WO2012025861A1

WO2012025861A1 - Process for the preparation of ( s ) - 3 - cyano - 5 - methylhexanoic acid derivatives adn of pregabalin

Info

Publication number: WO2012025861A1
Application number: PCT/IB2011/053659
Authority: WO
Inventors: Adam James Musgrave Burrell; Carlos Alberto Martinez; Paul Oliver Mcdaid; Padraig Mary O'neill; John Wing Wong
Original assignee: Pfizer Manufacturing Ireland
Priority date: 2010-08-23
Filing date: 2011-08-19
Publication date: 2012-03-01

Abstract

The invention provides a process for the manufacture of a compound of formula (I) using an enzyme catalysed reduction of a compound of formula (lla) or llb). Compounds of formula (I) are useful for preparing pregabalin.

Description

PROCESS FOR THE PREPARATION OF ( S )- 3 - CYANO - 5 -METHYLHEXANOIC ACID DERIVATIVES ADN OF PREGABALIN

Field of the Invention

5 The present invention relates to a process for the manufacture of (S)-3-cyano-5- methylhexanoic acid derivatives that are useful intermediates in the manufacture of (S)-(+)-3-aminomethyl-5-methylhexanoic acid (pregabalin). Pregabalin is a γ-amino acid that exhibits binding affinity to the human α₂δ calcium channel subunit.

10 Background to the Invention

1. Pregabalin

Pregabalin, or (S)-(+)-3-aminomethyl-5-methyl-hexanoic acid,

15 is the active agent in Lyrica®, which is approved for the treatment of epilepsy,

neuropathic pain, fibromyalgia and generalized anxiety disorder. It exhibits antiseizure activity, as discussed in U.S. Patent US 5,563,175, and anti-nociceptive activity, as discussed in U.S. Patent US 6,001 ,876. It is hypothesised that the pharmacological activity of pregabalin is the result of binding to the alpha-2-delta 0 (α₂δ) subunit of a calcium channel. Pregabalin is also described as having utility in other conditions, such as physiological conditions associated with psychomotor stimulants, inflammation, gastrointestinal damage, alcoholism, insomnia, and various psychiatric disorders, including anxiety, depression, mania, and bipolar disorder.

5

It will be recognized that 3-aminomethyl-5-methyl-hexanoic acid has a single chiral centre and so exists as two optical isomers. As indicated above, pregabalin is the (S)-enantiomer, and a key consideration in the commercial manufacture of

pregabalin is the strategy by which optically pure material is obtained.

0 2. Manufacturing methods involving resolution

Pregabalin has been prepared in various ways. A common strategy shared by many syntheses has been the resolution of the final product or of an earlier intermediate into its R- and S-enantiomers. Such methods may involve an azide intermediate (e.g., U.S. Patent US 5563175), or a Hoffman synthesis (e.g. U.S. Patents US 5629447, and US 5616793). A route involving a malonate intermediate (e.g., U.S. Patents US 6046353, US 5840956, and US 5637767) has also been utilised, and an improvement of this method is described in International Patent Application WO 2006/000904.

3. Manufacturing methods involving chiral synthesis

In general, chiral synthesis is an attractive alternative to methods involving resolution in that the formation of the undesired enantiomer is avoided and potentially the overall yield can be doubled.

An asymmetric hydrogenation of a cya no-substituted olefin to produce a chiral cyano precursor of (S)-3-aminomethyl-5-methylhexanoic acid has also been used to prepare pregabalin, see e.g. U.S. Patent US 6891059. The cyano precursor is subsequently reduced to give Pregabalin (Scheme 1 ).

The asymmetric hydrogenation employs a chiral catalyst that is comprised of a transition metal bound to a bisphosphine ligand, such as (R,R)-Me-DUPHOS.

However biphosphine ligands may be difficult and costly to prepare. Asymmetric hydrogenation also requires the use of special equipment capable of handling H₂, which can add to the capital costs of carrying out a large-scale synthesis. Pregabalin has also been synthesized directly using a chiral auxiliary, (4R,5S)-4- methyl-5-phenyl-2-oxazolidinone: see, e. g., U.S. Patents US 6359169, US

6028214, US 5847151 , US 5710304, US 5684189, US 5608090, and US 5599973. Although these methods provide pregabalin in high enantiomeric purity, they are less desirable for large-scale synthesis because they employ comparatively costly reagents (e. g., the chiral auxiliary) that are difficult to handle, as well as special cryogenic equipment to reach required operating temperatures, which can be as low as -78°C.

The use of a chiral oxazolidinone has also been reported in the synthesis of the antipode of pregabalin (see Convine and Popkin, Synlett, 2006, (10), 1589-1591 ). The addition of cyanide to an α,β-unsaturated oxazolidinone derivative afforded a chiral cyano precursor of pregabalin. However, the oxazolidinone derivative derived from the naturally occurring isomer of valine gives the cyano intermediate with the incorrect stereochemistry for pregabalin as the major diastereomer. In addition, a stoichiometric amount of the chiral oxazolidinone auxiliary was needed to prepare the α,β-unsaturated oxazolidinone derivative, as was a samarium-based catalyst, making this route financially unviable and environmentally undesirable, especially for a large-scale synthesis.

Two further processes are disclosed in WO2010/070593. In the first route a chiral phase-transfer catalyst is used to mediate the enantioselective addition of cyanide to an alkylidenemalonate, providing a key (cyanoalkyl)malonate intermediate. In the second route an enzyme is used to provide chiral isovaleraldehyde cyanohydrin, which is transformed in two steps to the same key (cyanoalkyl)malonate

intermediate.

Still further improved syntheses of pregabalin are sought. It is especially desirable to provide a process which is cost effective and safe. In particular, it is important to provide a synthesis of pregabalin which can be carried out on a commercial scale and which uses readily available starting materials and cheap reagents. 4. Enoate reductase

In the process of the invention set out herein, a -cyano-a, -unsaturated ester is reduced in the presence of an enoate reductase enzyme. Enoate reductases, sometimes called "Old Yellow Enzyme", are a family of enzymes that catalyse the addition of hydrogen to electron-deficient double bonds. Representative uses are described in WO/2008/058951 . Usually the hydrogen source is either NADH or NADPH. For a review, see R. Stuermer et al., Current Opinion in Chemical Biology 2007, 1 1 , 203-213, or H. Toogood et al., ChemCatChem 2010, 2(8), 892-914. Summary of the Invention

In a first aspect, the invention provides a process for preparing a compound of formula (I)

wherein R¹ is selected from hydrogen, Ci-C-i₂-alkyl, C₃-Ci₂ cycloalkyi, aryl-C-i -C₆ alkyi and aryl, said alkyi, cycloalkyi and aryl being optionally substituted by one or more groups selected from halo, C-i-C6-alkoxy and tri(Ci-C3-alkyl)silyl,

comprising the steps of:

a) preparing a

or a mixture thereof, wherein R¹ is as defined for the compound of formula (I); and b) treating the compound of formula (lla) or (Mb), or the mixture of compounds, with a suitable reducing agent in the presence of an enoate reductase enzyme.

In a preferred embodiment, R¹ is selected from Ci-C-i₂-alkyl and benzyl.

In a more preferred embodiment, R¹ is selected from C-i-C₄-alkyl. In a particularly preferred embodiment, R¹ is ethyl.

In a second aspect, the invention provides a process for preparing pregabalin (III)

comprising the steps of: a) preparing a compound of formula (lla) or (Mb)

(lla) (lib)

or a mixture thereof, wherein R¹ is selected from hydrogen, Ci -Ci₂-alkyl, C3-C12 cycloalkyi, aryl-Ci -C₆-alkyl and aryl, said alkyl, cycloalkyi and aryl being optionally substituted by one or more groups selected from halo, C-i -C6-alkoxy and tri(Ci -C3- alkyl)silyl; b) treating the compound of formula (lla) or (Mb), or the mixture of compounds, with a suitable reducing agent in the presence of an enoate reductase enzyme to provide a compound of formula (I)

(I)

wherein R¹ is as defined for the compound of formula (lla) and (Mb); and c) converting the compound of formula (I) into pregabalin.

In a preferred embodiment, R¹ is selected from Ci -Ci2-alkyl and benzyl.

In a more preferred embodiment, R¹ is selected from C-i -C -alkyl. In a particularly preferred embodiment, R¹ is ethyl.

Detailed Description of Preferred Embodiments

The term "alkyi" means a straight-chain or branched-chain saturated aliphatic hydrocarbon radical containing the specified number of carbon atoms. Examples of alkyi radicals include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl and fe/t-butyl. The term "aryl" means a phenyl or naphthyl group.

The term "aryl-alkyl" means a straight-chain or branched-chain saturated aliphatic hydrocarbon radical in which an aryl group is substituted for an alkyi hydrogen atom. An example of an aryl-alkyl group is benzyl .

The term "cycloalkyl" means a saturated carbocyclic ring containing the specified number of carbon atoms. Examples of carbocyclic rings include cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl. The term "enantiomeric excess", sometimes abbreviated as "e.e.", is a measure, for a given sample, of the excess of one enantiomer in excess of its antipode and is expressed as a percentage. Enantiomeric excess is defined as:

100 x (er-1 ) / (er +1 )

where "er" is the ratio of the more abundant enantiomer to the less abundant enantiomer.

The term "optionally substituted" with reference to an alkyi or aryl group means that a hydrogen atom of the alkyi or aryl group may be replaced by one of the groups listed. The substitution may be made at any position within the alkyi or aryl group. When the optional substitution is with "one or more groups" then any number of hydrogen atoms of the alkyi or aryl group, up to a maximum equal to the number of hydrogens present in the alkyi or aryl group, may be replaced, and each replacement is independent of the others. In the first aspect as set out above, the invention provides a two-step process for preparing a compound of formula (I).

The first step comprises the preparation of a compound of formula (lla) or (Mb), or a mixture thereof.

(lla) (lib) The compounds of formula (lla) and (Mb) can be prepared by any suitable method. It will be understood that some methods will provide for a specific double bond geometry, other methods will provide a high degree of selectivity, and some methods will be non-selective. Accordingly, depending on the method selected, the compound of formula (lla) or the compound of formula (Mb) may be obtained as a pure single isomer, a mixture enriched in one component (such as a 90:10, 80:20, 20:80 or 10:90 mixture), or as a 50:50 mixture. If the method chosen provides a mixture that is unsuitable for use in the second step of the process then the isomers may be separated by conventional techniques.

Examples of methods suitable for the preparation of compounds of formula (lla) and (Mb) are set out in Schemes 2 to 6. These methods provide further aspects of the invention.

Tf = CF₃SO₂- a: diethyl carbonate, NaH; b: Tf₂O, LiOTf, iPr₂NEt; c: Zn(CN)₂, Pd(PPh₃)₄ 4-Methyl-2-pentanone may be reacted with a carbonate diester (here diethyl carbonate) to give a β-keto-ester. In the presence of trifluoromethanesulfonic anhydride (triflic anhydride) and lithium triflate this is converted to the corresponding enol triflate with high selectivity for the Z-isomer. Reaction with zinc cyanide in the presence of tetrakis(triphenylphosphine)palladium gives the nitrile with retention of the double bond geometry, so corresponding to formula (I la).

d : Tf₂O, Me₄N⁺OH^"; e: Zn(CN)₂, Pd(PPh₃)

The use of tetramethylammonium hydroxide in a two-phase system results in the formation of the E-enol triflate, again with relatively high selectivity. Cyanation then gives the compound corresponding to formula (Mb).

Knoevenagel condensation of isovaleraldehyde and monoethyl malonate gives mainly the α,β-unsaturated ester. Reaction with bromine gives the corresponding dibromide. Reaction with potassium cyanide gives mainly the Z-isomer

corresponding to formula (I la) with the E-isomer as a minor component. In a variation of this method, the dibromide can be treated with potassium carbonate to give an unsaturated monobromide which can be treated with potassium cyanide to give the desired compound.

j: KOH, H₂O; k: H₂, catalyst; I: HCI; m: base, Ac₂O

Isobutyraldehyde and cyanoacetic acid are condensed in the presence of a suitable base, such as potassium hydroxide, to give a salt of 2-cyano-4-methyl-2-pentenoic acid. This is reduced by hydrogenation in the presence of a suitable catalyst to give the corresponding salt of 2-cyano-4-methylpentanoic acid. A preferred catalyst is Ecat-147. Use of this catalyst enables the condensation and hydrogenation steps to be carried out simultaneously. Alternatively, the reactions may be performed sequentially, in which case sodium borohydride may be used as the reducing agent. The salt is converted to the free acid, for example by treatment with a mineral acid such as hydrochloric acid. The acid is then condensed with ethyl glyoxylate or suitable equivalent to give the desired compound as a mixture of isomers.

Scheme 6

n : NaCN, CuCN; o: (EtO)₂P(O)CH₂CO₂Et, BuLi

Isovaleryl chloride is converted to the corresponding acyl cyanide by reaction with sodium cyanide and cuprous cyanide. A Wadsworth-Emmons reaction with triethyl phosphonacetate gives the desired compound as a mixture of isomers.

The methods set out above may not be compatible with the preparation of compounds of formula (lla) or (Mb) wherein R¹ is hydrogen. These compounds may be prepared from the corresponding esters by conventional means, such as hydrolysis in the presence of an alkali metal hydroxide.

In the second step of the process the compound of formula (lla) or (Mb), or the mixture of compounds, is treated with a suitable reducing agent in the presence of an enoate reductase enzyme.

The reducing agent is a hydrogen donor that can participate in the enoate reductase catalytic cycle. Typically it is NADH or NADPH, or a mixture of these two agents. The NADH or NADPH may be used in a stoichiometric amount, but generally it will be preferred to provide a means for recycling the NAD⁺ or NADP⁺. Such a means may be a second oxido-reductase enzyme coupled with an inexpensive substrate. For example, the recycling of NAD⁺ can be carried out by the use of a suitable second enzyme and reducing agent including glucose dehydrogenase with glucose, formate dehydrogenase with ammonium formate, and alcohol dehydrogenase with an appropriate alcohol such as ethanol, propanol or isopropanol. NADP⁺ can also be recycled using similar systems including glucose dehydrogenase with glucose, glucose-6-phosphate dehydrogenase with glucose-6-phosphate, and alcohol dehydrogenase with an appropriate alcohol such as ethanol, propanol, or isopropanol. Suitable methods are described in WO/2008/058951 . Alternatively the means may be provided by a whole-cell preparation, in which case the hydrogen derives from the sugars provided in the nutrient medium.

The enoate reductase is selected to provide rapid turnover of the substrate and a high degree of enantioselectivity in the product. A particularly preferred enzyme is oxophytodienoate reductase 1 (OPR1 ) from the tomato (Lycopersicon esculentum). The enzyme may be derived from a natural source, or it may be produced in a recombinant host (such as E. coli). Methods for producing enzymes using recombinant technology are well known in the art.

In one embodiment intact cells expressing enoate reductase are used as the enzyme component.

In another embodiment the cells are lysed and the crude cell lysate is used as the enzyme component. In another embodiment the cell lysate is subject to one or more purification steps and the purified or partially purified enoate reductase is used as the enzyme component.

In another embodiment the purified or partially purified enoate reductase is immobilized on a solid support and this immobilized material is used as the enzyme component.

The enzyme-catalysed reduction reaction will generally be performed in a suitable solvent. Water and mixtures of water and water-miscible organic solvents are preferred. Alternatively a two-phase system of water and a water-immiscible solvent may be used. A buffer may be used to maintain the pH of the mixture within a suitable range, such as a pH of between 4.5 and 8.5. The reaction will generally be performed at a temperature of between 0°C and 70°C, particularly between 15°C and 50°C, and more particularly between 20°C and 40°C.

In a second aspect, the invention provides a process for preparing pregabalin (III).

The process of this second aspect comprises, in addition to the two steps discussed above, a third step of converting the compound of formula (I) into pregabalin. This third step may comprise two transformations. Where R¹ is other than hydrogen the carboxylic acid group must be provided. Methods for achieving this conversion will depend on the nature of R¹, but are widely known in the art. The nitrile group must be reduced to provide the aminomethyl group. Again, methods for achieving this conversion are widely known. The two transformations may be carried out in any order. They may be carried out separately, with the intermediate product being isolated, or sequentially, with no intervening isolation.

Where R¹ is ethyl, a preferred method is to first hydrolyse the ester using an alkali metal hydroxide such as lithium, sodium or potassium hydroxide in water, and then to add Raney nickel to the mixture and stir under hydrogen to afford Pregabalin.

Examples

The invention is illustrated by the following non-limiting examples in which the following abbreviations and definitions are used: bp Boiling point

CNE Ethyl 3-cyano-5-methylhexanoate

CyH Cyclohexane

d Doublet

DCM Dichloromethane Dehydro-CNE Ethyl 3-cyano-5-methyl-2-hexenoate

DIW De-ionised water

dd Doublet of doublets

ddd Doublet of doublets of doublets

dt Doublet of triplets

eq or eq. Equivalent

e.e. or ee Enantiomeric excess

EtOAc Ethyl Acetate

HPLC High Performance Liquid Chromatography

Hr or h Hour

¹H NMR Proton Nuclear Magnetic Resonance Spectroscopy

L Litre

m Multiplet

mbar Millibar

min Minute

ml_ Millilitre

mmol Millimole

Mp Melting point

MTBE Methyl tert-butyl Ether

NAD⁺ Nicotinamide adenine dinucleotide (oxidised)

NADP⁺ Nicotinamide adenine dinucleotide phosphate (oxidised)

NADH Nicotinamide adenine dinucleotide (reduced)

NADPH Nicotinamide adenine dinucleotide phosphate (reduced) ppm Parts per million

q Quartet

Rf Retention factor

RT Room temperature

s Singlet

t Triplet

δ Chemical shift

Commercial chemicals were used as received unless stated otherwise. Thin layer chromatography was performed on pre-coated plastic plates (Merck silica 60F254), and visualised using UV light and KMnO₄ dip. Proton (¹H) and carbon (¹³C) NMR spectra were recorded on a Varian I NOVA 300 MHz spectrometer. Chemical shifts are quoted relative to tetramethylsilane and referenced to residual solvent peaks as appropriate. Unless otherwise indicated, chiral HPLC analysis was performed using an Agilent 1200 HPLC system and data was processed using the

Chemstation software or with a Varian semiprep/analytical HPLC using Galaxie software.

Preparations

Preparation 1 : Ethyl 3-oxo-5-methylhexanoate

A 20L jacketed reactor was charged with anhydrous THF (4.87L) and 60% sodium hydride (256.7g; 1 .32eq) under an inert atmosphere. The suspension was cooled to 5-10°C and 4-methyl-2-pentanone (487g; 608ml; 1 eq) was added dropwise to the mixture at <15°C. The suspension was stirred for 20 minutes at 10-15°C, then diethyl carbonate (884ml; 1 .5eq) was added dropwise to the mixture at <20°C. The mixture was allowed to warm from 15 to 25°C over 1 hr then stirred at 25°C for 18 hours. A sample taken from the mixture was partitioned between MTBE and water (1 ml each), the water layer was back-extracted with MTBE (1 ml), and the combined organic extracts were filtered through cotton wool/MgSO₄. Analysis by GC showed that no more than 5% 4-methyl-2-pentanone remained. Acetic acid was added slowly until the pH of the mixture reached 6. The resulting thick orange/yellow suspension was cooled to 0-5°C and water (9.74L) was added slowly at >10°C. Stirring was stopped and the mixture was allowed to warm from 5 to 25°C over 30 minutes whilst adding DCM (4.87L). The mixture was then stirred for 5 minutes, the layers allowed to settle and the lower organic layer separated. The aqueous layer was extracted with a further portion of DCM (4.87L). The combined organic extracts were washed with water (4.87L) then 20% brine (4.87L), then stirred with MgSO₄ (~500g) for 30 minutes. The solid was removed by filtration and the residue was washed with DCM (490ml). The filtrate was concentrated under vacuum at <30°C to give an orange oil. The title product was isolated as a pale yellow oil by fractional distillation, b.p. 64-82°C/7-10mbar (overall yield 79%, 84.1 % area purity by GC).

¹ H NMR (CDCIs, δ= 7.20): δ 0.86 (6H, d, J = 6.4 Hz), 1 .21 (3H, t, J = 7.2 Hz), 2.09 (1 H, hept, J = 6.7 Hz), 2.35 (2H, d, J = 6.9 Hz), 3.34 (2H, s), 4.12 (2H, q, J = 7.2 Hz) ppm.

Preparation 2: Ethyl E-5-methyl-3-(trifluoromethylsulfonyloxy)-2-hexenoate

A 20L jacketed reactor was charged with hexane (7.83L) and ethyl 3-oxo-5- methylhexanoate (261 . Og; 1 eq) under an inert atmosphere. The solution was cooled to 5°C and stirred vigorously whilst adding a mixture of 25% aq. tetramethylammonium hydroxide (2.76kg; 2.76L; 5eq) and water (1 .89L) over 30 minutes at <15°C. The biphasic mixture was stirred vigorously for 10 minutes at 5- 10°C, then triflic anhydride (1 .07kg; 637ml; 2.5eq) was added dropwise to the mixture over 1 .5 hours at <10°C. The mixture was stirred vigorously at 5°C for a further 1 hour, then agitation was stopped and the layers allowed to settle before sampling upper organic layer. GC analysis showed that no more than 1 % starting material remained. The mixture was allowed to warm from 5 to 25°C over 1 hour whilst quenching with water (1 .97L), then stirred for 5 minutes. The mixture was allowed to settle and layers were separated. The aqueous layer was extracted with EtOAc (3.92L). The combined organic layers were washed with water (1 .97L) then 20% brine (1 .97L), stirred with MgSO₄ (~300g) for 15-30 minutes, then filtered. The residue was washed with EtOAc (260ml) and the filtrate was concentrated under vacuum at <40°C to give the E-vinyl triflate as a brown oil (overall yield of 378g, 82%; corrected for 8.4%w/w EtOAc content, 75.5% area purity by GC). NMR analysis indicated that the isomeric ratio was 6:1 .

¹ H NMR (CDCIs, δ= 7.20): δ 0.92 (6H, d, J = 6.7 Hz, E- + Z- ), 1 .24 (3H, t, J = 7.2 Hz, E- + Z-), 1 .95 (1 H, hept, J = 6.8 Hz, E-), 2.17 (0.33H, d, J = 7.2 Hz, Z-), 2.76 (2H, d, J = 7.3 Hz, E-), 4.14 (2H, q, J = 7.2, E-), 4.18 (0.28H, q, J = 7.2 Hz, Z-), 5.66 (0.14H, s, Z-), 5.91 (1 H, s, E-) ppm. Preparation 3: Ethyl E-3-cvano-5-methyl-2-hexenoate

A 5L 3 neck round bottom flask was charged with anhydrous DMF (2.27L), the E- triflate of preparation 2 (378.26g; 1 eq) and zinc cyanide (87.57g; 0.6eq) under inert atmosphere to form an orange suspension. The suspension was purge with N₂ for 15 minutes, then tetrakis(triphenylphosphine)palladium(0) (14.37g; 0.01 eq) was added to the reaction vessel. The suspension was heated to 70°C and stirred for 15 hours.

A sample was withdrawn and partitioned between MTBE / 20% aq. NH₄OH (1 ml each). The aqueous layer was extracted with MTBE (1 ml) and the combined organic extracts were filtered through cotton wool/MgSO . Analysis by GC indicated that the reaction was complete.

The reaction mixture was cooled from 70°C to 20-25°C and added to toluene (3.78L) in a 20L jacketed reactor, 20% aq. NH₄OH (1 .51 L) was added, and the mixture was stirred for 5 minutes then allowed to settle. The aqueous layer was separated and the organic layer was washed with a second portion of 20% aq. NH OH (1 .51 L). The first aqueous layer was extracted with toluene (1 .51 L), and the combined organic phases were washed with 20% brine (1 .51 L). A gelatinous solid was observed at the interface between the phases. The solid was separated by filtration through celite and washed with toluene. The toluene washings were added to the organic phases. The combined organic layers were stirred with MgSO (~380g) for 15-30 minutes then filtered and the solids were washed solid with toluene (380ml). The filtrate was concentrated under vacuum at <60°C to give a red oil (243.7g; 108%).

The material obtained above (1 10.7g) was purified by chromatography on a Biotage apparatus (65i cartridge (350g silica); 1 -6% EtOAc/cyclohexane) to give the title product as an orange/yellow oil. Impure fractions were re-purified (25.3g per run using 65i cartridge (350g silica); 0-1 % EtOAc/cyclohexane) to give a further amount of the title product as an orange/yellow oil. Yield 55g (53%; corrected for 3.7%w/w residual solvent content (2.0%w/w EtOAc and 1 .7%w/w cyclohexane)); 98.3% area purity by GC.

¹ H NMR (CDCIs, δ= 7.20): δ 0.91 (6H, d, J = 6.7 Hz), 1 .24 (3H, t, J = 7.1 Hz), 1 .95 (1 H, hept, J = 6.8 Hz), 2.61 (2H, dd, J i = 7.3 Hz, J₂ = 1 .1 Hz), 4.15 (2H, q, J = 7.1 Hz), 6.37 (1 H, t, J = 1 .1 Hz) ppm.

Preparation 4: Ethyl Z-5-methyl-3-(trifluoromethylsulfonyloxy)-2-hexenoate

A 20L jacketed reactor was charged with DCM (2.45L), ethyl 3-oxo-5- methylhexanoate (163.3g; 1 eq) and lithiunn triflate (295.86g; 2eq) under an inert atmosphere. The resulting white suspension was stirred and cooled to 0°C. N, N- Diisopropylethylamine (134.8g; 182ml; 1 .1 eq) was added over 10 minutes at <10°C. The suspension was stirred for 20 minutes at 0°C, then triflic anhydride (294.28g; 175ml; 1 .1 eq) was added slowly to the mixture over 30 minutes at <10°C. The suspension was stirred at 0°C for 1 hour.

A sample of the reaction mixture was taken and partitioned between MTBE and sat. NH₄CI (1 ml each). The aqueous layer was extracted with MTBE (1 ml) and the combined organic extracts were filtered through cotton wool/MgSO . Analysis by GC indicated that less than 2% starting material remained.

The mixture was allowed to warm from 0 to 25°C over 1 hr whilst quenching with sat. NH₄CI (980ml). DCM (490ml) was added and the mixture was stirred for 5 minutes, then allowed to settle and the layers were separated. The aqueous layer was extracted with DCM (490ml). The combined organic phases were then washed with 1 M HCI (2 490ml), water (490ml) and 20% brine (490ml), then stirred for 30 minutes with MgSO₄ (~165g) for 15-30 minutes. The solids were removed by filtration and washed with DCM (165ml). The filtrate was concentrated under vacuum at <40°C to give an orange/brown oil containing crystalline solids. The crude product was triturated with MTBE (980ml). The mixture was filtered and the solids were washed with MTBE (2 x 165ml). The filtrate was concentrated under vacuum at <40°C to give the title product as an orange/brown oil: overall yield 271 g (94%; corrected for 2.1 %w/w MTBE content); 87.7% area purity by GC. ¹ H NMR (CDCI3, δ= 7.20): δ 0.94 (6H, d, J = 6.7 Hz), 1 .24 (3H, t, J = 7.2 Hz), 1 .89 (1 H, hept, J = 6.8 Hz), 2.17 (2H, d, J = 7.2 Hz), 4.18 (2H, q, J = 7.2 Hz), 5.67 (1 H, s) ppm. Preparation 5: Ethyl Z-3-cvano-5-methyl-2-hexenoate

A 5L 3 neck round bottom flask was charged with anhydrous DMF (1 .63L; 6vols), the Z-triflate of preparation 4 (271 .38g; 1 eq) and zinc cyanide (62.83g; 0.6eq) under inert atmosphere to form a yellow suspension. The suspension was purged with N₂ for 15 minutes, then tetrakis(triphenylphosphine)palladium (0) (10.31 g; 0.01 eq) was added. The mixture was heated to 70°C and stirred for 15 hours.

A sample of the reaction mixture was withdrawn and partitioned between MTBE/ 20% aq. NH₄OH (1 ml each). The aqueous layer was extracted with MTBE (1 ml) and the combined organic phases were filtered through cotton wool/MgSO . Analysis by GC indicated that all the starting material had been consumed.

The reaction mixture was cooled from 70°C to 20-25°C then added to toluene (2.71 L) in a 20L jacketed reactor. 20% aq. NH₄OH (1 .09L) was added and the mixture was stirred for 5 minutes, then allowed to settle and the layers were separated. The organic layer was washed with 20% aq. NH OH (1 .09L). The first aqueous layer was extracted with toluene (1 .09L), and the extract was combined with the first organic layer. The combined organic layers were washed with 20% brine (1 .09L), then stirred with MgSO₄ (~375g) for 30 minutes and filtered. The solids were washed with toluene (275ml) and the combined filtrates were concentrated under vacuum at <60°C to give an orange/brown oil (160.3g; 99%).

The crude product (109.8g) was purified by chromatography on a Biotage apparatus (25.3g per run using 65i cartridge (350g silica); 1 -6% EtOAc/cyclohexane) to give the title product as a yellow oil: yield of 67g (60%; corrected for 4.7%w/w residual solvent content (2.8%w/w EtOAc and 1 .9%w/w cyclohexane)); 99.4% area purity by GC. ¹ H NMR (CDCI3, δ= 7.20): δ 0.90 (6H, d, J = 6.6 Hz), 1 .27 (3H, t, J = 7.2 Hz), 1 .99 (1 H, hept, J = 6.8 Hz), 2.19 (2H, dd, J₁ = 7.2 Hz, J₂ = 1 .2 Hz), 4.22 (2H, q, J = 7.2 Hz), 6.21 (1 H, t, J = 1 .2 Hz) ppm. Preparation 6: Ethyl 3-cvano-5-methyl-2-hexenoate (Mixture of E- and Z-isomers) Step 1 - Ethyl potassium malonate

A 2 litre round bottomed flask was charged with diethyl malonate (100g, 0.625 mol) and ethanol (400 ml) with magnetic agitation. A solution of KOH (35 g, 0.624 mol) in ethanol (400 ml) was added dropwise at room temperature and the mixture was stirred overnight, then the mixture was heated to reflux and allowed cool slowly to room temperature. A 1 ^st crop of the product was isolated by vacuum filtration through a large size 2 sintered glass funnel and left to dry for 1 hour. The mother liquor was reduced to 500 ml and allowed to cool to room temperature and a 2^nd crop of crystals was isolated; total 97.7g, 92%.

The product was kept in a sealed container until needed for the next step.

Step 2 - Ethyl malonate monoester

A stirrer solution of ethyl potassium malonate (45 g) in H₂O (30 ml) was cooled to 0°C. Concentrated HCI was added dropwise until universal indicator pH paper showed the pH to be 2-3. The aqueous solution was extracted with MTBE (3 x 100 ml). The combined organic layers were washed with H₂O (2 x 50 ml), dried over magnesium sulphate and concentrated to afford a clear oil; 30g, 86%.

Step 3 - Ethyl 5-methyl-2-hexenoate (Knoevenagel condensation)

A solution of ethyl malonate monoester (10 g, 0.075 mol), isovaleraldehyde (4.35 g, 0.05 mol), and DMAP (0.61 g, 0.005 mol) in DMF (50 ml) in a 250 ml round- bottomed flask was stirred at room temperature overnight. TLC of the reaction showed that all of the aldehyde had been consumed. The mixture was diluted with MTBE (100 ml) and washed with saturated ammonium chloride (30 ml), H₂O (30 ml), saturated sodium hydrogen carbonate (30 ml) and once again with H₂O (30 ml). The organic layer was dried over magnesium sulfate and the solvent was removed on the rotary evaporator to afford the product as a clear oil; 13.2g, 73%.

1 H NMR (CDCIs, δ= 7.20): δ 0.92 (6H, d), 1 .29 (3H, t), 1 .75 (1 H, m), 2.08 (2H, m), 4.16 (2H, q), 5.81 (1 H, d) 6.94 (1 H, m) ppm.

Step 4 - Ethyl 2,3-dibromo-5-methylhexanoate

A solution of bromine (0.98 ml, 0.019 mol) in DCM (3 ml) was added dropwise to a stirred solution of the α,β-unsaturated ester of step 3 (3 g, 0.019 mol) in DCM (6ml) at 0°C. The reaction was stirred at room temperature overnight, then saturated sodium metabisulphite was added dropwise until the mixture turned clear. The mixture was diluted with DCM (50 ml) and the aqueous layer was removed. The organic layer was washed with H₂O (2 x 25 ml), dried over magnesium sulfate and concentrated to afford the product as a clear oil; 5.06g, 85%.

1 H NMR (CDCIs, δ= 7.20): δ 0.92 (3H, d), 1 .01 (3H, d), 1 .31 (3H, t), 1 .69 (1 H, m), 2.02 (2H, m), 4.42(4H, m) ppm.

Step 5 - Ethyl 2-bromo-5-methyl-2-hexenoate

Potassium carbonate (1 .05 g, 7.59 mmol) was added to a solution of the dibromide of step 4 (2 g, 6.33 mmol) in ethanol (10 ml) at room temperature. The mixture was stirred for 2 hrs, then filtered. The solids were washed with ethanol (10 ml) and the combined filtrates were concentrated on the rotary evaporator. The residue was dissolved in MTBE (50 ml) and washed with H₂O (2 x 25 ml), then dried over magnesium sulfate and the solvent removed to afford the product as a clear oil; 1 .47g, 98% (E:Z = 4:1 ).

E-isomer: ¹H NMR (CDCI₃, δ= 7.20): δ 0.94 (6H, d), 1 .43 (3H, t), 1 .75 (1 H, m), 2.49 (2H, m), 4.27 (2H, q), 6.68 (1 H, t) ppm.

Z-isomer: ¹ H NMR (CDCI_{3 >} δ= 7.20): δ 0.98 (6H, d), 1 .42 (3H, t), 1 .86 (1 H, m), 2.23 (2H, m), 4.27 (2H, q), 7.31 (1 H, t) ppm. Step 6 - Ethyl 2-cyano-5-methyl-2-hexenoate

A 50 ml 2-necked round-bottomed flask fitted with a magnetic stirrer, nitrogen inlet and bleach scrubber was charged with a solution of the monobromide of step 5 (0.5 g, 2.22 mmol) in ethanol (2.5 ml). KCN (0.28 g, 4.24 mmol) was added and the mixture was heated to reflux overnight, then allowed to cool to room temperature. The ethanol was removed on the rotary evaporator. The residue was dissolved in MTBE (30 ml) and the organic layer was washed with H₂O (5 x 20 ml), then dried over magnesium sulfate and concentrated to afford the product as a clear oil; 0.28g, 73% (E:Z = 1 :2.5).

Step 7 - Ethyl 2-cyano-5-methyl-2-hexenoate (one-pot from dibromide)

A 50 ml 2-necked round-bottomed flask fitted with magnetic stirrer, condenser and bleach scrubber was charged with a solution of the dibromide of step 4 (1 g, 3.16 mmol) in ethanol (10 ml). KCN (0.62 g, 9.49mmol) was added and the mixture was heated at reflux overnight. The reaction mixture was allowed to cool and the ethanol was removed on the rotary evaporator. The residue was dissolved in MTBE (50 ml) and the organic layer was washed with brine (30 ml) and H₂O (2 x 30 ml). The organic layer was dried and the solvent was removed to leave the product as a brown oil; 0.29g, 81 % (E:Z = 1 :2.2).

Preparation 7: Ethyl 3-cyano-5-methyl-2-hexenoate (Mixture of E- and Z-isomers) Step 1 - 2-Cyano-4-methyl-2-pentenoic acid

A stirred suspension of cyanoacetic acid (42.5g, 0.5 mol), ammonium acetate

(1 .56g, 0.02 mol, 4 mol%) and isobutyraldehyde (55ml, 39.66g, 0.55 mol, 1 .1 eq) in toluene (130ml) was heated to reflux with Dean-Stark removal of water. When generation of water ceased, the reaction mixture was cooled to room temperature and concentrated under reduced pressure to give a yellow solid (79.5g). Hexane (150ml) was added and the suspension was stirred at 400rpm for 1 hour. The solid was filtered, washed with hexane (2 x 50ml) and dried to provide the title compound as a yellow crystalline solid (58.5g, 83% yield). Step 2 - 2-Cyano-4-methylpentanoic acid (by hydrogenation)

A suspension of 2-cyano-4-methylpentenoic acid (10g, 0.072 mols) in water (100 ml) was stirred at 400rpm and cooled to < 5°C in an ice/water bath. Aqueous potassium hydroxide (4.24% w/w, 100g, 0.0757 mols, 1 .05 eq) was added dropwise over 15 mins. The solution is then transferred to a 1 L Buchi hydrogenator. Escat- 147 (3g) was added to the vessel and the reaction mixture was stirred at 1000rpm under hydrogen (1 bar) for 1 hr, then filtered through celite and washed with MTBE (1 x 100ml). The resulting clear solution was stirred at 400rpm and cooled to < 5°C in an ice/water bath. Aqueous hydrochloric acid (20% w/w, 13.81 g, 0.0757 mols) was added dropwise over 15 mins. The resulting biphasic solution was extracted with MTBE (3 x 100ml). The organic layers were combined, dried over MgSO , filtered and concentrated under reduced pressure to provide the title compound as a clear, yellow liquid (8.8g, 86.7% yield).

Step 3 - 2-Cyano-4-methylpentanoic acid (by sodium borohydride reduciton) A suspension of 4-methyl-2-cyano-2-butenoic acid (10g, 71 .9mmol) in water (60ml_) was cooled to 0°C with an ice bath, then NaHCO3 (7.25g, 1 .2 eq.) was added slowly to the mixture. The mixture is stirred for 15 mins to provide a clear solution, then NaBH₄ (5.44g, 2 eq.) was added slowly at 0°C and the reaction was stirred at room temperature for 5h. The mixture was cooled down to 0°C and a solution of HCI 20% (44ml_, 4 eq.) was slowly added to the mixture (pH= 2-3). The product was extracted with EtOAc (3x 30ml_) and the combined organic phases were washed with water (3x 20 ml_), dried over MgSO , filtered and evaporated under reduced pressure to give material identical to that obtained by the hydrogenation route (10.2g, 100%).

Step 4 - 2-Cyano-4-methylpentanoic acid (one-pot process)

A stirred solution of cyanoacetic acid (20g, 0.235 mols) in water (125 ml) was cooled to <5°C in an ice/water bath. Aqueous potassium hydroxide (9.5% w/w, 138.16g, 0.235 mols) was added dropwise over 15 mins. The solution was then transferred to a 1 L Buchi hydrogenator. Escat-147 (6g) and isobutyraldehyde (23.6ml, 18.6g, 0.2585 mols, 1 .1 eq) were added to the vessel and the reaction mixture was stirred at 1000rpm under hydrogen (1 bar) for 17hrs. The reaction mixture was filtered through celite and washed with MTBE (1 x 100ml). The resulting clear solution was transferred to a 3-neck 500ml rb flask fitted with an overhead stirrer, pressure equalised dropping funnel and thermometer, then stirred at 400rpm and cooled to <5°C in an ice/water bath. Aqueous hydrochloric acid (20% w/w, 42.88g, 0.235 mols) was added dropwise over 15 mins. The resulting biphasic solution was extracted with MTBE (3 x 200ml). The organic layers were combined, dried over MgSO4, filtered and concentrated under reduced pressure to provide the title compound as a clear, colourless liquid (33g, 99% yield).

Step 5 - Ethyl glyoxylate

A mixture of glyoxylic acid (50% w/w soln, 100g, 0.675 mol), MTBE (225 ml), ethanol (75ml) and sodium chloride (15g) was stirred vigorously for 18hr. The layers were separated and the aqueous phase was extracted with MTBE (1 x 30ml). The organic phases were combined and concentrated under reduced pressure to provide crude ethyl glyoxylate as a clear, colourless liquid (72g, quantitative yield).

Step 6 - Ethyl E/Z-3-cyano-5-methyl-2-hexenoate

To a mixture of 2-cyano-4-methylpentanoic acid (3.0 g, 21 .27 mmol) and pyridine (3.44 mL, 42.55 mmol) in toluene (30 mL) were added, consecutively, ethyl glyoxylate 50% solution in toluene (5.06 mL, 25.55 mmol) and acetic anhydride (2.0 mL, 21 .27 mmol). The mixture was stirred overnight at room temperature and then quenched by addition of H₂O (30 mL). The organic phase was separated and washed with brine (3x 20 mL), dried over MgSO₄, filtered and evaporated under reduced pressure to give the title compound; 3.25 g, 85% (E:Z≥ 1 :1 ).

Preparation 8: Ethyl 3-cyano-5-methyl-2-hexenoate (Mixture of E- and Z-isomers) Step 1 -4-Methyl-2-oxopentanenitrile

A mixture of isovaleryl chloride (1 .0 eq), toluene (0.5 vols), NaCN (1 .3 eq), CuCN (0.1 eq) and MeCN (0.3 eq) was heated to 100-105°C for 4hrs, then cooled to 15°C. The solid was removed by filtration and washed with toluene (0.5 vols). The filtrate was concentrated under reduced pressure (bath temperature < 30°C) and distilled under vacuum (base temperature 58-68°C; distillate temperature 21 -24°C; 25-28mbar) to give the title product as a yellow oil (yield 13%). Step 2 - Ethyl E/Z-3-cyano-5-methyl-2-hexenoate

A solution of triethyl phosphonoacetate (1 .03eq) in anhydrous THF (240vols) was cooled to 0°C and ⁿBuLi (2.5M in hexane; 1 .23eq) was added dropwise with vigorous stirring. The mixture was agitated for 30mins and 4-methyl-2-oxopentanenitrile (1 eq) was added dropwise. The reaction mixture was allowed to warm to room

temperature overnight. Sat. NH₄CI (100vols) and ethyl acetate (100vols) were added and the layers were separated. The aqueous phase was back-extracted with ethyl acetate (50vols). The combined organic layers were washed with sat. brine

(l OOvols) and then concentrated under reduced pressure (bath temperature <45°C) to give the title compound as an orange oil; 96% yield (Z:E = 5:1 ).

Preparation 9: Sodium (E)-3-cvano-5-methylhex-2-enoate

A mixture of ethyl (E)-3-cyano-5-methylhex-2-enoate (1 g), methanol (5 ml), and aqueous sodium hydroxide solution (0.49 g, 50% wt/wt) was stirred at 22°C for 18 h, then the reaction mixture was concentrated under vacuum to give a crude product. The crude product was taken up with isopropanol, filtered onto a sintered glass funnel, washed with isopropanol, and air-dried to give sodium (E)-3-cyano-5- methylhex-2-enoate (149 mg, 15.4% yield). Methyl (E)-3-cyano-5-methylhex-2- enoate was prepared by derivatization of sodium (E)-3-cyano-5-methylhex-2-enoate with trimethylsilyldiazomethane and analyzed by GC (Chiraldex™ G-TA column, method described in example 2), which showed a peak at 3.4 min.

Preparation 10: Sodium (Z)-3-cvano-5-methylhex-2-enoate

A mixture of ethyl (Z)-3-cyano-5-methylhex-2-enoate (1 g), methanol (5 ml), and aqueous sodium hydroxide solution (0.49 g, 50% wt/wt) was stirred at 22°C for 18 h, then the reaction mixture was concentrated under vacuum to give a crude product. The crude product was taken up with isopropanol, filtered onto a sintered glass funnel, washed with isopropanol, and air-dried to give sodium (Z)-3-cyano-5- methylhex-2-enoate (505 mg, 52.2% yield). Methyl (Z)-3-cyano-5-methylhex-2- enoate was prepared by derivatization of sodium (Z)-3-cyano-5-methylhex-2-enoate with trimethylsilyldiazomethane and analyzed by GC (Chiraldex™ G-TA column, method described in example 2), which showed a peak at 6.4 min.

Examples

Example 1 : Expression of 12-Oxophytodienoate Reductase (OPR1 ) and

Homologues in E. coli

The DNA sequence corresponding to the gene for Lycopersicon esculentum

(tomato) 12-oxophytodienoate reductase 1 (OPR1 ) was retrieved from the Genbank database (accession number AC Q9XG54) and was synthesized by GeneArt (Germany). The sequence was codon optimized for expression in E. coli, and was subcloned into an E. coli expression plasmid pSTRC18 (Pfizer Inc., USA). The protein sequence is shown below. The OPR1 expression construct was transformed into BL21 (DE3) E. coli (Stratagene, Agilent Technologies, Santa Clara, CA, USA) as directed and overnight cultures were incubated in LB + streptomycin media. The LB culture was used to inoculate expression cultures (LB, M9Y, or TB), which were incubated at 37°C (210 rpm) After the culture reached a suitable biomass concentration (OD 1 at /4600), IPTG was added (1 mM) and cultures were incubated for another 20 h (30°C, 210 rpm). The cells were harvested by centrifugation (4000 x g, 30 min, 4°C) and stored at -20 °C. The BLASTP program was used to search the NCBI non-redundant protein sequences database for gene sequences related to OPR1 . Thirty seven sequences for related genes were selected, codon optimized for expression in E.coli, and subcloned into the pET28b(+) E. coli expression plasmid (Novagen, EMD

Chemicals, Gibbstown, NJ, USA). The OPR1 related expression constructs were transformed into BL21 (DE3) E. coli (Stratagene, Agilent Technologies, Santa Clara, CA, USA) as directed and overnight cultures were grown in LB + kanamycin media. The LB cultures were used to inoculate expression cultures grown in Overnight Express Instant TB Medium (Novagen, EMD Chemicals, Gibbstown, NJ, USA). Cultures were incubated for 20 h at 30°C, and the cells were harvested by centrifugation (4000 x g, 30 min, 4°C) and stored at -20 °C.

Lycopersicon esculentum (tomato) 12-Oxophytodienoate Reductase 1 protein sequence:

MENKWEEKQ VDKIPLMSPC KMGKFELCHR WLAPLTRQR SYGYIPQPHA ILHYSQRSTN GGLLIGEATV ISETGIGYKD VPGIWTKEQV EAWKPIVDAV HAKGGIFFCQ IWHVGRVSNK DFQPNGEDPI SCTDRGLTPQ IRSNGIDIAH FTRPRRLTTD EIPQIVNEFR VAARNAIEAG FDGVEIHGAH GYLIDQFMKD QVNDRSDKYG GSLENRCRFA LEIVEAVANE IGSDRVGIRI SPFAHYNEAG DTNPTALGLY MVESLNKYDL AYCHVVEPRM KTAWEKIECT ESLVPMRKAY KGTFIVAGGY DREDGNRALI EDRADLVAYG RLFISNPDLP KRFELNAPLN KYNRDTFYTS DPIVGYTDYP FLETMT Lycopersicon esculentum (tomato) 12-Oxophytodienoate Reductase 1 codon optimized sequence:

ATGGAAAACAAAGTTGTGGAAGAAAAACAGGTTGATAAAATCCCGCTGATGAG

CCCGTGTAAAATGGGTAAATTCGAGCTGTGTCATCGCGTTGTACTGGCACCGC

TGACTCGTCAGCGTTCTTATGGTTACATTCCGCAGCCGCACGCAATCCTGCATT ACTCTCAGCGCAGCACCAACGGTGGCCTGCTGATCGGTGAAGCAACCGTGAT CAGCGAAACTGGCATCGGTTACAAAGATGTGCCGGGTATCTGGACGAAAGAG CAGGTTGAGGCCTGGAAACCGATCGTCGACGCGGTGCATGCCAAAGGTGGTA TTTTCTTTTGTCAGATCTGGCACGTTGGTCGTGTATCCAACAAAGATTTTCAGC CGAACGGCGAAGATCCGATTTCCTGTACTGACCGCGGCCTGACCCCGCAGAT CCGTTCCAACGGCATTGACATTGCCCACTTCACCCGTCCACGTCGCCTGACTA CTGACGAGATTCCGCAGATCGTGAACGAGTTCCGCGTTGCAGCGCGTAATGCT ATTGAAGCGGGTTTCGATGGCGTCGAGATTCATGGTGCCCACGGTTACCTGAT CGACCAATTCATGAAAGACCAAGTTAACGACCGCAGCGATAAGTATGGCGGTT CTCTGGAGAACCGTTGTCGCTTCGCGCTGGAAATCGTTGAAGCAGTAGCCAAC GAGATTGGCTCCGACCGTGTTGGTATCCGTATCTCTCCATTCGCACACTACAA CGAAGCGGGCGACACTAACCCGACCGCACTGGGCCTGTATATGGTGGAGAGC CTGAATAAATACGACCTGGCGTATTGTCACGTGGTCGAGCCGCGCATGAAAAC CGCCTGGGAAAAGATTGAGTGCACCGAAAGCCTGGTGCCGATGCGTAAAGCC TACAAAGGCACCTTCATCGTAGCTGGTGGCTACGACCGTGAAGACGGTAACCG CGCTCTGATCGAAGACCGTGCCGACCTGGTTGCGTACGGTCGTCTGTTCATCA GCAACCCAGACCTGCCGAAGCGTTTTGAACTGAACGCTCCGCTGAACAAATAC AACCGTGACACTTTCTACACTTCCGACCCGATCGTTGGTTACACCGATTACCCG TTTCTGGAAACTATGACTTAATAA

Example 2: Reduction of (E)-ethyl 3-cvano-5-methylhex-2-enoate with E. coli cells Expressing Recombinant Reductases

Recombinant enoate reductases were tested for reduction of (E)-ethyl 3-cyano-5- methylhex-2-enoate ((E)-dehydro-CNE) using E. coli cells prepared as described in Example 1 . Reactions were carried out at 30°C in potassium phosphate buffer (100 mM, pH 7.0) with E. coli cells (20 - 40 mg wet cells/ml), NADPH (10 mM), NADH (10 mM) and (E)-dehydro-CNE (10 mM, added as DMSO solution (45.3 mg/ml)). After 22 h reactions were extracted with ethyl acetate. GC analysis (Chiraldex™ G-TA 30 M x 0.25 mm column (Supelco), Column temperature: 135°C (isothermal); Injector temperature: 200°C; Carrier gas: nitrogen (flow rate approx. 1 ml/min)) of the ethyl acetate extracts gave the results shown in Table 1 .

TABLE 1

(S)-CNE

Enzyme Name Accession Conversion

Entry ee (%)

Source Number (%)

Old yellow enzyme 1

1 Q02899 15.2 100 Saccharomyces carlsbergensis

Old yellow enzyme 2

2 Q03558 15.7 100

Saccharomyces cerevisiae

Old yellow enzyme 3

3 P41816 13.9 100

Saccharomyces cerevisiae

NADH:flavin oxidoreductase

4 Q5NLA1 32.2 100

Zymomonas mobilis

5 Pentaerythritol tetranitrate Q6JL81 33.4 100 reductase

Enterobacter cloacae

12-oxophytodienoate reductase

Q9XG54 48.6 100 Lycopersicon esculentum

unnamed enzyme

Q3Z206 47.7 100 Shigella sonnei

12-oxo-phytodienoic acid

reductase Q49HE0 29.3 100 Zea mays

12-oxophytodienoate reductase

B9SK95 1 .1 100 Castor Bean

NADH:flavin oxidoreductase/NADH

oxidase D0YIM0 38.4 100 Klebsiella variicola

unnamed enzyme

A8AH31 42.7 100 Citrobacter koseri

/V-ethylmaleimide reductase

D2THI8 41 .2 100 Citrobacter rodentium

/ -ethylmaleimide reductase

Q5PH09 42.7 100 Salmonella paratyphi

/ -ethylmaleimide reductase

C9Y3L1 39.1 100 Cronobacter turicensis

12-oxo-phytodienoic acid

reductase Q49HE4 53.2 100 Zea mays

unnamed enzyme

A5BF80 2.4 100 Vitis vinifera

unnamed enzyme

B9MWG6 40.2 100 Populus trichocarpa

12-oxophytodienoate reductase

Q8GYB8 22.2 100 Arabidopsis thaliana

/V-ethylmaleimide reductase C1 M473 62.8 100 Citrobacter sp.

unnamed enzyme

20 B2Q290 22.5 100

Providencia stuartii

unnamed enzyme

21 Q6CI57 9.9 100

Yarrowia lipolytica

/V-ethylmaleimide reductase

22 Q88I29 12.9 100

Pseudomonas putida

12-oxophytodienoate reductase

23 150864790 1 .1 100

Pichia stipitis

NAPDH dehydrogenase

24 126131638 10.5 100

Pichia stipitis

unnamed enzyme

25 146393506 31 .5 100

Pichia guilliermondii

unnamed enzyme

26 50293551 14.1 100

Candida glabrata

unnamed enzyme

27 50405397 1 .2 100

Debaryomyces hansenii

¹ Entries 1 - 6: 20 mg/ml cell concentration, 22 h reaction; entries 7 - 27: 40 mg/ml cell concentration, 22 h reaction

Example 3: Reduction of (Z)-ethyl 3-cyano-5-methylhex-2-enoate with Recombinant Reductases

Recombinant enoate reductases were tested for reduction of (Z)-ethyl 3-cyano-5- methylhex-2-enoate ((Z)-dehydro-CNE) using E. coli cells prepared as described in Example 1 . Reactions were carried out at 30°C in potassium phosphate buffer (100 mM, pH 7.0) with E. coli cells (20 - 40 mg wet cells/ml), NADPH (10 mM), NADH (10 mM) and (Z)-dehydro-CNE (10 mM, added as DMSO solution (45.3 mg/ml)). After 22 h reactions were extracted with ethyl acetate. GC analysis (Chiraldex™ G-TA column, method described in example 2) of the ethyl acetate extracts gave the results shown in Table 2. TABLE 2

Example 4: Reduction of (Z)-dehydro-CNE with E. coli cells expressing recombinant OPR1 Reductase (Tomato)

E. coli cells expressing recombinant OPR1 reductase (tomato) were tested for reduction of (Z)-dehydro-CNE. A reaction mixture consisting of E. coli cells expressing OPR1 reductase (80 mg wet cells prepared as described in example 1 ), NADPH (7.9 mg), 100 mM potassium phosphate buffer (0.9 ml, pH 7) and (Z)- dehydro-CNE (1 .8 mg added as 90.6 mg/ml solution in DMSO) was incubated at 30°C. After 45 h the reaction mixture was extracted with ethyl acetate. GC analysis (Chiraldex™ G-TA column, method described in example 2) of the ethyl acetate extract indicated 39% conversion of (Z)-dehydro-CNE to (S)-CNE (89.3% ee).

Example 5: Reduction of (E)-dehvdro-CNE with E. coli cells expressing

recombinant OPR1 Reductase (Tomato) and NADPH or NADH

E. coli cells expressing recombinant OPR1 reductase (tomato) were tested for reduction of (E)-dehydro-CNE with added cofactor (NADPH or NADH) or without added cofactor. Three separate reactions were setup with E. coli cells expressing OPR1 reductase (40 mg wet cells prepared as described in example 1 ), 100 mM potassium phosphate buffer (0.5 ml, pH 7), (E)-dehydro-CNE (3.6 mg) and either NADPH (15.7 mg, reaction A), NADH (14.2 mg, reaction B), or no added cofactor (reaction C). The reactions were incubated at 30°C for 45 h and then extracted with MTBE. GC analysis (Chiraldex™ G-TA column, method described in example 2) of the MTBE extracts gave the results summarized in Table 3.

TABLE 3

(S)-CNE

Entry Cofactor Added % Conversion % ee

Reaction A NADPH 82.9 100

Reaction B NADH 84.4 100

Reaction C none 19.6 100

Example 6: Reduction of (E)-dehvdro-CNE with E. coli cells expressing

recombinant OPR1 Reductase (Tomato)

A glass-jacketed reaction vessel maintained at 30°C was charged with 100 mM potassium phosphate buffer (14.6 ml, pH 7.0), E. coli cells expressing OPR1 reductase (1 .6 g wet cells prepared as described in example 1 ), NADP⁺ (0.0126 g), glucose dehydrogenase (0.02 g, CDX901 , Codexis), glucose (0.288 g), and (E)- dehydro-CNE (0.145 g). The reaction mixture was stirred and pH was maintained at 7 by addition of aqueous 1 N sodium hydroxide. After 32 h, the reaction mixture was centrifuged to remove the cells and the supernatant was extracted with MTBE.

Concentration of the MTBE extract under vacuum gave 60 mg (40.9% yield) of (S)- CNE. GC analysis of the product on a Chiraldex-GTA column indicated an enantiomeric purity of 100% ee for the (S)-isomer.

Example 7: Reduction of (E)-dehvdro-CNE with E. coli cells expressing

recombinant OPR1 Reductase (Tomato)

A glass-jacketed reaction vessel maintained at 30°C was charged with 100 mM potassium phosphate buffer (21 .3 ml, pH 7.0), E. coli cells expressing OPR1 reductase (2.5 g wet cells prepared as described in example 1 ), NADP⁺ (0.071 g), glucose dehydrogenase (0.025 g, CDX901 , Codexis), glucose (1 .6 g), ethanol (0.75 ml), and (E)-dehydro-CNE (0.453 g). The reaction mixture was stirred and pH was maintained at 7 by addition of aqueous 1 N sodium hydroxide. Additional charges of E. coli cells (0.25 g), NADP⁺ (14 mg), glucose dehydrogenase (7 mg), and glucose (0.315 g) were made to the reaction vessel after 48 h. After 72 h, the reaction mixture was extracted with MTBE. Concentration of the MTBE extract under vacuum gave 0.323 g (70.5% yield) of (S)-CNE. GC analysis of the product on a Chiraldex-GTA column indicated an enantiomeric purity of 100% ee for the (S)- isomer.

Example 8: (S)-Preqabalin

A solution of 50% KOH (95.6mL/144g, 1 .288 mol) and water (7ml_) was added to a mixture of (S)-CNE oil (206g) in water (97.4ml_) over 2hrs. The temperature was kept at <25°C throughout the addition_. The reaction mixture was then stirred at this temperature for 4hrs to give a solution of potassium (S)-3-cyano-5-methyl hexanoate.

Raney Nickel catalyst slurry (10.5g active) was charged to a hydrogenator and water (55.13ml_) was used to wash in the residual catalyst. The solution of potassium (S)-3-cyano-5-methyl hexanoate was charged to the hydrogenator and water

(97.56ml_) was used to wash in the residual solution. The reaction mixture was hydrogenated at 30°C under a hydrogen pressure of 4.0 barg until hydrogen uptake had ceased. On completion of hydrogenation, the batch was filtered and washed with DIW (87.20ml_) to give a solution of Pregabalin potassium salt.

The solution of Pregabalin potassium salt was heated to 35°C, and ethanol (144ml_) was charged to the batch. Acetic acid (22ml) was added to the batch over 45 minutes after which the batch was then seeded (optional) with Pregabalin API. The batch was then held until nucleation had stopped after which the acetic acid addition was continued to final pH of 7.5. The batch was cooled to 0-5°C and isolated. The cake was washed with a solution of 50:50 ethanol : water (4 volumes vs. CNE). The batch was dried in the oven at <55°C for 16 hours to give Pregabalin API in 81 % yield ex. S-CNE.

SEQUENCE LISTING

<110> Burrell, Adam

Martinez, Carlos

McDaid, Paul

O'Neill, Padraig

Wong, John

<120> Process

<130> PC71709

<150> US 61/375,952

<151> 2010-08-23

<160> 2

<170> Patentln version 3.3

<210> 1

<211> 376

<212> PRT

<213> Lycopersicon esculentum

<400> 1

Met Glu Asn Lys Val Val Glu Glu Lys Gin Val Asp Lys lie Pro Leu 1 5 10 15

Met Ser Pro Cys Lys Met Gly Lys Phe Glu Leu Cys His Arg Val Val

20 25 30 Leu Ala Pro Leu Thr Arg Gin Arg Ser Tyr Gly Tyr lie Pro Gin Pro

35 40 45

His Ala lie Leu His Tyr Ser Gin Arg Ser Thr Asn Gly Gly Leu Leu 50 55 60 lie Gly Glu Ala Thr Val lie Ser Glu Thr Gly lie Gly Tyr Lys Asp 65 70 75 80

Val Pro Gly lie Trp Thr Lys Glu Gin Val Glu Ala Trp Lys Pro lie

85 90 95

Val Asp Ala Val His Ala Lys Gly Gly lie Phe Phe Cys Gin lie Trp

100 105 110 His Val Gly Arg Val Ser Asn Lys Asp Phe Gin Pro Asn Gly Glu Asp

115 120 125 Pro He Ser Cys Thr Asp Arg Gly Leu Thr Pro Gin He Arg Ser Asn 130 135 140

Gly He Asp He Ala His Phe Thr Arg Pro Arg Arg Leu Thr Thr Asp 145 150 155 160

Glu He Pro Gin He Val Asn Glu Phe Arg Val Ala Ala Arg Asn Ala

165 170 175

He Glu Ala Gly Phe Asp Gly Val Glu He His Gly Ala His Gly Ty

180 185 190

Leu He Asp Gin Phe Met Lys Asp Gin Val Asn Asp Arg Ser Asp Lys

195 200 205

Tyr Gly Gly Ser Leu Glu Asn Arg Cys Arg Phe Ala Leu Glu He Val 210 215 220

Glu Ala Val Ala Asn Glu He Gly Ser Asp Arg Val Gly He Arg He 225 230 235 240

Ser Pro Phe Ala His Tyr Asn Glu Ala Gly Asp Thr Asn Pro Thr Ala

245 250 255

Leu Gly Leu Tyr Met Val Glu Ser Leu Asn Lys Tyr Asp Leu Ala Tyr

260 265 270

Cys His Val Val Glu Pro Arg Met Lys Thr Ala Trp Glu Lys He Glu

275 280 285

Cys Thr Glu Ser Leu Val Pro Met Arg Lys Ala Tyr Lys Gly Thr Phe 290 295 300

He Val Ala Gly Gly Tyr Asp Arg Glu Asp Gly Asn Arg Ala Leu He 305 310 315 320

Glu Asp Arg Ala Asp Leu Val Ala Tyr Gly Arg Leu Phe He Ser Asn

325 330 335

Pro Asp Leu Pro Lys Arg Phe Glu Leu Asn Ala Pro Leu Asn Lys Tyr

340 345 350 Asn Arg Asp Thr Phe Tyr Thr Ser Asp Pro lie Val Gly Tyr Thr Asp 355 360 365

Pro Phe Leu Glu Thr Met Thr

370 375

<210> 2

<211> 1134

<212> DNA

<213> Lycopersicon esculentum

<400> 2

atggaaaaca aagttgtgga agaaaaacag gttgataaaa tcccgctgat gagcccgtgt 60

aaaatgggta aattcgagct gtgtcatcgc gttgtactgg caccgctgac tcgtcagcgt 120

tcttatggtt acattccgca gccgcacgca atcctgcatt actctcagcg cagcaccaac 180

ggtggcctgc tgatcggtga agcaaccgtg atcagcgaaa ctggcatcgg ttacaaagat 240

gtgccgggta tctggacgaa agagcaggtt gaggcctgga aaccgatcgt cgacgcggtg 300

catgccaaag gtggtatttt cttttgtcag atctggcacg ttggtcgtgt atccaacaaa 360

gattttcagc cgaacggcga agatccgatt tcctgtactg accgcggcct gaccccgcag 420

atccgttcca acggcattga cattgcccac ttcacccgtc cacgtcgcct gactactgac 480

gagattccgc agatcgtgaa cgagttccgc gttgcagcgc gtaatgctat tgaagcgggt 540

ttcgatggcg tcgagattca tggtgcccac ggttacctga tcgaccaatt catgaaagac 600

caagttaacg accgcagcga taagtatggc ggttctctgg agaaccgttg tcgcttcgcg 660

ctggaaatcg ttgaagcagt agccaacgag attggctccg accgtgttgg tatccgtatc 720

tctccattcg cacactacaa cgaagcgggc gacactaacc cgaccgcact gggcctgtat 780

atggtggaga gcctgaataa atacgacctg gcgtattgtc acgtggtcga gccgcgcatg 840 aaaaccgcct gggaaaagat tgagtgcacc gaaagcctgg tgccgatgcg taaagcctac 900

aaaggcacct tcatcgtagc tggtggctac gaccgtgaag acggtaaccg cgctctgatc 960

gaagaccgtg ccgacctggt tgcgtacggt cgtctgttca tcagcaaccc agacctgccg 1020

aagcgttttg aactgaacgc tccgctgaac aaatacaacc gtgacacttt ctacacttcc 1080

gacccgatcg ttggttacac cgattacccg tttctggaaa ctatgactta ataa 1134

Claims

CLAIMS:

A process for preparing a compound of formula (I)

wherein R¹ is selected from hydrogen, Ci-C-i₂-alkyl, C3-C₁₂ cycloalkyl, aryl- Ci-C6-alkyl and aryl, said alkyl, cycloalkyl and aryl being optionally substituted by one or more groups selected from halo, C-i-C6-alkoxy and tri(Ci-C₃-alkyl)silyl,

comprising the steps of:

a) preparing a compound of formula (I la) or (Mb)

(Ma) (lib)

or a mixture thereof, wherein R¹ is as defined for the compound of formula (I) and

b) treating the compound of formula (I la) or (Mb), or the mixture of

compounds, with a suitable reducing agent in the presence of an enoate reductase enzyme.

2. The process according to claim 1 wherein R¹ is selected from Ci-Ci₂-alkyl and benzyl.

3. The process according to claim 2 wherein R¹ is selected from C-i-C -alkyl.

4. The process according to claim 3 wherein R¹ is ethyl. The process according to any one of claims 1 to 4 wherein the enoate reductase enzyme is Lycopersicon esculentum 12-Oxophytodienoate Reductase 1 .

A process for preparing pregabalin (III)

comprising the steps of: a) preparing a compound of formula (lla) or (Mb)

(lla) (lib)

or a mixture thereof, wherein R¹ is selected from hydrogen, Ci-Ci2-alkyl, C3 C12 cycloalkyi, aryl-C-i -C₆-alkyl and aryl, said alkyl, cycloalkyi and aryl being optionally substituted by one or more groups selected from halo, C-i-C₆- alkoxy and tri(Ci-C3-alkyl)silyl; b) treating the compound of formula (lla) or (Mb), or the mixture of compounds, with a suitable reducing agent in the presence of an enoate reductase enzyme to provide a compound of formula (I)

(I)

wherein R¹ is as defined for the compound of formula (lla) and (Mb); and c) converting the compound of formula (I) into pregabalin. The process according to claim 6 wherein R¹ is selected from Ci -Ci2-alkyl and benzyl.

The process according to claim 7 wherein R¹ is selected from C-i-C₄-alkyl.

The process according to claim 8 wherein R¹ is ethyl.

The process according to any one of claims 6 to 9 wherein the enoate reductase enzyme is Lycopersicon esculentum 12-Oxophytodienoate

Reductase 1 .

A compound of formula (I la) or (Mb)

(Ma) (lib)

or a mixture thereof, wherein R¹ is selected from hydrogen, Ci-Ci2-alkyl, C3- C12 cycloalkyl, aryl-Ci -C₆-alkyl and aryl, said alkyl, cycloalkyl and aryl being optionally substituted by one or more groups selected from halo, C-i-C₆- alkoxy and tri(Ci-C3-alkyl)silyl.

The compound of formula (I la) or (Mb) or mixture thereof according to cla 1 1 , wherein R¹ is ethyl.

13. A process for preparing a compound of formula (I la) or (Mb) or mixture thereof according to claim 1 1 or 12, comprising the steps of:

a) preparing a compound of formula (IV)

(IV)

wherein R¹ is as defined in claim 1 1 or 12; b) treating the compound of formula (IV) with trifluoromethanesulfonic anhydride in the presence of a base to obtain a compound of formula (Va) or

(Vb)

(Va) (Vb) or a mixture thereof; and c) reacting the compound of formula (Va) or (Vb), or the mixture thereof, with a suitable cyanide source.

14. A process for preparing a compound of formula (I la) or (Mb) or mixture thereof according to claim 1 1 or 12, comprising the steps of:

a) preparing a compound of formula (VI)

(VI)

wherein R¹ is as defined in claim 1 1 or 12; b) treating the compound of formula (VI) with bromine to obtain a compound of formula (VII)

(VII) c) reacting the compound of formula (VII) with a suitable base to provide a compound of formula (VIII)

(VIII)

and

d) reacting the compound of formula (VIII) with a cyanide source to provide a compound of formula (Ma) or (Mb) or mixture thereof.

15. A process for preparing a compound of formula (Ma) or (Mb) or mixture thereof according to claim 1 1 or 12, comprising the steps of:

a) preparing a compound of formula (VI)

(VI)

(VII)

and

c) reacting the compound of formula (VII) with a suitable suitable cyanide source base to provide a compound of formula (Ma) or (Mb) or mixture thereof.

16. A process for preparing a compound of formula (Ma) or (Mb) or mixture thereof according to claim 1 1 or 12, comprising the steps of: a) preparing a compound of formula (IX)

(IX)

or a salt thereof;

(X)

and

c) reacting the compound of formula (X) with a glyoxylic acid ester to provide a compound of formula (lla) or (Mb) or mixture thereof.

A process for preparing a compound of formula (lla) or (Mb) or mixture thereof according to claim 1 1 or 12, comprising the steps of:

a) preparing a compound of formula (XI)

(XI)

and b) treating the compound of formula (XI) with a trialkyi phosphonoacetate in the presence of a to provide a compound of formula (lla) or (Mb) or mixture thereof.