WO2012022723A1 - Reporter mouse for delivery of rnai - Google Patents

Reporter mouse for delivery of rnai Download PDF

Info

Publication number
WO2012022723A1
WO2012022723A1 PCT/EP2011/064049 EP2011064049W WO2012022723A1 WO 2012022723 A1 WO2012022723 A1 WO 2012022723A1 EP 2011064049 W EP2011064049 W EP 2011064049W WO 2012022723 A1 WO2012022723 A1 WO 2012022723A1
Authority
WO
WIPO (PCT)
Prior art keywords
sirna
hsp90
genetic
fluorescent marker
test animal
Prior art date
Application number
PCT/EP2011/064049
Other languages
French (fr)
Inventor
Antonio Iglesias
Original Assignee
F. Hoffmann-La Roche Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by F. Hoffmann-La Roche Ag filed Critical F. Hoffmann-La Roche Ag
Publication of WO2012022723A1 publication Critical patent/WO2012022723A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2207/00—Modified animals
    • A01K2207/05—Animals modified by non-integrating nucleic acids, e.g. antisense, RNAi, morpholino, episomal vector, for non-therapeutic purpose
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/15—Animals comprising multiple alterations of the genome, by transgenesis or homologous recombination, e.g. obtained by cross-breeding
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/20—Animal model comprising regulated expression system
    • A01K2217/203—Animal model comprising inducible/conditional expression system, e.g. hormones, tet
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0393—Animal model comprising a reporter system for screening tests
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/10—Applications; Uses in screening processes
    • C12N2320/11—Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids

Definitions

  • the present invention relates to method for assessing delivery and activity of a small interfering ribonucleic acid (siRNA) to a target tissue comprising a non-human animal reporter system.
  • siRNA small interfering ribonucleic acid
  • RNA interference is a powerful approach for suppressing expression of specific genes in mammalian cells.
  • the use of RNAi is a viable pathway in the development of therapeutically active substances for the treatment of a wide range of diseases.
  • the efficient in vivo delivery of functional therapeutic or diagnostic RNAi agents to a target tissue or cell still remains one of the biggest obstacles in RNAi drug development.
  • a wide variety of different delivery systems have been developed in the recent past, but critical assessment of utility is frequently confounded by the absence of effective systems for evaluation of successful siRNA delivery and activity.
  • siRNA activity or 'pharmacodynamics'
  • Most techniques to assess siRNA activity therefore rely on the nature of the molecular target to be silenced.
  • pharmacodynamics can be assessed by measuring inhibition of enzyme activity in isolated organs, tissues or cells. This approach is highly invasive and does not reflect the body-wide effects of siRNA. In addition, for most of the therapeutic siRNA targets there is no such read-out assay.
  • Transgenic reporter mice or disease models that ubiquitously express reporter genes such as GFP or luciferase can be employed to test the silencing effect of siRNA delivery (Palliser et al, 2006).
  • GFP GFP
  • luciferase reporter genes
  • Transgenic reporter mice or disease models that ubiquitously express reporter genes such as GFP or luciferase can be employed to test the silencing effect of siRNA delivery (Palliser et al, 2006).
  • models generating ubiquitous expression of the target mRNA in a specific organ, i.e. 'negative readout' models suffer from high levels of background with intrinsic poor signal to noise ratio.
  • the inventors of the present invention developed a non-invasive positive-readout animal model for studying siRNA pharmacodynamics in which RNAi activity is reported by expression of a fluorescent marker protein.
  • a fluorescent marker protein a fluorescent marker protein.
  • the new reporter model of this invention it is now possible to detect the action of siRNA in all kinds of tissues, in whole organs or in peripheral blood. On reaching the tissue, the siRNA activates a reporter gene. Activation of the reporter gene is irreversible and persists beyond cell division, thus allowing for easy quantification of siRNA action.
  • This reporter model is a new tool providing important insights into the development of novel siRNA delivery systems and to improve the pipeline of molecules available for therapies.
  • the positive-readout reporter system of the present invention is activated by successful delivery of siRNA targeting the hsp90 repressor protein. Towards this end a nonhuman transgenic test animal is utilized.
  • the genome of the nonhuman transgenic test animal contains two components: a gene encoding a hormone-activated DNA recombinase (CreER) and a reporter gene whose expression is activated by Cre-mediated excision of an inhibitory DNA segment.
  • Cre is the 38-kDa product of the ere (cyclization recombination) gene of bacteriophage PI and is a site-specific DNA recombinase of the Int family.
  • Cre recognizes a 34-bp site on the PI genome called loxP (locus of X-over of PI) and efficiently catalyzes reciprocal conservative DNA recombination between two loxP sites.
  • the loxP site consists of two 13 -bp inverted repeats flanking an 8-bp nonpalindromic core region. Cre-mediated recombination between two directly repeated loxP sites results in excision of the DNA inbetween as a covalently closed circle. Therefore, precise DNA rearrangements and genetic switches can be efficiently generated in a straightforward manner using Cre recombinase.
  • the recombinant CreER recombinase consists of Cre that is fused with a mutated estrogen receptor ligand binding domain (CreER T ).
  • the CreER T modification ensures that Cre is sequestered in the cytoplasm by heat shock protein 90 (Hsp90), thus being kept in an inactive state (R. Feil, J. Brocard, B. Mascrez, M. LeMeur, D. Metzger and P. Chambon, Ligand- activated site-specific recombination in mice, Proc. Natl. Acad. Sci. USA 93 (1996), pp. 10887- 10890.)
  • the second key component used in this approach is a reporter gene whose expression is activated by Cre-mediated excision of an inhibitory DNA segment.
  • This conditional phenotyping allele has the potential to be expressed in all cell types, but is quiescent because of a loxP flanked inhibitory DNA segment, e.g.. a Stop sequence, which precedes the reporter gene.
  • the reporter gene Upon successful delivery of siRNA targeting the hsp90 repressor protein the cellular hsp90 level is decreased and subsequently the inactivation of CreER is released.
  • the active form of CreER mediates intrachromosomal recombination at the lox sites and thus excises the loxP flanked Stop sequence and brings the reporter gene of the phenotyping allele under the control of a constitutive promoter.
  • the reporter gene is now constitutively expressed and thereby labels the cells and all their descendants in a permanent manner.
  • the reporter gene has the potential to be expressed in all cell types, it is now possible with the method of the invention to easily detect siRNA action on different tissues.
  • the reporter gene preferably encodes for a fluorescent marker protein which enables easy readout of the siRNA targeted cells.
  • the loxP flanked inhibitory DNA segment comprises a gene encoding for a second reporter gene and its Stop signal.
  • the transcriptional Stop signals of the second reporter gene prevents expression of an adjacent first reporter gene.
  • said reporter genes encode for fluorescent marker proteins; most preferably said first reporter gene encodes for a first fluorescent marker protein that is easily distinguishable from the second fluorescent marker protein encoded by the second marker protein.
  • said first marker gene encodes for the green fluorescnent marker protein GFP and said second marker gene encodes for the red fluorescent marker protein DsRed.
  • the second reporter gene is constitutively expressed until Cre-mediated excision of the genetic sequence in between the LoxP sites. Upon activation of CreER, said second reporter gene and its transcriptional Stop sequence are removed and said first reporter gene is activated.
  • CreER can also be activated by the synthetic estrogen tamoxifen, as it binds to ER and releases CreER from Hsp90. Hence tamoxifen can be used as a positive control to determine the functionality of the reporter read out system (independently of RNAi).
  • said invention comprises a method for detection of siRNA action in vivo comprising a) administering a siRNA targeting hsp90 to a nonhuman transgenic test animal, wherein the genome of the nonhuman transgenic test animal comprises a sequence coding for a fluorescent marker protein which is under control of a genetic silencer element, wherein the genetic silencer element is flanked by LoxP recognition sites; a sequence coding for a recombinant CreER recombinase, wherein after translation the CreER recombinase is kept in an inactive form by Hsp90 b) measuring a fluorescence signal in the target tissue, wherein the existence of a fluorescence signal is indicative of siRNA action on said tissue.
  • said genetic silencer element flanked by LoxP recognition sites comprises a Stop signal.
  • said genetic silencer element comprises a gene encoding for a second fluorescent protein and its transcriptional Stop signal.
  • said method comprises a) administering a siRNA targeting hsp90 to a nonhuman transgenic test animal, wherein the genome of the nonhuman transgenic test animal comprises a sequence encoding for a first fluorescent marker protein which is under control of a genetic silencer element, wherein said genetic silencer element is flanked by LoxP recognition sites and comprises a sequence encoding for a second fluorescent marker protein and its transcriptional Stop sequence; a sequence coding for a recombinant CreER recombinase, wherein after translation the CreER recombinase is kept in an inactive form by Hsp90 b) measuring a fluorescence signal in the target tissue, wherein the existence of a fluorescence signal of the first fluorescent marker protein is indicative of siRNA
  • the non-human transgenic test animal is a mammal, more preferably a rodent such as rat or a mouse, most preferably, the non-human transgenic animal is a mouse.
  • the fluorescent marker protein is selected from the group GFP, YFP, EGFP, DsRed, EYFP.
  • Other fluorescent marker proteins known in the art can also easily be employed in the method of this invention.
  • the fluorescent signal emitted by the fluorescent marker protein can be detected by measures known in the art.
  • said fluorescence signal is measured by microscopical analysis of histological tissue sections in UV light, most preferably by macroscopical examination of whole organs and tissues under UV light.
  • said fluorescence signal is measured by Fluorescence Activated Cell Sorting (FACS).
  • FACS Fluorescence Activated Cell Sorting
  • the siRNA action is detected on different tissues.
  • the method of the invention can be used for the assessment of successful delivery of the siRNA to various tissues, for example, but not limited to, brain tissue, dermal tissue, cardiac tissue, liver tissue, splenic tissue, thymus tissue, lung tissue, ovarian tissue, testicular tissue, renal tissue or intestinal tissue.
  • the chemically synthesized siRNAs must be able to travel in the bloodstream, escape from digestion by RNAses, and, more importantly, overcome the cell membrane barrier and translocate itself into cells.
  • a wide range of strategies have been evaluated for delivery of siRNA, including hydrodynamic injection, or covalent conjugation of siRNA molecules to cholesterol, to targeting peptides or to antibodies leading to receptor mediated endocytosis. Delivery can also be mediated by siRNA-binding vectors including lipids, cationic polymers and a variety of other carriers. With the present invention it is now possible to test all these strategies and future developments for their efficiency.
  • said method is used to determine the delivery and activity of siRNAs.
  • one aspect of the invention is a method for testing the properties and efficiency of different siRNA delivery strategies.
  • said method is used to determine the delivery and activity of siRNAs formulated with a delivery compound.
  • Said delivery compound comprises chemical conjugates and noncovalent complexes that mediate the transport of a siRNA to its target cell and their entry into cells. These include, but are not limited to small molecules, lipids, polymers, biopolymers, liposomes, cell-targeting ligands such as antibodies, polypeptides, small organic molecules and cell penetrating peptides, for example polycationic peptides.
  • siRNA formulated into a pharmaceutical composition preferably comprises a delivery compound or complex, and a pharmaceutically acceptable carrier, stabilizer or diluent.
  • said method is used for detection of siRNA action in selected tissues.
  • the reporter gene is under control of a tissue-specific promoter, e.g. heart- specific, which is activated through the action of CreER mediated intrachromosomal recombination at the lox sites.
  • said invention comprises a method for detection of siRNA action comprising a) administering a siRNA targeting hsp90 to a cell line of a nonhuman transgenic test animal, wherein the genome of the nonhuman transgenic test animal comprises a sequence coding for a fluorescent marker protein which is under control of a genetic silencer element, wherein the genetic silencer element is flanked by LoxP recognition sites; a sequence coding for a recombinant CreER recombinase, wherein after translation the CreER recombinase is kept in an inactive form by Hsp90 b) measuring a fluorescence signal in the target tissue, wherein the existence of a fluorescence signal is indicative of siRNA action in said cell line.
  • said method comprises a) administering a siRNA targeting hsp90 to a cell line of a nonhuman transgenic test animal, wherein the genome of the nonhuman transgenic test animal comprises a sequence coding for a fluorescent marker protein which is under control of a genetic silencer element, wherein the genetic silencer element is flanked by LoxP recognition sites and comprises a sequence encoding for a second fluorescent marker protein and its transcriptional Stop sequence; a sequence coding for a recombinant CreER recombinase, wherein after translation the CreER recombinase is kept in an inactive form by Hsp90 b) measuring a fluorescence signal in the target tissue, wherein the existence of a fluorescence signal of the first fluorescent marker protein is indicative of siRNA action in said cell line.
  • said first fluorescent marker protein is different from said second fluorescent marker protein.
  • RNA as used herein means an oligomer or polymer composed of nucleotides, e.g., deoxyribonucleotides or ribonucleotides, or compounds produced synthetically (e.g., PNA as described in U.S. Pat. No. 5,948,902 and the references cited therein) which can silence a target gene by hybridizing with naturally occurring nucleic acids in a sequence specific manner.
  • siRNA does not only include double stranded small interfering RNAs (siRNAs) per se but also any other molecule capable of RNA interference. These include but are not limited to: antisense molecules, shRNA, microRNA.
  • the siRNA contains a sequence that is identical or nearly identical to a portion of a gene.
  • RNA may be polymerized in vitro, comprise recombinant RNA or chimeric sequences, or derivatives of these groups.
  • the siRNA may contain ribonucleotides, deoxyribonucleotides, synthetic nucleotides, or any suitable combination such that expression of the target gene is inhibited.
  • the RNA is preferably double stranded, but may be single, triple, or quadruple stranded.
  • An example of a single strand siRNA is an siRNA with a hairpin loop.
  • Oligomers or polymers which contain compounds produced synthetically comprise nucleobase sequences which do not occur in nature or species which contain functional equivalents of naturally occurring nucleobases, sugars, or inter-sugar linkages, like peptide nucleic acids (PNA), threose nucleic acids (TNA), locked nucleic acids (LNA), or glycerol nucleic acids (GNA).
  • PNA peptide nucleic acids
  • TAA threose nucleic acids
  • LNA locked nucleic acids
  • GNA glycerol nucleic acids
  • RNA also includes oligomers that contain the naturally occurring nucleic acid nucleobases adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U), as well as oligomers that contain base analogs or modified nucleobases, such as a 2'-0-methyl modified nucleotide, a nucleotide comprising a 5'-phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group.
  • A adenine
  • G guanine
  • T thymine
  • C cytosine
  • U uracil
  • 2' modified nucleotides may have the additional advantage that certain immuno stimulatory factors or cytokines are suppressed when the siRNA molecules are employed in vivo, for example in a medical setting.
  • the modified nucleotide may be chosen from the group of: a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide.
  • Nucleic acids can derive from a variety of natural sources such as viral, bacterial and eukaryotic DNAs and RNAs. Other nucleic acids can be derived from synthetic sources, and include any of the multiple oligonucleotides that are being manufactured for use as research reagents, diagnostic agents or potential and definite therapeutic agents.
  • the term "siRNA” includes oligomers comprising of a single strand nucleic acid or a double strand nucleic acid.
  • RNA targeting hsp90 means an oligomer or polymer composed of nucleotides, e.g., deoxyribonucleotides or ribonucleotides, or compounds produced synthetically that can inhibit the expression of heatshock protein hsp90 in a target cell.
  • Hsp90 refers to heatshock protein 90 including all homologues, for example hsp90 alpha (depicted as hsp90 a herein) and hsp 90 beta (depicted as hsp90 b herein).
  • siRNA action means the physiological effects of siRNA in vivo, i.e. the inhibition of the expression of a target gene after successful delivery of the siRNA into a target cell.
  • expression refers to the process by which a nucleic acid is transcribed into mRNA and/or to the process by which the transcribed mRNA (also referred to as transcript) is subsequently being translated into peptides, polypeptides, or proteins.
  • the transcripts and the encoded polypeptides are collectively referred to as gene product. If the polynucleotide is derived from genomic DNA, expression in a eukaryotic cell may include splicing of the mRNA.
  • fluorescent marker protein as used herein includes but is not limited to green fluorescent protein (GFP), enhanced GFP (EGFP), Discosoma sp.
  • Red fluorescent protein DsRed
  • YFP yellow fluorescent protein
  • EYFP enhanced YFP
  • any other naturally occurring or modified chromophore See, for example: Fluorescent proteins: a cell biologist's user guide. E.L.Snapp Trends in Cell Biology - 1 November 2009 (Vol. 19, Issue 11, pp. 649- 655)).
  • Non-human test animal as used herein means any non-human test animal, preferably a mammal, most preferably a rodent such as a mouse or a rat.
  • the genome of the non-human test animals comprise transgenic DNA sequences which are integrated in all or a portion of the animal's cells. The integration into the genome is stable.
  • the transgenic proteins may be ubiquitary expressed or only expressed in certain tissues.
  • administering means to administer a siRNA to a nonhuman test animal by any mode of administration known to a person skilled in the art, or by any method in combination with other known techniques, for example enteral, oral and topical administration, as well as parenteral administration, usually by injection, which includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion.
  • delivery reagent or “delivery compound” as used herein, means a compound or compounds that bind(s) to or complex(es) with siRNA molecules and mediates their entry into cells without affecting the activity of the siRNA.
  • siRNA molecules include chemical conjugates, such as small molecules, carbohydrates, peptide-mediated delivery, antibodies and proteins and noncovalent complexes, for example viral delivery systems, liposomes, nanoparticles, cationic polymer complexes, polymeric micelles and lipoplexes.
  • delivery reagents include cationic liposomes and lipids, calcium phosphate precipitates, rechargeable particles and polylysine complexes. Typically, the delivery reagent has a net positive charge that binds to the siRNA's negative charge.
  • Other delivery reagents used for siRNA delivery include but are not limited to conjugates such as small molecules, antibodies, peptides, proteins and carbohydrates as well as vehicles like lipids, polymers and biopolymers.
  • delivery system hence comprises all means for the delivery of active siRNA molecules into a cell.
  • pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible.
  • the carrier is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g. by injection or infusion).
  • Pharmaceutical carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. The use of such media and agents for pharmaceutically active substances is known in the art.
  • formulated and “formulation” means the admixing, encapsulating, conjugating or otherwise association of the siRNA with molecules, molecule structures or mixtures of compounds.
  • formulations are the formulation of the siRNA with a delivery compound and/ or a pharmaceutically acceptable carrier.
  • gene “genetic silencer element” refers to a regulatory nucleotide sequence that inhibits the genetic transcription of a given gene by inhibiting the activity of the nearest promoter on the same DNA molecule.
  • An example of a genetic silener element is a "Stop signal”.
  • transla ⁇ ion stop signal refers to the genetic code, which contains three eodoti triplets (UAA, UAG, UGA) for terminating the polypeptide chain production during protein synthesis in a ribosorae. In a DNA strand the corresponding stop signal triplets are TAA, TAG and TGA.
  • promoter refers region of gene that binds RNA polymerase and transcription factors to initiate transcription.
  • recombinant CreER recombinase refers to a recombinant protein wherein the mutated form of the ligand-binding domain of an estrogen receptor (ER) is fused to the Cre recombinase, essentially as described in the literature (R. Feil, J. Brocard, B. Mascrez, M. LeMeur, D. Metzger and P. Chambon, Ligand-activated site-specific recombination in mice, Proc. Natl. Acad. Sci. USA 93 (1996), pp. 10887-10890; A.K. Indra, X. Warot, J. Brocard, J.-M. Bornert, J.-H. Xiao, P.
  • Figure 1 Relative reduction of Hsp90a mRNA in NIH-3T3 cells after transduction with recombinant adenovirus expressing shRNA sequences inhibitory for Hsp90a.
  • Ctrl Hsp90a mRNA level of cells transduced with empty control vector (left panel).
  • Ctrl Hsp90b mRNA level of cells transduced with empty control vector (right panel).
  • FIG. 2 Relative reduction of Hsp90a protein levels in NIH-3T3 cells after transduction with recombinant adenovirus expressing shRNA sequences inhibitory for Hsp90a.
  • Control Hsp90a protein level of cells transduced with empty control vector (upper panel)
  • Control Hsp90b protein level of cells transduced with empty control vector (lower panel).
  • Figure 3 - (DsRedEGFPxCreER) double transgenic mice were either treated with scrambled shRNA (upper panel) or a Hsp90a/Hsp90b shRNA mixture encoded on adenoviruses and fluorescence of organs and tissues determined macroscopic ally after 7 days.
  • FIG. 4 GFP and Dsred expression of (DsRedEGFPxCreER) double transgenic mice treated with the Hsp90a/Hsp90b shRNA mix detected by FACS analysis in peripheral blood cells.
  • PI and P2 detailed analysis of myeloid and lymphoid blood cell populations.
  • Y-axis log green fluorescence intensity
  • x- axis log red fluorescence intensity.
  • FIG. 5 GFP and DsRed expression of (DsRedEGFPxCreER) double transgenic mice treated with the scrambled shRNA (upper panel) and Hsp90a/Hsp90b shRNA mix (lower panel) detected by FACS analysis of spleen tissue.
  • the markers corresponding to the populations of blood cells analyzed are CD19 for B cells and CD3 for T-cells.
  • FIG. 6 GFP and DsRed expression of (DsRedEGFPxCreER) double transgenic mice treated with the scrambled shRNA (upper panel) and Hsp90a/Hsp90b shRNA mix (lower panel) detected by FACS analysis of spleen tissue.
  • the markers corresponding to the populations of blood cells analyzed are NKl-1 for natural killer cells and Cdl lb (abbreviated as 1 lb) for monocytes and macrophages.
  • FIG. 7 GFP expression and DsRed of (DsRedEGFPxCreER) double transgenic mice treated with the scrambled shRNA (upper panel) and Hsp90a/Hsp90b shRNA mix (lower panel) detected by FACS analysis of bone marrow.
  • the markers corresponding to the populations of blood cells analyzed are CD 19 for B cells and CD3 for T- cells.
  • FIG 8 GFP expression and DsRed of (DsRedEGFPxCreER) double transgenic mice treated with the scrambled shRNA (upper panel) and Hsp90a/Hsp90b shRNA mix (lower panel) detected by FACS analysis of bone marrow.
  • the markers corresponding to the populations of blood cells analyzed are NKl-1 for natural killer cells and Cdl lb (abbreviated as 1 lb) for monocytes and macrophages.
  • FIG. 9 Schematic drawing of the selectable marker gene under control of a genetic silencer.
  • the selectable marker gene here EYFP
  • EYFP The selectable marker gene
  • a) The selectable marker gene is under control of a Stop sequence flanked by two LoxP sites. EYFP is not expressed (no fluorescence signal).
  • the selectable marker gene Upon Cre-mediated excision of the Stop sequence the selectable marker gene is activated, which in case of EYFP is detectable as yellow fluorescence signal
  • the selectable marker gene (here EGFP) is preceded by a gene encoding a second fluorescent protein (here DsREd) and its transcriptional Stop sequence flanked by two LoxP sites.
  • the second fluorescent protein is constitutively expressed and its Stop sequence silences the gene encoding for the first fluorescent protein.
  • Cre-mediated excision of the second fluorescent protein and its Stop sequence the selectable marker gene is activated, which results in a switch of the fluorescence signal from red to green. Examples
  • the two transgenic systems proposed here are each composed of two transgenic modules:
  • the first transgenic module is C57BL/6-Gt(ROSA)26Sortm9(cre/Esrl)Arte (termed thereafter ROSA-CreER Deleter, for simplicity) a transgene encoding the Cre-recombinase fused at its carboxy-terminal end to the mutant estrogen receptor ER.
  • the ER domain no longer binds estrogen and instead binds the estrogen antagonist 4-hydroxytamoxifen (Tamoxifen).
  • the chimeric CreER protein is complexed with the heat shock protein HSP90, and retained in an inactive conformation.
  • CreER Upon exposure to Tamoxifen, CreER is released from the complex with HSP90 and acquires an active conformation that can recombine and excise DNA sequences flanked by LoxP elements. In the absence of Tamoxifen the Cre recombinase activity is not detectable.
  • the second transgene is the s/B6.C3-Tg(CAG- DsRed,EGFP)5GaeJ reporter transgene (termed thereafter Tg(Red-Stop-EGFP), for simplicity).
  • a series of double transgenic mice bearing the ROSA-CreER Deleter and the Tg(Red- Stop-EGFP reporter transgene provide a system to study the siRNA-mediated activation of an independent fluorescence gene.
  • the reporter gene (DsRed) is constructed such that its transcriptional stop signals prevent expression of the adjacent EGFP gene.
  • these transgenic mice express constitutively red fluorescence but not the attached green EGFP. Since the DsRed gene, including its stop signal is flanked by LoxP elements, their Cre recombinase- mediated removal not only abolish red fluorescence but also automatically leads to activation of the EGFP gene and to green fluorescence.
  • mice thus provide a system apt to evaluate the dynamic process of cre-mediated activation of the reporter EGFP gene during the siRNA treatment. In addition it permits the quantification of the siRNA effects under the conditions of alternative fluorescence measurements.
  • Gt(ROSA)26Sortml(EYFP)Cos/J bears a transgene encoding the enhanced YFP (EYFP) fluorochrome gene in a silent state due to transcription stop signals placed in front of the coding region.
  • the stop signals are flanked by loxP elements and this so-called Floxed-Stop/YGFP gene was inserted into the ROSA26 locus of the mouse via gene-targeting (S. Srivinas, T. Watanabe, C.-S. Lin, C. M. William, Y. Tanabe, T. M. Jessel and F.
  • Double transgenic mice bearing the ROSA-Stop-EYFP reporter, and the ROSA-CreER Deleter knock-in transgenes provide another adequate system to study siRNA delivery.
  • the rational hereto is that application of siRNA specific for HSP90 will lead to (at least transient) reduction of HSP90 levels that in turn will cause conformational activation of CreER recombinase proteins.
  • the subsequent recombination excision of the floxed Stop signals in the ROSA-Stop-EYFP reporter transgene will trigger expression of EYFP and thus flag the cells affected and their progeny as fluorescence positive indicators of successful siRNA delivery.
  • activation of CreER can also be achieved by the application of Tamoxifen. Therefore, Tamoxifen-induced EYFP expression can be used in this double transgenic system both to validate this transgenic system and to quantify the extent of YGFP expression upon siRNA delivery.
  • Hsp90a CCCAATCACATTCTGCTTTAA (Seq ID No. 1)
  • Hsp90b CTCCGCGAGTTGATCTCTAAT (Seq ID No 2)
  • mice are monitored daily during one week for expression of EGFP in different organs and tissues.
  • One week after treatment blood samples were analyzed by FACS for EGFP expresion.
  • Two weeks after treatment organs were surveyed optically for green fluorescence and single cell suspensions of spleen and bone marrow were analyzed by FACS for EGFP expression.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Veterinary Medicine (AREA)
  • Environmental Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to method for assessing delivery and activity of a small interfering ribonucleic acid (siRNA) to a target tissue comprising a non-human animal reporter system comprising a positive read-out system.

Description

REPORTER MOUSE FOR DELIVERY OF RNAI
The present invention relates to method for assessing delivery and activity of a small interfering ribonucleic acid (siRNA) to a target tissue comprising a non-human animal reporter system.
RNA interference (RNAi) is a powerful approach for suppressing expression of specific genes in mammalian cells. The use of RNAi is a viable pathway in the development of therapeutically active substances for the treatment of a wide range of diseases. The efficient in vivo delivery of functional therapeutic or diagnostic RNAi agents to a target tissue or cell still remains one of the biggest obstacles in RNAi drug development. A wide variety of different delivery systems have been developed in the recent past, but critical assessment of utility is frequently confounded by the absence of effective systems for evaluation of successful siRNA delivery and activity.
Since silencing of genes through the action of siRNA is crucially dependent on transfer through the cell membrane, anatomical biodistribution of siRNA is not a good indicator of biological activity. Most techniques to assess siRNA activity (or 'pharmacodynamics') therefore rely on the nature of the molecular target to be silenced. For example when the siRNA targets mRNA encoding specific enzymes, pharmacodynamics can be assessed by measuring inhibition of enzyme activity in isolated organs, tissues or cells. This approach is highly invasive and does not reflect the body-wide effects of siRNA. In addition, for most of the therapeutic siRNA targets there is no such read-out assay. Transgenic reporter mice or disease models that ubiquitously express reporter genes such as GFP or luciferase, can be employed to test the silencing effect of siRNA delivery (Palliser et al, 2006). However, such systems are not ideal since models generating ubiquitous expression of the target mRNA in a specific organ, i.e. 'negative readout' models, suffer from high levels of background with intrinsic poor signal to noise ratio.
Therefore there is a need for an animal model that reveals successful siRNA delivery and activity. The inventors of the present invention developed a non-invasive positive-readout animal model for studying siRNA pharmacodynamics in which RNAi activity is reported by expression of a fluorescent marker protein. With the new reporter model of this invention it is now possible to detect the action of siRNA in all kinds of tissues, in whole organs or in peripheral blood. On reaching the tissue, the siRNA activates a reporter gene. Activation of the reporter gene is irreversible and persists beyond cell division, thus allowing for easy quantification of siRNA action. This reporter model is a new tool providing important insights into the development of novel siRNA delivery systems and to improve the pipeline of molecules available for therapies. Positive readout yields better signal/noise ratios than existing negative-readout systems. The positive-readout reporter system of the present invention is activated by successful delivery of siRNA targeting the hsp90 repressor protein. Towards this end a nonhuman transgenic test animal is utilized. The genome of the nonhuman transgenic test animal contains two components: a gene encoding a hormone-activated DNA recombinase (CreER) and a reporter gene whose expression is activated by Cre-mediated excision of an inhibitory DNA segment. Cre is the 38-kDa product of the ere (cyclization recombination) gene of bacteriophage PI and is a site-specific DNA recombinase of the Int family. Cre recognizes a 34-bp site on the PI genome called loxP (locus of X-over of PI) and efficiently catalyzes reciprocal conservative DNA recombination between two loxP sites. The loxP site consists of two 13 -bp inverted repeats flanking an 8-bp nonpalindromic core region. Cre-mediated recombination between two directly repeated loxP sites results in excision of the DNA inbetween as a covalently closed circle. Therefore, precise DNA rearrangements and genetic switches can be efficiently generated in a straightforward manner using Cre recombinase.
The recombinant CreER recombinase consists of Cre that is fused with a mutated estrogen receptor ligand binding domain (CreER T ). The CreER T modification ensures that Cre is sequestered in the cytoplasm by heat shock protein 90 (Hsp90), thus being kept in an inactive state (R. Feil, J. Brocard, B. Mascrez, M. LeMeur, D. Metzger and P. Chambon, Ligand- activated site-specific recombination in mice, Proc. Natl. Acad. Sci. USA 93 (1996), pp. 10887- 10890.)
The second key component used in this approach is a reporter gene whose expression is activated by Cre-mediated excision of an inhibitory DNA segment. This conditional phenotyping allele has the potential to be expressed in all cell types, but is quiescent because of a loxP flanked inhibitory DNA segment, e.g.. a Stop sequence, which precedes the reporter gene.
Upon successful delivery of siRNA targeting the hsp90 repressor protein the cellular hsp90 level is decreased and subsequently the inactivation of CreER is released. The active form of CreER mediates intrachromosomal recombination at the lox sites and thus excises the loxP flanked Stop sequence and brings the reporter gene of the phenotyping allele under the control of a constitutive promoter. The reporter gene is now constitutively expressed and thereby labels the cells and all their descendants in a permanent manner. As the reporter gene has the potential to be expressed in all cell types, it is now possible with the method of the invention to easily detect siRNA action on different tissues. In the present invention the reporter gene preferably encodes for a fluorescent marker protein which enables easy readout of the siRNA targeted cells.
In another preferred aspect of the invention, the loxP flanked inhibitory DNA segment comprises a gene encoding for a second reporter gene and its Stop signal. The transcriptional Stop signals of the second reporter gene prevents expression of an adjacent first reporter gene. Preferably said reporter genes encode for fluorescent marker proteins; most preferably said first reporter gene encodes for a first fluorescent marker protein that is easily distinguishable from the second fluorescent marker protein encoded by the second marker protein. For example, said first marker gene encodes for the green fluorescnent marker protein GFP and said second marker gene encodes for the red fluorescent marker protein DsRed.
The second reporter gene is constitutively expressed until Cre-mediated excision of the genetic sequence in between the LoxP sites. Upon activation of CreER, said second reporter gene and its transcriptional Stop sequence are removed and said first reporter gene is activated.
CreER can also be activated by the synthetic estrogen tamoxifen, as it binds to ER and releases CreER from Hsp90. Hence tamoxifen can be used as a positive control to determine the functionality of the reporter read out system (independently of RNAi).
In the first object said invention comprises a method for detection of siRNA action in vivo comprising a) administering a siRNA targeting hsp90 to a nonhuman transgenic test animal, wherein the genome of the nonhuman transgenic test animal comprises a sequence coding for a fluorescent marker protein which is under control of a genetic silencer element, wherein the genetic silencer element is flanked by LoxP recognition sites; a sequence coding for a recombinant CreER recombinase, wherein after translation the CreER recombinase is kept in an inactive form by Hsp90 b) measuring a fluorescence signal in the target tissue, wherein the existence of a fluorescence signal is indicative of siRNA action on said tissue.
In one embodiment of the invention, said genetic silencer element flanked by LoxP recognition sites comprises a Stop signal. In another embodiment said genetic silencer element comprises a gene encoding for a second fluorescent protein and its transcriptional Stop signal. Hence in one embodiment of the invention, said method comprises a) administering a siRNA targeting hsp90 to a nonhuman transgenic test animal, wherein the genome of the nonhuman transgenic test animal comprises a sequence encoding for a first fluorescent marker protein which is under control of a genetic silencer element, wherein said genetic silencer element is flanked by LoxP recognition sites and comprises a sequence encoding for a second fluorescent marker protein and its transcriptional Stop sequence; a sequence coding for a recombinant CreER recombinase, wherein after translation the CreER recombinase is kept in an inactive form by Hsp90 b) measuring a fluorescence signal in the target tissue, wherein the existence of a fluorescence signal of the first fluorescent marker protein is indicative of siRNA action on said tissue.
Preferably said first fluorescent marker protein is different from said second fluorescent marker protein. Preferably, the non-human transgenic test animal is a mammal, more preferably a rodent such as rat or a mouse, most preferably, the non-human transgenic animal is a mouse.
Preferably the fluorescent marker protein is selected from the group GFP, YFP, EGFP, DsRed, EYFP. Other fluorescent marker proteins known in the art can also easily be employed in the method of this invention. The fluorescent signal emitted by the fluorescent marker protein can be detected by measures known in the art. In a preferred embodiment said fluorescence signal is measured by microscopical analysis of histological tissue sections in UV light, most preferably by macroscopical examination of whole organs and tissues under UV light. In another embodiment said fluorescence signal is measured by Fluorescence Activated Cell Sorting (FACS). Preferred herein is the measurement of fluorescence in peripheral blood, spleen and bone marrow.
In one preferred embodiment the siRNA action is detected on different tissues. Hence the method of the invention can be used for the assessment of successful delivery of the siRNA to various tissues, for example, but not limited to, brain tissue, dermal tissue, cardiac tissue, liver tissue, splenic tissue, thymus tissue, lung tissue, ovarian tissue, testicular tissue, renal tissue or intestinal tissue. For drug development, the chemically synthesized siRNAs must be able to travel in the bloodstream, escape from digestion by RNAses, and, more importantly, overcome the cell membrane barrier and translocate itself into cells. A wide range of strategies have been evaluated for delivery of siRNA, including hydrodynamic injection, or covalent conjugation of siRNA molecules to cholesterol, to targeting peptides or to antibodies leading to receptor mediated endocytosis. Delivery can also be mediated by siRNA-binding vectors including lipids, cationic polymers and a variety of other carriers. With the present invention it is now possible to test all these strategies and future developments for their efficiency.
In one preferred embodiment said method is used to determine the delivery and activity of siRNAs. Hence one aspect of the invention is a method for testing the properties and efficiency of different siRNA delivery strategies.
In one preferred embodiment said method is used to determine the delivery and activity of siRNAs formulated with a delivery compound. Said delivery compound comprises chemical conjugates and noncovalent complexes that mediate the transport of a siRNA to its target cell and their entry into cells. These include, but are not limited to small molecules, lipids, polymers, biopolymers, liposomes, cell-targeting ligands such as antibodies, polypeptides, small organic molecules and cell penetrating peptides, for example polycationic peptides.
In other embodiments the activity of siRNA formulated into a pharmaceutical composition is tested with this method. Said pharmaceutical composition preferably comprises a delivery compound or complex, and a pharmaceutically acceptable carrier, stabilizer or diluent.
In addition the impact of the route of administration on the efficiency of the delivery and activity of siRNAs administered by different routes can be assessed with this method.
In another embodiment said method is used for detection of siRNA action in selected tissues. In this embodiment the reporter gene is under control of a tissue-specific promoter, e.g. heart- specific, which is activated through the action of CreER mediated intrachromosomal recombination at the lox sites.
In yet another embodiment said invention comprises a method for detection of siRNA action comprising a) administering a siRNA targeting hsp90 to a cell line of a nonhuman transgenic test animal, wherein the genome of the nonhuman transgenic test animal comprises a sequence coding for a fluorescent marker protein which is under control of a genetic silencer element, wherein the genetic silencer element is flanked by LoxP recognition sites; a sequence coding for a recombinant CreER recombinase, wherein after translation the CreER recombinase is kept in an inactive form by Hsp90 b) measuring a fluorescence signal in the target tissue, wherein the existence of a fluorescence signal is indicative of siRNA action in said cell line. In another embodiment of the invention, said method comprises a) administering a siRNA targeting hsp90 to a cell line of a nonhuman transgenic test animal, wherein the genome of the nonhuman transgenic test animal comprises a sequence coding for a fluorescent marker protein which is under control of a genetic silencer element, wherein the genetic silencer element is flanked by LoxP recognition sites and comprises a sequence encoding for a second fluorescent marker protein and its transcriptional Stop sequence; a sequence coding for a recombinant CreER recombinase, wherein after translation the CreER recombinase is kept in an inactive form by Hsp90 b) measuring a fluorescence signal in the target tissue, wherein the existence of a fluorescence signal of the first fluorescent marker protein is indicative of siRNA action in said cell line.
Preferably said first fluorescent marker protein is different from said second fluorescent marker protein.
Definitions:
The term "siRNA" as used herein means an oligomer or polymer composed of nucleotides, e.g., deoxyribonucleotides or ribonucleotides, or compounds produced synthetically (e.g., PNA as described in U.S. Pat. No. 5,948,902 and the references cited therein) which can silence a target gene by hybridizing with naturally occurring nucleic acids in a sequence specific manner. As used herein the term "siRNA" does not only include double stranded small interfering RNAs (siRNAs) per se but also any other molecule capable of RNA interference. These include but are not limited to: antisense molecules, shRNA, microRNA. The siRNA contains a sequence that is identical or nearly identical to a portion of a gene. RNA may be polymerized in vitro, comprise recombinant RNA or chimeric sequences, or derivatives of these groups. The siRNA may contain ribonucleotides, deoxyribonucleotides, synthetic nucleotides, or any suitable combination such that expression of the target gene is inhibited. The RNA is preferably double stranded, but may be single, triple, or quadruple stranded. An example of a single strand siRNA is an siRNA with a hairpin loop. Oligomers or polymers which contain compounds produced synthetically comprise nucleobase sequences which do not occur in nature or species which contain functional equivalents of naturally occurring nucleobases, sugars, or inter-sugar linkages, like peptide nucleic acids (PNA), threose nucleic acids (TNA), locked nucleic acids (LNA), or glycerol nucleic acids (GNA). The term "siRNA" also includes oligomers that contain the naturally occurring nucleic acid nucleobases adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U), as well as oligomers that contain base analogs or modified nucleobases, such as a 2'-0-methyl modified nucleotide, a nucleotide comprising a 5'-phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group. 2' modified nucleotides may have the additional advantage that certain immuno stimulatory factors or cytokines are suppressed when the siRNA molecules are employed in vivo, for example in a medical setting. Alternatively and non-limiting, the modified nucleotide may be chosen from the group of: a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide. Nucleic acids can derive from a variety of natural sources such as viral, bacterial and eukaryotic DNAs and RNAs. Other nucleic acids can be derived from synthetic sources, and include any of the multiple oligonucleotides that are being manufactured for use as research reagents, diagnostic agents or potential and definite therapeutic agents. The term "siRNA" includes oligomers comprising of a single strand nucleic acid or a double strand nucleic acid.
Accordingly as used herein, "siRNA targeting hsp90" means an oligomer or polymer composed of nucleotides, e.g., deoxyribonucleotides or ribonucleotides, or compounds produced synthetically that can inhibit the expression of heatshock protein hsp90 in a target cell. "Hsp90" as used herein refers to heatshock protein 90 including all homologues, for example hsp90 alpha (depicted as hsp90 a herein) and hsp 90 beta (depicted as hsp90 b herein).
The term "siRNA action" as used herein means the physiological effects of siRNA in vivo, i.e. the inhibition of the expression of a target gene after successful delivery of the siRNA into a target cell.
As used herein, "expression" refers to the process by which a nucleic acid is transcribed into mRNA and/or to the process by which the transcribed mRNA (also referred to as transcript) is subsequently being translated into peptides, polypeptides, or proteins. The transcripts and the encoded polypeptides are collectively referred to as gene product. If the polynucleotide is derived from genomic DNA, expression in a eukaryotic cell may include splicing of the mRNA. The term "fluorescent marker protein" as used herein includes but is not limited to green fluorescent protein (GFP), enhanced GFP (EGFP), Discosoma sp. Red fluorescent protein (DsRed), yellow fluorescent protein (YFP), enhanced YFP (EYFP), or any other naturally occurring or modified chromophore (See, for example: Fluorescent proteins: a cell biologist's user guide. E.L.Snapp Trends in Cell Biology - 1 November 2009 (Vol. 19, Issue 11, pp. 649- 655)).
"Non-human test animal" as used herein means any non-human test animal, preferably a mammal, most preferably a rodent such as a mouse or a rat. The genome of the non-human test animals comprise transgenic DNA sequences which are integrated in all or a portion of the animal's cells. The integration into the genome is stable. The transgenic proteins may be ubiquitary expressed or only expressed in certain tissues.
The term "administering" as used herein means to administer a siRNA to a nonhuman test animal by any mode of administration known to a person skilled in the art, or by any method in combination with other known techniques, for example enteral, oral and topical administration, as well as parenteral administration, usually by injection, which includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion. The terms "delivery reagent" or "delivery compound" as used herein, means a compound or compounds that bind(s) to or complex(es) with siRNA molecules and mediates their entry into cells without affecting the activity of the siRNA. These include chemical conjugates, such as small molecules, carbohydrates, peptide-mediated delivery, antibodies and proteins and noncovalent complexes, for example viral delivery systems, liposomes, nanoparticles, cationic polymer complexes, polymeric micelles and lipoplexes.
Examples of delivery reagents include cationic liposomes and lipids, calcium phosphate precipitates, rechargeable particles and polylysine complexes. Typically, the delivery reagent has a net positive charge that binds to the siRNA's negative charge. Other delivery reagents used for siRNA delivery include but are not limited to conjugates such as small molecules, antibodies, peptides, proteins and carbohydrates as well as vehicles like lipids, polymers and biopolymers. The term "delivery system" hence comprises all means for the delivery of active siRNA molecules into a cell.
As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. Preferably, the carrier is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g. by injection or infusion). Pharmaceutical carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. The use of such media and agents for pharmaceutically active substances is known in the art.
The terms "formulated" and "formulation" means the admixing, encapsulating, conjugating or otherwise association of the siRNA with molecules, molecule structures or mixtures of compounds. Examples for formulations are the formulation of the siRNA with a delivery compound and/ or a pharmaceutically acceptable carrier. The term "genetic silencer element" refers to a regulatory nucleotide sequence that inhibits the genetic transcription of a given gene by inhibiting the activity of the nearest promoter on the same DNA molecule. An example of a genetic silener element is a "Stop signal". The term"transla†ion stop signal" used herein refers to the genetic code, which contains three eodoti triplets (UAA, UAG, UGA) for terminating the polypeptide chain production during protein synthesis in a ribosorae. In a DNA strand the corresponding stop signal triplets are TAA, TAG and TGA. The term "promoter" as used herein refers region of gene that binds RNA polymerase and transcription factors to initiate transcription.
The term "recombinant CreER recombinase" refers to a recombinant protein wherein the mutated form of the ligand-binding domain of an estrogen receptor (ER) is fused to the Cre recombinase, essentially as described in the literature (R. Feil, J. Brocard, B. Mascrez, M. LeMeur, D. Metzger and P. Chambon, Ligand-activated site-specific recombination in mice, Proc. Natl. Acad. Sci. USA 93 (1996), pp. 10887-10890; A.K. Indra, X. Warot, J. Brocard, J.-M. Bornert, J.-H. Xiao, P. Chambon and D. Metzger, Temporally-controlled site-specific mutagenesis in the basal layer of the epidermis: comparison of the recombinase activity of the tamoxifen-inducible Cre-ER T and Cre-ER T2 recombinases, Nucleic Acids Research 27 (1999), pp. 4324-4327). This mutated ER will not bind to the natural ligand, beta estradiol, and instead binds the synthetic ligands tamoxifen or 4-hydroxy (OH)- tamoxifen. In the absence of the ligand, the Cre-ER fusion protein is bound to the heat-shock protein, Hsp90, hence Cre is inactive. On removal of Hsp90 inhibition the nuclear localization signal of the ER is exposed and causing the translocation of the Cre-ER fusion protein to the nucleus, hence inducing Cre activity. Short description of the figures
Figure 1 - Relative reduction of Hsp90a mRNA in NIH-3T3 cells after transduction with recombinant adenovirus expressing shRNA sequences inhibitory for Hsp90a.Ctrl = Hsp90a mRNA level of cells transduced with empty control vector (left panel). Relative reduction of Hsp90b mRNA in NIH-3T3 cells after transduction with recombinant adenovirus expressing shRNA sequences inhibitory for Hsp90b. Ctrl = Hsp90b mRNA level of cells transduced with empty control vector (right panel).
Figure 2 - Relative reduction of Hsp90a protein levels in NIH-3T3 cells after transduction with recombinant adenovirus expressing shRNA sequences inhibitory for Hsp90a.Control = Hsp90a protein level of cells transduced with empty control vector (upper panel) Relative reduction of Hsp90b protein levels in NIH-3T3 cells after transduction with recombinant adenovirus expressing shRNA sequences inhibitory for Hsp90b. Control = Hsp90b protein level of cells transduced with empty control vector (lower panel).
Figure 3 - (DsRedEGFPxCreER) double transgenic mice were either treated with scrambled shRNA (upper panel) or a Hsp90a/Hsp90b shRNA mixture encoded on adenoviruses and fluorescence of organs and tissues determined macroscopic ally after 7 days.
Figure 4 - GFP and Dsred expression of (DsRedEGFPxCreER) double transgenic mice treated with the Hsp90a/Hsp90b shRNA mix detected by FACS analysis in peripheral blood cells. PI and P2: detailed analysis of myeloid and lymphoid blood cell populations. Y-axis: log green fluorescence intensity, x- axis: log red fluorescence intensity. Filters used are FITC-A = fluorescein isothyocianate filter and PE= phycoerythrin filter.
Figure 5 - GFP and DsRed expression of (DsRedEGFPxCreER) double transgenic mice treated with the scrambled shRNA (upper panel) and Hsp90a/Hsp90b shRNA mix (lower panel) detected by FACS analysis of spleen tissue. Filters used are FITC-A = fluorescein isothyocianate filter, APC= allophycocyanin filter, PE= phycoerythrin filter. The markers corresponding to the populations of blood cells analyzed are CD19 for B cells and CD3 for T-cells. Figure 6 - GFP and DsRed expression of (DsRedEGFPxCreER) double transgenic mice treated with the scrambled shRNA (upper panel) and Hsp90a/Hsp90b shRNA mix (lower panel) detected by FACS analysis of spleen tissue. Filters used are FITC-A = fluorescein isothyocianate filter, APC= allophycocyanin filter, PE= phycoerythrin filter. The markers corresponding to the populations of blood cells analyzed are NKl-1 for natural killer cells and Cdl lb (abbreviated as 1 lb) for monocytes and macrophages.
Figure 7 - GFP expression and DsRed of (DsRedEGFPxCreER) double transgenic mice treated with the scrambled shRNA (upper panel) and Hsp90a/Hsp90b shRNA mix (lower panel) detected by FACS analysis of bone marrow. Filters used are FITC-A = fluorescein isothyocianate filter, APC= allophycocyanin filter, PE= phycoerythrin filter. The markers corresponding to the populations of blood cells analyzed are CD 19 for B cells and CD3 for T- cells.
Figure 8 - GFP expression and DsRed of (DsRedEGFPxCreER) double transgenic mice treated with the scrambled shRNA (upper panel) and Hsp90a/Hsp90b shRNA mix (lower panel) detected by FACS analysis of bone marrow. Filters used are FITC-A = fluorescein isothyocianate filter, APC= allophycocyanin filter, PE= phycoerythrin filter. The markers corresponding to the populations of blood cells analyzed are NKl-1 for natural killer cells and Cdl lb (abbreviated as 1 lb) for monocytes and macrophages.
Figure 9 - Schematic drawing of the selectable marker gene under control of a genetic silencer. Two systems are envisaged: a) The selectable marker gene (here EYFP) is under control of a Stop sequence flanked by two LoxP sites. EYFP is not expressed (no fluorescence signal). Upon Cre-mediated excision of the Stop sequence the selectable marker gene is activated, which in case of EYFP is detectable as yellow fluorescence signal, b) The selectable marker gene (here EGFP) is preceded by a gene encoding a second fluorescent protein (here DsREd) and its transcriptional Stop sequence flanked by two LoxP sites. The second fluorescent protein is constitutively expressed and its Stop sequence silences the gene encoding for the first fluorescent protein. Upon Cre-mediated excision of the second fluorescent protein and its Stop sequence the selectable marker gene is activated, which results in a switch of the fluorescence signal from red to green. Examples
The two transgenic systems proposed here are each composed of two transgenic modules:
A The first transgenic module is C57BL/6-Gt(ROSA)26Sortm9(cre/Esrl)Arte (termed thereafter ROSA-CreER Deleter, for simplicity) a transgene encoding the Cre-recombinase fused at its carboxy-terminal end to the mutant estrogen receptor ER. The ER domain no longer binds estrogen and instead binds the estrogen antagonist 4-hydroxytamoxifen (Tamoxifen). In the absence of this hormone, the chimeric CreER protein is complexed with the heat shock protein HSP90, and retained in an inactive conformation. Upon exposure to Tamoxifen, CreER is released from the complex with HSP90 and acquires an active conformation that can recombine and excise DNA sequences flanked by LoxP elements. In the absence of Tamoxifen the Cre recombinase activity is not detectable. The second transgene is the s/B6.C3-Tg(CAG- DsRed,EGFP)5GaeJ reporter transgene (termed thereafter Tg(Red-Stop-EGFP), for simplicity).
A series of double transgenic mice bearing the ROSA-CreER Deleter and the Tg(Red- Stop-EGFP reporter transgene, provide a system to study the siRNA-mediated activation of an independent fluorescence gene. The reporter gene (DsRed) is constructed such that its transcriptional stop signals prevent expression of the adjacent EGFP gene. Hence, these transgenic mice express constitutively red fluorescence but not the attached green EGFP. Since the DsRed gene, including its stop signal is flanked by LoxP elements, their Cre recombinase- mediated removal not only abolish red fluorescence but also automatically leads to activation of the EGFP gene and to green fluorescence. These double transgenic mice thus provide a system apt to evaluate the dynamic process of cre-mediated activation of the reporter EGFP gene during the siRNA treatment. In addition it permits the quantification of the siRNA effects under the conditions of alternative fluorescence measurements. B In an alternative approach, the gene-targeted mouse B6.129X1-
Gt(ROSA)26Sortml(EYFP)Cos/J (termed thereafter ROSA-Stop-EYFP, for simplicity) bears a transgene encoding the enhanced YFP (EYFP) fluorochrome gene in a silent state due to transcription stop signals placed in front of the coding region. The stop signals are flanked by loxP elements and this so-called Floxed-Stop/YGFP gene was inserted into the ROSA26 locus of the mouse via gene-targeting (S. Srivinas, T. Watanabe, C.-S. Lin, C. M. William, Y. Tanabe, T. M. Jessel and F. Costantini, Cre reporter strains produced by targeted insertion of EYFP and ECFP into ROSA26 locus, BMC Developmental Biology 1:4 (2001)). This Floxed-Stop/YGFP transgene can be activated by the action of the bacterial Cre-recombinase. The second transgenic module of the ROSA-CreER Deleter is described above.
Double transgenic mice bearing the ROSA-Stop-EYFP reporter, and the ROSA-CreER Deleter knock-in transgenes, provide another adequate system to study siRNA delivery. The rational hereto is that application of siRNA specific for HSP90 will lead to (at least transient) reduction of HSP90 levels that in turn will cause conformational activation of CreER recombinase proteins. The subsequent recombination excision of the floxed Stop signals in the ROSA-Stop-EYFP reporter transgene will trigger expression of EYFP and thus flag the cells affected and their progeny as fluorescence positive indicators of successful siRNA delivery. As stated above, activation of CreER can also be achieved by the application of Tamoxifen. Therefore, Tamoxifen-induced EYFP expression can be used in this double transgenic system both to validate this transgenic system and to quantify the extent of YGFP expression upon siRNA delivery.
Induction of Reporter Gene by Tamoxifen: Proof of Concept Groups of [ROSA-CreER Deleter x Tg(Red-Stop-EGFP)] double transgenic mice andTg(Red-Stop-EGFP) single transgenic are treated p.o. with Tamoxifen (100 μg, in 200μ1 oil) and analyzed 2 days later for the induction of EGFP expression. Macroscopical examination of whole organs and tissues under UV light showed that almost all tissues were DsRed positive before induction (Brain, thymus, heart, lungs, skin, kidney, testis and guts; data not shown) whereas expression of EGFP could not be observed in any tissue. After induction by tamoxifen, strong EGFP expression could be observed in various tissues (thymus, heart, skin, kidney, testis and guts; data not shown), whereas expression of DsRed was silenced in most of the tissues (thymus, lung, liver, skin, spleen, guts) and weaker in some other tissues (heart, kidney, testis; data not shown). All tissues but the brain showed a shift from DsRed to EGFP upon induction with tamoxifen.
Induction of Reporter Gene by molecules that mediate RNAi (here: shRNA) shRNA sequences used
Hsp90a: CCCAATCACATTCTGCTTTAA (Seq ID No. 1) Hsp90b: CTCCGCGAGTTGATCTCTAAT (Seq ID No 2) Negative control CAACAAGATGAAGAGCACCAA (Seq ID No 3)
Functionality of shRNA sequences was determined in in vitro assays, which showed stable knock-down of Hsp90 mRNA in cell cultures as well as depletion of cellular levels of Hsp90 protein (Figures 1 and 2). In parallel, groups of [ROSA-CreER Deleter x Tg(Red-Stop-EGFP)] double transgenic mice and Tg(Red-Stop-EGFP) single transgenic mice are injected i.v. with 100 μΐ containing PBS containing a mixture of 0,5 x 109 IU shRNA inhibitory for Hsp90a (Seq ID No. 1) and 0,5 x 109 IU shRNA inhibitory for Hsp90b (Seq ID No. 2) to a total of 109 IU shRNA expressing Adenovirus per mouse. One additional group [ROSA-CreER Deleter x Tg(Red-Stop-EGFP)] double transgenic mice is injected i.v. with 100 μΐ containing of Adenovirus bearing 109 IU non- target shRNA sequences (Seq ID No 3) to serve as negative control.
The treated mice are monitored daily during one week for expression of EGFP in different organs and tissues. One week after treatment blood samples were analyzed by FACS for EGFP expresion. Two weeks after treatment organs were surveyed optically for green fluorescence and single cell suspensions of spleen and bone marrow were analyzed by FACS for EGFP expression.
Results:
No GFP expression was detected in DsRedEGFP single transgenic control mice treated with Scrambled shRNA or with the Hsp90a + Hsp90b shRNA mix (data not shown). None of the (DsRedEGFPxCreER) double transgenic mice treated with scrambled shRNA displayed green fluorescence (Figure 3) at any time. In contrast, 7 days after treatment of (DsRedEGFPxCreER) double transgenic mice with the Hsp90a/Hsp90b shRNA mix green fluorescence is detectable in skin, brain, heart, (and with less intensity, gut and thymus) (Figure 3). GFP expression after treatment with the Hsp90a/Hsp90b shRNA mix was also detected by FACS analysis in peripheral blood cells (Figure 4). FACS analysis of spleen and bone marrow 2 weeks after treatment evidenced GFP expression in myeloid and lymphoid cells, in spite of lack of apparent fluorescence when the whole organ was examined (Figures 3 and 5 to 8).
These data demonstrate the potential of the (DsRedEGFPxCreER) double transgenic mouse system to report the action of inhibitory siRNA molecules in different organs/tissues when administered in vivo. The system is thus suited for the evaluation of the functional delivery potential of formulated siRNA preparations in the context of a living mammalian organism.

Claims

Claims
1. A method for detection of siRNA action in vivo comprising a) administering a siRNA targeting hsp90 to a nonhuman transgenic test animal, wherein the genome of the nonhuman transgenic test animal comprises a sequence coding for a fluorescent marker protein which is under control of a genetic silencer element, wherein the genetic silencer element is flanked by LoxP recognition sites; a sequence coding for a recombinant CreER recombinase, wherein after translation the CreER recombinase is kept in an inactive form by Hsp90 b) measuring a fluorescence signal in the target tissue, wherein the existence of a fluorescence signal is indicative of siRNA action on said tissue.
2. The method of claim 1, comprising a) administering a siRNA targeting hsp90 to a nonhuman transgenic test animal, wherein the genome of the nonhuman transgenic test animal comprises a sequence encoding for a first fluorescent marker protein which is under control of a genetic silencer element, wherein said genetic silencer element is flanked by LoxP recognition sites and comprises a sequence encoding for a second fluorescent marker protein and its transcriptional Stop sequence; a sequence coding for a recombinant CreER recombinase, wherein after translation the CreER recombinase is kept in an inactive form by Hsp90 b) measuring a fluorescence signal in the target tissue, wherein the existence of a fluorescence signal of the first fluorescent marker protein is indicative of siRNA action on said tissue.
3. The method of claims 1 or 2 wherein the siRNA action in different tissues is detected.
4. The method of any of claims 1 to 3, wherein the siRNA is formulated.
5. The method of claim 4, wherein the siRNA is formulated with a delivery reagent.
6. The method of claim 5, wherein the siRNA is additionally formulated with a pharmaceutically acceptable carrier, stabilizer or diluent.
7. The method of any of claims 1 to 6 wherein the nonhuman transgenic test animal is a mammal, preferably a mouse or rat.
8. The method of claims 1 to 7 wherein the fluorescent marker proteins are selected from GFP, EGFP, YFP, EYFP, DsRed
9. The method of any of claims 1 to 8 for assessment of the properties and efficiencies of siRNA formulations.
10. A method for detection of siRNA action comprising a) administering a siRNA targeting hsp90 to a cell line of a nonhuman transgenic test animal, wherein the genome of the nonhuman transgenic test animal comprises a sequence coding for a fluorescent marker protein which is under control of a genetic silencer element, wherein the genetic silencer element is flanked by LoxP recognition sites; a sequence coding for a recombinant CreER recombinase, wherein after translation the CreER recombinase is kept in an inactive form by Hsp90 b) measuring a fluorescence signal in the target tissue, wherein the existence of a fluorescence signal is indicative of siRNA action in said cell line.
11. The method of claim 10 comprising a) administering a siRNA targeting hsp90 to a cell line of a nonhuman transgenic test animal, wherein the genome of the nonhuman transgenic test animal comprises a sequence coding for a first fluorescent marker protein which is under control of a genetic silencer element, wherein the genetic silencer element is flanked by LoxP recognition sites and comprises a sequence encoding for a second fluorescent marker protein and its transcriptional Stop sequence; a sequence coding for a recombinant CreER recombinase, wherein after translation the CreER recombinase is kept in an inactive form by Hsp90 b) measuring a fluorescence signal in the target tissue, wherein the existence of a fluorescence signal of the first fluorescent marker protein is indicative of siRNA action in said cell line.
12. The method essentially as hereinbefore described.
PCT/EP2011/064049 2010-08-16 2011-08-16 Reporter mouse for delivery of rnai WO2012022723A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP10172868.1 2010-08-16
EP10172868 2010-08-16

Publications (1)

Publication Number Publication Date
WO2012022723A1 true WO2012022723A1 (en) 2012-02-23

Family

ID=44532839

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2011/064049 WO2012022723A1 (en) 2010-08-16 2011-08-16 Reporter mouse for delivery of rnai

Country Status (1)

Country Link
WO (1) WO2012022723A1 (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5948902A (en) 1997-11-20 1999-09-07 South Alabama Medical Science Foundation Antisense oligonucleotides to human serine/threonine protein phosphatase genes
WO1999053017A2 (en) * 1998-04-15 1999-10-21 Fred Hutchinson Cancer Research Center Methods and vector constructs for making transgenic non-human animals which ubiquitously express a heterologous gene
WO2006008484A2 (en) * 2004-07-16 2006-01-26 Cxr Biosciences Limited Detection of cellular stress
WO2009154999A2 (en) * 2008-05-28 2009-12-23 Oregon Health & Science University Methods of identifying inhibitors of gene silencing in mammalian cells
WO2010062951A2 (en) * 2008-11-25 2010-06-03 University Of Rochester Animal model for osteoarthritis and intervertebral disc disease

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5948902A (en) 1997-11-20 1999-09-07 South Alabama Medical Science Foundation Antisense oligonucleotides to human serine/threonine protein phosphatase genes
WO1999053017A2 (en) * 1998-04-15 1999-10-21 Fred Hutchinson Cancer Research Center Methods and vector constructs for making transgenic non-human animals which ubiquitously express a heterologous gene
WO2006008484A2 (en) * 2004-07-16 2006-01-26 Cxr Biosciences Limited Detection of cellular stress
WO2009154999A2 (en) * 2008-05-28 2009-12-23 Oregon Health & Science University Methods of identifying inhibitors of gene silencing in mammalian cells
WO2010062951A2 (en) * 2008-11-25 2010-06-03 University Of Rochester Animal model for osteoarthritis and intervertebral disc disease

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
A.K. INDRA, X. WAROT, J. BROCARD, J.-M. BORNERT, J.-H. XIAO, P. CHAMBON, D. METZGER: "Temporally-controlled site-specific mutagenesis in the basal layer of the epidermis: comparison of the recombinase activity of the tamoxifen-inducible Cre-ER and Cre-ERT2 recombinases", NUCLEIC ACIDS RESEARCH, vol. 27, 1999, pages 4324 - 4327, XP002144711, DOI: doi:10.1093/nar/27.22.4324
E.L.SNAPP: "Fluorescent proteins: a cell biologist's user guide", TRENDS IN CELL BIOLOGY, vol. 19, no. 11, 1 November 2009 (2009-11-01), pages 649 - 655, XP026716914, DOI: doi:10.1016/j.tcb.2009.08.002
FEIL R ET AL: "Ligand-activated site-specific recombination in mice", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE, WASHINGTON, DC; US, vol. 93, no. 20, 1 January 1996 (1996-01-01), pages 10887 - 10890, XP002144709, ISSN: 0027-8424, DOI: 10.1073/PNAS.93.20.10887 *
GELJA MAIWALD: "In vivo bioluminescence imaging for monitoring of siRNA mediated luciferase knockdown in tumor models", 2009, XP002661476, Retrieved from the Internet <URL:http://edoc.ub.uni-muenchen.de/11302/1/Maiwald_Gelja.pdf> [retrieved on 20111028] *
INDRA ARUP KUMAR ET AL: "Temporally-controlled site-specific mutagenesis in the basal layer of the epidermis: Comparison of the recombinase activity of the tamoxifen-inducible Cre-ERT and Cre-ERT2 recombinases", NUCLEIC ACIDS RESEARCH, vol. 27, no. 22, 15 November 1999 (1999-11-15), OXFORD UNIVERSITY PRESS, SURREY, GB, pages 4324 - 4327, XP002144711, ISSN: 0305-1048, DOI: 10.1093/NAR/27.22.4324 *
NICHOLS M, RIENTJES JM, LOGIE C, STEWART AF.: "FLP recombinase/estrogen receptor fusion proteins require the receptor D domain for responsiveness to antagonists, but not agonists.", MOL ENDOCRINOL., vol. 11, no. 7, June 1997 (1997-06-01), pages 950 - 961, XP002661479 *
PALLISER DEBORAH ET AL: "An siRNA-based microbicide protects mice from lethal herpes simplex virus 2 infection", NATURE, vol. 439, no. 7072, 5 January 2006 (2006-01-05), NATURE PUBLISHING GROUP, LONDON, GB, pages 89 - 94, XP002550734, ISSN: 0028-0836, [retrieved on 20051123], DOI: 10.1038/NATURE04263 *
R. FEIL, J. BROCARD, B. MASCREZ, M. LEMEUR, D. METZGER, P. CHAMBON: "Ligand-activated site-specific recombination in mice", PROC. NATL. ACAD. SCI. USA, vol. 93, 1996, pages 10887 - 10890, XP002144709, DOI: doi:10.1073/pnas.93.20.10887
S. SRIVINAS, T. WATANABE, C.-S. LIN, C. M. WILLIAM, Y. TANABE, T. M. JESSEL, F. COSTANTINI: "Cre reporter strains produced by targeted insertion of EYFP and ECFP into ROSA26 locus", BMC DEVELOPMENTAL BIOLOGY, vol. 1, 2001, pages 4
SNAPP ET AL: "Fluorescent proteins: a cell biologist's user guide", TRENDS IN CELL BIOLOGY, vol. 19, no. 11, 1 November 2009 (2009-11-01), ELSEVIER SCIENCE LTD, XX, pages 649 - 655, XP026716914, ISSN: 0962-8924, [retrieved on 20091008], DOI: 10.1016/J.TCB.2009.08.002 *
SOLIT D B ET AL: "348 HER2 imaging as a non-invasive pharmacodynamic marker of Hsp90 inhibition", EUROPEAN JOURNAL OF CANCER. SUPPLEMENT, vol. 2, no. 8, 1 September 2004 (2004-09-01), PERGAMON, OXFORD, GB, pages 105, XP004639791, ISSN: 1359-6349, DOI: 10.1016/S1359-6349(04)80355-0 *
SRINIVAS S, WATANABE T, LIN CS, WILLIAM CM, TANABE Y, JESSELL TM, COSTANTINI F.: "Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus.", BMC DEV BIOL., vol. 1, 27 March 2001 (2001-03-27), XP021001303 *
STERN P, ASTROF S, ERKELAND SJ, SCHUSTAK J, SHARP PA, HYNES RO.: "A system for Cre-regulated RNA interference in vivo.", PROC NATL ACAD SCI U S A., vol. 105, no. 37, 8 September 2008 (2008-09-08), XP002661477 *

Similar Documents

Publication Publication Date Title
Murshed et al. The absence of nidogen 1 does not affect murine basement membrane formation
US7625750B2 (en) Compositions for DNA mediated gene silencing
ES2877275T3 (en) Animals with humanized dipeptidyl peptidase IV (DPP4)
US20140041063A1 (en) Genetically Modified Rat Models for Obesity and Diabetes
Gurumurthy et al. Genetically modified mouse models to help fight COVID-19
Ahrens et al. siRNA mediated knockdown of tissue factor expression in pigs for xenotransplantation
US20220304286A1 (en) SYSTEMS AND METHODS FOR IN VIVO DUAL RECOMBINASE-MEDIATED CASSETTE EXCHANGE (dRMCE) AND DISEASE MODELS THEREOF
ES2970541T3 (en) CRISPR/CAS screening platform to identify genetic modifiers of tau seeding or aggregation
JP2024063065A (en) Systems and methods for in vivo dual recombinase-mediated cassette exchange (dRMCE) and disease models thereof
EP1599573B1 (en) Model for studying the role of genes in tumor resistance to chemotherapy
EP2621268B1 (en) Model for muscle atrophy
US7732658B2 (en) Composition and method for imaging cells
WO2010010887A1 (en) Tissue expression promoter
CN113424797B (en) Method for regulating blood brain barrier permeability and application thereof
JP5250810B2 (en) Screening for substances that enhance utrophin gene expression
JPWO2006095846A1 (en) A model animal capable of observing the state of a disease state in real time, a genetic construct enabling it, and use thereof
WO2012022723A1 (en) Reporter mouse for delivery of rnai
US20230357792A1 (en) Method of engineering and isolating adeno-associated virus
CN112280800B (en) Construct and application thereof in preparation of medicines for tracing and removing aged cells of animals
JP2009011167A (en) Method for screening substance controlling hypoxic response, and pharmaceutical composition controlling hypoxic response
JP2022543589A (en) KLF-induced myocardial regeneration
EP4074821A1 (en) System for detecting extracellular purinergic receptor ligand and nonhuman animal having same transferred thereinto
WO2023034775A1 (en) Aavr knockout mouse in combination with human liver chimerism and methods of use and production of the same
TW201819630A (en) Non-obese diabetes mice and its applications
ES2338971B1 (en) ANIMAL MODEL FOR THE STUDY OF LIVING ANGIOGENESIS AND LYMPHANGIOGENESIS.

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11743245

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11743245

Country of ref document: EP

Kind code of ref document: A1