WO2012030745A1 - MULTIVITAMIN TARGETING OF RNAi THERAPEUTICS - Google Patents

Abstract

Conjugates comprising vitamin B12 (Fig. 1) and oligonucleotides are useful in inhibiting expression of other oligonucelotides in a cell.

Description

MULTIVITAMIN TARGETING OF RNAi THERAPEUTICS

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Application No. 61/378,272, filed August 30, 2010, the contents of which is incorporated by reference in its entirety into the present application.

TECHNICAL FIELD

[0002] The invention relates to the delivery of RNA interference (RNAi) therapeutics such as microRNA (miRNA), small interfering RNA (siRNA) and other oligonucleotides across biological barriers using naturally-occurring vitamin transport systems.

BACKGROUND

[0003] RNA interference (RNAi) is a process that occurs within living cells which involves the binding of small oligonucleotides to RNA to either increase or decrease the activity of that RNA, which are typically derived from genes. A typical example is the binding of a small interfering RNA (siRNA) to an RNA to prevent a messenger RNA (mRNA) from producing a protein. In its natural environment, RNA interference has an important role in defending cells against parasitic genes - viruses and transposons - but also in directing development as well as gene expression in general.

[0004] Extensive research into RNAi since its discovery in the 1990s has yielded many highly promising siRNA sequences with potential for providing therapeutic benefit. The major challenge has become the effective delivery of RNAi therapeutics to the cytoplasm of diseased cells (Castanotto and Rossi (2009) Nature 457:426-433).

[0005] RNAi delivery approaches can be categorized as either: (1) involving the native oligonucleotide, in which the oligonucleotide is encapsulated in a nanostructure such as a virus particle or other lipid-based carrier, or a nanoparticle polymer system, typically a cationic polymer such as polyethylenimine forming a polyelectolyte complex (PEC) to protect the oligonucleotide during transport; or (2) covalently linking the oligonucleotide to a targeting system. The linkage group is typically cleavable either by enzymes typically found within the cytoplasm or under certain physical conditions.

[0006] R Ai delivery systems have been reviewed in the literature, for example, Whitehead et al. (2009) Nature Reviews Drug Discovery 8: 129-138. RNAi therapeutics have advanced to clinical trials, but effective intracellular delivery of oligonucleotides remains suboptimal, and many technical challenges still need to be addressed (Ruenraroengsak et al. (2010) J. Controlled Release 141 :265-276).

[0007] This disclosure provides a new delivery system that addresses and overcomes the limitations of prior approaches. SUMMARY OF THE INVENTION

[0008] It is one object of the present invention to provide a novel oligonucleotide delivery system (oligonucleotide conjugates) by covalently attaching to the oligonucleotide to molecules of vitamin B12, directly and/or via certain linker or spacer groups, and with optionally attached additional groups which are known in the art and can assist in one or more of cell targeting, avoidance of the RES, and/or release of the oligonucleotide or

oligonucleotide conjugate into the cell cytoplasm.

[0009] It is an additional object of the present invention that the above oligonucleotide conjugate can be formulated (oligonucleotide formulations) to provide some protection from degradation or denaturing of the oligonucleotide or oligonucleotide carrier in body compartments in which the oligonucleotide or oligonucleotide carrier might otherwise, if unprotected, be caused to degrade, denature or metabolize.

[0010] It is an additional object of the present invention that the above oligonucleotide conjugates and oligonucleotide formulations have the potential benefit of transportation from one body compartment to another by utilizing the body's natural transportation mechanisms for vitamin B12, including, but not limited to, transportation from the gut lumen to the portal blood vein in the ileum of the GI tract, passage across cell membranes to enter cellular compartments, and traverse major biological barriers such as the blood-brain barrier.

[0011] It is an additional object of the present invention that the above oligonucleotide conjugates and oligonucleotide formulations can release the oligonucleotide in a controlled manner, and that oligonucleotide release can result from cleavage of the oligonucleotide from the oligonucleotide conjugate within target cells.

[0012] It is an additional object of the present invention that the above oligonucleotide conjugates can release the oligonucleotide at sites within the body to achieve a

therapeutically-meaningful effect.

[0013] It is an additional object of the present invention that the oligonucleotide conjugates and oligonucleotide formulations can degrade in the body to permit the components of the formulation and of the conjugate to be safely metabolized and eliminated from the body.

[0014] It is an additional object of the present invention that the above oligonucleotide conjugates and oligonucleotide formulations can formulated by methods known in the art to provide pharmaceutical preparations suitable for administration to patients. Examples of pharmaceutical preparations that might be suitable for the oligonucleotide conjugates and oligonucleotide formulations of this invention include, but are not limited to, tablets or capsules for oral administration, lyophilized powers in vials for subsequent reconstitution with a pharmaceutically-acceptable vehicle for injection into the patient, or liquids comprising the oligonucleotide conjugates and oligonucleotide formulations in

pharmaceutically-acceptable vehicle for injection into the patient.

[0015] It is an additional object of the present invention that the above oligonucleotide conjugates and oligonucleotide formulations be administered to patients for the prevention and treatment of diseases, including, but not limited to cancer, autoimmune conditions, endocrine disorders, diabetes, genetic conditions, genetic diseases such as cystic fibrosis, chromosome conditions, viral infections, bacterial infections, parasitic infections, mitochondrial diseases, sexually transmitted diseases, immune disorders, balance disorders, pain, systemic disorders, blood conditions, blood vessel conditions, nerve conditions, and conditions of muscles, heart and other organs.

[0016] In one mode, the present invention consists of oligonucleotide conjugates formed by the formation of a covalent bond between an oligonucleotide and a compound minimally containing covalently-linked vitamin B12 and optionally containing additional groups which are known in the art and can assist in one or more of cell targeting, avoidance of the RES, and/or release of the oligonucleotide or oligonucleotide conjugate into the cell cytoplasm. The covalent bond can be formed by methods known in the art in a suitable solvent. Vitamin B12 (or VB12) is an essential component of the oligonucleotide conjugate, and introduced either prior to or after formation of the covalent blond between the oligonucleotide and the linker/spacer group.

[0017] In a further mode, the present invention consists of oligonucleotide conjugates formulated in delivery systems such as polymer nanoparticles (for example, polyelectrolyte complexes, whereby two synthetic or natural polymers are brought together in a suitable solvent in which one polymer contains multiple charged and/or ionisable groups of net positive charge and the other polymer contains multiple charged and/or ionisable groups of net negative charge), liposomes, micelles, or other drug delivery carrier systems known in the art, and whereby the carrier system may be covalently-linked to vitamin B12 and/or additional groups which are known in the art and may assist in one or more of cell targeting, avoidance of the RES, and/or release of the oligonucleotide or oligonucleotide conjugate into the cell cytoplasm, such that at least some VB12 and some of the optional additional groups are located at the surface of the delivery system such that these groups may be effective in providing one or more of cell targeting, avoidance of the RES, and/or release of the oligonucleotide or oligonucleotide conjugate into the cell cytoplasm.

[0018] In a further mode, the present invention consists of oligonucleotide conjugates formed as described above and VB12 and/or other functional groups provided for one or more of cell targeting, avoidance of the RES, and/or release of the oligonucleotide or

oligonucleotide conjugate into the cell cytoplasm are introduced to the surface of the oligonucleotide formulation after formation of said formulation either by formation of a covalent bond between the particle surface and VB12 or VB12 derivative, or by the formation of a physical bonds (ionic, hydrophilic, and/or hydrophobic) between the particle and VB12 or VB12 derivative.

[0019] B12 contains a monodentate axial ligand (see Figure 1). It is known in the art that these axial ligands can be exchanged under appropriate conditions, and such ligand exchange is incorporated as part this disclosure. For example, it is known that nitrosyl cobalamin can be effective as an antitumor agent because it serves to deliver nitric oxide to tumors (for example, Bauer (1998) Anti-Cancer Drugs 9:239) and it may be desirable to convert VB12 in the nanoparticles of this invention to the nitrosyl form to enhance the therapeutic effect. In addition, in order to link the VB12 molecule to an oligonucleotide or to a polymer via an optional linker, the VB12 may be connected to the linker through the cobalt atom of VB12 by way of a ligand exchange process, as described in for example U.S. Application

20020115595; Bagnato et al. (2004) J. Org. Chem. 69:8987.

BRIEF DESCRIPTION OF THE FIGURES

[0020] Figure 1 depicts a structure of vitamin B12.

[0021] Figure 2 is a schematic of one embodiment of this invention. [0022] Figure 3 depicts a schematic of a nanoparticle conjugate. Nanoparticle is a formulation of the oligonucleotide polymer conjugates of the current invention optionally formulated with other polymers (grey strands), other functional groups (grey circles) and other excipients whereby the oligonucleotide conjugates are primarily physically embedded in the nanoparticle. [0023] Figure 4 depicts a schematic of a nanoparticle of polymer conjugates. Nanoparticle is a formulation of the oligonucleotide conjugates of the current invention optionally formulated with other polymers (grey strands), other functional groups (grey circles) and other excipients whereby the oligonucleotide conjugates are primarily physically embedded in the nanoparticle. DETAILED DESCRIPTION OF THE INVENTION

Definitions

[0024] All technical and patent publications cited herein are incorporated herein by reference in their entirety.

[0025] All numerical designations, e.g., pH, temperature, time, concentration, and molecular weight, including ranges, are approximations which are varied ( + ) or ( - ) by increments of 0.1 or 1.0, as appropriate. It is to be understood, although not always explicitly stated that all numerical designations are preceded by the term "about". It also is to be understood, although not always explicitly stated, that the reagents described herein are merely exemplary and that equivalents of such are known in the art.

[0026] As used in the specification and claims, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. [0027] "Comprising" refers to compounds, compositions and methods including the recited elements, but not exclude others. "Consisting essentially of," when used to define compounds, compositions or methods, shall mean excluding other elements that would materially affect the basic and novel characteristics of the claimed technology. "Consisting of," shall mean excluding any element, step, or ingredient not specified in the claim.

Embodiments defined by each of these transition terms are within the scope of this technology.

[0028] As used herein, "nanoparticle" or "nanostructure" refers a microscopic particle less than about 1 micron in diameter. In some embodiments, the nanoparticles range in size from about 1 nm to about 1,000 nm diameter, or alternatively between about 10 nm to about 1000 nm, or alternatively between about 10 nm to about 900 nm, or alternatively between about 10 nm to about 800 nm, or alternatively between about 10 nm to about 700 nm, or alternatively between about 10 nm to about 600 nm, or alternatively between about 10 nm to about 500 nm, or alternatively between about 20 nm to about 1000, or alternatively between about 20 nm to about 800 nm, or alternatively between about 20 nm to about 700 nm, or alternatively between about 20 nm to about 600 nm, or alternatively between about 20 nm to about 500 nm; or alternatively between about 30 nm to about 1000 nm, or alternatively between about 30 nm to about 900 nm, or alternatively between about 30 nm to about 800 nm, or alternatively between about 30 nm to about 700 nm, or alternatively between about 100 nm to about 900 nm, or alternatively between about 200 nm to about 1000 nm, or alternatively between about 300 nm to about 1000 nm, or alternatively between about 400 nm to about

1000 nm, or alternatively between about 500 nm to about 1000 nm; or alternatively between about 600 nm to about 1000 nm; or alternatively between about 700 nm to about 1000 nm; or alternatively between about 800 nm to about 1000 nm; or alternatively between about 900 nm to about 1000 nm; or alternatively between about 100 nm to about 300 nm; or alternatively between about 200 nm to about 600 nm; or alternatively between about 300 nm to about 600 nm; or alternatively between about 500 nm to about 800 nm.

[0029] As used herein, "polymer" refers to a naturally-occurring, synthetic or semi-synthetic large molecule (macromolecule) typically composed of repeating structural units connected by covalent chemical bonds. Polymers useful for the implementation of this invention have molecular weights in the range of 1 to 5000 kDa.

[0030] As used herein, "random copolymer" refers to a polymer comprising two or more repeating structural units in which the sequence of the individual repeating structural units is random and not predetermined or defined. [0031] As used herein, "block copolymer" refers to a polymer comprising two or more repeating structural units in which individual repeating structural units are connected to each other forming identifiable blocks of repeating structural units within the complete polymer strand.

[0032] As used herein, "charged group" refers to a chemical functional group that is fully ionized resulting in that group having either a positive or a negative charge, or possibly multiple positive or multiple negative charges. Polymers could have multiple charged groups either as components of the polymer chain, and/or as attachments to the polymer, either direct attachment or by way of a linker. Polymer charged groups may be either naturally-occurring or synthetic. A charged group may be part of a therapeutically active compound, either as an intrinsic component of that compound or as a synthetic analog of the therapeutically active compound, for example a prodrug.

[0033] As used herein, "ionisable group" refers to a chemical functional group that is partially ionized at or close to physiological pH resulting in that group having either a partial positive or a partial negative charge. The charge of an ionisable group will vary with pH. Polymers could have multiple ionisable groups either as components of the polymer chain, and/or as attachments to the polymer, either direct attachment or by way of a linker. Polymer ionisable groups may be either naturally-occuring or synthetic. A ionisable group may be part of a therapeutically active compound, either as an intrinsic component of that compound or as a synthetic analog of the therapeutically active compound, for example a prodrug. [0034] As used herein, "alkyl" refers to a saturated (containing no multiple carbon-carbon bonds) aliphatic (containing no delocalized π-electron system), hydrocarbon containing, if otherwise unsubstituted, only carbon and hydrogen atoms. The designation (nlC- n2C)alkyl, wherein nl and n2 are integers from one to 6, refers to straight or branched chain alkyl groups comprising from nl to and including n2 carbon atoms. An alkyl group herein may be optionally substituted with one or more entities selected from the group consisting of halo, hydroxy, alkoxy, aryloxy, carbonyl, nitro, cyano, carboxyl and alkoxycarbonyl.

[0035] As used herein, "linker" refers to a group of atoms that is used to couple an oligonucleotide to VB12 or to a polymeric backbone to spatially separate the two entities. Thus, a linker of this invention has an essentially longitudinal axis, that is, it is essentially linear rather than highly branched or clumped, although the structure will, of course, not be exactly linear due to the angular constraints placed on the structure by required bond angles between covalently bonded atoms. Examples of linkers include, but are not limited to, straight and branced alkyl and alkenyl groups containing functional groups such as carboxyl, amino, hydroxyl, and thiol, through which covalent bonds can be formed to connect the linker to the polymer and to other components. A preferred linker is a short peptide chain ( H- [NHCHR-CO]n-OH) where n is 1-20, or alternatively from 1-18, or alternatively from 1-16, or alternatively from 1-14, or alternatively from 1-12, or alternatively from 2-14, or alternatively from 2-12, or alternatively from 3-20, or alternatively from 4-18, or alternatively from 5-20, or alternatively from 5-18, and R is the same or different for each of the n amino acids, and is one of the 22 side groups known to be present in natural amino acids. A peptide linker can be incorporated into the polymer compound by one of the peptide condensation reactions (producing an amide bond) that are known in the art.

[0036] As used herein, "therapeutic agent" refers to a single-stranded or double-stranded oligonucleotide that can provide a beneficial effect when administered to a patient.

[0037] As used herein, "amino acid" refers to a compound containing both amino (-NH ₂ ) and carboxyl (-COOH) groups generally separated by one carbon atom. The central carbon atom can contain a substituent which can be either charged, ionisable, hydrophilic or hydrophobic. Any of 22 basic building blocks of proteins having the formula NH₂ -CHR- COOH, where R is different for each specific amino acid, and the stereochemistry is in the 'L' configuration. Additionally, amino acid can optionally include those with an unnatural 'D' stereochemistry and modified forms of the 'D' and 'L' amino acids.

[0038] As used herein, "peptide" refers to a chain of amino acids in which each amino acid is connected to the next by a formation of an amide bond. Peptides are generally considered to consist of up to 30 amino acids, or alternatively up to 25 amino acids, or alternatively up to 20 amino acids, or alternatively up to 15 amino acids, or alternatively up to 10 amino acids, or alternatively up to 5 amino acids, or alternatively between about 5-10 amino acids, or alternatively between about 10-15 amino acids, while the term "protein" is applied to compounds containing longer amino acid chains. [0039] As used herein, "glycoprotein" refers to a protein which contains a number of carbohydrate substituents.

[0040] As used herein, "halo" or "halogen" refers to fluorine (F), chlorine (CI), bromine (Br) and iodine (I).

[0041] As used herein, a primary, secondary or tertiary alkyl amine refers to an R H₂, an R "NH or an RR'R"N group, wherein R, R' and R" independently represent, without limitation, alkyl, cycloalkyl, aryl, heteroaryl and heteroalicyclic moieties.

[0042] As used herein, "vitamin B12" or "VB12" refers to the series of compounds otherwise know as cobalamins which are structurally identical and vary only in the nature of the monodentate axial ligand attached to the VB12 cobalt atom, which typically can be cyanide (cyanocobalamin), methyl (methylcobalamin), hydroxyl (hydroxycobalamin), or nitric oxide (nitrosylcobalamin). It is known in the art that these axial ligands can be exchanged under appropriate conditions, and such ligand exchange is incorporated as part of this disclosure. Linkage of the VB12 to the polymer systems to create the delivery systems described herein can be accomplished by converting one or more amide VB12 group to carboxyl then using the free carboxyl to form a covalent link, such as an amide. Alternatively, formation of a covalent bond to one of the two hydroxyl groups of the ribose unit of VB12 can be employed. Alternatively, VB12 could be linked to the polymer system might also be accomplished by addition of a suitable monodentate ligand to the polymer, via an optional linker, and formation of a metal coordinate bond between the cobalt atom of VB12 and the polymer-attached monodentate ligand.

[0043] As used herein, a "disease" or "medical condition" is an abnormal condition of an organism that impairs bodily functions, associated with specific symptoms and signs. [0044] As used herein, the term "cancer" refers to various types of malignant neoplasms, most of which can invade surrounding tissues, and may metastasize to different sites, as defined by Stedman's Medical Dictionary, 25th edition (Hensyl ed. 1990). Examples, without limitation, of cancers which may be treated using the compounds of the present invention include, but are not limited to, brain, ovarian, colon, prostate, kidney, bladder, breast, lung, oral, skin and blood cancers.

[0045] As used herein, a "tumor-seeking" group refers to an entity that is know to preferentially seek out and bond to surface structures on neoplastic cells that do not occur or are expressed to a substantially lesser degree by normal cells or entitles that preferentially accumulate in tumors over normal tissue. [0046] As used herein, the terms "treat", "treating" and "treatment" refer to a method of alleviating or abrogating a disease and/or its attendant symptoms. The effect may be prophylactic in terms of completely or partially preventing a disorder or sign or symptom thereof, and/or may be therapeutic in terms of a partial or complete cure for a disorder and/or adverse effect attributable to the disorder. For example, the life expectancy of an individual affected with a cancer will be increased and/or that one or more of the symptoms of the disease will be reduced.

[0047] As used herein, "administer," "administering" or "administration" refers to the delivery of a compound or compounds of this invention or of a pharmaceutical composition containing a compound or compounds of this invention to a patient in a manner suitable for the treatment of a particular disease, such as cancer. "Administration" can be effected in one dose, continuously or intermittently throughout the course of treatment. Methods of determining the most effective means and dosage of administration are known to those of skill in the art and will vary with the composition used for therapy, the purpose of the therapy, the target cell being treated, and the subject being treated. Single or multiple administrations can be carried out with the dose level and pattern being selected by the treating physician. Suitable dosage formulations and methods of administering the agents are known in the art. Route of administration can also be determined and method of determining the most effective route of administration are known to those of skill in the art and will vary with the

composition used for treatment, the purpose of the treatment, the health condition or disease stage of the subject being treated, and target cell or tissue. Non-limiting examples of route of administration include oral administration, nasal administration, injection, and topical application.

[0048] A "patient" or a "subject" refers to any higher organism that is susceptible to disease. Examples of such higher organisms include, without limitation, non-human animals such as mice, rats, rabbits, dogs, cats, horses, cows, pigs, sheep, fish and reptiles. In some

embodiments, "patient" or "subject" refers to a human being.

[0049] As used herein, the term "therapeutically effective amount" refers to that amount of a compound or combination of compounds of this invention which has the effect of (a) preventing a disorder from occurring in a subject that may be predisposed to a disorder, but may have not yet been diagnosed as having it; (b) inhibiting a disorder, i.e., arresting its development; or (c) relieving or ameliorating the disorder. For example, but not limited to, (1) reducing the size of the tumor; (2) inhibiting (that is, slowing to some extent, preferably stopping) tumor metastasis; (3) inhibiting to some extent (that is slowing to some extent, preferably stopping) tumor growth; (4) relieving to some extent (or preferably eliminating) one or more symptoms associated with the cancer; and/or (5) extending survival time of the patient.

[0050] As used herein, a "pharmaceutical composition" refers to a mixture of one or more of the compounds of this invention with other chemical components such as pharmaceutically acceptable excipients. The purpose of a pharmacological composition is to facilitate administration of a compound of this invention to a patient.

[0051] As used herein, a "pharmaceutically acceptable excipient" or "pharmaceutically acceptable carrier" refers to an excipient that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered composition. "Pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" refers to any diluents, excipients, or carriers that may be used in the compositions of the invention. Such excipients or carriers include, without limitation, ion exchangers, alumina, aluminum stearate, lecithin, serum proteins, such as human serum albumin, buffer substances, such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol and wool fat. Suitable pharmaceutical carriers are described in Remington's Pharmaceutical Sciences, Mack

Publishing Company, a standard reference text in this field. They are preferably selected with respect to the intended form of administration, that is, oral tablets, capsules, elixirs, syrups and the like, and consistent with conventional pharmaceutical practices. [0052] As used herein, the term "oligonucleotides" includes deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA). The term should also be understood to include, as equivalents, derivatives, variants and analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single (sense or antisense) and double-stranded polynucleotides. Deoxyribonucleotides include

deoxyadenosine, deoxycytidine, deoxyguanosine, and deoxythymidine. For purposes of clarity, when referring herein to a nucleotide of a nucleic acid, which can be DNA or an RNA, the terms "adenosine", "cytidine", "guanosine", and "thymidine" are used. It is understood that if the nucleic acid is RNA, a nucleotide having a uracil base is uridine.

[0053] The terms "polynucleotide" and "oligonucleotide" are used interchangeably and refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides or analogs thereof. Polynucleotides can have any three-dimensional structure and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: a gene or gene fragment (for example, a probe, primer, EST or SAGE tag), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, dsRNA, siRNA, miRNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers. A polynucleotide can comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure can be imparted before or after assembly of the polynucleotide. The sequence of nucleotides can be interrupted by non-nucleotide components. A polynucleotide can be further modified after polymerization, such as by conjugation with a labeling component. The term also refers to both double- and single-stranded molecules. Unless otherwise specified or required, any embodiment of this invention that is a polynucleotide encompasses both the double-stranded form and each of two complementary single-stranded forms known or predicted to make up the double-stranded form.

[0054] A polynucleotide is composed of a specific sequence of four nucleotide bases:

adenine (A); cytosine (C); guanine (G); thymine (T); and uracil (U) for thymine when the polynucleotide is RNA. Thus, the term "polynucleotide sequence" is the alphabetical representation of a polynucleotide molecule. This alphabetical representation can be input into databases in a computer having a central processing unit and used for bioinformatics applications such as functional genomics and homology searching. The term

"polymorphism" refers to the coexistence of more than one form of a gene or portion thereof. A portion of a gene of which there are at least two different forms, i.e., two different nucleotide sequences, is referred to as a "polymorphic region of a gene". A polymorphic region can be a single nucleotide, the identity of which differs in different alleles.

[0055] As used herein, the term "carrier" encompasses any of the standard carriers, such as a phosphate buffered saline solution, buffers, water, and emulsions, such as an oil/water or water/oil emulsion, and various types of wetting agents. The compositions also can include stabilizers and preservatives. For examples of carriers, stabilizers and adjuvants, see

Sambrook and Russell (2001), supra. Those skilled in the art will know many other suitable carriers for binding polynucleotides, or will be able to ascertain the same by use of routine experimentation. In one aspect of the invention, the carrier is a buffered solution such as, but not limited to, a PCR buffer solution.

[0056] A "gene delivery vehicle" is defined as any molecule that can carry inserted polynucleotides into a host cell. Examples of gene delivery vehicles are liposomes, biocompatible polymers, including natural polymers and synthetic polymers; lipoproteins; polypeptides; polysaccharides; lipopolysaccharides; artificial viral envelopes; metal particles; and bacteria, or viruses, such as baculovirus, adenovirus and retrovirus, bacteriophage, cosmid, plasmid, fungal vectors and other recombination vehicles typically used in the art which have been described for expression in a variety of eukaryotic and prokaryotic hosts, and may be used for gene therapy as well as for simple protein expression.

[0057] "Gene delivery," "gene transfer," and the like as used herein, are terms referring to the introduction of an exogenous polynucleotide (sometimes referred to as a "transgene") into a host cell, irrespective of the method used for the introduction. Such methods include a variety of well-known techniques such as vector-mediated gene transfer (by, e.g., viral infection, sometimes called transduction), transfection, transformation or various other protein-based or lipid-based gene delivery complexes) as well as techniques facilitating the delivery of "naked" polynucleotides (such as electroporation, "gene gun" delivery and various other techniques used for the introduction of polynucleotides). Unless otherwise specified, the term transfected, transduced or transformed may be used interchangeably herein to indicate the presence of exogenous polynucleotides or the expressed polypeptide therefrom in a cell. The introduced polynucleotide may be stably or transiently maintained in the host cell. Stable maintenance typically requires that the introduced polynucleotide either contains an origin of replication compatible with the host cell or integrates into a replicon of the host cell such as an extrachromosomal replicon (e.g., a plasmid) or a nuclear or mitochondrial chromosome. A number of vectors are known to be capable of mediating transfer of genes to mammalian cells, as is known in the art and described herein.

[0058] "RNA interference" (RNAi) refers to sequence-specific or gene specific suppression of gene expression (protein synthesis) that is mediated by short interfering RNA (siRNA). [0059] "Short interfering RNA" (siRNA) refers to double-stranded RNA molecules (dsRNA), generally, from about 10 to about 30 nucleotides in length that are capable of mediating RNA interference (RNAi), or 11 nucleotides in length, 12 nucleotides in length, 13 nucleotides in length, 14 nucleotides in length, 15 nucleotides in length, 16 nucleotides in length, 17 nucleotides in length, 18 nucleotides in length, 19 nucleotides in length, 20 nucleotides in length, 21 nucleotides in length, 22 nucleotides in length, 23 nucleotides in length, 24 nucleotides in length, 25 nucleotides in length, 26 nucleotides in length, 27 nucleotides in length, 28 nucleotides in length, or 29 nucleotides in length. As used herein, the term siRNA includes short hairpin RNAs (shRNAs). A siRNA directed to a gene or the mRNA of a gene may be a siRNA that recognizes the mRNA of the gene and directs a RNA- induced silencing complex (RISC) to the mRNA, leading to degradation of the mRNA. A siRNA directed to a gene or the mRNA of a gene may also be a siRNA that recognizes the mRNA and inhibits translation of the mRNA.

[0060] "Double stranded RNA" (dsRNA) refer to double stranded RNA molecules that may be of any length and may be cleaved intracellularly into smaller RNA molecules, such as siRNA. In cells that have a competent interferon response, longer dsRNA, such as those longer than about 30 base pair in length, may trigger the interferon response. In other cells that do not have a competent interferon response, dsRNA may be used to trigger specific RNAi.

[0061] A siRNA can be designed following procedures known in the art. See, e.g., Dykxhoorn and Lieberman (2006) Annu. Rev. Biomed. Eng. 8:377-402; Dykxhoorn et al.

(2006) Gene Therapy, 13:541-52; Aagaard and Rossi (2007) Adv. Drug Delivery Rev. 59:75- 86; de Fougerolles et al. (2007) Nature Reviews Drug Discovery 6:443-53; Krueger et al.

(2007) Oligonucleotides 17:237-250; U.S. Patent Application Publication No.:

2008/0188430; and U.S. Patent Application Publication No.: 2008/0249055. [0062] siRNAs can be made with methods known in the art. See, e.g., Dykxhoorn and Lieberman (2006) Annu. Rev. Biomed. Eng. 8:377-402; Dykxhoorn et al. (2006) Gene Therapy, 13:541-52; Aagaard and Rossi (2007) Adv. Drug Delivery Rev. 59:75-86; de Fougerolles et al. (2007) Nature Reviews Drug Discovery 6:443-53; Krueger et al. (2007) Oligonucleotides 17:237-250; U.S. Patent Application Publication No.: 2008/0188430; and U.S. Patent Application Publication No.: 2008/0249055.

[0063] A siRNA may be chemically modified to increase its stability and safety. See, e.g. Dykxhoorn and Lieberman (2006) Annu. Rev. Biomed. Eng. 8:377-402 and U.S. Patent Application Publication No.: 2008/0249055. [0064] microRNA or miRNA are single-stranded RNA molecules of 21-23 nucleotides in length, which regulate gene expression. miRNAs are encoded by genes from whose DNA they are transcribed but miRNAs are not translated into protein (non-coding RNA); instead each primary transcript (a pri-miRNA) is processed into a short stem-loop structure called a pre-miRNA and finally into a functional miRNA. Mature miRNA molecules are partially complementary to one or more messenger RNA (mRNA) molecules, and their main function is to down-regulate gene expression.

[0065] A siRNA vector, dsRNA vector or miRNA vector as used herein, refers to a plasmid or viral vector comprising a promoter regulating expression of the RNA. "siRNA promoters" or promoters that regulate expression of siRNA, dsRNA, or miRNA are known in the art, e.g., a U6 promoter as described in Miyagishi and Taira (2002) Nature Biotech. 20:497-500, and a HI promoter as described in Brummelkamp et al. (2002) Science 296:550-3.

Modes for Carrying Out the Invention

[0066] Disclosed herein is a conjugate comprising, or alternatively consisting essentially of, or yet further consisting of, an oligonucleotide linked to a linker group covalently bonded to a vitamin B12 molecule. Also provided is conjugate comprising or alternatively consisting essentially of, or yet further consisting of, a natural, synthetic, or semi-synthetic polymer to which is conjugated an oligonucleotide linked through a first linker group and a vitamin B12 molecule linked, either directly to the polymer, or indirectly via a second linker group which is the same or different than the first linker group.

[0067] In one aspect, the polymer is one or more of polyethylene glycol (PEG), PEG block copolymers, a polyacrylate, a polymethacrylate, a polyacrylamide, a polymethacrylamide, a synthetic polymer, a semi-synthetic polymer, a polysaccharide. In another aspect, the conjugate further comprises or alternatively consisting essentially of, or yet further consisting of, one or more of a cell targeting moiety, a moiety that facilitates oral delivery of the oligoncucleotide, a RES avoiding moiety, a moiety that facilitates endome release, or a moiety that facilitates oligonucleotide transport into the cytoplasm of a cell, wherein the one or more moieties are covalently linked to the conjugate. [0068] For the embodiments of this disclosure, a nanoparticle derived from the formulation of a conjugate as described herein, is formulated alone or with other components.

[0069] For the aspects of this disclosure, the oligonucleotide comprises a DNA molecule or an RNAi molecule. In one aspect, the oligonucleotide comprises, or alternatively consisting essentially of, or yet further consisting of, a DNA molecule that encodes a RNAi molecule. In another aspect, the RNAi comprises, or alternatively consisting essentially of, or yet further consisting of, an siRNA, a dsRNA, a mRNA, an antisense RNA or a ribozyme.

[0070] In one aspect, the linker is one or more of a protein, a peptide, a single amino acid, a mono-, di- or polysaccharide, or any organic compound of molecular weight between 25 and 100,000 Daltons that contains functional groups to provide covalent links to both the oligonucleotide and vitamin B12.

[0071] In another aspect, the conjugate wherein the vitamin B12 is attached following chemical modification at the 5'-0 or 2'-0 position of vitamin B12 to provide a functional group suitable for conjugation, or by direct or in direct reaction at the 5'-0 or 2'-0 position of vitamin B12, or by liberating a free carboxyl group from one of the primary amide groups on vitamin B12 to facilitate formation of a covalent bond between the carboxyl and linker groups.

[0072] In another aspect, the nanoparticle -vitamin conjugate is formulated optionally with other components to form a nanoparticle. [0073] Also provided is a composition comprising, or alternatively consisting essentially of, or yet further consists of, the conjugate as describe above and a carrier, e.g., a

pharmaceutically acceptable carrier.

[0074] The compositions described herein are useful for inhibiting expression of a polynucleotide in a cell, comprising, or alternatively consisting essentially of, or yet further consisting of, contacting the cell with an effective amount of the conjugate described above or the composition described above, thereby inhibiting the expression of the polynucleotide in the cell. The contacting can be in vitro or in vivo.

[0075] Also provided is a method for treating a disease or disorder in a human or non- human subject, comprising or alternatively consisting essentially of, or yet further consisting of, contacting the cell with an effective amount of the conjugate describe herein, the nanoparticle-vitamin conjugate described herein, the composition described herein, wherein the disease or the disorder is treatable by inhibiting the expression of a polynucleotide in a cell in the human or non-human subject, thereby treating the disease or the disorder in the human or non-human subject. Non- limiting examples of such disorders include, cancer, autoimmune conditions, endocrine disorders, diabetes, genetic conditions, chromosome conditions, viral infections, bacterial infections, parasitic infections, mitochondrial diseases, sexually transmitted diseases, immune disorders, balance disorders, pain, systemic disorders, blood conditions, blood vessel conditions, nerve conditions, or a condition of muscles, heart, or other organs. In one aspect, administered is achieved orally in a tablet, capsule, or other suitable vehicle, optionally formulated with pharmaceutically-accepted excipients, or given by injection in a suitable injection vehicle, or applied topically to the surface of the body in a suitable vehicle.

[0076] Further provided is a method for preparing the conjugate described herein comprising, or alternatively consisting essentially of, or yet further consisting of, the formation of a phosphoramidate bond between the oligonucleotide and a 5'-0 aminoalkyl vitamin B12 derivative. In a further aspect, the synthetic method further comprises, or alternatively consists essentially of, or yet further consists of, linking the oligonucleotide through a linker group to a polymer and to which one or more vitamin B12 molecules are also attached through a linker by the formation of a phosphoramidate bond between the oligonucleotide and an amino group on the polymer. Non-limiting examples of polymers include one or more of polyethylene glycol (PEG), PEG block copolymers, a polyacrylate, a polymethacrylate, a polyacrylamide, a polymethacrylamide, a synthetic polymer, a polysaccharide, and the polymercontains a functional group to form a covalent bond to a linker or to an oligonucleotide.

[0077] In one embodiment, the method further comprises, or alternatively consists essentially of, or yet further consists of, covalent attachment to the conjugate a cell targeting moiety, a moiety that facilitates oral delivery of the oligoncucleotide, a RES avoiding moiety or a moiety that facilitates endosome release. [0078] Another aspect is a method for preparing an oligonucleotide conjugate nanoparticle comprising, or alternatively consisting essentially of, or yet further consisting of, mixing two or more solutions containing the conjugate described herein with a nanoparticle or nanoparticle-forming components and subsequent isolation of the oligonucleotide conjugate nanoparticle formed by coacervation. [0079] For the aspects of this method, the oligonucleotide comprises a DNA molecule or an RNAi molecule. In one aspect, the oligonucleotide comprises, or alternatively consisting essentially of, or yet further consisting of, a DNA molecule that encodes a RNAi molecule. In another aspect, the RNAi comprises, or alternatively consisting essentially of, or yet further consisting of, an siRNA, a dsRNA, a mRNA, an antisense RNA or a ribozyme. Additional aspects of this method include wherein the linker is one or more of a protein, peptide, a single amino acid, a mono-, di- or polysaccharide, or any organic compound of molecular weight between 25 and 100,000 Daltons that contains functional groups to provide covalent links to both the oligonucleotide and vitamin B12. In a further aspect, the vitamin B12 is covalently linked to the polymer by a method comprising the formation of an amide bond between either a free primary amino function on a first vitamin B12 derivative and a free carboxyl group on a polymer side-chain or a free primary amino group on a polymer side-chain with a free carboxyl group on a second vitamin B12 derivative.

[0080] Also provided by this disclosure is a kit comprising, or alternatively consisting essentially of, or yet further consisting of, any one of the conjugates or described herein, the oligonucleotide conjugate nanoparticle described herein, or the composition of described herein, and instructions for their administration to treat a disease or disorder as described herein..

Polymer Conjugates

[0081] The invention relates to the delivery of RNA interference (RNAi) therapeutics such as microRNA (miRNA), small interfering RNA (siRNA) and other oligonucleotides across biological barriers using naturally-occurring vitamin transport systems. In one aspect, the invention relates to the delivery of oligonucleotides utilizing a vitamin such as vitamin B12 (VB12) transport systems by covalently linking the oligonucleotide to the vitamin via a linking group. In a further aspect, the oligonucleotide is covalently linked via a linking group to a polymer to which the vitamin is also attached. In a further aspect, the oligonucleotide - vitamin construct is formulated into a nanoparticle. In some embodiments, additional cell targeting and/or endosome disrupting functional groups are covalently linked to the oligonucleotide carrier system. The invention also relates to processes for preparing the oligonucleotide delivery vehicles, pharmaceutical compositions containing same and methods of drug delivery and treatment of disease involving the oligonucleotide structures.

[0082] Surprisingly it has been found by the Applicants that a single or a double-stranded oligonucleotide can be delivered to the cytoplasm of cells in effective quantities by oral administration or by injection, by covalently linking the oligonucleotide to a delivery system containing a vitamin such as VB12 and optionally other components to facilitate oral absorption, cell penetration, avoidance of uptake by the reticuloendothelial system (RES) and/or endosome release. Covalent linkage of the oligonucleotide to the delivery and targeting vehicle can be achieved by methods disclosed herein and application of methods known in the art. The constructs of this invention are able to provide for either or both oral drug delivery of the oligonucleotide through transfer from the intestinal lumen into the

bloodstream, and/or targeted to diseased cells in the body that over-express the receptors that facilitate vitamin such as vitamin B12 cell uptake. The oligonucleotides delivered to the interior of diseased cells by the delivery vehicles of this invention are capable of initiating gene silencing processes, as described in the art for example, Aagaard and Rossi (2007) Advanced Drug Delivery Reviews 59:75-86).

[0083] In one aspect, the present invention relates to covalently-linked oligonucleotide conjugates in which the oligonucleotide is bound to a linker group to which VB12 is also covalently linked. The oligonucleotide is bound to the linker by methods known in the art to provide a stable linkage that may be cleaved in the target cell to liberate the oligonucleotide such that the released oligonucleotide is able to initiate sequence-specific gene silencing processes. For the clarity of simplicity, the constructs containing one vitamin (VB12) molecule and one oligonucleotide will be referred to in this application as simple conjugates.

[0084] In a further aspect of this invention, one or more oligonucleotides are covalently- linked to a synthetic, semi-synthetic, or naturally-occurring oligomer or polymer by way of a linker group to which one or more VB12 molecules are also covalently attached. Polymer constructs which contain a targeting group plus multiple copies of the active agent give rise to an amplification of delivery; that is, the uptake mechanism initiated by interaction of one targeting group with its target results in the uptake of multiple copies of the active agent (whereas a single copy of the active agent is taken up by a single conjugate). For the purpose of clarity, the oligomer and polymer constructs containing at least one covalently-linked vitamin (VB12) molecule and at least one covalently-linked oligonucleotide will be referred to in this application as polymer conjugates.

[0085] In a further aspect of this invention, exemplary siR A sequences that can be used in for the reduction to practice of this invention include, but are not limited to the following sequences. These sequences denote the 'guide strand' in dsRNA, and are grouped by preferred gene targets:

For human MAP4K4 (NM_004834):

UGGCGAACGACUCCCCUGCUU

AGUCUGGUGGACAUCGACCUU GUGGUUGG AAAUGGC AC CUUU

AUGGCACCUAUGGACAAGUUU For human FLT3 (NM 004119):

UGAUAUUUGGGACUAUUACUU

AUCAAGAUCUGCCUGUGAUUU GAUCUGCCUGUGAUCAAGUUU

UCAAUCAUAAGAACAAUGAUU

For human MSI2 (NMJ38962):

AUGGGAGCCAAGGCACCUCUU

GGCACCUCGGGCAGCGCCAUU CGACUCCCAGCACGACCCCUU

UGUUUAUCGGUGGACUGAGUU [0086] Other gene targets and oligonucleotide sequences known in the art can be utilized for the reduction to practice of this invention; for example, as contained within publically- available databases such as that at following URL: http://www.rnainterference.org/

[0087] In a further aspect of this invention, simple conjugates and polymer conjugates can be covalently linked to one or more other components or functional groups to facilitate or improve oral absorption, cell penetration, avoidance of uptake by the reticuloendothelial system (RES) and/or endosome release. Many of the components or functional groups to perform these functions are known in the art. For the purpose of clarity, simple conjugates and polymer conjugates these other components and functional groups will be referred to in this application as derivatized simple conjugates and derivatized polymer conjugates.

[0088] In a further aspect of this invention, simple conjugates, derivatized simple conjugates, polymer conjugates and derivatized polymer conjugates may be formulated alone or with other components in a gene delivery vehicle.

[0089] In a further aspect of this invention, simple conjugates, derivatized simple conjugates, polymer conjugates and derivatized polymer conjugates may be formulated alone or with one or more other components to form nanoparticles to serve as delivery vehicles and to protect the oligonucleotide following administration. The components required for nanoparticle formation may optionally include one or more components or functional groups to facilitate or improve oral absorption, cell penetration, avoidance of uptake by the reticuloendothelial system (RES) and/or endosome release.

[0090] In the aspects of this invention, the oligonucleotides, include for example those which are, or that encode RNA interference fRNAi) such as siRNA, dsRNA, mRNA and antisense RNA, as well DNA, such as in gene therapy applications.

[0091] In a further aspect of this invention, simple conjugates, derivatized simple conjugates, polymer conjugates, derivatized polymer conjugates and nanoparticle

formulations can be formulated optionally with one or more other components to provide pharmaceutical products suitable for administration to patients. Formulations of this invention may be administered orally, topically, or by injection. [0092] In a further aspect of this invention, simple conjugates, derivatized simple conjugates, polymer conjugates, derivatized polymer conjugates, nanoparticle formulations and pharmaceutical products of this invention may be administered to patients to prevent or treat diseases. The pharmaceutical formulations of this invention can be used to treat a wide variety of diseases including, but not limited to cancer, autoimmune conditions, endocrine disorders, diabetes, genetic conditions, genetic diseases such as cystic fibrosis, chromosome conditions, viral infections, bacterial infections, parasitic infections, mitochondrial diseases, sexually transmitted diseases, immune disorders, balance disorders, pain, systemic disorders, blood conditions, blood vessel conditions, nerve conditions, and conditions of muscles, heart and other organs.

[0093] In some embodiments, the derivatized simple conjugates, derivatized polymer conjugates, and components used for nanoparticle formation of the above noted aspects further comprises one or more of components selected from the group consisting of polyethylene glycol (PEG), PEG block copolymers, polyacrylic, polymethacrylic, polyacrylamide, polymethacrylamide, synthetic polymer, polysaccharide, surfactant, and metal ions.

[0094] In some embodiments, the vitamin B12 is attached to one or more of the

components.

[0095] In some embodiments, an average nanoparticle diameter is in a range of about 20 nm to about 800 nm.

[0096] In some embodiments, the pharmaceutical formulation is configured for oral administration in a subject.

[0097] In some embodiments, the pharmaceutical formulation is configured for

administration by injection to a subject. [0098] In some embodiments, the synthetic or natural oligomer or polymer is selected from the group of a protein, peptide, a polysaccharide, a derivatized poly(acrylic acid) or poly(methacrylic acid), a polyester, a polyanhydride, or copolymers of any one or more thereof. The oligomer or polymer can either linear, branched or a dendrimer. The oligomer or polymer can either be stable or unstable under biological conditions, and may contain charged groups or may be neutral. Those skilled in the art will know of other suitable synthetic or natural oligomers or polymers for the use in this invention.

[0099] In some embodiments, the polysaccharide as noted above is dextran, cellulose, or starch. [0100] In some embodiments, the synthetic polymer is a copolymer of

hydroxyproplymethacrylamide (HPMA).

[0101] In some embodiments, an axial ligand substituent on a cobalt atom of vitamin B12 is CN, Me, OH or NO.

[0102] In some embodiments, the linking group used to link the oligonucleotide to VB12 in the simple conjugates can be a protein, peptide, single aminoacid, mono-, di- or

polysaccharide, or any organic compound of molecular weight between 25 and 100,000 Daltons that contains functional groups to provide covalent links to both the oligonucleotide and VB12. For example, a linker can contain a free amino group and an ester-protected carboxyl group. The amino group is reacted with N-succinimidyl 3-(2-pyridyldithio) propionate (SPDP) and reacted with a thiol-derivatized sense siRNA to link the

oligonucleotide and linker. Liberation of the free carboxyl will allow it to be linked to the free amine of aminohexyl VB12 (McEwan et al. (1999) Bioconjugate Chem 10: 1131-1136) by standard peptide coupling chemistry. A double-stranded RNA is then created by adding the anti-sense RNA to the VB12-RNA conjugate. The linker may optionally contain other functional groups to allow attachment of components or functional groups to facilitate or improve oral absorption, cell penetration, avoidance of uptake by the reticuloendothelial system (RES) and/or endosome release. Other methods of linking VB12 and an

oligonucleotide via a linking compound will be obvious to those skilled in the art.

[0103] In some embodiments, covalently- linked functional groups or compounds used to facilitate or improve oral absorption include, but are not limited to, B-group vitamins, peptides, proteins, and/or hydrophobic groups such as cholesterol. Additionally,

pharmaceutical formulations of the conjugates of this invention may contain agents known to improve oral absorption such as surfactants or other permeation enhancers, enzyme inhibitors, mucoadhesive polymeric systems and particulate carrier delivery systems [0104] In some embodiments, covalently- linked functional groups or compounds used in the avoidance of uptake by the reticuloendothelial system (RES) include, but are not limited to, polyethylene glycol (PEG), HPMA, and other hydrophilic oligomers and polymers that are known in the art to provide such functionality. Additionally, nanoparticle formulations of the conjugates of this invention may contain PEG, HPMA, derivatives of PEG or HPMA, and/or other components known in the art to provide RES -avoiding "stealth" features to

pharmaceutical formulations while in circulation in the body.

[0105] In some embodiments, covalently- linked functional groups or compounds used to assist in cell penetration include, but are not limited to, B-group vitamins, antibodies, peptides, proteins, and/or hydrophobic groups such as cholesterol that are known in the art to provide such functionality. Additionally, nanoparticle formulations of the conjugates of this invention can contain B-group vitamins, antibodies, peptides, proteins, and/or hydrophobic groups such as cholesterol, and/or other components known in the art to improve cell penetration of the nanoparticles. [0106] In some embodiments, covalently- linked functional groups or compounds used to assist in endosomal release include, but are not limited to, polyplexes or peptides known in the art to provide such functionality. Additionally, nanoparticle formulations of the conjugates of this invention can contain one or more of B-group vitamins, antibodies, peptides, proteins, and/or hydrophobic groups such as cholesterol, and/or other components known in the art to improve cell penetration of the nanoparticles.

[0107] In one aspect, there is provided a process for preparing a nanoparticle composition comprising, or alternatively consisting essentially of, or yet further consisting of the nanoparticle of any of the above recited aspects and embodiments, comprising, or

alternatively consisting essentially of or alternatively consisting of combining the one or more synthetic or natural polymers, simple conjugates, derivatized simple conjugates, polymer conjugates or derivatized polymer conjugates, in a suitable solvent, and isolating, purifying and/or drying the nanoparticles. In some embodiments, the solvent is > 50% water.

[0108] In another aspect, there is provided a process for preparing a nanoparticle composition comprising or alternatively consisting essentially of, or yet further consisting of the nanoparticle of any of the above recited aspects and embodiments, comprising, or alternatively consisting essentially of or alternatively consisting of mixing two immiscible solvents and a surfactant to produce an emulsion, optionally cross-linking the nanoparticles, and isolating, purifying, and/or drying resultant nanoparticles. [0109] In some embodiments, the nanoparticles are isolated by solvent evaporation

[0110] In some embodiments, the nanoparticles are isolated by filtration or centrifugation

[0111] In some embodiments, the nanoparticles are isolated by addition of a cosolvent followed by filtration or centrifugation.

[0112] In some embodiments, the purifying step is effected by washing the nanoparticles with a suitable solvent.

[0113] In some embodiments, the above recited aspects further comprise modifying the nanoparticles to effect cross-linking of the components of the nanoparticle.

[0114] In some embodiments, the above recited aspects further comprise modifying the nanoparticles to add a vitamin B12 analog to a surface of the nanoparticle by physical or covalent attachment.

[0115] In some embodiments, the above recited aspects further comprise modifying the nanoparticles to substitute an axial ligand on a one or more cobalt atoms of attached vitamin B12 with replacement axial ligands.

[0116] In another aspect, there is provided a pharmaceutical composition comprising the nanoparticle of the above recited aspects, and a pharmaceutically-acceptable excipient.

[0117] In some embodiments, the composition is formulated as a tablet, a capsule, or a liquid.

[0118] In some embodiments, the composition is formulated as a lyophilized powder in a container for subsequent re-suspension or dissolution of the pharmaceutical composition in a pharmaceutically-acceptable injection vehicle.

[0119] In some embodiments, the composition is formulated as a suspension or solution in a pharmaceutically-acceptable injection vehicle. [0120] In another aspect, there is provided a method for treating a subject, comprising, or alternatively consisting essentially of, or alternatively consisting of, administering an effective amount of the nanoparticle of any of the above recited aspects or the pharmaceutical composition of any of the above recited aspects. [0121] In some embodiments, the oligonucleotide functions as an antidiabetic agent.

[0122] In some embodiments, the oligonucleotide functions as a hormone.

[0123] In some embodiments, the oligonucleotide functions as an antineoplastic agent.

[0124] A number of technologies have been advocated for the enhancement of oral bioavailability of pharmaceutically-active compounds. As an example, one area of particularly active research has been in the development of technologies for the oral delivery of insulin. Khafagy et al. (2007) Advanced Drug Delivery Reviews 59: 1521-1546 classified the various oral insulin approaches as: Absorption enhancers; Enzyme inhibitors;

Mucoadhesive polymeric systems; Particulate carrier delivery systems; and Targeted delivery systems. [0125] Absorption or permeation enhancers are molecules which either increase the fluidity of membranes or widen junctions between the cells of membranes thus providing a small transient improvement in paracellular and transcellular drug transport. There are a number of distinct disadvantages to absorption enhancers for oral drug delivery:

[0126] Typically, they should slightly precede the appearance of drug molecules at the absorption site to provide maximum possible drug absorption. Once the concentration of the enhancer molecule decreases at the membrane site (for example, by continued transit in the GI tract, or by virtue of the fact that it is itself absorbed or metabolized), the membrane permeability returns to normal.

[0127] Increasing membrane permeability permits increased penetration of all molecules in the vicinity, not just the drug molecules.

[0128] Enzyme inhibitors slow the rate at which actives, particularly proteins and peptides, are enzymatically degraded in the GI tract. In principle, this provides for a higher

concentration of the active at the sites of absorption, resulting in greater passive absorption by virtue of a larger concentration gradient. This effect is only beneficial for actives that are naturally able to diffuse readily across the gut wall, and are only prevented from doing so through enzymatic degradation of the active compound. Additionally, inhibition of enzyme activity in the GI tract can give rise to significant adverse effects as inhibition of protein degradation will be non-selective. For example, enzyme inhibitors will reduce the rate to breakdown (and hence reduced absorption) of food proteins.

[0129] Peristalsis generates a flow of material down the gastrointestinal (GI) tract. Materials moving along the small intestine, where most pharmaceutical actives are thought to be absorbed, do so in an average time of about three hours. If were possible to retard the flow of drugs, and provide them with greater contact at the sites of absorption, it should be possible to achieve higher levels of absorption of drugs that are otherwise poorly absorbed in the GI tract. Because of transient 'sticking' of mucoadhesive polymeric systems to the mucosal surface of the GI tract lumen, formulations based upon such polymers have the potential to demonstrate an extended residence on the epithelial cell layer, slowing the flow of these particles relative to other material in the GI tract. . When formulated into particles, mucoadhesive polymers may also provide some protection to embedded active agents that might otherwise be degraded in the GI tract. Because of the direct contact between the polymer formulation and the GI mucosa, other potential advantages of this oral drug delivery system is the possibility for direct diffusion of actives from the particle into the mucosa and epithelial cell layer, and for pinocytosis of particles into epithelial cells. All of these potential benefits suggest that oral drug delivery systems based upon mucoadhesive polymers should be highly effective, yet results to date in numerous examples in the literature indicate only modest improvements in oral bioavailability of pharmaceutical active compounds using mucoadhesive polymer formulations. [0130] Gastrointestinal absorption of many essential nutrients and vitamins can be facilitated by active transport processes. These processes generally require the material to bind to a surface receptor, which initiates a process such as receptor-mediated endocytosis whereby the active is absorbed into the epithelial cell. Disassociation of the receptor-active complex occurs and other processes then facilitate the transfer of the active material into the blood stream. One transport system which has been well documented in the literature is the process for absorption of vitamin B12 (VB12). VB12 liberated from food binds to intrinsic factor (IF, which is produced in the stomach and passes down the GI tract following a meal), and the VB12-IF complex binds to the Cubulin receptor, primarily located in the ileum. Receptor-mediated endocytosis, as described above, then takes place. Dissociation of the receptor-IF-VB12 complex in the epithelial cell results in liberation of VB12, which then binds to transcobalamin II, a protein which facilities the transfer of VB12 to the blood stream.

[0131] It has been documented by Russell- Jones and others that the VB12 uptake mechanism in the GI tract can be used to facilitate the oral absorption of other compounds. Using a 'Trojan Horse' approach, the active is either covalently linked via a degradable linker group to VB12, or covalently linked via a degradable linker group to a polymer which is also linked to VB12, or encapsulated in a nanoparticle to which VB12 is attached (see Figure 2). In the polymer approach, multiple drug-linker groups can be attached to a single polymer strand. For each of these possibilities, provided that VB12 is bound to the linker or particle so as not to prevent binding to IF, these constructs will bind IF in the GI tract and be taken up primarily in the ileum by the cubulin receptor and transported to the bloodstream. Breakdown of the degradable linker will then release drug in the bloodstream, completing its oral absorption. Similarly, drug release by diffusion from the nanoparticle and/or breakdown of the nanoparticle structure in the bloodstream will result in bioavailability of the active. In the case of single conjugation of the active to the VB12 via a linker, one molecule of the drug is absorbed for each receptor-mediated endocytotic event. By comparison, the polymer approach allows for multiple drug molecules to be absorbed each time one polymer strand is absorbed as a result of VB12 attached to that polymer strand binding to IF and cubulin. This allows for an 'amplication' of oral uptake when compared with the 1 : 1 conjugate. Similarly, a VB12 nanoparticle can carry many copies of the drug, also permitting amplification of drug uptake. [0132] A number of patents which describe either single VB12 conjugates, VB12-polymer conjugates, and VB12-coated nanoparticles are known, represented by the following (all of which are incorporated herein by reference in their entirety): US Patents: 5,428,023,

5,449,720, 807,832, 5,589,463, 6,083,926, 6,150,341, 6,159,502, 6,221,397, 6,482,413.

[0133] US 5,428,023 describes a carrier molecule is capable of binding in vivo to intrinsic factor, thereby enabling uptake and transport of the complex from the intestinal lumen of a vertebrate host via intrinsic factor to the systemic circulation of said host, wherein said vitamin B12 carrier molecule is selected from the group consisting of cyanocobalamin, aquocobalamin, denosylcobalamin, methylcobalamin, hydroxycobalamin, cyanocobalamin carbanilide, 5-o-methylbenzylcobalamin, desdimethyl, monoethylamide and methylamide analogues of cyanocobalamin, aquocobalamin, adenosylcobalamin, methylcobaJ.amin, hydroxycobalamin, cyanocobalamin carbanilide, 5-0-methylbenzylcobalamin, coenzyme B12, 5'-deoxyadenosylcobalamin, chlorocobalamin, sulphitocobalamin, nitrocobalamin, thiocyanatocobalamin, adenosylcyanocobalamin, cobalamin lactone, cobalamin

lactam, vitamin B12 anilide, vitamin B12 propionamide, and a vitamin B12 molecule in which one or two corrin ring side chains are free carboxylic acids.

[0134] US 5,499,720 further describes a carrier which consists of a polymer which can either be degradable or non-degradable in a biological environment to which vitamin B12 (as listed above) is covalently bound optionally via a linking group and to which also bound to the polymer is a biologically-active polypeptide or hormone by way of a linker which is degradable under biologically significant conditions. Polymers may be straight or branched. Degradable linkers include peptides. Preferred linkers are those that are thiol degradable, such as linkers derived from disuccinimidyl suberate (DSS), bis(sulfosuccinimidyl) suberate (BSS), ethylene glycol bis(succinimidylsuccinate) (EGS), ethylene

glycolbis(sulfosuccinimidylsuccinate) (sulfoEGS), p-aminophenylacetic acid,

dithiobis(succinimidylpropionate), (DSP), 3,3-'diothibis(sulfosuccinimidyl tartarate (sulfo- DST), bis[(2-succinimidooxycarbonyloxy)-ethylene]sulfone (BSOCOES),

bis[2(sulfosuccinimidooxycarbonyloxy)-ethylene]sulfone (sulfo-BSOCOES), bis- (sulfosuccinimidooxycarbonyloxy)-ethylene]sulfone (sulfo-BSOCOES), dimethyl

adipimidate.2HCl (DMAA), dimethyl pimelimidate.HCl (DMP and dimethyl suberimidate. 2HC1 (DMS).

[0135] U.S. 5,589,463 and U.S. 5,807,832 describe the liberation of a single free carboxyl group on vitamin B12 and conjugation of carboxyl vitamin B 12 to a linker group which is bound to a drug, antigen or hapten such that the molecule created can be used for oral delivery to provide a pharmacological response to the drug, hormone, bio-active molecule or to elicit a systemic immune response to the immunogen. [0136] U.S. 6,083,926 describes the attachment of vitamin B12 via either a free carboxyl group generated by cleavage of one of the naturally-occurring primary amide groups on vitamin B 12 or by formation of an ether or carbamate linkage at the 5'-hydroxyl group. The vitamin B12 is attached to a linear water-soluble synthetic polymer. This construct is able to bind to transcobalamin II and targets receptors for the vitamin B12-transcobalamin II cell surface receptor, affecting cell trafficking via this receptor.

[0137] U.S. 6,450,341 relates to methods for preparing vitamin B12 (VB12) derivatives suitable for linking to a polymer, nanoparticle or therapeutic agent, protein or peptide. The methods involve reacting the 5ΌΗ group of VB12 or an analog thereof with an active carbonyl electrophile and subsequently obtaining said VB12 derivatives. The invention also relates to novel VB12 derivatives, VB12 derivatives prepared by the methods of the present invention and uses thereof in the preparation of in the preparation of polymer complexes or nanoparticles.

[0138] U.S. 6,159,502 and U.S. 6,221,397 describe nanoparticles and microparticles coupled to at least one carrier, the carrier being capable of enabling the complex to be transported to the circulation or lymphatic drainage system via the mucosal epithelium of the host, and the microparticle entrapping or encapsulating, or being capable of entrapping or encapsulating, the substance(s). Examples of suitable carriers include vitamin B12 and analogs or derivatives of Vitamin B12. [0139] U.S. 6,482,413 describes drug delivery systems for oral delivery of drugs, therapeutic proteinipeptides and vaccines which are loaded in a vitamin B12 coupled particulate carrier system with spacers in between, the carrier system with spacers which provide either a NH, or COOH or SH groups to link to a micro or nano particle carriers for the delivery of injectable drugs, therapeutic protein, peptides and vaccines. Disease-targeting

[0140] Extensive research into RNAi since its discovery in the 1990s has yielded many highly promising siRNA sequences with potential for providing therapeutic benefit. The absence of effecive delivery of RNAi therapeutics to the cytoplasm of diseased cells has been the major limitation of the realization of the promise of this technology. Castanotto and Rossi (2009) Nature 457:426-433.

[0141] One method to deliver therapeutics to the site of action is to employ a targeting group. Typically, this will be a chemical or biological entity which shows high affinity for a cell surface receptor which is overexpressed in disease cells. While the targeting group does not actually direct the therapeutic to the site of disease, it causes the therapeutic agent to be retained at that site and possibly facilitates internalization; for example, by initiating receptor mediated endocytosis. Many potential targeting groups have been explored, including proteins, peptides, monoclonal antibodies, steroids, and polysaccharides. Increased demand in diseased cells for nutrients and vitamins has also been used to provide effective targeting agents. The inventors and others have effectively used vitamin B12 (VB12; also known as cobalamin) to target drugs, typically cytotoxic agents, to sites of diseases in which demand for this vitamin is increased, resulting in overexpression of cell surface receptors which facilitate the absorption of these vitamins. [0142] VB12 is a group of cobalt-containing compounds which differ only in the nature of a monodentate ligand bound to the metal. This ligand is typically adenosine, cyanide, methyl or hydroxyl. VB12 functions as an essential co factor for two enzymes, methionine synthase and L-methylmalonyl coenzyme A (CoA) mutase. An inadequate in vivo concentration of VB12 results in neuropathy, megaloblastic anemia, and gastrointestinal symptoms. VB12 is not made in vivo and is naturally replenished by absorption from food.

[0143] Two transport processes are primarily responsible for transport of VB12 from the gut to cells involving the megalin and cubilin receptors (Christensen and Birn (2002) Nature Reviews Mol. Cell Biology 3:258-268). VB12 liberated from food in the gut binds to intrinsic factor (IF) for transport across gut epithelial cells and to transcobalamin II (TCII) for transport from the blood into cells (See Tharam (1999) Annual Rev. Nutr. 19: 173-195). Intrinsic factor binding to VB12 facilitates gut epithelial cell uptake in the ileum through receptor-mediated endocytosis (Batt and Horadagoda (1989) Am. J. Physiol. Gastrointest. Liver Physiol.

20:G344-G349). In the endosome, pH drops to 5.0 and VB12 is separates from IF at that pH, allowing TCII within the endosome to bind to the liberated VB12 (Ramasamy et al. (1989) Am. J. Physiol. Gastrointest. Liver Physiol. 20:G791-G797; Quadras et al. (1999) Am. J. Physiol. Gastrointest. Liver Physiol. 277:G161-G166). TCII-bound VB12 is then transported into the bloodstream (Seetharam et al. (1999) J. Nutrition. 129: 1761-1764). Recently it has been proposed that VB12 is pumped out of the endosome by the lysosomal Cbl transporter (LMBD1) then unbound VB12 is pumped across the epithelial cell wall by way of an ATP- driven exporter, MRP1, and VB12 binding to TCII occurs in the bloodstream (Beedholm- Ebsen et al. (2010) Blood 115: 1632-1639). This mechanism for VB12 transport out of the epithelial cell would appear suitable only for free VB12 and therefore unsuitable for nanoparticle bound VB12. But it has been clearly demonstrated that VB12 nanoparticles are transported across epithelial cell monolayers (Russell- Jones et al. (1999) Int. J. Pharmaceutics 179:247-255) and so endosome recycling presumably plays a vital role in completing the transport of VB12-TC II and other VB12 constructs across epithelial cells to microcirculation and then to portal blood (Scita and Di Fiore (2010) Nature 463:464-473).

[0144] Cyanocobalamin and hydroxycobalamin radiolabeled with either 57 Co or 32 P have similar biodistributions in rats 4 days after either s.c. or oral administration 4 days after administration, with % i.d. per gram approximately as follows: liver, 2.5; kidney, 5.5; lung, 2.0; spleen, 2.0; skeletal muscle, 1.2; bone and marrow, 1.2; blood, 2.0. (Grasbeck and Sarparanta (2008) Label Compd. Radiopharm 51 :59-63). High renal levels probably result due to the high proportion of cardiac output to that organ, glomerular filtration of VB12 followed by tubular reabsorption by the Megalin receptor (Birn et al. (2002) Am. J. Physiol. Renal Physiol. 282:F408-F416, Birn (2006) Am. J. Physiol. Renal Physiol. 291 :F22-F36).

[0145] Because "solid malignant tumors require prodigious amounts of B12 for growth" (Brown (2005) Chem. Rev. 105:2075-2149), over expression of the TCII receptors occurs which facilitates VB12 transport into cells, as reported for Caco-2 colon adenocarcinoma cells (Ramanujam et al. (1991) Am. J. Physiol. Gastrointest. Liver Physiol. 23:G416-G422) and several other studies (Oreshkin and Myasishcheva (1990) Bulletin Experi. Biology and Medicine 110:957-960, Finkler and Hal (1967) Archives of Biochemistry and Biophysics 120:79-85, Rabinowitz et al. (1982) Isr. J. Med. Sci. 18:740-745, Waibel et al. (2008) Cancer Res. 68:2904-2911). Radionuclide imaging of tumors using VB12 as the targeting agent provides evidence of the ability to VB12 to deliver a payload preferentially to tumors (Collins et al. (2000) Mayo Clin. Proc. 75:568-580). It has been proposed that TCI receptors are also preferentially expressed on the surface of tumor cells facilitating specific targeting of VB12 to tumor cells (Waibel et al. (2008) Cancer Res. 68:2904-2911). The cell-surface receptor for TCII is also known to be over expressed in several autoimmune diseases (Christensen and Birn (2002) Nature Reviews Mol. Cell Biology 3:258-268) which may permit VB12 targeting in other diseases.

[0146] It has been reported previously that VB12 bound to biologically-active compounds via linkers or polymer constructs can facilitate oral uptake of these biologically-active compounds or can facilitate tumor targeting following injection; similarly, biologically-active compounds encapsulated in nanoparticles which have VB12 bound to the surface of nanoparticles can also facilitate oral uptake of these biologically-active compounds or can facilitate tumor targeting following injection (Russell- Jones et al. US Pat 5,428,023; Russell- Jones et al. US Pat 5,449,720; Russell- Jones et al. US Pat 5,589,463; Russell- Jones et al. US Pat 6,150,341; Russell- Jones et al. US Pat 6,159,502; Bagnato et al. (2004) J. Org. Chem. 69:8987-8996; Chalasani et al. (2007) J. Controlled Release 117:421-429; Chalasani et al. (2007) J. Controlled Release 122: 141-150; Viola-Villegas et al. (2009) J. Med. Chem.

52:5253-5261; Petrus et al. (2009) Angew. Chem. Int. Ed. 48: 1022-1028; ). However, it has not previously been shown that such VB12 constructs can provide effective delivery of oligonucleotides.

[0147] In many diseases which involve cell proliferation, there is increased demand for certain vitamins compared with normal tissue. This phenomena can be utilized for targeting drugs to the site of disease such as tumors. For example, folic acid (vitamin B9), riboflavin, thiamine, and vitamin B12 has been reported used to target drugs and radioactive materials to tumors for therapy and diagnosis (U.S. Patents 5,108,921, 5,416,016, 5,635,382, 5,688,488, 7,128,893, 7,601,332, and Waibel et al. (2008) Cancer Res. 68:2904-2911). In most cases, the drug is covalently linked to the targeting system, thereby altering the drug and potentially altering its pharmacological and toxicological profile. A simple method is required to target the drug to sites of disease without chemical modification of the drug.

[0148] In many diseases, cells have an increased demand for vitamin B 12 which is reflected by an increase in the expression of cell surface receptors which facilitate the uptake, through receptor-mediated endocytosis, of this vitamin. Mechanistically, vitamin B12 binds to the circulating protein, transcobalamin II (TC-II), and it is the B12-TC-II complex which is recognized by the cell surface receptors. The B12-TC-II complex binding results in receptor- mediated endocytosis and internalization of the complex, followed by release of the vitamin B12. As was the case for vitamin B12 uptake in the GI tract, the process for cell uptake of vitamin B12 can be utilized using the 'Trojan Horse' principle to transport molecules into cells when these molecules are chemically linked to vitamin B12. For example, Waibel et al. (2008) Cancer Res. 68:2904-2911.

[0149] It is one object of the present invention to provide drug carrier systems and formulations which are effective while requiring no drug modification. Oligonucleotide conjugates of vitamin B12

[0150] The potential benefits of new therapeutics based upon RNA interference (RNAi) have been widely recognized for several years, and siRNA molecules are now available for silencing a very large number of genes. The main issue in applying this technology is the effective delivery of these oligonucleotides to the cytoplasm of cells in which gene silencing is desired. There are no active or facilitated transport processes to transfer oligonucleotides across cell membranes and the high negative charge of these molecules prevents passive diffusion. Oligonucleotides are also subject to degradation under certain biological conditions, and so must be protected during transport in vivo.

[0151] Many different drug delivery methods have been explored. There are two fundamental approaches. Either the unmodified oligonucleotide is encapsulated in a nano- sized delivery vehicle (such as virus particle, liposome, polymer nanoparticle) which can either be targeted (i.e. there is a surface function which show preferential binding at the target site) or untargeted. A second approach involves covalent conjugation of the oligonucleotide to a targeted or non-targeted delivery system (Aagaard and Rossi (2007) Advanced Drug Delivery Reviews 59:75-86). In both cases, at least two biological barriers must be circumvented. The construct must be able to enter cells, with some preference for the target cells, and the oligonucleotide then must be freed in the cell cytoplasm in sufficient quantities to be effective. Typically, cell entry involves endocytosis, and the drug delivery vehicle has to be able to cross (or disrupt) a second bilayer, the endosome/lysosome membrane to deliver the oligonucleotide. The delivery vehicle must be sufficiently robust to protect and hold its cargo during transit, yet must be able to release its cargo once in the cytoplasm.

[0152] The major research focus for the encapsulated approach involves the use of cationic lipids for liposome formation or cationic polymers for formation of nanoparticles. In both cases the positively charged carrier forms polyelectrolyte complexes (PECs) with the highly negatively charged oligonucleotide. PEC is a term which relates to two or more compounds binding to each other by virtue of multiple charge interactions. Liposomes now appear to be the leading platform for the systemic delivery of RNAi therapeutics, particularly for diseases which are natural targets for liposomes; the liver and solid cancers. They also have potential for treating infectious diseases and immune cell-related disorders. A large number of cationic lipids have been made and tested and siR A delivery in liposomes made from these lipids is starting to show promise (Semple et al. (2010) Nat. Biotechnol. 28: 172-176). However, the limited delivery range, known side-effect issues for other liposomal pharmaceutical products, and endosomal escape and controlled release in the cytoplasm remain issues. Targeted lysosomes have also been studied, but limited data exist to date (Chen et al. (2010) Mol. Ther. 2010, Epub ahead of print]; Venkatraman (2010) Front Biosci. [Schol Ed] 2:801-814).

[0153] While less advanced, cationic polymers are also some showing promise. However, issues of cytotoxicity of the polymers and controlled release still need to be addressed

(Bilensoy (2010) Expert Opin. Drug Deliv. 7:795-809). [0154] Release of the oligonucleotide payload from cationic lipid or cationic polymer nanostructures relies on a physicochemical disassociation of the two charged entities, and it has proven very difficult to achieve this selectively in the endosome, lysosome or cell cytoplasm (and rupture of the endosome/lysosome is an additional requirement after oligonucleotide release in this compartment in order that cytoplasm is accessed). This disadvantage is less apparent in the conjugate approach as linkers can be used which cleave much more selectively in the cell. However, choices are limited in order to ensure that little or no linker fragment remains attached to the oligonucleotide, which might alter or disrupt its ability to function within the cell. [0155] Some representative examples of targeted oligonucleotide conjugates intended to deliver a siR A to cell cytoplasm can be found in the following publications (all of which are incorporated herein by reference in their entirety): Nakagawa et al. (2010) J. Am. Chem. Soc. 132:8848-8849: Biswal et al. (2010) Mol. Biol. Rep. 37:2919-2926; and Meng et al. (2009) Intervirology 52: 135-140.

[0156] Various methods for conjugation of oligonucleotides to carrier and delivery systems have been documented in the literature. In will be obvious to those skilled in the art that these methods can be adapted for use in conjugating oligonucleotides to the carrier systems described in this application, and these conjugation methods are incorporated by reference. Singh et al. (2010) Chem. Soc. Rev. 39(6):2054-70. Nakagawa et al. (2010) J. Am. Chem. Soc. 132(26):8848-9. Marlin et al. (2010) Chembiochem. 11(11): 1493-500. Biswal et al. (2010) Mol. Biol. Rep. 37(6):2919-26.

[0157] Preferred methods of conjugating oligonucleotides to the carriers described herein are listed below, although other methods of conjugation known by those skilled in the art may be used.

[0158] Several protected aminohexyl phosphoramidites are commercially available which allow facile attachment of amine functionality to either the 3'- or 5'- end of oligonucleotides using standard synthetic protocols. The amine groups can be:

1. conjugated directly to various functional groups on the carriers, including:

a. via amide linkages with activated esters such as N-hydroxysuccinimide or carbodiimide activated carboxylic acids;

via thiourea linkages with isothiocyanates;

via carbamate linkages with carbonyl bis-azole activated alcohols;

2. reacted via amide, thiourea and carbamate linkages with heterobifunctional

coupling reagents bearing a different reactive group to amine, such as: a. thiol groups, which can be conjugated to various functional groups on the carriers, including:

i. via disulfide linkages with free thiols or pyridyldithio derivatives; ii. via thioether linkages with maleimide derivatives; b aldehyde groups, which can be conjugated to various functional groups on the carriers, including:

1 via reductive amination with amines;

ii. via hydrazone linkages with hydrazine derivatives;

iii. via oxime linkages with hydroxylamine derivatives;

iv. via thiazolidine linkages with 2-mercapto-ethylamine derivatives; c alkyne or azide groups, which can be conjugated to azide or alkyne groups, respectively, on the carriers via copper-catalyzed "click chemistry"

[0159] Several propargyl phosphoramidites are commercially available which allow facile attachment of alkyne functionality to either the 3'- or 5'- end of oligonucleotides using standard synthetic protocols. The alkyne groups can be conjugated to azide derivatives on the carriers via copper-catalyzed "click chemistry".

[0160] Nucleic acid phosphoramidation is a preferred method for conjugation as it provides a stable bond between linkers such as peptides and oligonucleotides. (Chu et al. (1983) Nucleic Acids Res. 11 :6513-6529). A 3 '-thiopropyl functionalized oligonucleotide can be synthesized as described in the literature or purchased commercially and coupled to a N- bromoacetylpeptyl-linked carrier system as described herein to link the oligonucleotide via a thioether linkage. Formation of an oligonucleotide conjugate by reaction between the oligonucleotide derivatized at the 5 '-extremity with a benzaldehyde moiety and an aminooxy reporter group resulting in an aromatic oxime linkage (Murat et al. (2009) Bioorganic & Medicinal Chemistry Letters 19:6534-6537).

[0161] Conjugation of the oligonucleotide to the carrier can be achieved either by performing solution chemistry or by use of a solid support process. Other methods for conjugating oligonucleotides to carrier systems that are known in the art can be adapted to prepare the conjugates described herein .

[0162] Attempts have been made to attach targeting groups to siRNA conjugates to enhance the delivery of these constructs in vivo to certain target regions, e.g. cancer. Examples of targeting groups which have been attached to siRNA include transferin (Kursa et al. (2003) Bioconjugate Chemistry 14:222) and folate (Zhang et al. (2008) RNA 14:577-583). During nanoparticle formation such large and/or hydrophobic targeting groups might be expected to migrate towards the surface of nanoparticles in preference to the hydrophilic environment within the internal matrix of the nanoparticle.

[0163] Alternatively VB12 can be attached using other methods known in the art. For example, one or more of the primary amide groups of VB12 may be selectively hydro lyzed to generate a free carboxyl group or ester, and subsequently the VB12 can be linked to the polymer via an optional linker through the liberated carboxyl group by methods well-known in the art (for example; Wilbur et al. (1996) Bioconjugate Chem. 7:461-474). The preferred method of attachment of VB12 to the polymer via an optional linker involves the formation of a covalent bond to one of the two hydroxyl groups of the ribose unit of VB12 by methods known in the art (for example; McEwan et al. (1999) Bioconjugate Chem. 10: 1131-1136).

[0164] It is within the scope of this invention that naturally-occurring polymers or readily- available synthetic polymers be used directly for formation of polymer conjugates of this invention, or that such polymers can be synthetically-modified. Modifications can include, but are not limited to, the introduction of charged or ionizable groups, attachment of VB12, and the introduction of functional groups (for example, hydrophobic or hydrophilic) which either enhance the nanoparticle formation and/or the pharmaceutical qualities of the resultant nanoparticles.

[0165] In one embodiment of this invention, the oligonucleotide is covalently linked to a small molecule, which can be a peptide, an aliphatic or aromatic entity, or mixture therefore, provided that such small molecule contains at least one functional group capable of covalently linking to the oligonucleotide and one functional group capable of covalently linking to VB12 and additional functional groups as needed to covalently link to any additional functional groups provided for cell targeting, avoidance of the RES, and/or release of the oligonucleotide or oligonucleotide conjugate into the cell cytoplasm.

[0166] In one embodiment of this invention, the oligonucleotide is covalently linked to a small molecule, which can be a peptide, an aliphatic or aromatic entity, or mixture therefore, provided that such small molecule contains at an saturated or unsaturated, linear or branched group containing at least one functional group at one end of the aliphatic chain capable of covalently linking to the oligonucleotide and one functional group at the other end of the aliphatic chain capable of covalently linking to VB12 and to additional functional groups as needed to covalently link to any additional functional groups provided for cell targeting, avoidance of the RES, and/or release of the oligonucleotide or oligonucleotide conjugate into the cell cytoplasm. The oligonucleotide conjugate as described may optionally be formulated in a liposome such that the oligonucleotide is positioned within the liposome and VB12 (and optional other functional groups) are presented on the surface of the liposome.

[0167] In one embodiment of this invention, oligonucleotide conjugates are incorporated into liposomes or nanoparticles formed by interacting oligonucleotide conjugate with the liposome components (which may be lipid aliphatic molecules with a positively charged group at one end, lipid aliphatic molecules with a negatively charged group at one end, or a mixture of positive and negatively charged lipids) or polymer components in such a manner as known in the art to form liposomes or polymer nanoparticles. Formation of the liposome or nanoparticle and/or the suitability of the resultant liposome or nanoparticle for pharmaceutical use may be facilitated or improved by the use of additional components during nanoparticle formation such that these additional components become incorporated into the liposome or nanoparticle.

[0168] In some embodiments, a ratio of the oligonucleotide to the vitamin B12 in the oligonucleotide conjugate of the present invention is in a range of 1 :20 to about 20:1, or alternatively in a range of about 1 : 15 to about 15 : 1 , or alternatively in a range of about 1 : 10 to about 10 : 1 , or alternatively in a range of about 1 :5 to about 5 : 1 , or alternatively in a range of about 1 :2 to about 2 : 1 , or alternatively the ratio of the therapeutic agent to the vitamin B 12 in the nanoparticles of the present invention is about 1 : 1 , or alternatively about 2: 1 , or alternatively about 1 :2, or alternatively about 3 : 1 , or alternatively about 1 :3, or alternatively about 4: 1 , or alternatively about 1 :4, or alternatively about 5 : 1 , or alternatively about 1 :5, or alternatively about 6: 1 , or alternatively about 1 :6, or alternatively about 7: 1 , or alternatively about 1 :7, or alternatively about 8: 1, or alternatively about 1 :8, or alternatively about 9: 1, or alternatively about 1 :9, or alternatively about 2:3.

[0169] It is obvious to those skilled in the art that pharmaceutically- suitable oligonucleotide formulations can also be formed by incorporation of more than one therapeutically-active oligonucleotide conjugate compound or combining the oligonucleotide conjugate with a therapeutically active compound in a single formulation.

[0170] As indicated above, it may be desirous in the formation of oligonucleotide formulations to utilize additional components before, during or after formation of the oligonucleotide formulations in order to control the size of particles, control stability and/or the drug release profile. Possible additional components include, but are not limited to, polyethylene glycol (PEG) and PEG block copolymers, polyacrylic, polymethacrylic, and other synthetic polymers, starch, cellulose, and other polysaccharides, fatty acids and other surfactants, and metal ions, especially di- and trivalent ions such as zinc, magnesium, calcium, iron, chromium and aluminum. Additional components might also include a crosslinking agent, for example epoxy compounds, dialdehyde starch, glutaraldehyde, formaldehyde, dimethyl suberimidate, carbodiimides, succinimidyls, diisocyanates, acyl azide, reuterin, and crosslinking effected by ultraviolet irradiation.

[0171] It is within the scope of this invention that the primary purpose of the additional component is to facilitate the introduction of additional VB12 or additional functional groups provided for cell targeting, avoidance of the RES, and/or release of the oligonucleotide or oligonucleotide conjugate into the cell cytoplasm to the particle during its formation. For example, the additional component could be VB12 which contains a fatty acid attached to either the 5'-0 or 2'-0 position (or both), and the VB12 is incorporated by hydrophobic interaction of the fatty acid portion with other hydrophobic components involved in nanoparticle formation. Other methods of incorporating VB12 as one of the additional components will be obvious to those skilled in the art. As another example, the VB12 additional component may be functionalized with a compound that is known to bind strongly to one of the other components of nanoparticle formation (e.g. strepatavidin and biotin are well known to bind strongly to each other; similarly, U.S. Pat. 5,605,890 exemplifies a cyclodextrin-adamantane "lock and key" binding system).

[0172] The polymers used in this invention can have an average molecular weight in the range of 1-10,000 kDa. The preferred average molecular weights will be determined by the specific requirements of formation and the desired pharmaceutical properties of the PEC nanoparticles. In some embodiments, the average molecular weight of the polymer of the invention is in a range of about 1-10,000 kDa; or alternatively in a range of about 1-5000 KDa; or alternatively in a range of about 1-1000 KDa; or alternatively in a range of about 1- 500 KDa; or alternatively in a range of about 1-100 KDa; or alternatively in a range of about 10-10,000 KDa; or alternatively in a range of about 10-5000 KDa; or alternatively in a range of about 10-4000 KDa; or alternatively in a range of about 10-2000 KDa; or alternatively in a range of about 10-1000 KDa; or alternatively in a range of about 10-500 KDa; or alternatively in a range of about 50-10,000 KDa; or alternatively in a range of about 50-5,000 KDa; or alternatively in a range of about 50-1,000 KDa; or alternatively in a range of about 50-500 KDa; or alternatively in a range of about 100-10,000 KDa; or alternatively in a range of about 100-5,000 KDa; or alternatively in a range of about 100-1,000 KDa; or alternatively in a range of about 100-500 KDa; or alternatively in a range of about 500-10,000 KDa; or alternatively in a range of about 500-1,000 KDa; or alternatively in a range of about 1000- 10,000 KDa; or alternatively in a range of about 1000-5,000 KDa; or alternatively in a range of about 2000-10,000 KDa; or alternatively in a range of about 2000-5,000 KDa; or alternatively in a range of about 4000-10,000 KDa; or alternatively in a range of about 4000- 5000 KDa; or alternatively in a range of about 5000-10,000 KDa; or alternatively in a range of about 6000-10,000 KDa; or alternatively in a range of about 7000-10,000 KDa; or alternatively in a range of about 8000-10,000 KDa; or alternatively in a range of about 9000- 10,000 KDa. [0173] In one embodiment, a function of the oligonucleotide conjugate of this invention is to facilitate or enhance the oral bioavailability of the oligonucleotides. Oligonucleotides have poor natural oral bioavailability by virtue of degradation and denaturing in the GI tract and an inability to cross the gut wall and enter the bloodstream.

[0174] In one embodiment, a function of the oligonucleotide formulations of this invention is to facilitate or enhance the oral bioavailability of the oligonucleotide conjugate (or conjugates) contained within the formulation. For example, the oligonucleotide conjugates may have poor natural oral bioavailability by virtue of either (or both) degradation or denaturing in the GI tract or an inability to cross the gut wall and enter the bloodstream.

[0175] In a further embodiment, a function of the oligonucleotide formulations of this invention is to modify the oral bioavailability of oligonucleotides conjugates contained within the formulation. For example, the oligonucleotides conjugates may have sufficient oral bioavailability to be therapeutically effective when given orally, and the formulations of this invention either improve oral bioavailability (reducing the amount of oligonucleotide conjugate that needs to be administered) and/or alters the pharmacokinetic profile of the oligonucleotide conjugate in a desirable manner.

[0176] In a further embodiment, a function of the oligonucleotide conjugates and oligonucleotide formulations of this invention is to facilitate targeting of the oligonucleotide to sites of disease, especially in diseases in which the demand for VB12 is increased compared with the demand for the vitamin normally. [0177] In a further embodiment, a function of the oligonucleotide conjugates and oligonucleotide formulations of this invention is to facilitate release of the oligonucleotide into the cytoplasm of cells at the sites of disease, especially in diseases in which the demand for VB12 is increased compared with the demand for the vitamin normally.

[0178] In a further embodiment, a function of the oligonucleotide conjugates and oligonucleotide formulations of this invention is to combine oral drug delivery and targeting; following oral drug delivery as described above, the oligonucleotide conjugates and oligonucleotide formulations are then targeted to sites of disease, also as described above.

[0179] In a further embodiment, a function of the oligonucleotide conjugates and oligonucleotide formulations of this invention is to deliver polynucleotides (e.g. siRNA and antisense RNA) and other RNA interference therapeutics across cell membranes to deliver the actives into the intracellular environment and to the nucleus, where they are effective, and for gene therapy.

[0180] In a further embodiment, a function of the oligonucleotide conjugates and oligonucleotide formulations of this invention is to deliver oligonucleotide conjugates and oligonucleotide formulations which are effective in the treatment of CNS disorders across the blood-brain barrier.

[0181] In a further embodiment, a function of the oligonucleotide conjugates and oligonucleotide formulations of this invention is to deliver oligonucleotide conjugates and oligonucleotide formulations which are effective in the treatment diseases and disorders wherein the demand for vitamin B12 is increased, including but not limited to, cancer, rheumatoid arthritis, psoriasis, acute leukemia, lymphomas, Crohn's disease, ulcerative colitis, and multiple sclerosis. Pharmaceutical preparations for targeted delivery to sites of disease can be administered by injection. Compositions and Formulations

[0182] In another aspect, the present technology provides compositions comprising or consisting essentially of a oligonucleotide conjugate and oligonucleotide formulation of the present technology and a carrier, diluent, or excipient. In another embodiment, the carrier, diluent, or excipient is pharmaceutically acceptable. A variety of carrier, diluent, or excipient, pharmaceutically acceptable or not, are well known to one of skill in the art.

[0183] The nanoparticle may comprise an agent or agents which in turn are compounds or isomers, prodrug, tautomer, or pharmaceutically acceptable salts thereof, of the present technology can be formulated in the pharmaceutically acceptable compositions per se, or in the form of a hydrate, solvate, N-oxide, or pharmaceutically acceptable salt, as described herein. Typically, such salts are more soluble in aqueous solutions than the corresponding free acids and bases, but salts having lower solubility than the corresponding free acids and bases may also be formed. The present technology includes within its scope solvates of the compounds and salts thereof, for example, hydrates.

[0184] In one embodiment, the present technology provides a pharmaceutically acceptable composition (formulation) comprising a nanoparticle and at least one pharmaceutically acceptable excipient, diluent, preservative, stabilizer, or mixture thereof.

[0185] In one embodiment, the methods can be practiced as a therapeutic approach towards the treatment of the conditions described herein. Thus, in a specific embodiment, the compounds of the present technology can be used to treat the conditions described herein in animal subjects, including humans. The methods generally comprise administering to the subject a nanoparticle of the present technology, or a salt, prodrug, hydrate, or N-oxide thereof, effective to treat the condition. As used herein, prodrug of a compound of the present technology is a compound that is converted in vivo or in vitro to the compound of the present technology. Hydrolysis, oxidation, and/or reduction are some ways that a prodrug is converted to the compound of the present technology.

[0186] In some embodiments, the subject is a non-human mammal, including, but not limited to, bovine, horse, feline, canine, rodent, or primate. In another embodiment, the subject is a human.

[0187] The oligonucleotide conjugates and oligonucleotide formulations of the present technology can be provided in a variety of formulations and dosages. It is to be understood that reference to the compound of the present technology, or "active" in discussions of formulations is also intended to include, where appropriate as known to those of skill in the art, formulation of the salts and prodrugs of the compounds.

[0188] Pharmaceutically acceptable compositions comprising the nanoparticles described herein (or salts or prodrugs thereof) can be manufactured by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilization processes. The compositions can be formulated in conventional manner using one or more physiologically acceptable carriers, diluents, excipients, or auxiliaries which facilitate processing of the active compounds into preparations which can be used

pharmaceutically.

[0189] The oligonucleotide conjugates and oligonucleotide formulations of the present technology can be administered by oral, parenteral (e.g., intramuscular, intraperitoneal, intravenous, ICV, intracisternal injection or infusion, subcutaneous injection, or implant), by inhalation spray, nasal, vaginal, rectal, sublingual, urethral (e.g., urethral suppository) or topical routes of administration (e.g., gel, ointment, cream, aerosol, etc.) and can be formulated, alone or together, in suitable dosage unit formulations containing conventional non-toxic pharmaceutically acceptable carriers, adjuvants, excipients, and vehicles appropriate for each route of administration.

[0190] The pharmaceutically acceptable compositions for the administration of the oligonucleotide conjugates and oligonucleotide formulations of this invention can be conveniently presented in unit dosage form and can be prepared by any of the methods well known in the art. The pharmaceutically acceptable compositions can be, for example, prepared by uniformly and intimately bringing the active ingredient into association with a liquid carrier, a finely divided solid carrier or both, and then, if necessary, shaping the product into the desired formulation. In the pharmaceutical composition the active object compound is included in an amount sufficient to produce the desired therapeutic effect. For example, pharmaceutically acceptable compositions of the present technology may take a form suitable for virtually any mode of administration, including, for example, topical, ocular, oral, buccal, systemic, nasal, injection, transdermal, rectal, and vaginal, or a form suitable for

administration by inhalation or insufflation.

[0191] For topical administration, the oligonucleotide conjugates and oligonucleotide formulations can be formulated as solutions, gels, ointments, creams, suspensions, etc., as is well-known in the art.

[0192] Systemic pharmaceutically acceptable compositions include those designed for administration by injection (e.g., subcutaneous, intravenous, intramuscular, intrathecal, or intraperitoneal injection) as well as those designed for transdermal, transmucosal, oral, or pulmonary administration.

[0193] Useful injectable pharmaceutically acceptable compositions include sterile suspensions, solutions, or emulsions of the active compound(s) in aqueous or oily vehicles. The pharmaceutically acceptable compositions may also contain formulating agents, such as suspending, stabilizing, and/or dispersing agents. The formulations for injection can be presented in unit dosage form, e.g., in ampules or in multidose containers, and may contain added preservatives.

[0194] Alternatively, the injectable pharmaceutically acceptable compositions can be provided in powder form for reconstitution with a suitable vehicle, including but not limited to sterile pyrogen free water, buffer, and dextrose solution, before use. To this end, the active compound(s) can be dried by any art-known technique, such as lyophilization, and

reconstituted prior to use.

[0195] For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the pharmaceutically acceptable compositions. Such penetrants are known in the art. [0196] For oral administration, the pharmaceutically acceptable compositions may take the form of, for example, lozenges, tablets, or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone, or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose, or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc, or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulfate). The tablets can be coated by methods well known in the art with, for example, sugars, films, or enteric coatings. Additionally, the

pharmaceutically acceptable compositions containing the compounds of the present technology or prodrug thereof in a form suitable for oral use may also include, for example, troches, lozenges, aqueous, or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs.

[0197] Pharmaceutically acceptable compositions intended for oral use can be prepared according to any method known to the art for the manufacture of pharmaceutically acceptable compositions, and such compositions may contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents, and preserving agents in order to provide pharmaceutically elegant and palatable preparations. Tablets contain the active ingredient (including drug and/or prodrug) in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets. These excipients can be for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents (e.g., corn starch or alginic acid); binding agents (e.g. starch, gelatin, or acacia); and lubricating agents (e.g., magnesium stearate, stearic acid, or talc). The tablets can be left uncoated or they can be coated by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a time delay material such as glyceryl monostearate or glyceryl distearate can be employed. They may also be coated by the techniques described in the U.S. Pat. Nos.

4,256,108; 4,166,452; and 4,265,874 to form osmotic therapeutic tablets for control release. The pharmaceutically acceptable compositions of the present technology may also be in the form of oil-in- water emulsions. [0198] Liquid pharmaceutically acceptable compositions (or liquid preparations) for oral administration may take the form of, for example, elixirs, solutions, syrups, or suspensions, or they can be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations can be prepared by conventional means with

pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives, or hydrogenated edible fats); emulsifying agents (e.g., lecithin, or acacia); nonaqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol, cremophore™, or fractionated vegetable oils); and preservatives (e.g., methyl or propylphydroxybenzoates or sorbic acid). The preparations may also contain buffer salts, preservatives, flavoring, coloring, and sweetening agents as appropriate.

[0199] Preparations for oral administration can be suitably formulated to give controlled release or sustained release of the active compound, as is well known. The sustained release formulations (or sustained release pharmaceutically acceptable compositions) of the present technology are preferably in the form of a compressed tablet comprising an intimate mixture of compound of the present technology and a partially neutralized pH-dependent binder that controls the rate of compound dissolution in aqueous media across the range of pH in the stomach (typically approximately 2) and in the intestine (typically approximately about 5.5).

[0200] To provide for a sustained release of compounds of the present technology, one or more pH-dependent binders can be chosen to control the dissolution profile of the sustained release pharmaceutically acceptable compositions so that such pharmaceutically acceptable compositions release compound slowly and continuously as the pharmaceutically acceptable compositions are passed through the stomach and gastrointestinal tract. Accordingly, the pH- dependent binders suitable for use in the present technology are those which inhibit rapid release of drug from a tablet during its residence in the stomach (where the pH is-below about 4.5), and which promotes the release of a therapeutic amount of the compound of the present technology from the dosage form in the lower gastrointestinal tract (where the pH is generally greater than about 4.5). Many materials known in the pharmaceutical art as "enteric" binders and coating agents have a desired pH dissolution properties. The examples include phthalic acid derivatives such as the phthalic acid derivatives of vinyl polymers and copolymers, hydroxyalkylcelluloses, alkylcelluloses, cellulose acetates, hydroxyalkylcellulose acetates, cellulose ethers, alkylcellulose acetates, and the partial esters thereof, and polymers and copolymers of lower alkyl acrylic acids and lower alkyl acrylates, and the partial esters thereof. One or more pH-dependent binders present in the sustained release formulation of the present technology are in an amount ranging from about 1 to about 30 wt %, about 5 to about 12 wt % and about 10 wt %.

[0201] One or more pH-independent binders may be in used in oral sustained release pharmaceutically acceptable compositions of the present technology. The pH-independent binders can be present in the pharmaceutically acceptable compositions of the present technology in an amount ranging from about 1 to about 10 wt %, from about 1 to about 3 wt % and about 2 wt %.

[0202] The sustained release pharmaceutically acceptable compositions of the present technology may also contain pharmaceutically acceptable excipients intimately admixed with the compound and the pH-dependent binder. Pharmaceutically acceptable excipients may include, for example, pH-independent binders or film-forming agents such as hydroxypropyl methylcellulose, hydroxypropyl cellulose, methylcellulose, polyvinylpyrrolidone, neutral poly(meth)acrylate esters, starch, gelatin, sugars, carboxymethylcellulose, and the like. Other useful pharmaceutical excipients include diluents such as lactose, mannitol, dry starch, microcrystalline cellulose and the like; surface active agents such as polyoxyethylene sorbitan esters, sorbitan esters and the like; and coloring agents and flavoring agents. Lubricants (such as talc and magnesium stearate) and other tableting aids can also be optionally present.

[0203] The sustained release pharmaceutically acceptable compositions of the present technology have a compound of the present technology in the range of about 50% by weight to about 95% or more by weight, about 70%> to about 90%> by weight; a pH-dependent binder content of between 5% and 40%>, between 5% and 25%, and between 5% and 15%; with the remainder of the dosage form comprising pH-independent binders, fillers, and other optional excipients.

[0204] For buccal administration, the pharmaceutically acceptable compositions may take the form of tablets or lozenges formulated in the conventional manner. [0205] For rectal and vaginal routes of administration, the active compound(s) can be formulated as solutions (for retention enemas), suppositories, or ointments containing conventional suppository bases such as cocoa butter or other glycerides.

[0206] For nasal administration or administration by inhalation or insufflation, the active compound(s) or prodrug(s) can be conveniently delivered in the form of an aerosol spray from pressurized packs or a nebulizer with the use of a suitable propellant (e.g.,

dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, fluorocarbons, carbon dioxide, or other suitable gas). In the case of a pressurized aerosol, the dosage unit can be determined by providing a valve to deliver a metered amount. Capsules and cartridges for use in an inhaler or insufflator (for example, capsules and cartridges comprised of gelatin) can be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

[0207] The pharmaceutically acceptable compositions can be in the form of a sterile injectable aqueous or oleaginous suspension. This suspension can be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents which have been mentioned above. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent. Among the acceptable vehicles and solvents that can be employed are water, Ringer's solution, and isotonic sodium chloride solution. The compounds may also be administered in the form of suppositories for rectal or urethral administration of the drug.

[0208] For topical use, creams, ointments, jellies, gels, solutions, suspensions, etc., containing the oligonucleotide conjugates and oligonucleotide formulations of the present technology, can be employed. In some embodiments, the compounds of the present technology can be formulated for topical administration with polyethylene glycol (PEG). These formulations may optionally comprise additional pharmaceutically acceptable ingredients such as diluents, stabilizers, and/or adjuvants.

[0209] Included among the devices which can be used to administer oligonucleotide conjugates and oligonucleotide formulations of the present technology, are those well-known in the art, such as metered dose inhalers, liquid nebulizers, dry powder inhalers, sprayers, thermal vaporizers, and the like. Other suitable technology for administration of particular oligonucleotide conjugates and oligonucleotide formulations of the present technology includes electrohydrodynamic aerosolizers. As those skilled in the art will recognize, the formulation of oligonucleotide conjugates and oligonucleotide formulations, the quantity of the formulation delivered, and the duration of administration of a single dose depend on the type of inhalation device employed as well as other factors. For some aerosol delivery systems, such as nebulizers, the frequency of administration and length of time for which the system is activated will depend mainly on the concentration of the oligonucleotide conjugates and oligonucleotide formulations in the aerosol. For example, shorter periods of

administration can be used at higher concentrations of nanoparticles in the nebulizer solution. Devices such as metered dose inhalers can produce higher aerosol concentrations and can be operated for shorter periods to deliver the desired amount of oligonucleotide conjugates and oligonucleotide formulations in some embodiments. Devices such as dry powder inhalers deliver active agent until a given charge of agent is expelled from the device. In this type of inhaler, the amount of oligonucleotide conjugates and oligonucleotide formulations in a given quantity of the powder determines the dose delivered in a single administration.

[0210] Pharmaceutically acceptable compositions of the oligonucleotide conjugates and oligonucleotide formulations of the present technology for administration from a dry powder inhaler may typically include a finely divided dry powder containing oligonucleotide conjugates and oligonucleotide formulations, but the powder can also include a bulking agent, buffer, carrier, excipient, another additive, or the like. Additives can be included in such a dry powder composition of oligonucleotide conjugates and oligonucleotide formulations of the present technology, for example, to dilute the powder as required for delivery from the particular powder inhaler, to facilitate processing of the formulation, to provide advantageous powder properties to the formulation, to facilitate dispersion of the powder from the inhalation device, to stabilize the formulation (e.g., antioxidants or buffers), to provide taste to the formulation, or the like. Typical additives include mono-, di-, and polysaccharides; sugar alcohols and other polyols, such as, for example, lactose, glucose, raffmose, melezitose, lactitol, maltitol, trehalose, sucrose, mannitol, starch, or combinations thereof; surfactants, such as sorbitols, diphosphatidyl choline, or lecithin; and the like. [0211] For prolonged delivery, the oligonucleotide conjugates and oligonucleotide formulations of the present technology can be formulated as a depot preparation for administration by implantation or intramuscular injection. The active ingredient can be formulated with suitable polymeric or hydrophobic materials (e.g., as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives (e.g., as a sparingly soluble salt). Alternatively, transdermal delivery systems manufactured as an adhesive disc or patch which slowly releases the active oligonucleotide conjugates and oligonucleotide formulations for percutaneous absorption can be used. To this end, permeation enhancers can be used to facilitate transdermal penetration of the active oligonucleotide conjugates and oligonucleotide formulations. Suitable transdermal patches are described in, for example, U.S. Patent No. 5,407,713.; U.S. Patent No. 5,352,456; U.S. Patent No. 5,332,213; U.S. Patent No. 5,336,168; U.S. Patent No. 5,290,561; U.S. Patent No. 5,254,346; U.S. Patent No. 5,164,189; U.S. Patent No. 5,163,899; U.S. Patent No. 5,088,977; U.S. Patent No. 5,087,240; U.S. Patent No. 5,008,110; and U.S. Patent No. 4,921,475. [0212] Alternatively, other pharmaceutical delivery systems can be employed. Liposomes and emulsions are well-known examples of delivery vehicles that can be used to deliver active nanoparticle(s) or prodrug(s). Certain organic solvents such as dimethylsulfoxide (DMSO) may also be employed, for example for topical administration, although usually at the cost of greater toxicity. [0213] The pharmaceutical compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active nanoparticle(s). The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device can be accompanied by instructions for administration.

[0214] The oligonucleotide conjugates and oligonucleotide formulations described herein, or compositions thereof, will generally be used in an amount effective to achieve the intended result, for example, in an amount effective to treat or prevent the particular condition being treated. The nanoparticles can be administered therapeutically to achieve therapeutic benefit or prophylactically to achieve prophylactic benefit. By therapeutic benefit is meant eradication or amelioration of the underlying disorder being treated and/or eradication or amelioration of one or more of the symptoms associated with the underlying disorder such that the patient reports an improvement in feeling or condition, notwithstanding that the patient may still be afflicted with the underlying disorder. Therapeutic benefit also includes halting or slowing the progression of the disease, regardless of whether improvement is realized. [0215] The amount of oligonucleotide conjugates and oligonucleotide formulations administered will depend upon a variety of factors, including, for example, the particular condition being treated, the mode of administration, the severity of the condition being treated, the age and weight of the patient, the bioavailability of the particular oligonucleotide conjugate and oligonucleotide formulation. Determination of an effective dosage is well within the capabilities of those skilled in the art. As known by those of skill in the art, the preferred dosage of oligonucleotide conjugates and oligonucleotide formulations of the present technology will also depend on the age, weight, general health, and severity of the condition of the individual being treated. Dosage may also need to be tailored to the sex of the individual and/or the lung capacity of the individual, where administered by inhalation. Dosage, and frequency of administration of the oligonucleotide conjugates and

oligonucleotide formulations thereof, will also depend on whether the oligonucleotide conjugates and oligonucleotide formulations are formulated for treatment of acute episodes of a condition or for the prophylactic treatment of a disorder. A skilled practitioner will be able to determine the optimal dose for a particular individual. [0216] For prophylactic administration, the oligonucleotide conjugates and oligonucleotide formulations can be administered to a patient at risk of developing one of the previously described conditions. Alternatively, prophylactic administration can be applied to avoid the onset of symptoms in a patient diagnosed with the underlying disorder.

[0217] Effective dosages can be estimated initially from in vitro assays. For example, an initial dosage for use in animals can be formulated to achieve a circulating blood or serum concentration of the oligonucleotide conjugate or oligonucleotide formulation that is at or above an IC₅₀ of the particular oligonucleotide as measured in as in vitro assay. Calculating dosages to achieve such circulating blood or serum concentrations taking into account the bioavailability of the particular nanoparticle is well within the capabilities of skilled artisans. For guidance, the reader is referred to Fingl & Woodbury, "General Principles," GOODMAN AND GILMAN'S THE PHARMACEUTICAL BASIS OF THERAPEUTICS, Chapter 1, pp. 1-46, latest edition, Pergamon Press, and the references cited therein.

[0218] Initial dosages can also be estimated from in vivo data, such as animal models. Certain animal models useful for testing the efficacy of oligonucleotide conjugates and oligonucleotide formulations to treat or prevent the various diseases described above are well- known in the art. Ordinarily skilled artisans can routinely adapt such information to determine dosages suitable for human administration.

[0219] Dosage amounts will typically be in the range of from about 0.0001 or about 0.001 or about 0.01 mg/kg/day to about 100 mg/kg/day, but can be higher or lower, depending upon, among other factors, the activity of the oligonucleotide conjugate or oligonucleotide formulation, its bioavailability, the mode of administration, and various factors discussed above. Dosage amount and interval can be adjusted individually to provide levels in the organ system of interest of the nanoparticle(s) which are sufficient to maintain therapeutic or prophylactic effect. For example, the oligonucleotide conjugates and oligonucleotide formulations can be administered once per week, several times per week (e.g., every other day), once per day, or multiple times per day, depending upon, among other things, the mode of administration, the specific indication being treated, and the judgment of the prescribing physician. In cases of local administration or selective uptake, such as local topical administration, the effective local concentration of oligonucleotide conjugates and

oligonucleotide formulations may not be related to plasma concentration. Skilled artisans will be able to optimize effective local dosages without undue experimentation.

[0220] The oligonucleotide conjugates and oligonucleotide formulations useful in the treatment methods of the present technology will provide therapeutic or prophylactic benefit without causing substantial toxicity. Toxicity of the oligonucleotide conjugates and oligonucleotide formulations can be determined using standard pharmaceutical procedures. The dose ratio between toxic and therapeutic (or prophylactic) effect is the therapeutic index. In certain embodiments, the oligonucleotide conjugates and oligonucleotide formulations exhibit high therapeutic indices as pertinent to the disease treated. [0221] The foregoing disclosure pertaining to the dosage requirements for the oligonucleotide conjugates and oligonucleotide formulations of the present technology is pertinent to dosages required for prodrugs, with the realization, apparent to the skilled artisan, that the amount of prodrug(s) administered will also depend upon a variety of factors, including, for example, the bioavailability of the particular prodrug(s) and the conversation rate and efficiency into active drug nanoparticle under the selected route of administration. Determination of an effective dosage of prodrug(s) for a particular use and mode of administration is well within the capabilities of those skilled in the art.

[0222] Also provided are kits for administration of the oligonucleotide conjugates and oligonucleotide formulations of the present technology, prodrug thereof, or pharmaceutical formulations comprising the oligonucleotide conjugate or oligonucleotide formulation that may include a dosage amount of at least one oligonucleotide conjugate or oligonucleotide formulation or a composition comprising at least one oligonucleotide conjugate or oligonucleotide formulation, as disclosed herein. Kits may further comprise suitable packaging and/or instructions for use of the oligonucleotide conjugate or oligonucleotide formulation. Kits may also comprise a means for the delivery of the at least one

oligonucleotide conjugate or oligonucleotide formulation or compositions comprising at least one oligonucleotide conjugate or oligonucleotide formulation of the present technology, such as an inhaler, spray dispenser (e.g., nasal spray), syringe for injection, or pressure pack for capsules, tablets, suppositories, or other device as described herein.

[0223] Other types of kits provide the oligonucleotide conjugate or oligonucleotide formulation and reagents to prepare a composition of the present technology for

administration. The composition can be in a dry or lyophilized form or in a solution, particularly a sterile solution. When the composition is in a dry form, the reagent may comprise a pharmaceutically acceptable diluent for preparing a liquid formulation. The kit may contain a device for administration or for dispensing the compositions, including, but not limited to, syringe, pipette, transdermal patch, or inhalant.

[0224] The kits may include other formulated therapeutic agents for use in conjunction with the oligonucleotide conjugates and oligonucleotide formulations of the present technology described herein. These formulated therapeutic agents can be provided in a separate form or mixed with the oligonucleotide conjugates and oligonucleotide formulations of the present technology. The kits will include appropriate instructions for preparation and administration of the composition, side effects of the compositions, and any other relevant information. The instructions can be in any suitable format, including, but not limited to, printed matter, videotape, computer readable disk, or optical disc.

[0225] In one embodiment, the present technology provides a kit comprising a

oligonucleotide conjugate or oligonucleotide formulation selected from the oligonucleotide conjugates and oligonucleotide formulations of the present technology or a salt or prodrug thereof, packaging, and instructions for use. [0226] In another embodiment, the present technology provides a kit comprising the pharmaceutically acceptable composition comprising a oligonucleotide conjugate or oligonucleotide formulation selected from the oligonucleotide conjugates and oligonucleotide formulations of the present technology or a salt or prodrug thereof and at least one

pharmaceutically acceptable excipient, diluent, preservative, stabilizer, or mixture thereof, packaging, and instructions for use. In another embodiment, kits for treating an individual who suffers from or is susceptible to the conditions described herein are provided, comprising a container comprising a dosage amount of a nanoparticle or composition of the present technology, as disclosed herein, and instructions for use. The container can be any of those known in the art and appropriate for storage and delivery of oral, intravenous, topical, rectal, urethral, or inhaled formulations.

[0227] Kits may also be provided that contain sufficient dosages of the oligonucleotide conjugates and oligonucleotide formulations or composition to provide effective treatment for an individual for an extended period, such as a week, 2 weeks, 3, weeks, 4 weeks, 6 weeks, or 8 weeks or more. [0228] The technology having been described in summary and in detail is illustrated and not limited by the examples below.

Examples

Example 1 - Synthesis of Dextran Succinate (DS)

[0229] 70 kDa Dextran (10 g) was stirred in dry dimethylsulfoxide (100 mL) and pyridine (15 mL). Succinic anhydride (1.54 g) was added and the mixture, which became a homogenous solution after 1 hour, was stirred at room temperature under argon for 16 hours. The solution was poured into stirred ethyl acetate (400 mL), and then acetone (400 mL) was added and stirring was continued for 16 hours, during which the pasty precipitate eventually became granular. The precipitate was filtered, washed with ethyl acetate and dried under vacuum to afford a white solid, which was dissolved in water (250 mL). The aqueous solution was acidified with dilute HC1 to pH 2 and 5x diafiltered with water using a 0.1 m TFF (tangential flow filtration) module with a 5 kDa MWCO membrane. The solution was then concentrated to ~50 mL by TFF and lyophilized to afford dextran 20% succinate as a white solid (10.2 g). 1H NMR analysis confirmed that the product contained 0.2 equivalents of succinate per anhydroglucose unit (20% succinylation).

Example 2 - Synthesis of VB12-Dextran Succinate Conjugate (Cob-DS)

[0230] 70 kDa Dextran 20% succinate (200 mg) and aminohexyl-VB12 (20 mg) were dissolved in water (8 mL). l-Ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (200 mg) and N-hydroxysuccinimide (200 mg) were added and the solution (pH 5.5) was stirred for 16 hours. The mixture was centrifuged in a 5 kDa Amicon-15 centrifugal filter at 4800 rpm for 45 min. Water (15 mL) was added to the retentate and centrifuged; then the 15 mL wash was repeated once more. The washed retentate was lyophilized to afford Cob- DS (223 mg) as a pale red solid. UV-VIS spectrophotometric analysis revealed the product contained 3.25 % w/w of VB12, which corresponds to -0.5 equivalents of AH-VB12 per 100 anhydroglucose units (0.5 mol%> VB12).

Example 3 - Synthesis of Carboxymethyl Dextran (CMD)

[0231] A solution of 70 kDa dextran (4.0 g) in 11% sodium hydroxide (20 mL) was added to a solution of chloroacetic acid (2.3 g) in tert-butanol (40 mL) and the biphasic mixture was stirred vigorously at 60°C for 3 hours. After cooling to room temperature, the mixture was poured into stirring acetone (400 mL) and the resulting pasty precipitate was separated by decantation. The paste was dissolved in water (25 mL) and poured into stirring methanol (300 mL) and the resulting white precipitate was filtered, washed with methanol and dried under vacuum. The crude product was dissolved in water and 5x diafiltered with water using 2

a 0.1 m TFF (tangential flow filtration) module with a 5 kDa MWCO membrane. The solution was then concentrated by TFF and lyophilized to afford a white solid (4.6 g). 1H NMR analysis revealed that the product contained 0.2 carboxy-methyl equivalents per anhydroglucose unit (20% carboxymethylation). Example 4 - Synthesis of VB12-Carboxymethyl Dextran Conjugate (Cob-CMD)

[0232] 20% Carboxymethyl 70 kDa dextran (200 mg) and aminohexyl-VB12 (50 mg) were dissolved in water (10 mL). l-Ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (ED AC; 60 mg) and N-hydroxysuccinimide (NHS; 15 mg) were added and the solution was stirred for 20 hours at pH 5.5. The mixture was centrifuged in a 5 kDa Amicon-15 centrifugal filter at 3800 rpm for 45 min. Water (15 mL) was added to the retentate and centrifuged, and then the 15 mL wash was repeated once more. The retentate was lyophilized to afford Cob- CMD (224 mg) as a pale red solid. UV-VIS spectrophotometric analysis revealed the product contained 12% w/w of VB12, which corresponds to -1.7 equivalents of AH-VB12 per 100 anhydroglucose units (1.7 mol% VB12). [0233] While certain embodiments have been illustrated and described, it will be understood that changes and modifications can be made therein in accordance with ordinary skill in the art without departing from the present invention in its broader aspects as defined in the following claims.

[0234] The inventions illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms "comprising", "including," containing", etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed.

[0235] Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification, improvement and variation of the inventions embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications, improvements and variations are considered to be within the scope of this invention. The materials, methods, and examples provided here are representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention. [0236] The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein. [0237] In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.

[0238] All publications, patent applications, patents, and other references mentioned herein are expressly incorporated by reference in their entirety, to the same extent as if each were incorporated by reference individually. In case of conflict, the present specification, including definitions, will control.

Claims

What is claimed is:

1. A conjugate comprising an oligonucleotide linked to a linker group covalently bonded to a vitamin B12 molecule.

2. A conjugate comprising a natural, synthetic, or semi-synthetic polymer to which is conjugated an oligonucleotide linked through a first linker group and a vitamin B12 molecule linked, either directly to the polymer, or indirectly via a second linker group which is the same or different than the first linker group.

3. The conjugate of claim 2, wherein the polymer is one or more of polyethylene glycol (PEG), PEG block copolymers, a polyacrylate, a polymethacrylate, a polyacrylamide, a polymethacrylamide, a synthetic polymer, a semi-synthetic polymer, a polysaccharide.

4. The conjugate of any one of claims 1 - 3, further comprising one or more of a cell targeting moiety, a moiety that facilitates oral delivery of the oligoncucleotide, a RES avoiding moiety, a moiety that facilitates endome release, or a moiety that facilitates oligonucleotide transport into the cytoplasm of a cell, wherein the one or more moieties are covalently linked to the conjugate.

5. A nanoparticle derived from formulation of a conjugate of claim 1 or claim 4 or a polymer conjugate of claim 2 or claim 4 formulated alone or with other components.

6. The conjugate of any one of claims 1 to 5, wherein the oligonucleotide is a DNA molecule or an RNAi molecule.

7. The conjugate of claim 6, wherein the oligonucleotide is a DNA molecule that encodes a RNAi molecule.

8. The conjugate of claim 6 or 7, wherein the RNAi is an siRNA, a dsRNA, a mRNA, an antisense RNA or a ribozyme.

9. The conjugate of any one of claims 1 to 8, wherein the linker is one or more of a protein, a peptide, a single amino acid, a mono-, di- or polysaccharide, or any organic compound of molecular weight between 25 and 100,000 Daltons that contains functional groups to provide covalent links to both the oligonucleotide and vitamin B12.

10. The conjugate of claim 9, wherein the vitamin B12 is attached following chemical modification at the 5'-0 or 2'-0 position of vitamin B12 to provide a functional group suitable for conjugation, or by direct or in direct reaction at the 5'-0 or 2'-0 position of vitamin B12, or by liberating a free carboxyl group from one of the primary amide groups on vitamin B12 to facilitate formation of a covalent bond between the carboxyl and linker groups.

11. A nanoparticle-vitamin conjugate comprising the conjugate of any one of claims 1 to 10 formulated optionally with other componens to form a nanoparticle.

12. A composition comprising the conjugate of any one of claims 1 to 10 or the nanoparticle-formulation of claim 11 and a carrier.

13. The composition of claim 12, wherein the carrier is a pharmaceutically acceptable carrier.

14. A method for inhibiting expression of a polynucleotide in a cell, comprising contacting the cell with an effective amount of the conjugate of any one of claims 1 to 10, the nanoparticle-vitamin conjugate of claim 11, or the composition of claim 12 or 13, thereby inhibiting the expression of the polynucleotide in the cell.

15. The method of claim 14, wherein the contacting is in vitro or in vivo.

16. A method for treating a disease or disorder in a human or non-human subject, comprising contacting the cell with an effective amount of the conjugate of any one of claims 1 to 10, the nanoparticle-vitamin conjugate of claim 11, or the composition of claim 12 or 13, wherein the disease or the disorder is treatable by inhibiting the expression of a

polynucleotide in a cell in the human or non-human subject, thereby treating the disease or the disorder in the human or non-human subject.

17. A method of claim 16, wherein the conjugate of any one of claims 1 to 10, the nanoparticle formulation of claim 11, or the composition of claim 12 or 13 is administered orally in a tablet, capsule, or other suitable vehicle, optionally formulated with pharmaceutically-accepted excipients, or given by injection in a suitable injection vehicle, or applied topically to the surface of the body in a suitable vehicle.

18. The method of claim 17, wherein the disease or disorder is cancer, autoimmune conditions, endocrine disorders, diabetes, genetic conditions, chromosome conditions, viral infections, bacterial infections, parasitic infections, mitochondrial diseases, sexually transmitted diseases, immune disorders, balance disorders, pain, systemic disorders, blood conditions, blood vessel conditions, nerve conditions, or a condition of muscles, heart, or other organs.

19. A method for preparing the conjugate of claim 1, comprising the formation of a phosphoramidate bond between the oligonucleotide and a 5'-0 aminoalkyl vitamin B12 derivative.

20. The method of claim 19, further comprising linking the oligonucleotide through a linker group to a polymer and to which one or more vitamin B12 molecules are also attached through a linker by the formation of a phosphoramidate bond between the oligonucleotide and an amino group on the polymer.

21. The method of claim 20, wherein the polymer is one or more of polyethylene glycol (PEG), PEG block copolymers, a polyacrylate, a polymethacrylate, a polyacrylamide, a polymethacrylamide, a synthetic polymer, a polysaccharide, and the polymercontains a functional group to form a covalent bond to a linker or to an oligonucleotide.

22. The method of claim 20 or 21, further comprising covalent attachment to the conjugate a cell targeting moiety, a moiety that facilitates oral delivery of the

oligoncucleotide, a RES avoiding moiety or a moiety that facilitates endome release.

23. A method for preparing an oligonucleotide conjugate nanoparticle of claim 5 or claim 11 comprising mixing two or more solutions containing the conjugate of any one of claims 1-

4 with a nanoparticle or nanoparticle-forming components and subsequent isolation of the oligonucleotide conjugate nanoparticle formed by coacervation.

24. The method of any one of claims 19 to 23, wherein the oligonucleotide is a DNA molecule or an R Ai molecule.

25. The method of claim 24, wherein the oligonucleotide is a DNA molecule that encodes a RNAi molecule.

26. The method of claim 24 or 25, wherein the RNAi is an siRNA, a dsRNA, a mRNA, an antisense RNA or a ribozyme.

27. The method of any one of claims 19 to 26, wherein the linker is one or more of a protein, peptide, a single amino acid, a mono-, di- or polysaccharide, or any organic compound of molecular weight between 25 and 100,000 Daltons that contains functional groups to provide covalent links to both the oligonucleotide and vitamin B12.

28. The method of claim 27, wherein the vitamin B12 is covalently linked to the polymer by a method comprising the formation of an amide bond between either a free primary amino function on a first vitamin B12 derivative and a free carboxyl group on a polymer side-chain or a free primary amino group on a polymer side-chain with a free carboxyl group on a second vitamin B 12 derivative .

29. A kit comprising any one of the conjugate of claims 1 to 10, the oligonucleotide conjugate nanoparticle of claim 11, or the composition of claims 12 or 13, and instructions for their administration to treat a disease or disorder according to claim 17 or 18.