WO2012038530A1

WO2012038530A1 - Plants resistant to fungal pathogens and methods for production thereof

Info

Publication number: WO2012038530A1
Application number: PCT/EP2011/066576
Authority: WO
Inventors: Jean-Benoit Morel; Amandine Delteil; François Jean Georges TORNEY
Original assignee: Genoplante-Valor
Priority date: 2010-09-23
Filing date: 2011-09-23
Publication date: 2012-03-29

Abstract

The present invention relates to plant genes involved in negative regulation of resistance to fungal pathogens and uses thereof. More particularly, the present invention relates to plants comprising an inactivated WAK112 gene, or an ortholog thereof, and having increased resistance to fungal pathogens. The invention also relates to methods for producing modified plants having increased or improved fungal disease and pathogen resistance. Furthermore, the invention relates to methods of screening and identifying molecules that modulate WAK112 gene expression.

Description

PLANTS RESISTANT TO FUNGAL PATHOGENS AND METHODS FOR

PRODUCTION THEREOF

FIELD OF THE INVENTION

The invention relates generally to the field of agricultural biotechnology and plant diseases. In particular, the invention relates to plant genes involved in negative regulation of resistance to fungal pathogens and uses thereof. More specifically, the invention relates to plants comprising an inactivated WAK112 gene, or an ortholog thereof and having increased or improved fungal pathogen resistance. The invention also relates to methods for producing modified plants resistant to fungal diseases. Furthermore, the invention relates to methods of screening and identifying molecules that modulate WAK112 gene expression. BACKGROUND OF THE INVENTION

To meet the increasing demand on the world food supply, it will be necessary to produce up to 40% more rice by 2030 (Khush 2005). This will have to be on a reduced sowing area due to urbanization and increasing environmental pollution. For example, the sowing area in China decreased by 8 million hectares between 1996 and 2007. Improvement of yield per plant is not the only way to achieve this goal; reduction of losses by biotic and abiotic stress is also a solution. According to FAO estimates, diseases, insects and weeds cause as much as 25% yield losses annually in cereal crops (Khush, 2005).

Fungal and bacterial pathogens represent a permanent threat on rice cultivation. In particular, fungal diseases can cause important losses (between 1 and 10%) regionally (Savary et al. 2000). In China alone, it is estimated that 1 million hectares are lost annually because of blast disease (Khush and Jena 2009). Between 1987 and 1996, fungicides represented, for example, up to 20 and 30% of the culture costs in China ($46 Million) and Japan ($461 Million) respectively. Blast disease is caused by the ascomycete Magnaporthe oryzae, also known as rice blast fungus. Members of the M. grisea/M. oryzae complex (containing at least two biological species: M. grisea and M. oryzae) are extremely effective plant pathogens as they can reproduce both sexually and asexually to produce specialized infectious structures known as appressoria that infect aerial tissues and hyphae that can infect root tissues. Magnaporthe fungi can also infect a number of other agriculturally important cereals including wheat, rye, barley, and pearl millet causing diseases called blast disease or blight disease. Other plant pathogens of economic importance include Fusarium, Thielaviopsis, Verticillium, Rhizoctonia and Puccinia species. Fusarium contamination in cereals (e.g., barley or wheat) can result in head blight disease. For example, the total losses in the US of barley and wheat crops between 1991 and 1996 have been estimated at $3 billion (Brewing Microbiology, 3rd edition. Priest and Campbell, ISBN 0-306-47288-0).

Pathogen infection of crop plants can have a devastating impact on agriculture due to loss of yield and contamination of plants with toxins. Currently, outbreaks of blast disease are controlled by applying expensive and toxic fungicidal chemical treatments using for example probenazole, tricyclazole, pyroquilon and phthalide, or by burning infected crops. These methods are only partially successful since the fungal pathogens are able to develop resistance to chemical treatments.

To reduce the amount of fungicides used, plant breeders and geneticists have also been trying to identify disease resistance loci and exploit the plant's natural defense mechanism against pathogen attack. However, pathogens may mutate and overcome the protection conferred by resistance genes.

Plants can recognize certain pathogens and activate defense in the form of the resistance response that may result in limitation or stopping of pathogen growth. Many resistance (R) genes, which confer resistance to various plant species against a wide range of pathogens, have been identified. However, the key factors that switch these genes on and off during plant defense mechanisms remain poorly understood. The vast majority of the known R genes code for proteins carrying nucleotide-binding sites and leucine-rich repeat motifs (NBS-LRR) (Jones and Dangl, 2006). Many R genes identified in rice are NBS-LRR genes (Ballini et al. 2008; White and Yang 2009). Most of the products of R genes recognize pathogen effectors developed by pathogens to inhibit defense (e.g Lee et al. 2009).

After recognition mediated by the R gene, signal transduction occurs causing a deep transcriptional re-programming of the cell (Eulgem 2005) leading to the activation of defense responses per se. These include production of antimicrobial secondary metabolites such as phytoalexins like momilactones in rice (Peters et al., 2006), pathogenesis-related (PR) proteins, e.g., chitinases, glucanases, PBZ 1 in rice (Jwa et al., 2006; van Loon et al., 2006), cell-wall strengthening (Hiickelhoven 2007) and programmed cell death known as the hypersensitive response (HR) (Greenberg and Yao, 2004). The genes that act downstream of the disease resistance pathway are collectively called defense genes. A disadvantage of most R genes is to be rapidly circumvented by the pathogen.

Pathogen recognition can also occur through the action of plant proteins called PRR (Pattern Recognition Receptor). The pathogen-specific molecules that are recognized by PRRs are called pathogen-associated molecular patterns (PAMPs) and include bacterial carbohydrates (e.g. lipopolysaccharide or LPS, mannose), nucleic acids (e.g., bacterial or viral DNA or RNA), bacerial peptides (e.g., flagellin), peptidoglycans lipotechoic acids, N-formylmethionine, lipoproteins and fungal glucans. However, there are very few data concerning the implication of these PRR receptors in defense mechanisms of plants.

Consequently, there exists a high demand for novel efficient methods for controlling plant diseases such as blast disease, as well as for producing plants of interest with increased resistance to fungal pathogens. SUMMARY OF THE INVENTION

The present invention provides novel and efficient methods for producing plants resistant to pathogens. Surprisingly, the inventors have demonstrated that WAK112 is a negative regulator of plant resistance to fungal pathogens. Moreover, the inventors have shown that inhibiting said gene increases plant resistance to fungal diseases. To our knowledge, this is the first example of a negative regulation of resistance in plants by a receptor-like kinase. In addition, the inventors have identified orthologs of WAK112 in various plants, thus extending the application of the invention to different cultures.

An object of this invention therefore relates to plants comprising an inactivated WAK1 12 gene or an ortholog thereof. As will be discussed, said plants exhibit an increased or improved resistance to fungal pathogens. Preferably, said plants are cereals selected preferably from rice, wheat, barley, oat, rye, sorghum or maize.

The invention also relates to loss-of-function WAK112 mutant cereal plants with increased resistance to fungal pathogens.

A further object of this invention relates to seeds of a plant of the invention.

Another object of this invention relates to plants, or descendent of plants, grown or otherwise derived from said seeds.

A further object of the invention relates to a method for producing a plant having increased resistance to fungal pathogens, wherein the method comprises the following steps:

(a) inactivation of the WAKl 12 gene, or an ortholog thereof, in a plant cell;

(b) optionally, selection of plant cells of step (a) with inactivated WAKl 12 gene;

(c) regeneration of plants from cells of step (a) or (b); and

(d) optionally, selection of a plant of (c) with increased resistance to fungal pathogens, said plant having an inactivated WAKl 12 gene, or an ortholog thereof. As will be further disclosed in the present application, WAK1 12 inactivation may be carried out by various techniques such as for example deletion, insertion and/or substitution of one or more nucleotides, site-specific mutagenesis, ethyl methanesulfonate (EMS) mutagenesis, targeting induced local lesions in genomes (TILLING) or by gene silencing.

The invention also relates to a method of identifying a molecule that modulates, preferably inhibits WAK112 gene expression, the method comprising:

- providing a cell comprising a nucleic acid construct that comprises the sequence of a WAKl 12 gene promoter operably linked to a reporter gene;

contacting the cell with a candidate molecule;

measuring the activity of WAKl 12 promoter by monitoring of the expression of a marker protein encoded by the reporter gene in the cell;

- selecting a molecule that modulates the expression of the marker protein.

Preferably, such a molecule inhibits the activity of the WAKl 12 gene promoter.

A further object of the invention relates to the use of a molecule that inhibits WAKl 12 gene expression for increasing resistance of plants to fungal pathogens. Such a molecule may be identified according to the above method.

The invention also relates to a method for conferring or increasing resistance to fungal pathogens to a plant, comprising a step of inhibiting permanently or transiently the expression of WAKl 12 gene in said plant.

A further object of the invention relates to a nucleic acid molecule comprising the sequence of a WAKl 12 gene promoter, or of an ortholog thereof, operably linked to a reporter gene. A further object of the invention relates to an isolated cDNA comprising a nucleic acid sequence selected from: (a) a nucleic acid sequence which encodes a WAK1 12 kinase or an ortholog thereof, or a fragment thereof;

(b) a nucleic acid sequence of SEQ ID NO: 1, 3, 4 or 5, or a fragment thereof ;

(c) a nucleic acid sequence which hybridizes to one of the above sequences under stringent conditions, and encodes a WAK112 kinase or an ortholog thereof; and

(d) a mutant of any of the above nucleic acid sequences.

A further object of the invention relates to recombinant vectors comprising one of the above nucleic acid molecules.

Further objects of the invention relate to cells or plants transformed with such recombinant vectors, and to seeds of the transformed plants.

The invention is applicable to produce cereals having increased resistance to pathogens, and is particularly suited to produce resistant rice.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1: WAK112 expression after inoculation with Magnaporthe. Plants of the Nipponbare genotype were either inoculated with a virulent isolate (FR13), an avirulent isolate (CL367) or gelatin (used for making the spore suspension; non-infected plants). The repression (4x) of the WAK112 gene is observed early (4hpi) during infection by an avirulent (CL367) and virulent (GFR13) isolate. (A) The expression of the WAK112 gene was monitored using QRT-PCR. The activity of the gene was normalized using the actin control; absolute values are shown for 3 replicates; Mock: non infected plants; (B) The expression value in infected plants was divided by the expression value in non- infected plants and the ratio was log2 transformed. This experiment was repeated three times and the mean of ratios is shown. Figure 2: Chitin represses WAK112 expression. Chitin alone is sufficient to repress WAK1 12 (up to 4x) in entire plants after 1 hour. Chitin fragments (two concentrations) were sprayed on healthy rice plants. (A) The expression value of the WAK112 gene expression (normalized by actin) was measured at the indicated time after treatment. (B) The expression value after chitin treatment was divided by the expression value in untreated plants and the ratio was log transformed. Figure 3: WAK112-defective plants are more resistant to M. oryzae. The expression level of the WAKl 12 gene was normalized using the actin gene as a reference. (A) The expression of the WAKl 12 gene is 11-fold higher in wild type line (Wt) than in mutants (Ho); (B) The WAKl 12 mutants are more resistant to M. oryzae isolate FR13 (number of lesions/unit surface).

Figure 4: The WAK112 mutants are more resistant to infection by Magnaporthe.

Plants mutated for the WAKl 12 gene and the corresponding normal plants (wild-type) were inoculated with the virulent isolate FR13 of Magnaporthe oryzea. Symptoms are shown 5 days after infection. The brown and grey spots represent sporulating lesions.

Figure 5: WAK112 expression after inoculation with Puccinia triticina (wheat pathogen). The non-adapted fungus Puccinia triticina represses the WAKl 12 gene. (A) Absolute values of WAKl 12 expression monitored after inoculation with Puccinia triticina; Mock: non infected plants; (B) The expression value in infected plants was divided by the expression value in non-infected plants and the ratio was log2 transformed.

Figure 6: Over-expression plasmid for the WAK112 gene. The WAK coding sequence was cloned under control of the constitutive maize ubiquitin promoter into a pCAMBIA2300OX plasmid in order to overexpress the WAKl 12 gene.

Figure 7: Over-expression of the WAK112 gene increases susceptibility to Magnaporthe. TO transgenic plants containing the vector overexpressing WAKl 12 pCAMBIA2300OX/WAK112 (S) or empty vector (R) were inoculated with the virulent isolate FR13 of Magnaporthe oryzae. It is observed that the lines overexpressing the WAKl 12 gene are more susceptible to infection by M. oryzae isolate FR13. (A) Disease symptoms in the form of brown and grey spots (lesions) are shown on susceptible transgenic plants (S) and control plants (R). (B) Panel B shows the expression of the WAKl 12 transgene (OX-3614, OX-3626, OX-3634) and the endogenous WAKl 12 gene (empty vector plants: OX-3615, OX-3525, OX-3635). (C) Panel C shows a ratio between lesion number and unit size for the transgene OX- WAKl 12 and empty vector plants. The lesion number is increased by 4-fold.

DETAILED DESCRIPTION OF THE INVENTION

The WAK family of genes code for proteins belonging to a group of wall-associated kinases (WAK). These kinases contain an extracellular domain containing an EGF- domain of unknown function, a transmembrane domain and a cytoplasmic kinase domain. As indicated in the examples, there is no substantial sequence homology between these WAK genes and it is not possible to predict biological function from sequence data. WAKl gene was recently shown to be involved in positive regulation of resistance against the fungus Magnaporthe since its overexpression was shown to lead to an increase of resistance to the fungus (Li et al., 2009).

Surprisingly the inventors have now discovered that WAKl 12 is a negative regulator of plant resistance to pathogens, i.e., its inhibition increases resistance. This is the first example of a negative regulation of resistance in plants by a receptor-like kinase. WAKl 12, and orthologs thereof, thus represent novel and highly valuable targets for producing plants of interest with increased resistance to pathogens.

The present invention thus relates to methods for increasing pathogen resistance in plants based on a regulation of WAKl 12.

The invention also relates to plants or plant cells having an inactivated WAKl 12 gene, or an ortholog thereof. The invention also relates to constructs (e.g., nucleic acids, vectors, cells, etc) suitable for production of such plants and cells, as well as to methods for producing plant resistant regulators. The present disclosure will be best understood by reference to the following definitions: Definitions

As used therein, the term "WAK1 12 protein" designates a wall-associated kinase protein comprising the amino acid sequence of SEQ ID NO: 2 (which corresponds to the WAK112 amino acid sequence of Oryza sativa), and any natural variant thereof (e.g., variants present in other (rice) plants as a result of polymorphism). Within the context of the present invention, the term "WAK112 gene" designates a gene or nucleic acid that codes for a WAK112 wall-associated kinase protein. In particular, a "WAK112 gene" includes any nucleic acid encoding a protein comprising SEQ ID NO: 2, or a natural variant of such a protein. A specific example of a WAK112 gene comprises nucleic acid sequence of SEQ ID NO: 1 (which corresponds to WAK112 nucleotide sequence of Oryza sativa). Within the context of the present invention, the term "ortholog" designates a related gene or protein from a distinct species, having a level of sequence identity to WAK112 above 50% and a WAK112-like activity. An ortholog of WAK112 is most preferably a gene or protein from a distinct species having a common ancestor with WAK1 12, acting as a negative regulator of plant resistance, and having a degree of sequence identity with WAK1 12 superior to 50%. Preferred orthologs of WAK1 12 have a sequence of at least 60%, preferably at least 62 or 67 %, especially preferably at least 70, 80, 90, 95% or more sequence identity to the sequence shown in SEQ ID NO: 1 or 2. WAK112 orthologs can be identified using such tools as "best blast hit" searches or "best blast mutual hit" (BBMH). WAK112 orthologs have been identified by the inventors in various plants, including wheat, barley, oat, rye, sorghum or maize (see Table 1 and sequence listing). Specific examples of such orthologs include the nucleic acid sequence of SEQ ID NO: 3, the nucleic acid sequence of SEQ ID NO: 4, and the nucleic acid sequence of SEQ ID NO: 5. Within the context of the present invention, the term "pathogens" designates all pathogens of plants in general. More preferably the pathogens are fungal pathogens. In a particular embodiment, fungal pathogens are cereal fungal pathogens. Examples of such pathogens include, without limitation, Magnaporthe, Puccinia, Aspergillus, Ustilago, Septoria, Erisyphe, Rhizoctonia and Fusarium species. In the most preferred embodiment, the pathogen is Magnaporthe oryzae. The invention is particularly suited to create rice resistant to Magnaporthe.

Different embodiments of the present invention will now be further described in more details. Each embodiment so defined may be combined with any other embodiment or embodiments unless otherwise indicated. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous.

WAK1 12- defective plants As previously described, the present invention is based on the finding that WAK112 gene is a negative regulator of plant resistance to fungal pathogens. The inventors have demonstrated that the inactivation of WAK112 gene increases plant resistance to fungal pathogens. Therefore, according to a first embodiment, the invention relates to a plant or a plant cell comprising an inactivated WAK112 gene or an ortholog thereof. Preferably, the plant is a cereal. More preferably, the cereal is selected from rice, wheat, barley, oat, rye, sorghum or maize. In the most preferred embodiment the plant is rice, for example Oryza sativa indica, Oryza sativa japonica or Nipponbare. Preferred plants or plant cells of the invention exhibit an increased resistance to pathogens, preferably to fungal pathogens.

In another variant, the invention relates to a plant with increased resistance to fungal pathogens, wherein said increased resistance is due to inactivation of a gene encoding WAK 1 12, or an ortholog thereof. In another embodiment, the invention relates to transgenic plants or plant cells which have been engineered to be (more) resistant to fungal pathogens by inactivation of WAKl 12 or an ortholog thereof. In a particular embodiment, the modified plant is a loss-of-function WAKl 12 mutant cereal plant, with increased resistance to fungal pathogens.

The invention also relates to a seed of a plant of the invention, as well as to a plant, or a descendent of a plant, grown or otherwise derived from said seed, said plant having an increased resistance to pathogens.

The invention also relates to vegetal material of a plant of the invention, such as roots, leaves, flowers, callus, etc.

Within the context of this invention, the term "inactivated" or "inactivation", in relation to WAKl 12 or its orthologs, indicates a reduction in the level of active WAKl 12 protein present in the cell or plant. Such a reduction is typically of about 20%, more preferably 30%, as compared to a wild-type plant. Reduction may be even more substantial (e.g., above 50%, 60%, 70% or 80%), or even complete (e.g., as a result of complete gene destruction).

Inactivation of WAKl 12 or orthologs thereof may be carried out by techniques known per se in the art such as, without limitation, by genetic means, enzymatic techniques, chemical methods, or combinations thereof. Inactivation may be conducted at the level of DNA, mRNA or protein, and inhibit the expression (e.g., transcription or translation) or the activity of WAKl 12. A preferred inactivation method affects expression and leads to the absence of production of a functional WAKl 12 protein in the cells. It should be noted that the inhibition of WAKl 12 may be transient or permanent.

In a first embodiment, inactivation of WAKl 12 or its orthologs is produced by deletion, mutation, insertion and/or substitution of one or more nucleotides in the WAKl 12 gene. This may be performed by techniques known per se in the art, such as e.g., site-specific mutagenesis, ethyl methanesulfonate (EMS) mutagenesis, targeting induced local lesions in genomes (TILLING), homologous recombination, conjugation, etc. A particular approach is gene inactivation by insertion of a foreign sequence, e.g., through transposon mutagenesis using mobile genetic elements called transposons, which may be of natural or artificial origin.

According to another embodiment, WAKl 12 is inactivated by gene silencing using RNA interference.

WAKl 12 production in a plant may also be reduced by mutating or silencing genes involved in the WAKl 12 kinase biosynthesis pathway. Alternatively, WAKl 12 synthesis and/or activity may also be manipulated by (over)expressing negative regulators of WAKl 12, such as transcription factors or second messengers. In another embodiment, a mutant allele of a gene involved in WAKl 12 production may be (over)expressed in a plant.

WAKl 12 inactivation may also be performed transiently, e.g., by applying (e.g., spraying) an exogenous agent to the plant, for example molecules that inhibit WAKl 12 expression. Preferred inactivation is a permanent inactivation produced by destruction of the integrity of the WAKl 12 gene, e.g., by insertion of a foreign sequence or by deletion of a fragment (e.g., at least 50 consecutive bp) of the gene sequence. Such modification, as illustrated in the examples, leads to a drastic reduction in the expression of an active WAKl 12 protein in the plant, while the plant is still viable.

In a preferred embodiment, WAKl 12 inactivation is produced by deletion and/or insertion of a fragment of at least 50 consecutive bp on chromosome 10 of the plant, between the genomic positions 5554559 and 5561117. The invention thus provides a method for producing a plant having increased resistance to pathogens, preferably to fungal pathogens, wherein the method comprises the following steps: (a) inactivation of the WAK1 12 gene, or an ortholog thereof, in a plant cell;

(b) optionally, selection of plant cells of step (a) with inactivated WAK112 gene;

(c) regeneration of plants from cells of step (a) or (b); and

(d) optionally, selection of a plant with increased resistance to fungal pathogens, said plant with increased resistance to fungal pathogens having an inactivated WAK112 gene.

Inactivation of the WAK1 12 gene can be done as disclosed above. In a preferred method, inactivation is caused by WAK112 gene destruction using e.g., a transposon of natural or artificial origin, such as retrotransposon Tosl7. Genetic alteration in the WAK1 12 gene may also be performed by transformation using the Ti plasmid and Agrobacterium infection method, according to the protocol described e.g., by Toki et al (2006).

Selection of plant cells having an inactivated WAK112 gene can be made by techniques known per se to the skilled person (e.g., PCR, hybridization, use of a selectable marker gene, protein dosing, western blot, etc.).

Plant generation from the modified cells can be obtained using methods known per se to the skilled worker. In particular, it is possible to induce, from callus cultures or other undifferentiated cell biomasses, the formation of shoots and roots. The plantlets thus obtained can be planted out and used for cultivation. Methods for regenerating plants from cells are described, for example, by Fennell et al. (1992) Plant Cell Rep. 11 : 567- 570; Stoeger et al (1995) Plant Cell Rep. 14: 273-278; Jahne et al. (1994) Theor. Appl. Genet. 89: 525-533.

The resulting plants can be bred and hybridized according to techniques known in the art. Preferably, two or more generations should be grown in order to ensure that the genotype or phenotype is stable and hereditary. Selection of plants having a increased resistance to a pathogen can be done by applying the pathogen to the plant, determining resistance and comparing to a wt plant. Within the context of this invention, the term "increased" resistance to pathogen means a resistance superior to that of a control plant such as a wild type plant, to which the method of the invention has not been applied. The "increased" resistance also designates a reduced, weakened or prevented manifestation of the disease symptoms provoked by a pathogen. The disease symptoms preferably comprise symptoms which directly or indirectly lead to an adverse effect on the quality of the plant, the quantity of the yield, its use for feeding, sowing, growing, harvesting, etc. Such symptoms include for example infection and lesion of a plant or of a part thereof (e.g., different tissues, leaves, flowers, fruits, seeds, roots, shoots), development of pustules and spore beds on the surface of the infected tissue, maceration of the tissue, accumulation of mycotoxins, necroses of the tissue, sporulating lesions of the tissue, colored spots, etc. Preferably, according to the invention, the disease symptoms are reduced by at least 5% or 10% or 15%, more preferably by at least 20% or 30% or 40%, particularly preferably by 50% or 60%, most preferably by 70% or 80% or 90% or more, in comparison with the control plant.

Preferred plants or cells of the invention should be homozygous with respect to WAK1 12 gene inactivation, i.e., both WAK1 12 alleles are inactive.

In the most preferred embodiment, the method of the invention is used to produce rice plants having an inactivated WAK112 gene, more preferably Oryza sativa with increased resistance to Magnaporthe oryzae. Examples of such plants, and their capacity to resist pathogens are disclosed in the experimental section.

Screening of plant resistance modulators

The invention also discloses novel methods of selecting or producing regulators of plant resistance, as well as tools and constructs for use in such methods.

In a particular aspect, the invention relates to a method for screening or identifying a molecule that modulates plant resistance, the method comprising testing whether a candidate compound modulates WAK112 gene expression or activity. The test can be performed in a cell containing a reporter DNA construct cloned under control of WAK1 12 promoter sequence, or in a cell expressing WAK112.

Preferably, such a method comprises the following steps:

- providing a cell comprising a nucleic acid construct that comprises the sequence of a WAK1 12 gene promoter operably linked to a reporter gene;

- contacting the cell with a candidate molecule;

- measuring the activity of WAK112 promoter by monitoring of the expression of a marker protein encoded by the reporter gene in the cell; and

- selecting a molecule that modulates the expression of the marker protein.

Preferred modulators are inhibitors of the expression of WAK112. In this regard, the inventors have found that chitin, a major component of fungal cell wall, is involved in WAK1 12 repression as shown in Figures 1 and 2, showing that small drug or compounds may act to repress WAK1 12 expression.

In a further embodiment, the invention thus also relates to the use of a compound that inhibits WAK1 12 for increasing resistance of plants to fungal pathogens. Such compounds are typically identified using the above method of screening. The use of such compounds typically comprise exposing a plant to such compound, e.g., by spraying or in admixture with water, thereby causing transient WAK1 12 inactivation, and transient increase in resistance to pathogens.

The present invention also relates to nucleic acid molecules suitable for use in the above methods and/or for constructing plants of the invention.

In a particular embodiment, the invention relates to a nucleic acid construct comprising a promoter sequence of a WAK112 gene or an ortholog thereof, which is operably linked to a reporter gene. "Operably linked" means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter. A reporter gene operably linked to a promoter is "under transcriptional initiation regulation" of the promoter. In another embodiment, the invention relates to an isolated cDNA comprising a nucleic acid sequence selected from:

(a) a nucleic acid sequence which encodes a WAK112 or an ortholog thereof, or a fragment thereof;

(b) a nucleic acid sequence of SEQ ID NO: 1, 3, 4 or 5, or a fragment thereof ;

(c) a nucleic acid sequence which hybridizes to the sequence of (a) or (b) under stringent conditions, and encodes a kinase; and

(d) a mutant of a nucleic acid sequence of (a), (b) or (c).

Stringent hybridization/washing conditions are well known in the art. For example, nucleic acid hybrids that are stable after washing in O.lx SSC, 0.1% SDS at 60°C. It is well known in the art that optimal hybridization conditions can be calculated if the sequence of the nucleic acid is known. Typically, hybridization conditions can be determined by the GC content of the nucleic acid subject to hybridization. Typically, hybridization conditions uses 4 - 6 x SSPE (20x SSPE contains Xg NaCl, Xg NaH2P04 H20 and Xg EDTA dissolved to 1 1 and the pH adjusted to 7.4); 5-1 Ox Denhardts solution (50x Denhardts solution contains 5g Ficoll), 5g polyvinylpyrrolidone, 5g bovine serum albumen; X sonicated salmon/herring DNA; 0.1-1.0%s sodium dodecyl sulphate; optionally 40-60% deionised formamide. Hybridization temperature will vary depending on the GC content of the nucleic acid target sequence but will typically be between 42-65 °C.

The present invention also relates to a recombinant vector comprising a nucleic acid molecule as described above. Such a recombinant vector may be used for transforming a cell or a plant in order to increase plant resistance to fungal pathogens, or to screen modulators of resistance. Suitable vectors can be constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate. Preferably the nucleic acid in the vector is under the control of, and operably linked to an appropriate promoter or other regulatory elements for transcription in a host cell such as a microbial, (e.g. bacterial), or plant cell. The vector may be a bi-functional expression vector which functions in multiple hosts. In a preferred aspect, the promoter is a constitutive or inducible promoter. In a preferred embodiment, the recombinant vector is pCAMBIA2300OX: : WAK112.

Further aspects and advantages of the invention are provided in the following examples, which are given for purposes of illustration and not by way of limitation. EXAMPLES

MATERIALS AND METHODS WAK112d mutant production

The insertion mutant for the WAK112d gene was characterized. The mutant harbors an insertion of the retrotranspososon Tosl7 at the genomic position 5557872 of chromosome 10 (WAK112d gene is between 5554559 and 5561 117).

Different PCR primers were used to genotype the line at the insertion site. The Tail6 primer (GTACTGTATAGTTGGCCC ATGTCC ; SEQ ID NO: 6) is positioned on the Tosl7 insertion and the primers AT5F (GGTCACTGGCTCCTTCAGTC; SEQ ID NO: 7) and AT5R (CATCTTCCACCGTGATGTGA; SEQ ID NO: 8) are on genomic DNA. A combination of the Tail6 and AT5F primers allows the identification mutant alleles. The combination of the AT5F and AT5R allows the identification of the wild- type allele.

Gene expression studies

Gene expression was performed using Quantitative RT-PCR as described in Vergne et al (2007). For RT-QPCR applications, frozen tissue were ground in liquid nitrogen. Approximately 500 μ{ of powder was then treated with 1ml of TRIZOL supplied by Invitrogen, vortexed for 30 s and incubated at room temperature for 15 minutes. The samples were centrifuged (10 min, 12 000 rpm at 4°C) and the supematants were collected in new 2 mi fresh tubes. Then 200μ1 of chloroform were added and the samples were shaked for 15 8 (no vortex) and incubated at room temperature 5-10 min. After centrifugation (12 000 rpm, 4°C) 3 phases were obtained. The supematants (approximatively 400μ1) were transfered to new 1,5 ml fresh tubes, and 200μ1 of isopropanol was added. Samples were incubated 5 min at room temperature, and then centrifuged (30 min, 10 000 rpm, 4°C) to obtain RNA pellets. After elimination of isopropanol, pellets were washed with 70% ethanoi and resuspendend in distilled water. Polysaccharides were removed by adding a last centrifugation step (10 00(3 rpm, 4°C, 60 s). They formed a translucent pellet (or drop). RNA samples (5 g) were denaturated for 5 min at 65°C with oligo dT (3.5 μ.Μ) and d^'NTP (1.5 μΜ). They were then subjected to reverse transcription for 60 min at 37°C with 200 U of reverse transcriptase M-MLV (Promega, Madi son, WI, USA) in the appropriate buffer. Two microlitres of cDNA (dilution 1/10) were then used for quantitative RT-PCR. Quantitative RT-PCR mixtures contained PGR buffer, dNTP (0.25 mM), MgC12 (2.5 mM), forward and reverse primers ( 150 or 300 μΜ), 1 U of HotGoldStar polymerase and SYBR Green PCR mix as per the manufacturer's recommendations (Eurogentec, Seraing, Belgium). Amplification was performed as fol lows: 95°C for 10 min; 40 cycles of 95°C for 15 s, 62°C for 1 min and 72°C for 30 s; then 95°C for 1 min and 55°C for 30 s. The quantitative RT-PCR (QRT- PCR) reactions were performed using a MX3000P machine (Stratagene) and data were extracted using the MX3000P software. The amount of plant RNA in each sample was normalized using actin (Os03g50890) as internal control. Primers used for the WAK112d gene were ATql6F (TCGCAATACCCGGATTTAGT; SEQ ID NO: 9) and ATql6R (TTAGGATCCCA AATCGCTTG; SEQ ID NO: 10).

Treatments with pathogens

Magnaporthe oryzae was inoculated as described in Vergne et al (2007). The rice cultivar Nipponbare {Oryza sattva L.) and two races, FRO and CL3.6.7 of blast fungus {Magnaporthe oryzae) were used. The race CL367 is incompatible and race FR13 is compatible with Nipponbare. Rice plants and fungus were grown as described in Berruyer et al (2003). The inoculation was carried out by spraying conidial suspension (2 x 10⁵ conidia/ml) and mock suspension on the third leaf of three week old rice seedlings. The third leaves were harvested at 0.25, 0.50, 1, 1 .50, 2, 4, 8, 24, 48, 72 and 96h after infection for total RNA extractions and expression analysis by QRT-PCR. For mutant phenotyping inoculation was carried out by spraying 25 x 10^J conidia/ml of FR1.3 race (compatible strain which normally leads to disease) whereas for expression analysis 2 x 10³ conidia/ml of conidial suspension was used, on fourth leaves of four week old plants. All treated seedlings were placed in dark boxes with 100% relative humidity for 24 h . The fourt leaves for mutant phenotyping were harvested and scanned at 5 days after infection for lesion observations and quantifications.

Puccinia was inoculated as described in Tufan et al (2009).

Plants over-expressing the WAK112d gene

The WA 1 12d coding sequence was amplified by RT-PCR with primers containing Gateway extensions (underlined sequences below). The primers used were : ATFL I 2-F (SEQ ID NO : 11): GGGGAC AAGTTTGTAC AAA AAAGCAGGCTGATGCTTAGCTAGACATGC and ATFL12-R (SEQ ID NO: 12): GGGGACCACTTTGTACAAGAAAGCTGGGTGGATAAACACATCTACCGTGG. The corresponding cDNA (3125 bp including Gateway extensions) was cloned into the pCAMBIA2300 OX vector using the BP elonase (Invitrogen).

The integrity of the coding sequence was checked by complete re-sequencing of the insert in the transformation vector (pCAMBIA2300OX/WAKl 12).

This vector was used to transform rice (cultivar Nipponbare) using a derived protocol from Toki et al (2006). Transformant plants (TO) were selected on kanamycin. The number of insertions of the T-DNA was measured by Southern Blot using a kanamycin probe. Only single insertion plants were selected for further phenotyping in the Tl generation.

Example 1: The WAK112 gene is repressed during infection by Magnaporthe oryzae

The gene was found to be repressed during infection (Figure 1). The WAK112 gene is repressed up to 4-fold after inoculation by virulent (FR13) and avirulent (CL367) isolates. Chitin, a major component of fungal cell wall, could be the signal inducing this repression. Example 2: Chitin is sufficient to trigger WAK122d differential expression

We tested whether this repression pattern could be triggered by chitin. Chitin was purchased at Yaizu Suisankagaku Industrial (Shizuoka, Japan) and used as described in Miya et al (2007). The data show that chitin is sufficient to cause WAK112 repression (Figure 2). This expression pattern is likely due to the detection, by an unknown receptor, of chitin. Example 3: WAK112 Tosl7 mutants no longer express the WAK112 gene

Tosl7 mutant insertion lines were produced and tested. The inventors have identified by PCR WAK112-defective plants homozygous for the Tosl7 insertion ("ho") in the WAK1 12 gene. Then, the inventors have verified that the expression of the WAK112 gene was abolished in the insertion "ho" mutant (Figure 3A).

Example 4: WAK112 mutants are more resistant to infection

The "ho" and "wt" lines have been tested for resistance to Magnaporthe virulent isolate FR13 (Figures 3B and 4). Repeated experiments showed that the "ho" mutant plants displayed less lesions than "wt" plants. The average lesion number was 1.5-fold lower in "ho" plants than in "wt" plants. This was true for three independent "ho" lines as compared to three independent "wt" lines, confirming that the phenotype observed is not due to an unknown mutation. This indicates that the mutation in the WAK1 12 gene increases resistance to rice blast. Example 5: the WAK112 gene is repressed after infection with Puccinia tnticina (wheat pathogen).

The non-adapted fungus Puccinia tnticina has been shown to represses the WAK112 gene (Figure 5). The WAK112 gene is repressed up to 4-fold after inoculation by Puccinia triticina isolate.

Example 6: Plants over-expressing the WAK112 gene are more susceptible to Magnaporthe

In order to further demonstrate that the WAK112 is a negative regulator of resistance to Magnaporthe, we built plants over-expressing WAK1 12. The WAK1 12 coding sequence was cloned under the control of the constitutive maize ubiquitin promoter (Figure 6). Nipponbare plants were transformed with the pUBI: :WAK1 12 plasmid using Agrobacterium infection, according to the protocol described by Toki et al (2006) and modified during the Genoplante CAGRILL program. The expression of the WAKl 12 transgene was measured in TO plants during transfer from in vitro to soil. Plants were allowed to recover, were splitted when tillering occurred in order to perform inoculation. Preliminary data on TO plants indicate that over-expression of the WAKl 12 gene increases susceptibility to Magnaporthe (Figure 7).

These data thus confirm that the WAKl 12 is a negative regulator of resistance to Magnaporthe and that the enhanced resistance to Magnaporthe observed in the AEUE06 mutants (Figures 3B and 4) is due to the mutation "loss of function" in the WAKl 12 gene.

Conclusions

Altogether, the expression data and the phenotypical data indicate that the WAKl 12 gene is a negative regulator of resistance to Magnaporthe. This is the first example ever found of a plant receptor-like kinase negatively regulating disease resistance.

Example 7: WAK112 homology with other genes

There exists a large number of WAK proteins in plant genomes. For example, in rice there is more than 140 WAK proteins, Zhang et al., 2005. However, there is a clear phylogenetic separation between WAK proteins in different plants, and therefore it is not possible to predict the biological function of different WAKs from the available data. For example, the amino acid homology between WAKl 12 of rice and OsWAKl of rice is only 33%.

Example 8: WAK112 orthologs

Furthermore, the inventors have carried out Tblastn searches with the WAKl 12 protein from rice and have identified several orthologs in wheat, barley and sorghum. Table 1 shows BBMH established by blasting back (protein or nucleic acid) on rice. To see if homology uncovers phylogenetic relationship and possibly functional homology, the inventors have tested whether the cereal homologs were in turn the best blast hit (Best Blast Mutual Hit=BBMH) on rice.

Table 1 : Orthologs of WAK112

REFERENCES

Khush, G. (2005) What it will take to Feed 5.0 Billion Rice consumers in 2030. Plant Molecular Biology, 59(1): 1-6.

Khush, GS. and Jena, KK , (2009) Current status and future prospects for research on blast resistance in rice (Oryza sativa L.) In GL Wang (ed.) and B Valent (ed.). Advances in Genetics, Genomics and Control of Rice Blast Disease, p.1-10, Springer.

Savary, S., Willocquet, L., Elazegui, F.A., Castilla, N.P., and Teng, P.S. (2000) Rice Pest Constraints in Tropical Asia: Quantification of Yield Losses Due to Rice Pests in a Range of Production Situations. Plant Disease, 84(3): 357-369.

Jones, J.D.G., and Dangl, J.L. (2006) The plant immune system. Nature, 444(7117): 323-329.

Ballini, E., Morel, J.-B., Droc, G.t., Price, A., Courtois, B., Notteghem, J.-L., and Tharreau, D. (2008) A Genome- Wide Meta- Analysis of Rice Blast Resistance Genes and Quantitative Trait Loci Provides New Insights into Partial and Complete Resistance. Molecular Plant-Microbe Interactions, 21(7): 859-868.

White, F.F. and Yang, B. (2009) Host and Pathogen Factors Controlling the Rice-Xanthomonas oryzae Interaction. Plant Physiology, 150(4): 1677-1686.

Greenberg, J.T., and Yao, N. (2004) The role and regulation of programmed cell death in plant-pathogen interactions. Cellular Microbiology, 6(3): 201-211.

Huckelhoven, R. (2007) Cell Wall Associated Mechanisms of Disease Resistance and Susceptibility. Annual Review of Phytopathology, 45(1): 101-127.

Jwa, N.-S., Agrawal, G.K., Tamogami, S., Yonekura, M., Han, O., Iwahashi, H, and Rakwal, R. Role of defense/stress-related marker genes, proteins and secondary metabolites in defining rice self-defense mechanisms. Plant Physiology and Biochemistry, 44(5-6): 261-273.

Lee, SW, Han, SW, Sririyanum, M, Park, CJ, Seo, YS, Ronald, PC. (2009) A type I-secreted, sulfated peptide triggers XA21 -mediated innate immunity. Science, 326(5954):850-853. Peters, RJ. (2006) Uncovering the complex metabolic network underlying diterpenoid phytoalexin biosynthesis in rice and other cereal crop plants. Phytochemistry, 67(21): 2307-2317.

van Loon, L.C., Rep, M., and Pieterse, C.M.J. (2006) Significance of Inducible Defense-related Proteins in Infected Plants. Annual Review of Phytopathology, 44(1): 135-162.

Eulgem T. (2005) Regulation of the Arabidopsis defense transcriptome. Trends Plant Sci. 2005 Feb; 10(2):71-8. Review.

Vergne E, Ballini E, Marques S, Sidi Mammar B, Droc G, Gaillard S, Bourot S, DeRose R, Tharreau D, Notteghem JL, Lebrun MH, Morel JB. Early and specific gene expression triggered by rice resistance gene Pi33 in response to infection by ACE1 avirulent blast fungus. New Phytol. 2007; 174(1): 159-71. PubMed PMID: 17335506.

Tufan HA, McGrann GR, Magusin A, Morel JB, Miche L, Boyd LA. Wheat blast: histopathology and transcriptome reprogramming in response to adapted and nonadapted Magnaporthe isolates. New Phytol. 2009 Oct;184(2):473-84. Epub 2009;Jul 23. PubMed PMID: 19645735.

Berruyer R, Adreit H, Milazzo J, Gaillard S, Berger A, Dioh W, Lebrun MH, Tharreau D. Identification and fine mapping of Pi33, the rice resistance gene corresponding to the Magnaporthe grisea avirulence gene ACE1. Theor Appl Genet. 2003 Oct; 107(6): 1 139-47. Epub 2003 Jun 28. PubMed PMID: 12838393.

Miya A, Albert P, Shinya T, Desaki Y, Ichimura K, Shirasu K, Narusaka Y, Kawakami N, Kaku H, Shibuya N. CERKl, a LysM receptor kinase, is essential for chitin elicitor signaling in Arabidopsis. Proc Natl Acad Sci U S A. 2007 Dec 4; 104(49): 19613-8. Epub 2007 Nov 27. PubMed PMID: 18042724; PubMed Central PMCID: PMC2148337.

Toki S, Hara N, Ono K, Onodera H, Tagiri A, Oka S, Tanaka H. Early infection of scutellum tissue with Agrobacterium allows high-speed transformation of rice. Plant J. 2006 Sep;47(6):969-76. PubMed PMID: 16961734.

Claims

1. A plant comprising an inactivated WAK112 gene or an ortholog thereof and exhibiting an increased resistance to fungal pathogens.

2. The plant of claim 1, wherein said plant is a cereal, preferably selected from rice, wheat, barley, oat, rye, sorghum or maize.

3. The plant of claim 1 or 2, wherein said WAK112 gene or an ortholog thereof is inactivated by deletion, insertion and/or substitution of one or more nucleotides, site- specific mutagenesis, ethyl methanesulfonate (EMS) mutagenesis, targeting induced local lesions in genomes (TILLING) or by gene silencing induced by RNA interference.

4. A seed of the plant of any one of claims 1 to 3.

5. A plant, or a descendent of a plant grown or otherwise derived from the seed of claim 4.

6. A method for producing a plant having increased resistance to fungal pathogens, wherein the method comprises the following steps:

(a) inactivation of the WAK1 12 gene, or an ortholog thereof, in a plant cell;

(c) regeneration of plants from cells of step (a) or (b); and

(d) optionally, selection of a plant of (c) with increased resistance to fungal pathogens, said plant having an inactivated WAKl 12 gene, or an ortholog thereof.

7. The method according to claim 6, wherein said WAKl 12 inactivation of step (a) is carried out by deletion, insertion and/or substitution of one or more nucleotides, site- specific mutagenesis, ethyl methanesulfonate (EMS) mutagenesis, targeting induced local lesions in genomes (TILLING) or by gene silencing induced by RNA interference.

8. The method according to claim 6 or 7, wherein the plant is a cereal, preferably selected from rice, wheat, barley, oat, rye, sorghum or maize.

9. The method according to any one of claims 6 to 8, wherein said fungal pathogens are selected from Magnaporthe, Puccinia, Aspergillus, Ustilago, Septoria, Erisyphe,

Rhizoctonia and Fusarium species.

10. The method according to claim 9, wherein the pathogen is Magnaporthe oryzae.

11. A method of identifying a molecule that modulates WAK112 gene expression, the method comprising:

(a) providing a cell comprising a nucleic acid construct that comprises a WAKl 12 gene promoter that is operably linked to a reporter gene;

(b) contacting the cell with a candidate molecule;

(c) measuring the activity of WAKl 12 promoter by monitoring of the expression of a marker protein encoded by the reporter gene in the cell; (d) selecting a molecule that modulates the expression of the marker protein.

12. The method of claim 11, wherein the molecule inhibits the expression of WAKl 12.

13. The method according to claim 12, wherein said molecule is an analog of chitin.

14. Use of the molecule selected according to any one of claims 11 to 13 for increasing resistance of plants to fungal pathogens.

15. A method for conferring or increasing resistance to fungal pathogens to a plant, comprising a step of inhibiting the expression of WAKl 12 gene in said plant.

16. A nucleic acid molecule comprising a promoter sequence derived from a WAKl 12 gene or an ortholog thereof, which is operably linked to a reporter gene.

17. An isolated cDNA comprising a nucleic acid sequence selected from:

(a) a nucleic acid sequence which encodes a WAKl 12 kinase or an ortholog thereof, or a fragment thereof;

(b) a nucleic acid sequence of SEQ ID NO: 1, 3, 4 or 5, or a fragment thereof ;

(c) a nucleic acid sequence which hybridizes to the sequence of (a) or (b) under stringent conditions, and encodes a WAKl 12 kinase or an ortholog thereof; and (d) a mutant of a nucleic acid sequence of (a), (b) or (c).

18. A recombinant vector comprising a nucleic acid molecule of claim 17, for transforming a cell or a plant.

19. A cell or plant transformed with the recombinant vector of claim 18.

20. Seeds of the plant of claim 19.

21. An oligonucleotide between about 10 and about 100 nucleotides in length, which specifically hybridizes with a portion of a nucleic acid sequence of claim 17.

22. A loss-of-function WAK l 12 mutant cereal plain with increased resistance to fungal pathogens.