WO2012027814A1 - Immunomodulation by means of a recombinant bacterial strain - Google Patents

Immunomodulation by means of a recombinant bacterial strain Download PDF

Info

Publication number
WO2012027814A1
WO2012027814A1 PCT/BR2011/000321 BR2011000321W WO2012027814A1 WO 2012027814 A1 WO2012027814 A1 WO 2012027814A1 BR 2011000321 W BR2011000321 W BR 2011000321W WO 2012027814 A1 WO2012027814 A1 WO 2012027814A1
Authority
WO
WIPO (PCT)
Prior art keywords
hsp65
lactis
protein
inflammatory
lactic acid
Prior art date
Application number
PCT/BR2011/000321
Other languages
French (fr)
Portuguese (pt)
Inventor
Anderson Miyoshi
Ana Maria Caetano De Faria
Vasco Ariston Electo De Paiva
Bernardo Coelho Horta
Ana Cristina Gomes Santos Hostt
Marcela Santiago Pacheco De Azevedo
Clarissa Santos Rocha
Naira Roque Electo De Paiva
Original Assignee
Universidade Federal De Minas Gerais - Ufmg
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universidade Federal De Minas Gerais - Ufmg filed Critical Universidade Federal De Minas Gerais - Ufmg
Publication of WO2012027814A1 publication Critical patent/WO2012027814A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0008—Antigens related to auto-immune diseases; Preparations to induce self-tolerance
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/35—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Mycobacteriaceae (F)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
    • A61K2039/523—Bacterial cells; Fungal cells; Protozoal cells expressing foreign proteins

Definitions

  • the present invention relates to obtaining a genetically engineered bacterial strain (strain) engineered for the production and secretion of the LPS-free Hsp65 protein.
  • strain genetically engineered bacterial strain
  • the present invention also describes the use of such a strain and pharmaceutical compositions containing the same in the prevention and treatment of inflammatory and autoimmune diseases.
  • autoimmune diseases include multiple sclerosis (or experimental autoimmune encephalomyelitis), thyroiditis, myasthenia, arthritis, uveitis, diabetes, colitis, among others.
  • oral tolerance refers to the suppression of systemic inflammatory reactivity to an antigen (protein) that has been previously administered orally.
  • Mechanisms for the induction of oral tolerance range from inactivation of antigen-reactive T lymphocytes to the generation of regulatory T lymphocytes in the intestinal mucosa capable of regulating the systemic inflammatory reactivity to the administered antigen.
  • autoimmune diseases are inflammatory
  • the modulation of inflammation results in an improvement in the evolution of the disease (Faria, AMC & Weiner, HL (2006) Oral tolerance: therapeutic implications for autoimmune diseases, Clinical and Developmental Immunology, 13 -4): 143-157).
  • Hsp65 An antigen (protein) used in these experiments was Hsp65, which was able to reduce inflammatory reactivity and atherosclerotic plaques in the aorta of mice genetically prone to the development of atherosclerosis when administered orally or nasally (Maron et al. , 2002).
  • Heat shock protein 65 is one of the proteins important in maintaining cellular integrity whose expression increases in cells under stress. For this reason, it is present in high concentrations in inflammatory processes and is an excellent candidate as a target protein for immuno-modulation in inflammatory processes where there are no known target antigens such as atherosclerosis, Crohn's disease (and experimental colitis) or even in clearly autoimmune diseases where the targets are known but the inflammatory process also involves the presence of this protein (such as multiple sclerosis, arthritis, diabetes, etc.).
  • Hsp65 is part of a family of proteins (all known as Hsp) that are constitutively expressed (at levels lower than those observed during inflammation) in eukaryotic cells and prokaryotes, where it plays an important role in cell maintenance events.
  • Hsp are among the most well conserved proteins during evolution with Hsp65 from Mycobacteria having 60-70% homology to human Hsp60. This allows them to be used in different species with similar effects, as previously shown by studying the modulatory effect of Mycobacterium tuberculosis Hsp65 on experimental atherosclerosis in mice (Maron et al, 2002).
  • lactic acid bacteria expressing Hsp proteins are: a) as Hsp are not an antigen specific for an inflammatory disease but are present in abundance in inflammatory foci in general, they are single candidates for the treatment of inflammatory conditions in general; b) the assurance that the Hsps antigens would not contain lipopolysaccharide (LPS, an innate immune system activator); unlike hsps produced so far, c) as lactic bacteria remain in the intestine for about 48 hours, this form of oral administration of Hsps would facilitate the induction of oral tolerance and, on the other hand, would also facilitate its interruption when this administration was not more necessary, d) Lactic bacteria releasing Hsp65 protein for 48 hours allows the development of a drug formulation for the treatment of inflammatory diseases of easy use, since it can be administered with wide intervals of time and will not yet attack the stomach mucosa, as it occurs with the anti-inflammatories present on the market.
  • LPS lipopolysaccharide
  • Lactococcus lactis in fact, has been used as carrier of a large variety of proteins mainly of bacterial and viral origin (such as HPV-16 E7, NSP4, L7 / L12 of Brucella abortus, GroEL) using the NICE expression system.
  • L. lactis the producer of Hsp65
  • cytokines such as IFN-tau, IL-12 or IL-10, for example
  • Lactococcus lactis producing IL-10 had beneficial effects on experimental colitis and allergy in mice (Lothar Steidler, Wolfgang Hans, Lieven Schotte, Sabine Neirynck, Florian Obermeier, Werner Falk, Walter Fiers, Erik Remaut, (2000) Treatment of Murine Colitis by Lactococcus lactis Secreting Interleukin-10 Science 25 August 2000: Vol. (1996) Oral administration of an IL-10-secreting Lactococcus lactis strain prevents food-induced IgE sensitization Journal of Allergy Clinical Immunology, 19 (4), pp. 1353-855, Frossard CP, Steidler L, Eigenmann PA : 952-958).
  • Biopharmaceutical Expressing Mycobacteria Hsp65 Thermal Shock Protein stipulates the use of a mycobacteria 65 KDa heat shock protein (Hsp) -containing DNA composition in the preparation of a biopharmaceutical for the prevention, treatment and / or cure of inflammatory, infectious and / or fibrotic diseases in humans and animals.
  • Hsp heat shock protein
  • the present application is intended for the use of the biopharmaceutical in the therapy of pulmonary interstitial disease (PID).
  • PID pulmonary interstitial disease
  • This patent differs from the present invention in that it is not a live vaccine and does not use bacteria as the vaccine vector.
  • lactis makes this methodology safe (because it is a probiotic), efficient (because it is the administration of a continuously released antigen in the intestine) and multifunctional (because it contains a protein abundantly proven in inflammatory sites generally). On the other hand, this suppression would not affect inflammatory anti-infective processes since pathogens have other lymphocyte-activating products that generally overlap the stimulatory effect of Hsps present in the infectious foci. 1
  • FIG. 1 Immunodetection of rHsp65 from cultures of L. lactis clones pCYT: Hsp65.
  • the rectangle in red highlights the protein fragment related to rHsp65. Twenty microliters of each sample were deposited in each channel. Membranes were developed using anti-Hsp65 mouse serum (1: 1000).
  • FIG. 2 Immunodetection of rHsp65 from cultures of L. lactis pSEC: Hsp65 clones.
  • the rectangle in red highlights the protein fragment related to rHsp65. Twenty microliters of each sample were deposited in each channel. Membranes were developed using anti-Hsp65 mouse serum (1: 1000).
  • Figure 3 Oral treatment with Lactococcus lactis producing Hsp65 prevents the inflammatory process characteristic of ulcerative colitis.
  • the slides were stained with hematoxin and eosin, increased by 100x.
  • Medium M17 without Lactococcus
  • WT wild type, wild L lactis
  • SEC wild type, wild L lactis
  • SEC wild type, wild L lactis
  • SEC wild type, wild L lactis producing secreted Hsp65
  • CYT Z. lactis producing Hsp65 cytoplasm
  • Figure 4 Oral treatment with Hsp65-producing Lactococcus lactis reduces production of the proinflammatory cytokines IL-4 and IFN-gamma in the colon of camunodongs with ulcerative colitis.
  • Medium M1 7 without Lactococcus
  • WT wild type, wild L lactis
  • SEC lactis producing Hsp65 secreted
  • CYT L. lactis producing Hsp65 cytoplasm.
  • Number of animals per group 5 for each experimental group. Different letters indicate statistical difference (ANOVA Tukey), p ⁇ 0.05.
  • Figure 5 - Oral treatment with Lactococcus lactis producer of Hsp65 reduces the activation state of lymphocytes in the mesenteric lymph nodes of mice with ulcerative colitis.
  • CD44 expressed on activated CD4 + T lymphocytes MIF: mean fluorescence intensity).
  • Medium M17 without Lactococcus
  • WT wild type, L. lactis wild
  • SEC L. lactis secreted Hsp65 producers.
  • Number of animals per group 5 for each experimental group. Different letters indicate statistical difference (ANOVA Tukey), p ⁇ 0.05.
  • Figure 7 - Oral treatment with Hsp65-producing Lactococcus lactis reduces the number of activated T lymphocytes in the lamina intestinal of IL-10 deficient camunodongs.
  • CD44 is expressed on effector activated CD4 + T lymphocytes.
  • Medium M17 without Lactococcus
  • WT wild type, L. lactis wild
  • SEC L. lactis secreted Hsp65 producers.
  • n 4 for each experimental group.
  • the CT group is composed of younger animals that have not yet developed colitis (control). Different letters indicate statistical difference (ANOVA Tukey), p ⁇ 0.05.
  • FIG 8 Effect of L. lactis producing hsp65 on experimental autoimmune encephalomyelitis.
  • C57BL / 6 mice were treated with hsp65-producing L. lactis and then immunized for induction of the multiple sclerosis experimental model.
  • the development of the disease was evaluated by the clinical index (A) and the infiltration of cells in the spinal cord (B).
  • Control group Naive
  • the group not treated with L lactis received only water
  • Water + EAE group a control group received oral treatment with wild L.lactis containing the empty vector
  • WT + EAE wild L.lactis containing the empty vector
  • the test group received the oral treatment with lactose producing hsp65 (HSP + EAE) before induction of the disease.
  • Number of animals per group 5. * indicates significant difference between groups with P ⁇ 0.005 (ANOVA test).
  • Figure 9 Effect of treatment with L. lactis producing HSP65 on the frequency of Tregs.
  • Frequency of regulatory T cells CD4 / CD25 / FOXp3 in the spleen of NOD mice (mice that spontaneously develop autoimmune diabetes) after treatment with HSP65-producing Lactococcus lactis. Bars represent the mean ⁇ standard error of regulatory T cell frequency in the total T lymphocyte population 24h, 72h, or 7 days after initiation of treatment with HSP-producing L. lactis.
  • Number of animals per group 4. * indicates statistical difference in relation to the untreated control (ANOVA test).
  • the present invention relates to obtaining a genetically engineered bacterial strain (strain) engineered for the production and secretion of the LPS-free Hsp65 protein.
  • strain genetically engineered bacterial strain
  • the present invention also describes the use of such a strain and pharmaceutical compositions containing the same in the prevention and treatment of inflammatory diseases.
  • M. leprae Hsp65-producing L. lactis recombinant strains were constructed from the amplification of the M. leprae Hsp 65 ORF present in the plasmid pcDNA3: Hsp65 , using the enzyme Accuprime TM Pfx DNA polymerase (Invitrogen) and the following primers containing the restriction sites for Nsil and EcoRI: Forward primer of the secreted form (restriction site for the Nsi enzyme):
  • Cytoplasmic forward primer (restriction site for the Nsi enzyme):
  • E. coli TOP10 cells were then used to transform electrocompetent E. coli TOP10 cells. Selection of recombinant E. coli colonies was performed on LB medium containing kanamycin. Ten colonies transformed with each construct (cytoplasmic or secreted) were randomly selected, inoculated in liquid selective medium and incubated at 37 ° C for 18 hours. These cultures were then used to make a stock culture, in glycerol, of each possible clone and for the extraction of the recombinant plasmids.
  • Plasmid DNA was extracted by the alkaline lysis method (Sambrook et al., 1989) and used as template to confirm cloning of the insert by a PCR reaction using the specific M. leprae ORs Hsp65 primers. All ten clones of each construct were confirmed to be bearers of the corresponding Hsp65 ORF insert (626 bp). The clones presenting the fragment corresponding to the cytoplasmic insert and the ones presenting the fragment corresponding to the insert secreted were given the designation of pTP cHsp65 and pTP: sHsp65, respectively.
  • the digested and purified products corresponding to the Hsp65 insert and the pXy / 7 ⁇ : CYT and pXy / 7 " : SEC vectors were subjected to a T4 DNA polymerase (Invitrogen) binding reaction.
  • the product of each binding reaction (pXylT: CYJ.Hsp65 and pXy / 7 ⁇ : SEC: Hsp65) was used to transform E. coli TOP10 electrocompetent cells.
  • a culture stock was made in glycerol (1 ml of the culture + 1 ml of 80% glycerol) of each clone and these were stored at -70 ° C.
  • Plasmids extracted pXylT: CYT: Hsp65 and pXylT: SEC: Hsp65 were applied in a PCR reaction with the primers already described, followed by enzymatic digestion with Nsil and EcoRI, in order to confirm the presence of the Hsp65 ORF.
  • the plasmids were then subjected to DNA sequencing reactions (Sanger F, Nicklen S, Coulson AR. (1977) DNA sequencing with chain-terminating inhibitors, Biotechnology, 1992; 24: 104-8).
  • BLAST Basic Local Alignment Search Tool
  • L. lactis NCDO21 18 electrocompetent cells After preparation of L. lactis NCDO21 18 electrocompetent cells, they were transformed with plasmids pXylT CYT: Hsp65 and pXylT: SEC: Hsp65, extracted by the alkaline lysis method from the TOP10 E. coli clones. Transformants were screened in Petri dishes containing M17Glu-Sac agar medium supplemented with 10 ng / ml chloramphenicol. The transforming clones were recovered and their plasmid DNA was extracted.
  • the extracted plasmids were applied in a PCR reaction with the primers already with the objective of confirming the obtaining of recombinant plasmids containing the Hsp65 ORF.
  • TCA trichloroacetic acid
  • DTT dithiothreitol
  • PMSF phenylmethyl sulfonyl fluoride
  • the cellular pellet was resuspended in 100 ⁇ l of Tris-EDTA-lysozyme solution plus 1 mM PMSF and 10 mM DTT. It was then incubated at 37 ° C for 30 minutes and then 50pL of 20% SDS was added thereafter.
  • the samples were resuspended in DTT-LB buffer in the ratio of:, heated at 100 ° C for 5 minutes and stored at -20 ° C.
  • mice were immunized subcutaneously with 50 ⁇ g of purified rHsp65 protein from Escherichia coli mixed with incomplete Freud's adjuvant (Sigma) in the ratio 1: 1. The animals received three doses of this mixture every 15 days (days 15, 30 and 45). Serum was collected from the orbital plexus by a glass Pasteur pipette on day 0 and day 50. After the experiment, the animals were sacrificed with prior sedation followed by cervical dislocation.
  • Antigen expression analyzes by clone pSEC.Hsp65 demonstrated that the secretion efficiency (i.e., the ratio of the amount of protein observed in the extracellular medium to the intracellular content) was approximately 50%, as can be seen by comparing the intensity of the proteins detected in these two fractions ( Figure 2).
  • the protein fragment observed in the cytoplasmic fraction corresponds to the protein precursor (PS Us p45 :: Hsp65) that probably remained associated with the cellular envelope.
  • Hsp65 was quantified by the Bradford method using lysozyme as standard. Total protein concentrations of the culture supernatant and the uninduced culture were measured. The concentration of proteins observed in the culture supernatant was 93 pg / L and that of the induced culture was 660 ⁇ g / L. Since the only difference between the proteins present in the supernatant of the uninduced and induced culture is the presence of rHsp65, one can conclude that 567 pg / L of the antigen is being secreted into the extracellular medium. It is important to note that this concentration concerns an aliquot of 2 ml of culture induced.
  • LAL Limulus Amebocyte Lysate
  • lactis pCYT Hsp65 C NI ⁇ 0.1 0.00501 A
  • lactis pCYT Hsp65 S 1 ⁇ 0.1 0.00458 A
  • L. lactis pCYT Hsp65 Line producing the cytoplasmic form of the antigen
  • L. lactis pSEC Hsp65 Production line of the secreted form of the antigen All tested samples had endotoxin concentration below 0.1 ⁇ / ⁇ and were therefore considered free of LPS in compliance with the requirements established by the Food and Drug Administration ), USP (United States Pharmacopeia) and EP (European Pharmacopoeia). Considering that L. lactis is a Gram-positive bacterium and that LPS is present only in the cell wall of Gram-negative bacteria, the observed results are in agreement with the expected.
  • mice In the pre-clinical tests we performed, we treated mice with two types of experimental colitis: a) induced by the administration of sodium dextran sulfate (DSS), a chemical agent that causes acute colitis with inflammatory features similar to ulcerative colitis in humans; b) spontaneously in mice genetically deficient in IL-1 which develop a colitis picture similar to human Crohn's disease.
  • DSS sodium dextran sulfate
  • the bottle containing medium of growth of bacteria (Medium group), wild L. lactis (WT group), L. lactis producers of the secreted form (SEC group) or cytoplasmic (CYT group) of Hsp65 were offered ad libitum for 4 consecutive days . After an interval of 10 days, the induction of experimental colitis (model of ulcerative colitis in mice) was performed by administration of DSS at 1.5%, offered in the bottle as the only liquid source for 7 days.
  • Example 7 Effect of administration of hsp65-producing Lactococcus lactis in autoimmune disease models Experimental model of multiple sclerosis
  • mice C57BL / 6 mice were treated with hsp65-producing Lactococcus lactis solution for 4 consecutive days, according to the scheme presented below.
  • Ten days later experimental autoimmune encephalomyelitis (EAE-animal model of multiple sclerosis) was induced by subcutaneous injection of oligodendrocytic myelin sheath (MOG) along with complete Freund's adjuvant (CFA) and pertussis toxin (PT).
  • MOG oligodendrocytic myelin sheath
  • CFA complete Freund's adjuvant
  • PT pertussis toxin

Abstract

The present invention relates to the obtention of a genetically modified bacterial lineage (strain) engineered to produce and secrete LPS-free Hsp65 protein. Moreover, the present invention also describes the use of this strain and pharmaceutical compositions containing same for preventing and treating inflammatory and autoimmune diseases.

Description

IMUNOMODULAÇÃO ATRAVÉS DE CEPA BACTERIANA RECO BINANTE  IMMUNOMODULATION THROUGH RECO BINANT BACTERIAL ECCEP
A presente invenção refere-se a obtenção de uma linhagem bacteriana geneticamente modificada (cepa) engenhada para a produção e secreção da proteína Hsp65 livre de LPS. Além disso, a invenção ora proposta também descreve o uso dessa cepa e composições farmacêuticas contendo a mesma na prevenção e tratamento de doenças inflamatórias e autoimunes. The present invention relates to obtaining a genetically engineered bacterial strain (strain) engineered for the production and secretion of the LPS-free Hsp65 protein. In addition, the present invention also describes the use of such a strain and pharmaceutical compositions containing the same in the prevention and treatment of inflammatory and autoimmune diseases.
A imunomodulação de doenças de caráter auto-imune pela administração oral de antígenos (proteínas) que são o alvo do ataque tem sido relatada em vários trabalhos. Tais doenças auto-imunes, testadas em modelos experimentais animais, incluem esclerose múltipla (ou encefalomielite auto- imune experimental), tireoidite, miastenia, artrite, uveíte, diabetes, colite, entre outras. Essa possibilidade terapêutica, testada em animais, pode ser explicada pela indução de um fenómeno imunológico conhecido há longo tempo na literatura como "tolerância oral". A tolerância oral se refere à supressão da reatividade inflamatória sistémica a um antígeno (proteína) que tenha sido administrada previamente pela via oral. Os mecanismos para a indução de tolerância oral incluem desde a inativação de linfocitos T reativos com o antígeno até a geração de linfocitos T reguladores na mucosa intestinal capazes de regular a reatividade inflamatória sistémica ao antígeno administrado. Como todas as doenças auto-imunes são inflamatórias, a modulação da inflamação resulta em melhora na evolução da doença (Faria, AMC & Weiner, HL. (2006) Oral tolerance: therapeutic implications for autoimmune diseases. Clinicai and Developmental Immunology, 13(2-4): 143- 157).  Immunomodulation of autoimmune diseases by oral administration of antigens (proteins) that are the target of the attack has been reported in several papers. Such autoimmune diseases, tested in experimental animal models, include multiple sclerosis (or experimental autoimmune encephalomyelitis), thyroiditis, myasthenia, arthritis, uveitis, diabetes, colitis, among others. This therapeutic possibility, tested in animals, can be explained by the induction of an immunological phenomenon known long in the literature as "oral tolerance". Oral tolerance refers to the suppression of systemic inflammatory reactivity to an antigen (protein) that has been previously administered orally. Mechanisms for the induction of oral tolerance range from inactivation of antigen-reactive T lymphocytes to the generation of regulatory T lymphocytes in the intestinal mucosa capable of regulating the systemic inflammatory reactivity to the administered antigen. As all autoimmune diseases are inflammatory, the modulation of inflammation results in an improvement in the evolution of the disease (Faria, AMC & Weiner, HL (2006) Oral tolerance: therapeutic implications for autoimmune diseases, Clinical and Developmental Immunology, 13 -4): 143-157).
Um outro aspecto importante da indução de tolerância por via da mucosa oral assim como da mucosa nasal, é que a identificação precisa do antígeno alvo do ataque auto-imune não é necessária. Já que o mecanismo de imuno-modulação envolve linfocitos T que regulam a atividade de outras células no sítio da inflamação, foi demonstrado que qualquer antígeno (proteína) expresso nesse sítio inflamatório pode ser utilizado para indução da tolerância oral ou nasal porque a redução da reatividade inflamatória a esse antígeno atinge outras reatividades na vizinhança num processo conhecido como "supressão cruzada"ou "bystander suppression". Esse processo permitiu, então, modular condições inflamatórias não necessariamente auto-imunes tais como a aterosclerose, a isquemia cardíaca (Frenkel et al, 2009), o acidente vascular cerebral - AVC (Frenkel et al, 2003) e a doença de Alzheimer (Frenkel et al, 2005) pela administração oral ou nasal de proteínas sabidamente presentes nos respectivos sítios inflamatórios (vascular, cardíaco e cerebral) (Maron R, Sukhova G., Faria AMC, Hoffmann E, Mach F, Libby P, Weiner HL (2002) Mucosal administration of heat shock protein-65 decreases atherosclerosis and inflammation in aortic arch of low-density Iipoprotein receptor-deficient mice. Circulation, 106: 1708-1714; Frenkel D, Maron R, Burt DS, Weiner HL. (2009) Nasal vaccination with a proteosome-based adjuvant and glatiramer acetate clears beta-amyloid in a mouse modelo of Alzheimer disease. Journal of Clinicai Investigation, 115(9):2423-2433; Frenkel D, Pachori AS, Zhang L, Dembinsky-Vaknin A, Fartara D, Petrovic-Stojkovic S, Dzau VJ, Weiner HL. (2005) Nasal vaccination with troponin reduces specific T cell respnses and improve heart function in myocardial ischemia-reperfusion injury. International Immunology, 21 (7):817-829; Frenkel D, Huang Z, Maron R, Koldzic DN, Hancock WW, Moskowitz MA, Weiner HL. (2003) Nasal vaccination with myelin oligodendrocyte glycoprotein reduces stroke size by inducing IL-10- producing CD4+ T cells. Journal of Immunology, 171 (12):6549-55). Another important aspect of inducing tolerance via the oral mucosa as well as the nasal mucosa is that precise identification of the target antigen of the autoimmune attack is not required. Since the immuno modulatory mechanism involves T lymphocytes that regulate the activity of other cells at the site of inflammation, it has been shown that any antigen (protein) expressed at this inflammatory site can be used to induce oral or nasal tolerance because the reduction of reactivity inflammatory response to that antigen reaches other reactivities in the neighborhood in a known process such as "cross-suppression" or "bystander suppression". This process allowed to modulate non-necessarily autoimmune inflammatory conditions such as atherosclerosis, cardiac ischemia (Frenkel et al, 2009), strokes (Frenkel et al., 2003) and Alzheimer's disease (Frenkel (Marin R, Sukhova G., Faria AMC, Hoffmann E, Mach F, Libby P, Weiner HL (2002)), and the use of oral or nasal administration of proteins known in the respective inflammatory sites (vascular, cardiac and cerebral) Mucosal administration of heat shock protein-65 decreases atherosclerosis and inflammation in aortic arch of low-density Iipoprotein receptor-deficient mice Circulation, 106: 1708-1714; Frenkel D, Maron R, Burt DS, Weiner HL (2009) Nasal vaccination with a proteosome-based adjuvant and glatiramer acetate clears beta-amyloid in a mouse model of Alzheimer's disease Journal of Clinical Research, 115 (9): 2423-2433; Frenkel D, Pachori AS, Zhang L, Dembinsky-Vaknin A, Fartara D, Petrovic-Stojkovic S, Dzau VJ, Weiner HL. (2005) Nasal vaccination with troponin reduces specific T cell responses and improve heart function in myocardial ischemia-reperfusion injury. International Immunology, 21 (7): 817-829; Frenkel D, Huang Z, Maron R, Koldzic DN, Hancock WW, Moskowitz MA, Weiner HL. (2003) Nasal vaccination with myelin oligodendrocyte glycoprotein reduces stroke size by inducing IL-10- producing CD4 + T cells. Journal of Immunology, 171 (12): 6549-55).
Um antígeno (proteína) utilizado nesses experimentos foi a Hsp65 que mostrou-se capaz, quando administrada por via oral ou nasal, de reduzir a reatividade inflamatória e a formação de placas ateroscleróticas na aorta de camundongos geneticamente propensos ao desenvolvimento da aterosclerose (Maron et al, 2002).  An antigen (protein) used in these experiments was Hsp65, which was able to reduce inflammatory reactivity and atherosclerotic plaques in the aorta of mice genetically prone to the development of atherosclerosis when administered orally or nasally (Maron et al. , 2002).
A proteína de choque térmico 65 é uma das proteínas importantes na manutenção da integridade celular cuja expressão aumenta em células submetidas ao estresse. Por isto mesmo, ela está presente em altas concentrações nos processos inflamatórios sendo uma excelente candidata como proteína alvo de imuno-modulação em processos inflamatórios onde não existem antígenos alvo conhecidos como a aterosclerose, a doença de Crohn (e a colite experimental) ou mesmo em doenças claramente auto-imunes onde os alvos são conhecidos mas o processo inflamatório também envolve a presença dessa proteína (como a esclerose multlipla, a artrite, a diabetes, etc). A Hsp65 faz parte de uma família de proteínas (todas conhecidas como Hsp) que são expressas constitutivamente (em níveis mais baixos que aqueles observados durante a inflamação) nas células eucariotas e nas procariotas, onde tem um papel importante em eventos de manutenção celular. As Hsp estão entre as proteínas mais bem conservadas durante a evolução sendo que a Hsp65 de Mycobacteria tem 60-70% de homologia com a Hsp60 humana. Isto permite que elas sejam utilizadas em diferentes espécies com efeitos semelhantes, como comprovado anteriormente estudando o efeito modulador da Hsp65 de Mycobacterium tuberculosis na aterosclerosis experimental em camundongos (Maron et al, 2002). Heat shock protein 65 is one of the proteins important in maintaining cellular integrity whose expression increases in cells under stress. For this reason, it is present in high concentrations in inflammatory processes and is an excellent candidate as a target protein for immuno-modulation in inflammatory processes where there are no known target antigens such as atherosclerosis, Crohn's disease (and experimental colitis) or even in clearly autoimmune diseases where the targets are known but the inflammatory process also involves the presence of this protein (such as multiple sclerosis, arthritis, diabetes, etc.). Hsp65 is part of a family of proteins (all known as Hsp) that are constitutively expressed (at levels lower than those observed during inflammation) in eukaryotic cells and prokaryotes, where it plays an important role in cell maintenance events. Hsp are among the most well conserved proteins during evolution with Hsp65 from Mycobacteria having 60-70% homology to human Hsp60. This allows them to be used in different species with similar effects, as previously shown by studying the modulatory effect of Mycobacterium tuberculosis Hsp65 on experimental atherosclerosis in mice (Maron et al, 2002).
Outro aspecto importante da imuno-modulação induzida pela administração oral de antígenos (proteínas) é a descrição feita pelo nosso grupo de que a maneira mais eficaz para induzir tal modulação é a administração oral contínua da proteína relevante. Essa administração contínua foi obtida pela oferta de mamadeiras contendo o antígeno diluído em água (em concentração conhecida) como única fonte de líquido para animais experimentais. Camundongos assim testados beberam essa solução de forma contínua ao longo do dia e a concentração total administrada pôde ser calculada ao final do dia. Essa forma de administração (lenta e gradual) demonstrou-se muito mais eficaz que a administração da mesma dose da proteína por via oral em uma única vez ao dia. A eficácia desse método foi comprovada em um modelo experimental de esclerose múltipla (encefalomielite auto-imune experimental) (Faria, AM; Maron, R; Ficker, SM; Slavin, AJ; Spahn, T; Weiner, HL. (2003) Oral tolerance induced by continuous feeding: enhanced up-regulation of transforming growth factor-beta/interleukin-10 and suppression of experimental autoimmune encephalomyelitis. Journal of Autoimmunity, 20(2): 135-145).  Another important aspect of immuno-modulation induced by the oral administration of antigens (proteins) is the description made by our group that the most effective way to induce such modulation is the continuous oral administration of the relevant protein. This continuous administration was obtained by the supply of bottles containing the antigen diluted in water (in known concentration) as the only source of liquid for experimental animals. Mice so tested drank this solution continuously throughout the day and the total concentration administered could be calculated at the end of the day. This form of administration (slow and gradual) was shown to be much more effective than the administration of the same dose of the oral protein once a day. The efficacy of this method was demonstrated in an experimental model of multiple sclerosis (experimental autoimmune encephalomyelitis) (Faria, AM; Maron, R; Ficker, SM; Slavin, AJ; Spahn, T; Weiner, HL. induced by continuous feeding: enhanced up-regulation of transforming growth factor-beta / interleukin-10 and suppression of experimental autoimmune encephalomyelitis Journal of Autoimmunity, 20 (2): 135-145).
Tendo em vista esses dados prévios, na presente invenção foi testado o efeito da administração oral contínua (diluição na mamadeira) de Lactococcus lactis produtores (na forma secretada ou citoplasmática) de Hsp65 de Mycobacterium leprae na colite experimental em camundongos. As vantagens da utilização de bactérias lácticas expressando proteínas Hsp são: a) como as Hsp não são um antígeno específico de uma doença inflamatória mas estão presentes em abundância em focos inflamatórios em geral, elas são candidatas únicas para o tratamento de condições inflamatórias em geral; b) a garantia de que os antígenos Hsps não conteriam lipopolissacarídeo (LPS, um ativador do sistema imune inato); ao contrário das Hsps até então produzidas c) como bactérias lácticas permanecem no intestino por cerca de 48 horas, essa forma de administração oral de Hsps facilitaria a indução de tolerância oral e, por outro lado, também facilitaria a sua interrupção quando essa administração não fosse mais necessária, d) Bactérias Lácticas liberando proteína Hsp65 por 48 horas permitem o desenvolvimento de uma formulação medicamentosa para o tratamento de doenças inflamatórias de fácil uso, pois poderá ser administrada com largos intervalos de tempo e ainda não agredirá a mucosa estomacal, como ocorre com os antiinflamatórios presentes no mercado. In view of these prior data, the effect of continuous oral administration (bottle dilution) of Lactococcus lactis producers (in the secreted or cytoplasmic form) of Hsp65 from Mycobacterium leprae in experimental colitis in mice. The advantages of the use of lactic acid bacteria expressing Hsp proteins are: a) as Hsp are not an antigen specific for an inflammatory disease but are present in abundance in inflammatory foci in general, they are single candidates for the treatment of inflammatory conditions in general; b) the assurance that the Hsps antigens would not contain lipopolysaccharide (LPS, an innate immune system activator); unlike hsps produced so far, c) as lactic bacteria remain in the intestine for about 48 hours, this form of oral administration of Hsps would facilitate the induction of oral tolerance and, on the other hand, would also facilitate its interruption when this administration was not more necessary, d) Lactic bacteria releasing Hsp65 protein for 48 hours allows the development of a drug formulation for the treatment of inflammatory diseases of easy use, since it can be administered with wide intervals of time and will not yet attack the stomach mucosa, as it occurs with the anti-inflammatories present on the market.
Num comentário publicado recentemente, Luis Bermudez-Humaran cita vários trabalhos que demonstraram a eficiência do Lactococcus lactis como vetor vivo para a liberação de proteínas com propriedades terapêuticas (Bermudez-Humaran LG (2009) Lactococcus lactis as a vector for mucosal delivery of therapeutic proteins. Human Vaccines, 5(4): 264-267). O Lactococcus lactis, de fato, tem sido usado como carreador de uma grande variedade de proteínas principalmente de origem bacteriana e virai (como HPV- 16 E7, NSP4, L7/L12 de Brucella abortus, GroEL) usando o sistema NICE de expressão. O objetivo desses estudos tem sido invariavelmente a produção de vacinas de mucosa, ou seja, a criação de novos agentes que estimulem a resposta inflamatória do sistema imune contra infecções. Nosso objetivo, com o L. lactis produtor de Hsp65, é exatamente o oposto: imunomodular às respostas inflamatórias em doenças não infecciosas e, para isto, as heat-shock proteins teriam um papel diferenciado. Por outro lado, o mesmo L. lactis tem sido utilizado também como carreador de citocinas (como IFN-tau, IL-12 ou IL- 10, por exemplo) pela via oral. Lactococcus lactis produtores de IL-10, por exemplo, apresentaram efeitos benéficos na colite e na alergia experimentais em camundongos (Lothar Steidler, Wolfgang Hans, Lieven Schotte, Sabine Neirynck, Florian Obermeier, Werner Falk, Walter Fiers, Erik Remaut; (2000) Treatment of Murine Colitis by Lactococcus lactis Secreting lnterleukin-10 Science 25 August 2000: Vol. 289. no. 5483, pp. 1352 - 1355; Frossard CP, Steidler L, Eigenmann PA (2007) Oral administration of an IL-10-secreting Lactococcus lactis strain prevenis food-induced IgE sensitization. Journal of Allergy Clinicai lmmunology,19(4): 952-958). In a recent review, Luis Bermudez-Humaran cites several papers that have demonstrated the effectiveness of Lactococcus lactis as a living vector for the release of proteins with therapeutic properties (Bermudez-Humarman (2009) Lactococcus lactis as a vector for mucosal delivery of therapeutic proteins. Human Vaccines, 5 (4): 264-267). Lactococcus lactis, in fact, has been used as carrier of a large variety of proteins mainly of bacterial and viral origin (such as HPV-16 E7, NSP4, L7 / L12 of Brucella abortus, GroEL) using the NICE expression system. The aim of these studies has invariably been the production of mucosal vaccines, that is, the creation of new agents that stimulate the inflammatory response of the immune system against infections. Our objective with L. lactis, the producer of Hsp65, is exactly the opposite: immunomodulating the inflammatory responses in noninfectious diseases and, for this, the heat-shock proteins would play a different role. On the other hand, the same L. lactis has also been used as a carrier of cytokines (such as IFN-tau, IL-12 or IL-10, for example) by the oral route. Lactococcus lactis producing IL-10, for example, had beneficial effects on experimental colitis and allergy in mice (Lothar Steidler, Wolfgang Hans, Lieven Schotte, Sabine Neirynck, Florian Obermeier, Werner Falk, Walter Fiers, Erik Remaut, (2000) Treatment of Murine Colitis by Lactococcus lactis Secreting Interleukin-10 Science 25 August 2000: Vol. (1996) Oral administration of an IL-10-secreting Lactococcus lactis strain prevenis food-induced IgE sensitization Journal of Allergy Clinical Immunology, 19 (4), pp. 1353-855, Frossard CP, Steidler L, Eigenmann PA : 952-958).
Um estudo clínico de fase I está em andamento testando os efeitos de L. lactis produtor de IL-10 em pacientes com doença de Crohn (Braat H, Rottiers P, Hommes DW, Huyghebaert N, Remaut E., Remon JP et al (2006) A phase I clinicai Trial with transgenic bactéria expressing interleukin-10 in Crohn's disease. Clinicai Gastroenterology and Hepatology, 4: 754-759). No caso desses estudos, o objetivo é semelhante ao que pretendemos mas a estratégia muito diferente. A administração oral de citocinas moduladoras (como a IL-10), seja na forma solúvel ou expressa por L.lactis, teria um efeito direto sobre o sistema imune de mucosas. No entanto, esse efeito seria exógeno e efémero na inflamação desaparecendo logo que a proteína deixasse de ser administrada. A estratégia que utilizamos com o L. lactis produtor de Hsp65 seria ativa, direcionada e duradoura. A indução de tolerância oral à proteína Hsp65 seria capaz de gerar células T reguladoras (Treg) produtoras de citocinas imunomoduladoras (IL-10 e outras como TGF-beta) endógenas, seletivamente liberadas nos sítios inflamados (para onde as células Treg migrariam). Como o processo seria endógeno e ativo, os mecanismos de imunomodulação persistiriam por todo o período em que a inflamação existir.  A phase I clinical trial is underway testing the effects of IL-10 producing L. lactis in patients with Crohn's disease (Braat H, Rottiers P, Hommes DW, Huyghebaert N, Remaut E., Remon JP et al (2006) ) A phase I Clinical Trial with transgenic bacterium expressing interleukin-10 in Crohn's disease, Clinical Gastroenterology and Hepatology, 4: 754-759). In the case of these studies, the goal is similar to what we intend but the very different strategy. Oral administration of modulating cytokines (such as IL-10), whether in the soluble form or expressed by L. lactis, would have a direct effect on the mucosal immune system. However, this effect would be exogenous and ephemeral in the inflammation disappearing as soon as the protein ceased to be administered. The strategy we used with L. lactis as producer of Hsp65 would be active, targeted and long-lasting. Induction of oral tolerance to Hsp65 protein would be able to generate endogenous immunomodulatory cytokines (IL-10 and others as TGF-beta), selectively released at the inflamed sites (where Treg cells would migrate), to generate regulatory T cells. As the process would be endogenous and active, the immunomodulation mechanisms would persist for as long as the inflammation exists.
O documento PI0705784-9A2- Usos de uma Composição Contendo um A compound of the formula:
Biofármaco Expressando a Proteína de Choque Térmico Hsp65 de Micobactérias- descreve o uso de uma composição de DNA contendo o gene da proteína de choque térmico (heat shock protein - Hsp) de 65 KDa de micobactérias no preparo de um biofármaco para prevenção, tratamento e / ou cura de doenças inflamatórias, infecciosas e / ou fibróticas em seres humanos e animais. Particularmente, o presente pedido destina-se ao emprego do biofármaco na terapia da doença intersticial pulmonar (DIP). Essa patente se difere da presente invenção pelo fato de não se constituir de vacina viva e de não utilizar bactérias como vetor vacinai. Biopharmaceutical Expressing Mycobacteria Hsp65 Thermal Shock Protein-describes the use of a mycobacteria 65 KDa heat shock protein (Hsp) -containing DNA composition in the preparation of a biopharmaceutical for the prevention, treatment and / or cure of inflammatory, infectious and / or fibrotic diseases in humans and animals. Particularly, the present application is intended for the use of the biopharmaceutical in the therapy of pulmonary interstitial disease (PID). This patent differs from the present invention in that it is not a live vaccine and does not use bacteria as the vaccine vector.
Outros estudos têm abordado uma estratégia semelhante para a indução de tolerância oral como recentemente publicado pelo grupo de Rottiers (Huibregtse IL, Snoeck V, Creus AD, Braat H, Jong EC, van Deventer JH, Rottiers P. (2007) Induction of ovalbumin-specific tolerance by oral administration of Lactococcus lactis secreting ovalbumin. Gastroenterology, 133: 517-528). Esses pesquisadores mostraram que Lactococcus lactis expressando a proteína ovalbumina são agentes eficientes para a indução da supressão da resposta imune à ovalbumina quando esta é utilizada para a imunização sistémica. Embora a estratégia seja semelhante, a metodologia de expressão de ovalbumina pelo L. lactis descrita é diferente. Um outro fator fundamental que diferencia nosso estudo desse apresentado por Huibregtse e colaboradores é que eles utilizam um antígeno específico para a indução de tolerância oral a esse antígeno (ovalbumina). A utilização do método proposto por esse estudo para o tratamento de doenças auto-imunes ou inflamatórias exigiria que o antígeno alvo da inflamação fosse identificado e expresso no vetor incorporado ao L. lactis para cada doença em questão. Como algumas doenças inflamatórias e mesmo auto-imunes têm múltiplos antígenos alvo os quais nem sempre são conhecidos, a tarefa se tornaria difícil e dispendiosa. O grande avanço da presente invenção é demonstrar que a identificação de um alvo específico não é necessária e que a Hsp65 pode funcionar como antígeno universal das condições inflamatórias patológicas a serem tratadas pelo método da indução de tolerância por via oral. A expressão de Hsp65 pelo L. lactis torna essa metodologia segura (por se tratar de um probiótico), eficiente (por se tratar da administração de um antígeno liberado de forma contínua no intestino) e multifuncional (por conter uma proteína comprovadamente abundante em sítios inflamatórios em geral). Por outro lado, essa supressão não afetaria processos inflamatórios antiinfecciosos já que os patógenos possuem outros produtos ativadores de linfócitos que em geral se sobrepõem ao efeito estimulador das Hsps presentes nos focos infecciosos. 1 Other studies have addressed a similar strategy for inducing oral tolerance as recently published by the Rottiers group (Huibregtse IL, Snoeck V, Creus AD, Braat H, Jong EC, van Deventer JH, Rottiers P. (2007) Induction of ovalbumin- specific tolerance by oral administration of Lactococcus lactis secreting ovalbumin, Gastroenterology, 133: 517-528). These investigators have shown that Lactococcus lactis expressing the ovalbumin protein are efficient agents for the induction of suppression of the immune response to ovalbumin when it is used for systemic immunization. Although the strategy is similar, the methodology of expression of ovalbumin by L. lactis described is different. Another fundamental factor that differentiates our study from that presented by Huibregtse et al. Is that they use a specific antigen to induce oral tolerance to this antigen (ovalbumin). The use of the method proposed by this study for the treatment of autoimmune or inflammatory diseases would require that the target antigen of the inflammation be identified and expressed in the vector incorporated into L. lactis for each disease in question. As some inflammatory and even autoimmune diseases have multiple target antigens which are not always known, the task would become difficult and expensive. The great advance of the present invention is to demonstrate that the identification of a specific target is not necessary and that Hsp65 can function as a universal antigen of the pathological inflammatory conditions to be treated by the oral tolerance induction method. The expression of Hsp65 by L. lactis makes this methodology safe (because it is a probiotic), efficient (because it is the administration of a continuously released antigen in the intestine) and multifunctional (because it contains a protein abundantly proven in inflammatory sites generally). On the other hand, this suppression would not affect inflammatory anti-infective processes since pathogens have other lymphocyte-activating products that generally overlap the stimulatory effect of Hsps present in the infectious foci. 1
7  7
Breve descrição das figuras: Brief description of the figures:
Figura 1 : Imunodetecção da rHsp65 a partir de culturas dos clones de L. lactis pCYT: Hsp65. (1 ): Controle- proteína Hsp65 purificada produzida em E. coli. (2): PM- padrão de peso molecular BenchMark™ Pre-stained Protein Ladder (Invitrogen). (3): C- fração citoplasmática. (4): S- fração secretada. (A): NI - não induzido. (B): I - induzido. O retângulo em vermelho destaca o fragmento protéico referente à rHsp65. Vinte microlitros de cada amostra foram depositados em cada canaleta. As membranas foram reveladas utilizando-se soro de camundongo anti-Hsp65 (1 :1000). Figura 2: Imunodetecção da rHsp65 a partir de culturas dos clones de L. lactis pSEC:Hsp65. (1): Controle- proteína Hsp65 purificada produzida em E. coli. (1 ): PM- padrão de peso molecular BenchMark™ Pre-stained Protein Ladder (Invitrogen) (3): C- fração citoplasmática. (4): S- fração secretada. (A): NI- não induzido. (B): I - induzido. O retângulo em vermelho destaca o fragmento protéico referente à rHsp65. Vinte microlitros de cada amostra foram depositados em cada canaleta. As membranas foram reveladas utilizando-se soro de camundongo anti-Hsp65 (1 :1000). Figure 1: Immunodetection of rHsp65 from cultures of L. lactis clones pCYT: Hsp65. (1): Control-purified Hsp65 protein produced in E. coli. (2): MW-standard molecular weight BenchMark ™ Pre-stained Protein Ladder (Invitrogen). (3): C- cytoplasmic fraction. (4): S- secreted fraction. (A): NI - not induced. (B): I - induced. The rectangle in red highlights the protein fragment related to rHsp65. Twenty microliters of each sample were deposited in each channel. Membranes were developed using anti-Hsp65 mouse serum (1: 1000). Figure 2: Immunodetection of rHsp65 from cultures of L. lactis pSEC: Hsp65 clones. (1): Control-purified Hsp65 protein produced in E. coli. (1): MW- standard molecular weight BenchMark ™ Pre-stained Protein Ladder (Invitrogen) (3): C- cytoplasmic fraction. (4): S- secreted fraction. (A): NI- not induced. (B): I - induced. The rectangle in red highlights the protein fragment related to rHsp65. Twenty microliters of each sample were deposited in each channel. Membranes were developed using anti-Hsp65 mouse serum (1: 1000).
Figura 3 - Tratamento oral com Lactococcus lactis produtor de Hsp65 impede o processo inflamatório característico da colite ulcerativa. As lâminas foram coradas com hematoxina e eosina, aumento de 100x. Meio (M17 sem Lactoccocus), WT (wild type, L lactis selvagem), SEC (L. lactis produtores de Hsp65 secretada), CYT (Z_. lactis produtores de Hsp65 citoplasmática). Número de animais por grupo=5 para cada grupo experimental. Figure 3 - Oral treatment with Lactococcus lactis producing Hsp65 prevents the inflammatory process characteristic of ulcerative colitis. The slides were stained with hematoxin and eosin, increased by 100x. Medium (M17 without Lactococcus), WT (wild type, wild L lactis), SEC (L. lactis producing secreted Hsp65), CYT (Z. lactis producing Hsp65 cytoplasm). Number of animals per group = 5 for each experimental group.
Figura 4 - Tratamento oral com Lactococcus lactis produtor de Hsp65 reduz a produção das citocinas pró-inflamatórias IL-4 e IFN-gama no cólon de camunodongos com colite ulcerativa. Níveis de (A) IL-4 e (B) IFN- gamma medidas por ELISA em extratos de cólon. Meio (M1 7 sem Lactoccocus), WT (wild type, L lactis selvagem), SEC (L lactis produtores de Hsp65 secretada), CYT (L. lactis produtores de Hsp65 citoplasmática). Número de animais por grupo=5 para cada grupo experimental. Letras diferentes indicam diferença estatística (ANOVA Tukey), p<0,05. Figure 4 - Oral treatment with Hsp65-producing Lactococcus lactis reduces production of the proinflammatory cytokines IL-4 and IFN-gamma in the colon of camunodongs with ulcerative colitis. Levels of (A) IL-4 and (B) IFN-gamma measured by ELISA in colon extracts. Medium (M1 7 without Lactococcus), WT (wild type, wild L lactis), SEC (lactis producing Hsp65 secreted), CYT (L. lactis producing Hsp65 cytoplasm). Number of animals per group = 5 for each experimental group. Different letters indicate statistical difference (ANOVA Tukey), p <0.05.
Figura 5 - Tratamento oral com Lactococcus lactis produtor de Hsp65 reduz o estado de ativação de linfocitos nos linfonodos mesentéricos de camundongos com colite ulcerativa. CD44 expresso em linfocitos T CD4+ ativados efetores (MIF: intensidade média de fluorescência). Meio (M17 sem Lactoccocus), WT (wild type, L. lactis selvagem), SEC (L. lactis produtores de Hsp65 secretada). Número de animais por grupo=5 para cada grupo experimental. Letras diferentes indicam diferença estatística (ANOVA Tukey), p<0,05. Figure 5 - Oral treatment with Lactococcus lactis producer of Hsp65 reduces the activation state of lymphocytes in the mesenteric lymph nodes of mice with ulcerative colitis. CD44 expressed on activated CD4 + T lymphocytes (MIF: mean fluorescence intensity). Medium (M17 without Lactococcus), WT (wild type, L. lactis wild), SEC (L. lactis secreted Hsp65 producers). Number of animals per group = 5 for each experimental group. Different letters indicate statistical difference (ANOVA Tukey), p <0.05.
Figura 6 - Tratamento oral com Lactococcus lactis produtor de Hsp65 aumenta a produção da citocinas anti-inflamatórias IL-10 no cólon de camunodongos com colite ulcerativa. Níveis de IL-10 medida por ELISA em extratos de cólon. Meio (M17 sem Lactoccocus), WT (wild type, L. lactis selvagem), SEC (L lactis produtores de Hsp65 secretada), CYT (L. lactis produtores de Hsp65 citoplasmática). Número de animais por grupo=5 para cada grupo experimental. Letras diferentes indicam diferença estatística (ANOVA Tukey), p<0, 05. Figure 6 - Oral treatment with Lactococcus lactis producer of Hsp65 increases the production of anti-inflammatory cytokines IL-10 in the colon of camunodongs with ulcerative colitis. Levels of IL-10 measured by ELISA in colon extracts. Medium (M17 without Lactococcus), WT (wild type, L. lactis wild), SEC (lactis producing Hsp65 secreted), CYT (L. lactis producing Hsp65 cytoplasmic). Number of animals per group = 5 for each experimental group. Different letters indicate statistical difference (ANOVA Tukey), p <0.05.
Figura 7 - Tratamento oral com Lactococcus lactis produtor de Hsp65 reduz o número de linfocitos T ativados na lâmina própria de camunodongos deficientes para IL-10. CD44 é expresso em linfocitos T CD4+ ativados efetores. Meio (M17 sem Lactoccocus), WT (wild type, L. lactis selvagem), SEC (L. lactis produtores de Hsp65 secretada). n=4 para cada grupo experimental. O grupo CT é formado de animais mais jovens que ainda não desenvolveram a colite (controle). Letras diferentes indicam diferença estatística (ANOVA Tukey), p<0,05. Figure 7 - Oral treatment with Hsp65-producing Lactococcus lactis reduces the number of activated T lymphocytes in the lamina propria of IL-10 deficient camunodongs. CD44 is expressed on effector activated CD4 + T lymphocytes. Medium (M17 without Lactococcus), WT (wild type, L. lactis wild), SEC (L. lactis secreted Hsp65 producers). n = 4 for each experimental group. The CT group is composed of younger animals that have not yet developed colitis (control). Different letters indicate statistical difference (ANOVA Tukey), p <0.05.
Figura 8 - Efeito do L. lactis produtor de hsp65 na encefalomielite autoimune experimental . Camundongos C57BL/6 foram tratados com L. lactis produtor de hsp65 e depois imunizados para a indução do modelo experimental de esclerose múltipla. O desenvolvimento da doença foi avaliado pelo índice clínico (score clínico) (A) e pela infiltração de células na medula espinhal (B). Grupo controle (Naive), o grupo não tratado com L lactis recebeu apenas água (grupo Water+EAE), um grupo controle recebeu o tratamento oral com L.lactis selvagem contendo o vetor vazio (WT +EAE) e o grupo teste recebeu o tratamento oral com L lactis produtor de hsp65 (HSP + EAE) antes da indução da doença. Número de animais por grupo = 5. * indica diferença significativa entre os grupos com P<0.005 (teste de ANOVA). Figure 8 - Effect of L. lactis producing hsp65 on experimental autoimmune encephalomyelitis. C57BL / 6 mice were treated with hsp65-producing L. lactis and then immunized for induction of the multiple sclerosis experimental model. The development of the disease was evaluated by the clinical index (A) and the infiltration of cells in the spinal cord (B). Control group (Naive), the group not treated with L lactis received only water (Water + EAE group), a control group received oral treatment with wild L.lactis containing the empty vector (WT + EAE) and the test group received the oral treatment with lactose producing hsp65 (HSP + EAE) before induction of the disease. Number of animals per group = 5. * indicates significant difference between groups with P <0.005 (ANOVA test).
Figura 9 - Efeito do tratamento com L. lactis produtor de HSP65 na frequência de Tregs. Frequência de células T reguladoras (CD4/CD25/FOXp3) no baço de camundongos NOD (camundongos que desenvolvem diabetes autoimune espontaneamente) após o tratamento com Lactococcus lactis produtor de HSP65. As barras representam a média ± erro padrão da frequência de células T reguladoras na população de linfócitos T totais 24h, 72h, ou 7 dias após o início do tratamento com L. lactis produtor de HSP. Número de animais por grupo = 4. * indica diferença estatística em relação ao controle não tratado (teste ANOVA). Figure 9 - Effect of treatment with L. lactis producing HSP65 on the frequency of Tregs. Frequency of regulatory T cells (CD4 / CD25 / FOXp3) in the spleen of NOD mice (mice that spontaneously develop autoimmune diabetes) after treatment with HSP65-producing Lactococcus lactis. Bars represent the mean ± standard error of regulatory T cell frequency in the total T lymphocyte population 24h, 72h, or 7 days after initiation of treatment with HSP-producing L. lactis. Number of animals per group = 4. * indicates statistical difference in relation to the untreated control (ANOVA test).
Descrição detalhada da invenção Detailed description of the invention
A presente invenção refere-se à obtenção de uma linhagem bacteriana geneticamente modificada (cepa) engenhada para a produção e secreção da proteína Hsp65 livre de LPS. Além disso, a invenção ora proposta também descreve o uso dessa cepa e composições farmacêuticas contendo a mesma na prevenção e tratamento de doenças inflamatórias. The present invention relates to obtaining a genetically engineered bacterial strain (strain) engineered for the production and secretion of the LPS-free Hsp65 protein. In addition, the present invention also describes the use of such a strain and pharmaceutical compositions containing the same in the prevention and treatment of inflammatory diseases.
Construção de linhagens recombinantes de L. lactis produtoras de Hsp65 de M. leprae As linhagens recombinantes de L. lactis produtoras de Hsp65 de M. leprae foram construídas a partir da amplificação da ORF Hsp 65 de M. leprae presente no plasmídeo pcDNA3: Hsp 65, utilizando-se a enzima Accuprime™ Pfx DNA polimerase (Invitrogen) e os primers que se seguem, contendo os sítios de restrição para Nsil e EcoRI: Iniciador "forward" da forma secretada (sítio de restrição para a enzima Nsi\ sublinhado): Construction of M. leprae Hsp65-producing L. lactis recombinant strains M. leprae Hsp65-producing L. lactis recombinant strains were constructed from the amplification of the M. leprae Hsp 65 ORF present in the plasmid pcDNA3: Hsp65 , using the enzyme Accuprime ™ Pfx DNA polymerase (Invitrogen) and the following primers containing the restriction sites for Nsil and EcoRI: Forward primer of the secreted form (restriction site for the Nsi enzyme):
5' CCATGCATCAGCCAAGACAATTGCGTACG 3' 5 'CCATGCATCAGCCAAGACAATTGCGTACG 3'
Iniciador "forward" da forma citoplasmática (sítio de restrição para a enzima Nsi\ sublinhado): Cytoplasmic forward primer (restriction site for the Nsi enzyme):
5' CCATGCATGCCAAGACAATTGCGTACG 3' 5 'CCATGCATGCCAAGACAATTGCGTACG 3'
Iniciador "reverse" tanto da forma secretada quanto da citoplasmática (sítio de restrição para a enzima EcoRI sublinhado): Reverse primer for both the secreted and cytoplasmic forms (restriction site for the underlined EcoRI enzyme):
5' CCGAATTCTCAGAAGTCCATACCACCC 3' Os dois fragmentos amplificados, correspondentes às sequências codificadoras da forma citoplasmática e secretada de Hsp65, foram clonados no vetor pCR®-Blunt ll-TOPO ®, gerando assim os plasmídeos intermediários pTP:cHsp65 (citoplasmático) e pTP sHsp65 (secretado). 5 'CCGAATTCTCAGAAGTCCATACCACCC 3' The two amplified fragments, corresponding to sequences encoding the cytoplasmic and secreted form of Hsp65, were cloned into the pCR®-Blunt ll-TOPO ® vector, thus generating the intermediate plasmids pTP: cHsp65 (cytoplasmic) and pTP sHsp65 ( secreted).
Estes plasmídeos foram então utilizados para transformar células de E. coli TOP10 eletrocompetentes. A seleção de colónias de E. coli recombinantes foi realizada em meio LB ágar contendo canamicina. Dez colónias transformadas com cada construção (citoplasmática ou secretada) foram escolhidas aleatoriamente, inoculadas em meio seletivo líquido e incubadas à 37° C por 18 horas. Essas culturas foram então utilizadas para fazer uma cultura estoque, em glicerol, de cada possível clone e para a realização da extração dos plasmídeos recombinantes.  These plasmids were then used to transform electrocompetent E. coli TOP10 cells. Selection of recombinant E. coli colonies was performed on LB medium containing kanamycin. Ten colonies transformed with each construct (cytoplasmic or secreted) were randomly selected, inoculated in liquid selective medium and incubated at 37 ° C for 18 hours. These cultures were then used to make a stock culture, in glycerol, of each possible clone and for the extraction of the recombinant plasmids.
O DNA plasmidiano foi extraído através do método de lise alcalina (Sambrook et al., 1989) e utilizado como molde para confirmar a clonagem do inserto através de uma reação de PCR utilizando os iniciadores específicos da ORF Hsp65 de M. leprae. Todos os dez clones de cada construção foram confirmados como sendo portadores do inserto correspondente à ORF Hsp65 ( 626 pb). Os clones apresentando o fragmento correspondente ao inserto citoplasmático e os apresentando o fragmento correspondente ao inserto secretado receberam a denominação de pTP cHsp65 e pTP:sHsp65, respectivamente. Plasmid DNA was extracted by the alkaline lysis method (Sambrook et al., 1989) and used as template to confirm cloning of the insert by a PCR reaction using the specific M. leprae ORs Hsp65 primers. All ten clones of each construct were confirmed to be bearers of the corresponding Hsp65 ORF insert (626 bp). The clones presenting the fragment corresponding to the cytoplasmic insert and the ones presenting the fragment corresponding to the insert secreted were given the designation of pTP cHsp65 and pTP: sHsp65, respectively.
Após a confirmação da presença dos insertos nos vetores, os fragmentos correspondentes aos insertos Hsp65 citoplasmático e Hsp65 secretado extraídos dos clones pTP:cHsp65 e pTP:sHsp65 foram subclonados no. sistema de expressão XIES (Xylose-Inducible-Expression-System), onde são utilzados os vetores de expressão pXylT CYT:nuc e pXy/T:SEC.77<vc extraídos de linhagens de E. coli 83 e 84 (Miyoshi, A., Jamet, E., Commissaire, J., Renault, P., Langella, P. and Azevedo, V. (2004) A xylose-inducible expression system for Lactococcus lactis. FEMS Microbiol Lett 239, 205-212).  After confirmation of the presence of the inserts in the vectors, the fragments corresponding to the cytoplasmic Hsp65 and secreted Hsp65 inserts extracted from the pTP: cHsp65 and pTP: sHsp65 clones were subcloned into. (Xylose-Inducible-Expression-System), where the expression vectors pXylT CYT: nuc and pXy / T: SEC.77 are extracted from E. coli lines 83 and 84 (Miyoshi, A. , Jamet, E., Commissaire, J., Renault, P., Langella, P. and Azevedo, V. (2004) The xylose-inducible expression system for Lactococcus lactis FEMS Microbiol Lett 239, 205-212).
Para a subclonagem da ORF Hsp65 nos vetores de expressão pXylT.CYT.nuc e pXy/7~:SEC:/7uc, inicialmente foi realizada a extração desses plasmídeos a partir das linhagens de E. coli 83 e 84, através do método de lise alcalina (Sambrook et al., 1989). Em seguida, foi realizada uma reação de digestão enzimática com as enzimas Nsi\ e EcoRI. Os fragmentos de DNA correspondentes aos vetores pXy/T":CYT (3244 pb) e pXy/7~:SEC (3316 pb), desprovidos da sequência codificadora da nuclease de S. aureus {nuc; 51 pb), foram purificados com o Kit GFX (Amersham Biosciences). A concentração e a pureza dos produtos purificados foram então estimadas através de resolução eletroforética em gel de agarose à 1 %. For the subcloning of the Hsp65 ORF into the expression vectors pXylT.CYT.nuc and pXy / 7 ~ : SEC: / 7uc, the extraction of these plasmids from the strains of E. coli 83 and 84 was initially carried out by the lysis method (Sambrook et al., 1989). Then, an enzymatic digestion reaction was performed with the Nsi and EcoRI enzymes. The DNA fragments corresponding to vectors pxy / T ": CYT (3244 bp) and pxy / ~ 7: SEC (3316 bp) lacking the coding sequence for the S. aureus nuclease {nuc; 51 bp) were purified with GFX Kit (Amersham Biosciences) The concentration and purity of the purified products were then estimated by electrophoretic resolution on 1% agarose gel.
Os produtos digeridos e purificados correspondentes ao inserto Hsp65 e aos vetores pXy/7~:CYT e pXy/7":SEC foram submetidos a uma reação de ligação com a enzima T4 DNA polimerase (Invitrogen). The digested and purified products corresponding to the Hsp65 insert and the pXy / 7 ~ : CYT and pXy / 7 " : SEC vectors were subjected to a T4 DNA polymerase (Invitrogen) binding reaction.
O produto de cada reação de ligação (pXylT:CYJ.Hsp65 e pXy/7~:SEC:Hsp65) foi usado para transformar células eletrocompetentes de E. coli TOP10. Dez colónias transformadas com cada construção, selecionadas em placas de Petri contendo meio LB ágar suplementado com 10 ng/mL de cloranfenicol, foram inoculadas em 5,0 ml_ de meio LB suplementado com 10 ig/mL de cloranfenicol e mantidas a 37° C por aproximadamente 18 horas sob agitação. Foi feita uma cultura estoque em glicerol (1 ml_ da cultura + 1 mL de glicerol 80%) de cada clone e estes foram armazenados a -70° C. A partir destes clones foi realizada a extração dos plasmídeos. Os plasmídeos extraídos pXylT:CYT:Hsp65 e pXylT:SEC:Hsp65 foram aplicados em uma reação de PCR com os iniciadores já descritos, seguida de digestão enzimática com Nsil e EcoRI, com o objetivo de confirmar a presença da ORF Hsp65. Os plasmídeos foram então submetidos a reações de sequenciamento de DNA (Sanger F, Nicklen S, Coulson AR. (1977) DNA sequencing with chain-terminating inhibitors, Biotechnology. 1992;24:104-8). The product of each binding reaction (pXylT: CYJ.Hsp65 and pXy / 7 ~ : SEC: Hsp65) was used to transform E. coli TOP10 electrocompetent cells. Ten colonies transformed with each construct, selected from Petri dishes containing LB agar medium supplemented with 10 ng / ml chloramphenicol, were inoculated in 5.0 ml of LB medium supplemented with 10 μg / ml chloramphenicol and maintained at 37 ° C for approximately 18 hours under stirring. A culture stock was made in glycerol (1 ml of the culture + 1 ml of 80% glycerol) of each clone and these were stored at -70 ° C. From these clones the plasmids were extracted. Plasmids extracted pXylT: CYT: Hsp65 and pXylT: SEC: Hsp65 were applied in a PCR reaction with the primers already described, followed by enzymatic digestion with Nsil and EcoRI, in order to confirm the presence of the Hsp65 ORF. The plasmids were then subjected to DNA sequencing reactions (Sanger F, Nicklen S, Coulson AR. (1977) DNA sequencing with chain-terminating inhibitors, Biotechnology, 1992; 24: 104-8).
.As sequências nucleotídicas obtidas através do sequenciamento dos plasmídeos pXylT:CYT:Hsp65 e pXylT:SEC:Hsp65 foram analisadas utilizando- se o algoritmo BLAST (Basic Local Alignment Search Tool) disponível no NCBI e demonstraram que os insertos correspondem à sequência codificadora do gene Hsp65 de M. leprae (Escore "e-value" = 0.0) e que estes encontram-se clonados em fase de leitura correta com o sítio de ligação ao ribossomo (RBS) ou com o peptídeo sinal (PS) da proteína Usp45 de L. lactis, respectivamente. . The nucleotide sequences obtained by sequencing plasmids pXylT: CYT: Hsp65 and pXylT: SEC: Hsp65 were analyzed using the BLAST (Basic Local Alignment Search Tool) algorithm available from the NCBI and showed that the inserts correspond to the coding sequence of the gene Hsp65 from M. leprae (e-value score = 0.0) and that they are cloned in the correct reading phase with the ribosome binding site (RBS) or the signal peptide (PS) of the protein Usp45 from L lactis, respectively.
Exemplo 1 : Preparo de células L. lactis eletrocompetentes Example 1: Preparation of electrolyte L. lactis cells
Após o preparo de células eletrocompetentes de L. lactis NCDO21 18, estas foram transformadas com os plasmídeos pXylT CYT:Hsp65 e pXylT:SEC:Hsp65, extraídos pelo método de lise alcalina a partir dos clones de E. coli TOP10. Os transformantes foram selecionados em placas de Petri contendo meio M17Glu-Sac ágar suplementado com 10 ng/mL de cloranfenicol. Os clones transformantes foram recuperados e seu DNA plasmidiano foi extraído.  After preparation of L. lactis NCDO21 18 electrocompetent cells, they were transformed with plasmids pXylT CYT: Hsp65 and pXylT: SEC: Hsp65, extracted by the alkaline lysis method from the TOP10 E. coli clones. Transformants were screened in Petri dishes containing M17Glu-Sac agar medium supplemented with 10 ng / ml chloramphenicol. The transforming clones were recovered and their plasmid DNA was extracted.
Os plasmídeos extraídos foram aplicados em uma reação de PCR com os iniciadores já com o objetivo de confirmar a obtenção de plasmídeos recombinantes contendo a ORF Hsp65.  The extracted plasmids were applied in a PCR reaction with the primers already with the objective of confirming the obtaining of recombinant plasmids containing the Hsp65 ORF.
A presente invenção pode ser melhor compreendida, de forma não limitante, a partir dos seguintes exemplos:  The present invention may be better understood, without limitation, from the following examples:
Exemplo 2: Indução da expressão da rHsp65 em L. lactis Example 2: Induction of rHsp65 expression in L. lactis
Uma alíquota de 10 μΙ_ da cultura estoque dos clones confirmados de L. lactis NCDO21 18 {pXylT:CYT:Hsp65 e pXylT:SEC:Hsp65) foi inoculada em meio GM17 suplementado com 10 de cloranfenicol. Os inóculos foram mantidos "over-night" à 30° C, sem agitação. Essas culturas foram então diluídas (1 :10.000) em meio XM17 ou GM17 (controle negativo da indução) suplementados com 10 ng/mL de cloranfenicol. Uma vez que a cultura alcançou uma densidade óptica (DOeoonm) em torno de 1 .5, alíquotas da fração celular e do sobrenadante (2 mL) de cada cultura foram coletadas e submetidas à extração protéica. An aliquot of 10 μg of stock culture of the confirmed clones of L. lactis NCDO21 18 (pXylT: CYT: Hsp65 and pXylT: SEC: Hsp65) was inoculated into GM17 medium supplemented with 10 of chloramphenicol. The inocula were kept over-night at 30 ° C without agitation. These cultures were then diluted (1: 10,000) in XM17 or GM17 medium (negative control of induction) supplemented with 10 ng / mL chloramphenicol. Once the culture reached an optical density (ODeoonm) around 1.5, aliquots of the cell fraction and the supernatant (2 mL) of each culture were collected and submitted to protein extraction.
Extração das frações protéicas, citoplasmatica e secretada, dos clones recombinantes de L. lactis NCD02118  Extraction of cytoplasmic and secreted protein fractions from recombinant L. lactis clones NCD02118
Alíquotas de 2 mL das culturas (induzidas e não induzidas) foram centrifugadas a 12.000 x g, 4o C, por 10 minutos. Em seguida, o sobrenadante foi separado do precipitado celular e estes foram tratados separadamente. Aliquots of 2 ml cultures (induced and non-induced) were centrifuged at 12,000 xg, 4 o C for 10 minutes. Thereafter, the supernatant was separated from the cell pellet and these were treated separately.
O sobrenadante foi filtrado e então adicionou-se 100 pL de ácido tricloroacético (TCA) 100% gelado; ditiotreitol (DTT) 10mM e fenil-metil sulfonil fluoreto (PMSF) 1 mM e este foi incubado por uma hora no gelo. Após incubação, foi centrifugado a 12.000 x g, 4o C, por 20 minutos. O precipitado protéico foi então ressuspenso em 60 pL de NaOH 50 mM. The supernatant was filtered and then 100 ul of 100% trichloroacetic acid (TCA) was added; 10 mM dithiothreitol (DTT) and 1 mM phenylmethyl sulfonyl fluoride (PMSF) and this was incubated for one hour on ice. After incubation, it was centrifuged at 12,000 xg, 4 o C for 20 minutes. The protein precipitate was then resuspended in 60 μl of 50 mM NaOH.
O "pellet" celular foi ressuspenso em 100 pL de solução de Tris-EDTA- lisozima acrescido de PMSF 1 mM e DTT 10mM. Em seguida, foi incubado a 37° C por 30 minutos e, posteriormente, foi adicionado 50pL de SDS 20%.  The cellular pellet was resuspended in 100 μl of Tris-EDTA-lysozyme solution plus 1 mM PMSF and 10 mM DTT. It was then incubated at 37 ° C for 30 minutes and then 50pL of 20% SDS was added thereafter.
Ao final da extração, as amostras foram ressuspensas em tampão DTT-LB na proporção de : , aquecidas à 100°C por 5 minutos e estocadas a -20° C.  At the end of the extraction, the samples were resuspended in DTT-LB buffer in the ratio of:, heated at 100 ° C for 5 minutes and stored at -20 ° C.
Exemplo 3- Análise da expressão da rHsp65 produzida por L. lactis Example 3- Analysis of rHsp65 expression produced by L. lactis
O teor de proteína contida nos extratos celular e sobrenadante de L. lactis foi aferido pelo ensaio de Bradford (Bradford MM. (1976). A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principie of protein-dye-binding; Anal Biochem 1976; 72:248-54). As proteínas extraídas foram então separadas por eletroforese em gel de poliacrilamida sob condições desnaturantes (SDS-PAGE), de acordo com o protocolo descrito por Laemmli (1970), e transferidas para membranas para posterior imunodetecção por "Western Blotting". Como controle, foi aplicado no mesmo gel a proteína Hsp65 purificada produzida em E. coli (Nanocore Biotecnologia LTDA). Após a transferência, as membranas foram reveladas através do Kit WestemBreeze® Chromogenic Western Blot Immunodetection (Invitrogen), utilizando-se soro de camundongo anti-Hsp65 (1 :1000), produzido como se segue: The protein content contained in the cell extracts and supernatant of L. lactis was measured by the Bradford assay (Bradford MM, 1976), a rapid and sensitive method for the quantification of microgram quantities of protein using the principle of protein-dye-binding; Anal Biochem 1976; 72: 248-54). The extracted proteins were then separated by polyacrylamide gel electrophoresis under denaturing conditions (SDS-PAGE), according to the protocol described by Laemmli (1970), and transferred to membranes for further Western Blotting immunodetection. As a control, the purified Hsp65 protein produced in E. coli (Nanocore Biotechnology LTDA) was applied to the same gel. After transfer, membranes were developed using WestemBreeze kit Chromogenic Western Blot Immunodetection ® (Invitrogen) using serum of anti-HSP65 mouse (1: 1000), produced as follows:
Camundongos BALB/c foram imunizados subcutâneamente com 50 μg da proteína rHsp65 purificada de Escherichia coli misturada com adjuvante incompleto de Freud (Sigma) na proporção 1 :1 . Os animais receberam três doses dessa mistura a cada 15 dias (dias 15, 30 e 45). O soro foi coletado do plexo orbital por meio de uma pipeta Pasteur de vidro no dia 0 e no dia 50. Finalizado o experimento, os animais foram sacrificados com sedação prévia seguida de deslocamento cervical.  BALB / c mice were immunized subcutaneously with 50 μg of purified rHsp65 protein from Escherichia coli mixed with incomplete Freud's adjuvant (Sigma) in the ratio 1: 1. The animals received three doses of this mixture every 15 days (days 15, 30 and 45). Serum was collected from the orbital plexus by a glass Pasteur pipette on day 0 and day 50. After the experiment, the animals were sacrificed with prior sedation followed by cervical dislocation.
As análises de imunodetecção da rHsp65 produzida pelos clones pCYT:Hsp65 (Figura 1 ) e pSEC:Hsp65 (Figura 2) confirmam a capacidade de produção da proteína recombinante por L. lactis.  Immunodetection analyzes of rHsp65 produced by clones pCYT: Hsp65 (Figure 1) and pSEC: Hsp65 (Figure 2) confirm the production capacity of the recombinant protein by L. lactis.
A rHsp65 produzida pelo clone pCYT Hsp65 ficou retida dentro da célula, o que está de acordo com o esperado, já que o vetor de expressão pXy/7~:CYT não possui peptídeo sinal para a exportação da proteína. Nenhum sinal do antígeno recombinante foi detectado nos extratos das culturas não induzidas (Figura 1). The rHsp65 produced by clone pCYT Hsp65 was retained within the cell, which is as expected, since the pXy / 7 ~ : CYT expression vector has no signal peptide for the export of the protein. No signal from the recombinant antigen was detected in extracts from the non-induced cultures (Figure 1).
As análise de expressão do antígeno pelo clone pSEC.Hsp65 demonstrou que a eficiência de secreção (isto é, a razão entre a quantidade de proteína observada no meio extracelular e no conteúdo intracelular) foi de aproximadamente 50%, como pode ser observado pela comparação da intensidade das proteínas detectadas nestas duas frações (Figura 2). O fragmento protéico observado na fração citoplasmática corresponde ao precursor da proteína (PSUsp45::Hsp65) que provavelmente permaneceu associado ao envelope celular. Antigen expression analyzes by clone pSEC.Hsp65 demonstrated that the secretion efficiency (i.e., the ratio of the amount of protein observed in the extracellular medium to the intracellular content) was approximately 50%, as can be seen by comparing the intensity of the proteins detected in these two fractions (Figure 2). The protein fragment observed in the cytoplasmic fraction corresponds to the protein precursor (PS Us p45 :: Hsp65) that probably remained associated with the cellular envelope.
Quantificação da produção da rHsp65 produzida em L. lactis  Quantification of the production of rHsp65 produced in L. lactis
A produção de rHsp65 de M. leprae produzida pelo clone pSEC:Hsp65 foi quantificada pelo método de Bradford utilizando-se lisozima como padrão. Foi feita a dosagem de proteínas totais do sobrenadante da cultura induzida e da cultura não induzida. A concentração de proteínas observadas no sobrenadante da cultura não induzida foi de 93 pg/L e no da cultura induzida foi de 660 μg/L· Uma vez que a única diferença entre as proteínas presentes no sobrenadante da cultura não induzida e induzida é a presença da rHsp65, pode-se concluir que 567 pg/L do antígeno estão sendo secretados para o meio extracelular. É importante notar que essa concentração diz respeito a uma alíquota de 2 mL de cultura induzida. Sendo assim, em 1 ml_ há 283,5 mg/L; o que por sua vez foi obtido por precipitação em cerca de 50 pL (concentrado 40X). Por fim, podemos concluir que o total de Hsp65 secretado para o sobrenadante do cultivo celular é de 7,08 mg/L. Como anteriormente mencionado, a eficiência de secreção foi estimada em 50%, logo, podemos concluir que a produção total (presente dentro da célula e no sobrenadante da cultura) de rHsp65 foi de aproximadamente 14,16 mg/L. Production of rHsp65 from M. leprae produced by clone pSEC: Hsp65 was quantified by the Bradford method using lysozyme as standard. Total protein concentrations of the culture supernatant and the uninduced culture were measured. The concentration of proteins observed in the culture supernatant was 93 pg / L and that of the induced culture was 660 μg / L. Since the only difference between the proteins present in the supernatant of the uninduced and induced culture is the presence of rHsp65, one can conclude that 567 pg / L of the antigen is being secreted into the extracellular medium. It is important to note that this concentration concerns an aliquot of 2 ml of culture induced. Thus, in 1 ml there is 283.5 mg / L; which in turn was obtained by precipitation in about 50 pL (40X concentrate). Finally, we can conclude that the total Hsp65 secreted into the cell culture supernatant is 7.08 mg / L. As previously mentioned, secretion efficiency was estimated at 50%, so we can conclude that the total production (present within the cell and in the culture supernatant) of rHsp65 was approximately 14.16 mg / L.
Exemplo 4- Teste do Lisado do Amebócito Limulus (LAL) Example 4: Limulus Amebocyte Lysate (LAL)
O teste do Lisado do Amebócito do Limulus (LAL) foi utilizado para a detecção de endotoxina nas proteínas extraídas da fração citoplasmática e secretada de L. lactis selvagem e recombinante, utilizando-se o Kit QCL-1000® (Lonza). Este teste permite a investigação do grau farmacêutico das linhagens a serem utilizadas nos ensaios imunológicos. A constatação da ausência de impurezas contaminantes nas linhagens garante sua qualidade, segurança e eficácia. A tabela 1 demonstra os resultados obtidos. The Limulus Amebocyte Lysate (LAL) test was used for the detection of endotoxin in proteins extracted from the cytoplasmic and secreted fraction of wild and recombinant L. lactis using the QCL-1000® Kit (Lonza). This test allows the investigation of the pharmaceutical grade of the lines to be used in the immunological tests. The finding of the absence of contaminating impurities in the lineages guarantees its quality, safety and efficacy. Table 1 shows the results obtained.
TABELA 1 : Resultados do ensaio do Lisado do Amebócito do Limulus realizado a partir das frações protéicas extraídas das linhagens recombinantes de L. lactis  TABLE 1: Results of the Limulus Amebocyte Lysate assay performed from the protein fractions extracted from L. lactis recombinant strains
Linhagens Limite de Resultados Result Lineage Lineages
UE/pg aceito  EU / PG accepted
Media de Final UE/pg obtida  Final average EU / pg obtained
L lactis pCYT:Hsp65 C I < 0,1 0,00881 A L lactis pCYT: Hsp65 C I <0.1 0.00881 A
L. lactis pCYT:Hsp65 C NI < 0,1 0,00501 A L. lactis pCYT:Hsp65 S 1 < 0,1 0,00458 A L. lactis pCYT: Hsp65 C NI <0.1 0.00501 A L. lactis pCYT: Hsp65 S 1 <0.1 0.00458 A
L. lactis pCYT:Hsp65 S Nl < 0,1 0,00641 A L. lactis pCYT: Hsp65 S Nl <0.1 0.00641 A
L. lactis pSEC:Hsp65 C 1 < 0,1 0,00192 A L. lactis pSEC: Hsp65 C 1 <0.1 0.00192 A
L lactis pSEC:Hsp65 C Nl < 0,1 0,00542 A L lactis pSEC: Hsp65 C Nl <0.1 0.00542 A
L. lactis pSEC:Hsp65 S 1 < 0,1 0,00137 A L. lactis pSEC: Hsp65 S 1 <0.1 0.00137 A
L. lactis pSEC:Hsp65 S Nl < 0,1 0,00205 A L. lactis pSEC: Hsp65 S Nl <0.1 0.00205 A
L. lactis selvagem C < 0,1 0,01 1 19 A L. lactis wild C <0.1 0.01 1 19 A
L. lactis selvagem S < 0,1 0,00225 A L. lactis wild S <0.1 0.00225 A
A: Aprovado; C: Fração celular; S: Fração secretada; I: Linhagem Induzida; Nl: Linhagem Não Induzida; UE/ g: unidades endotoxicas/micrograma L. lactis pCYT Hsp65: Linhagem produtora da forma citoplasmática do antígeno; L. lactis pSEC Hsp65: Linhagem produtora da forma secretada do antígeno Todas as amostras testadas apresentaram concentração de endotoxina abaixo de 0,1 ΙΙΕ/μς e, dessa maneira, foram consideradas livres de LPS cumprindo os requisitos estabelecidos pelo FDA (Food and Drug Administration), USP (United States Pharmacopeia) e EP (European Pharmacopoeia). Considerando que L. lactis é uma bactéria Gram-positiva e que o LPS está presente somente na parede celular de bactérias Gram- negativas, os resultados observados estão de acordo com o esperado. A: Approved; C: Cell fraction; S: Fraction secreted; I: Induced Lineage; Nl: Non-induced lineage; EU / g: endotoxic / microgram units L. lactis pCYT Hsp65: Line producing the cytoplasmic form of the antigen; L. lactis pSEC Hsp65: Production line of the secreted form of the antigen All tested samples had endotoxin concentration below 0.1 ΙΙΕ / μ and were therefore considered free of LPS in compliance with the requirements established by the Food and Drug Administration ), USP (United States Pharmacopeia) and EP (European Pharmacopoeia). Considering that L. lactis is a Gram-positive bacterium and that LPS is present only in the cell wall of Gram-negative bacteria, the observed results are in agreement with the expected.
Exemplo 6- Testes da atividade anti-inflamatória Example 6- Anti-inflammatory activity tests
Nos testes pré-clínicos que fizemos, tratamos camundongos com dois tipos de colite experimental: a) induzida, pela administração de dextrana sulfato de sódio (DSS), um agente químico causador de um quadro de colite agudo com características inflamatórias semelhantes à colite ulcerativa em humanos; b) espontânea, em camundongos geneticamente deficientes em IL- 0 que desenvolvem um quadro de colite semelhante à doença de Crohn humana. Para isso mamadeira contendo meio de crescimento das bactérias (grupo Meio), L. Lactis selvagem (grupo WT), L. lactis produtores da forma secretada (grupo SEC) ou citoplasmática (grupo CYT) da Hsp65 foram ofertadas ad libitum durante 4 dias consecutivos. Após um intervalo de 10 dias, a indução da colite experimental (modelo de colite ulcerativa em camundongos) foi realizada pela administração de DSS a 1 ,5%, oferecido na mamadeira, como única fonte líquida por 7 dias. In the pre-clinical tests we performed, we treated mice with two types of experimental colitis: a) induced by the administration of sodium dextran sulfate (DSS), a chemical agent that causes acute colitis with inflammatory features similar to ulcerative colitis in humans; b) spontaneously in mice genetically deficient in IL-1 which develop a colitis picture similar to human Crohn's disease. For this, the bottle containing medium of growth of bacteria (Medium group), wild L. lactis (WT group), L. lactis producers of the secreted form (SEC group) or cytoplasmic (CYT group) of Hsp65 were offered ad libitum for 4 consecutive days . After an interval of 10 days, the induction of experimental colitis (model of ulcerative colitis in mice) was performed by administration of DSS at 1.5%, offered in the bottle as the only liquid source for 7 days.
O tratamento prévio com o L. lactis secretor de Hsp65 aboliu completamente (100% de inibição) a perda de peso que acompanha a colite experimental), melhorou drasticamente os parâmetros clínicos e histológicos da doença) e impediu o processo inflamatório no intestino grosso (Figura 3) dos camundongos tratados com DSS. As citocinas inflamatórias típicas da colite ulcerativa (IL-4 e IFN-gama) foram inibidas e a frequência de linfócitos T CD4+ efetores (CD44+) nos linfonodos mesentéricos foram reduzidos pela administração de L. lactis produtor de Hsp65 (Figura 4 e 5). O aumento da citocina imuno-moduladora IL-10 nos extratos de cólon de camundongos tratados com L. lactis produtor de Hsp65 indica que mecanismos imuno- moduladores locais geralmente relacionados à indução de tolerância oral foram desencadeados pelo tratamento (Figura 6).  Previous treatment with Hsp65 secretory L. lactis completely abolished (100% inhibition) the weight loss accompanying experimental colitis), drastically improved the clinical and histological parameters of the disease) and prevented the inflammatory process in the large intestine (Figure 3) of the mice treated with DSS. Inflammatory cytokines typical of ulcerative colitis (IL-4 and IFN-gamma) were inhibited and the frequency of effector CD4 + T lymphocytes (CD44 +) in mesenteric lymph nodes was reduced by administration of Hsp65-producing L. lactis (Figure 4 and 5). The increase of the IL-10 immuno-modulating cytokine in colon extracts from Hsp65-producing L. lactis-treated mice indicates that local immunomodulatory mechanisms generally related to induction of oral tolerance were triggered by the treatment (Figure 6).
Testamos também o tratamento com L. lactis produtor de Hsp65 em camundongos 29 Sv/Ev geneticamente deficientes em IL- 0 que desenvolvem colite espontânea (semelhante à doença de Crohn humana) a partir de 6 semanas de idade . Para isso a mamadeira contendo meio de crescimento das bactérias (grupo Meio) L. Lactis selvagem (grupo WT) ou L. lactis produtores da forma secretada (grupo SEC) da Hsp65 foram ofertadas ad libitum durante 4 dias consecutivos aos camundongos deficientes para IL-10 que desenvolvem enterocolite espontânea. Quando os animais atingiram a idade de 12 semanas, esses foram sacrificados e estudados. Nesse modelo experimental, obtivemos até o momento alguns resultados preliminares (com poucos animais ainda) que mostram um efeito benéfico do L. lactis produtor de Hsp65 tanto melhorando os parâmetros clínicos da doença como o aumento do comprimento dos vilos do cólon, por exemplo quanto reduzindo a frequência de linfócitos T CD4+ ativados efetores (CD44+) na lâmina própria do intestino dos camundongos deficientes de IL-10 com 12 semanas de idade (Figura 7). We also tested treatment with Hsp65-producing L. lactis in 29 Sv / Ev mice genetically deficient in IL-1 which develop spontaneous colitis (similar to human Crohn's disease) from 6 weeks of age. For this purpose, the bottle containing medium growth medium (L. medium) L. lactis (WT group) or L. lactis secretory producers (SEC group) of Hsp65 were given ad libitum for 4 consecutive days to the mice deficient for IL- 10 that develop spontaneous enterocolitis. When the animals reached the age of 12 weeks, these were sacrificed and studied. In this experimental model, we have obtained some preliminary results (with few animals yet) showing a beneficial effect of Hsp65-producing L. lactis, both improving the clinical parameters of the disease and increasing the length of the colon villi, for example reducing the frequency of CD4 + T lymphocytes activated (CD44 +) effectors in the gut lamina propria of 12-week-old IL-10 deficient mice (Figure 7).
Exemplo 7- Efeito da administração de Lactococcus lactis produtor de hsp65 em modelos de doenças autoimunes Modelo experimental de esclerose múltipla Example 7- Effect of administration of hsp65-producing Lactococcus lactis in autoimmune disease models Experimental model of multiple sclerosis
Camundongos da linhagem C57BL/6 foram tratados com solução de Lactococcus lactis produtor de hsp65 por 4 dias consecutivos, de acordo com o esquema apresentado abaixo. Dez dias depois foi induzida a encefalomielite autoimune experimental (EAE- modelo animal da esclerose múltipla) pela injeção subcutânea de proteína oligodendrocítica da bainha de mielina (MOG) juntamente com o adjuvante completo de Freund (CFA) e a toxina pertussis (PT). C57BL / 6 mice were treated with hsp65-producing Lactococcus lactis solution for 4 consecutive days, according to the scheme presented below. Ten days later experimental autoimmune encephalomyelitis (EAE-animal model of multiple sclerosis) was induced by subcutaneous injection of oligodendrocytic myelin sheath (MOG) along with complete Freund's adjuvant (CFA) and pertussis toxin (PT).
Figure imgf000020_0001
Figure imgf000020_0001
Tiatameirto Oial Inteivalo Indução Saciiíicio  Tiatameirto Oial Inteivalo Saciiíicio Induction
EAE  EAE
O desenvolvimento da doença foi monitorado através da medida de um índice clínico (clinicai score) que atribui números a cada nível de perda motora e defeitos neurológicos (em uma escala de 1 a 5, onde o índice 5 representa a morte do animal). Além disto, foram analisados vários parâmetros imunológicos relacionados a inflamação local e sistémica além da análise histológica de infiltração de células inflamatórias na medula espinhal (principal alvo da doença). Como podemos observar na figura 8, o tratamento com L. lactis produtor de hsp65 foi capaz de reduzir significativamente em todos os tempos analisados o índice clínico da doença (Figura 8A) e prevenir a infiltração da medula espinhal por células inflamatórias (Figura 8B). Disease development was monitored by measuring a clinical index (clinicai score) that assigns numbers to each level of motor loss and neurological defects (on a scale of 1 to 5, where index 5 represents the death of the animal). In addition, several immunological parameters related to local and systemic inflammation were analyzed in addition to the histological analysis of infiltration of inflammatory cells in the spinal cord (main target of the disease). As shown in figure 8, treatment with hsp65-producing L. lactis was able to significantly reduce the clinical index of the disease (Figure 8A) and prevent infiltration of the spinal cord by inflammatory cells at all time points (Figure 8B).
Observamos que o controle da EAE pela administração do L. lactis produtor de hsp65 estava associado ao aumento na frequência de células T reguladoras CD4+CD25+Foxp3+ e CD4+CD25+LAP+ nos linfonodos drenantes e no baço. Essas células estão associadas com a regulação da reatividade a auto-antígenos mantendo a homeostase do sistema imune. Em doenças autoimunes, a sua produção no timo ou expansão na periferia estão alteradas. Utilizando um marcador (Hélios) para distinguir células T reguladoras naturais (geradas no timo), observamos que 60% das células T reguladoras CD4+CD25+Foxp3+ com frequência aumentada, nos animais tratados com L. lactis produtor de hsp65, tem origem tímica. Isto nos sugere que a administração da bactéria modificada interfere positivamente com um dos mecanismos fundamentais no controle da autoimunidade periférica. We observed that control of EAE by administration of hsp65-producing L. lactis was associated with increased T cell regulators CD4 + CD25 + Foxp3 + and CD4 + CD25 + LAP + in the draining and spleen lymph nodes. These cells are associated with the regulation of reactivity to autoantigens while maintaining the homeostasis of the immune system. In autoimmune diseases, their production in the thymus or expansion in the periphery are altered. Using a marker (Helios) to distinguish natural regulatory T cells (generated in the thymus), we observed that 60% of CD4 + CD25 + Foxp3 + regulatory T cells with increased frequency in animals treated with hsp65-producing L. lactis has a thymic origin. This suggests that the administration of the modified bacterium positively interferes with one of the fundamental mechanisms in the control of peripheral autoimmunity.
Modelo Experimental de diabetes autoimune (tipo 1) Experimental model of autoimmune diabetes (type 1)
Para nos certificarmos que esse mecanismo de regulação da autoimunidade via expansão de células T reguladoras CD4+CD25+Foxp3+ ocorria em outros tipos de doenças autoimunes, avaliamos o efeito da administração do L. lactis produtor de hsp65 na frequência dessas células no baço de camundongos NOD {non-obese diabetic), animais que desenvolvem espontaneamente a diabetes autoimune. To make sure that this mechanism of regulation of autoimmunity via CD4 + CD25 + Foxp3 + regulatory T cell expansion occurred in other types of autoimmune diseases, we evaluated the effect of the administration of hsp65-producing L. lactis on the frequency of these cells in the spleen of NOD mice {non-obese diabetic), animals that spontaneously develop autoimmune diabetes.
Observamos também nesses animais um efeito do L. lactis produtor de hsp65 (mas não da bactéria selvagem) no aumento da frequência de células T reguladoras CD4+CD25+Fosp3+ no baço nas primeiras 24-48 horas após o início da administração oral da bactéria modificada (Figura 9). Após 7 dias, essa frequência retorna ao basal sugerindo que essas células podem haver migrado para os sítios de inflamação (no caso, o pâncreas).  We also observed in these animals an effect of hsp65-producing L. lactis (but not wild-type bacteria) on increasing CD4 + CD25 + Fosp3 + regulatory T cell frequency in the spleen within the first 24-48 hours after oral administration of the modified bacterium (Figure 9). After 7 days, this frequency returns to baseline suggesting that these cells may have migrated to sites of inflammation (in this case, the pancreas).

Claims

REIVINDICAÇÕES
1 - Cepa recombinante de bactéria láctica, caracterizada por apresentar a sequência codificadora (ORF; open reading frame) de uma proteína de choque térmico (Hsp) livre de LPS. 1 - Recombinant strain of lactic acid bacteria, characterized by presenting the coding sequence (ORF) of a heat shock protein (Hsp) free of LPS.
2- Cepa recombinante de bactéria láctica, de acordo com a reivindicação 1 , caracterizada por ser preferencialmente do género Lactococcus sp. 2. A recombinant strain of lactic acid bacteria according to claim 1, characterized in that it is preferably of the genus Lactococcus sp.
3- Cepa recombinante de bactéria láctica, de acordo com a reivindicação 1, caracterizada pela proteína de choque térmico ser preferencialmente Hsp65 livre de LPS. A recombinant strain of lactic acid bacteria according to claim 1, characterized in that the heat shock protein is preferably Hsp65 free of LPS.
4- Cepa recombinante de bactéria láctica, de acordo com a reivindicação 3, caracterizada pela proteína Hsp65 livre de LPS ser expressa na forma secretada ou citoplasmática. A recombinant strain of lactic acid bacteria according to claim 3, characterized in that the LPS-free Hsp65 protein is expressed in the secreted or cytoplasmic form.
5- Cepa recombinante de bactéria láctica, de acordo com as reivindicações 1 a 4, caracterizada por ser utilizada como imunomoduladora no tratamento e prevenção de doenças inflamatórias e auto-imunes.  A recombinant strain of lactic acid bacteria according to claims 1 to 4, characterized in that it is used as an immunomodulator in the treatment and prevention of inflammatory and autoimmune diseases.
6- Composição farmacêutica, caracterizada por compreender cepa recombinante de bactéria láctica produtora de proteínas de choque térmico (Hsp) livre de LPS, citoplasmática ou secretada e ao menos um excipiente farmaceuticamente aceitável.  Pharmaceutical composition, comprising recombinant strain of lactic acid bacteria (Hsp) free of LPS, cytoplasmic or secreted and at least one pharmaceutically acceptable excipient.
7- Composição farmacêutica, de acordo com a reivindicação 6, caracterizada pela cepa recombinante de bactéria láctica ser preferencialmente do género Lactococcus sp. Pharmaceutical composition according to claim 6, characterized in that the recombinant strain of lactic acid bacteria is preferably of the genus Lactococcus sp.
8- Composição farmacêutica, de acordo com a reivindicação 6, caracterizada pela proteína de choque térmico ser preferencialmente Hsp65 livre de LPS.  Pharmaceutical composition according to claim 6, characterized in that the heat shock protein is preferably Hsp65 free of LPS.
9- Composição farmacêutica, de acordo com as reivindicações 6 a 8, caracterizada por ser utilizada como imunomoduladora no tratamento e prevenção de doenças inflamatórias e auto imunes.  Pharmaceutical composition according to claims 6 to 8, characterized in that it is used as an immunomodulator in the treatment and prevention of inflammatory and autoimmune diseases.
10- Composição farmacêutica, de acordo com as reivindicações 1 a 9, caracterizada por ser administrada por via oral.  Pharmaceutical composition according to claims 1 to 9, characterized in that it is administered orally.
PCT/BR2011/000321 2010-09-02 2011-09-02 Immunomodulation by means of a recombinant bacterial strain WO2012027814A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
BRPI1005908-3 2010-09-02
BRPI1005908 BRPI1005908A2 (en) 2010-09-02 2010-09-02 immunomodulation through recombinant bacterial strain
BR014110002629 2011-08-31

Publications (1)

Publication Number Publication Date
WO2012027814A1 true WO2012027814A1 (en) 2012-03-08

Family

ID=45772029

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/BR2011/000321 WO2012027814A1 (en) 2010-09-02 2011-09-02 Immunomodulation by means of a recombinant bacterial strain

Country Status (2)

Country Link
BR (1) BRPI1005908A2 (en)
WO (1) WO2012027814A1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080039400A1 (en) * 2006-01-24 2008-02-14 Universiteit Utrecht Uu Holding B.V. Treatment and prevention of inflammatory bowel diseases

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080039400A1 (en) * 2006-01-24 2008-02-14 Universiteit Utrecht Uu Holding B.V. Treatment and prevention of inflammatory bowel diseases

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
AZEVEDO, MARCELA SANTIAGO PACHECO.: "Avaliação da Imunogenicidade de linhagens de Lactococcus lactis produtoras da forma citoplasmática e secretada do antigeno Hsp65 de Mycobacterium leprae.", UNIVERSIDADE FEDERAL DE MINAS GERAIS, 2009, pages 31 - 35,37-48,52-60 *
BERMÚDAZ-HUMARÁN LG.: "lactococcus lactis as a live vector for mucosal delivery of therapeutic proteins.", HUM VACCIN., vol. 5, no. 4, April 2009 (2009-04-01), pages 264 - 267 *
FARIA, AMC ET AL.: "Oral tolerance induced by continuous feeding: enhanced up-regulation of transforming growth- factor-p/interleukin- 10 and suppression of experimental autoimmune encephalomyelitis.", J AUTOIMMUNITY, vol. 20, no. 2, March 2003 (2003-03-01), pages 135 - 145 *
GOMES-SANTOS, AC ET AL.: "Oral administration of hsp65-producing Lactococcus lactis modulates experimental colitis, abstr. IR024", XXXV CONGRESS OF THE BRAZILIAN SOCIETY FOR IMMUNOLOGY., 2010 *
MARON R ET AL.: "Mucosal administration of heat shock protein-65 decreases atherosclerosis and inflammation in aortic arch of low- density lipoprotein receptor-deficient mice.", CIRCULATION., vol. 106, no. 13, September 2002 (2002-09-01), pages 1708 - 1715 *
RESENDE, RM ET AL.: "Oral administration of hsp65-producing Lactococcus lactis prevents experimental autoimmune encephalomyelitis in mice, abstr. IR025", XXXV CONGRESS OF THE BRAZILIAN SOCIETY FOR IMMUNOLOGY., 2010 *
ROCHA, CLARISSA SANTOS.: "Construção de linhagens de Lactococcus lactis produtoras da forma citoplasmática e secretada do antígeno Hsp65 de Mycobacterium leprae: desenvolvimento tecnológico do processo de obtenção da proteína.", UNIVERSIDADE FEDERAL DE MINAS GERAIS, 2007 *

Also Published As

Publication number Publication date
BRPI1005908A2 (en) 2012-08-14

Similar Documents

Publication Publication Date Title
ES2356863T3 (en) MUTANTS OF SPI2 OF SALMONELLA ATENUATED AS CARRIERS OF ANTIGENS.
CA2931146C (en) Use of fluorinated cyclic dinucleotides as oral vaccine adjuvants
BRPI0807828A2 (en) &#34;Methods for breeding yeast-based vaccines&#34;.
JP5480812B2 (en) Compositions and methods for enhancing immune responses against Eimeria
EP0977874A1 (en) Attenuated salmonella strain used as a vehicle for oral immunization
TW201718000A (en) Formulations for neoplasia vaccines and methods of preparing thereof
EA034352B1 (en) UspA2 PROTEIN CONSTRUCTS AND USES THEREOF
EP3081227A1 (en) Lactococcus lactis producing tslp or il-25 and their uses as probiotics and therapeutics
BR112013016231B1 (en) IMMUNOMODULATORY COMPOSITION FOR THE TREATMENT OF BOVINE RESPIRATORY DISEASE
JP2011502165A (en) Compositions and methods for enhancing the immune response against flagellar bacteria
SI9400085A (en) Vaccine compositions comprising antigenic polypeptide and 3d-mpl, useful in preventing infection with influenza
BRPI1004898B1 (en) surface expression vector, recombinate microorganism, vaccine to treat cervical and method to prepare a microorganism
KR20190076020A (en) An idiotatic DNA vaccine
Steidler et al. Actobiotics™ as a novel method for cytokine delivery: The Interleukin‐10 case
WO2003031602A1 (en) The oncolytic microorganisms expressing hsp and uses thereof
EP2491946B1 (en) Adjuvant for vaccines, vaccines that comprise said adjuvant and uses thereof
Shiau et al. Prothymosin α enhances protective immune responses induced by oral DNA vaccination against pseudorabies delivered by Salmonella choleraesuis
WO2012009774A2 (en) Recombinant microorganisms, methods for preparing vaccine strains, antigens, and vector vaccine compositions of same, uses thereof, and related antibodies, diagnostic kit, and treatment and/or prophylactic methods
BR112020010316A2 (en) modified brucella vaccine strain for the treatment of brucellosis
Kim et al. Live attenuated Salmonella enterica serovar Typhimurium expressing swine interferon-α has antiviral activity and alleviates clinical signs induced by infection with transmissible gastroenteritis virus in piglets
WO2012027814A1 (en) Immunomodulation by means of a recombinant bacterial strain
ES2561667T3 (en) Synthetic genes encoding myelin natural protein peptide fragments for the induction of oral tolerance, DNA fragment comprising these genes, means for obtaining these peptides in a microbial (bacterial) system and their medical application
KR100985914B1 (en) Cell Surface Expression Vector for liver Cancer Specific Antigen Alpha-fetoprotein and Microorganism Transformed by Thereof
Buttaro et al. Engineered E. coli as vehicles for targeted therapeutics
RU2730657C1 (en) Anti-tumour agent based on recombinant vaccinia virus strain and method for production thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11820944

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11820944

Country of ref document: EP

Kind code of ref document: A1