WO2012033407A2

WO2012033407A2 - Method for diagnosing colorectal cancer

Info

Publication number: WO2012033407A2
Application number: PCT/NL2011/050612
Authority: WO
Inventors: Harold Tjalsma
Original assignee: Stichting Katholieke Universiteit
Priority date: 2010-09-10
Filing date: 2011-09-08
Publication date: 2012-03-15
Also published as: WO2012033407A3

Abstract

The invention describes a method for assessing the risk of a subject of developing colorectal cancer and/or for diagnosing early stage colorectal cancer. It relies on detection of Enterobacterial manifestation in the colon by means of blood samples. Increased Enterobacterial manifestation in the colon in subjects compared to healthy control subjects is indicative of an increased risk of developing colorectal cancer.

Description

Method for diagnosing colorectal cancer Field of the invention

The present invention is in the medical field, more particular in the field of assessing the risk of developing colorectal cancer (CRC) and/or diagnosis of CRC.

Background

The human intestinal tract contains about 10¹⁴ bacteria, comprising ~10³ species, which are essential for digestion of food, the control of intestinal epithelial homeostasis, intestinal development and human health (Hooper and Gordon 2001). Conversely, a large body of evidence supports a relationship between infective agents and human cancers (Parkin 2006) and that certain mucosa-associated bacterial species play an important role in the pathogenesis of CRC (Mager 2006, Rowland 2009, zur Hausen 2006). Moreover, clinical associations between bacterial infection and CRC have been described for many decades, the most prominent of which concern infections with Streptococcus bovis (Boleij et al 2009, Waisberg et al 2002) and Clostridium septicum (Seder et al 2009). However, the co-incidence of these infections with CRC is very low (<1%) since such low-grade opportunistic pathogens can only become clinically manifest in compromised patients. Correspondingly, serological data have shown an increased exposure to S. bovis antigens in early stage CRC patients without clinical signs of bacterial infection (Tjalsma et al 2006). Based on this, it has been suggested that specific gut bacteria have a competitive advantage in the CRC microenvironment, whereas opportunistic infections remain repressed by the active immune system in the majority of patients. Despite this vast body of circumstantial evidence, no clinical data have thus far been available to directly show different bacterial colonization patterns between colon tumors and non-malignant colonic mucosa.

Summary of the Invention

The present inventors used deep pyrosequencing of bacterial rRNA to compare the CRC tumor microbiome to that of adjacent non-malignant mucosa across six patients. The inventors have found that the intrinsic mucosal microbiome of a minority of the human population contains Enterobacterial species that can drive the initiation and progression of colon adenomas and carcinomas. Thereby, this colonization makes that these individuals are at increased risk for CRC.

Without wishing to be bound by theory, it is hypothesised that upon CRC progression, the tumor microenvironment changes in such a way that these tumor initiators are gradually replaced by commensal-like species or bacteria with proposed probiotic properties that have increased access to and/or can more efficiently forage in the altered tumor microenvironment. This may explain the long time frame during which pre-malignant lesions develop into carcinomas.

The present inventors have now identified bacteria that are involved in initiation and progression of colon adenomas and carcinomas.

Thus, the present invention provides a method for assessing the risk of a subject of developing CRC and/or diagnosing CRC, such as diagnosing early stage CRC, said method comprising the steps of: a) determining the level of immunoglobulins specifically binding to one or more bacteria of the family Enterobacteriaceae in a test sample, said test sample being a blood-derived test sample of bodily fluid of said subject, and b) comparing the level of immunoglobulins specifically binding to said one or more bacteria of the family Enterobacteriaceae in said test sample with the level of immunoglobulins specifically binding to said one or more bacteria of the family Enterobacteriaceae in a reference sample, wherein a level of immunoglobulins specifically binding to said one or more bacteria of the family Enterobacteriaceae in the test sample compared to the reference sample is indicative of an increased risk of developing CRC and/or a diagnosis of CRC, such as early stage CRC.

The method may be for assessing the risk of a subject of developing CRC, or may be for diagnosing of CRC, such as diagnosing early stage CRC, or both.

In an embodiment, the bacteria of the family Enterobacteriaceae are selected from genera of the group consisting of Salmonella, Citrobacter, Cronobacter, Kluyvera, Serratia, and Shigella.

In a suitable embodiment, the levels of immunoglobulins specifically binding to at least 3 different bacteria of the family Enterobacteriaceae are determined, preferably 3 different bacteria selected from the genera Salmonella, Citrobacter, Cronobacter, Kluyvera, Serratia, and Shigella. In an embodiment, the immunoglobulins comprise immunoglobulin G (IgG). They may also comprise immunoglobulin A (IgA), or any of the other types of immunoglobulins .

In an embodiment, the test sample of bodily fluid is a blood-derived test sample, preferably selected from the group consisting of a whole blood sample, and a serum sample.

In one embodiment, the reference sample is derived from one or more healthy subjects, and an increased level of immunoglobulins specifically binding to said one or more bacteria of the family Enterobacteriaceae in the test sample compared to the reference sample is indicative of an increased risk of developing CRC and/or a diagnosis of CRC, such as early stage CRC.

In another embodiment, the reference sample is derived from one or more subjects known to be at risk of developing CRC and/or one or more subjects diagnoses with early stage CRC, and a similar level of immunoglobulins specifically binding to said one or more bacteria of the family Enterobacteriaceae in the test sample compared to the reference sample is indicative of an increased risk of developing CRC and/or a diagnosis of CRC, such as early stage CRC.

In another aspect, the present invention relates to a kit suitable for assessing the risk of a subject of developing CRC and/or diagnosing CRC comprising a solid carrier comprising at least two antigens derived from two different bacteria of the family Enterobacteriaceae being selected from the group consisting of Salmonella, Citrobacter, Cronobacter, Kluyvera, Serratia, and Shigella, and optionally a container comprising anti- human immunoglobulin antibodies. In an embodiment, the kit further comprises an enzymatic substrate to produce a visible signal upon binding of the anti- human immunoglobulin antibodies, which may be contained in a separate container.

Detailed Description of the Invention

The present invention relates to a method for assessing the risk of a subject of developing CRC and/or diagnosing CRC, such as early stage CRC, said method comprising the steps of: a) determining the level of immunoglobulins specifically binding to one or more bacteria of the family Enterobacteriaceae in a test sample, said test sample being a blood-derived test sample of bodily fluid of said subject, and b) comparing the level of immunoglobulins specifically binding to said one or more bacteria of the family Enterobacteriaceae in said test sample with the level of immunoglobulins specifically binding to said one or more bacteria of the family Enterobacteriaceae in a reference sample, wherein an increased level of immunoglobulins specifically binding to said one or more bacteria of the family Enterobacteriaceae in the test sample compared to the reference sample is indicative of an increased risk of developing CRC and/or a diagnosis of CRC.

The method may be for assessing the risk of a subject of developing CRC, or may be for diagnosing of CRC. The method of the invention may particularly be used for diagnosing early stage CRC. The method may also be used for monitoring a subject for the onset or stage of CRC. The term "early stage CRC" as used herein refers to Stage 0, and, optionally, Stage I CRC.

The term "colorectal cancer" ("CRC") as used herein includes cancerous growths in the colon, rectum and appendix. CRC is also called "colon cancer" or "large bowel cancer". CRCs arise from adenomatous polyps in the colon. These mushroom-shaped growths are usually benign, but some develop into cancer over time. Localized colon cancer is usually diagnosed through colonoscopy. CRC can take many years to develop and early detection of CRC greatly improves the chances of cure. If caught in an early stage, CRC is one of the most curable cancer types.

The subject may be an animal subject, for example a mammalian subject. In an embodiment, the subject is a human subject.

In a first step of the method of the invention, the level of immunoglobulins specifically binding to one or more bacteria of the family Enterobacteriaceae in a test sample is determined.

Immunoglobulins (Ig's) are gamma globulin proteins that are found in blood or other bodily fluids of vertebrates, and are used by the immune system to identify and neutralize foreign objects, such as bacteria and viruses. They are typically composed of two large heavy chains and two small light chains. Several different types of antibody heavy chains, and several different kinds of antibodies exist, which are grouped into different isotypes based on which heavy chain they possess. Five different antibody isotypes are known in mammals (IgA, IgD, IgE, IgG, and IgM) which perform different roles, and help direct the appropriate immune response for each different type of foreign substance they encounter. A small region at the tip of the protein is extremely variable (the hypervariable region), allowing millions of antibodies with slightly different tip structures, or antigen binding sites, to exist. Each of these variants can bind to a different target, known as an antigen. This huge diversity of antibodies allows the immune system to recognize an equally wide variety of antigens. In an embodiment, the immunoglobulins that are determined in the method of the present invention comprise immunoglobulin G (IgG). They may also comprise immunoglobulin A (IgA), or any of IgD, IgE, and IgM.

As used herein, the term "immunoglobulins specifically binding to one or more bacteria of the family Enterobacteriaceae" refers to immunoglobulins that are specific for a specific bacterial genus or species belonging to the family of Enter obacteriaceae. They may also be referred to as anti-Enterobacterial Ig's, for example, anti-Salmonella Ig's, anti-Citrobacter Ig's, ant -Cronobacter Ig's, anti-Kluyvera Ig's, anti-Serratia Ig's, antx-Shigella Ig's, anti-Salmonella typhimurium Ig's, and the like.

The Enterobacteriaceae are a large family of bacteria, including many of the more familiar pathogens, such as Salmonella. In an embodiment of the method of the invention, the bacteria of the family Enterobacteriaceae are selected from genera of the group consisting of Salmonella, Citrobacter, Cronobacter, Kluyvera, Serratia, and Shigella, preferably, Salmonella. The immunoglobulins may be specific for a species belonging to the genera Salmonella, Citrobacter, Cronobacter, Kluyvera, Serratia, and Shigella, preferably Salmonella, or may be specific for the genus as a whole. Antigens of several species belonging to one genus may be highly homologous and as such, immunoglobulins may specifically bind to antigens that are shared by two or more species belonging to the same genus. Also, immunoglobulins may specifically bind to antigens that are shared by all species belonging to one genus, or even to antigens that are shared by several bacterial species of various genera. Preferably, immunoglobulins specifically bind to an antigen of a species, preferably a single species, belonging to a single genus of Enterobacteriacea; a preferred genus is Salmonella.

The test sample of bodily fluid may be any bodily fluid sample, but is preferably a test sample derived from blood or from tissue liquid of said subject. Advantageously, said test sample is a blood-derived sample of said subject, preferably a whole blood sample or a serum sample.

In the method of the invention, the level of said immunoglobulins may be determined by methods well known in the art, e.g., using an enzyme immunoassay. The term "enzyme immunoassay" ("EIA"), also called enzyme-linked immunosorbent assay (ELISA), is a biochemical technique that is well known in the art. It is used mainly in immunology to detect the presence of an antibody or an antigen in a sample. In ELISA, an unknown amount of antigen may be affixed to a surface, and then a specific antibody is washed over the surface so that it can bind to the antigen. This antibody may be linked to an enzyme, and in the final step a substance is added that the enzyme can convert to some detectable signal. For example, in the case of fluorescence ELISA, when light of the appropriate wavelength is shone upon the sample, any antigen/antibody complexes will fluoresence so that the amount of antigen in the sample can be inferred through the magnitude of the fluorescence signal.

In the method of the present invention, the antigen responsible for generating the anti-Enterobacterial Ig's may be affixed to a surface. The test sample may then be contacted with the antigen, causing binding of the anti-Enterobacterial Ig's to the antigen. Binding of the anti-Enterobacterial Ig's may then be detected using a conjugated secondary antibody specific for the Ig in question (for example, anti-human immunoglobulin antibodies), and a substrate cleaved by the conjugate to the secondary antibody. Any detection method may be used.

In step b) of the method of the present invention, the level of immunoglobulins specifically binding to said one or more bacteria of the family Enterobacteriaceae in said test sample with the level of immunoglobulins specifically binding to said one or more bacteria of the family Enterobacteriaceae in a reference sample. The reference sample may be derived from a healthy subject or from one or more subjects known to be at risk of developing CRC and/or one or more subjects diagnosed with CRC, such as early stage CRC. The reference sample is preferably treated in the same way as is the test sample. Thus, preferably the reference sample is sampled in the same way as is the test sample, and the determination of the level of immunoglobulins in the reference sample is performed under the same conditions as the level of immunoglobulins in the test sample to allow a fair comparison of the test sample and reference sample. It is not necessary to determine the level of immunoglobulins specifically binding to said one or more bacteria of the family Enterobacteriaceae in a reference sample each time a test sample is measured; once the level of immunoglobulins specifically binding to said one or more bacteria of the family Enterobacteriaceae is reliably determined in a reference sample, the level values may be stored, e.g., in a computer, and used for the comparative purposes herein set forth. In one embodiment, the reference sample is derived from one or more healthy subjects, in which case an increased level of immunoglobulins specifically binding to said one or more bacteria of the family Enterobacteriaceae in the test sample compared to the reference sample is indicative of an increased risk of developing CRC and/or a diagnosis of CRC, such as early stage CRC.

As used herein, the level of immunoglobulins specifically binding to said one or more bacteria of the family Enterobacteriaceae in a test sample is increased when it is significantly higher than the level of said immunoglobulins in a reference sample. It is also considered increased when the level of said immunoglobulins in the test sample is at least 20%, 25%, 30%, 35%, 40%, 45%, 50% higher than the level of the corresponding immunoglobulin(s) in the reference sample.

In another embodiment, the reference sample is derived from one or more subjects known to be at risk of developing CRC and/or one or more subjects diagnosed with CRC, such as early stage CRC, and a similar level of immunoglobulins specifically binding to said one or more bacteria of the family Enterobacteriaceae in the test sample compared to the reference sample is indicative of an increased risk of developing CRC and/or a diagnosis of CRC, such as early stage CRC.

As used herein, the the level of immunoglobulins specifically binding to said one or more bacteria of the family Enterobacteriaceae in a test sample is similar when the level of said immunoglobulins in the test sample differs less than about 20%>, such as less than about 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%), 5%, 4%, 3%, 2% from the level of the corresponding immunoglobulin(s) in the reference sample.

In a suitable embodiment, the levels of immunoglobulins specifically binding to at least 2 different bacteria of the family Enterobacteriaceae are determined, preferably 3, more preferably at least 4, yet more preferably at least 5 or 6, different bacteria, selected from the genera Salmonella, Citrobacter, Cronobacter, Kluyvera, Serratia, and Shigella. The co -utilization of several of such genera/species from the family Enterobacteriaceae provides a more reliable measure of the risk assessment or early stage CRC diagnosis.

Preferably, the use of anti-Salmonella typhimurium Ig's, more preferably IgG's, is included in the method of the invention. Preferably, the determination of the level anti-Salmonella typhimurium immunoglobulins, more preferably anti-Salmonella typhimurium IgG's, is included in the method of the invention.

The invention is also concerned with a kit suitable for assessing the risk of a subject of developing CRC and/or diagnosing CRC comprising a solid carrier comprising at least two antigens derived from two different bacteria of the family Enterobacteriaceae being selected from the group consisting of Salmonella,

Citrobacter, Cronobacter, Kluyvera, Serratia, and Shigella, and optionally, a container comprising anti- human immunoglobulin antibodies. The solid carrier may be any solid carrier known in the art, for example, an array, chip, or beads (e.g., Luminex). Such solid carrier can advantageously be used in carrying out an indirect ELISA using methods well known in the art. The antigens are to bind specifically to the

immunoglobulins specifically binding to said one or more bacteria of the family Enterobacteriaceae. Binding of the immunoglobulins to said antigens may then be detected using any means known in the art, e.g., binding of the immunoglobulins may be demonstrated using antibodies against said immunoglobulins which are conjugated to a molecule to react with, for example, an enzymatic substrate to produce a detectable signal upon binding.

In an embodiment, the solid carrier comprises at least three, such as at least 4, at least 5, or at least 6 different antigens derived from at at least three, such as at least 4, at least 5, or at least 6 different bacteria of the family Enterobacteriaceae, preferably selected from genera from the group consisting of Salmonella, Citrobacter, Cronobacter, Kluyvera, Serratia, and Shigella. In an advantageous embodiment, at least 2, 3, 4, 5, or 6 different antigens specific for the genera Salmonella, Citrobacter, Cronobacter, Kluyvera, Serratia, and Shigella are comprised on the solid carrier. The kit may further comprise an enzymatic substrate to produce a detectable signal upon binding of the anti-human immunoglobulin antibodies to the immunoglobulins specifically binding to said one or more bacteria of the family Enterobacteriaceae. Such substrate is preferably comprised in a separate container.

The solid carrier may further comprise other antigens, such as non-

Enterobacterial antigens, for example, antigens that are derived from other bacteria inhabiting the colon. Such antigens may be derived from bacteria that have been associated with (the presence of) colorectal tumors. Alternatively, colorectal tumor antigens may be comprised on said solid carrier.

In this document and in its claims, the verb "to comprise" and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition, the verb "to consist" may be replaced by "to consist essentially of meaning that a composition of the invention may comprise additional component(s) than the ones specifically identified, said additional component(s) not altering the unique characteristics of the invention.

In addition, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article

"a" or "an" thus usually means "at least one".

All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety.

It will be clear that the above description and the examples are included to illustrate some embodiments of the invention, and not to limit the scope of protection.

Starting from this disclosure, many more embodiments will be evident to a skilled person which are within the scope of protection and the essence of this invention and which are obvious combinations of prior art techniques and the disclosure of this patent.

Figure legends

Figure 1. CoUinsella- and Salmonella-specific DNA fragments were PCR-amplified from total DNA that was extracted from tumor/off-tumor samples of 24 CRC patients. Positive samples were plotted as the percentage of total number of samples.

Figure 2. Anti-Flagelin IgG levels were measured in serum samples from polyp and CRC patients and in samples from asymptomatic age-matched controls. Anti-FlaS IgG levels were expressed as arbitrary Salmonella typhemurium units (STU); median levels are indicated. Nijmegen population: controls (n=27); polyp patients (n=12); CRC patients (n=37); Detroit population: controls (n=47); polyp patients (n=l 1); CRC patients (n=33). Significance of different antibody expression levels is indicated by: *, p < 0.05; **, p < 0.01.

Examples

Example 1: Method for diagnosing colorectal cancer

Materials and Methods

Patient Material. Six patients underwent resections for primary colon adenocarcinoma at the Radboud University Nijmegen Medical Centre. After resection, the colonic specimens were extensively rinsed with sterile water. From each sample, biopsies were taken from the tumor site ("on-tumor") and from adjacent non-malignant tissue ("off- tumor") on the luminal side of the colonic wall. Tissue specimens were stored at -80°C and disrupted by mechanical shearing after which total DNA was extracted using the AllPrep DNA/RNA kit (Qiagen). Serum samples from 37 early stage (non- metastasized) CRC patients and 35 healthy age-matched blood donors were used for serological analysis. All samples were stored at -80 °C until use.

Ethics Statement. Research was conducted according to the principles expressed in the Declaration of Helsinki. The study was approved by the Medical Ethical Committee of the district Amhem-Nijmegen (The Netherlands); patients provided written informed consent for the collection of samples and subsequent analysis when required.

Denaturing Gradient Gel Electrophoresis (DGGE). Using total DNA from the 12 colonic biopsies as a template, bacterial 16S rRNA genes were amplified by a nested approach (Boon et al 2002) using the primers pairs 27f/1492r Lane (Lane et al 1991) and L1401r/968f-GC (Nubel et al 1996) in two subsequent PCR reactions (Table 1). DGGE was performed on the resulting PCR mixture as described previously (Scanlan et al 2008). It should be noted that visible bands in DGGE represent bacterial species that have an abundance of at least 1-10% of the total community, whereas low abundant species will not result in a detectable bands by this approach. Ribosomal Intergenic Spacer Analysis (RISA). Using total DNA from the 12 colonic biopsies as a template, bacterial ribosomal intergenic spacer regions were amplified with primers 1406f and 23Sr (Table 1 (Borneman and Triplett 1997)). RISA was performed as described previously (Scanlan et al 2008). FLX 454 titanium pyrosequencing. In the second step of the nested PCR approach, the VI -V3 region of the bacterial 16S rRNA gene was amplified using primer pairs tagged with 12 distinct Metagenome IDentification (MID) tags (Table 1). 454 sequencing was performed at the University of Liverpool's Advanced Genomics Facility. Sequences were deposited in the Short Read Archive (http://www.ncbi.nlm.nih.gov/sra) under the accession number: SRA012451 {released upon publication). Read processing and community diversity. All partial 16S rRNA gene sequences were processed initially using the Pyro-pipeline at the Ribosomal database project (RDP, (Cole et al 2009); Release 10) to trim and remove primers from the partial ribotags and to limit sequences to >400bp and <500bp. This step provided the datasets for analysis with read length histograms. The data from all the samples was processed using MOTHUR (Schloss et al 2009) to generate indices of diversity, rarefaction curves and to undertake the Libshuff analysis of sample similarity. MOTHUR was run using the computational facilities of the Advanced Research Computing @ Cardiff (ARCCA) Division, Cardiff University. Comparisons of the libraries from an individual was performed using the RDP's Library compare tool. Analysis of the ribotags was also performed using MEGAN (Huson et al 2009) for which the input was the csv output from the RDP's classifier pipeline (using default settings and a confidence level of 50%). The comparison tool was selected and reads normalized between samples and Bonferroni correction used to highlight differences between samples. An alignment independent analysis of the date was also undertaken using 5-mers and frequency landscape distribution (fLAND) analysis (Rudi et al 2006, Rudi et al 2007a, Rudi et al 2007b). The generation of the 5-mers was performed using a bespoke PERL script (written by BED; available on request) and PCA analysis was undertaken in MATLAB on ARCCA, the fLAND analysis was performed using the software fLAND. Consistency analysis. Biases in microbiota between the on-tumor and off-tumor samples across patients were summarized in order to identify taxa which were either consistently enriched or consistently depleted in the two niches. All pyrosequencing reads were first mapped to the SILVA comprehensive database of aligned, quality checked 16S/18S rRNA sequences >300nt (version SSUParc lOO; (Pruesse et al 2007)) using BLAT v34 with default parameters and cutoffs (Kent 2002). We assumed that each read was derived from a different micro-organism and that the sampling of reads represented the taxonomic distribution within the intestinal microbiota. For each sample, every read was assigned to its most similar sequence in the SILVA database and a summary of the taxonomic annotations of the detected database sequences was generated. Each taxonomic clade was assessed to determine whether it showed a higher fraction of reads in off-tumor or on-tumor samples for every patient, and a consistency score was calculated by counting "+1" if the clade was higher off-tumor, "-1" if the clade was higher on-tumor, and "0" if the fraction of reads on- and off-tumor was identical (e.g. if the clade was not measured in this patient). Finally, these scores were summed, yielding an overall consistency score between -6 and +6 that reflects how consistently the clade was enriched or depleted across all patients. Note that each sequence in the SILVA database has two taxonomic annotations, i.e. EMBL and RDP. Some sequences are better annotated by EMBL than by RDP, and vice versa.

Salmonella anti-Flagellin IgG ELISA. To measure serum anti-Flagellin IgG levels, ELISA microtiter plates (Maxisorp Nunc) were first coated with recombinant Flagellin protein from Salmonella typhimurium (0.15 μg/ml; Invivogen) in 50 mM NaHC03 (pH9.5) during a 48 hour incubation at 4°C. Next, the anti-Flagelin IgG titers in 100- fold diluted serum samples were determined as described previously (Boleij et al 2010). Anti-Flagelin IgG levels were expressed as arbitrary Salmonella Units (SU) relative to the IgG levels in a control sample from a patient with a known Salmonella bloodstream infection.

Results

CRC microbiome analyses

As a first exploration, profiles of bacterial 16S rRNA genes were generated using DGGE and RISA for tumor and matching adjacent non-malignant (off-tumor) mucosa from 6 early stage CRC patients. The microbial communities of tumor tissue and adjacent "off-tumor" mucosa were strikingly different. This result sharply contrasts with the previous observations that the colonic mucosal microbiota is almost identical at adjacent sites in healthy subjects (Ahmed et al 2007, Eckburg et al 2005, Green et al 2006, Palmer et al 2006, Zoetendal et al 2002). This intriguing finding inspired us to further define the colon tumor microbiome at a deeper level. We amplified and sequenced the V1-V3 region of the bacterial 16S rRNA genes, resulting in a total of 193,880 ribotags of length >400 bp. The data showed high coverage values (>88%) and rarefaction curves indicated satisfactory sampling of the communities at 90% identity. Libshuff analysis showed that all on- and off-tumor communities were significantly different from each other (p<0.0001). Importantly, both alignment-dependent and independent methods support the observation of these altered tumor microbiomes.

CRC Drivers & Passengers

To pinpoint consistent microbiome changes during formation of CRC, the within- patient sample pairs were compared. Consistency across all patients was calculated for each taxon individually by giving it a score of if the normalized number of sequence reads of that taxon in the tumor tissue was higher than in matching off-tumor mucosa, if the taxon was more abundant in healthy mucosa and "0" if it was not detected at all in that patient. Summing these scores across patients resulted in a consistency score from -6 to +6 for each taxon. This analysis showed that CRC tissue was consistently associated with overrepresentation of the subclass of Coriobacteridae, especially the genera Slackia and Collinsella, which can be regarded as gut commensals. Notably, reduced numbers of Collinsella spp. and Roseburia spp. (here with score -4) have been found in elderly subjects using non-steroidal antiinflammatory drugs compared to non-users (NSAID; (Makivuokko et al 2009)), suggesting that these bacteria need inflammatory niches to optimally colonize the bowel wall. Interestingly, the genera Roseburia, Fusobacterium and Faecalibacterium, which are moderately enriched in tumors (consistency score -3) belong to the major butyrate producing intestinal bacteria. Butyrate is thought to be protective against CRC by inducing a p21 -dependent cell cycle arrest resulting in an increased apoptosis rate of carcinogenic cells (Bordonaro et al 2008). The effects of butyrate are however still under debate as tumor inhibition may for instance be restricted to the early phases of carcinogenesis (Bordonaro et al 2008).

Considering the above data, we could draw the conclusion that the CRC microenvironment is preferably colonized by intestinal bacteria with anti-tumorigenic and anti-carcinogenic properties, which thereby may prevent rapid progression of this disease. However, one could also argue that for instance butyrate provides an additional energy source for tumor cells, while dampening the inflammatory response stops the innate immune system from attacking the nascent tumor. Thus, both tumor suppressing or tumor promoting scenarios may be possible outcomes of different colonization patterns in CRC patients.

It is remarkable, however, that the adjacent off-tumor mucosa of the investigated patients is preferentially colonized by members of the Enterobacteriaceae, such as Citrobacter, Shigella, Cronobacter, Kluyvera, Serratia and Salmonella spp. (scores between +4 and +6). The family of Enterobacteriaceae contains genuine pathogens, which may be responsible for an increased susceptibility for CRC by for instance inducing an asymptomatic, but chronic, inflammatory response in the colonic mucosa. Additionally, several Enterobacteria produce DNA damaging genotoxin and may contribute to the accumulation of mutations that characterize the adenoma-carcinoma sequence. This idea is strengthened by the fact that no Enterobacterial 16S rRNA sequences were observed in the intestinal microbiomes of healthy individuals (among 11,831 ribotags (Eckburg et al 2005)), whereas this bacterial family was detectably present in non-malignant colonic mucosa samples from CRC patients (Ahmed et al 2007). Furthermore, a recent metagenomic inventory of the intestinal micobiome of 124 individuals showed that Salmonella, Citrobacter, and Cronobacter were low abundant intestinal species, whereas the tumor-overrepresented species Ruminococcus, Faecalibacterium, Roseburia and Collinsella were among the more dominant inhabitants of the human intestinal tract (Qin et al 2010). Moreover, Shen and colleagues recently published an inventory of adherent bacteria in normal colonic mucosa of 21 adenoma (polyp) and 23 non-adenoma subjects by clone sequencing of bacterial 16S rRNA (335 clones). This study showed that Shigella spp were among the bacteria with increased abundance in the intrinsic (non-malignant) microbiome of adenoma patients (Shen et al 2010).

To further gain evidence for the hypothesis that invasive Enterobacterial species colonize the tract of a minority of the human population in which these bacteria establish a intestinal chronic, "subclinical", infection that contributes to the development of CRC, we tested whether early stage CRC patients are indeed prone to an increased exposure to Enterobacterial antigens. To this purpose, we used an ELISA to measure serum IgG against the flagellin protein from Salmonella typhimurium (FlaS) in early stage CRC patients (n=37) and healthy age matched controls (n=35). These analyses showed a significant (p=0.002) increase in anti-FlaS IgG titers in CRC patients (median 7.6; range 4.4-14.1) compared to the healthy control subjects (median 6.1; range 3.8-11.0). In contrast, the humoral immune response to endotoxin, a general intrinsic component of the cell wall from many intestinal bacteria, was not increased in CRC patients (Boleij et al 2010), implicating that the increased anti-FlaS IgG levels in CRC patients cannot be attributed to a general loss of intestinal barrier function. Moreover, it should be realized that about 20-30% of the elderly population contains asymptomatic colon adenomas, which is a potential pre-malignant precursor of sporadic CRC. Thus, the control samples from individuals with relatively high anti- FlaS titers may concern those from individuals with increased susceptibility to CRC. Together, this finding is in-line with the concept that increased Enterobacterial bowel colonization is associated with increased risk for CRC and points towards the use of Enterobacterial antigens as novel biomarkers in CRC risk assessment.

Table 1. Primers used in this study.

Primer Reference Sequence

DGGE

27f [1] 5 ' -AGAGTTTGATYMTGGCTCAG

1492r [1] 5 ' -TACGGYTACCTTGTTACGACTT

L1401 r [2] 5 ' -CGGTGTGTACAAGACCC

5 ' -CCCGCCGCGCCCCGCGCCCGTCCCG

968f-GC [2]

CCGCCCCCGCCCGAACGCGAAGAACCTTAC

RISA

1406f [3] 5 ' -TGYACACACCGCCCGT

23Sr [3] 5' -GGGTTBCCCCATTCRG

454 Pyrosequencing

16S. V1V3. Ml DA. _For This study 5' ^■ACGAGTGCGTGCCTAACACATGCAAGTC

16S. V1V3_ .Ml DA. .Rev This study 5' ^■ACGAGTGCGTATTACCGCGGCTGCTGG

16S. V1V3. .MIDB. _For This study 5' ^■ACGCTCGACAGCCTAACACATGCAAGTC

16S. V1V3_ .MIDB. .Rev This study 5' ^■ACGCTCGACAATTACCGCGGCTGCTGG

16S. V1V3_ .Ml DC _For This study 5' ^■AGACGCACTCGCCTAACACATGCAAGTC

16S. V1V3_ .Ml DC. _Rev This study 5' ^■AGACGCACTCATTACCGCGGCTGCTGG

16S. V1V3_ .MIDD. _For This study 5' ^■AGCACTGTAGGCCTAACACATGCAAGTC

16S. V1V3_ .MIDD. _Rev This study 5' ^■AGCACTGTAGATTACCGCGGCTGCTGG

16S. V1V3. MIDE. _For This study 5' ^■ATCAGACACGGCCTAACACATGCAAGTC

16S. _V1V3_ .MIDE. _Rev This study 5' -ATCAGACACGATTACCGCGGCTGCTGG

16S. _V1V3. MIDF. .For This study 5' ^■CGTGTCTCTAGCCTAACACATGCAAGTC

16S. _V1V3_ .MIDF. .Rev This study 5' ^■CGTGTCTCTAATTACCGCGGCTGCTGG

16S. _V1V3. MIDG. _For This study 5' ^■CTCGCGTGTCGCCTAACACATGCAAGTC

16S. _V1V3_ .MIDG. _Rev This study 5' ^■CTCGCGTGTCATTACCGCGGCTGCTGG

16S. _V1V3_ .MIDH _For This study 5' ^■TAGTATCAGCGCCTAACACATGCAAGTC

16S. _V1V3_ .MIDH _Rev This study 5' ^■TAGTATCAGCATTACCGCGGCTGCTGG

16S. _V1V3. _MIDI_ For This study 5' ^■TCTCTATGCGGCCTAACACATGCAAGTC

16S. _V1V3. _MIDI_ Rev This study 5' -TCTCTATGCGATTACCGCGGCTGCTGG

16S. _V1V3. _MIDJ_ For This study 5' -TGATACGTCTGCCTAACACATGCAAGTC

16S. _V1V3. _MIDJ_ Rev This study 5' -TGATACGTCTATTACCGCGGCTGCTGG

16S. _V1V3. MIDK _For This study 5' -TACTGAGCTAGCCTAACACATGCAAGTC

16S. _V1V3. MIDK _Rev This study 5' -TACTGAGCTAATTACCGCGGCTGCTGG

16S. _V1V3. _MIDL_ .For This study 5' -ATATCGCGAGGCCTAACACATGCAAGTC

16S. _V1V3. _MIDL_ .Rev This study 5' -ATATCGCGAGATTACCGCGGCTGCTGG Example 2: Method for diagnosing colorectal cancer MATERIAL & METHODS

Patient material. Twenty four patients underwent resections for primary colon adenocarcinoma at the Radboud University Nijmegen Medical Centre. After resection, the colonic specimens were extensively rinsed with sterile water. From each sample, biopsies were taken from the tumor site and from adjacent non-malignant tissue on the luminal side of the colonic wall. Tissue specimens were stored at 80°C and disrupted by mechanical shearing after which total DNA was extracted using the AllPrep DNA/RNA kit (Marchesi et al., 2011). Blood samples were derived from the same collections as used before in our studies (Boleij et al., 2010). However, here we primarily focused on the early stages of CRC {i.e. colorectal polyps and local stage of colorectal cancer). Serum samples from 37 CRC and 12 polyp patients who had been admitted to the Radboud University Nijmegen Medical Centre (Nijmegen, The Netherlands) were used. As control samples, serum from 27 healthy blood donors (>50 years) was used. In addition, plasma samples from 33 CRC, 11 polyp patients and 47 healthy controls who participated in a population-based case-control study in Metropolitan Detroit (USA), were included as a second independent study population. CRC samples concerned localized disease (stage I or II), with the exception of 7 Detroit cases with unknown stage. The use of the samples was approved by the Medical Ethical Committee of Nijmegen/ Arnhem (#2006/078) and Wayne State University Human Investigation Committee (#0409000504); informed consent was obtained when required. Serum and plasma samples were stored at -80 °C until use.

PCR validation. Differential bacterial colonization patterns that were observed by deep pyrosequencing (Marchesi et al., 2011) were validated by conventional polymerase chain reaction (PCR) amplification of specific DNA fragments from Columella with primers c-Atopo-F (5 '-GGGTTGAGAGACCGACC-3) c-Atopo-R

('5 '-CGGRGCTTCTTCTG CA GG-3'; Matsuki et al, 2004) and from Salmonella with primers InvA-139 (5 '-GTGAAATTATCGCC ACGTTCGGGCAA-3 ')/ InvA-141 (5'- TC ATCGCACCGTCAAAGGAACC-3 ' ; Rahn et al, 1992) using total DNA from 48 malignant and non-malignant colonic biopsies as a template. PCR products were analyzed by agarose gel electrophoresis. The samples were scored positive or negative for the respective absence or presence of a specific bacterial amplification product. Salmonella anti-Flagellin IgG ELISA measurements. The FlaS ELISA assay was build and performed as described before (Boleij et al., 2010). A few improvements were made as we observed that background levels due to non-specific binding of serum immunoglobulins to the ELISA plate could vary significantly between samples. First, after antigen (AG) coating for at least 18 hours at 4°C, the well was extensively blocked by 1% bovine serum albumin (BSA) in PBS-Tween20 (0.1%) for 2 hours at 37°C. In addition, for each antigen-coated well, a duplicate well on the same plate was incubated in coating buffer without antigens and subsequently blocked with 1% BSA (blank). Finally, 1 % BSA was added to all incubation buffers that were used during the ELISA measurements. The optical density of HRP-converted TMB-substrate was quantified at a wavelength of 450 nm in a spectrophotometer. Samples were measured in duplicate and titers of a specific sample were calculated as the mean

- OO450biank and expressed as arbitrary Salmonella typhimurium units (STU) based on a reference sample from a S. typhimurium-mfQcted patient that was measured in every plate. Titers were set to zero in case of a negative outcome of the calculation.

RESULTS

PCR validation of differential colonization of malignant and non-malignant tissues

Pyrosequencing of 16S rRNA genes from tumor and matching adjacent non-malignant (off-tumor) mucosa from 6 CRC patients showed that Collinsella spp were consistently overrepresented in tumor tissue, whereas Salmonella spp were underrepresented in this tissue (Marchesi et al., 201 1). To validate these findings, total DNA was extracted from 24 tumor/off-tumor samples from CRC patients after which specific DNA fragments of these species were amplified by PCR. The data confirmed the colonization preference of Collinsella spp for tumor tissue and Salmonella spp for off- tumor tissue in this independent set of patient samples (Figure 1). Humoral immune response to Flagelin antigen in CRC patients

To investigate whether subclinical infections with Salmonella typhimurium can be monitored in CRC patients by the improved FlaS ELISA assay, serum from polyp and early stage CRC patients and asymptomatic age-matched individuals from the Nijmegen and Detroit populations (Boleij et al, 2010) were measured. As shown in Figure 2, the anti-FlaS IgG titers in serum of tumor patients was significantly increased in both populations, whereas these IgG titers in serum of polyp patients from the Detroit population were also significantly increased. To assess to which extent an antibody response to the S. typhimurium FlaS proteins can be instrumental in the diagnosis of CRC, first a simple strategy was employed in which the highest IgG level in the control group was used as cutoff value for the diseased groups. This implicates that the assay has a 100% specificity as all controls are classified as not diseased. Table 2A shows the respective sensitivity levels of 16%> and 7% for the detection of polyps and tumors in the Nijmegen and Detroit populations. However, as about 20% of the asymptomatic elderly population carries polyps, the sensitivity of the FlaS ELISA assays for CRC was also calculated using lower cutoff levels {i.e. 80 percentile of each control group), which corrects for the asymptomatic polyp carriage in the control group. As shown in 2B, this yielded an increased sensitivity of 27% in the Nijmegen population and 43% in the Detroit population. These data indicate that a serum antibodies against Salmonella antigens are promising complementary markers for the early detection, or risk assessment of, CRC in both European and American populations.

Table 2. Sensitivity and Specificity of Salmonella FlaS ELISA assays for the detection ofCRC¹

(49 cases and 27 non- (44 cases and 47 non-

Nijmegen cases) Detroit cases)

'CRC here includes both polyps and tumor cases; the lower cutoff value in B represents the 80 percentile in each control group which corrects for the about 20% incidence of polyps in the control groups

References

Ahmed S, Macfarlane GT, Fite A, McBain AJ, Gilbert P, Macfarlane S (2007).

Mucosa-Associated Bacterial Diversity in Relation to Human Terminal Ileum and Colonic Biopsy Samples. Appl Environ Microbiol 73: 7435-7442.

Boleij A, Schaeps RM, Tjalsma H (2009). Association between Streptococcus bovis and colon cancer. J Clin Microbiol 47: 516.

Boleij A, Roelofs R, Schaeps RM, Schulin T, Glaser P, Swinkels DW et al (2010).

Increased exposure to bacterial antigen RpL7/L12 in early stage colorectal cancer patients. Cancer 116: 4014-22.

Boon N, De Windt W, Verstraete W, Top EM (2002). Evaluation of nested PCR-

DGGE (denaturing gradient gel electrophoresis) with group-specific 16S rRNA primers for the analysis of bacterial communities from different wastewater treatment plants. FEMS Microbiol Ecol 39: 101-112.

Bordonaro M, Lazarova DL, Sartorelli AC (2008). Butyrate and Wnt signaling: a possible solution to the puzzle of dietary fiber and colon cancer risk? Cell Cycle 7:

1178-1183.

Borneman J, Triplett EW (1997). Molecular microbial diversity in soils from eastern Amazonia: Evidence for unusual microorganisms and microbial population shifts associated with deforestation. Appl Environ Microbiol 63: 2647-2653.

Cole JR, Wang Q, Cardenas E, Fish J, Chai B, Farris RJ et al (2009). The Ribosomal Database Project: improved alignments and new tools for rRNA analysis. Nucl Acids Res 37: D141-145.

Eckburg PB, Bik EM, Bernstein CN, Purdom E, Dethlefsen L, Sargent M et al (2005). Diversity of the Human Intestinal Microbial Flora. Science 308: 1635-1638.

Green GL, Brostoff J, Hudspith B, Michael M, Mylonaki M, Rayment N et al (2006). Molecular characterization of the bacteria adherent to human colorectal mucosa. J Appl Microbiol 100: 460-469.

Hooper LV, Gordon XI (2001). Commensal host-bacterial relationships in the gut. Science 292: 1115-1118.

Huson DH, Richter DC, Mitra S, Auch AF, Schuster SC (2009). Methods for comparative metagenomics. BMC Bioinformatics 10 Suppl 1: S12.

Kent WJ (2002). BLAT-the BLAST-like alignment tool. Genome Res 12: 656-664. Lane DJ, Stackebrandt E, Goodfellow M (1991). 16S/23S rRNA Sequencing. Nucleic Acids Techniques in Bacterial Systematics. John Wiley & Sons: Chichester, pp 115- 175.

Mager DL (2006). Bacteria and Cancer: Cause, Coincidence or Cure? J Transl Med 4:

14.

Marchesi JR, Dutilh BE, Hall N, Peters WH, Roelofs R, Boleij A, Tjalsma H. Towards the human colorectal cancer microbiome. PLoS One 201 l;6:e20447.

Matsuki T, Watanabe K, Fujimoto J, Takada T, Tanaka R.Use of 16S rRNA gene- targeted group-specific primers for real-time PCR analysis of predominant bacteria in human feces. Appl Environ Microbiol. 2004; 70: 7220-8.

Makivuokko H, Tiihonen K, Tynkkynen S, Paulin L, Rautonen N (2009). The effect of age and non-steroidal anti-inflammatory drugs on human intestinal microbiota composition. Br JNutr 103: 227-234.

Nubel U, Engelen B, Felske A, Snaidr J, Wieshuber A, Amann RI et al (1996).

Sequence heterogeneities of genes encoding 16S rRNAs in Paenibacillus polymyxa detected by temperature gradient gel electrophoresis. J Bact 178: 5636-5643.

Palmer C, Bik EM, Eisen MB, Eckburg PB, Sana TR, Wolber PK et al (2006). Rapid quantitative profiling of complex microbial populations. Nucleic Acids Res 34: e5. Parkin DM (2006). The global health burden of infection-associated cancers in the year

2002. Int J Cancer 118: 3030-3044.

Pruesse E, Quast C, Knittel K, Fuchs BM, Ludwig W, Peplies J et al (2007). SILVA: a comprehensive online resource for quality checked and aligned ribosomal RNA sequence data compatible with ARB. Nucleic Acids Res 35: 7188-7196.

Qin JJ, Li RQ, Raes J, Arumugam M, Burgdorf KS, Manichanh C et al (2010). A human gut microbial gene catalogue established by metagenomic sequencing. Nature

464: 59-U70.

Rahn K, De Grandis SA, Clarke RC, McEwen SA, Galan JE, Ginocchio C, Curtiss R, 3rd, Gyles CL: Amplification of an invA gene sequence of Salmonella typhimurium by polymerase chain reaction as a specific method of detection of Salmonella. Mol Cell Probes 1992; 6: 271-279.

Rowland IR (2009). The role of the gastrointestinal microbiota in colorectal cancer. Cur Pharm Des 15: 1524-1527. Rudi K, Zimonja M, Naes T (2006). Alignment-independent bilinear multivariate modelling (AIBIMM) for global analyses of 16S rRNA gene phylogeny. Int J Syst

Evol Microbiol 56: 1565-1575.

Rudi K, Zimonja M, Kvenshagen B, Rugtveit J, Midtvedt T, Eggesbo M (2007a). Alignment-Independent Comparisons of Human Gastrointestinal Tract Microbial

Communities in a Multidimensional 16S rRNA Gene Evolutionary Space. Appl

Environ Microbiol 73: 2727-2734.

Rudi K, Zimonja M, Trosvik P, Naes T (2007b). Use of multivariate statistics for 16S rRNA gene analysis of microbial communities. Int J Food Microbiol 120: 95-99. Scanlan PD, Shanahan F, Clune Y, Collins JK, O'Sullivan GC, O'Riordan M et al

(2008). Culture-independent analysis of the gut microbiota in colorectal cancer and polyposis. Environ Microbiol 10: 1382.

Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M, Hollister EB et al (2009).

Introducing mothur: Open Source, Platform-independent, Community-supported Software for Describing and Comparing Microbial Communities. Appl Environ

Microbiol 75: 7537-7541.

Seder CW, Kramer M, Long G, Uzieblo MR, Shanley CJ, Bove P (2009). Clostridium septicum aortitis: Report of two cases and review of the literature. J Vase Surg 49:

1304-1309.

Shen X, Rawls J, Randall T, Burcal L, Mpande C, Jenkins N et al (2010). Molecular characterization of mucosal adherent bacteria and associations with colorectal adenomas. Gut Microbes 1: 138-147.

Tjalsma H, Scholler-Guinard M, Lasonder E, Ruers TJ, Willems HL, Swinkels DW (2006). Profiling the humoral immune response in colon cancer patients: Diagnostic antigens from Streptococcus bovis. Int J Cancer 119: 2127-2135.

Waisberg J, Matheus Cde O, Pimenta J (2002). Infectious endocarditis from Streptococcus bovis associated with colonic carcinoma: case report and literature review. Arq Gastroenterol 39: 177-180.

Zoetendal EG, von Wright A, Vilpponen-Salmela T, Ben Amor K, Akkermans AD, de zur Hausen H (2006). Streptococcus bovis: causal or incidental involvement in cancer of the colon? Int J Cancer 119: xi-xii.

Claims

1. Method for assessing the risk of a subject of developing colorectal cancer and/or diagnosing colorectal cancer, said method comprising the steps of:

a) determining the level of immunoglobulins specifically binding to one or more bacteria of the family Enterobacteriaceae in a test sample of bodily fluid of said subject, and

b) comparing the level of immunoglobulins specifically binding to said one or more bacteria of the family Enterobacteriaceae in said test sample with the level of immunoglobulins specifically binding to said one or more bacteria of the family Enterobacteriaceae in a reference sample,

wherein a level of immunoglobulins specifically binding to said one or more bacteria of the family Enterobacteriaceae in the test sample compared to the reference sample is indicative of an increased risk of developing colorectal cancer and/or a diagnosis of colorectal cancer.

2. Method according to claim 1, wherein the method is for assessing the risk of a subject of developing colorectal cancer.

3. Method according to claim 1, wherein the method is for diagnosing of colorectal cancer, such as for diagnosing early stage colorectal cancer.

4. Method according to any one of claims 1 - 3, wherein the bacteria of the family Enterobacteriaceae are selected from genera of the group consisting of Salmonella, Citrobacter, Cronobacter, Kluyvera, Serratia, and Shigella.

5. Method according to claim 4, wherein the levels of immunoglobulins specifically binding to at least 3 different bacteria of the family Enterobacteriaceae are determined.

6. Method according to any of the preceding claims, wherein the immunoglobulins comprise immunoglobulin G (IgG).

7. Method according to any of the preceding claims, wherein the test sample of bodily fluid is a blood-derived test sample.

8. Method according to claim 7, wherein the blood-derived test sample is selected from the group consisting of a whole blood sample, and a serum sample.

9. Method according to any of the preceding claims, wherein the reference sample is derived from one or more healthy subjects, and an increased level of immunoglobulins specifically binding to said one or more bacteria of the family Enterobacteriaceae in the test sample compared to the reference sample is indicative of an increased risk of developing colorectal cancer and/or a diagnosis of colorectal cancer.

10. Method according to any one of claims 1-8, wherein the reference sample is derived from one or more subjects known to be at risk of developing colorectal cancer and/or one or more subjects diagnoses with colorectal cancer, and a similar level of immunoglobulins specifically binding to said one or more bacteria of the family Enterobacteriaceae in the test sample compared to the reference sample is indicative of an increased risk of developing colorectal cancer and/or a diagnosis of colorectal cancer.

11. Method according to any of the preceding claims, wherein the level of anti- Salmonella typhimurium immunoglobulins are determined.

12. A kit suitable for assessing the risk of a subject of developing colorectal cancer and/or diagnosing colorectal cancer comprising a solid carrier comprising at least two antigens derived from two different bacteria of the family Enterobacteriaceae being selected from the group consisting of Salmonella, Citrobacter, Cronobacter, Kluyvera, Serratia, and Shigella, and optionally, a container comprising anti-human immunoglobulin antibodies.

13. A kit according to claim 12, further comprising an enzymatic substrate to produce a visible signal upon binding of the anti-human immunoglobulin antibodies.