic acid of claim 1 and determining whether or not the subject is at risk for the proliferative disorder.

18. The method of claim 17, wherein the proliferative disorder is cancer or endometriosis.

19. The method of claim 18, wherein the cancer is bladder carcinoma, breast cancer, colorectal cancer, endocrinologic cancer, thyroid cancer, glioblastoma, head and neck cancer, leukemia, melanoma, liver cancer, lung cancer, non-small cell lung cancer, pancreatic adenocarcinoma, or skin cancer.

20. A method for detecting risk of an age-associated condition in a subject which comprises measuring a level of the nucleic acid of claim 1 and determining whether or not the subject is at risk for the age-associated condition.

21. The method of claim 20 wherein the age-associated condition is frailty, life- expectancy or longevity.

22. A kit comprising:

(a) at least one reagent selected from the group consisting of:

(i) a nucleic acid probe capable of specifically hybridizing with a nucleic acid encoding a circular RNA comprising two or more ANRTL exons;

(ii) a pair of nucleic acid primers capable of PCR amplification of the nucleic acid; and

(iii) a probe capable of specifically hybridizing with the nucleic acid; and

(b) instructions for use in measuring the nucleic acid in a tissue sample from a subject suspected of having an ANRIL-associated disorder.

23. The kit of claim 20, wherein the ANRIL-associated disorder is a vascular disease.

24. The kit of claim 20 wherein the ANRIL-associated disorder is a metabolic disease, a proliferative disorder or an age-associated condition.

25. The kit of claim 20, further which comprises contacting the sample with a reagent that selectively enriches the circular RNA.

26. The kit of claim 22, wherein the reagent that selective enriches the sample is an exonuclease.

27. A method of identifying a compound that prevents or treats an ANRIL-associated disorder, the method comprising the steps of:

(a) contacting a compound with a sample comprising a cell or a tissue;

(b) measuring a level of a nucleic acid encoding a circular RNA comprising two or more ANRIL exons; and determining a functional effect of the compound on the level of the nucleic acid; thereby identifying a compound that prevents or treats an ANRIL- associated disorder.