WO2012020308A2 - Cellular and molecular therapies - Google Patents

Cellular and molecular therapies Download PDF

Info

Publication number
WO2012020308A2
WO2012020308A2 PCT/IB2011/002048 IB2011002048W WO2012020308A2 WO 2012020308 A2 WO2012020308 A2 WO 2012020308A2 IB 2011002048 W IB2011002048 W IB 2011002048W WO 2012020308 A2 WO2012020308 A2 WO 2012020308A2
Authority
WO
WIPO (PCT)
Prior art keywords
mir
cells
hsa
seq
homo sapiens
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2011/002048
Other languages
French (fr)
Other versions
WO2012020308A3 (en
Inventor
Paul Shiels
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Glasgow
Original Assignee
University of Glasgow
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Glasgow filed Critical University of Glasgow
Publication of WO2012020308A2 publication Critical patent/WO2012020308A2/en
Priority to US13/766,637 priority Critical patent/US20140234263A1/en
Anticipated expiration legal-status Critical
Publication of WO2012020308A3 publication Critical patent/WO2012020308A3/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/37Digestive system
    • A61K35/407Liver; Hepatocytes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14Blood; Artificial blood
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/22Urine; Urinary tract, e.g. kidney or bladder; Intraglomerular mesangial cells; Renal mesenchymal cells; Adrenal gland
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/37Digestive system
    • A61K35/39Pancreas; Islets of Langerhans
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/48Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/5005Wall or coating material
    • A61K9/5063Compounds of unknown constitution, e.g. material from plants or animals
    • A61K9/5068Cell membranes or bacterial membranes enclosing drugs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/02Drugs for disorders of the nervous system for peripheral neuropathies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/88Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microencapsulation, e.g. using amphiphile liposome vesicle
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5061Muscle cells
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/507Pancreatic cells
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5073Stem cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K2035/124Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells the cells being hematopoietic, bone marrow derived or blood cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • C12N2310/141MicroRNAs, miRNAs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/10Applications; Uses in screening processes
    • C12N2320/11Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00Production
    • C12N2330/10Production naturally occurring

Definitions

  • Microvesicles and Related MicroRNAs filed on even date, the entirety of which is incorporated herein by reference.
  • Acute tissue damage may cause serious diseases and dangerous health conditions.
  • Organ ischemia occurs when blood flow to an organ is interrupted, usually by a blood clot or a severe drop in blood pressure.
  • ischemic strokes a lack of oxygen flow to the brain can result in apoptosis and necrosis of brain tissue leading to an infarction.
  • brain ischemia can be caused by various factors such as blood clots, thrombosis, embolism, blockage by atherosclerotic plaques, or other obstructions in the vasculature.
  • Hypercholesterolemia, hypertension, diabetes, and obesity have been identified as risk factors for ischemic strokes.
  • Ischemic strokes are a leading cause of death of human beings worldwide. In the United States, strokes strikes 700,000 people annually. Of these stroke patients, 40% will die, the equivalent of one death every three minutes. Acute tissue damage may also occur when a tissue is injured or under stressful or traumatic condition, resulting in acute organ failure.
  • the present invention provides, among other things, cellular and molecular therapies for acute tissue damage and related diseases, disorders and conditions.
  • the present invention encompasses the discovery that multipotent cells may be isolated from various adult tissues and these multipotent cells, also known as “pathfinder cells,” showed significant therapeutic effects in various acute tissue damage model in various tissues, including pancreas, kidney, heart and blood system.
  • the present invention further encompasses the discovery that pathfinder cells contain certain specific microRNAs that may function as intercellular regulators involved in cell or tissue repair, regeneration, remodeling, reconstruction, reprogramming, or transdifferentiation, and the discovery that pathfinder cells or their extracellular secretomes (e.g., microvesicles) induce immune tolerance and thus are particularly useful in treating inflammation and suppressing, inhibiting or reducing transplantation associated stress.
  • pathfinder cells contain certain specific microRNAs that may function as intercellular regulators involved in cell or tissue repair, regeneration, remodeling, reconstruction, reprogramming, or transdifferentiation
  • pathfinder cells or their extracellular secretomes e.g., microvesicles
  • the pathfinder cells induce immune tolerance at least by suppressing pro-inflammatory and/or anti-angiogenic cytokines or chemokines, such as, IL-4, IL-5, IL-6, IL- 10, IL-12, IL-13, IL-17, GMCSF, TGF- ⁇ , TNF-a, IFN- ⁇ , MCAF, and MIP1. It was found that pathfinder cells have unexpectedly distinct cytokine or chemokine profiles as compared to Mesenchymal stem cells (MSCs). For example, pathfinder cells according to the present invention reduce the expression or activity of IL-4, IL-6 and/or IL-10, while MSCs increase the expression or activity of IL-4, IL-6 and IL-10. Other distinctions are shown in Table 7. This discovery further confirms that pathfinder cells are distinct from mesenchymal stem cells.
  • cytokines or chemokines such as, IL-4, IL-5, IL-6, IL- 10, IL-12, IL-13, IL-17, GMCSF,
  • the present invention provides methods and compositions for treating or cure acute tissue damage and related diseases, disorders and conditions based on pathfinder cells and/or associated microRNAs.
  • the present invention provides a method for treating acute tissue damage comprising a step of administering a population of cells to an individual suffering from a disease, disorder or condition characterized by acute damage to one or more tissues, wherein the cells are originated from an adult tissue and wherein the cells induce tissue repair, regeneration, remodeling, reconstitution or differentiation.
  • the acute damage is to one or more tissues selected from the group consisting of kidney, heart, liver, lungs, pancreas, brain, intestine, bones, tendons, cornea, skin, muscle, veins, spinal cord, spleen, blood, and combinations thereof.
  • the acute damage is to kidney and/or heart.
  • the acute damage is ischemic damage.
  • the acute damage is associated with tissue transplantation.
  • the acute damage is associated with exposure to radiation and/or chemicals (e.g., in the context of therapy or injury, such as chemical injury to the cornea, skin, or other tissues).
  • the acute damage is associated with an inflammatory condition.
  • an inventive method according to the present invention is used to treat a disease, disorder or condition selected from the group consisting of myocardial infarct, acute renal failure, type I diabetes, and combination thereof.
  • the disease, disorder, or condition is characterized by cell apoptosis, aponecrosis, or necrosis.
  • the disease, disorder, or condition is characterized by inflammation of one or tissues.
  • the disease, disorder, or condition is associated with biological aging.
  • the cells used in a method of the invention are originated from an adult tissue that is distinct from the damaged tissue. In some embodiments, the cells used in a method of the invention are originated from an adult tissue that is from a different species. In some embodiments, the cells used in a method of the invention are originated from a human adult tissue. In some embodiments, the cells used in a method of the invention are originated from a non-human adult tissue. In some embodiments, the cells used in a method of the invention are originated from an autologous adult tissue. In some embodiments, the cells used in a method of the invention are originated from a non-autologous adult tissue. In some embodiments, the adult tissue is selected from the group consisting of pancreas, kidney, breast, lymph node, liver, spleen, myometrium, peripheral blood, chord blood, and bone marrow, and combinations thereof.
  • the cells used in a method according to the invention are first cultivated in a cell culture medium (e.g., serum-containing or serum-free) under conditions and time sufficient for cell proliferation.
  • a cell culture medium e.g., serum-containing or serum-free
  • the cell culture medium is a Matrigel free culture medium comprising serum.
  • the cells are first treated to reduce a telomeric attrition rate before the cultivating step.
  • the population of cells is substantially homogenous. In some embodiments, at least 30% (e.g., at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%), 80%), 85%o, 90%), 95%, or more) of the population of cells express one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, or nine or more) markers selected from the group consisting of CD24, c-myc, HLA class 1 ABC, ICAM3, Nestin, Nanog, Oct4, Integrin a2 + bl, Ngn3, and CD130.
  • markers selected from the group consisting of CD24, c-myc, HLA class 1 ABC, ICAM3, Nestin, Nanog, Oct4, Integrin a2 + bl, Ngn3, and CD130.
  • the one or more markers comprise Oct4, Nanog, and c-myc. In some embodiments, at least 30% (e.g., at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more) of the population of cells express Nestin.
  • At least 30%> (e.g., at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more) of the population of cells do not express at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight) marker(s) selected from the group consisting of CD34, CD105, VCAM1, CXCR2, CD44, CD73, ICAM1, and NCAM.
  • at least one e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight
  • marker(s) selected from the group consisting of CD34, CD105, VCAM1, CXCR2, CD44, CD73, ICAM1, and NCAM.
  • At least 30% (e.g., at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%), 85%o, 90%), 95%), or more) of the population of cells do not express any of the markers selected from the group consisting of CD34, CD105, VCAM1, CXCR2, CD44, CD73, ICAM1, and NCAM.
  • the cells used in a method according to the present invention express one or more microRNAs as shown in Table 1.
  • the cells used in a method according to the present invention express one or more microRNAs as shown in Tables 6-10.
  • the cells used in a method according to the present invention express one or more microRNAs as shown in Table 10.
  • the population of cells used in a method constitutes a therapeutically effective amount of cells.
  • the therapeutically effective amount ranges from approximately 1 x 10 6 to 3 x 10 8 cells per kg body weight per dose.
  • the cells are administered intravenously, intra-arterially, intramuscularly, subcutaneously, cutaenously, intradermally, intracranially, intrathecally, intrapleurally, intra-orbitally, intranasally, orally, intra alimentrally, colorectally, and/or intra- cerebrospinally.
  • the cells are administered daily, three times a week, twice a week, weekly, biweekly, monthly, once every two months, once every three months, once every four months, once every five months, once every six months, or once every year.
  • the cells are not administered in conjunction with an immunosuppressant.
  • the present invention provides a method for treating tissue damage (e.g., acute tissue damage) comprising a step of administering to an individual suffering from a disease, disorder or condition characterized by tissue damage a therapeutically effective amount of one or more microR As having a sequence at least 70% (e.g., 75%, 80%>, 85%, 90%, 95%, 96%, 97%, 98%, 99%) identical to any of SEQ ID NOs: 1 to 610 (or any one of SEQ ID NOs: 1 to 225).
  • the one or more microRNAs comprise a sequence identical to any of SEQ ID NOs: 1 to 610 (or any one of SEQ ID NOs: 1 to 225).
  • the present invention may be used to facilitate organ transplantation (e.g., heart, kidney, liver, lung, pancreas, intestine, thymus, and skin
  • organ transplantation e.g., heart, kidney, liver, lung, pancreas, intestine, thymus, and skin
  • the present invention provides a method of organ transplantation comprising a step of administering to an organ transplant recipient a population of cells, wherein the cells are originated from an adult tissue and wherein the cells induce tissue repair, regeneration, remodeling, reconstruction, reprogramming, or transdifferentiation.
  • the organ transplant recipient is a heart, kidney, liver, lung, pancreas, intestine, thymus, or skin transplant recipient.
  • the present invention also provides various pharmaceutical compositions based on cells and/or microRNAs described herein.
  • the present invention provides a pharmaceutical composition for tissue repair or regeneration comprising a
  • substantially homogeneous population of cells and a pharmaceutically acceptable carrier wherein the cells are originated from an adult tissue and wherein the cells induce tissue repair, regeneration, remodeling, reconstruction, reprogramming, or transdifferentiation.
  • a pharmaceutically acceptable carrier wherein the cells are originated from an adult tissue and wherein the cells induce tissue repair, regeneration, remodeling, reconstruction, reprogramming, or transdifferentiation.
  • Various cells described above in connection with various methods may be used in various embodiments of pharmaceutical compositions.
  • the present invention provides a pharmaceutical composition for tissue repair or regeneration comprising a therapeutically effective amount of one or more microRNAs having a sequence at least 70% (e.g., 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%) identical to any of SEQ ID NOs: 1 to 610 (or any one of SEQ ID NOs: 1 to 225)and a pharmaceutically acceptable carrier.
  • the one or more microRNAs have a sequence identical to any of SEQ ID NOs: 1 to 610 (or any one of SEQ ID NOs: 1 to 225).
  • the present invention is not limited to the treatment of acute tissue damage. It is contemplated that methods and compositions described herein may be used to treat tissue damage in general including both acute and chronic damage and related diseases, disorders, or conditions.
  • the present invention provides a method for treating inflammation comprising a step of administering a population of cells, or extracellular secretomes thereof, to an individual suffering from a disease, disorder or condition characterized by inflammation of one or more tissues, wherein the cells are originated from an adult tissue and wherein the cells induce an anti-inflammatory response.
  • the extracellular secretoms comprise micro vesicles.
  • the cells induce increased IL-2 response. In some embodiments, the cells induce expansion of regulatory T cells, suppression of T cell responses and/or immune tolerance. In some embodiments, the expansion of regulatory T cells comprises increased level and/or activity of T regulatory cells. In certain embodiments, the cells induce decreased level and/or activity of cytotoxic T cells and/or helper T cells.
  • the cells suppress pro-inflammatory and/or anti-angiogenic cytokine or chemokine response.
  • the pro-inflammatory and/or anti- angiogenic cytokine or chemokine is selected from the group consisting of IL-4, IL-5, IL-6, IL- 10, IL-12, IL-13, IL-17, GMCSF, , TGF- ⁇ , TNF-a, IFN- ⁇ , MCAF, MIP1, and combinations thereof.
  • the cells do not increase the expression or activity of IL-4, IL-6 and/or IL-10.
  • the cells increase anti-inflammatory and/or pro-angiogenic cytokine or chemokine response.
  • the anti-inflammatory and/or pro- angiogenic cytokine or chemokine is selected from IL- ⁇ , GSCF, IL-8 and combinations thereof.
  • an inventive method according to the present invention is used to treat a disease, disorder or condition selected from acute inflammatory conditions; adult respiratory distress syndrome (ARDS); Airway hyperresponsiveness (AHR); allergy disorders; alopecia areata; ankylosing spondylitis; asthma; atopic inflammatory disorders; autoimmune thyroiditis; bronchial hyperreactivity; cancers; cardiovascular disorders; Chronic Obstructive Pulmonary disease (COPD); cirrhosis; Crohn's disease, Congestive Heart Failure (CHF); colitis; dermatitis; diabetes mellitus (type I); disorders associated with wound healing; end-stage renal disease (ESRD); eosinophilic esophagitis; HIV; Graves' disease; infectious diseases;
  • ARDS adult respiratory distress syndrome
  • AHR Airway hyperresponsiveness
  • AHR Airway hyperresponsiveness
  • allergy disorders alopecia areata
  • ankylosing spondylitis asthma
  • atopic inflammatory disorders autoimmune thyroiditis
  • IBD inflammatory bowel disease
  • the inflammation is associated with Graft- versus-host disease (GVHD).
  • the inflammation is associated with autoimmune disease.
  • the inflammation is associated with chronic renal disease.
  • osteoarthritis inflammation is associated with osteoarthritis.
  • the individual suffering from a disease, disorder or condition characterized by inflammation of one or more tissues is a mammal.
  • the mammal is a human.
  • the adult tissue from which the cells are originated is from a human.
  • the adult tissue is from a non-human mammal, e.g., selected from a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, and/or a Pig-
  • the adult tissue is selected from the group consisting of bone marrow, liver, blood, heart, brain, gum, eye, skin, breast, chord blood, kidney, lymph node, myometrium, pancreas, peripheral blood, spleen, and combinations thereof.
  • the term "approximately” or “about” refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%), 2%>, 1%), or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
  • Figure 1 shows a graphical representation of serum creatinine levels in mice at day 14 post ischemia. Control mice (group A) were injected with saline, while experimental mice (groups B-D) received PDPCs according to various treatment regimens.
  • Figure 2 depicts photomicrographs of kidney sections from control ischemic mice and PDPC-treated ischemic mice. Sections were stained for pi 6, p21, and SA GAL (markers of cell stress and cell senescence) and TUNEL (a marker of apoptosis).
  • Figure 3 shows graphs displaying relative levels of cytoplasmic p21 expression in heart tissues of control and PDPC-treated cardiac ischemic mice. From left to right, the bars in each group are (1) ischemic mice that were untreated; (2) ischemic mice that were injected with an NaCl solition; (3) ischemic mice that were treated with PDPCs; and (4) untreated, nonischemic mice.
  • Figures 4 and 5 show exemplary graphical representations of serum creatinine levels in mice at day 14 post ischemia. Control mice (group A) were injected with saline, while experimental mice (groups B-D) received PDPCs according to various treatment regimens.
  • Figures 6 and 7 show exemplary graphical representations of serum creatinine levels adjusted for body weight in mice at day 14 post ischemia. Control mice (group A) were injected with saline, while experimental mice (groups B-D) received PDPCs according to various treatment regimens.
  • Figure 8 shows exemplary graphs displaying measurement of various indicators of cardiac function in cardiac ischemic mice (controls and PDPC-treated). Fractional shortening (FS), left ventricle diastolic diameter (LVEDD), and left ventricle systolic diameter (LVESD) were measured before ischemia and at 1 and 2 weeks post-ischemia.
  • FS Fractional shortening
  • LVEDD left ventricle diastolic diameter
  • LVESD left ventricle systolic diameter
  • Figure 9 shows an exemplary graph displaying measurement of fractional shortening (FS) in cardiac ischemic mice (controls and PDPC-treated).
  • Figure 10 shows an exemplary graph displaying measurement of left ventricle diastolic diameter (LVEDD) in cardiac ischemic mice (controls and PDPC-treated).
  • Figure 11 shows an exemplary graph displaying measurement of left ventricle systolic diameter (LVESD) in cardiac ischemic mice (controls and PDPC-treated).
  • Figures 12, 13, and 14 show exemplary graphs displaying blood glucose levels of
  • NOD mice in groups 1, 2, and 3 respectively at various time points were untreated; group 2 mice were treated with PDPCs; and group 3 mice were treated with PDPCs and CsA (cyclosporine A, an immunosuppressant).
  • group 1 mice were untreated; group 2 mice were treated with PDPCs; and group 3 mice were treated with PDPCs and CsA (cyclosporine A, an immunosuppressant).
  • Figure 15A and 15B depict exemplary scanning electron microscopy pictures of sub-confluent rat PDPCs adapted for growth in medium with fetal bovine serum (FBS) depleted for bovine micro vesicles. Nascent micro vesicles can be seen at the surfaces of cells in both figures.
  • FBS fetal bovine serum
  • Figures 16 to 21 depict exemplary ELISA measurements of IL-1B, IL-2, IL-4,
  • Figures 22 to 34 depict exemplary ELISA measurements of IL-2, IL-4, IL-5, IL-
  • Acute As used herein, the term “acute” when used in connection with tissue damage and related diseases, disorders, or conditions, has the meaning understood by any one skilled in the medical art. For example, the term typically refers to a disease, disorder, or condition in which there is sudden or severe onset of symptoms. In some embodiments, acute damage is due to an ischemic or traumatic event. Typically, the term “acute” is used in contrast to the term “chronic.”
  • adult As used herein, the term “adult” when used to describe tissues is not meant herein to imply that the tissues must be obtained from an adult individual, but rather, that the tissues are themselves fully developed or differentiated, rather than being in embryonic or undifferentiated form.
  • animal refers to any member of the animal kingdom. In some embodiments, “animal” refers to humans, at any stage of development. In some embodiments, “animal” refers to non-human animals, at any stage of development. In certain embodiments, the non-human animal is a mammal ⁇ e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, and/or a pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, and/or worms. In some embodiments, an animal may be a transgenic animal, genetically-engineered animal, and/or a clone.
  • autoimmune disorder refers to a disorder resulting from attack of a body's own tissue by its immune system.
  • autoimmune diseases is diabetes mellitus, multiple sclerosis, premature ovarian failure, scleroderma, Sjogren's disease, lupus, alopecia (baldness), polyglandular failure, Grave's disease, hypothyroidism, polymyosititis, Celiac disease, Crohn's disease, inflammatory bowel disease, ulcerative colitis, autoimmune hepatitis, hypopituitarism, Guillain-Barre syndrome, myocardititis, Addison's disease, autoimmune skin diseases (e.g., psoriasis), uveititis, pernicious anemia, polymyalgia rheumatica, Goodpasture's syndrome, hypoparathyroidism, Hashimoto's thyoriditis, Rayn
  • Autologous and non-autologus means from the same organism. In the context of the present application, the term is used to mean that the population of cells and/or microvesicles referred to as “autologous” to each other do not contain any material which could be regarded as allogenic or xenogenic, that is to say derived from a “foreign” cellular source. As used herein, the term “non-autologous” means not from the same organism.
  • Cell culture As used herein, the term "cell culture” or its equivalents shall mean one or more cells cultivated in a controlled environment.
  • a cell culture typically pertains to an isolated collection of cells in a defined medium under controlled conditions. However, in certain circumstances, a cell culture may contain a single cell. Typically, a single cell culture is obtained from a larger culture by dilution. In other embodiments, a cell culture contains two or more cells. For such a cell culture, the culture may consist of cells of a significantly pure population. For example, in some embodiments, cells in a culture are clonal in nature. Clonal cells are derived from a single parental cell and typically contain identical genetic make-up.
  • a culture may be characterized as a mixed cell culture, which contains multiple cell types.
  • a mixed cell culture is prepared by design.
  • a mixed cell culture is a result of a contamination.
  • Chronic As used herein, the term “chronic,” when used in connection with tissue damage or related diseases, disorders, or conditions has the meaning as understood by any one skilled in the medical art. Typically, the term “chronic” refers to diseases, disorders, or conditions that involve persisting and/or recurring symptoms. Chronic diseases, disorders, or conditions typically develop over a long period of time. The term “chronic” is used in contrast to the term “acute.” In some embodiments, a chronic disease, disorder, or condition results from cell degeneration. In some embodiments, a chronic disease, disorder, or condition results from age-related cell degeneration.
  • Diabetes mellitus refers to a metabolic disease characterized by abnormally high levels of glucose in the blood, caused by an inherited inability to produce insulin (Type 1) or an acquired resistance to insulin (Type 2).
  • Type 1 diabetes is a severe, chronic form of diabetes caused by insufficient production of insulin and resulting in abnormal metabolism of carbohydrates, fats, and proteins. The disease, which typically appears in childhood or adolescence, is characterized by increased sugar levels in the blood and urine, excessive thirst, frequent urination, acidosis, and wasting. Type 1 diabetes is also called insulin-dependent diabetes.
  • Type 2 diabetes is a mild form of diabetes that typically appears first in adulthood and is exacerbated by obesity and an inactive lifestyle. This disease often has no symptoms, is usually diagnosed by tests that indicate glucose intolerance, and is treated with changes in diet and an exercise regimen. Type 2 diabetes is also called non-insulin- dependent diabetes.
  • Control has its art-understood meaning of being a standard against which results are compared. Typically, controls are used to augment integrity in experiments by isolating variables in order to make a conclusion about such variables.
  • a control is a reaction or assay that is performed
  • a control is a historical control (i.e., of a test or assay performed previously, or an amount or result that is previously known).
  • a control is or comprises a printed or otherwise saved record.
  • a control may be a positive control or a negative control.
  • a control is also referred to as a reference.
  • Cosmetic surgical procedure refers to a procedure that is not directed to the therapy of a disease but is, rather, directed to the improvement of an individual's aesthetic appearance, particularly the appearance of the skin or hair of an individual.
  • cosmetic surgical procedures include procedures that result in reduction in skin wrinkles, an increase in skin firmness, an increase in hair growth or shine, a reduction in grey hairs, a regrowth of hair in cases of baldness (especially male pattern baldness), reduction in hair growth (especially facial hair growth), an aesthetic enhancement of breast size or shape, and a reduction in cellulite.
  • Crude when used in connection with a biological sample, refers to a sample which is in a substantially unrefined state.
  • a crude sample can be cell lysates or biopsy tissue sample.
  • a crude sample may exist in solution or as a dry preparation.
  • the term “derivative thereof,” when used in connection with microvesicles or cells, refers to a fraction or extract (especially those containing R A and/or DNA and/or protein) of the original microvesicle or population of cells which retains at least some biological activity (especially the ability to induce differentiation and/or the ability to provide therapeutic benefit) of the original.
  • the term also include complexed, encapsulated or formulated microvesicles or cells (for example, microvesicles that have been encapsulated, complexed or formulated to facilitate administration). Examples of derivatives include lysates, lyophilates and homogenates.
  • Dysfunction refers to an abnormal function.
  • Dysfunction of a molecule ⁇ e.g., a protein
  • Dysfunction of a molecule can be caused by an increase or decrease of an activity associated with such molecule.
  • Dysfunction of a molecule can be caused by defects associated with the molecule itself or other molecules that directly or indirectly interact with or regulate the molecule.
  • a "functional" biological molecule is a biological molecule in a form in which it exhibits a property and/or activity by which it is characterized.
  • Functional derivative denotes, in the context of a functional derivative of a nucleotide sequence (e.g., microRNA), a molecule that retains a biological activity (either function or structural) that is substantially similar to that of the original sequence.
  • a functional derivative or equivalent may be a natural derivative or is prepared synthetically.
  • Exemplary functional derivatives include nucleotide sequences having substitutions, deletions, or additions of one or more nucleotides, provided that the biological activity of the nucleic acids (e.g., microR As) is conserved.
  • Inflammation includes inflammatory conditions occurring in many disorders which include, but are not limited to: Systemic
  • Inflammatory Response SIRS
  • Alzheimer's Disease and associated conditions and symptoms including: chronic neuroinflammation, glial activation; increased microglia; neuritic plaque formation; and response to therapy
  • ALS Amyotropic Lateral Sclerosis
  • arthritis and associated conditions and symptoms including, but not limited to: acute joint inflammation, antigen-induced arthritis, arthritis associated with chronic lymphocytic thyroiditis, collagen- induced arthritis, juvenile arthritis; rheumatoid arthritis, osteoarthritis, prognosis and
  • asthma and associated conditions and symptoms, including: bronchial asthma; chronic obstructive airway disease; chronic obstructive pulmonary disease, juvenile asthma and occupational asthma);
  • cardiovascular diseases and associated conditions and symptoms, including atherosclerosis; autoimmune myocarditis, chronic cardiac hypoxia, congestive heart failure, coronary artery disease, cardiomyopathy and cardiac cell dysfunction, including: aortic smooth muscle cell activation; cardiac cell apoptosis; and immunomodulation of cardiac cell function; diabetes and associated conditions and symptoms, including autoimmune diabetes, insulin-dependent (Type 1) diabetes, diabetic periodontitis, diabetic retinopathy, and diabetic nephropathy);
  • Type 1 diabetes diabetes, diabetic periodontitis, diabetic retinopathy, and diabetic nephropathy
  • gastrointestinal inflammations and related conditions and symptoms, including celiac disease, associated osteopenia, chronic colitis, Crohn's disease, inflammatory bowel disease and ulcerative colitis); gastric ulcers; hepatic inflammations such as viral and other types of hepatitis, cholesterol gallstones and hepatic fibrosis, HIV infection (and associated conditions and symptoms, including degenerative responses, neurodegenerative responses, and HIV associated Hodgkin's Disease), Kawasaki's Syndrome (and associated diseases and conditions, including mucocutaneous lymph node syndrome, cervical lymphadenopathy, coronary artery lesions, edema, fever, increased leukocytes, mild anemia, skin peeling, rash, conjunctiva redness, thrombocytosis; multiple sclerosis, nephropathies (and associated diseases and conditions, including diabetic nephropathy, endstage renal disease, acute and chronic glomerulonephritis, acute and chronic interstitial nephritis, lupus nephritis
  • Immunological disorders including autoimmune diseases, such as alopecia aerata, autoimmune myocarditis, Graves' disease, Graves opthalmopathy, lichen sclerosis, multiple sclerosis, psoriasis, systemic lupus erythematosus, systemic sclerosis, thyroid diseases (e.g. goiter and struma lymphomatosa (Hashimoto's thyroiditis, lymphadenoid goiter), sleep disorders and chronic fatigue syndrome and obesity (non-diabetic or associated with diabetes).
  • autoimmune diseases such as alopecia aerata, autoimmune myocarditis, Graves' disease, Graves opthalmopathy, lichen sclerosis, multiple sclerosis, psoriasis, systemic lupus erythematosus, systemic sclerosis, thyroid diseases (e.g. goiter and struma lymphomatosa (Hashimoto's thyroiditis, lymphadenoid goiter
  • viral trauma including strokes and ischemias, encephalitis, encephalopathies, epilepsy, perinatal brain injury, prolonged febrile seizures, SIDS and subarachnoid hemorrhage), low birth weight (e.g.
  • febrile response general inflammatory response
  • acute respiratory distress response acute systemic inflammatory response
  • wound healing acute systemic inflammatory response
  • adhesion immunoinflammatory response
  • neuroendocrine response fever development and resistance
  • acute -phase response stress response
  • disease susceptibility repetitive motion stress, tennis elbow, and pain management and response.
  • inducer refers to any molecule or other substance capable of inducing a change in the fate of differentiation of a cell to which it is applied.
  • in vitro refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within a multi-cellular organism.
  • in vivo refers to events that occur within a multi-cellular organism such as a non-human animal.
  • Ischemia typically refers to a restriction in blood or oxygen supply that may result in damage or dysfunction of a tissue. Ischemia may be caused by any of a variety of factors, such as factors in blood vessels, a blood clot, a severe drop in blood pressure, an increase in compartmental pressure, and/or trauma.
  • the term "ischemia” as used herein also refers to local anemia in a given part of a body or tissue that may result, for example, from vasoconstriction, thrombosis, or embolism. Any tissue that normally receives a blood supply can experience ischemia.
  • Isolated refers to a substance and/or entity that has been (1) separated from at least some of the components with which it was associated when initially produced (whether in nature and/or in an experimental setting), and/or (2) produced, prepared, and/or manufactured by the hand of man. Isolated substances and/or entities may be separated from at least about 10%, about 20%>, about 30%>, about 40%>, about 50%>, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, about 99%, substantially 100%, or 100% of the other components with which they were initially associated.
  • isolated agents are more than about 80%>, about 85%, about 90%>, about 91%>, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, substantially 100%, or 100% pure.
  • a substance is "pure” if it is substantially free of other components.
  • isolated cell refers to a cell not contained in a multi-cellular organism.
  • microRNAs refers to post- transcriptional regulators that typically bind to complementary sequences in the three prime untranslated regions (3' UTRs) of target messenger RNA transcripts (mRNAs), usually resulting in gene silencing.
  • miRNAs are short ribonucleic acid (RNA) molecules, for example, 21 or 22 nucleotides long.
  • Th terms "microRNA” and “miRNA” are used interchangeably.
  • Microvesicle refers to a membranaceus particle comprising fragments of plasma membrane derived from various cell types. Typically, microvesicles have a diameter (or largest dimension where the particle is not spheroid) of between about 10 nm to about 5000 nm (e.g., between about 50 nm and 1500 nm, between about 75 nm and 1500 nm, between about 75 nm and 1250 nm, between about 50 nm and 1250 nm, between about 30 nm and 1000 nm, between about 50 nm and 1000 nm, between about 100 nm and 1000 nm, between about 50 nm and 750 nm, etc.).
  • microvesicles suitable for use in the present invention may originate from cells by membrane inversion, exocytosis, shedding, blebbing, and/or budding. Depending on the manner of generation (e.g., membrane inversion, exocytosis, shedding, or budding), the microvesicles contemplated herein may exhibit different surface/lipid characteristics.
  • Alternative names for microvesicles include, but are not limited to, exosomes, ectosomses, membrane particles, exosome-like particles, and apoptotic vesicles.
  • an abbreviated form "MV" is sometime used to refer to microvesicle.
  • Pathfinder cells refers to cells that have the capacity to induce or stimulate tissue repair, regeneration, remodeling, reconstitution, or differentiation. Typically, pathfinder cells induce or stimulate tissue or repair, regeneration, remodeling, reconstitution or differentiation without being a source of new tissue themselves. In some embodiments, pathfinder cells are also referred to as "progenitor cells.” As used herein, an abbreviated form "PC” is sometime used to refer to a pathfinder cell. Typically, pathfinder cells are originated from adult tissues, including primary cells directly isolated from adult tissues or cells grown from primary cells in a cell culture system.
  • pathfinder cells may be obtained from any developed individual (whether a child, adolescent, or adult), but are generally not obtained from embryos or fetuses. Pathfinder cells typically have one or more characteristics as described herein, such as expression of microRNAs, cell surface markers, and production of micro vesicles.
  • Subject refers to a human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat, cattle, swine, sheep, horse or primate).
  • a human includes pre and post natal forms.
  • a subject is a human being.
  • a subject can be a patient, which refers to a human presenting to a medical provider for diagnosis or treatment of a disease.
  • the term "subject” is used herein interchangeably with “individual” or "patient.”
  • a subject can be afflicted with or is susceptible to a disease or disorder but may or may not display symptoms of the disease or disorder.
  • the term “substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest.
  • One of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, go to completion and/or proceed to completeness or achieve or avoid an absolute result.
  • the term “substantially” is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.
  • Susceptible to An individual who is "susceptible to" a disease, disorder, and/or condition has not been diagnosed with the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition may not exhibit symptoms of the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will develop the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will not develop the disease, disorder, and/or condition.
  • therapeutically effective amount As used herein, the term "therapeutically effective amount" of a therapeutic agent means an amount that is sufficient, when administered to a subject suffering from or susceptible to a disease, disorder, and/or condition, to treat, diagnose, prevent, and/or delay the onset of the symptom(s) of the disease, disorder, and/or condition. It will be appreciated by those of ordinary skill in the art that a therapeutically effective amount is typically administered via a dosing regimen comprising at least one unit dose.
  • Therapeutic agent refers to any agent that, when administered to a subject, has a therapeutic effect and/or elicits a desired biological and/or pharmacological effect.
  • a therapeutic agent of the invention refers to a peptide inhibitor or derivatives thereof according to the invention.
  • Tissue As used herein, the term “tissue” refers to an aggregation of
  • tissue falls into one of four basic types: muscle, nerve, epidermal, and connective.
  • a tissue is substantially solid, e.g., cells within the tissue are strongly associated with one another to form a solid.
  • a tissue is substantially non-solid, e.g, cells within the tissue are loosely associated with one another, or not at all physically associated with one another, but may be found in the same space, bodily fluid, etc. For example, blood cells are considered a tissue in non-solid form.
  • Transdifferentiation refers to a process in which a non-stem cell transforms into a different type of cell, or an already differentiated stem cell creates cells outside its already established differentiation path.
  • transdifferentiation include de- and then re-differentiation of adult cell types (or differentiated cell types).
  • Treating refers to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of and/or reduce incidence of one or more symptoms or features of a particular disease, disorder, and/or condition. Treatment may be administered to a subject who does not exhibit signs of a disease and/or exhibits only early signs of the disease for the purpose of decreasing the risk of developing pathology associated with the disease.
  • the present invention provides, among other things, improved compositions and methods for the treatment of tissue damage (e.g., acute or chronic) and related diseases, disorders or conditions based on the use of pathfinder cells, extracellular secretomes thereof, and/or pathfinder cell-associated micro R As.
  • tissue damage e.g., acute or chronic
  • the present invention provides a method for treating tissue damage (e.g., acute or chronic) comprising a step of administering a population of cells to an individual suffering from a disease, disorder or condition characterized by acute damage to one or more tissues, wherein the cells are originated from an adult tissue and wherein the cells induce tissue repair, regeneration, remodeling, reconstitution or differentiation.
  • Cells suitable for the present invention are typically multipotent or pluripotent and can induce tissue repair, regeneration, remodeling, reconstruction, reprogramming, or transdifferentiation in vivo and/or in vitro.
  • the present invention utilizes cells originated from an adult tissue. Such cells are also referred to as "pathfinder cells" or
  • pathfinder cells may induce or stimulate host tissue repair, regeneration, remodeling, reconstitution, differentiation or transdifferentitaion without being a source of new tissue themselves.
  • pathfinder cells may induce changes within target tissue or cells to convert them into active repair mode by providing microRNAs and/or other components (e.g., membrane associated polypeptide, transcription factors, etc.) that will regulate expression of genes relating to, e.g., increased cell mobility, tissue remodeling and
  • pathfinder cells or microRNAs from different tissues, cell types or organisms may be used.
  • cells suitable for the present invention may be originated from an adult tissue that may or may not be the same as the target tissue.
  • cells suitable for the present invention may be originated from autologous or non-autologous adult tissues.
  • cells suitable for the present invention may be originated from adult tissues obtained from different species.
  • cells suitable for the present invention may be originated from human or non-human adult tissues.
  • cells suitable for the present invention may have any desirable origin, including endothelial, mesothelial, and ectothelial origins.
  • suitable cells include those found in a gland, an organ, muscle, a structural tissue, etc.
  • Suitable cells may be heterologous (or non-autologous) or autologous relative to recipient.
  • suitable cells may be derived from a tissue the same as or different than the recipient tissue (e.g., a diseased or damaged tissue to be treated).
  • kidney-derived cells may be used to stimulate repair of damaged cardiac tissue.
  • cells may be derived from a different organism (i.e., non-autologous).
  • a cell may be a porcine pancreatic cell, while the recipient is a human with damaged pancreatic or other tissue.
  • Cells suitable for the present invention may be isolated from any of a variety of tissue types, including, but not limited to, pancreas, kidney, lymph node, liver, spleen, myometrium, blood cells (including cells from peripheral blood and chord blood), and/or bone marrow.
  • Suitable cells may also be in any stage of their individual cellular age, ranging from just separated from their progenitor cell to a senescent or even dead cell. Thus, cells may include pre-apoptotic cells, or a cell committed to apoptosis.
  • suitable cells also include non-diseased and diseased cells, wherein diseased cells may be affected by one or more pathogens and/or conditions.
  • a diseased cell may be infected with a virus, an intracellular parasite, or bacterium.
  • a diseased cell may be a metabolically diseased cell (e.g., due to genetic defect, due to an enzyme, receptor, and/or transporter dysfunction, or due to metabolic insult), a neoplastic cell, or cell that has one or more mutations that render the cell susceptible to uncontrolled cell growth.
  • cells may be native (e.g., obtained by biopsy), cultured (e.g., native, or immortalized), or treated.
  • cells may be chemically and/or mechanically treated, resulting in a cell that exhibits a cell-specific stress response.
  • suitable cells may be treated with a natural or synthetic ligand to which the cell has a receptor or otherwise complementary structure.
  • a cell may also be treated with a drug or compound that alters at least one of a metabolism, cell growth, cell division, cell structure, and/or secretion.
  • suitable cells are recombinant cells.
  • recombinant cells may contain one or more nucleic acid molecules introduced by recombinant DNA technology. All known manners of introducing nucleic acids are deemed suitable for use herein (e.g., viral transfection, chemical transfection, electroporation, ballistic transfection, etc.).
  • the nucleic is a DNA
  • the DNA may be integrated into the genome of the cell, or that the DNA may reside as extrachromosomal unit within the cell.
  • Such DNA may be employed as a template for RNA production, which may have regulatory and/or protein encoding function.
  • nucleic acid is an RNA
  • such RNA may be used as a regulatory entity (e.g., via antisense or interference) and/or as a protein encoding entity.
  • nucleic acids encompass all known nucleic acid analogs (e.g., phosphorothioate analogs, peptide nucleic acid analogs, etc.)
  • cells are obtained from freshly isolated or stored materials
  • cells e.g., biological fluids, tissues, organs, etc.
  • storage may include storage at a reduced temperature (e.g., 4 °C) or even storage in frozen form.
  • cells may also be obtained from an in vitro source, and most typically from cell or tissue culture (see the Cell Culture Condition section below), or even organ culture.
  • Cells may be isolated, for example, according to methods previously developed by the present inventor and available in the art, or variations thereof. See, e.g., Shiels et al. (2009) Stem Cells Dev.,18(10): 1389-98 and International Patent Publications WO2006/120476 and WO2009/136168.
  • a tissue or a part of a tissue e.g., pancreatic ducts
  • the minced tissue can be seeded in a suitable culture medium and incubated.
  • pathfinder cells will emerge as a confluent monolayer after a period of time (e.g., 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, or more) in culture.
  • Pathfinder cells in a monolayer can be harvested and optionally washed in a solution such as PBS (phosphate-buffered saline).
  • pathfinder cells are obtained from cell cultures, they may be of any passage number so long as they can still have one or more properties that confer therapeutic benefit.
  • pathfinder cells of low (e.g., less than about 10 passages), medium (e.g., between to about 10 to about 20 passages), or high (e.g., more than about 20 passages (e.g., about 30, 40, 50, 60, 70, 80, 90, 100, or more than 100)) passage number may be used in various embodiments of the invention.
  • pathfinder cells are obtained from a cell culture that had been established from freshly isolated or stored materials.
  • cells may be cultured in a liquid medium that contains nutrients for the cells and are incubated in an environment where the temperature and/or gas composition is controlled.
  • specific cell culture conditions may vary depending on the type of cells used. Cell culture conditions for pathfinder cells have been described. See, e.g., International Patent Publication WO2006/120476.
  • An exemplary suitable medium for culture of pathfinder cells is CMRL 1066 medium (Invitrogen) supplemented with fetal bovine serum (e.g., at 10%).
  • media is supplemented with glutamine or glutamine-containing mixtures such as GLUTAMAXTM (Invitrogen) and/or with antibiotics (e.g., amphotericin, penicillin, and/or streptomycin).
  • glutamine or glutamine-containing mixtures such as GLUTAMAXTM (Invitrogen) and/or with antibiotics (e.g., amphotericin, penicillin, and/or streptomycin).
  • cells are grown such they are attached on a surface.
  • cells are grown as a monolayer on the surface.
  • cells are grown until they are confluent, i.e., until they cover the entire surface on which they are growing and there is nowhere else on the surface for cells to grow.
  • cells are grown until they are close to but not yet at confluence, i.e., until they cover most of the surface on which they are growing, but there is still some room for cells to grow.
  • cells are grown until they are approximately or more than 50%, 60%>, 70%>, 80%>, 85%, 90%, 95%, 97%, 98%, 99%, or more confluent, wherein x% confluent is defined as coverage of approximately x% of the growing surface. In some embodiments, cells are grown until they are approximately 50-99% (e.g., 60-99%, 70-99%, 75-99%, 80-99%, 85-99%, 90-99%, or 95-99%) confluent.
  • cells are grown on a substrate that may affect one or more properties of the cell, such as microvesicle production rate, cell proliferation rate, or miRNA expression pattern.
  • a nonwoven substrate such as a nonwoven fabric comprised of fibers.
  • nonwoven fabric includes, but is not limited to, bonded fabrics, formed fabrics, or engineered fabrics, that are manufactured by processes other than, weaving or knitting.
  • nonwoven fabric refers to a porous, textile-like material, usually in flat sheet form, composed primarily or entirely of fibers, such as staple fibers assembled in a web, sheet or batt.
  • the structure of the nonwoven fabric may be based on the arrangement of, for example, staple fibers that are typically arranged more or less randomly.
  • Nonwoven fabrics can be created by a variety of techniques known in the textile industry. Various methods may create carded, wet laid, melt blown, spunbonded, or air laid nonwovens. Exemplary methods and substrates are described in U.S. Application Publication No. 20100151575, the entire teachings of which are incorporated herein by reference.
  • the density of the nonwoven fabrics may be varied depending upon the processing conditions. In one embodiment, the nonwoven fabrics have a density of about 60 mg/mL to about 350 mg/mL.
  • the nonwoven substrates are biocompatible and/or bioabsorbable.
  • suitable biocompatible, bioabsorbable polymers include polymers selected from the group consisting of aliphatic polyesters, poly(amino acids), copoly(ether-esters), polyalkylene oxalates, polyamides, poly(iminocarbonates), polyorthoesters, polyoxaesters, polyamidoesters, polyoxaesters containing amine groups, poly(anhydrides), polyphosphazenes, and blends thereof.
  • the aliphatic polyesters are homopolymers and/or copolymers of monomers selected from the group consisting of lactide (which includes lactic acid, D-,L- and meso lactide), glycolide (including glycolic acid), epsilon-caprolactone, p- dioxanone (l,4-dioxan-2-one), trimethylene carbonate (l,3-dioxan-2-one), alkyl derivatives of trimethylene carbonate, delta-valerolactone, beta-butyrolactone, gamma-butyrolactone, epsilon- decalactone, hydroxybutyrate (repeating units), hydroxyvalerate (repeating units), 1 ,4-dioxepan- 2-one (including its dimer l,5,8,12-tetraoxacyclotetradecane-7,14-dione), l,5-dioxepan-2-one
  • aliphatic polyesters which include, but are not limited to homopolymers and/or copolymers of lactide (which includes lactic acid, D-,L- and meso lactide), glycolide (including glycolic acid), epsilon- caprolactone, p-dioxanone (l,4-dioxan-2-one), trimethylene carbonate (l,3-dioxan-2-one) and combinations thereof.
  • lactide which includes lactic acid, D-,L- and meso lactide
  • glycolide including glycolic acid
  • epsilon- caprolactone p-dioxanone
  • trimethylene carbonate l,3-dioxan-2-one
  • the aliphatic polyesters are homopolymers and/or copolymers of monomers selected from the group consisting of lactide (which includes lactic acid, D-,L- and meso lactide), glycolide (including glycolic acid), epsilon-caprolactone, p- dioxanone (l,4-dioxan-2-one), trimethylene carbonate (l,3-dioxan-2-one) and combinations thereof.
  • lactide which includes lactic acid, D-,L- and meso lactide
  • glycolide including glycolic acid
  • epsilon-caprolactone p- dioxanone
  • trimethylene carbonate l,3-dioxan-2-one
  • the aliphatic polyesters are homopolymers and/or copolymers of monomers selected from the group consisting of lactide (which includes lactic acid, D-,L- and meso lactide), glycolide (including glycolic acid), and p-dioxanone (1,4-dioxan- 2-one) and combinations thereof.
  • lactide which includes lactic acid, D-,L- and meso lactide
  • glycolide including glycolic acid
  • p-dioxanone 1,4-dioxan- 2-one
  • suitable fabrics include those that comprise aliphatic polyester fibers, e.g., fibers that comprise homopolymers or copolymers of lactide (e.g., lactic acid D-.
  • L- and meso lactide L- and meso lactide
  • glycolide e.g., glycolic acid
  • epsilon- caprolactone p-dioxanone
  • p-dioxanone l,4-dioxan-2-one
  • trimethylene carbonate l,3-dioxan-2-one
  • suitable farbics may contain poly(glycolide-co-lactide) (PGA/PL A); poly(lactide-co-glycolide) (PL A/PGA); 1 ,3 propanediol (PDO), and/or blends thereof.
  • cells are grown on a solid surface that has been textured in a particular way so as to confer special properties to the surface (e.g., repulsion or attraction of certain substances, reduced adsorption of proteins, etc.), which in turn may influence behavior of cells on such surfaces.
  • cells may be grown on a nano-textured surface
  • Nanosurface See, e.g., US 7,597,950; Sun et al. (2009) “Combining nanosurface chemistry and microfluidics for molecular analysis and cell biology,” Analytica Chimica Acta, 650(1):98- 105; the entire contents of each of which are herein incorporated by reference. Nanosurfaces and other textured surfaces may be generated, for example by any of a variety of methods known in the art, including sanding, chemical etching, sandblasting, and/or dewetting.
  • cells are grown in suspension.
  • cells are grown in a Matrigel free culture system in the presence of serum.
  • Pathfinder cells have been shown to be able to grow in such systems. See, e.g., International Patent Publication WO 2006/120476.
  • cells are subjected for at least part of the time to one or more conditions that enhance their growth, e.g., such that increased numbers of cells can be obtained from a culture.
  • enhancement of cell growth is accomplished by modulating accessibility of telomeres in cells. For example, cells may be first treated to reduce a telomeric attrition rate prior to cell culture. In some embodiments, to accheve reduced telomeric attrition rate, components of the telomere complex and/or factors that associate with it may be targeted by an agent that causes their downregulation or otherwise impairs their function.
  • RNAs such as small inhibitory RNAs (siRNAs) to inhibit expression a gene encoding a protein or other gene product that forms part of the telomere complex or associates with the telomere comlpex.
  • RAF1 expression is inhibited with the use of a RAF1 specific siRNA.
  • STAU1 expression is inhibited with the use of a STAU1 specific siR A.
  • Growth medium generally refers to any substance or preparation used for the cultivation of living cells.
  • the growth medium is renal growth medium.
  • the growth medium is Dulbecco's Modification of Eagle's medium (DMEM).
  • DMEM Dulbecco's Modification of Eagle's medium
  • cells are grown in media that does not contain serum.
  • cells are grown for at least a period of time in media that has been depleted of micro vesicles from media components.
  • media containing fetal bovine serum may be depleted of bovine micro vesicles.
  • commercially available medium that is depleted of microviescles e.g. , bovine microvesicles is used.
  • cells are grown at or about 37 °C. In some embodiments, cells are grown in the presence of at or about 5% C0 2 . In some embodiments, cells are grown under room air oxygen conditions. In some embodiments, cells are grown under conditions where the oxygen pressure is less than or equal to 5% 0 2 . In some embodiments, cells are grown in conditions of normal oxygen (e.g., about 5% 0 2 ). In some embodiments, cells are grown in hypoxic conditions (e.g., low oxygen such as ⁇ 5%, ⁇ 4%, ⁇ 3 %, ⁇ 2%, or ⁇ 1% 0 2 ).
  • hypoxic conditions e.g., low oxygen such as ⁇ 5%, ⁇ 4%, ⁇ 3 %, ⁇ 2%, or ⁇ 1% 0 2 ).
  • cells are grown under serum starvation conditions.
  • serum starvation includes, but is not limited to, serum depletion, serum- free medium or conditions.
  • serum starvation conditions are known in the art and can be used to practice the present invention.
  • cells may be grown under serum starvation conditions for about 6, about 12, about 18, about 24, about 30, about 36, about 42, about 48 hours, or longer.
  • cells may be grown under conditions where the serum concentration is less than or equal to 10%, less than or equal to 9%>, less than or equal to 8%), less than or equal to 7%>, less than or equal to 6%>, less than or equal to 5%, less than or equal to 4%>, less than or equal to 3%>, less than or equal to 2%>, less than or equal to 1.5%, less than or equal to 1%, or less than or equal to 0.5%.
  • cells may be grown under conditions where the serum concentration is 0%> (i.e., serum is absent).
  • cells may be grown under conditions where the serum concentration is decreased in a step-wise manner over time.
  • cells may be grown under conditions where the serum concentration is between about 2% to about 11% (e.g., about 2%, 3%), 4%), 5%, 6%, 7%, 8%), 9%), 10%>, or 11%) and is subsequently reduced in one or more steps to a serum concentration between about 0% to about 5% (e.g., about 0%, 0.5%, 1%, 1.5%, 2%, 3%, 4%, or 5%).
  • the serum concentration is between about 2% to about 11% (e.g., about 2%, 3%), 4%), 5%, 6%, 7%, 8%), 9%), 10%>, or 11%) and is subsequently reduced in one or more steps to a serum concentration between about 0% to about 5% (e.g., about 0%, 0.5%, 1%, 1.5%, 2%, 3%, 4%, or 5%).
  • pathfinder cells may differentiate into one or more cell types in the cell culture and the differentiated cell types are used in therapeutic applications in accordance with the invention.
  • pathfinder cells are differentiated fully to a defined cell type, including, but not limited to, pancreatic cells, neuronal cells, cardiovascular cells, epithelial cells, hepatocytes, muscle cells, retinal cells, hair follicle cells, and kidney cells.
  • pathfinder cells are differentiated into an "intermediate" cell type that is less pluripotent than a pathfinder cell, yet has greater potency than at least most fully differentiated cells.
  • a pathfinder cell may be differentiated into one of several progenitor cells of the immune system (e.g., lymphoid progenitor cells or myeloid progenitor cells) which are less pluripotent than hematopoetic stem cells yet not fully differentiated.
  • the cell type into which pathfinder cells are differentiated are tailored for the specific therapeutic indication for which the pathfinder cells are being used. For example, in some embodiments in which pathfinder cells are being used to stimulate repair in an individual with damage to the liver, pathfinder cells are differentiated into hepatocytes before administering to the individual.
  • pathfinder cells are cultured in a growth medium ("differentiation media") distinct from the growth medium in which pathfinder cells were maintained before differentiation (“maintenance media").
  • Differentiation media may vary depending on intended cell type, and may, for example, have a composition known to be suitable for growth of a particular cell type.
  • differentiation media contains one or more elements (e.g., growth factors, serum, additives, etc.) that are not present in maintenance media.
  • differentiation media lack one or more elements (e.g., growth factors, serum, additives, etc.) that are present in maintenance media.
  • pathfinder cells may be grown at a lower cell density than they are typically grown during maintenance. Without wishing to be bound by any particular theory, growth at lower cell densities affect the growth properties of the cells in a culture, because their ability to signal to one another is altered when the cell density in the plate is lower.
  • pathfinder cells may be grown on a different kind of surface (e.g., substrate) as was used to grown them for maintenance purposes. Such surfaces may help alter properties of the pathfinder cells and thereby help induce differentiation.
  • cells suitable for the present invention bear one or more characteristic biomarkers (e.g., protein or nucleic acid).
  • pathfinder cells may express one or more markers including, but not limited to, CD24, c-myc, HLA class 1 ABC, ICAM3, Nestin, Nanog, Oct4, Integrin ⁇ x2 + ⁇ ⁇ , Ngn3, and CD130.
  • pathfinder cells may express two, three, four, five, six, seven, eight, or all of the markers described herein.
  • pathfinder cells express one or more markers typically associated with stem cells, such as, for example, Nestin.
  • pathfinder cells suitable for the present invention express Oct 4, Nanog, and c-myc.
  • pathfinder cells suitable for the present invention are characterized with the absence of certain biomarkers.
  • pathfinder cells suitable for the present invention do not express at least one marker selected from the group consisting of CD34, CD105, VCAMl, CXCR2, CD44, CD73, ICAMl, and NCAM.
  • pathfinder cells suitable for the invention do not express any of the above biomarkers.
  • pathfinder cells have the biomarker profile: CD24 + , c- myc + , HLA class 1 ABC + , ICAM3 + , Nesting Nanog + , Oct4 + , Integrin ⁇ 2 + ⁇ 1 + , Ngn3 + , CD130 + , CD34 , CD105 , VCAMl , CXCR2 , CD44 , CD73 , ICAMl , and NCAM .
  • biomarkers may be used to isolate, enrich, and/or monitoring the growth of cells suitable for the present invention.
  • biomarkers may be used to prepare, isolate, or obtain a population of substantially homogeneous cells for therapeutic uses.
  • a population of substantially homogeneous cells refers to a population with at least 30% (e.g., at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%), 85%o, 90%), 95%), or more) of the cells expressing one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, or nine or more) identical biomarkers that are typically expressed on pathfinder cells.
  • suitable biomarkers include, but are not limited to, CD24, c-myc, HLA class 1 ABC, ICAM3, Nestin, Nanog, Oct4, Integrin a2 + bl, Ngn3, and CD130.
  • a population of substantially homogeneous cells refers to a population with at least 30%> (e.g., at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more) of the cells that do not express one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, or nine or more) biomarkers that are typically not expressed on pathfinder cells.
  • biomarkers include, but are not limited to, CD34, CD105, VCAMl, CXCR2, CD44, CD73, ICAMl, and NCAM.
  • nucleic acids such as the microRNAs described below may be used as biomarkers to isolate, enrich or monitoring the growth of pathfinder cells and to obtain a population of substantially homogeneous cells for therapeutic uses. II. MicroRNAs
  • cells comprise one or more specific microRNAs.
  • pathfinder cell microRNAs include those microRNAs that are present in pathfinder cells derived from one or more tissues.
  • Pathfinder cell-specific microRNAs are a subset of pathfinder cell microRNAs and include those microRNAs that are present in pathfinder cells but not other comparable cell types derived from the same tissue, such as differentiated cells.
  • pathfinder cell microRNAs and “pathfinder cells-specific
  • microRNAs encompass microRNAs isolated or purified from pathfinder cells as well as microRNAs having the same sequence synthesized using recombinant or chemical techniques.
  • microRNA molecules may be generated by in vitro transcription of DNA sequences encoding the relevant molecule. Such DNA sequences may be incorporated into a wide variety of vectors with suitable RNA polymerase promoters such as T7, T3, or SP6.
  • RNAs miRNAs
  • miRNAs refers to post-transcriptional regulators that typically bind to complementary sequences in the three prime untranslated regions (3 ' UTRs) of target messenger RNA transcripts (mRNAs), usually resulting in gene silencing.
  • miRNAs are short ribonucleic acid (RNA) molecules.
  • microRNAs may be approximately 18-25 nucleotides long (e.g., approximately 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides long).
  • pathfinder cell microRNAs individually or in combination, may be used to induce or stimulate repair of tissues, cell growth, cell regeneration, remodeling, reconstruction, differentiation and/or transdifferentiation, among other functions. It is further contemplated that pathfinder cell microRNAs can stimulate repair of tissues that are damaged from trauma or other acute diseases, disorders, or conditions.
  • Table 1 shows exemplary microRNAs that are present in pathfinder cells. In some embodiments, it was found that SEQ ID NOs: 1 to 319 are present in pathfinder cells. Additional microRNAs identified according to the present invention are listed in Tables 6 to 10 and include SEQ ID NOs: 320 to 608. Table 1 below, and Tables 6-10 in the Examples, list exemplary miRNA sequences for each miRNA of interest; corresponding miRNA sequences in other species are publicly available (e.g., see http://diana.cslab.ece.ntua.gr/mirgen/)..
  • miRNA sequences are well conserved across species, including, but not limited to, Homo sapiens, Rattus norvegicus, Mus musculus, Danio rerio, and Gallus gallus, and some miRNA sequence variants exist even in the same species.
  • asterisks (*) denote variants.
  • microRNAs useful in methods and compositions of the invention include those having nucleotide sequences identical to any of SEQ ID NOs: 1 to 319, as shown in Table 1.
  • microRNAs useful in methods and compositions of the invention also include those having nucleotide sequences identical to any of SEQ ID NOs: 320 to 608, as shown in Tables 6-10.
  • microRNAs having at least 70%, 75%, 80%, 85%, 90%, 95%, or more nucleotide sequence identity with any of SEQ ID NOs: 1 to 610 (or any of SEQ ID NOs: 1 o 225) are used in methods and compositions of the invention.
  • miR-27a >hsa-miR-27a* MIMAT0004501 Homo sapiens miR-27a* 47
  • miR-34a >hsa-miR-34a MIMAT0000255 Homo sapiens miR-34a 66
  • miR-143 >hsa-miR-143* MIMAT0004599 Homo sapiens miR-143* 104
  • miR-224 >hsa-miR-224 MIMAT0000281 Homo sapiens miR-224 161
  • miR-374b >hsa-miR-374b MIMAT0004955 Homo sapiens miR-374b 180
  • miR-708 >hsa-miR-708 MIMAT0004926 Homo sapiens miR-708 218
  • miR-187 >hsa-miR-187 MIMAT0000262 Homo sapiens miR-187 234
  • miR-513a-3p >hsa-miR-513a-3p MIMAT0004777 Homo sapiens miR-513a-3p 252 UAAAUUUCACCUUUCUGAGAAGG
  • miR-345 >hsa-miR-345 MIMAT0000772
  • Homo sapiens miR-345 270 GCUGACUCCUAGUCCAGGGCUC
  • miR-450b-5p >hsa-miR-450b-5p MIMAT0004909 Homo sapiens miR-450b- 288
  • microRNAs identified according to the present invention may be used to induce or stimulate tissue or cell repair, growth, remodeling, reconstruction, differentiation and/or transdifferentitation, and/or to treat associated diseases, disorders or conditions.
  • functional variants of microRNAs described herein may be used.
  • suitable microRNAs may include microRNAs having a sequence at least 70% (e.g., 75%, 80%>, 85%, 90%, 95%, 96%, 97%, 98%, 99%) identical to any one of microRNAs identified in Table 1 and Tables 6-10.
  • suitable microRNAs are functional variants of
  • suitable microRNAs may include microRNAs having a sequence at least 70%> (e.g., 75%, 80%>, 85%, 90%, 95%, 96%, 97%, 98%, 99%) identical to any one of SEQ ID NOs: 1 to 610 or SEQ ID NOs: 1 to 225.
  • Percent (%) nucleic acid sequence identity with respect to microRNA sequences identified herein is defined as the percentage of nucleotides in a candidate sequence that are identical with the nucleotides in a reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.
  • the WU-BLAST-2 software is used to determine amino acid sequence identity (Altschul et ah, Methods in Enzymology, 266, 460-480 (1996); http://blast.wustl/edu/blast/README.html).
  • WU-BLAST-2 uses several search parameters, most of which are set to the default values.
  • HSP score (S) and HSP S2 parameters are dynamic values and are established by the program itself, depending upon the composition of the particular sequence, however, the minimum values may be adjusted and are set as indicated above.
  • Suitable microRNAs may be comprised entirely of natural RNA nucleotides, or may instead include one or more nucleotide analogs and/or modifications.
  • the microRNA structure may be stabilized, for example by including nucleotide analogs at one or more free strand ends in order to reduce digestion, e.g., by exonucleases.
  • Suitable microRNAs may contain modified ribonucleotides, that is, ribonucleotides that contain a modification in the chemical structure of an unmodified nucleotide base, sugar and/or phosphate (or phospodiester linkage).
  • an "unmodified ribonucleotide” has one of the bases adenine, cytosine, guanine, and uracil joined to the 1 ' carbon of beta-D-ribo-furanose.
  • Modified microRNA molecules may also contain modified backbones or non-natural internucleoside linkages, e.g., modified phosphorous-containing backbones and non-phosphorous backbones such as morpholino backbones; siloxane, sulfide, sulfoxide, sulfone, sulfonate, sulfonamide, and sulfamate backbones; formacetyl and thioformacetyl backbones; alkene-containing backbones; methyleneimino and methylenehydrazino backbones; amide backbones, and the like.
  • modified backbones or non-natural internucleoside linkages e.g., modified phosphorous-containing backbones and non-phosphorous backbones such as morpholino backbones; siloxane, sulfide, sulfoxide, sulfone, sulfonate, sulfonamide, and sulfamate back
  • extracellular secretomes of pathfinder cells refer to any isolates derived from pathfinder cells according to the invention, including, but not limited to, any micro vesicles including exosomes isolated from Pathfinder cells.
  • Various methods of isolating or enriching microvesicles known in the art may be used to practice the present invention.
  • the terms "isolation” or “isolating” in conjunction with microvesicles are interchangeably used with the terms “enrichment” or “enriching,” and refer to one or more process steps that result in an increase of the fraction of microvesicles in a sample as compared to the fraction of microvesicles in the obtained biological sample.
  • microvesicles may be purified to homogeneity, purified to at least 90% (with respect to non-microvesicle particulate matter), at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, or at least 20%) (or even less).
  • physical properties of microvesicles- may be employed to separate them from a medium or other source material.
  • microvesicles may be separated on the basis of electrical charge (e.g., electrophoretic separation), size (e.g., filtration, molecular sieving, etc), density (e.g., regular or gradient centrifugation), Svedberg constant (e.g., sedimentation with or without external force, etc).
  • microvesicles are isolated or purified by centrifugation
  • a sample may be centrifuged at a fairly low centrifugal force (e.g., approximately 16,000 x g) sufficient to pellet larger microvesicles (e.g., approximately 1000 nm or more).
  • a fairly low centrifugal force e.g., approximately 16,000 x g
  • a sample (e.g., the resulting supernatant from the initial low speed spin) may be centrifuged at a higher centrifugal force (e.g., approximately 120,000 x g) sufficient to pellet microvesicles of a smaller size (e.g., less then 1000 nm).
  • a microvesicle preparation prepared using this method may contain substantially small particles, for example, particles with a size ranging from about lOnm to 1000 nm (e.g., about 50-1000 nm, 75-1000 nm, 100-1000 nm, 10-750 nm, 50-750 nm, 100-75 Onm, 100-500 nm).
  • such small particles are also referred to as exosomes, exosome-like vesicles, and/or membrane particles.
  • such fraction is referred to as exosome fraction.
  • microvesicles are isolated or purified by precipitation. It will be appreciated that various precipitation conditions may be used in order to obtain a desired fraction of isolated or purified microvesicles. For example, various kits are available for exosome precipitation, such as ExoQuickTM and Exo-Quick-TCTM (available from System Biosciences, Mountain View, California) and may be used in accordance with the present invention.
  • isolation may be based on one or more biological properties, and may employ surface markers (e.g., for precipitation, reversible binding to solid phase, FACS separation, specific ligand binding, non-specific ligand binding such as annexin V, etc.).
  • the microvesicles may also be fused using chemical and/or physical methods, including PEG-induced fusion and/or ultrasonic fusion.
  • microvesicles are obtained from conditioned media from cultures of microvesicle-producing cells.
  • microvesicles suitable for the present invention may be synthetically produced.
  • Synthetic microvesicles typically include one or more membrane components obtained from a donor cell.
  • synthetic microvesicles include at least one microRNA described herein.
  • synthetic microvesicles may be prepared by disintegration of a donor cell (e.g., via detergent, sonication, shear forces, etc.) and use of the crude preparation or an at least partially enriched membrane fraction to reconstitute one or more microvesicles.
  • exogenous microRNAs may be added to microvesicles.
  • the present invention provides methods of using pathfinder cells, cells differentiated from pathfinder cells, extracellular secretomes (e.g., microvesicles) and/or microRNAs for inducing or stimulating tissue or cell repair, growth, remodeling, reconstruction, differentiation and/or transdifferentitation, or treating associated diseases, disorders or conditions.
  • extracellular secretomes e.g., microvesicles
  • microRNAs for inducing or stimulating tissue or cell repair, growth, remodeling, reconstruction, differentiation and/or transdifferentitation, or treating associated diseases, disorders or conditions.
  • pathfinder cells may induce changes within target tissue or cells to convert them into active repair mode by providing microRNAs and/or other components (e.g., membrane associated polypeptide, transcription factors, etc.) that will regulate expression of genes relating to, e.g., increased cell mobility, tissue remodeling and reprogramming, growth, angiogenesis, cell adhesion and cell signaling, etc. It is further contemplated that pathfinder cells will typically not be part of the new tissue or cells. Thus, according to the present invention, pathfinder cells or microRNAs from different tissues, cell types or organisms may be used. In some embodiments, cell types or organisms may be used.
  • pathfinder cells or microRNAs may be used without inducing an immune reaction. In some embodiments, pathfinder cells or microRNAs may be used without an
  • pathfinder cells or microRNAs can be derived from autologous cells (i.e., cells from the same individual as the patient) or non-auto logous cells (i.e., cells from a different individual as the patient) or both.
  • pathfinder cells are derived from tissue that is the same as the diseased tissue.
  • pathfinder cells may be taken from healthy kidney cells from the same or different individual being treated.
  • pathfinder cells are derived from tissue that is different than the diseased tissue.
  • methods of treatment comprise one or more steps that are performed in vitro or ex vivo to induce cells ("recipient cells") to differentiate or
  • transdifferentiate into a desirable cell type. Such recipient cells can then be transferred into a patient.
  • pathfinder cells may act on other cells at least partially through microvesicles.
  • microvesicles produced by pathfinder cells contain factors (e.g., microR As) that confer desirable properties on recipient cells (i.e., cells that receive microvesicles, their contents, and/or or other factors secreted or produced by pathfinder cells).
  • provided methods comprise co-culturing pathfinder cells and recipient cells ex vivo and then transferring recipient cells into an patient.
  • recipient cells are transferred back into the same individual from whom recipient cells were obtained.
  • pathfinder cells can be co-cultured with bone marrow cells obtained from a patient for a period of time ex vivo to allow transfer of stimulatory factors (e.g., microvesicles, their contents, and/or other factors secreted or produced by pathfinder cells), then bone marrow cells may be transferred back into the individual.
  • stimulatory factors e.g., microvesicles, their contents, and/or other factors secreted or produced by pathfinder cells
  • recipient cells are tested for expression of specific biomarkers such as certain proteins and/or microRNAs after co-culturing with pathfinder cells before transfer into a patient.
  • methods of treatment comprise a step of administering to a patient in need of treatment a therapeutically effective amount of one or more microRNAs as described herein. miRNAs may be used in the absence or presence of cells.
  • methods and compositions of the present invention are used to stimulate repair of tissues and/or cells that have are damaged acutely (e.g., by trauma, and/or due to an acute disease, disorder, or condition).
  • Results described herein provide the first evidence to the inventor's knowledge that pluripotent adult cells can successfully stimulate repair of acute damage to tissues. It is contemplated that pathfinder cell-associated microRNAs disclosed herein would similarly be useful in stimulating repair of acute damage.
  • methods and compositions of the present invention are used to stimulate repair of damaged tissue in an acute condition resulting from ischemia.
  • methods and compositions of the present invention may be used to treat stroke, subarachnoid hemorrhage, brain hemorrhage, hemorrhagic stroke, brain trauma, head injury, head trauma, seizure, a headache disorder (e.g., migraine or cluster headache), cardiovascular disease (e.g., myocardial infarction, heart disease, coronary artery disease, congestive heart failure, cardiac valvular disease, cardiac arrhythmia, and cardiac arrest), tissue organ engraftment rejection, sequelae of ischemic reperfusion injury, retinal ischemia (e.g., diabetic retinopathy, central retinal artery or vein occlusion, stenosis of the carotid artery, and sickle cell retinopathy), retinal detachment, retinal tearing, gastrointestinal ischemia (e.
  • methods and compositions of the present invention are used to treat reperfusion injury.
  • Reperfusion injury refers to damage to a tissue caused when blood supply returns to the tissue after a period of ischemia.
  • Reperfusion injury is thought to arise at least in part from the inflammatory response of damaged tissues. Blood cells in newly returning blood may release a host of inflammatory factors such as interleukins and free radicals in response to the tissue damage. Oxidative stress resulting from reintroduced oxygen from returning blood flow may also contribute to reperfusion injury.
  • methods and compositions of the present invention are used to treat or alleviate acute organ failure, such as, for example, kidney failure or liver failure.
  • methods and compositions of the present invention are used to treat or alleviate acute complications of diseases.
  • Type I diabetes also known as "juvenile diabetes”
  • acute complications may arise suddenly from alterations in blood glucose levels; such complications include, but are not limited to, ketoacidosis (a pathological metabolic state marked by extreme and uncontrolled ketosis), hyperglycemic hyperosmolar nonketotic syndrom (HHNS) (usually associated with insulin deficiency and dehydration), and hypoglycemia (usually associated with too much insulin and/or too little glucose).
  • HHNS hyperglycemic hyperosmolar nonketotic syndrom
  • hypoglycemia usually associated with too much insulin and/or too little glucose.
  • inflammation includes inflammatory conditions occurring in many disorders which include, but are not limited to: Systemic Inflammatory Response (SIRS); Alzheimer's Disease (and associated conditions and symptoms including: chronic neuroinflammation, glial activation; increased microglia; neuritic plaque formation; and response to therapy); Amyotropic Lateral Sclerosis (ALS), arthritis (and associated conditions and symptoms including, but not limited to: acute joint inflammation, antigen-induced arthritis, arthritis associated with chronic lymphocytic thyroiditis, collagen- induced arthritis, juvenile arthritis; rheumatoid arthritis, osteoarthritis, prognosis and
  • SIRS Systemic Inflammatory Response
  • Alzheimer's Disease and associated conditions and symptoms including: chronic neuroinflammation, glial activation; increased microglia; neuritic plaque formation; and response to therapy
  • ALS Amyotropic Lateral Sclerosis
  • arthritis and associated conditions and symptoms including, but not limited to: acute joint inflammation, antigen-induced arthritis, arthritis associated with chronic lymphocytic thyroiditis, collagen- induced arthritis, juvenile arthritis;
  • asthma and associated conditions and symptoms, including: bronchial asthma; chronic obstructive airway disease; chronic obstructive pulmonary disease, juvenile asthma and occupational asthma);
  • cardiovascular diseases and associated conditions and symptoms, including atherosclerosis; autoimmune myocarditis, chronic cardiac hypoxia, congestive heart failure, coronary artery disease, cardiomyopathy and cardiac cell dysfunction, including: aortic smooth muscle cell activation; cardiac cell apoptosis; and immunomodulation of cardiac cell function; diabetes and associated conditions and symptoms, including autoimmune diabetes, insulin-dependent (Type 1) diabetes, diabetic periodontitis, diabetic retinopathy, and diabetic nephropathy);
  • Type 1 diabetes diabetes, diabetic periodontitis, diabetic retinopathy, and diabetic nephropathy
  • gastrointestinal inflammations and related conditions and symptoms, including celiac disease, associated osteopenia, chronic colitis, Crohn's disease, inflammatory bowel disease and ulcerative colitis); gastric ulcers; hepatic inflammations such as viral and other types of hepatitis, cholesterol gallstones and hepatic fibrosis, HIV infection (and associated conditions and symptoms, including degenerative responses, neurodegenerative responses, and HIV associated Hodgkin's Disease), Kawasaki's Syndrome (and associated diseases and conditions, including mucocutaneous lymph node syndrome, cervical lymphadenopathy, coronary artery lesions, edema, fever, increased leukocytes, mild anemia, skin peeling, rash, conjunctiva redness, thrombocytosis; multiple sclerosis, nephropathies (and associated diseases and conditions, including diabetic nephropathy, endstage renal disease, acute and chronic glomerulonephritis, acute and chronic interstitial nephritis, lupus nephritis
  • Immunological disorders including autoimmune diseases, such as alopecia aerata, autoimmune myocarditis, Graves' disease, Graves opthalmopathy, lichen sclerosis, multiple sclerosis, psoriasis, systemic lupus erythematosus, systemic sclerosis, thyroid diseases (e.g. goiter and struma lymphomatosa (Hashimoto's thyroiditis, lymphadenoid goiter), sleep disorders and chronic fatigue syndrome and obesity (non-diabetic or associated with diabetes).
  • autoimmune diseases such as alopecia aerata, autoimmune myocarditis, Graves' disease, Graves opthalmopathy, lichen sclerosis, multiple sclerosis, psoriasis, systemic lupus erythematosus, systemic sclerosis, thyroid diseases (e.g. goiter and struma lymphomatosa (Hashimoto's thyroiditis, lymphadenoid goiter
  • viral trauma including strokes and ischemias, encephalitis, encephalopathies, epilepsy, perinatal brain injury, prolonged febrile seizures, SIDS and subarachnoid hemorrhage), low birth weight (e.g.
  • febrile response general inflammatory response
  • acute respiratory distress response acute systemic inflammatory response
  • wound healing acute systemic inflammatory response
  • adhesion immunoinflammatory response
  • neuroendocrine response fever development and resistance
  • acute -phase response stress response
  • disease susceptibility repetitive motion stress, tennis elbow, and pain management and response.
  • methods and compositions of the present invention can be used to treat or ameliorate inflammation associated with an immunodeficiency disease, disorder, or condition.
  • diseases, disorders, and conditions that may be characterized by immunodeficiency include hypgammaglobulinemia, agammaglobulinemia, ataxia telengiectasia, severe combined immunodeficiency disease (SCID), acquired
  • AIDS immunodeficiency syndrome
  • pathfinder cells and/or cells differentiated from pathfinder cells treat or ameliorate immunodeficiency by stimulating reconstitution of one or more blood cell types, i.e., cells of the immune system. It is contemplated that pathfinder cell-associated microRNAs disclosed herein would similarly be useful in treating or ameliorating immunodeficiency.
  • methods and compositions of the present invention are used to treat or ammeliorate an autoimmune diesase, disorder or condition.
  • autoimmunity is the failure of an organism to recognize its own constituent parts as "self,” which results in an immune response against the organism's own tissues and cells.
  • Exemplary autoimmune diseases and/or suspected autoimmune diseases include, but are not limited to, Acute disseminated encephalomyelitis (ADEM), Addison's disease, Alopecia universalis, Ankylosing spondylitisis, Antiphospholipid antibody syndrome (APS), Aplastic anemia, Autoimmune hemolytic anemia, Autoimmune hepatitis, Autoimmune inner ear disease (AIED), Autoimmune lymphoproliferative syndrome (ALPS), Autoimmune oophoritis, Balo disease, Behcet's disease, Bullous pemphigoid, Cardiomyopathy, Chagas' disease, Chronic fatigue immune dysfunction syndrome (CFIDS), Chronic inflammatory demyelinating polyneuropathy, Crohn's disease, Cicatrical pemphigoid, Coeliac sprue-dermatitis herpetiformis, Cold agglutinin disease, CREST syndrome, Degos disease, Diabetes mellitus, Discoid lupus, Dys
  • Hidradenitis suppurativa Idiopathic and/or acute thrombocytopenic purpura, Idiopathic pulmonary fibrosis, IgA neuropathy, Interstitial cytisis, Juvenile arthritis, Kawasaki's disease, Lichen planus, Lupus erythematosus, Lyme disease, Meniere disease, Mixed connective tissue disease (MCTD), Multiple sclerosis, Myasthenia gravis, Neuromyotonia, Opsoclonus myoclonus syndrome (OMS), Optic neuritis, Ord's thyroiditis, Osteoarthritis, Pemphigus vulgaris,
  • Pernicious anemia Polyarthritis, Polychondritis, Polymyositis and dermatomyositis, Primary biliary cirrhosis, Psoriasis, Polyarteritis nodosa, Polyglandular syndromes, Polymyalgia rheumatica, Primary agammaglobulinemia, Raynaud phenomenon, Reiter's syndrome,
  • tissue/organ transplantation may cause acute tissue damage and pathfinder cells, extracellular secretomes (e.g., microvesicles) and associated micro R As disclosed herein may be administered into an organ/tissue transplant recipient to stimulate tissue repair, regeneration, reconstitution, remodeling, and/or inducing immune tolerance, thereby alleviating transplantation stress.
  • tissue/organ transplantation may cause acute tissue damage and pathfinder cells, extracellular secretomes (e.g., microvesicles) and associated micro R
  • extracellular secretomes e.g., microvesicles
  • associated micro R extracellular secretomes
  • the present invention may be used to facilitate any organ transplantation including, but not limited to, heart, kidney, liver, lung, pancreas, intestine, thymus, and skin transplantation.
  • methods and compositions of the present invention are used to treat or ameliorate a disease, disorder, or condition associated with graft rejection.
  • graft rejection may result from functional immune cells in a recipient recognizing a donor organ or tissue as a foreign entity and mounting of an immunologic attack on the donor organ or tissue.
  • graft rejection arises in an acute phase following transplantation of donor organs or tissues to a recipient.
  • graft rejection arises in a chronic phase following transplantation of donor organs or tissues to a recipient. It is to be understood that the present invention encompasses methods and compositions for treatment of acute and/or chronic graft rejection.
  • graft versus host disease may result from functional immune cells in a transplanted tissue or organ from a donor recognizing the recipient as a foreign entity and mounting an immunologic attack on the recipient's cells and/or tissues.
  • GVHD may result from functional immune cells in a transplanted tissue or organ from a donor recognizing the recipient as a foreign entity and mounting an immunologic attack on the recipient's cells and/or tissues.
  • GVHD arises in an acute phase following transplantation of donor organs or tissues to a recipient.
  • GVHD arises in a chronic phase following transplantation of donor organs or tissues to a recipient. It is to be understood that the present invention encompasses methods and compositions for treatment of acute and/or chronic GVHD.
  • pathfinder cells or their extracellular secretomes induce immune tolerance and thus are particularly useful in treating inflammation and suppressing, inhibiting or reducing transplantation associated stress.
  • the pathfinder cells or their extracellular secretomes induce immune tolerance by inducing increased IL-2 response, resulting in expansion of regulatory T cells (e.g., increased level and/or activity of T regulatory cells), decreased level and/or activity of cytotoxic T cells and/or helper T cells, and/or suppression of T cell or non T cell lymphocyte responses.
  • pathfinder cells or their extracellular secretomes suppress pro-inflammatory and/or anti-angiogenic cytokine or chemokine response.
  • Pro-inflammatory and/or anti-angiogenic cytokines or chemokines are well known in the art.
  • Exemplary pro-inflammatory and/or anti- angiogenic cytokines or chemokines include, but are not limited to, IL-4, IL-5, IL-6, IL-10, IL- 12, IL-13, IL-17, GMCSF, TGF- ⁇ , TNF-a, IFN- ⁇ , MCAF, and MIP1.
  • cells or their extracellular secretomes e.g., microvesicles
  • MSCs Mesenchymal stem cells
  • pathfinder cells reduce the expression or activity of IL-4, IL-6 and/or IL-10
  • MSCs are known to increase the expression or activity of IL-4, IL-6 and IL-10.
  • Table 7 cells or their extracellular secretomes (e.g., microvesicles) increase anti-inflammatory and/or pro-angiogenic cytokine or chemokine response.
  • Anti-inflammatory and/or pro-angiogenic cytokines or chemokines are known in the art.
  • Exemplary antiinflammatory and/or pro-angiogenic cytokines or chemokines include, but are not limited to, IL- 1 ⁇ , GSCF, and IL-8.
  • severe adverse effects include, but are not limited to, substantial immune response, toxicity, or death.
  • substantial immune response refers to severe or serious immune responses, such as adaptive T-cell immune responses.
  • inventive methods according to the present invention do not involve concurrent immunosuppressant therapy (i.e., any immunosuppressant therapy used as pre -treatment/pre-conditioning or in parallel to the method).
  • immunosuppressant therapy i.e., any immunosuppressant therapy used as pre -treatment/pre-conditioning or in parallel to the method.
  • inventive methods according to the present invention do not involve an immune tolerance induction in the subject being treated. In some embodiments, inventive methods according to the present invention do not involve a pre-treatment or preconditioning of the subject using T-cell immunosuppressive agent.
  • pathfinder cells or their extracellular secretomes can mount an immune response against these agents.
  • Immune tolerance may be induced using various methods known in the art. Any immunosuppressant agent known to the skilled artisan may be employed together with a combination therapy of the invention.
  • immunosuppressant agents include but are not limited to cyclosporine, FK506, rapamycin, CTLA4-Ig, and anti-TNF agents such as etanercept (see e.g.
  • the anti-IL2 receptor (.alpha.- subunit) antibody daclizumab (e.g. Zenapax.TM.), which has been demonstrated effective in transplant patients, can also be used as an immunosuppressant agent (see e.g. Wiseman et al, 1999, Drugs 58, 1029-1042; Beniaminovitz et al, 2000, N. Engl J. Med. 342, 613-619; Ponticelli et al, 1999, Drugs R. D.
  • Additionalimmunosuppressant agents include but are not limited to anti-CD2 (Branco et al., 1999, Transplantation 68, 1588-1596; Przepiorka et al, 1998, Blood 92, 4066-4071), anti-CD4 (Marinova-Mutafchieva et al, 2000, Arthritis Rheum. 43, 638-644; Fishwild et al, 1999, Clin. Immunol.
  • methods and compositions e.g., pathfinder cells, cells differentiated from pathfinder cells, microvesicles and/or microRNAs
  • methods and compositions may be used to treat diseases, disorders, or conditions in various tissues including, but not limited to, central nervous system (CNS), peripheral nervous system, cardiovascular system, respiratory system, gastrointestinal tract and associated glands, integumentary system, musculoskeletal system, and other systems of the body.
  • CNS central nervous system
  • methods and compositions according to the present invention may be used to treat age-related degeneration as well as progerias.
  • methods and compositions according to the present invention may be used to treat inflammation.
  • cells and/or microRNAs according to the present invention may be suitable for cosmetic uses or for treating a condition or disorder associated with a cosmetic surgical procedure.
  • Examples of CNS-related diseases, disorders or conditions that may be treated by the methods and compositions of the present invention include motor neuron disease, multiple sclerosis, degenerative diseases of the CNS, dementive illnesses such as Alzheimer's disease, age related dysfunction of the CNS, Parkinson's disease, cerebrovascular accidents, epilepsy, temporary ischaemic accidents, disorders of mood, psychotic illnesses, specific lobe dysfunction, pressure related injury, cognitive dysfunction or impairments, deafness, blindness anosmia, diseases of the special senses, motor deficits, sensory deficits, head injury and trauma to the CNS.
  • Methods and products of the present invention may also be used to enhance brain function or ameliorate deficiencies at a functional level or to facilitate post surgical repair of the CNS.
  • Examples of diseases, disorders or conditions of the cardiovascular system that may be treated by the methods and compositions of the present invention include arrhythmias, myocardial infarction and other heart attacks, pericarditis, congestive heart diseases, valve- related pathologies, myocardial, endocardial and pericardial dysfunctions or degeneration, age- related cardiovascular disorders, dysfunctions, degeneration or diseases, sclerosis and thickening of valve flaps, fibrosis of cardiac muscle, decline in cardiac reserve, congenital defects of the heart or circulatory system, developmental defects of the heart or circulatory system, repair of hypoxic or necrotic damage, blood vessel damage and cardiovascular diseases or dysfunction (e.g., angina, dissected aorta, thrombotic damage, aneurysm, atherosclerosis, emboli damage and other problems associated with blood flow, pressure or impediment).
  • arrhythmias e.g., myocardial infarction and other heart attacks
  • pericarditis congestive heart diseases
  • Methods and compositions of the present invention may also be used to enhance cardiovascular function or health and to revascularise tissues. Moreover, methods and compositions of the present invention may be used to repair, modify, enhance or regenerate traumatic damage to the heart or blood vessels and as a technique to enhance the transplantation/implantation of a whole organ or its parts. Examples of this latter embodiment include heart transplantation, valve replacement surgeries, implantation of prosthetic devices and the development of novel surgical techniques.
  • diseases, disorders or conditions of the respiratory system include damage, pathology, ageing and trauma of the nose and paranasal sinuses, nasopharynx, oropharynx, laryngopharynx, larynx, vocal ligaments, vocal cords, vestibular folds, glottis, epiglottis, trachea, mucocilliary mucosa, trachealis muscle, primary bronchi, lobar bronchi, segmental bronchi, terminal bronchioles, respiratory zone structures and plural membranes.
  • Examples of such damage include obstructive pulmonary diseases, restrictive disorders, emphysema, chronic bronchitis, pulmonary infections, asthma, tuberculosis, genetic disorders (e.g., cystic fibrosis), gas exchange problems, burns, barotraumas and disorders affecting blood supply to the respiratory system.
  • Methods and medicaments of the present invention may also be used to repair, modify, enhance or regenerate the respiratory system following damage.
  • methods and compositions of the present invention may be used as a technique to enhance the transplantation/implantation of whole respiratory structures or organs or their parts.
  • Examples of diseases, disorders or conditions of the gastrointestinal tract and associated glands that may be treated by the methods and medicaments of the present invention include disorders, damage and age related changes of both the gastrointestinal tract and the large accessory glands (liver and pancreas), salivary glands, mouth, teeth, oesophagus, stomach, duodenum, jejunum, ileum, ascending colon, transverse colon, descending colon, sigmoid colon, rectum and anal canal and enteric nervous system of the canal.
  • these disorders, damage and age related changes include dental caries, periodontal disease, deglutition problems, ulcers, enzymatic disturbances/deficiencies, motility problems, paralysis, dysfunction of absorption or absorptive surfaces, diverticulosis, inflammatory bowel problems, hepatitis, cirrhosis and portal hypertension.
  • Methods and medicaments of the present invention may also be used to repair, modify, enhance or regenerate the gastrointestinal tract following damage, or be used as a technique to enhance any of these processes following surgery, such as resection of the stomach, ileostomy and reconstructive surgery (eg ileoanal juncture).
  • Examples of this latter embodiment include reconstructive surgery involving specific anatomical structures of the mouth, such as labia, vestibule, oral cavity proper, red margin, labial frenulum, hard palate palatine bones, soft palate, uvula, tongue, intrinsic muscles of the tongue and extrinsic muscles of the tongue.
  • specific anatomical structures of the mouth such as labia, vestibule, oral cavity proper, red margin, labial frenulum, hard palate palatine bones, soft palate, uvula, tongue, intrinsic muscles of the tongue and extrinsic muscles of the tongue.
  • diseases, disorders or conditions of the integumentary system that may be treated by the methods and medicaments of the present invention include disorders, damage and age related changes of the skin and integumentary system, such as age related decline in thickness or function, disorders of sweat gland and sebaceous glands, piloerectile dysfunction, follicular problems, hair loss, epidermal disease, diseases of the dermis or hypodermis, burns, ulcers, sores and infections.
  • Methods and products of the present invention may also be used to enhance, regenerate or repair skin structures or functions, for example in plastic reconstruction, cosmetic repair, tattoo removal, wound healing, modulation of wrinkles and in the treatment of striae, seborrhoea, rosacea, port wine stains, skin colour and the improvement of blood supply to the skin.
  • methods and products of the present invention may be used to enhance skin grafts, surgical reconstruction, cosmetic surgical procedures, wound healing and cosmetic appearance.
  • diseases, disorders or conditions of the musculoskeletal system that may be treated by the methods and products of the present invention include disease, damage and age related changes of the musculoskeletal system.
  • these may be in components of the axial skeleton, including the skull, cranium, face, skull associated bones, auditory ossicles, hyoid bone, sternum, ribs, vertebrae, sacrum and coccyx.
  • the appendicular skeleton including the clavicle, scapula, humerus, radius, ulna, carpal bones, metacarpal bones, phalanges (proximal, middle, distal), pelvic girdle, femur, patella, tibia, fibula, tarsal bones and metatarsal bones.
  • Methods and compositions of the present invention may also be used to correct problems associated with ossification and osteogenesis, such as intramembranous ossification, endochondral ossification, bone remodelling and repair, osteoporosis, osteomalacia, rickets, pagets disease, rheumatism and arthritis.
  • methods and products of the present invention may be used to treat disease, damage and age related changes of the skeletal muscle, elastic cartilages, fibrocartilages, long bones, short bones, flat bones and irregular bones.
  • the present invention may be used to enhance function or treat disease, damage and age related changes in other systems of the body, including special senses, endocrine system, lymphatic system, urinary system,
  • Methods and compositions of the present invention may be used to treat, ameliorate, reduce or compensate for general age-related degeneration. Similarly, methods and compositions of the present invention can be used to retain youthful functions of the body.
  • methods and products of the present invention may be used to treat specific age related system dysfunction, such as cognitive impairment, hearing loss, loss of visual activity, endocrine imbalances, skeletal changes and loss of reproductive function.
  • methods and compositions of the present invention may be used to prevent or reduce scars at a site of injury or infection.
  • cells or microRNAs may be employed to regenerate tissue that would otherwise scar or necrotize, including hepatic tissue in the treatment of hepatic fibrosis and/or cirrhosis, facial epidermal tissue to treat acne, and cardiac tissue in the treatment of ischemic infarction.
  • methods and compositions e.g., cells and/or microRNAs
  • methods and compositions may be used to enhance breast augmentation following mastectomy.
  • the present invention provides pharmaceutical compositions comprising a therapeutically effective amount of cells and/or microRNAs for the treatment of various diseases, disorders or conditions described herein.
  • Provided compositions typically comprise a therapeutically effective amount of cells (e.g., pathfinder cells, cells differentiated from pathfinder cells, and/or microRNAs associated with pathfinder cells) and a pharmaceutically acceptable carrier.
  • a therapeutically effective amount of cells and/or microRNAs for the treatment of an acute condition e.g, myocardial infarct, renal ischemia, stroke, renal failure, liver failure, and complications of Type I diabetes.
  • the term "pharmaceutically acceptable carrier” includes carriers that are approved by a regulatory agency of government or listed in the United States Pharmocopeia, the European Pharmocopeia, the United Kingdom Pharmocopeia, or other generally recognized pharmocopeia for use in animals, and in particular humans.
  • carrier refers to a diluent, adjuvant, excipient, or vehicle with which a therapeutic agent (e.g., cells and/or microRNAs) is administered.
  • compositions comprising cells
  • cells are enriched from their source material or culture.
  • the terms "isolation” or “isolating” in conjunction with cells are interchangeably used with the terms “enrichment” or “enriching,” and refer to one or more process steps that result in an increase of the fraction of cells in a sample or solution as compared to the fraction of cells in the material or culture from which it was derived.
  • Pathfinder cells and/or cells that are differentiated from pathfinder cells
  • physical properties of pathfinder cells may be employed to separate them from a medium or other source material.
  • cells may be separated on the basis of size (e.g., filtration, molecular sieving, etc), density (e.g., regular or gradient centrifugation), or Svedberg constant (e.g., sedimentation with or without external force, etc).
  • cells are isolated or purified by centrifugation.
  • the percentage of desired cells (e.g., pathfinder cells and/or cells differentiated from pathfinder cells) in a population of cells is assessed by methods based on one or more distinctive biological properties or set of biological properties of those cells.
  • Especially suitable assessment methods may employ surface markers (e.g., for precipitation, reversible binding to solid phase, (fiuorescence-activated cell sorting) FACS analyses or sorting, specific ligand binding, non-specific ligand binding such as annexin V, etc.).
  • cells having a particular set of characteristics e.g., cell surface biomarker profile
  • are selected for using cell separation methods known in the art e.g., marker-based cell separation methods).
  • a composition of cells comprising mostly or only cells of a desired type (e.g., pathfinder cells and/or cells differentiated from pathfinder cells) is obtained.
  • cells are reconstituted in a suitable solution (such as pharmaceutically acceptable diluent or carrier) such that the cells are present in the solution at a known concentration.
  • a suitable solution such as pharmaceutically acceptable diluent or carrier
  • the known concentration is chosen for convenience for dosing.
  • the known concentration is a concentration at which cells are known to be stable (e.g., retain viability and/or their therapeutic properties) for at least a period of time under clinically approved storage conditions.
  • Provided compositions may also contain minor amounts of wetting agents, emulsifying agents, and/or pH buffering agents.
  • compositions can take any of a variety of solid, liquid, or gel forms, including solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained-release formulations, and the like.
  • suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences” by E.W. Martin.
  • Compositions will generally contain a
  • compositions for intravenous administration may be formulated as solutions in sterile isotonic aqueous buffer. Such compositions may also include a solubilizing agent and/or a local anesthetic such as lidocaine (also known as lignocaine, xylocaine, or xylocard) to ease pain at the site of injection.
  • compositions for topical and/or local use may be formulated, for example, as a lotion or cream comprising a liquid or semi-solid oil-in- water or water-in-oil emulsion and ointments. Such compositions may also comprise a preservative.
  • compositions for delivery to the eye include may be formulated, for example, as eye drops that comprise the active ingredient in aqueous or oily solution and eye ointments that may be manufactured in sterile form.
  • Compositions for delivery to the nose may be formulated, for example, as aerosols or sprays, coarse powders to be rapidly inhaled, or nose drops that comprise the active ingredient (e.g., cells and/or microR As) in aqueous or oily solution.
  • compositions for local delivery to the buccal cavity may be formulated, for example, as lozenges that comprise the active ingredient in a mass generally formed of sugar and gum arabic or tragacanth, and pastilles that comprise the active ingredient in an inert mass (for example of gelatine and glycerine or sugar and gum arabic). Flavoring ingredients may be added to lozenges or pastilles.
  • Aerosol and spray formulations may comprise, for example, a suitable
  • Aerosol and spray formulations may be mixed with a propellant gas, such as an inert gas under elevated pressure or with a volatile liquid (e.g. , a liquid that boils under normal atmospheric pressure below customary room temperature, for example from -30 to +10 °C).
  • a propellant gas such as an inert gas under elevated pressure or with a volatile liquid (e.g. , a liquid that boils under normal atmospheric pressure below customary room temperature, for example from -30 to +10 °C).
  • cells, miRNAs, or a pharmaceutical composition thereof will generally be administered in such amounts and for such a time as is necessary or sufficient to achieve at least one desired result.
  • cells or miRNAs can be administered in such amounts and for such a time that it amelioriates one or more symptoms of a disease, disorder, or condition; prolongs the survival time of patients; or otherwise yields clinical benefits.
  • a dosing regimen according to the present invention may consist of a single dose or a plurality of doses over a period of time.
  • Administration may be, e.g., one or multiple times daily, weekly (or at some other multiple day interval), biweekly, monthly, or on an intermittent schedule. Typically an effective amount is administered.
  • the effective amount of cells, microRNAs, or a pharmaceutical composition thereof, will vary from subject to subject and will depend on several factors (see below).
  • Cells, microRNAs, or pharmaceutical compositions thereof may be administered using any administration route effective for achieving the desired therapeutic effect. Both systemic and local routes of administration may be used in accordance with methods of the invention. Suitable routes of administration include, but are not limited to, intravenous, intraarterial, intramuscular, subcutaneous, cutaneous (e.g., topical), intradermal, intracranial, intrathecal, intrapleural, intra-orbital, intranasal, oral, intra-alimentary (e.g. , via suppository), colorectal (e.g., via suppository), and intra-cerebrospinal.
  • routes of administration include, but are not limited to, intravenous, intraarterial, intramuscular, subcutaneous, cutaneous (e.g., topical), intradermal, intracranial, intrathecal, intrapleural, intra-orbital, intranasal, oral, intra-alimentary (e.g. , via suppository), colorectal (e
  • effective doses may be calculated according to, e.g. , the body weight and/or body surface area of the patient, the extent of damaged or diseased tissue, etc.. Optimization of the appropriate dosages can readily be made by one skilled in the art, e.g. , by a clinician.
  • the final dosage regimen is typically determined by the attending physician, considering various factors that might modify the action of the cells, miRNAs, or pharmaceutical compositions thereof (collectively referred herein as "drug"), e.g., the drug's specific activity, the severity of tissue damage and the responsiveness of the patient, the age, condition, body weight, sex and diet of the patient, the severity of any present infection, time of administration, the use (or not) of other therapies, and other clinical factors.
  • drug e.g., the drug's specific activity, the severity of tissue damage and the responsiveness of the patient, the age, condition, body weight, sex and diet of the patient, the severity of any present infection, time of administration, the use (or not) of other therapies, and other clinical factors.
  • dosing is given by number of cells per body weight of the individual to which cells are administered. In some embodiments, approximately lx 10 6 to 3 x 10 8 cells per kg per dose are administered. In some embodiments, approximately 1 x 10 6 to approximately 3 x 10 8 , approximately 1 x 10 7 to approximately 3 x 10 8 , or approximately 3 x 10 7 to approximately 3 x 10 8 cells are administered per kg per dose. In some embodiments, dosing is not calculated based on body weight and/or dosing is not calculated based on number of cells administered. For example, in some embodiments, a standard unit may be developed based on effectiveness in a particular measure for a particular condition. Alternatively or additionally, in some embodiments, recommended dosages are developed for adult and/or child individuals without regard to body weight.
  • Example 1 Stimulation of repair by pancreas-derived pathfinder cell (PDPC) in a kidney ischemic damage model
  • PDPCs can stimulate repair in a model of renal ischemic reperfusion injury that has direct relevance to acute renal failure and decreased allograft survival in the context of kidney transplantation.
  • PDPCs were isolated and cultured from male rats as previously described, for example, in International Patent Publications WO 2006/120476 and WO 2009/136168, the entire contents of each of which are incorporated by reference. Rat PDPCs were counted and reconstituted in phosphate-buffered saline solution (PBS) and injected into the tail vein of mice after renal ischemia. Varied cell treatment regimens were used depending on the experiment. (See below.)
  • PBS phosphate-buffered saline solution
  • Control animals were given an injection of saline or an equivalent number of
  • Renal function was monitored for two weeks after the ischemic event by determining serum creatinine levels and the urinary protein to creatinine ratio (UPCR).
  • UPCR urinary protein to creatinine ratio
  • Increased levels of these markers correspond to increased extent of tissue damage. Serum and urine samples were collected at two weeks after renal ischemia. Creatinine levels were measured using a creatinine analyzer and UPCR was determined by standard methodology.
  • Kidney tissue was either frozen or fixed in 4% formalin overnight and then embedded in OCT embedding medium.
  • Paraffin-embedded kidneys were sectioned and stained with periodic acid-Schiff or hematoxylin and eosin using standard protocols. To assess tubular injury in periodic acid-Schiff-stained sections, the percentage of cortical tubules was scored by a reviewer blind to the identity of each sample, using a semiquantitative scale as previously described. (See, e.g., Ramesh et al. (2004) "Inflammatory cytokines in acute renal failure," Kidney Int. SuppL, S56-S61 and Ramesh et al.
  • Apoptosis was evaluated by TUNEL staining of kidney sections as follows using a Chemicon ApopTag Plus Peroxidase In Situ Apoptosis Detection Kit (S7101). Frozen kidney sections were fixed by incubating slides in 95% ethanol for 10 minutes and then allowed to air dry. Slides were stored at 4 °C until further use. Sections were rehydrated at room temperature in DPBS for 10 minutes and then digested by incubation in Proteinase K (20 ⁇ g/mL) at 25 °C for 15 minutes, then washed twice in dH 2 0 for 2 minutes each.
  • Sections were treated with H 2 0 2 for 5 minutes at room temperature on a stirrer, washed in 1 x TBS (Tris-buffered saline), and then incubated in equilibration buffer at 25 °C for 10 minutes in a humidified chamber. After removal of equilibration buffer, sections were incubated in a TdT enzyme solution (Chemicon; Rosemont, Illinois) at 37 °C for 1 hour in a humidified chamber. Slides were placed in a stop/wash buffer and agitated for 15 seconds, then washed for 10 minutes on a stirrer at room temperature.
  • TBS Tris-buffered saline
  • pl6ink4a staining a mouse monoclonal antibody against pl6 (F12, Santa).
  • the Vector Mouse on Mouse (MOM) Peroxidase Kit Vector #Pk- 2200 was used.
  • a biotinylated anti-mouse IgG (H+L) antibody from Vector MOM kit was used as the secondary antibody. Immunohistochemical staining was performed according to the Vector protocol for the MOM kit.
  • HRP horseradish peroxidase
  • DAKO horseradish peroxidase-conjugated goat anti-rabbit IgG secondary antibody
  • Gal 5 mM potassoium ferricyanide , 5 mM potassium ferrocyanide, 2 mM MgCl 2 , 150 mM NaCl, and 40 mM (citric acid/sodium phosphate solution) were prepared in phosphate-buffered solution (PBS), one using a citric acid/sodium phosphate solution at pH 6.0 and the other using a citric acid/sodium phosphate solution at pH 4.0. Sections were stained in the pH 6.0 solution (except for positive controls, which were stained with the pH 4.0 solution) at 37 °C for approximately 48 hours.
  • PBS phosphate-buffered solution
  • Sections were washed in running water and counterstained in a filtered Aluminum Potassium Sulphate Dodecahydrate (50 g/L) and Nuclear Fast Red (1 g/L) solution for 30 seconds, then washed, dehydrated, and mounted according to standard procedures.
  • FISH Fluorescence in situ hybridization
  • Tissue sections were then digested in pepsin (DAKO; Carpenteria, CA) at 37 °C for 25 minutes. Pepsin was quenched in 0.2% glycine for 5 minutes at room temperature. Slides were washed in TBS and then incubated in 4% paraformaldehyde for 5 minutes at room temperature.
  • pepsin DAKO; Carpenteria, CA
  • a small-scale preliminary experiment was carried out using 2 ischemic controls and 2 rat PDPC-treated mice. Ischemia was carried out for 20 minutes to mimic a conservative damange level, and rat PDPCs were delivered 24 hours after ischemic damage. 1.5 x 10 6 cells were used for each injection, with one injection given at 24 hours post ischemia and second injection given 7 days post ischemia. Data from this preliminary experiment were suggestive of a beneficial effect from PDPCs. Although no significant improvement in serum creatinine levels were observed at 1 week after surgery, the UPCR was decreased in PDPC- treated mice, indicating less tubular epithelium damage. Decreased damage was confirmed by histological analyses.
  • Group A Saline only injection at 24 hours after ischemia.
  • Group B 1.5 x 10 6 rat PDPCs were injected 24 hours after ischemia and again at 7 days
  • Group C 1.5 x 10 6 rat PDPCs were injected immediately after ischemia and again at 7 days
  • Group D 3 x 10 6 rat PDPCs were injected 24 hours after ischemia.
  • PDPC treatment regimens resulted in statstically significant benefits for maintenance of kidney function and tissue integrity.
  • Apoptosis in kidneys were evaluated by TUNEL-staining of tissue sections.
  • renal ischemic mice were assigned into one of four groups. In addition to control ischemic mice injected with saline only, groups of mice were subject to various treatment regimens as follows.
  • Group A Saline only injection at 24 hours after ischemia (6 mice).
  • Group B 1.5 x 10 6 rat PDPCs were injected 24 hours after ischemia and again at 7 days (5 mice).
  • Group C 3 x 10 6 rat PDPCs were injected 24 hours after ischemia (3 mice).
  • Group D 1.5 x 10 6 rat PDPCs were injected immediately after ischemia and again at 7 days (4 mice).
  • Pathfinder cells can stimulate repair in a tissue that is not the same as the tissue of origin of Pathfinder cells. Furthermore, Pathfinder cells can alleviate acute damage to kidneys that have undergone ischemic stress. These findings support a potential for Pathfinder cells in treating acute conditions such as acute kidney damage and in alleviating transplantation stress.
  • Example 2 Stimulation of repair by PDPCs in a cardiac ischemic damage model
  • PDPCs can stimulate repair in an established model of cardiac ischemic damage with directed relevance to acute myocardial infarction (MI).
  • MI acute myocardial infarction
  • cTnT plasma cardiac troponin T
  • mice were anesthetized. A midline incision was made from the xiphoid process to the submentium. After separating the salivary glands, a tracheotomy was performed by inserting a polyethylene tube carefully into the trachea. The tube was taped in place to prevent dislodgment and connected to a rodent ventilator. After ventialtion was started, the chest was opened by a lateral cut along the left side of the sternum. Large intercostal blood vessels were coagulated using an electrocautery. The chest walls were retracted to better visualize the heart.
  • LAD left descending artery
  • PDPCs were isolated from rats and transplated into mouse hosts as described in
  • FS left ventricle size and fractional shortening
  • Cardiac function was also assessed by taking and analyzing electrocardiograms. Cardiac troponin (cTnT) measurements
  • Cardiac troponin (cTnT) levels in plasma were measured weekly using protocols as described in Metzler et al. (2002).
  • a quantitative rapid cTnT assay available from Roche Diagnostics (Cardiac T, Troponin T quantitative, Cardiac Reader) was used according to manufacturer's instructions.
  • FISH Fluorescence in situ hybridization
  • FISH was conducted to examine the number, location, and nature of rat cells remaining and the extent and location of any senescent tissue using protocols as described in Example 1.
  • mice in which cardiac ischemia was induced were assigned to one of three groups as folllows:
  • Group A No treatment (4 mice)
  • Group B Saline injection at 24 hours after infarct induction (6 mice)
  • Group C 1.5 x 10 6 PDPCs were injected 24 hours after infarct induction (6 mice)
  • the p-value for the difference in LVESD in PDPC-treated versus saline treated groups is at the 0.032 level (0.096 with Bonferroni correction). Analyses including all 6 mice in the PDPC-treated group is expected to show p-values consistently less than 0.05.
  • mice in which cardiac ischemia was induced were assigned to one of three groups as folllows:
  • Group B Saline injection at 24 hours after infarct induction (10 mice)
  • Group C 1.5 x 10 6 PDPCs were injected 24 hours after infarct induction (6 mice)
  • cTnT levels were not significantly different between the treatment groups, indicating that infarct sizes were comparable across all ischemic mice. Cardiac function was assessed two weeks after surgery. As determined by analyses of PDPC-treated mice, FS (fractional shortening), LVEDD (left ventricle diastolic diameter), and LVESD (left ventricle systolic diameter) data showed statistically significant improvements in cardiac function after PDPC treatment ( Figures 9, 10, and 11, respectively). The p-value for the difference in FS in PDPC-treated versus no treatment controls was ⁇ 0.001. The p-value for the difference in LVEDD in PDPC-treated versus saline treated groups was 0.013. The p-value for the difference in LVESD in PDPC-treated versus saline treated groups was ⁇ 0.001. [0217] Typically, recovery is considered successful when patients achieve an FS of over
  • mice attain levels of FS well within the range regarded as normal after clinical recovery in human patients, namely up to 40-45%.
  • Pathfinder cells in treating acute myocardial infarct.
  • PDPCs can stimulate reconstitution of the blood system.
  • NOG mice were irradiated at a level to which they would not normally recover
  • Three irradiated NOG mice were administered 1.5 x 10 6 PDPCs intravenously (by tail vein injection-yes) immediately after irradiation; two of these mice received rat PDPCs and one of these mice received human PDPCs. Three irradiated NOG mice were given saline as controls.
  • mice lived well beyond the survival time until they contracted a laboratory virus infection at beyond 56 days post-irradiation and died. These results demonstrated that PDPC-treated mice were able to produce blood cells and reconstitute their blood system. [0222] It was not possible to obtain high quality DNA from the mouse carcasses.
  • mice [0224] A further set of experiments is performed on male NOD/SCID (non obese diabetic/severe combined immunodeficient) mice.
  • Experimental groups include:
  • Group A a control group of unirradiated mice, injected with saline
  • Group B a control group of irradiated mice, injected with saline
  • Group C a control group of irradiated mice, administered 1.5 x 10 6 mouse NOD/SCID bone marrow cells
  • Group D an experimental group of irradiated mice, administered 1.5 x 10 6 rat PDPCs.
  • the experiment is terminated at a definitive timepoint (e.g., 14 days or later) after injection, or when a mouse's body weight falls under 40% 50%> of body weight at the beginning of the experiment. Survival time is noted and used as an indicator of reconstitution of the blood system.
  • Blood samples are collected and analyzed by FACS for rat- specific blood cell markers to determine the extent, if any, of contribution from rat PDPCs to the reconstituted blood cell population. Additionaly FACS analyses and/or PCR analyses may be used to (1) determine cell origin and/or (2) verify production of functional blood cells.
  • Examples 1-3 demonstrate that PCs enhance the survival and repair of various tissues in several in vivo models of acute damage in various tissues. No tumors formed in any of the models. The data thus far indicate that PCs themselves do not contribute a significant percentage of the repaired tissue population, but rather, stimulate repair of damaged host cells.
  • Example 4 Efficacy of kidney-derived Pathfinder cells (KDPCs) in a streptozocin (STZ)- induced diabetes model
  • mice Female mice were made diabetic by administration of 250 mg/kg streptozocin
  • Table 2 Blood glucose levels in control animals and KDPC-treated mice
  • KDPCs appear to act similarly to PDPCs, indicating that PCs are not restricted to the pancreas.
  • KDPCs would show similar repair stimulatory effects in acute models of damage as PDPCs have, and would be useful in reconstituting an immune system.
  • Example 5 - PDPC effects in the non-obese diabetic (NOD) mouse type I diabetes model
  • compositions of the present invention can be used to treat acute complications of chronic diseases.
  • the present Example demonstrates that PDPCs can stabilize glucose blood levels in non-obese diabetic (NOD) mice treated with PDPCs.
  • NOD non-obese diabetic
  • the NOD model is widely accepted as a much closer model of human Type I diabetes than chemical damage models such as STZ (streptozocin).
  • STZ streptozocin
  • the NOD mouse also allows further investigation of how repair-stimulatory effects of pathfinder cells can be established and maintained in the face of pre-existing immune attack.
  • NOD mice become spontaneously diabetic as they age. Diabetes can also be induced. In the present Example, diabetes was allowed to develope spontaneously. Animals were entered into a trial with rat PDPC delivery as they became diabetic. The trial is currently underway.
  • NOD mice were divided into three groups (1) untreated, (2) treated with PDPCs, and (3) treated with PDPCs and cyclosporin A (CsA, an immunosuppressant). Each group consisted of six mice each. In groups (2) and (3), PDPCs were administered intravenously by tail vein injection. CsA was also administered for group (3) animals at the time of PDPC administration.
  • CsA cyclosporin A
  • mice in Group I are still in the study and do not yet show elevated glucose levels (indicating development of diabetes).
  • the other mice in the study (including all mice in groups 2 and 3) developed diabetes according to one of two patterns: intense hyperglycemia with rapid onset or milder hyperglycemia with slower onset.
  • FIGS 12-14 show blood glucose levels in groups 1, 2, and 3 respectively.
  • two of the mice treated with PDPCs (group 2) showed a lowering of blood glucose levels.
  • One of these mice maintained low blood glucose levels until necropsy at day 50; the other of these mice also showed a lowering of blood glucose levels until day 30 of the study, followed by onset of hyperglycemia.
  • No efficacy was observed in group 3 (cells + CsA) animals.
  • Example 6 Morphological examination of pancreas-derived Pathfinder cells (PDPC) and identification of microvesicles (MVs)
  • PDPC pancreas-derived pathfinder cells
  • EM scanning electron microscopy
  • Pathfinder cells were isolated from rat pancreas cultured as previously described.
  • rat PDPCs were grown in medium containing fetal bovine serum (FBS) that was depleted of bovine microvesicles.
  • FBS fetal bovine serum
  • fibroblastoid and small round cell types As can be seen in Figure 15 A, both cell types have very great numbers of thin projections and interconnect with other cells at multiple points in a complex manner. Furthermore, these cells produce large numbers of small spheres on their surfaces, which are identified as nascent microvesicles ( Figure 15B).
  • the flat cell type depicted in Figure 15A is approximately 15-20 ⁇ in diameter, and is the predominant cell type in cultures that were studied.
  • the other cell type is
  • these spherical cells may be derived from a cell that has recently undergone cell division.
  • MVs microvesicles
  • Figure 15B Clusters of MVs were observed in some areas, typically at the end of a cell protrusion. Identified MVs typically had a size range of 300-600 nm in diameter.
  • Protein and mRNA profiles of various Pathfinder cells were studied. Protein and mRNA profiles may facilitate methods of identifying Pathfinder cells and potentially shed light on the mechanism of Pathfinder cell stimulation of repair.
  • Fluorescent antibody staining was performed on a panel of protein markers.
  • Results are presented on Table 1. Markers were noted as positive if in the opinion of an experienced observer the fluorescent signal for the marker is significantly higher in the cells of interest than the background level of fluorescence for the experimental conditions used. Some of the proteins studied are typically found in stem cells, e.g., Oct3/4, Nanog, c-myc, which were found to be expressed in both human PDPCs and kDPCs. Sox2, another stem cell marker, was detectable in hPDPCs but not in hKPDCs. The overall protein expression patterns of hPDPCs and hkDPCs were consistent with that of an "unspecialized" cell type.
  • *CD24 appears to be expressed above background only in small round cells in these cultures.
  • hKDPCs lymph-node derived Pathfinder cells
  • mRNA expression profiles were determined for two large sets of genes by reverse-transcription-PCR (RT-PR) using ABI gene cards for a) genes known to be involved in stem cell pluripotency and b) genes known to be involved in cell cycle control. Tables 4 and 5 summarize results from these mRNA expression profiling experiments. Table 4: mRNA expression results for genes known to be involved in stem cell pluripotency
  • LIN28 has a role in embryo cell differentiation and is a negative regulator of the let-7 miRNA family. Absence of LIN28 thus correlates with high levels of expression of the let-7 mRNA family in Pathfinder cells.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Organic Chemistry (AREA)
  • Developmental Biology & Embryology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Virology (AREA)
  • Epidemiology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • General Physics & Mathematics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Toxicology (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Plant Pathology (AREA)

Abstract

The present invention provides, among other things, improved compositions and methods for the treatment of tissue damage (e.g., acute or chronic) and related diseases, disorders or conditions based on the use of pathfinder cells, extracellular secretomes thereof, and/or pathfinder cell-associated micro RNAs. In some embodiments, the present invention provides a method for treating tissue damage (e.g., acute or chronic) comprising a step of administering a population of cells to an individual suffering from a disease, disorder or condition characterized by acute damage to one or more tissues, wherein the cells are originated from an adult tissue and wherein the cells induce tissue repair, regeneration, remodeling, reconstitution or differentiation. In some embodiments, the present invention provides a method for treating inflammation comprising a step of administering a population of cells, or extracellular secretomes thereof, to an individual suffering from a disease, disorder or condition characterized by inflammation of one or more tissues, wherein the cells are originated from an adult tissue and wherein the cells induce an anti-inflammatory response.

Description

CELLULAR AND MOLECULAR THERAPIES
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to United States Provisional Patent Application serial numbers 61/373,715, filed August 13, 2010 and 61/380,766, filed September 8, 2010, the entirety of each of which is incorporated herein by reference.
[0002] This application relates to US application entitled "Therapeutic Uses of
Microvesicles and Related MicroRNAs" filed on even date, the entirety of which is incorporated herein by reference.
BACKGROUND
[0003] Acute tissue damage may cause serious diseases and dangerous health conditions.
For example, much acute tissue damage is caused by ischemic conditions. Organ ischemia occurs when blood flow to an organ is interrupted, usually by a blood clot or a severe drop in blood pressure. In ischemic strokes, a lack of oxygen flow to the brain can result in apoptosis and necrosis of brain tissue leading to an infarction. Similar to cardiovascular ischemia, brain ischemia can be caused by various factors such as blood clots, thrombosis, embolism, blockage by atherosclerotic plaques, or other obstructions in the vasculature. Hypercholesterolemia, hypertension, diabetes, and obesity, among other things, have been identified as risk factors for ischemic strokes. Ischemic strokes are a leading cause of death of human beings worldwide. In the United States, strokes strikes 700,000 people annually. Of these stroke patients, 40% will die, the equivalent of one death every three minutes. Acute tissue damage may also occur when a tissue is injured or under stressful or traumatic condition, resulting in acute organ failure.
[0004] Traditionally, acute tissue damage is treated by so-called secondary treatment such as organ transplantation and medical and surgical therapies. Although these therapies alleviate symptoms, and may even improve survival, none can reverse the disease process and directly repair the lasting damage. Thus, the cure of diseases, disorders or conditions associated with acute tissue damage remain a major unmet medical need. SUMMARY OF THE INVENTION
[0005] The present invention provides, among other things, cellular and molecular therapies for acute tissue damage and related diseases, disorders and conditions. The present invention encompasses the discovery that multipotent cells may be isolated from various adult tissues and these multipotent cells, also known as "pathfinder cells," showed significant therapeutic effects in various acute tissue damage model in various tissues, including pancreas, kidney, heart and blood system. The present invention further encompasses the discovery that pathfinder cells contain certain specific microRNAs that may function as intercellular regulators involved in cell or tissue repair, regeneration, remodeling, reconstruction, reprogramming, or transdifferentiation, and the discovery that pathfinder cells or their extracellular secretomes (e.g., microvesicles) induce immune tolerance and thus are particularly useful in treating inflammation and suppressing, inhibiting or reducing transplantation associated stress. As shown in the Examples section below, the pathfinder cells induce immune tolerance at least by suppressing pro-inflammatory and/or anti-angiogenic cytokines or chemokines, such as, IL-4, IL-5, IL-6, IL- 10, IL-12, IL-13, IL-17, GMCSF, TGF-β, TNF-a, IFN-γ, MCAF, and MIP1. It was found that pathfinder cells have unexpectedly distinct cytokine or chemokine profiles as compared to Mesenchymal stem cells (MSCs). For example, pathfinder cells according to the present invention reduce the expression or activity of IL-4, IL-6 and/or IL-10, while MSCs increase the expression or activity of IL-4, IL-6 and IL-10. Other distinctions are shown in Table 7. This discovery further confirms that pathfinder cells are distinct from mesenchymal stem cells.
[0006] Thus, in various embodiments, the present invention provides methods and compositions for treating or cure acute tissue damage and related diseases, disorders and conditions based on pathfinder cells and/or associated microRNAs.
[0007] In some embodiments, the present invention provides a method for treating acute tissue damage comprising a step of administering a population of cells to an individual suffering from a disease, disorder or condition characterized by acute damage to one or more tissues, wherein the cells are originated from an adult tissue and wherein the cells induce tissue repair, regeneration, remodeling, reconstitution or differentiation. [0008] In some embodiments, the acute damage is to one or more tissues selected from the group consisting of kidney, heart, liver, lungs, pancreas, brain, intestine, bones, tendons, cornea, skin, muscle, veins, spinal cord, spleen, blood, and combinations thereof. In some embodiments, the acute damage is to kidney and/or heart.
[0009] In some embodiments, the acute damage is ischemic damage. In some embodiments, the acute damage is associated with tissue transplantation. In some embodiments, the acute damage is associated with exposure to radiation and/or chemicals (e.g., in the context of therapy or injury, such as chemical injury to the cornea, skin, or other tissues). In some embodiments, the acute damage is associated with an inflammatory condition.
[0010] In some embodiments, an inventive method according to the present invention is used to treat a disease, disorder or condition selected from the group consisting of myocardial infarct, acute renal failure, type I diabetes, and combination thereof. In some embodiments, the disease, disorder, or condition is characterized by cell apoptosis, aponecrosis, or necrosis. In some embodiments, the disease, disorder, or condition is characterized by inflammation of one or tissues. In some embodimentsm, the disease, disorder, or condition is associated with biological aging.
[0011] In some embodiments, the cells used in a method of the invention are originated from an adult tissue that is distinct from the damaged tissue. In some embodiments, the cells used in a method of the invention are originated from an adult tissue that is from a different species. In some embodiments, the cells used in a method of the invention are originated from a human adult tissue. In some embodiments, the cells used in a method of the invention are originated from a non-human adult tissue. In some embodiments, the cells used in a method of the invention are originated from an autologous adult tissue. In some embodiments, the cells used in a method of the invention are originated from a non-autologous adult tissue. In some embodiments, the adult tissue is selected from the group consisting of pancreas, kidney, breast, lymph node, liver, spleen, myometrium, peripheral blood, chord blood, and bone marrow, and combinations thereof.
[0012] In some embodiments, the cells used in a method according to the invention are first cultivated in a cell culture medium (e.g., serum-containing or serum-free) under conditions and time sufficient for cell proliferation. In some embodiments, the cell culture medium is a Matrigel free culture medium comprising serum. In some embodiments, the cells are first treated to reduce a telomeric attrition rate before the cultivating step.
[0013] In some embodiments, the population of cells is substantially homogenous. In some embodiments, at least 30% (e.g., at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%), 80%), 85%o, 90%), 95%, or more) of the population of cells express one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, or nine or more) markers selected from the group consisting of CD24, c-myc, HLA class 1 ABC, ICAM3, Nestin, Nanog, Oct4, Integrin a2 + bl, Ngn3, and CD130. In some embodiments, the one or more markers comprise Oct4, Nanog, and c-myc. In some embodiments, at least 30% (e.g., at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more) of the population of cells express Nestin. In some embodiments, at least 30%> (e.g., at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more) of the population of cells do not express at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight) marker(s) selected from the group consisting of CD34, CD105, VCAM1, CXCR2, CD44, CD73, ICAM1, and NCAM. In some
embodiments, at least 30% (e.g., at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%), 85%o, 90%), 95%), or more) of the population of cells do not express any of the markers selected from the group consisting of CD34, CD105, VCAM1, CXCR2, CD44, CD73, ICAM1, and NCAM. In some embodiments, the cells used in a method according to the present invention express one or more microRNAs as shown in Table 1. In some embodiments, the cells used in a method according to the present invention express one or more microRNAs as shown in Tables 6-10. In certain embodiments, the cells used in a method according to the present invention express one or more microRNAs as shown in Table 10.
[0014] In some embodiments, the population of cells used in a method constitutes a therapeutically effective amount of cells. In some embodiments, the therapeutically effective amount ranges from approximately 1 x 106 to 3 x 108 cells per kg body weight per dose.
[0015] In some embodiments, the cells are administered intravenously, intra-arterially, intramuscularly, subcutaneously, cutaenously, intradermally, intracranially, intrathecally, intrapleurally, intra-orbitally, intranasally, orally, intra alimentrally, colorectally, and/or intra- cerebrospinally.
[0016] In some embodiments, the cells are administered daily, three times a week, twice a week, weekly, biweekly, monthly, once every two months, once every three months, once every four months, once every five months, once every six months, or once every year.
[0017] In some embodiments, the cells are not administered in conjunction with an immunosuppressant.
[0018] In some embodiments, the present invention provides a method for treating tissue damage (e.g., acute tissue damage) comprising a step of administering to an individual suffering from a disease, disorder or condition characterized by tissue damage a therapeutically effective amount of one or more microR As having a sequence at least 70% (e.g., 75%, 80%>, 85%, 90%, 95%, 96%, 97%, 98%, 99%) identical to any of SEQ ID NOs: 1 to 610 (or any one of SEQ ID NOs: 1 to 225). In some embodiments, the one or more microRNAs comprise a sequence identical to any of SEQ ID NOs: 1 to 610 (or any one of SEQ ID NOs: 1 to 225).
[0019] Among other things, the present invention may be used to facilitate organ transplantation (e.g., heart, kidney, liver, lung, pancreas, intestine, thymus, and skin
transplantation). In some embodiments, the present invention provides a method of organ transplantation comprising a step of administering to an organ transplant recipient a population of cells, wherein the cells are originated from an adult tissue and wherein the cells induce tissue repair, regeneration, remodeling, reconstruction, reprogramming, or transdifferentiation. In some embodiments, the organ transplant recipient is a heart, kidney, liver, lung, pancreas, intestine, thymus, or skin transplant recipient.
[0020] The present invention also provides various pharmaceutical compositions based on cells and/or microRNAs described herein. In some embodiments, the present invention provides a pharmaceutical composition for tissue repair or regeneration comprising a
substantially homogeneous population of cells and a pharmaceutically acceptable carrier, wherein the cells are originated from an adult tissue and wherein the cells induce tissue repair, regeneration, remodeling, reconstruction, reprogramming, or transdifferentiation. Various cells described above in connection with various methods may be used in various embodiments of pharmaceutical compositions.
[0021] In some embodiments, the present invention provides a pharmaceutical composition for tissue repair or regeneration comprising a therapeutically effective amount of one or more microRNAs having a sequence at least 70% (e.g., 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%) identical to any of SEQ ID NOs: 1 to 610 (or any one of SEQ ID NOs: 1 to 225)and a pharmaceutically acceptable carrier. In some embodiments, the one or more microRNAs have a sequence identical to any of SEQ ID NOs: 1 to 610 (or any one of SEQ ID NOs: 1 to 225).
[0022] The present invention is not limited to the treatment of acute tissue damage. It is contemplated that methods and compositions described herein may be used to treat tissue damage in general including both acute and chronic damage and related diseases, disorders, or conditions.
[0023] In some embodiments, the present invention provides a method for treating inflammation comprising a step of administering a population of cells, or extracellular secretomes thereof, to an individual suffering from a disease, disorder or condition characterized by inflammation of one or more tissues, wherein the cells are originated from an adult tissue and wherein the cells induce an anti-inflammatory response. In some embodiments, the extracellular secretoms comprise micro vesicles.
[0024] In some embodiments, the cells induce increased IL-2 response. In some embodiments, the cells induce expansion of regulatory T cells, suppression of T cell responses and/or immune tolerance. In some embodiments, the expansion of regulatory T cells comprises increased level and/or activity of T regulatory cells. In certain embodiments, the cells induce decreased level and/or activity of cytotoxic T cells and/or helper T cells.
[0025] In some embodiments, the cells suppress pro-inflammatory and/or anti-angiogenic cytokine or chemokine response. In certain embodiments, the pro-inflammatory and/or anti- angiogenic cytokine or chemokine is selected from the group consisting of IL-4, IL-5, IL-6, IL- 10, IL-12, IL-13, IL-17, GMCSF, , TGF-β, TNF-a, IFN-γ, MCAF, MIP1, and combinations thereof. In some embodiments, the cells do not increase the expression or activity of IL-4, IL-6 and/or IL-10.
[0026] In some embodiments, the cells increase anti-inflammatory and/or pro-angiogenic cytokine or chemokine response. In certain embodiments, the anti-inflammatory and/or pro- angiogenic cytokine or chemokine is selected from IL-Ιβ, GSCF, IL-8 and combinations thereof.
[0027] In some embodiments, an inventive method according to the present invention is used to treat a disease, disorder or condition selected from acute inflammatory conditions; adult respiratory distress syndrome (ARDS); Airway hyperresponsiveness (AHR); allergy disorders; alopecia areata; ankylosing spondylitis; asthma; atopic inflammatory disorders; autoimmune thyroiditis; bronchial hyperreactivity; cancers; cardiovascular disorders; Chronic Obstructive Pulmonary disease (COPD); cirrhosis; Crohn's disease, Congestive Heart Failure (CHF); colitis; dermatitis; diabetes mellitus (type I); disorders associated with wound healing; end-stage renal disease (ESRD); eosinophilic esophagitis; HIV; Graves' disease; infectious diseases;
inflammatory bowel disease (IBD); inflammatory complications of diabetes mellitus;
inflammatory conditions of the skin, cardiovascular system, nervous system, liver, kidney and pancreas; juvenile rheumatoid arthritis; lupus-associated arthritis; metabolic syndrome; multiple sclerosis; muscle fatigue; myasthenia gravis; neurodegenerative diseases; osteoarthritis; primary billiary cirrhosis; psoriatic arthritis; respiratory disorders; rheumatoid arthritis; sarcoidosis;
scleroderma; Sjogren's syndrome; Systemic Inflammatory Response Syndrome (SIRS)/sepsis; systemic lupus erythematosis; transplant rejection; ulcerative colitis; and/or vasculitis. In some embodiments, the inflammation is associated with Graft- versus-host disease (GVHD). In some embodiments, the inflammation is associated with autoimmune disease. In some embodiments, the inflammation is associated with chronic renal disease. In some embodiments, the
inflammation is associated with osteoarthritis.
[0028] In some embodiments, the individual suffering from a disease, disorder or condition characterized by inflammation of one or more tissues is a mammal. In certain embodiments, the mammal is a human.
[0029] In some embodiments, the adult tissue from which the cells are originated is from a human. In some embodiments, the adult tissue is from a non-human mammal, e.g., selected from a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, and/or a Pig-
[0030] In some embodiments, the adult tissue is selected from the group consisting of bone marrow, liver, blood, heart, brain, gum, eye, skin, breast, chord blood, kidney, lymph node, myometrium, pancreas, peripheral blood, spleen, and combinations thereof.
[0031] In this application, the use of "or" means "and/or" unless stated otherwise. As used in this application, the term "comprise" and variations of the term, such as "comprising" and "comprises," are not intended to exclude other additives, components, integers or steps. As used in this application, the terms "about" and "approximately" are used as equivalents. Any numerals used in this application with or without about/approximately are meant to cover any normal fluctuations appreciated by one of ordinary skill in the relevant art. In certain
embodiments, the term "approximately" or "about" refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%), 2%>, 1%), or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
[0032] Other features, objects, and advantages of the present invention are apparent in the detailed description, drawings and claims that follow. It should be understood, however, that the detailed description, the drawings, and the claims, while indicating embodiments of the present invention, are given by way of illustration only, not limitation. Various changes and modifications within the scope of the invention will become apparent to those skilled in the art.
BRIEF DESCRIPTION OF THE DRAWINGS
[0033] The drawings are for illustration purposes only not for limitation.
[0034] Figure 1 shows a graphical representation of serum creatinine levels in mice at day 14 post ischemia. Control mice (group A) were injected with saline, while experimental mice (groups B-D) received PDPCs according to various treatment regimens. [0035] Figure 2 depicts photomicrographs of kidney sections from control ischemic mice and PDPC-treated ischemic mice. Sections were stained for pi 6, p21, and SA GAL (markers of cell stress and cell senescence) and TUNEL (a marker of apoptosis).
[0036] Figure 3 shows graphs displaying relative levels of cytoplasmic p21 expression in heart tissues of control and PDPC-treated cardiac ischemic mice. From left to right, the bars in each group are (1) ischemic mice that were untreated; (2) ischemic mice that were injected with an NaCl solition; (3) ischemic mice that were treated with PDPCs; and (4) untreated, nonischemic mice.
[0037] Figures 4 and 5 show exemplary graphical representations of serum creatinine levels in mice at day 14 post ischemia. Control mice (group A) were injected with saline, while experimental mice (groups B-D) received PDPCs according to various treatment regimens.
[0038] Figures 6 and 7 show exemplary graphical representations of serum creatinine levels adjusted for body weight in mice at day 14 post ischemia. Control mice (group A) were injected with saline, while experimental mice (groups B-D) received PDPCs according to various treatment regimens.
[0039] Figure 8 shows exemplary graphs displaying measurement of various indicators of cardiac function in cardiac ischemic mice (controls and PDPC-treated). Fractional shortening (FS), left ventricle diastolic diameter (LVEDD), and left ventricle systolic diameter (LVESD) were measured before ischemia and at 1 and 2 weeks post-ischemia.
[0040] Figure 9 shows an exemplary graph displaying measurement of fractional shortening (FS) in cardiac ischemic mice (controls and PDPC-treated).
[0041] Figure 10 shows an exemplary graph displaying measurement of left ventricle diastolic diameter (LVEDD) in cardiac ischemic mice (controls and PDPC-treated).
[0042] Figure 11 shows an exemplary graph displaying measurement of left ventricle systolic diameter (LVESD) in cardiac ischemic mice (controls and PDPC-treated). [0043] Figures 12, 13, and 14 show exemplary graphs displaying blood glucose levels of
NOD mice in groups 1, 2, and 3 respectively at various time points. Group 1 mice were untreated; group 2 mice were treated with PDPCs; and group 3 mice were treated with PDPCs and CsA (cyclosporine A, an immunosuppressant).
[0044] Figure 15A and 15B depict exemplary scanning electron microscopy pictures of sub-confluent rat PDPCs adapted for growth in medium with fetal bovine serum (FBS) depleted for bovine micro vesicles. Nascent micro vesicles can be seen at the surfaces of cells in both figures.
[0045] Figures 16 to 21 depict exemplary ELISA measurements of IL-1B, IL-2, IL-4,
IL-5, IL-6, IL-7, IL-8, IL-10, IL-12, IL-13, IL-17, GCSF, GMCSF, IFN-g, MCAF, MIP-IB, and TNFa expression in response to incubation of MLR with PCs as compared to incubation of MLR with control cells.
[0046] Figures 22 to 34 depict exemplary ELISA measurements of IL-2, IL-4, IL-5, IL-
6, IL-7, IL-8, IL-10, IL-13, and IL-17, GCSF, GMCSF, and MCAF release by each of Fractions 1-4 in a mixed lymphocyte reaction (MLR).
DEFINITIONS
[0047] In order for the present invention to be more readily understood, certain terms are first defined below. Additional definitions for the following terms and other terms are set forth throughout the specification.
[0048] Acute: As used herein, the term "acute" when used in connection with tissue damage and related diseases, disorders, or conditions, has the meaning understood by any one skilled in the medical art. For example, the term typically refers to a disease, disorder, or condition in which there is sudden or severe onset of symptoms. In some embodiments, acute damage is due to an ischemic or traumatic event. Typically, the term "acute" is used in contrast to the term "chronic." [0049] Adult: As used herein, the term "adult" when used to describe tissues is not meant herein to imply that the tissues must be obtained from an adult individual, but rather, that the tissues are themselves fully developed or differentiated, rather than being in embryonic or undifferentiated form.
[0050] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to humans, at any stage of development. In some embodiments, "animal" refers to non-human animals, at any stage of development. In certain embodiments, the non-human animal is a mammal {e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, and/or a pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, and/or worms. In some embodiments, an animal may be a transgenic animal, genetically-engineered animal, and/or a clone.
[0051] Approximately: As used herein, the term "approximately" or "about," as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain embodiments, the term "approximately" or "about" refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
[0052] Autoimmune disorder. As used herein, the term "autoimmune disorder" refers to a disorder resulting from attack of a body's own tissue by its immune system. In some embodiments, autoimmune diseases is diabetes mellitus, multiple sclerosis, premature ovarian failure, scleroderma, Sjogren's disease, lupus, alopecia (baldness), polyglandular failure, Grave's disease, hypothyroidism, polymyosititis, Celiac disease, Crohn's disease, inflammatory bowel disease, ulcerative colitis, autoimmune hepatitis, hypopituitarism, Guillain-Barre syndrome, myocardititis, Addison's disease, autoimmune skin diseases (e.g., psoriasis), uveititis, pernicious anemia, polymyalgia rheumatica, Goodpasture's syndrome, hypoparathyroidism, Hashimoto's thyoriditis, Raynaud's phenomenon, polymyaglia rheumatica, and rheumatoid arthritis. [0053] Autologous and non-autologus: As used herein, the term "autologous" means from the same organism. In the context of the present application, the term is used to mean that the population of cells and/or microvesicles referred to as "autologous" to each other do not contain any material which could be regarded as allogenic or xenogenic, that is to say derived from a "foreign" cellular source. As used herein, the term "non-autologous" means not from the same organism.
[0054] Cell culture: As used herein, the term "cell culture" or its equivalents shall mean one or more cells cultivated in a controlled environment. A cell culture typically pertains to an isolated collection of cells in a defined medium under controlled conditions. However, in certain circumstances, a cell culture may contain a single cell. Typically, a single cell culture is obtained from a larger culture by dilution. In other embodiments, a cell culture contains two or more cells. For such a cell culture, the culture may consist of cells of a significantly pure population. For example, in some embodiments, cells in a culture are clonal in nature. Clonal cells are derived from a single parental cell and typically contain identical genetic make-up. In some embodiments, however, at least one of the cells in a culture contains at least one genetic mutation. Alternatively, a culture may be characterized as a mixed cell culture, which contains multiple cell types. In some embodiments, a mixed cell culture is prepared by design. In other embodiments, a mixed cell culture is a result of a contamination. In the context of cell cultures, the terms "grown" "cultivated" "maintained" and the like, are used interchangeably herein, unless specifically stated otherwise.
[0055] Chronic: As used herein, the term "chronic," when used in connection with tissue damage or related diseases, disorders, or conditions has the meaning as understood by any one skilled in the medical art. Typically, the term "chronic" refers to diseases, disorders, or conditions that involve persisting and/or recurring symptoms. Chronic diseases, disorders, or conditions typically develop over a long period of time. The term "chronic" is used in contrast to the term "acute." In some embodiments, a chronic disease, disorder, or condition results from cell degeneration. In some embodiments, a chronic disease, disorder, or condition results from age-related cell degeneration. [0056] Diabetes mellitus: As used herein, the term "diabetes mellitus" refers to a metabolic disease characterized by abnormally high levels of glucose in the blood, caused by an inherited inability to produce insulin (Type 1) or an acquired resistance to insulin (Type 2). Type 1 diabetes is a severe, chronic form of diabetes caused by insufficient production of insulin and resulting in abnormal metabolism of carbohydrates, fats, and proteins. The disease, which typically appears in childhood or adolescence, is characterized by increased sugar levels in the blood and urine, excessive thirst, frequent urination, acidosis, and wasting. Type 1 diabetes is also called insulin-dependent diabetes. Type 2 diabetes is a mild form of diabetes that typically appears first in adulthood and is exacerbated by obesity and an inactive lifestyle. This disease often has no symptoms, is usually diagnosed by tests that indicate glucose intolerance, and is treated with changes in diet and an exercise regimen. Type 2 diabetes is also called non-insulin- dependent diabetes.
[0057] Control: As used herein, the term "control" has its art-understood meaning of being a standard against which results are compared. Typically, controls are used to augment integrity in experiments by isolating variables in order to make a conclusion about such variables. In some embodiments, a control is a reaction or assay that is performed
simultaneously with a test reaction or assay to provide a comparator. In one experiment, the "test" {i.e., the variable being tested) is applied. In the second experiment, the "control," the variable being tested is not applied. In some embodiments, a control is a historical control (i.e., of a test or assay performed previously, or an amount or result that is previously known). In some embodiments, a control is or comprises a printed or otherwise saved record. A control may be a positive control or a negative control. In some embodiments, a control is also referred to as a reference.
[0058] Cosmetic surgical procedure: As used herein, the term "cosmetic surgical procedure" refers to a procedure that is not directed to the therapy of a disease but is, rather, directed to the improvement of an individual's aesthetic appearance, particularly the appearance of the skin or hair of an individual. Examples of cosmetic surgical procedures include procedures that result in reduction in skin wrinkles, an increase in skin firmness, an increase in hair growth or shine, a reduction in grey hairs, a regrowth of hair in cases of baldness (especially male pattern baldness), reduction in hair growth (especially facial hair growth), an aesthetic enhancement of breast size or shape, and a reduction in cellulite.
[0059] Crude: As used herein, the term "crude," when used in connection with a biological sample, refers to a sample which is in a substantially unrefined state. For example, a crude sample can be cell lysates or biopsy tissue sample. A crude sample may exist in solution or as a dry preparation.
[0060] Derivative thereof. As used herein, the term "derivative thereof," when used in connection with microvesicles or cells, refers to a fraction or extract (especially those containing R A and/or DNA and/or protein) of the original microvesicle or population of cells which retains at least some biological activity (especially the ability to induce differentiation and/or the ability to provide therapeutic benefit) of the original. The term also include complexed, encapsulated or formulated microvesicles or cells (for example, microvesicles that have been encapsulated, complexed or formulated to facilitate administration). Examples of derivatives include lysates, lyophilates and homogenates.
[0061] Dysfunction: As used herein, the term "dysfunction" refers to an abnormal function. Dysfunction of a molecule {e.g., a protein) can be caused by an increase or decrease of an activity associated with such molecule. Dysfunction of a molecule can be caused by defects associated with the molecule itself or other molecules that directly or indirectly interact with or regulate the molecule.
[0062] Functional: As used herein, a "functional" biological molecule is a biological molecule in a form in which it exhibits a property and/or activity by which it is characterized.
[0063] Functional derivative: As used herein, the term "functional derivative" denotes, in the context of a functional derivative of a nucleotide sequence (e.g., microRNA), a molecule that retains a biological activity (either function or structural) that is substantially similar to that of the original sequence. A functional derivative or equivalent may be a natural derivative or is prepared synthetically. Exemplary functional derivatives include nucleotide sequences having substitutions, deletions, or additions of one or more nucleotides, provided that the biological activity of the nucleic acids (e.g., microR As) is conserved. [0064] Inflammation: As used herein, the term "inflammation" includes inflammatory conditions occurring in many disorders which include, but are not limited to: Systemic
Inflammatory Response (SIRS); Alzheimer's Disease (and associated conditions and symptoms including: chronic neuroinflammation, glial activation; increased microglia; neuritic plaque formation; and response to therapy); Amyotropic Lateral Sclerosis (ALS), arthritis (and associated conditions and symptoms including, but not limited to: acute joint inflammation, antigen-induced arthritis, arthritis associated with chronic lymphocytic thyroiditis, collagen- induced arthritis, juvenile arthritis; rheumatoid arthritis, osteoarthritis, prognosis and
streptococcus-induced arthritis, spondyloarthopathies, gouty arthritis), asthma (and associated conditions and symptoms, including: bronchial asthma; chronic obstructive airway disease; chronic obstructive pulmonary disease, juvenile asthma and occupational asthma);
cardiovascular diseases (and associated conditions and symptoms, including atherosclerosis; autoimmune myocarditis, chronic cardiac hypoxia, congestive heart failure, coronary artery disease, cardiomyopathy and cardiac cell dysfunction, including: aortic smooth muscle cell activation; cardiac cell apoptosis; and immunomodulation of cardiac cell function; diabetes and associated conditions and symptoms, including autoimmune diabetes, insulin-dependent (Type 1) diabetes, diabetic periodontitis, diabetic retinopathy, and diabetic nephropathy);
gastrointestinal inflammations (and related conditions and symptoms, including celiac disease, associated osteopenia, chronic colitis, Crohn's disease, inflammatory bowel disease and ulcerative colitis); gastric ulcers; hepatic inflammations such as viral and other types of hepatitis, cholesterol gallstones and hepatic fibrosis, HIV infection (and associated conditions and symptoms, including degenerative responses, neurodegenerative responses, and HIV associated Hodgkin's Disease), Kawasaki's Syndrome (and associated diseases and conditions, including mucocutaneous lymph node syndrome, cervical lymphadenopathy, coronary artery lesions, edema, fever, increased leukocytes, mild anemia, skin peeling, rash, conjunctiva redness, thrombocytosis; multiple sclerosis, nephropathies (and associated diseases and conditions, including diabetic nephropathy, endstage renal disease, acute and chronic glomerulonephritis, acute and chronic interstitial nephritis, lupus nephritis, Goodpasture's syndrome, hemodialysis survival and renal ischemic reperfusion injury), neurodegenerative diseases (and associated diseases and conditions, including acute neurodegeneration, induction of IL-1 in aging and neurodegenerative disease, IL-1 induced plasticity of hypothalamic neurons and chronic stress hyperresponsiveness), ophtlialmopathies (and associated diseases and conditions, including diabetic retinopathy, Graves' opthalmopathy, and uveitis, osteoporosis (and associated diseases and conditions, including alveolar, femoral, radial, vertebral or wrist bone loss or fracture incidence, postmenopausal bone loss, mass, fracture incidence or rate of bone loss), otitis media (adult or pediatric), pancreatitis or pancreatic acinitis, periodontal disease (and associated diseases and conditions, including adult, early onset and diabetic); pulmonary diseases, including chronic lung disease, chronic sinusitis, hyaline membrane disease, hypoxia and pulmonary disease in SIDS; restenosis of coronary or other vascular grafts; rheumatism including rheumatoid arthritis, rheumatic Aschoff bodies, rheumatic diseases and rheumatic myocarditis; thyroiditis including chronic lymphocytic thyroiditis; urinary tract infections including chronic prostatitis, chronic pelvic pain syndrome and urolithiasis. Immunological disorders, including autoimmune diseases, such as alopecia aerata, autoimmune myocarditis, Graves' disease, Graves opthalmopathy, lichen sclerosis, multiple sclerosis, psoriasis, systemic lupus erythematosus, systemic sclerosis, thyroid diseases (e.g. goiter and struma lymphomatosa (Hashimoto's thyroiditis, lymphadenoid goiter), sleep disorders and chronic fatigue syndrome and obesity (non-diabetic or associated with diabetes). Resistance to infectious diseases, such as
Leishmaniasis, Leprosy, Lyme Disease, Lyme Carditis, malaria, cerebral malaria, meningitis, tubulointerstitial nephritis associated with malaria), which are caused by bacteria, viruses (e.g. cytomegalovirus, encephalitis, Epstein-Barr Virus, Human Immunodeficiency Virus, Influenza Virus) or protozoans (e.g., Plasmodium falciparum, trypanosomes). Response to trauma, including cerebral trauma (including strokes and ischemias, encephalitis, encephalopathies, epilepsy, perinatal brain injury, prolonged febrile seizures, SIDS and subarachnoid hemorrhage), low birth weight (e.g. cerebral palsy), lung injury (acute hemorrhagic lung injury, Goodpasture's syndrome, acute ischemic reperfusion), myocardial dysfunction, caused by occupational and environmental pollutants (e.g. susceptibility to toxic oil syndrome silicosis), radiation trauma, and efficiency of wound healing responses (e.g. burn or thermal wounds, chronic wounds, surgical wounds and spinal cord injuries). Hormonal regulation including fertility/fecundity, likelihood of a pregnancy, incidence of preterm labor, prenatal and neonatal complications including preterm low birth weight, cerebral palsy, septicemia, hypothyroidism, oxygen dependence, cranial abnormality, early onset menopause. A subject's response to transplant (rejection or acceptance), acute phase response (e.g. febrile response), general inflammatory response, acute respiratory distress response, acute systemic inflammatory response, wound healing, adhesion, immunoinflammatory response, neuroendocrine response, fever development and resistance, acute -phase response, stress response, disease susceptibility, repetitive motion stress, tennis elbow, and pain management and response.
[0065] Inducer. As used herein, the term "inducer" refers to any molecule or other substance capable of inducing a change in the fate of differentiation of a cell to which it is applied.
[0066] In vitro: As used herein, the term "in vitro" refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within a multi-cellular organism.
[0067] In vivo: As used herein, the term "in vivo" refers to events that occur within a multi-cellular organism such as a non-human animal.
[0068] Ischemia: As used herein, the term "ischemia" (also spelled "ischaemia") typically refers to a restriction in blood or oxygen supply that may result in damage or dysfunction of a tissue. Ischemia may be caused by any of a variety of factors, such as factors in blood vessels, a blood clot, a severe drop in blood pressure, an increase in compartmental pressure, and/or trauma. The term "ischemia" as used herein also refers to local anemia in a given part of a body or tissue that may result, for example, from vasoconstriction, thrombosis, or embolism. Any tissue that normally receives a blood supply can experience ischemia.
[0069] Isolated: As used herein, the term "isolated" refers to a substance and/or entity that has been (1) separated from at least some of the components with which it was associated when initially produced (whether in nature and/or in an experimental setting), and/or (2) produced, prepared, and/or manufactured by the hand of man. Isolated substances and/or entities may be separated from at least about 10%, about 20%>, about 30%>, about 40%>, about 50%>, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, about 99%, substantially 100%, or 100% of the other components with which they were initially associated. In some embodiments, isolated agents are more than about 80%>, about 85%, about 90%>, about 91%>, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, substantially 100%, or 100% pure. As used herein, a substance is "pure" if it is substantially free of other components. As used herein, the term "isolated cell" refers to a cell not contained in a multi-cellular organism.
[0070] microRNA: As used herein, the term "microRNAs (miRNAs)" refers to post- transcriptional regulators that typically bind to complementary sequences in the three prime untranslated regions (3' UTRs) of target messenger RNA transcripts (mRNAs), usually resulting in gene silencing. Typically, miRNAs are short ribonucleic acid (RNA) molecules, for example, 21 or 22 nucleotides long. Th terms "microRNA" and "miRNA" are used interchangeably.
[0071] Microvesicle: As used herein, the term "microvesicle" refers to a membranaceus particle comprising fragments of plasma membrane derived from various cell types. Typically, microvesicles have a diameter (or largest dimension where the particle is not spheroid) of between about 10 nm to about 5000 nm (e.g., between about 50 nm and 1500 nm, between about 75 nm and 1500 nm, between about 75 nm and 1250 nm, between about 50 nm and 1250 nm, between about 30 nm and 1000 nm, between about 50 nm and 1000 nm, between about 100 nm and 1000 nm, between about 50 nm and 750 nm, etc.). Typically, at least part of the membrane of the microvesicle is directly obtained from a cell (also known as a donor cell). Microvesicles suitable for use in the present invention may originate from cells by membrane inversion, exocytosis, shedding, blebbing, and/or budding. Depending on the manner of generation (e.g., membrane inversion, exocytosis, shedding, or budding), the microvesicles contemplated herein may exhibit different surface/lipid characteristics. Alternative names for microvesicles include, but are not limited to, exosomes, ectosomses, membrane particles, exosome-like particles, and apoptotic vesicles. As used herein, an abbreviated form "MV" is sometime used to refer to microvesicle.
[0072] Pathfinder cells: As used herein, the term "pathfinder cells" refers to cells that have the capacity to induce or stimulate tissue repair, regeneration, remodeling, reconstitution, or differentiation. Typically, pathfinder cells induce or stimulate tissue or repair, regeneration, remodeling, reconstitution or differentiation without being a source of new tissue themselves. In some embodiments, pathfinder cells are also referred to as "progenitor cells." As used herein, an abbreviated form "PC" is sometime used to refer to a pathfinder cell. Typically, pathfinder cells are originated from adult tissues, including primary cells directly isolated from adult tissues or cells grown from primary cells in a cell culture system. The term "adult" when used to describe tissues is not meant herein to imply that the tissues must be obtained from an adult individual, but rather, that the tissues are themselves fully developed, rather than being in embryonic form or derived from a fetus. Thus, it is specifically contemplated that pathfinder cells may be obtained from any developed individual (whether a child, adolescent, or adult), but are generally not obtained from embryos or fetuses. Pathfinder cells typically have one or more characteristics as described herein, such as expression of microRNAs, cell surface markers, and production of micro vesicles.
[0073] Subject: As used herein, the term "subject" refers to a human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat, cattle, swine, sheep, horse or primate). A human includes pre and post natal forms. In many embodiments, a subject is a human being. A subject can be a patient, which refers to a human presenting to a medical provider for diagnosis or treatment of a disease. The term "subject" is used herein interchangeably with "individual" or "patient." A subject can be afflicted with or is susceptible to a disease or disorder but may or may not display symptoms of the disease or disorder.
[0074] Substantially: As used herein, the term "substantially" refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, go to completion and/or proceed to completeness or achieve or avoid an absolute result. The term "substantially" is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.
[0075] Suffering from: An individual who is "suffering from" a disease, disorder, and/or condition has been diagnosed with or displays one or more symptoms of the disease, disorder, and/or condition.
[0076] Susceptible to: An individual who is "susceptible to" a disease, disorder, and/or condition has not been diagnosed with the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition may not exhibit symptoms of the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will develop the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will not develop the disease, disorder, and/or condition.
[0077] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" of a therapeutic agent means an amount that is sufficient, when administered to a subject suffering from or susceptible to a disease, disorder, and/or condition, to treat, diagnose, prevent, and/or delay the onset of the symptom(s) of the disease, disorder, and/or condition. It will be appreciated by those of ordinary skill in the art that a therapeutically effective amount is typically administered via a dosing regimen comprising at least one unit dose.
[0078] Therapeutic agent: As used herein, the phrase "therapeutic agent" refers to any agent that, when administered to a subject, has a therapeutic effect and/or elicits a desired biological and/or pharmacological effect. In some embodiments, a therapeutic agent of the invention refers to a peptide inhibitor or derivatives thereof according to the invention.
[0079] Tissue: As used herein, the term "tissue" refers to an aggregation of
morphologically similar cells and associated intercellular matter acting together to perform one or more specific functions in the body. In some embodiments, tissues fall into one of four basic types: muscle, nerve, epidermal, and connective. In some embodiments, a tissue is substantially solid, e.g., cells within the tissue are strongly associated with one another to form a solid. In some embodiments, a tissue is substantially non-solid, e.g, cells within the tissue are loosely associated with one another, or not at all physically associated with one another, but may be found in the same space, bodily fluid, etc. For example, blood cells are considered a tissue in non-solid form.
[0080] Transdifferentiation: As used herein, the term "transdifferentiation" refers to a process in which a non-stem cell transforms into a different type of cell, or an already differentiated stem cell creates cells outside its already established differentiation path.
Typically, transdifferentiation include de- and then re-differentiation of adult cell types (or differentiated cell types). [0081] Treating: As used herein, the term "treat," "treatment," or "treating" refers to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of and/or reduce incidence of one or more symptoms or features of a particular disease, disorder, and/or condition. Treatment may be administered to a subject who does not exhibit signs of a disease and/or exhibits only early signs of the disease for the purpose of decreasing the risk of developing pathology associated with the disease.
DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS
[0082] The present invention provides, among other things, improved compositions and methods for the treatment of tissue damage (e.g., acute or chronic) and related diseases, disorders or conditions based on the use of pathfinder cells, extracellular secretomes thereof, and/or pathfinder cell-associated micro R As. In some embodiments, the present invention provides a method for treating tissue damage (e.g., acute or chronic) comprising a step of administering a population of cells to an individual suffering from a disease, disorder or condition characterized by acute damage to one or more tissues, wherein the cells are originated from an adult tissue and wherein the cells induce tissue repair, regeneration, remodeling, reconstitution or differentiation.
[0083] Various aspects of the invention are described in detail in the following sections.
The use of sections is not meant to limit the invention. Each section can apply to any aspect of the invention. In this application, the use of "or" means "and/or" unless stated otherwise.
I. Cells
[0084] Cells suitable for the present invention are typically multipotent or pluripotent and can induce tissue repair, regeneration, remodeling, reconstruction, reprogramming, or transdifferentiation in vivo and/or in vitro. Typically, the present invention utilizes cells originated from an adult tissue. Such cells are also referred to as "pathfinder cells" or
"progenitor cells." In this application, the terms "cells," "pathfinder cells" and "progenitor cells" are used interchangeably. [0085] As discussed in the Examples section, there is evidence that pathfinder cells may induce or stimulate host tissue repair, regeneration, remodeling, reconstitution, differentiation or transdifferentitaion without being a source of new tissue themselves. Without wishing to be bound by any theory, it is contemplated that pathfinder cells may induce changes within target tissue or cells to convert them into active repair mode by providing microRNAs and/or other components (e.g., membrane associated polypeptide, transcription factors, etc.) that will regulate expression of genes relating to, e.g., increased cell mobility, tissue remodeling and
reprogramming, growth, angiogenesis, cell adhesion and cell signaling, etc.
[0086] Thus, according to the present invention, pathfinder cells or microRNAs from different tissues, cell types or organisms may be used. For example, cells suitable for the present invention may be originated from an adult tissue that may or may not be the same as the target tissue. In some embodiments, cells suitable for the present invention may be originated from autologous or non-autologous adult tissues. In some embodiments, cells suitable for the present invention may be originated from adult tissues obtained from different species. For example, cells suitable for the present invention may be originated from human or non-human adult tissues.
[0087] In some embodiments, cells suitable for the present invention may have any desirable origin, including endothelial, mesothelial, and ectothelial origins. Thus, suitable cells include those found in a gland, an organ, muscle, a structural tissue, etc. Suitable cells may be heterologous (or non-autologous) or autologous relative to recipient. For example, suitable cells may be derived from a tissue the same as or different than the recipient tissue (e.g., a diseased or damaged tissue to be treated). As a non-limiting example, kidney-derived cells may be used to stimulate repair of damaged cardiac tissue. In some embodiments, cells may be derived from a different organism (i.e., non-autologous). For example, a cell may be a porcine pancreatic cell, while the recipient is a human with damaged pancreatic or other tissue.
[0088] Cells suitable for the present invention may be isolated from any of a variety of tissue types, including, but not limited to, pancreas, kidney, lymph node, liver, spleen, myometrium, blood cells (including cells from peripheral blood and chord blood), and/or bone marrow. [0089] Suitable cells may also be in any stage of their individual cellular age, ranging from just separated from their progenitor cell to a senescent or even dead cell. Thus, cells may include pre-apoptotic cells, or a cell committed to apoptosis.
[0090] Furthermore, it is contemplated that suitable cells also include non-diseased and diseased cells, wherein diseased cells may be affected by one or more pathogens and/or conditions. For example, a diseased cell may be infected with a virus, an intracellular parasite, or bacterium. In other examples, a diseased cell may be a metabolically diseased cell (e.g., due to genetic defect, due to an enzyme, receptor, and/or transporter dysfunction, or due to metabolic insult), a neoplastic cell, or cell that has one or more mutations that render the cell susceptible to uncontrolled cell growth. Similarly, cells may be native (e.g., obtained by biopsy), cultured (e.g., native, or immortalized), or treated. For example, cells may be chemically and/or mechanically treated, resulting in a cell that exhibits a cell-specific stress response. In some embodiments, suitable cells may be treated with a natural or synthetic ligand to which the cell has a receptor or otherwise complementary structure. In some embodiments, a cell may also be treated with a drug or compound that alters at least one of a metabolism, cell growth, cell division, cell structure, and/or secretion.
[0091] In some embodiments, suitable cells are recombinant cells. For example, recombinant cells may contain one or more nucleic acid molecules introduced by recombinant DNA technology. All known manners of introducing nucleic acids are deemed suitable for use herein (e.g., viral transfection, chemical transfection, electroporation, ballistic transfection, etc.). Where the nucleic is a DNA, it is contemplated that the DNA may be integrated into the genome of the cell, or that the DNA may reside as extrachromosomal unit within the cell. Such DNA may be employed as a template for RNA production, which may have regulatory and/or protein encoding function. Similarly where the nucleic acid is an RNA, such RNA may be used as a regulatory entity (e.g., via antisense or interference) and/or as a protein encoding entity. As used herein, nucleic acids encompass all known nucleic acid analogs (e.g., phosphorothioate analogs, peptide nucleic acid analogs, etc.)
[0092] In some embodiments, cells are obtained from freshly isolated or stored materials
(e.g., biological fluids, tissues, organs, etc.). When cells are obtained from stored materials, such storage may include storage at a reduced temperature (e.g., 4 °C) or even storage in frozen form. Similarly, cells may also be obtained from an in vitro source, and most typically from cell or tissue culture (see the Cell Culture Condition section below), or even organ culture.
[0093] Cells may be isolated, for example, according to methods previously developed by the present inventor and available in the art, or variations thereof. See, e.g., Shiels et al. (2009) Stem Cells Dev.,18(10): 1389-98 and International Patent Publications WO2006/120476 and WO2009/136168. For example, a tissue or a part of a tissue (e.g., pancreatic ducts) can be isolated from an adult animal and minced. The minced tissue can be seeded in a suitable culture medium and incubated. In some embodiments, pathfinder cells will emerge as a confluent monolayer after a period of time (e.g., 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, or more) in culture. Pathfinder cells in a monolayer can be harvested and optionally washed in a solution such as PBS (phosphate-buffered saline).
[0094] Suitable cell culture conditions are described below. In embodiments in which pathfinder cells are obtained from cell cultures, they may be of any passage number so long as they can still have one or more properties that confer therapeutic benefit. Thus, pathfinder cells of low (e.g., less than about 10 passages), medium (e.g., between to about 10 to about 20 passages), or high (e.g., more than about 20 passages (e.g., about 30, 40, 50, 60, 70, 80, 90, 100, or more than 100)) passage number may be used in various embodiments of the invention.
Cell Culture Conditions
[0095] In some embodiments, pathfinder cells are obtained from a cell culture that had been established from freshly isolated or stored materials. For example, cells may be cultured in a liquid medium that contains nutrients for the cells and are incubated in an environment where the temperature and/or gas composition is controlled. As will be appreciated by one of ordinary skill in the art, specific cell culture conditions may vary depending on the type of cells used. Cell culture conditions for pathfinder cells have been described. See, e.g., International Patent Publication WO2006/120476. [0096] An exemplary suitable medium for culture of pathfinder cells is CMRL 1066 medium (Invitrogen) supplemented with fetal bovine serum (e.g., at 10%). In some
embodiments, media is supplemented with glutamine or glutamine-containing mixtures such as GLUTAMAX™ (Invitrogen) and/or with antibiotics (e.g., amphotericin, penicillin, and/or streptomycin).
[0097] In some embodiments, cells are grown such they are attached on a surface. In some such embodiments, cells are grown as a monolayer on the surface. In some embodiments, cells are grown until they are confluent, i.e., until they cover the entire surface on which they are growing and there is nowhere else on the surface for cells to grow. In some embodiments, cells are grown until they are close to but not yet at confluence, i.e., until they cover most of the surface on which they are growing, but there is still some room for cells to grow. In some embodiments, cells are grown until they are approximately or more than 50%, 60%>, 70%>, 80%>, 85%, 90%, 95%, 97%, 98%, 99%, or more confluent, wherein x% confluent is defined as coverage of approximately x% of the growing surface. In some embodiments, cells are grown until they are approximately 50-99% (e.g., 60-99%, 70-99%, 75-99%, 80-99%, 85-99%, 90-99%, or 95-99%) confluent.
[0098] In some embodiments, cells are grown on a substrate that may affect one or more properties of the cell, such as microvesicle production rate, cell proliferation rate, or miRNA expression pattern. In some embodiments, cells are grown on a nonwoven substrate such as a nonwoven fabric comprised of fibers. As used herein, the term "nonwoven fabric" includes, but is not limited to, bonded fabrics, formed fabrics, or engineered fabrics, that are manufactured by processes other than, weaving or knitting. In some embodiments, the term "nonwoven fabric" refers to a porous, textile-like material, usually in flat sheet form, composed primarily or entirely of fibers, such as staple fibers assembled in a web, sheet or batt. The structure of the nonwoven fabric may be based on the arrangement of, for example, staple fibers that are typically arranged more or less randomly. Nonwoven fabrics can be created by a variety of techniques known in the textile industry. Various methods may create carded, wet laid, melt blown, spunbonded, or air laid nonwovens. Exemplary methods and substrates are described in U.S. Application Publication No. 20100151575, the entire teachings of which are incorporated herein by reference. The density of the nonwoven fabrics may be varied depending upon the processing conditions. In one embodiment, the nonwoven fabrics have a density of about 60 mg/mL to about 350 mg/mL.
[0099] In some embodiments, the nonwoven substrates are biocompatible and/or bioabsorbable. Examples of suitable biocompatible, bioabsorbable polymers that could be used include polymers selected from the group consisting of aliphatic polyesters, poly(amino acids), copoly(ether-esters), polyalkylene oxalates, polyamides, poly(iminocarbonates), polyorthoesters, polyoxaesters, polyamidoesters, polyoxaesters containing amine groups, poly(anhydrides), polyphosphazenes, and blends thereof.
[0100] In some embodiments, the aliphatic polyesters are homopolymers and/or copolymers of monomers selected from the group consisting of lactide (which includes lactic acid, D-,L- and meso lactide), glycolide (including glycolic acid), epsilon-caprolactone, p- dioxanone (l,4-dioxan-2-one), trimethylene carbonate (l,3-dioxan-2-one), alkyl derivatives of trimethylene carbonate, delta-valerolactone, beta-butyrolactone, gamma-butyrolactone, epsilon- decalactone, hydroxybutyrate (repeating units), hydroxyvalerate (repeating units), 1 ,4-dioxepan- 2-one (including its dimer l,5,8,12-tetraoxacyclotetradecane-7,14-dione), l,5-dioxepan-2-one, 6,6-dimethyl-l,4-dioxan-2-one and polymer blends thereof. In another embodiment, aliphatic polyesters which include, but are not limited to homopolymers and/or copolymers of lactide (which includes lactic acid, D-,L- and meso lactide), glycolide (including glycolic acid), epsilon- caprolactone, p-dioxanone (l,4-dioxan-2-one), trimethylene carbonate (l,3-dioxan-2-one) and combinations thereof.
[0101] In some embodiments, the aliphatic polyesters are homopolymers and/or copolymers of monomers selected from the group consisting of lactide (which includes lactic acid, D-,L- and meso lactide), glycolide (including glycolic acid), epsilon-caprolactone, p- dioxanone (l,4-dioxan-2-one), trimethylene carbonate (l,3-dioxan-2-one) and combinations thereof. In yet another embodiment, the aliphatic polyesters are homopolymers and/or copolymers of monomers selected from the group consisting of lactide (which includes lactic acid, D-,L- and meso lactide), glycolide (including glycolic acid), and p-dioxanone (1,4-dioxan- 2-one) and combinations thereof. Non-limiting examples of suitable fabrics include those that comprise aliphatic polyester fibers, e.g., fibers that comprise homopolymers or copolymers of lactide (e.g., lactic acid D-. L- and meso lactide), glycolide (e.g., glycolic acid), epsilon- caprolactone, p-dioxanone (l,4-dioxan-2-one), trimethylene carbonate (l,3-dioxan-2-one), and combinations thereof. For example, suitable farbics may contain poly(glycolide-co-lactide) (PGA/PL A); poly(lactide-co-glycolide) (PL A/PGA); 1 ,3 propanediol (PDO), and/or blends thereof.
[0102] In some embodiments, cells are grown on a solid surface that has been textured in a particular way so as to confer special properties to the surface (e.g., repulsion or attraction of certain substances, reduced adsorption of proteins, etc.), which in turn may influence behavior of cells on such surfaces. For example, cells may be grown on a nano-textured surface
("nanosurface"). See, e.g., US 7,597,950; Sun et al. (2009) "Combining nanosurface chemistry and microfluidics for molecular analysis and cell biology," Analytica Chimica Acta, 650(1):98- 105; the entire contents of each of which are herein incorporated by reference. Nanosurfaces and other textured surfaces may be generated, for example by any of a variety of methods known in the art, including sanding, chemical etching, sandblasting, and/or dewetting.
[0103] In some embodiments, cells are grown in suspension.
[0104] In some embodiments, cells are grown in a Matrigel free culture system in the presence of serum. Pathfinder cells have been shown to be able to grow in such systems. See, e.g., International Patent Publication WO 2006/120476.
[0105] In some embodiments, cells are subjected for at least part of the time to one or more conditions that enhance their growth, e.g., such that increased numbers of cells can be obtained from a culture. In some embodiments, enhancement of cell growth is accomplished by modulating accessibility of telomeres in cells. For example, cells may be first treated to reduce a telomeric attrition rate prior to cell culture. In some embodiments, to accheve reduced telomeric attrition rate, components of the telomere complex and/or factors that associate with it may be targeted by an agent that causes their downregulation or otherwise impairs their function. For example, cells may be exposed to inhibitory RNAs such as small inhibitory RNAs (siRNAs) to inhibit expression a gene encoding a protein or other gene product that forms part of the telomere complex or associates with the telomere comlpex. In some embodiments, RAF1 expression is inhibited with the use of a RAF1 specific siRNA. In some embodiments, STAU1 expression is inhibited with the use of a STAU1 specific siR A. For a fuller discussion of methods for enhancing cell growth that may be used in accordance with the present invention, see, e.g., U.S. provisional application entitled "Enhanced Cell Growth by the Modulation of Telomore
Accessibility" filed on even date, the entire contents of which are herein incorporated by reference.
[0106] Various growth media may be used to culture cells. Growth medium generally refers to any substance or preparation used for the cultivation of living cells. In some embodiments, the growth medium is renal growth medium. In some embodiment the growth medium is Dulbecco's Modification of Eagle's medium (DMEM). In some embodiments, cells are grown in media that does not contain serum. In some embodiments, cells are grown for at least a period of time in media that has been depleted of micro vesicles from media components. For example, media containing fetal bovine serum may be depleted of bovine micro vesicles. Alternatively or additionally, commercially available medium that is depleted of microviescles (e.g. , bovine microvesicles) is used.
[0107] In some embodiments, cells are grown at or about 37 °C. In some embodiments, cells are grown in the presence of at or about 5% C02. In some embodiments, cells are grown under room air oxygen conditions. In some embodiments, cells are grown under conditions where the oxygen pressure is less than or equal to 5% 02. In some embodiments, cells are grown in conditions of normal oxygen (e.g., about 5% 02). In some embodiments, cells are grown in hypoxic conditions (e.g., low oxygen such as < 5%, < 4%, < 3 %, < 2%, or < 1% 02).
[0108] In some embodiments, cells are grown under serum starvation conditions. As used herein, the term "serum starvation" includes, but is not limited to, serum depletion, serum- free medium or conditions. Various serum starvation conditions are known in the art and can be used to practice the present invention. In some embodiments, cells may be grown under serum starvation conditions for about 6, about 12, about 18, about 24, about 30, about 36, about 42, about 48 hours, or longer. In some embodiments, cells may be grown under conditions where the serum concentration is less than or equal to 10%, less than or equal to 9%>, less than or equal to 8%), less than or equal to 7%>, less than or equal to 6%>, less than or equal to 5%, less than or equal to 4%>, less than or equal to 3%>, less than or equal to 2%>, less than or equal to 1.5%, less than or equal to 1%, or less than or equal to 0.5%. In some embodiments, cells may be grown under conditions where the serum concentration is 0%> (i.e., serum is absent). In some embodiments, cells may be grown under conditions where the serum concentration is decreased in a step-wise manner over time. For example, in some embodiments, cells may be grown under conditions where the serum concentration is between about 2% to about 11% (e.g., about 2%, 3%), 4%), 5%, 6%, 7%, 8%), 9%), 10%>, or 11%) and is subsequently reduced in one or more steps to a serum concentration between about 0% to about 5% (e.g., about 0%, 0.5%, 1%, 1.5%, 2%, 3%, 4%, or 5%).
Cell differentiation
[0109] In certain embodiments, pathfinder cells may differentiate into one or more cell types in the cell culture and the differentiated cell types are used in therapeutic applications in accordance with the invention. In some embodiments, pathfinder cells are differentiated fully to a defined cell type, including, but not limited to, pancreatic cells, neuronal cells, cardiovascular cells, epithelial cells, hepatocytes, muscle cells, retinal cells, hair follicle cells, and kidney cells.
[0110] In some embodiments, pathfinder cells are differentiated into an "intermediate" cell type that is less pluripotent than a pathfinder cell, yet has greater potency than at least most fully differentiated cells. For example, a pathfinder cell may be differentiated into one of several progenitor cells of the immune system (e.g., lymphoid progenitor cells or myeloid progenitor cells) which are less pluripotent than hematopoetic stem cells yet not fully differentiated.
[0111] In some embodiments, the cell type into which pathfinder cells are differentiated are tailored for the specific therapeutic indication for which the pathfinder cells are being used. For example, in some embodiments in which pathfinder cells are being used to stimulate repair in an individual with damage to the liver, pathfinder cells are differentiated into hepatocytes before administering to the individual.
[0112] Methods of differentiating pathfinder cells are known in the art and are described, for example, in WO 2009/136168. See also Example 11 in the present specification. Typically, pathfinder cells are cultured in a growth medium ("differentiation media") distinct from the growth medium in which pathfinder cells were maintained before differentiation ("maintenance media"). Differentiation media may vary depending on intended cell type, and may, for example, have a composition known to be suitable for growth of a particular cell type. In some embodiments, differentiation media contains one or more elements (e.g., growth factors, serum, additives, etc.) that are not present in maintenance media. In some embodiments, differentiation media lack one or more elements (e.g., growth factors, serum, additives, etc.) that are present in maintenance media.
[0113] Alternative or additionally, other culture conditions are altered as compared to culture conditions used to isolate and/or maintain pathfinder cells. For example, pathfinder cells may be grown at a lower cell density than they are typically grown during maintenance. Without wishing to be bound by any particular theory, growth at lower cell densities affect the growth properties of the cells in a culture, because their ability to signal to one another is altered when the cell density in the plate is lower. As another non-limiting example, pathfinder cells may be grown on a different kind of surface (e.g., substrate) as was used to grown them for maintenance purposes. Such surfaces may help alter properties of the pathfinder cells and thereby help induce differentiation.
Biomarkers
[0114] In some embodiments, cells suitable for the present invention bear one or more characteristic biomarkers (e.g., protein or nucleic acid). As discussed in the Examples section, pathfinder cells may express one or more markers including, but not limited to, CD24, c-myc, HLA class 1 ABC, ICAM3, Nestin, Nanog, Oct4, Integrin <x2 + β ΐ , Ngn3, and CD130. In some embodiments, pathfinder cells may express two, three, four, five, six, seven, eight, or all of the markers described herein. In some embodiments, pathfinder cells express one or more markers typically associated with stem cells, such as, for example, Nestin. In some embodiments, pathfinder cells suitable for the present invention express Oct 4, Nanog, and c-myc.
[0115] In some embodiments, pathfinder cells suitable for the present invention are characterized with the absence of certain biomarkers. In some embodiments, pathfinder cells suitable for the present invention do not express at least one marker selected from the group consisting of CD34, CD105, VCAMl, CXCR2, CD44, CD73, ICAMl, and NCAM. In some embodiments, pathfinder cells do not express two, three, four, five, six, or seven of the markers selected from the group consisting of CD34, CD105, VCAMl, CXCR2, CD44, CD73„ ICAMl, and NCAM. In some embodiments, pathfinder cells suitable for the invention do not express any of the above biomarkers.
[0116] In some embodiments, pathfinder cells have the biomarker profile: CD24+, c- myc+, HLA class 1 ABC+, ICAM3+, Nesting Nanog+, Oct4+, Integrin α2 + β1+, Ngn3+, CD130+, CD34 , CD105 , VCAMl , CXCR2 , CD44 , CD73 , ICAMl , and NCAM .
[0117] In some embodiments, biomarkers may be used to isolate, enrich, and/or monitoring the growth of cells suitable for the present invention. For example, biomarkers may be used to prepare, isolate, or obtain a population of substantially homogeneous cells for therapeutic uses. As used herein, a population of substantially homogeneous cells refers to a population with at least 30% (e.g., at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%), 85%o, 90%), 95%), or more) of the cells expressing one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, or nine or more) identical biomarkers that are typically expressed on pathfinder cells. In some embodiments, suitable biomarkers include, but are not limited to, CD24, c-myc, HLA class 1 ABC, ICAM3, Nestin, Nanog, Oct4, Integrin a2 + bl, Ngn3, and CD130. Additionally or alternatively, a population of substantially homogeneous cells refers to a population with at least 30%> (e.g., at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more) of the cells that do not express one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, or nine or more) biomarkers that are typically not expressed on pathfinder cells. Such biomarkers include, but are not limited to, CD34, CD105, VCAMl, CXCR2, CD44, CD73, ICAMl, and NCAM.
[0118] Additionally or alternatively, nucleic acids such as the microRNAs described below may be used as biomarkers to isolate, enrich or monitoring the growth of pathfinder cells and to obtain a population of substantially homogeneous cells for therapeutic uses. II. MicroRNAs
[0119] In some embodiments, cells comprise one or more specific microRNAs. As used herein, "pathfinder cell microRNAs" include those microRNAs that are present in pathfinder cells derived from one or more tissues. "Pathfinder cell-specific microRNAs" are a subset of pathfinder cell microRNAs and include those microRNAs that are present in pathfinder cells but not other comparable cell types derived from the same tissue, such as differentiated cells.
[0120] The terms "pathfinder cell microRNAs" and "pathfinder cells-specific
microRNAs" encompass microRNAs isolated or purified from pathfinder cells as well as microRNAs having the same sequence synthesized using recombinant or chemical techniques. For example, microRNA molecules may be generated by in vitro transcription of DNA sequences encoding the relevant molecule. Such DNA sequences may be incorporated into a wide variety of vectors with suitable RNA polymerase promoters such as T7, T3, or SP6. As used herein, the term "microRNAs (miRNAs)" refers to post-transcriptional regulators that typically bind to complementary sequences in the three prime untranslated regions (3 ' UTRs) of target messenger RNA transcripts (mRNAs), usually resulting in gene silencing. Typically, miRNAs are short ribonucleic acid (RNA) molecules. For example, microRNAs may be approximately 18-25 nucleotides long (e.g., approximately 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides long).
[0121] It is contemplated that pathfinder cell microRNAs, individually or in combination, may be used to induce or stimulate repair of tissues, cell growth, cell regeneration, remodeling, reconstruction, differentiation and/or transdifferentiation, among other functions. It is further contemplated that pathfinder cell microRNAs can stimulate repair of tissues that are damaged from trauma or other acute diseases, disorders, or conditions.
[0122] Table 1 shows exemplary microRNAs that are present in pathfinder cells. In some embodiments, it was found that SEQ ID NOs: 1 to 319 are present in pathfinder cells. Additional microRNAs identified according to the present invention are listed in Tables 6 to 10 and include SEQ ID NOs: 320 to 608. Table 1 below, and Tables 6-10 in the Examples, list exemplary miRNA sequences for each miRNA of interest; corresponding miRNA sequences in other species are publicly available (e.g., see http://diana.cslab.ece.ntua.gr/mirgen/).. Some miRNA sequences are well conserved across species, including, but not limited to, Homo sapiens, Rattus norvegicus, Mus musculus, Danio rerio, and Gallus gallus, and some miRNA sequence variants exist even in the same species. In Table 1, asterisks (*) denote variants.
[0123] microRNAs useful in methods and compositions of the invention include those having nucleotide sequences identical to any of SEQ ID NOs: 1 to 319, as shown in Table 1.
microRNAs useful in methods and compositions of the invention also include those having nucleotide sequences identical to any of SEQ ID NOs: 320 to 608, as shown in Tables 6-10. In some embodiments, microRNAs having at least 70%, 75%, 80%, 85%, 90%, 95%, or more nucleotide sequence identity with any of SEQ ID NOs: 1 to 610 (or any of SEQ ID NOs: 1 o 225) are used in methods and compositions of the invention.
Table 1: Exemplary microRNA sequences
SEQ ID
microRNA Accession info, species and Sequence
NO.
Expressed in hPDPCs, hKDPCs, and hLNDPCs
>hsa-let-7a MIMAT0000062 Homo sapiens let-7a 1 UGAGGUAGUAGGUUGUAUAGUU
Let-7a
>hsa-let-7a* MIMAT0004481 Homo sapiens let-7a* 2 CUAUACAAUCUACUGUCUUUC
>hsa-let-7b MIMAT0000063 Homo sapiens let-7b 3 UGAGGUAGUAGGUUGUGUGGUU
Let-7b
>hsa-let-7b* MIMAT0004482 Homo sapiens let-7b* 4 CUAUACAACCUACUGCCUUCCC
>hsa-let-7c MIMAT0000064 Homo sapiens let-7c 5 UGAGGUAGUAGGUUGUAUGGUU
Let-7c
>hsa-let-7c* MIMAT0004483 Homo sapiens let-7c* 6 UAGAGUUACACCCUGGGAGUUA
>hsa-let-7d MIMAT0000065 Homo sapiens let-7d 7 AGAGGUAGUAGGUUGCAUAGUU
Let-7d
>hsa-let-7d* MIMAT0004484 Homo sapiens let-7d* 8 CUAUACGACCUGCUGCCUUUCU
>hsa-let-7e MIMAT0000066 Homo sapiens let-7e 9
Let-7e UGAGGUAGGAGGUUGUAUAGUU
>hsa-let-7e* MIMAT0004485 Homo sapiens let-7e* 10 CUAUACGGCCUCCUAGCUUUCC
>hsa-let-7f MIMAT0000067 Homo sapiens let-7f 11
Let-7f
UGAGGUAGUAGAUUGUAUAGUU
>hsa-let-7g MIMAT0000414 Homo sapiens let-7g 12 UGAGGUAGUAGUUUGUACAGUU
Let-7g
>hsa-let-7g* MIMAT0004584 Homo sapiens let-7g* 13 CUGUACAGGCCACUGCCUUGC
>hsa-miR-9 MIMAT0000441 Homo sapiens miR-9 14 UCUUUGGUUAUCUAGCUGUAUGA
miR-9
>hsa-miR-9* MIMAT0000442 Homo sapiens miR-9* 15 AUAAAGCUAGAUAACCGAAAGU
>hsa-miR-10a MIMAT0000253 Homo sapiens miR-lOa 16 UACCCUGUAGAUCCGAAUUUGUG
miR-lOa
>hsa-miR-10a* MIMAT0004555 Homo sapiens miR-lOa* 17 CAAAUUCGUAUCUAGGGGAAUA
>hsa-miR-10b MIMAT0000254 Homo sapiens miR-lOb 18 UACCCUGUAGAACCGAAUUUGUG
miR-lOb
>hsa-miR-10b* MIMAT0004556 Homo sapiens miR-lOb* 19 ACAGAUUCGAUUCUAGGGGAAU
>hsa-miR-15a MIMAT0000068 Homo sapiens miR-15a 20 UAGCAGCACAUAAUGGUUUGUG
miR-15a
>hsa-miR-15a* MIMAT0004488 Homo sapiens miR-15a* 21 CAGGCCAUAUUGUGCUGCCUCA
>hsa-miR-15b MIMAT0000417 Homo sapiens miR-15b 22 UAGCAGCACAUCAUGGUUUACA
miR-15b
>hsa-miR-15b* MIMAT0004586 Homo sapiens miR-15b* 23 CGAAUCAUUAUUUGCUGCUCUA
>hsa-miR-16 MIMAT0000069 Homo sapiens miR-16 24 miR-16
UAGC AGC AC GUAAAUAUUGGC G
>hsa-miR-17 MIMAT0000070 Homo sapiens miR-17 25 CAAAGUGCUUACAGUGCAGGUAG
miR-17
>hsa-miR-17* MIMAT0000071 Homo sapiens miR-17* 26 ACUGCAGUGAAGGCACUUGUAG
>hsa-miR-18a MIMAT0000072 Homo sapiens miR-18a 27 UAAGGUGCAUCUAGUGCAGAUAG
miR-18a
>hsa-miR-18a* MIMAT0002891 Homo sapiens miR- 18a* 28 ACUGCCCUAAGUGCUCCUUCUGG >hsa-miR-19a* MIMAT0004490 Homo sapiens miR-19a* 29 AGUUUUGCAUAGUUGCACUACA
miR-19a
>hsa-miR-19a MIMAT0000073 Homo sapiens miR-19a 30 UGUGCAAAUCUAUGCAAAACUGA
>hsa-miR-19b MIMAT0000074 Homo sapiens miR-19b 31 miR-19b
UGUGCAAAUCCAUGCAAAACUGA
>hsa-miR-20a MIMAT0000075 Homo sapiens miR-20a 32 UAAAGUGCUUAUAGUGCAGGUAG
miR-20a
>hsa-miR-20a* MIMAT0004493 Homo sapiens miR-20a* 33 ACUGCAUUAUGAGCACUUAAAG
>hsa-miR-20b MIMAT0001413 Homo sapiens miR-20b 34 CAAAGUGCUCAUAGUGCAGGUAG
miR-20b
>hsa-miR-20b* MIMAT0004752 Homo sapiens miR-20b* 35 ACUGUAGUAUGGGCACUUCCAG
>hsa-miR-21 MIMAT0000076 Homo sapiens miR-21 36 UAGCUUAUCAGACUGAUGUUGA
miR-21
>hsa-miR-21 * MIMAT0004494 Homo sapiens miR-21 * 37 CAACACCAGUCGAUGGGCUGU
>hsa-miR-22* MIMAT0004495 Homo sapiens miR-22*
38 AGUUCUUCAGUGGCAAGCUUUA
miR-22
>hsa-miR-22 MIMAT0000077 Homo sapiens miR-22
39 AAGCUGCCAGUUGAAGAACUGU
>hsa-miR-23b* MIMAT0004587 Homo sapiens miR-23b* 40 UGGGUUCCUGGCAUGCUGAUUU
miR-23b
>hsa-miR-23b MIMAT0000418 Homo sapiens miR-23b 41 AUCACAUUGCCAGGGAUUACC
>hsa-miR-24 MIMAT0000080 Homo sapiens miR-24 42 miR-24
UGGCUCAGUUCAGCAGGAACAG
>hsa-miR-25 MIMAT0000081 Homo sapiens miR-25 43 miR-25
CAUUGCACUUGUCUCGGUCUGA
>hsa-miR-26a MIMAT0000082 Homo sapiens miR-26a 44 miR-26a
UUCAAGUAAUCCAGGAUAGGCU
>hsa-miR-26b MIMAT0000083 Homo sapiens miR-26b 45 UUCAAGUAAUUCAGGAUAGGU
miR-26b
>hsa-miR-26b* MIMAT0004500 Homo sapiens miR-26b* 46 CCUGUUCUCCAUUACUUGGCUC
miR-27a >hsa-miR-27a* MIMAT0004501 Homo sapiens miR-27a* 47
AGGGCUUAGCUGCUUGUGAGCA >hsa-miR-27a MIMAT0000084 Homo sapiens miR-27a 48 UUCACAGUGGCUAAGUUCCGC
>hsa-miR-27b* MIMAT0004588 Homo sapiens miR-27b* 49 miR-27b
AGAGCUUAGCUGAUUGGUGAAC
>hsa-miR-28-3p MIMAT0004502 Homo sapiens miR-28-3p 50 miR-28-3p
CACUAGAUUGUGAGCUCCUGGA
>hsa-miR-28-5p MIMAT0000085 Homo sapiens miR-28-5p 51 miR-28-5p
AAGGAGCUCACAGUCUAUUGAG
>hsa-miR-29a MIMAT0000086 Homo sapiens miR-29a 52 miR-29a
UAGCACCAUCUGAAAUCGGUUA
>hsa-miR-29c* MIMAT0004673 Homo sapiens miR-29c* 53 UGACCGAUUUCUCCUGGUGUUC
miR-29c
>hsa-miR-29c MIMAT0000681 Homo sapiens miR-29c 54 UAGCACCAUUUGAAAUCGGUUA
>hsa-miR-30a MIMAT0000087 Homo sapiens miR-30a 55 UGUAAACAUCCUCGACUGGAAG
miR-30a
>hsa-miR-30a* MIMAT0000088 Homo sapiens miR-30a* 56 CUUUCAGUCGGAUGUUUGCAGC
>hsa-miR-30b MIMAT0000420 Homo sapiens miR-30b 57 UGUAAACAUCCUACACUCAGCU
miR-30b
>hsa-miR-30b* MIMAT0004589 Homo sapiens miR-30b* 58 CUGGGAGGUGGAUGUUUACUUC
>hsa-miR-30c MIMAT0000244 Homo sapiens miR-30c 59 miR-30c
UGUAAACAUCCUACACUCUCAGC
>hsa-miR-30d MIMAT0000245 Homo sapiens miR-30d 60 UGUAAACAUCCCCGACUGGAAG
miR-30d
>hsa-miR-30d* MIMAT0004551 Homo sapiens miR-30d* 61 CUUUCAGUCAGAUGUUUGCUGC
>hsa-miR-30e MIMAT0000692 Homo sapiens miR-30e 62 UGUAAAC AUC CUUG ACUGG AAG
miR-30e
>hsa-miR-30e* MIMAT0000693 Homo sapiens miR-30e* 63 CUUUCAGUCGGAUGUUUACAGC
>hsa-miR-32 MIMAT0000090 Homo sapiens miR-32 64 UAUUGCACAUUACUAAGUUGCA
miR-32
>hsa-miR-32* MIMAT0004505 Homo sapiens miR-32* 65 CAAUUUAGUGUGUGUGAUAUUU
miR-34a >hsa-miR-34a MIMAT0000255 Homo sapiens miR-34a 66
UGGCAGUGUCUUAGCUGGUUGU >hsa-miR-34a* MIMAT0004557 Homo sapiens miR-34a* 67 CAAUCAGCAAGUAUACUGCCCU
>rno-miR-34c MIMAT0000814 Rattus norvegicus miR-34c 68 AGGCAGUGUAGUUAGCUGAUUGC
miR-34c
>rno-miR-34c* MIMAT0004723 Rattus norvegicus miR-34c* 69 AAUCACUAACCACACAGCCAGG
>hsa-miR-92a MIMAT0000092 Homo sapiens miR-92a 70 miR-92a
UAUUGCACUUGUCCCGGCCUGU
>hsa-miR-93 MIMAT0000093 Homo sapiens miR-93 71 C AAAGUGCUGUUC GUGC AGGUAG
miR-93
>hsa-miR-93* MIMAT0004509 Homo sapiens miR-93* 72 ACUGCUGAGCUAGCACUUCCCG
>hsa-miR-98 MIMAT0000096 Homo sapiens miR-98 73 miR-98
UGAGGUAGUAAGUUGUAUUGUU
>hsa-miR-99a MIMAT0000097 Homo sapiens miR-99a 74 miR-99a
AACCCGUAGAUCCGAUCUUGUG
>hsa-miR-99b MIMAT0000689 Homo sapiens miR-99b 75 CACCCGUAGAACCGACCUUGCG
miR-99b
>hsa-miR-99b* MIMAT0004678 Homo sapiens miR-99b* 76 CAAGCUCGUGUCUGUGGGUCCG
>hsa-miR-100 MIMAT0000098 Homo sapiens miR-100 77 AACCCGUAGAUCCGAACUUGUG
miR-100
>hsa-miR-100* MIMAT0004512 Homo sapiens miR-100* 78 CAAGCUUGUAUCUAUAGGUAUG
>hsa-miR- 101 * MIMAT0004513 Homo sapiens miR- 101 * 79 CAGUUAUCACAGUGCUGAUGCU
miR-101
>hsa-miR-101 MIMAT0000099 Homo sapiens miR-101 80 UACAGUACUGUGAUAACUGAA
>hsa-miR-103 MIMAT0000101 Homo sapiens miR-103 81 miR-103
AGCAGCAUUGUACAGGGCUAUGA
>hsa-miR-106a MIMAT0000103 Homo sapiens miR- 106a 82 AAAAGUGCUUACAGUGCAGGUAG
miR-106a
>hsa-miR-106a* MIMAT0004517 Homo sapiens miR- 106a* 83 CUGCAAUGUAAGCACUUCUUAC
>hsa-miR-106b MIMAT0000680 Homo sapiens miR- 106b 84 UAAAGUGCUGACAGUGCAGAU
miR-106b
>hsa-miR-106b* MIMAT0004672 Homo sapiens miR- 106b* 85 CCGCACUGUGGGUACUUGCUGC >hsa-miR-107 MIMAT0000104 Homo sapiens miR-107 86 miR-107
AGCAGCAUUGUACAGGGCUAUCA
>hsa-miR-125a-3p MIMAT0004602 Homo sapiens miR-125a-3p 87 miR-125a-3p
ACAGGUGAGGUUCUUGGGAGCC
>hsa-miR-125a-5p MIMAT0000443 Homo sapiens miR-125a-5p 88 miR-125a-5p
UCCCUGAGACCCUUUAACCUGUGA
>hsa-miR-125b MIMAT0000423 Homo sapiens miR-125b 89 miR-125b
UCCCUGAGACCCUAACUUGUGA
>hsa-miR-126* MIMAT0000444 Homo sapiens miR-126* 90 CAUUAUUACUUUUGGUACGCG
miR-126
>hsa-miR-126 MIMAT0000445 Homo sapiens miR-126 91 UCGUACCGUGAGUAAUAAUGCG
>hsa-miR-128 MIMAT0000424 Homo sapiens miR-128 92 miR-128
UCACAGUGAACCGGUCUCUUU
>hsa-miR-130a* MIMAT0004593 Homo sapiens miR-130a* 93 UUCACAUUGUGCUACUGUCUGC
miR-130a
>hsa-miR-130a MIMAT0000425 Homo sapiens miR-130a 94 CAGUGCAAUGUUAAAAGGGCAU
>hsa-miR-130b* MIMAT0004680 Homo sapiens miR-130b* 95 ACUCUUUCCCUGUUGCACUAC
miR-130b
>hsa-miR-130b MIMAT0000691 Homo sapiens miR-130b 96 CAGUGCAAUGAUGAAAGGGCAU
>hsa-miR-132* MIMAT0004594 Homo sapiens miR-132* 97 ACCGUGGCUUUCGAUUGUUACU
miR-132
>hsa-miR-132 MIMAT0000426 Homo sapiens miR-132 98 UAACAGUCUACAGCCAUGGUCG
>hsa-miR-133a MIMAT0000427 Homo sapiens miR-133a 99 miR-133a
UUUGGUCCCCUUCAACCAGCUG
>hsa-miR-138 MIMAT0000430 Homo sapiens miR-138 100 miR-138
AGCUGGUGUUGUGAAUCAGGCCG
>hsa-miR-139-5p MIMAT0000250 Homo sapiens miR-139-5p 101 miR-139-5p
UCUACAGUGCACGUGUCUCCAG
>hsa-miR-140-3p MIMAT0004597 Homo sapiens miR-140-3p 102 miR-140-3p
UAC C AC AGGGUAG AAC C AC GG
>hsa-miR-140-5p MIMAT0000431 Homo sapiens miR-140-5p 103 miR-140-5p
CAGUGGUUUUACCCUAUGGUAG
miR-143 >hsa-miR-143* MIMAT0004599 Homo sapiens miR-143* 104
GGUGCAGUGCUGCAUCUCUGGU >hsa-miR-143 MIMAT0000435 Homo sapiens miR- 143 105 UGAGAUGAAGCACUGUAGCUC
>hsa-miR-145 MIMAT0000437 Homo sapiens miR-145 106 miR-145
GUCCAGUUUUCCCAGGAAUCCCU
>hsa-miR-146a MIMAT0000449 Homo sapiens miR- 146a 107 UG AG AACUG AAUUC C AUGGGUU
miR-146a
>hsa-miR-146a* MIMAT0004608 Homo sapiens miR- 146a* 108 CCUCUGAAAUUCAGUUCUUCAG
>hsa-miR-146b-5p MIMAT0002809 Homo sapiens miR-146b-5p 109 miR-146b-5p
UG AG AACUG AAUUC CAUAGGCU
>hsa-miR-148b* MIMAT0004699 Homo sapiens miR-148b* 110 AAGUUCUGUUAUACACUCAGGC
miR-148b
>hsa-miR-148b MIMAT0000759 Homo sapiens miR-148b 111 UCAGUGCAUCACAGAACUUUGU
>hsa-miR-149 MIMAT0000450 Homo sapiens miR-149 112 UCUGGCUCCGUGUCUUCACUCCC
miR-149
>hsa-miR-149* MIMAT0004609 Homo sapiens miR-149* 113 AGGGAGGGACGGGGGCUGUGC
>hsa-miR-150 MIMAT0000451 Homo sapiens miR-150 114 UCUCCCAACCCUUGUACCAGUG
miR-150
>hsa-miR-150* MIMAT0004610 Homo sapiens miR-150* 115 CUGGUACAGGCCUGGGGGACAG
>hsa-miR-151-3p MIMAT0000757 Homo sapiens miR-151-3p 116 miR-151-3p
CUAGACUGAAGCUCCUUGAGG
>hsa-miR-152 MIMAT0000438 Homo sapiens miR-152 117 miR-152
UCAGUGCAUGACAGAACUUGG
>hsa-miR-155 MIMAT0000646 Homo sapiens miR-155 118 UUAAUGCUAAUC GUG AUAGGGGU
miR-155
>hsa-miR-155* MIMAT0004658 Homo sapiens miR-155* 119 CUCCUACAUAUUAGCAUUAACA
>hsa-miR-181a MIMAT0000256 Homo sapiens miR-181a 120 miR-181a
AAC AUUC AAC GCUGUC GGUG AGU
>hsa-miR-181c MIMAT0000258 Homo sapiens miR-181c 121 AACAUUCAACCUGUCGGUGAGU
miR-181c
>hsa-miR-181c* MIMAT0004559 Homo sapiens miR-181c* 122 AAC C AUC G AC C GUUG AGUGG AC
>hsa-miR-184 MIMAT0000454 Homo sapiens miR-184 123 miR-184
UGG AC GG AG AACUG AUAAGGGU >hsa-miR-185 MIMAT0000455 Homo sapiens miR-185 124 UGGAGAGAAAGGCAGUUCCUGA
miR-185
>hsa-miR-185* MIMAT0004611 Homo sapiens miR-185* 125 AGGGGCUGGCUUUCCUCUGGUC
>hsa-miR-186 MIMAT0000456 Homo sapiens miR-186 126 CAAAGAAUUCUCCUUUUGGGCU
miR-186
>hsa-miR-186* MIMAT0004612 Homo sapiens miR-186* 127 GCCCAAAGGUGAAUUUUUUGGG
>hsa-miR-188-5p MIMAT0000457 Homo sapiens miR-188-5p 128 miR-188-5p
CAUCCCUUGCAUGGUGGAGGG
>hsa-miR-190 MIMAT0000458 Homo sapiens miR-190 129 miR-190
UGAUAUGUUUGAUAUAUUAGGU
>hsa-miR-191 MIMAT0000440 Homo sapiens miR-191 130 CAACGGAAUCCCAAAAGCAGCUG
miR-191
>hsa-miR-191 * MIMAT0001618 Homo sapiens miR-191 * 131 GCUGCGCUUGGAUUUCGUCCCC
>hsa-miR-192 MIMAT0000222 Homo sapiens miR-192 132 CUGACCUAUGAAUUGACAGCC
miR-192
>hsa-miR-192* MIMAT0004543 Homo sapiens miR-192* 133 CUGCCAAUUCCAUAGGUCACAG
>hsa-miR-193a-3p MIMAT0000459 Homo sapiens miR-193a-3p 134 miR-193a-3p
AACUGGCCUACAAAGUCCCAGU
>hsa-miR-193a-5p MIMAT0004614 Homo sapiens miR-193a-5p 135 miR-193a-5p
UGGGUCUUUGCGGGCGAGAUGA
>hsa-miR-193b* MIMAT0004767 Homo sapiens miR-193b* 136 CGGGGUUUUGAGGGCGAGAUGA
miR-193b
>hsa-miR-193b MIMAT0002819 Homo sapiens miR-193b 137 AACUGGCCCUCAAAGUCCCGCU
>hsa-miR-194 MIMAT0000460 Homo sapiens miR-194 138 miR-194
UGUAAC AGC AACUC C AUGUGG A
>hsa-miR-195 MIMAT0000461 Homo sapiens miR-195 139 UAGCAGCACAGAAAUAUUGGC
miR-195
>hsa-miR-195* MIMAT0004615 Homo sapiens miR-195* 140 CCAAUAUUGGCUGUGCUGCUCC
>hsa-miR-197 MIMAT0000227 Homo sapiens miR-197 141 miR-197
UUCACCACCUUCUCCACCCAGC
>hsa-miR-199a-3p MIMAT0000232 Homo sapiens miR-199a-3p 142 miR-199a-3p
ACAGUAGUCUGCACAUUGGUUA >hsa-miR-199a-5p MIMAT0000231 Homo sapiens miR-199a-5p 143 miR-199a-5p
CCCAGUGUUCAGACUACCUGUUC
>hsa-miR-199b-5p MIMAT0000263 Homo sapiens miR-199b-5p 144 miR-199b-5p
CCCAGUGUUUAGACUAUCUGUUC
>hsa-miR-200b* MIMAT0004571 Homo sapiens miR-200b* 145 CAUCUUACUGGGCAGCAUUGGA
miR-200b
>hsa-miR-200b MIMAT0000318 Homo sapiens miR-200b 146 UAAUACUGCCUGGUAAUGAUGA
>hsa-miR-200c* MIMAT0004657 Homo sapiens miR-200c* 147 CGUCUUACCCAGCAGUGUUUGG
miR-200c
>hsa-miR-200c MIMAT0000617 Homo sapiens miR-200c 148 UAAUACUGCCGGGUAAUGAUGGA
>hsa-miR-206 MIMAT0000462 Homo sapiens miR-206 149 miR-206
UGGAAUGUAAGGAAGUGUGUGG
>hsa-miR-210 MIMAT0000267 Homo sapiens miR-210 150 miR-210
CUGUGCGUGUGACAGCGGCUGA
>hsa-miR-212 MIMAT0000269 Homo sapiens miR-212 151 miR-212
UAACAGUCUCCAGUCACGGCC
>hsa-miR-214* MIMAT0004564 Homo sapiens miR-214* 152 UGCCUGUCUACACUUGCUGUGC
miR-214
>hsa-miR-214 MIMAT0000271 Homo sapiens miR-214 153 ACAGCAGGCACAGACAGGCAGU
>hsa-miR-218 MIMAT0000275 Homo sapiens miR-218 154 miR-218
UUGUGCUUGAUCUAACCAUGU
>hsa-miR-221 * MIMAT0004568 Homo sapiens miR-221 * 155 ACCUGGCAUACAAUGUAGAUUU
miR-221
>hsa-miR-221 MIMAT0000278 Homo sapiens miR-221 156 AGCUACAUUGUCUGCUGGGUUUC
>hsa-miR-222* MIMAT0004569 Homo sapiens miR-222* 157 CUCAGUAGCCAGUGUAGAUCCU
miR-222
>hsa-miR-222 MIMAT0000279 Homo sapiens miR-222 158 AGCUACAUCUGGCUACUGGGU
>hsa-miR-223* MIMAT0004570 Homo sapiens miR-223* 159 CGUGUAUUUGACAAGCUGAGUU
miR-223
>hsa-miR-223 MIMAT0000280 Homo sapiens miR-223 160 UGUCAGUUUGUCAAAUACCCCA
miR-224 >hsa-miR-224 MIMAT0000281 Homo sapiens miR-224 161
CAAGUCACUAGUGGUUCCGUU >hsa-miR-224* MIMAT0009198 Homo sapiens miR-224* 162 AAAAUGGUGCCCUAGUGACUACA
>hsa-miR-296-5p MIMAT0000690 Homo sapiens miR-296-5p 163 miR-296-5p
AGGGCCCCCCCUCAAUCCUGU
>hsa-miR-301a MIMAT0000688 Homo sapiens miR-301a 164 miR-301a
CAGUGCAAUAGUAUUGUCAAAGC
>hsa-miR-301b MIMAT0004958 Homo sapiens miR-301b 165 miR-301b
CAGUGCAAUGAUAUUGUCAAAGC
>mmu-miR-320 MIMAT0000666 Mus musculus miR-320 166 miR-320
AAAAGCUGGGUUGAGAGGGCGA
>hsa-miR-323-3p MIMAT0000755 Homo sapiens miR-323-3p 167 miR-323-3p
CACAUUACACGGUCGACCUCU
>hsa-miR-324-3p MIMAT0000762 Homo sapiens miR-324-3p 168 miR-324-3p
ACUGCCCCAGGUGCUGCUGG
>hsa-miR-324-5p MIMAT0000761 Homo sapiens miR-324-5p 169 miR-324-5p
CGCAUCCCCUAGGGCAUUGGUGU
>hsa-miR-328 MIMAT0000752 Homo sapiens miR-328 170 miR-328
CUGGCCCUCUCUGCCCUUCCGU
>hsa-miR-331-3p MIMAT0000760 Homo sapiens miR-331-3p 171 miR-331-3p
GCCCCUGGGCCUAUCCUAGAA
>hsa-miR-331-5p MIMAT0004700 Homo sapiens miR-331-5p 172 miR-331-5p
CUAGGUAUGGUCCCAGGGAUCC
>hsa-miR-339-3p MIMAT0004702 Homo sapiens miR-339-3p 173 miR-339-3p
UG AGC GCCUC G AC G AC AG AGC CG
>hsa-miR-339-5p MIMAT0000764 Homo sapiens miR-339-5p 174 miR-339-5p
UCCCUGUCCUCCAGGAGCUCACG
>hsa-miR-361-5p MIMAT0000703 Homo sapiens miR-361-5p 175 miR-361-5p
UUAUCAGAAUCUCCAGGGGUAC
>mmu-miR-365 MIMAT0000711 Mus musculus miR-365 176 UAAUGCCCCUAAAAAUCCUUAU
miR-365
>hsa-miR-365* MIMAT0009199 Homo sapiens miR-365* 177 AGGGACUUUCAGGGGCAGCUGU
>hsa-miR-367* MIMAT0004686 Homo sapiens miR-367* 178 ACUGUUGCUAAUAUGCAACUCU
miR-367
>hsa-miR-367 MIMAT0000719 Homo sapiens miR-367 179 AAUUGCACUUUAGCAAUGGUGA
miR-374b >hsa-miR-374b MIMAT0004955 Homo sapiens miR-374b 180
AUAUAAUACAACCUGCUAAGUG >hsa-miR-374b* MIMAT0004956 Homo sapiens miR-374b* 181 CUUAGCAGGUUGUAUUAUCAUU
>hsa-miR-378* MIMAT0000731 Homo sapiens miR-378* 182 CUCCUGACUCCAGGUCCUGUGU
miR-378
>hsa-miR-378 MIMAT0000732 Homo sapiens miR-378 183 ACUGGACUUGGAGUCAGAAGG
>hsa-miR-422a MIMAT0001339 Homo sapiens miR-422a 184 miR-422a
ACUGGACUUAGGGUCAGAAGGC
>hsa-miR-423-5p MIMAT0004748 Homo sapiens miR-423-5p 185 miR-423-5p
UGAGGGGCAGAGAGCGAGACUUU
>hsa-miR-425 MIMAT0003393 Homo sapiens miR-425 186 AAUGACACGAUCACUCCCGUUGA
miR-425
>hsa-miR-425* MIMAT0001343 Homo sapiens miR-425* 187 AUCGGGAAUGUCGUGUCCGCCC
>hsa-miR-449b MIMAT0003327 Homo sapiens miR-449b 188 AGGCAGUGUAUUGUUAGCUGGC
miR-449b
>hsa-miR-449b* MIMAT0009203 Homo sapiens miR-449b* 189 CAGCCACAACUACCCUGCCACU
>hsa-miR-450a MIMAT0001545 Homo sapiens miR-450a 190 miR-450a
UUUUGCGAUGUGUUCCUAAUAU
>hsa-miR-452 MIMAT0001635 Homo sapiens miR-452 191 AACUGUUUGCAGAGGAAACUGA
miR-452
>hsa-miR-452* MIMAT0001636 Homo sapiens miR-452* 192 CUCAUCUGCAAAGAAGUAAGUG
>hsa-miR-483-5p MIMAT0004761 Homo sapiens miR-483-5p 193 miR-483-5p
AAG AC GGG AGG A AAG AAGGG AG
>hsa-miR-484 MIMAT0002174 Homo sapiens miR-484 194 miR-484
UCAGGCUCAGUCCCCUCCCGAU
>hsa-miR-485-3p MIMAT0002176 Homo sapiens miR-485-3p 195 miR-485-3p
GUCAUACACGGCUCUCCUCUCU
>hsa-miR-489 MIMAT0002805 Homo sapiens miR-489 196 miR-489
GUG AC AUC AC AUAUAC GGC AGC
>hsa-miR-494 MIMAT0002816 Homo sapiens miR-494 197 miR-494
UGAAACAUACACGGGAAACCUC
>hsa-miR-497 MIMAT0002820 Homo sapiens miR-497 198 CAGCAGCACACUGUGGUUUGU
miR-497
>hsa-miR-497* MIMAT0004768 Homo sapiens miR-497* 199 CAAACCACACUGUGGUGUUAGA >hsa-miR-509-3p MIMAT0002881 Homo sapiens miR-509-3p 200 miR-509-3p
UGAUUGGUACGUCUGUGGGUAG
>hsa-miR-516a-3p MIMAT0006778 Homo sapiens miR-516a-3p 201 miR-516a-3p
UGCUUCCUUUCAGAGGGU
>hsa-miR-532-3p MIMAT0004780 Homo sapiens miR-532-3p 202 miR-532-3p
CCUCCCACACCCAAGGCUUGCA
>hsa-miR-532-5p MIMAT0002888 Homo sapiens miR-532-5p 203 miR-532-5p
CAUGCCUUGAGUGUAGGACCGU
>hsa-miR-532-3p MIMAT0004780 Homo sapiens miR-532-3p 204 miR-542-3p
CCUCCCACACCCAAGGCUUGCA
>hsa-miR-550 MIMAT0004800 Homo sapiens miR-550 205 AGUGCCUGAGGGAGUAAGAGCCC
miR-550
>hsa-miR-550* MIMAT0003257 Homo sapiens miR-550* 206 UGUCUUACUCCCUCAGGCACAU
>hsa-miR-564 MIMAT0003228 Homo sapiens miR-564 207 miR-564
AGGCACGGUGUCAGCAGGC
>hsa-miR-572 MIMAT0003237 Homo sapiens miR-572 208 miR-572
GUCCGCUCGGCGGUGGCCCA
>hsa-miR-574-3p MIMAT0003239 Homo sapiens miR-574-3p 209 miR-574-3p
CACGCUCAUGCACACACCCACA
>hsa-miR-596 MIMAT0003264 Homo sapiens miR-596 210 miR-596
AAGCCUGCCCGGCUCCUCGGG
>hsa-miR-610 MIMAT0003278 Homo sapiens miR-610 211 miR-610
UGAGCUAAAUGUGUGCUGGGA
>hsa-miR-629 MIMAT0004810 Homo sapiens miR-629
212 UGGGUUUACGUUGGGAGAACU
miR-629
>hsa-miR-629* MIMAT0003298 Homo sapiens miR-629*
213 GUUCUCCCAACGUAAGCCCAGC
>hsa-miR-639 MIMAT0003309 Homo sapiens miR-639 214 miR-639
AUCGCUGCGGUUGCGAGCGCUGU
>hsa-miR-652 MIMAT0003322 Homo sapiens miR-652 215 miR-652
AAUGGCGCCACUAGGGUUGUG
>hsa-miR-661 MIMAT0003324 Homo sapiens miR-661 216 miR-661
UGCCUGGGUCUCUGGCCUGCGCGU
>hsa-miR-671-3p MIMAT0004819 Homo sapiens miR-671-3p 217 miR-671-3p
UCCGGUUCUCAGGGCUCCACC
miR-708 >hsa-miR-708 MIMAT0004926 Homo sapiens miR-708 218
AAGGAGCUUACAAUCUAGCUGGG >hsa-miR-708* MIMAT0004927 Homo sapiens miR-708* 219 CAACUAGACUGUGAGCUUCUAG
>hsa-miR-744 MIMAT0004945 Homo sapiens miR-744
609 UGCGGGGCUAGGGCUAACAGCA
miR-744
>hsa-miR-744* MIMAT0004946 Homo sapiens miR-744*
610 CUGUUGCCACUAACCUCAACCU
>hsa-miR-760 MIMAT0004957 Homo sapiens miR-760 220 miR-760
CGGCUCUGGGUCUGUGGGGA
>hsa-miR-770-5p MIMAT0003948 Homo sapiens miR-770-5p 221 miR-770-5p
UCCAGUACCACGUGUCAGGGCCA
>hsa-miR-875-5p MIMAT0004922 Homo sapiens miR-875-5p 222 miR-875-5p
UAUACCUCAGUUUUAUCAGGUG
>hsa-miR-877 MIMAT0004949 Homo sapiens miR-877 223 GUAG AGG AG AUGGC GC AGGG
miR-877
>hsa-miR-877* MIMAT0004950 Homo sapiens miR-877* 224 UCCUCUUCUCCCUCCUCCCAG
>hsa-miR-939 MIMAT0004982 Homo sapiens miR-939 225 miR-939
UGGGGAGCUGAGGCUCUGGGGGUG
Expressed in hKPDCs and hLNDPCs but not in hPDPCs (18 miRNAs)
>hsa-miR-7 MIMAT0000252 Homo sapiens miR-7 226 miR-7
UGGAAGACUAGUGAUUUUGUUGU
>hsa-miR-18b MIMAT0001412 Homo sapiens miR-18b 227 UAAGGUGCAUCUAGUGCAGUUAG
miR-18b
>hsa-miR-18b* MIMAT0004751 Homo sapiens miR-18b* 228 UGCCCUAAAUGCCCCUUCUGGC
>hsa-miR-135b MIMAT0000758 Homo sapiens miR-135b 229 UAUGGCUUUUCAUUCCUAUGUGA
miR-135b
>hsa-miR-135b* MIMAT0004698 Homo sapiens miR-135b* 230 AUGUAGGGCUAAAAGCCAUGGG
>hsa-miR-142-3p MIMAT0000434 Homo sapiens miR-142-3p 231 miR142-3p
UGUAGUGUUUCCUACUUUAUGGA
>hsa-miR-142-5p MIMAT0000433 Homo sapiens miR-142-5p 232 miR-142-5p
CAUAAAGUAGAAAGCACUACU
>hsa-miR-147b MIMAT0004928 Homo sapiens miR-147b 233 miR-147b
GUGUGCGGAAAUGCUUCUGCUA
miR-187 >hsa-miR-187 MIMAT0000262 Homo sapiens miR-187 234
UCGUGUCUUGUGUUGCAGCCGG >hsa-miR-187* MIMAT0004561 Homo sapiens miR-187* 235 GGCUACAACACAGGACCCGGGC
>hsa-miR-196b MIMAT0001080 Homo sapiens miR-196b 236 UAGGUAGUUUCCUGUUGUUGGG
miR-196b
>hsa-miR-196b* MIMAT0009201 Homo sapiens miR-196b* 237 UCGACAGCACGACACUGCCUUC
>hsa-miR-204 MIMAT0000265 Homo sapiens miR-204 238 miR-204
UUCCCUUUGUCAUCCUAUGCCU
>hsa-miR-216a MIMAT0000273 Homo sapiens miR-216a 239 miR-216a
UAAUCUCAGCUGGCAACUGUGA
>hsa-miR-296-3p MIMAT0004679 Homo sapiens miR-296-3p 240 miR-296-3p
G AGGGUUGGGUGG AGGCUCUC C
Expressed in hPDPCs and hLNDPCs
>hsa-miR-200a MIMAT0000682 Homo sapiens miR-200a 241 UAACACUGUCUGGUAACGAUGU
miR-200a
>hsa-miR-200a* MIMAT0001620 Homo sapiens miR-200a* 242 CAUCUUACCGGACAGUGCUGGA
>hsa-miR-361-3p MIMAT0004682 Homo sapiens miR-361-3p 243 miR-361-3p
UCCCCCAGGUGUGAUUCUGAUUU
>hsa-miR-374a MIMAT0000727 Homo sapiens miR-374a 244 UUAUAAUACAACCUGAUAAGUG
miR-374a
>hsa-miR-374a* MIMAT0004688 Homo sapiens miR-374a* 245 CUUAUCAGAUUGUAUUGUAAUU
>hsa-miR-455-5p MIMAT0003150 Homo sapiens miR-455-5p 246 miR455 UAUGUGCCUUUGGACUACAUC
>hsa-miR-455-3p MIMAT0004784 Homo sapiens miR-455-3p 247 GCAGUCCAUGGGCAUAUACAC
Expressed in hPDPCs and hKDPCs
hsa-miR-129-3p MIMAT0004605 Homo sapiens miR-129-3p 248 miR-129-3p
AAGCCCUUACCCCAAAAAGCAU
>hsa-miR-133b MIMAT0000770 Homo sapiens miR-133b 249 miR-133b
UUUGGUCCCCUUCAACCAGCUA
>hsa-miR-190b MIMAT0004929 Homo sapiens miR-190b 250 miR-190b
UGAUAUGUUUGAUAUUGGGUU
>hsa-miR-342-3p MIMAT0000753 Homo sapiens miR-342-3p 251 miR-342-3p
UCUCACACAGAAAUCGCACCCGU
miR-513a-3p >hsa-miR-513a-3p MIMAT0004777 Homo sapiens miR-513a-3p 252 UAAAUUUCACCUUUCUGAGAAGG
>has-miR-513a-5p MIMAT0002877 Homo sapiens miR-513a-5p 253 miR-513a-5p
UUCACAGGGAGGUGUCAU
>hsa-miR-571 MIMAT0003236 Homo sapiens miR-571 254 miR-571
UG AGUUGGC C AUCUG AGUG AG
>hsa-miR-592 MIMAT0003260 Homo sapiens miR-592 255 miR-592
UUGUGUCAAUAUGCGAUGAUGU
>hsa-miR-638 MIMAT0003308 Homo sapiens miR-638 256 miR-638
AGGGAUCGCGGGCGGGUGGCGGCCU
>hsa-miR-657 MIMAT0003335 Homo sapiens miR-657 257 miR-657
GGCAGGUUCUCACCCUCUCUAGG
>hsa-miR-659 MIMAT0003337 Homo sapiens miR-659 258 miR-659
CUUGGUUCAGGGAGGGUCCCCA
>hsa-miR-766 MIMAT0003888 Homo sapiens miR-766 259 miR-766
ACUCCAGCCCCACAGCCUCAGC
Express ;d in hPDPCs
>hsa-miR-122 MIMAT0000421 Homo sapiens miR-122 260 miR-122
UGGAGUGUGACAAUGGUGUUUG
>rno-miR-127 MIMAT0000833 Rattus norvegicus miR-127 261 miR-127
UCGGAUCCGUCUGAGCUUGGCU
>hsa-miR-134 MIMAT0000447 Homo sapiens miR-134 262 miR-134
UGUGACUGGUUGACCAGAGGGG
>hsa-miR-137 MIMAT0000429 Homo sapiens miR-137 263 miR-137
UUAUUGCUUAAGAAUACGCGUAG
>hsa-miR-148a* MIMAT0004549 Homo sapiens miR-148a* 264 miR-148a
AAAGUUCUGAGACACUCCGACU
>hsa-miR-299-5p MIMAT0002890 Homo sapiens miR-299-5p 265 miR-299-5p
UGGUUUACCGUCCCACAUACAU
>hsa-miR-302b* MIMAT0000714 Homo sapiens miR-302b* 266 miR-302b
ACUUUAACAUGGAAGUGCUUUC
>hsa-miR-337-5p MIMAT0004695 Homo sapiens miR-337-5p 267 miR-337-5p
GAACGGCUUCAUACAGGAGUU
>hsa-miR-340 MIMAT0004692 Homo sapiens miR-340 268 UUAUAAAGCAAUGAGACUGAUU
miR-340
>hsa-miR-340* MIMAT0000750 Homo sapiens miR-340* 269 UCCGUCUCAGUUACUUUAUAGC
miR-345 >hsa-miR-345 MIMAT0000772 Homo sapiens miR-345 270 GCUGACUCCUAGUCCAGGGCUC
>hsa-miR-362-5p MIMAT0000705 Homo sapiens miR-362-5p 271 miR-362-5p
AAUC CUUGG AAC CUAGGUGUG AGU
>hsa-miR-369-5p MIMAT0001621 Homo sapiens miR-369-5p 272 miR-369-5p
AGAUCGACCGUGUUAUAUUCGC
>hsa-miR-370 MIMAT0000722 Homo sapiens miR-370 273 miR-370
GCCUGCUGGGGUGGAACCUGGU
>hsa-miR-376a MIMAT0000729 Homo sapiens miR-376a 274 AUCAUAGAGGAAAAUCCACGU
miR-376a
>hsa-miR-376a* MIMAT0003386 Homo sapiens miR-376a* 275 GUAGAUUCUCCUUCUAUGAGUA
>mmu-miR-376b MIMAT0001092 276 AUCAUAGAGGAACAUCCACUU
miR-376b
>rno-miR-376b-5p MIMAT0003195 277 GUGGAUAUUCCUUCUAUGGUUA
> rno-miR-376c MIMAT0003194 278 miR-376c
AAC AUAG AGG AAAUUUC AC GU
>hsa-miR-379 MIMAT0000733 Homo sapiens miR-379 279 UGGUAGACUAUGGAACGUAGG
miR-379
>hsa-miR-379* MIMAT0004690 Homo sapiens miR-379* 280 UAUGUAACAUGGUCCACUAACU
>hsa-miR-409-3p MIMAT0001639 Homo sapiens miR-409-3p 281 miR-409-3p
GAAUGUUGCUCGGUGAACCCCU
>hsa-miR-411 MIMAT0003329 Homo sapiens miR-411 282 UAGUAGACCGUAUAGCGUACG
miR-411
>hsa-miR-411 * MIMAT0004813 Homo sapiens miR-411 * 283 UAUGUAACACGGUCCACUAACC
>hsa-miR-424 MIMAT0001341 Homo sapiens miR-424 284 miR-424
CAGCAGCAAUUCAUGUUUUGAA
>hsa-miR-432 MIMAT0002814 Homo sapiens miR-432 285 UCUUGGAGUAGGUCAUUGGGUGG
miR-432
>hsa-miR-432* MIMAT0002815 Homo sapiens miR-432* 286 CUGGAUGGCUCCUCCAUGUCU
>hsa-miR-433 MIMAT0001627 Homo sapiens miR-433 287 miR-433
AUCAUGAUGGGCUCCUCGGUGU
miR-450b-5p >hsa-miR-450b-5p MIMAT0004909 Homo sapiens miR-450b- 288
5pUUUUGCAAUAUGUUCCUGAAUA >hsa-miR-450b-3p MIMAT0004910 Homo sapiens miR-450b-3p 289 UUGGGAUCAUUUUGCAUCCAUA
>hsa-miR-454 MIMAT0003885 Homo sapiens miR-454 290 UAGUGCAAUAUUGCUUAUAGGGU
miR-454
>hsa-miR-454* MIMAT0003884 Homo sapiens miR-454* 291 ACCCUAUCAAUAUUGUCUCUGC
>hsa-miR-455-3p MIMAT0004784 Homo sapiens miR-455-3p 292 miR-455-3p
GCAGUCCAUGGGCAUAUACAC
>mmu-miR-486 MIMAT0003130 Mus musculus miR-486 293 miR-486
UCCUGUACUGAGCUGCCCCGAG
>hsa-miR-487b MIMAT0003180 Homo sapiens miR-487b 294 miR-487b
AAUCGUACAGGGUCAUCCACUU
>hsa-miR-490-3p MIMAT0002806 Homo sapiens miR-490-3p 295 miR-490-3p
CAACCUGGAGGACUCCAUGCUG
>hsa-miR-491-5p MIMAT0002807 Homo sapiens miR-491-5p 296 miR-491-5p
AGUGGGGAACCCUUCCAUGAGG
>hsa-miR-493 MIMAT0003161 Homo sapiens miR-493 297 UGAAGGUCUACUGUGUGCCAGG
miR-493
>hsa-miR-493* MIMAT0002813 Homo sapiens miR-493* 298 UUGUACAUGGUAGGCUUUCAUU
>hsa-miR-495 MIMAT0002817 Homo sapiens miR-495 299 miR-495
AAACAAACAUGGUGCACUUCUU
>hsa-miR-500 MIMAT0004773 Homo sapiens miR-500 300 UAAUCCUUGCUACCUGGGUGAGA
miR-500
>hsa-miR-500* MIMAT0002871 Homo sapiens miR-500* 301 AUGCACCUGGGCAAGGAUUCUG
>hsa-miR-501-5p MIMAT0002872 Homo sapiens miR-501-5p 302 miR-501-5p
AAUCCUUUGUCCCUGGGUGAGA
>hsa-miR-502-3p MIMAT0004775 Homo sapiens miR-502-3p 303 miR-502-3p
AAUGCACCUGGGCAAGGAUUCA
>hsa-miR-503 MIMAT0002874 Homo sapiens miR-503 304 miR-503
UAGCAGCGGGAACAGUUCUGCAG
>hsa-miR-539 MIMAT0003163 Homo sapiens miR-539 305 miR-539
GGAGAAAUUAUCCUUGGUGUGU
>hsa-miR-542-5p MIMAT0003340 Homo sapiens miR-542-5p 306 miR-542-5p
UCGGGGAUCAUCAUGUCACGAGA
>hsa-miR-543 MIMAT0004954 Homo sapiens miR-543 307 miR-543
AAACAUUCGCGGUGCACUUCUU >hsa-miR-549 MIMAT0003333 Homo sapiens miR-549 308 miR-549
UGACAACUAUGGAUGAGCUCU
>hsa-miR-590-5p MIMAT0003258 Homo sapiens miR-590-5p 309 miR-590-5p
GAGCUUAUUCAUAAAAGUGCAG
>hsa-miR-625 MIMAT0003294 Homo sapiens miR-625 310 miR-625
AGGGGGAAAGUUCUAUAGUCC
>hsa-miR-628-5p MIMAT0004809 Homo sapiens miR-628-5p 311 miR-628-5p
AUGCUGACAUAUUUACUAGAGG
>hsa-miR-655 MIMAT0003331 Homo sapiens miR-655 312 miR-655
AUAAUACAUGGUUAACCUCUUU
>hsa-miR-660 MIMAT0003338 Homo sapiens miR-660 313 miR-660
UACCCAUUGCAUAUCGGAGUUG
>hsa-miR-668 MIMAT0003881 Homo sapiens miR-668 314 miR-668
UGUCACUCGGCUCGGCCCACUAC
>hsa-miR-758 MIMAT0003879 Homo sapiens miR-758 315 miR-758
UUUGUGACCUGGUCCACUAACC
>hsa-miR-769-5p MIMAT0003886 Homo sapiens miR-769-5p 316 UGAGACCUCUGGGUUCUGAGCU
miR-769
>hsa-miR-769-3p MIMAT0003887 Homo sapiens miR-769-3p 317 CUGGGAUCUCCGGGGUCUUGGUU
>hsa-miR-886-3p MIMAT0004906 Homo sapiens miR-886-3p 318 miR-886-3p
CGCGGGUGCUUACUGACCCUU
>hsa-miR-886-5p MIMAT0004905 Homo sapiens miR-886-5p 319 miR-886-5p
CGGGUCGGAGUUAGCUCAAGCGG
[0124] It is contemplated that one or more microRNAs identified according to the present invention (e.g., SEQ ID NOs: 1 to 610 (or SEQ ID NOs: 1 to 225) may be used to induce or stimulate tissue or cell repair, growth, remodeling, reconstruction, differentiation and/or transdifferentitation, and/or to treat associated diseases, disorders or conditions. In some embodiments, functional variants of microRNAs described herein may be used. For example, suitable microRNAs may include microRNAs having a sequence at least 70% (e.g., 75%, 80%>, 85%, 90%, 95%, 96%, 97%, 98%, 99%) identical to any one of microRNAs identified in Table 1 and Tables 6-10. In some embodiments, suitable microRNAs are functional variants of
microRNAs that are specifically present in pathfinder cells. Accordingly, in some embodiments, suitable microRNAs may include microRNAs having a sequence at least 70%> (e.g., 75%, 80%>, 85%, 90%, 95%, 96%, 97%, 98%, 99%) identical to any one of SEQ ID NOs: 1 to 610 or SEQ ID NOs: 1 to 225.
[0125] "Percent (%) nucleic acid sequence identity" with respect to microRNA sequences identified herein is defined as the percentage of nucleotides in a candidate sequence that are identical with the nucleotides in a reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. Preferably, the WU-BLAST-2 software is used to determine amino acid sequence identity (Altschul et ah, Methods in Enzymology, 266, 460-480 (1996); http://blast.wustl/edu/blast/README.html). WU-BLAST-2 uses several search parameters, most of which are set to the default values. The adjustable parameters are set with the following values: overlap span=l, overlap fraction=0.125, world threshold (T)=l 1. HSP score (S) and HSP S2 parameters are dynamic values and are established by the program itself, depending upon the composition of the particular sequence, however, the minimum values may be adjusted and are set as indicated above.
[0126] Suitable microRNAs may be comprised entirely of natural RNA nucleotides, or may instead include one or more nucleotide analogs and/or modifications. The microRNA structure may be stabilized, for example by including nucleotide analogs at one or more free strand ends in order to reduce digestion, e.g., by exonucleases. Suitable microRNAs may contain modified ribonucleotides, that is, ribonucleotides that contain a modification in the chemical structure of an unmodified nucleotide base, sugar and/or phosphate (or phospodiester linkage). As is known in the art, an "unmodified ribonucleotide" has one of the bases adenine, cytosine, guanine, and uracil joined to the 1 ' carbon of beta-D-ribo-furanose. Modified microRNA molecules may also contain modified backbones or non-natural internucleoside linkages, e.g., modified phosphorous-containing backbones and non-phosphorous backbones such as morpholino backbones; siloxane, sulfide, sulfoxide, sulfone, sulfonate, sulfonamide, and sulfamate backbones; formacetyl and thioformacetyl backbones; alkene-containing backbones; methyleneimino and methylenehydrazino backbones; amide backbones, and the like.
III. Extracellular Secretomes
[0127] As used herein, extracellular secretomes of pathfinder cells refer to any isolates derived from pathfinder cells according to the invention, including, but not limited to, any micro vesicles including exosomes isolated from Pathfinder cells. Various methods of isolating or enriching microvesicles known in the art may be used to practice the present invention. As used herein, the terms "isolation" or "isolating" in conjunction with microvesicles are interchangeably used with the terms "enrichment" or "enriching," and refer to one or more process steps that result in an increase of the fraction of microvesicles in a sample as compared to the fraction of microvesicles in the obtained biological sample. Thus, microvesicles may be purified to homogeneity, purified to at least 90% (with respect to non-microvesicle particulate matter), at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, or at least 20%) (or even less). For example, physical properties of microvesicles- may be employed to separate them from a medium or other source material. For example, microvesicles may be separated on the basis of electrical charge (e.g., electrophoretic separation), size (e.g., filtration, molecular sieving, etc), density (e.g., regular or gradient centrifugation), Svedberg constant (e.g., sedimentation with or without external force, etc).
[0128] In some embodiments, microvesicles are isolated or purified by centrifugation
(e.g., ultracentrifugation). It will be appreciated that various centrifugation conditions (e.g., speed, centrifugal force, centrifugation time, etc.) may be used in order to obtain a desired fraction of isolated or purified microvesicles. For example, in some embodiments, a sample may be centrifuged at a fairly low centrifugal force (e.g., approximately 16,000 x g) sufficient to pellet larger microvesicles (e.g., approximately 1000 nm or more). In some embodiments, a sample (e.g., the resulting supernatant from the initial low speed spin) may be centrifuged at a higher centrifugal force (e.g., approximately 120,000 x g) sufficient to pellet microvesicles of a smaller size (e.g., less then 1000 nm). In some embodiments, a microvesicle preparation prepared using this method may contain substantially small particles, for example, particles with a size ranging from about lOnm to 1000 nm (e.g., about 50-1000 nm, 75-1000 nm, 100-1000 nm, 10-750 nm, 50-750 nm, 100-75 Onm, 100-500 nm). In some embodiments, such small particles are also referred to as exosomes, exosome-like vesicles, and/or membrane particles. In some embodiments, such fraction is referred to as exosome fraction.
[0129] In some embodiments, microvesicles are isolated or purified by precipitation. It will be appreciated that various precipitation conditions may be used in order to obtain a desired fraction of isolated or purified microvesicles. For example, various kits are available for exosome precipitation, such as ExoQuick™ and Exo-Quick-TC™ (available from System Biosciences, Mountain View, California) and may be used in accordance with the present invention.
[0130] Alternatively, or additionally, isolation may be based on one or more biological properties, and may employ surface markers (e.g., for precipitation, reversible binding to solid phase, FACS separation, specific ligand binding, non-specific ligand binding such as annexin V, etc.). In yet further contemplated methods, the microvesicles may also be fused using chemical and/or physical methods, including PEG-induced fusion and/or ultrasonic fusion.
[0131] In some embodiments, microvesicles are obtained from conditioned media from cultures of microvesicle-producing cells.
Synthetic Microvesicles
[0132] In some embodiments, microvesicles suitable for the present invention may be synthetically produced. Synthetic microvesicles typically include one or more membrane components obtained from a donor cell. In some embodiments, synthetic microvesicles include at least one microRNA described herein. For example, synthetic microvesicles may be prepared by disintegration of a donor cell (e.g., via detergent, sonication, shear forces, etc.) and use of the crude preparation or an at least partially enriched membrane fraction to reconstitute one or more microvesicles. In some embodiments, exogenous microRNAs may be added to microvesicles. [0133] Further detailed description of microvesicles and uses thereof are provide in PCT application entitled "THERAPEUTIC USES OF MICROVESICLES AND RELATED
MICRORNAS" filed on even date and claiming priority to United States Provisional Patent Application serial number 61/373,715 filed on August 13, 2010, the entirety of which is incorporated herein by reference.
III. Therapeutic Applications
[0134] In some embodiments, the present invention provides methods of using pathfinder cells, cells differentiated from pathfinder cells, extracellular secretomes (e.g., microvesicles) and/or microRNAs for inducing or stimulating tissue or cell repair, growth, remodeling, reconstruction, differentiation and/or transdifferentitation, or treating associated diseases, disorders or conditions. While not wishing to be bound by a particular theory or hypothesis, it is contemplated that pathfinder cells may induce changes within target tissue or cells to convert them into active repair mode by providing microRNAs and/or other components (e.g., membrane associated polypeptide, transcription factors, etc.) that will regulate expression of genes relating to, e.g., increased cell mobility, tissue remodeling and reprogramming, growth, angiogenesis, cell adhesion and cell signaling, etc. It is further contemplated that pathfinder cells will typically not be part of the new tissue or cells. Thus, according to the present invention, pathfinder cells or microRNAs from different tissues, cell types or organisms may be used. In some
embodiments, pathfinder cells or microRNAs may be used without inducing an immune reaction. In some embodiments, pathfinder cells or microRNAs may be used without an
immunosuppressant.
[0135] Thus, suitable pathfinder cells or microRNAs can be derived from autologous cells (i.e., cells from the same individual as the patient) or non-auto logous cells (i.e., cells from a different individual as the patient) or both. In some embodiments, pathfinder cells are derived from tissue that is the same as the diseased tissue. For example, in methods of treating a kidney disease, pathfinder cells may be taken from healthy kidney cells from the same or different individual being treated. In some embodiments, pathfinder cells are derived from tissue that is different than the diseased tissue. [0136] In some embodiments, methods of treatment comprise one or more steps that are performed in vitro or ex vivo to induce cells ("recipient cells") to differentiate or
transdifferentiate into a desirable cell type. Such recipient cells can then be transferred into a patient.
[0137] Without wishing to be bound by any particular theory, the inventors have proposed that pathfinder cells may act on other cells at least partially through microvesicles. (See U.S. provisional application serial number 61/373,715, filed on August 13, 2010, the entire contents of which are incorporated herein by reference). According to this theory, microvesicles produced by pathfinder cells contain factors (e.g., microR As) that confer desirable properties on recipient cells (i.e., cells that receive microvesicles, their contents, and/or or other factors secreted or produced by pathfinder cells).
[0138] In some embodiments, provided methods comprise co-culturing pathfinder cells and recipient cells ex vivo and then transferring recipient cells into an patient. In some embodiments, recipient cells are transferred back into the same individual from whom recipient cells were obtained. For example, pathfinder cells can be co-cultured with bone marrow cells obtained from a patient for a period of time ex vivo to allow transfer of stimulatory factors (e.g., microvesicles, their contents, and/or other factors secreted or produced by pathfinder cells), then bone marrow cells may be transferred back into the individual.
[0139] In some embodiments, recipient cells are tested for expression of specific biomarkers such as certain proteins and/or microRNAs after co-culturing with pathfinder cells before transfer into a patient.
[0140] In certain embodiments, methods of treatment comprise a step of administering to a patient in need of treatment a therapeutically effective amount of one or more microRNAs as described herein. miRNAs may be used in the absence or presence of cells.
[0141] In certain embodiments, methods and compositions of the present invention are used to stimulate repair of tissues and/or cells that have are damaged acutely (e.g., by trauma, and/or due to an acute disease, disorder, or condition). Results described herein provide the first evidence to the inventor's knowledge that pluripotent adult cells can successfully stimulate repair of acute damage to tissues. It is contemplated that pathfinder cell-associated microRNAs disclosed herein would similarly be useful in stimulating repair of acute damage.
[0142] In some embodiments, methods and compositions of the present invention are used to stimulate repair of damaged tissue in an acute condition resulting from ischemia. By way of non-limiting example, methods and compositions of the present invention may be used to treat stroke, subarachnoid hemorrhage, brain hemorrhage, hemorrhagic stroke, brain trauma, head injury, head trauma, seizure, a headache disorder (e.g., migraine or cluster headache), cardiovascular disease (e.g., myocardial infarction, heart disease, coronary artery disease, congestive heart failure, cardiac valvular disease, cardiac arrhythmia, and cardiac arrest), tissue organ engraftment rejection, sequelae of ischemic reperfusion injury, retinal ischemia (e.g., diabetic retinopathy, central retinal artery or vein occlusion, stenosis of the carotid artery, and sickle cell retinopathy), retinal detachment, retinal tearing, gastrointestinal ischemia (e.g., ischemic bowel, ischemic colitis, and mesenteric ischemia), renal (kidney) ischemia, peripheral ischemia (e.g., acute peripheral vascular ischemia, atherosclerosis, peripheral arterial occlusive disease, thromboembolic disease, and thromboangiitis obliterans (Buerger's disease). In some embodiments, methods and compositions of the invention are used to stimulate repair in individuals who suffer from stroke, renal ischemia, or myocardial infarct.
[0143] In some embodiments, methods and compositions of the present invention are used to treat reperfusion injury. Reperfusion injury refers to damage to a tissue caused when blood supply returns to the tissue after a period of ischemia. Reperfusion injury is thought to arise at least in part from the inflammatory response of damaged tissues. Blood cells in newly returning blood may release a host of inflammatory factors such as interleukins and free radicals in response to the tissue damage. Oxidative stress resulting from reintroduced oxygen from returning blood flow may also contribute to reperfusion injury.
[0144] In some embodiments, methods and compositions of the present invention are used to treat or alleviate acute organ failure, such as, for example, kidney failure or liver failure.
[0145] In some embodiments, methods and compositions of the present invention are used to treat or alleviate acute complications of diseases. For example, in Type I diabetes (also known as "juvenile diabetes"), acute complications may arise suddenly from alterations in blood glucose levels; such complications include, but are not limited to, ketoacidosis (a pathological metabolic state marked by extreme and uncontrolled ketosis), hyperglycemic hyperosmolar nonketotic syndrom (HHNS) (usually associated with insulin deficiency and dehydration), and hypoglycemia (usually associated with too much insulin and/or too little glucose).
Inflammation
[0146] In some embodiments, methods and compositions of the present invention are used to treat or ameliorate inflammation. As used herein, the term "inflammation" includes inflammatory conditions occurring in many disorders which include, but are not limited to: Systemic Inflammatory Response (SIRS); Alzheimer's Disease (and associated conditions and symptoms including: chronic neuroinflammation, glial activation; increased microglia; neuritic plaque formation; and response to therapy); Amyotropic Lateral Sclerosis (ALS), arthritis (and associated conditions and symptoms including, but not limited to: acute joint inflammation, antigen-induced arthritis, arthritis associated with chronic lymphocytic thyroiditis, collagen- induced arthritis, juvenile arthritis; rheumatoid arthritis, osteoarthritis, prognosis and
streptococcus-induced arthritis, spondyloarthopathies, gouty arthritis), asthma (and associated conditions and symptoms, including: bronchial asthma; chronic obstructive airway disease; chronic obstructive pulmonary disease, juvenile asthma and occupational asthma);
cardiovascular diseases (and associated conditions and symptoms, including atherosclerosis; autoimmune myocarditis, chronic cardiac hypoxia, congestive heart failure, coronary artery disease, cardiomyopathy and cardiac cell dysfunction, including: aortic smooth muscle cell activation; cardiac cell apoptosis; and immunomodulation of cardiac cell function; diabetes and associated conditions and symptoms, including autoimmune diabetes, insulin-dependent (Type 1) diabetes, diabetic periodontitis, diabetic retinopathy, and diabetic nephropathy);
gastrointestinal inflammations (and related conditions and symptoms, including celiac disease, associated osteopenia, chronic colitis, Crohn's disease, inflammatory bowel disease and ulcerative colitis); gastric ulcers; hepatic inflammations such as viral and other types of hepatitis, cholesterol gallstones and hepatic fibrosis, HIV infection (and associated conditions and symptoms, including degenerative responses, neurodegenerative responses, and HIV associated Hodgkin's Disease), Kawasaki's Syndrome (and associated diseases and conditions, including mucocutaneous lymph node syndrome, cervical lymphadenopathy, coronary artery lesions, edema, fever, increased leukocytes, mild anemia, skin peeling, rash, conjunctiva redness, thrombocytosis; multiple sclerosis, nephropathies (and associated diseases and conditions, including diabetic nephropathy, endstage renal disease, acute and chronic glomerulonephritis, acute and chronic interstitial nephritis, lupus nephritis, Goodpasture's syndrome, hemodialysis survival and renal ischemic reperfusion injury), neurodegenerative diseases (and associated diseases and conditions, including acute neurodegeneration, induction of IL-1 in aging and neurodegenerative disease, IL-1 induced plasticity of hypothalamic neurons and chronic stress hyperresponsiveness), ophthalmopathies (and associated diseases and conditions, including diabetic retinopathy, Graves' opthalmopathy, and uveitis, osteoporosis (and associated diseases and conditions, including alveolar, femoral, radial, vertebral or wrist bone loss or fracture incidence, postmenopausal bone loss, mass, fracture incidence or rate of bone loss), otitis media (adult or pediatric), pancreatitis or pancreatic acinitis, periodontal disease (and associated diseases and conditions, including adult, early onset and diabetic); pulmonary diseases, including chronic lung disease, chronic sinusitis, hyaline membrane disease, hypoxia and pulmonary disease in SIDS; restenosis of coronary or other vascular grafts; rheumatism including rheumatoid arthritis, rheumatic Aschoff bodies, rheumatic diseases and rheumatic myocarditis; thyroiditis including chronic lymphocytic thyroiditis; urinary tract infections including chronic prostatitis, chronic pelvic pain syndrome and urolithiasis. Immunological disorders, including autoimmune diseases, such as alopecia aerata, autoimmune myocarditis, Graves' disease, Graves opthalmopathy, lichen sclerosis, multiple sclerosis, psoriasis, systemic lupus erythematosus, systemic sclerosis, thyroid diseases (e.g. goiter and struma lymphomatosa (Hashimoto's thyroiditis, lymphadenoid goiter), sleep disorders and chronic fatigue syndrome and obesity (non-diabetic or associated with diabetes). Resistance to infectious diseases, such as
Leishmaniasis, Leprosy, Lyme Disease, Lyme Carditis, malaria, cerebral malaria, meningitis, tubulointerstitial nephritis associated with malaria), which are caused by bacteria, viruses (e.g. cytomegalovirus, encephalitis, Epstein-Barr Virus, Human Immunodeficiency Virus, Influenza Virus) or protozoans (e.g., Plasmodium falciparum, trypanosomes). Response to trauma, including cerebral trauma (including strokes and ischemias, encephalitis, encephalopathies, epilepsy, perinatal brain injury, prolonged febrile seizures, SIDS and subarachnoid hemorrhage), low birth weight (e.g. cerebral palsy), lung injury (acute hemorrhagic lung injury, Goodpasture's syndrome, acute ischemic reperfusion), myocardial dysfunction, caused by occupational and environmental pollutants (e.g. susceptibility to toxic oil syndrome silicosis), radiation trauma, and efficiency of wound healing responses (e.g. burn or thermal wounds, chronic wounds, surgical wounds and spinal cord injuries). Hormonal regulation including fertility/fecundity, likelihood of a pregnancy, incidence of preterm labor, prenatal and neonatal complications including preterm low birth weight, cerebral palsy, septicemia, hypothyroidism, oxygen dependence, cranial abnormality, early onset menopause. A subject's response to transplant (rejection or acceptance), acute phase response (e.g. febrile response), general inflammatory response, acute respiratory distress response, acute systemic inflammatory response, wound healing, adhesion, immunoinflammatory response, neuroendocrine response, fever development and resistance, acute -phase response, stress response, disease susceptibility, repetitive motion stress, tennis elbow, and pain management and response.
[0147] In particular embodiments, methods and compositions of the present invention can be used to treat or ameliorate inflammation associated with an immunodeficiency disease, disorder, or condition. Non-limiting examples of diseases, disorders, and conditions that may be characterized by immunodeficiency include hypgammaglobulinemia, agammaglobulinemia, ataxia telengiectasia, severe combined immunodeficiency disease (SCID), acquired
immunodeficiency syndrome (AIDS) such as that caused by infection by human
immunodeficiency virus (HIV), Chediak-Higashi syndrome, combined immunodeficiency disease, complement deficiencies, diGeorge syndrome, Job syndrome, leukocyte adhesion defects, panhypogammaglobulinemia (e.g., Bruton disease, congential agammaglobulinemia, selective deficiency of IgA, Wiscott-Aldrich syndrome. In some embodiments, pathfinder cells and/or cells differentiated from pathfinder cells treat or ameliorate immunodeficiency by stimulating reconstitution of one or more blood cell types, i.e., cells of the immune system. It is contemplated that pathfinder cell-associated microRNAs disclosed herein would similarly be useful in treating or ameliorating immunodeficiency.
[0148] In certain embodiments, methods and compositions of the present invention are used to treat or ammeliorate an autoimmune diesase, disorder or condition. In general, autoimmunity is the failure of an organism to recognize its own constituent parts as "self," which results in an immune response against the organism's own tissues and cells. Exemplary autoimmune diseases and/or suspected autoimmune diseases include, but are not limited to, Acute disseminated encephalomyelitis (ADEM), Addison's disease, Alopecia universalis, Ankylosing spondylitisis, Antiphospholipid antibody syndrome (APS), Aplastic anemia, Autoimmune hemolytic anemia, Autoimmune hepatitis, Autoimmune inner ear disease (AIED), Autoimmune lymphoproliferative syndrome (ALPS), Autoimmune oophoritis, Balo disease, Behcet's disease, Bullous pemphigoid, Cardiomyopathy, Chagas' disease, Chronic fatigue immune dysfunction syndrome (CFIDS), Chronic inflammatory demyelinating polyneuropathy, Crohn's disease, Cicatrical pemphigoid, Coeliac sprue-dermatitis herpetiformis, Cold agglutinin disease, CREST syndrome, Degos disease, Diabetes mellitus, Discoid lupus, Dysautonomia, Endometriosis, Essential mixed cryoglobulinemia, Fibromyalgia-fibromyositis, Goodpasture's syndrome, Grave's disease, Guillain-Barre syndrome (GBS), Hashimoto's thyroiditis,
Hidradenitis suppurativa, Idiopathic and/or acute thrombocytopenic purpura, Idiopathic pulmonary fibrosis, IgA neuropathy, Interstitial cytisis, Juvenile arthritis, Kawasaki's disease, Lichen planus, Lupus erythematosus, Lyme disease, Meniere disease, Mixed connective tissue disease (MCTD), Multiple sclerosis, Myasthenia gravis, Neuromyotonia, Opsoclonus myoclonus syndrome (OMS), Optic neuritis, Ord's thyroiditis, Osteoarthritis, Pemphigus vulgaris,
Pernicious anemia, Polyarthritis, Polychondritis, Polymyositis and dermatomyositis, Primary biliary cirrhosis, Psoriasis, Polyarteritis nodosa, Polyglandular syndromes, Polymyalgia rheumatica, Primary agammaglobulinemia, Raynaud phenomenon, Reiter's syndrome,
Rheumatic fever, Sarcoidosis, Schizophrenia, Scleroderma, Sjogren's syndrome, Stiff person syndrome, Takayasu's arteritis, Temporal arteritis (also known as "giant cell arteritis"),
Ulcerative colitis, Uveitis, Vasculitis, Vitiligo, Vulvodynia ("vulvar vestibulitis"), and
Wegener's granulomatosis.
Transplantation Stress
[0149] In certain embodiments, methods and compositions of the present invention are used to alleviate transplantation stress. It is contemplated that tissue/organ transplantation may cause acute tissue damage and pathfinder cells, extracellular secretomes (e.g., microvesicles) and associated micro R As disclosed herein may be administered into an organ/tissue transplant recipient to stimulate tissue repair, regeneration, reconstitution, remodeling, and/or inducing immune tolerance, thereby alleviating transplantation stress. It is contemplated that the present invention may be used to facilitate any organ transplantation including, but not limited to, heart, kidney, liver, lung, pancreas, intestine, thymus, and skin transplantation.
[0150] In certain embodiments, methods and compositions of the present invention are used to treat or ameliorate a disease, disorder, or condition associated with graft rejection. In general, graft rejection may result from functional immune cells in a recipient recognizing a donor organ or tissue as a foreign entity and mounting of an immunologic attack on the donor organ or tissue. In some cases, graft rejection arises in an acute phase following transplantation of donor organs or tissues to a recipient. In some cases, graft rejection arises in a chronic phase following transplantation of donor organs or tissues to a recipient. It is to be understood that the present invention encompasses methods and compositions for treatment of acute and/or chronic graft rejection.
[0151] In certain embodiments, methods and compositions of the present invention are used to treat or ameliorate a graft versus host disease, disorder, or condition. In general, Graft versus Host disease (GVHD) may result from functional immune cells in a transplanted tissue or organ from a donor recognizing the recipient as a foreign entity and mounting an immunologic attack on the recipient's cells and/or tissues. In some cases, GVHD arises in an acute phase following transplantation of donor organs or tissues to a recipient. In some cases, GVHD arises in a chronic phase following transplantation of donor organs or tissues to a recipient. It is to be understood that the present invention encompasses methods and compositions for treatment of acute and/or chronic GVHD.
Immune Tolerance
[0152] It is contemplated that pathfinder cells or their extracellular secretomes (e.g., microvesicles) induce immune tolerance and thus are particularly useful in treating inflammation and suppressing, inhibiting or reducing transplantation associated stress. Without wishing to be bound by particular theory, it is contemplated that the pathfinder cells or their extracellular secretomes (e.g., microvesicles) induce immune tolerance by inducing increased IL-2 response, resulting in expansion of regulatory T cells (e.g., increased level and/or activity of T regulatory cells), decreased level and/or activity of cytotoxic T cells and/or helper T cells, and/or suppression of T cell or non T cell lymphocyte responses. In some embodiments, pathfinder cells or their extracellular secretomes (e.g., microvesicles) suppress pro-inflammatory and/or anti-angiogenic cytokine or chemokine response. Pro-inflammatory and/or anti-angiogenic cytokines or chemokines are well known in the art. Exemplary pro-inflammatory and/or anti- angiogenic cytokines or chemokines include, but are not limited to, IL-4, IL-5, IL-6, IL-10, IL- 12, IL-13, IL-17, GMCSF, TGF-β, TNF-a, IFN-γ, MCAF, and MIP1. As shown in the
Examples section, cells or their extracellular secretomes (e.g., microvesicles) according to the present invention have unexpectedly distinct cytokine or chemokine profiles as compared to Mesenchymal stem cells (MSCs). For example, pathfinder cells according to the present invention reduce the expression or activity of IL-4, IL-6 and/or IL-10, while MSCs are known to increase the expression or activity of IL-4, IL-6 and IL-10. Other distinctions are shown in Table 7. In some embodiments, cells or their extracellular secretomes (e.g., microvesicles) increase anti-inflammatory and/or pro-angiogenic cytokine or chemokine response. Anti-inflammatory and/or pro-angiogenic cytokines or chemokines are known in the art. Exemplary antiinflammatory and/or pro-angiogenic cytokines or chemokines include, but are not limited to, IL- 1β, GSCF, and IL-8.
[0153] Accordingly, administration of pathfinder cells or their extracellular secretomes
(e.g., microvesicles) according to the present invention does not result in severe adverse effects in the subject. As used herein, severe adverse effects include, but are not limited to, substantial immune response, toxicity, or death. As used herein, the term "substantial immune response" refers to severe or serious immune responses, such as adaptive T-cell immune responses.
[0154] Thus, in many embodiments, inventive methods according to the present invention do not involve concurrent immunosuppressant therapy (i.e., any immunosuppressant therapy used as pre -treatment/pre-conditioning or in parallel to the method). In some
embodiments, inventive methods according to the present invention do not involve an immune tolerance induction in the subject being treated. In some embodiments, inventive methods according to the present invention do not involve a pre-treatment or preconditioning of the subject using T-cell immunosuppressive agent.
[0155] In some embodiments, however, administration of pathfinder cells or their extracellular secretomes (e.g., microvesicles) according to the present invention can mount an immune response against these agents. Thus, in some embodimnets, it may be useful to render the subject receiving the cells or their extracellular secretomes (e.g., microvesicles) tolerant to the therapy. Immune tolerance may be induced using various methods known in the art. Any immunosuppressant agent known to the skilled artisan may be employed together with a combination therapy of the invention. Such immunosuppressant agents include but are not limited to cyclosporine, FK506, rapamycin, CTLA4-Ig, and anti-TNF agents such as etanercept (see e.g. Moder, 2000, Ann. Allergy Asthma Immunol. 84, 280-284; Nevins, 2000, Curr. Opin. Pediatr. 12, 146-150; Kurlberg et al, 2000, Scand. J. Immunol. 51, 224-230; Ideguchi et al, 2000, Neuroscience 95, 217-226; Potteret al, 1999, Ann. N.Y. Acad. Sci. 875, 159-174; Slavik et al, 1999, Immunol. Res. 19, 1-24; Gaziev et al, 1999, Bone Marrow Transplant. 25, 689-696; Henry, 1999, Clin. Transplant. 13, 209-220; Gummert et al, 1999, J. Am. Soc. Nephrol. 10, 1366-1380; Qi et al, 2000, Transplantation 69, 1275-1283). The anti-IL2 receptor (.alpha.- subunit) antibody daclizumab (e.g. Zenapax.TM.), which has been demonstrated effective in transplant patients, can also be used as an immunosuppressant agent (see e.g. Wiseman et al, 1999, Drugs 58, 1029-1042; Beniaminovitz et al, 2000, N. Engl J. Med. 342, 613-619; Ponticelli et al, 1999, Drugs R. D. 1, 55-60; Berard et al, 1999, Pharmacotherapy 19, 1127-1137; Eckhoff et al, 2000, Transplantation 69, 1867-1872; Ekberg et al, 2000, Transpl. Int. 13, 151-159). Additionalimmunosuppressant agents include but are not limited to anti-CD2 (Branco et al., 1999, Transplantation 68, 1588-1596; Przepiorka et al, 1998, Blood 92, 4066-4071), anti-CD4 (Marinova-Mutafchieva et al, 2000, Arthritis Rheum. 43, 638-644; Fishwild et al, 1999, Clin. Immunol. 92, 138-152), and anti-CD40 ligand (Hong et al, 2000, Semin. Nephrol. 20, 108-125; Chirmule et al, 2000, J. Virol. 74, 3345-3352; Ito et al, 2000, J. Immunol. 164, 1230-1235).
[0156] In addition, methods and compositions (e.g., pathfinder cells, cells differentiated from pathfinder cells, microvesicles and/or microRNAs) according to the present invention may be used to treat diseases, disorders, or conditions in various tissues including, but not limited to, central nervous system (CNS), peripheral nervous system, cardiovascular system, respiratory system, gastrointestinal tract and associated glands, integumentary system, musculoskeletal system, and other systems of the body. In some embodiments, methods and compositions according to the present invention may be used to treat age-related degeneration as well as progerias. In some embodiments, methods and compositions according to the present invention may be used to treat inflammation. In some embodiments, cells and/or microRNAs according to the present invention may be suitable for cosmetic uses or for treating a condition or disorder associated with a cosmetic surgical procedure.
Central Nervous System (CNS)
[0157] Examples of CNS-related diseases, disorders or conditions that may be treated by the methods and compositions of the present invention include motor neuron disease, multiple sclerosis, degenerative diseases of the CNS, dementive illnesses such as Alzheimer's disease, age related dysfunction of the CNS, Parkinson's disease, cerebrovascular accidents, epilepsy, temporary ischaemic accidents, disorders of mood, psychotic illnesses, specific lobe dysfunction, pressure related injury, cognitive dysfunction or impairments, deafness, blindness anosmia, diseases of the special senses, motor deficits, sensory deficits, head injury and trauma to the CNS. Methods and products of the present invention may also be used to enhance brain function or ameliorate deficiencies at a functional level or to facilitate post surgical repair of the CNS.
Cardiovascular system
[0158] Examples of diseases, disorders or conditions of the cardiovascular system that may be treated by the methods and compositions of the present invention include arrhythmias, myocardial infarction and other heart attacks, pericarditis, congestive heart diseases, valve- related pathologies, myocardial, endocardial and pericardial dysfunctions or degeneration, age- related cardiovascular disorders, dysfunctions, degeneration or diseases, sclerosis and thickening of valve flaps, fibrosis of cardiac muscle, decline in cardiac reserve, congenital defects of the heart or circulatory system, developmental defects of the heart or circulatory system, repair of hypoxic or necrotic damage, blood vessel damage and cardiovascular diseases or dysfunction (e.g., angina, dissected aorta, thrombotic damage, aneurysm, atherosclerosis, emboli damage and other problems associated with blood flow, pressure or impediment). Methods and compositions of the present invention may also be used to enhance cardiovascular function or health and to revascularise tissues. Moreover, methods and compositions of the present invention may be used to repair, modify, enhance or regenerate traumatic damage to the heart or blood vessels and as a technique to enhance the transplantation/implantation of a whole organ or its parts. Examples of this latter embodiment include heart transplantation, valve replacement surgeries, implantation of prosthetic devices and the development of novel surgical techniques.
Respiratory system
[0159] Examples of diseases, disorders or conditions of the respiratory system that may be treated by the methods and compositions of the present invention include damage, pathology, ageing and trauma of the nose and paranasal sinuses, nasopharynx, oropharynx, laryngopharynx, larynx, vocal ligaments, vocal cords, vestibular folds, glottis, epiglottis, trachea, mucocilliary mucosa, trachealis muscle, primary bronchi, lobar bronchi, segmental bronchi, terminal bronchioles, respiratory zone structures and plural membranes. Examples of such damage include obstructive pulmonary diseases, restrictive disorders, emphysema, chronic bronchitis, pulmonary infections, asthma, tuberculosis, genetic disorders (e.g., cystic fibrosis), gas exchange problems, burns, barotraumas and disorders affecting blood supply to the respiratory system. Methods and medicaments of the present invention may also be used to repair, modify, enhance or regenerate the respiratory system following damage. Moreover, methods and compositions of the present invention may be used as a technique to enhance the transplantation/implantation of whole respiratory structures or organs or their parts.
Gastrointestinal tract and associated glands
[0160] Examples of diseases, disorders or conditions of the gastrointestinal tract and associated glands that may be treated by the methods and medicaments of the present invention include disorders, damage and age related changes of both the gastrointestinal tract and the large accessory glands (liver and pancreas), salivary glands, mouth, teeth, oesophagus, stomach, duodenum, jejunum, ileum, ascending colon, transverse colon, descending colon, sigmoid colon, rectum and anal canal and enteric nervous system of the canal. In specific embodiments, these disorders, damage and age related changes include dental caries, periodontal disease, deglutition problems, ulcers, enzymatic disturbances/deficiencies, motility problems, paralysis, dysfunction of absorption or absorptive surfaces, diverticulosis, inflammatory bowel problems, hepatitis, cirrhosis and portal hypertension. Methods and medicaments of the present invention may also be used to repair, modify, enhance or regenerate the gastrointestinal tract following damage, or be used as a technique to enhance any of these processes following surgery, such as resection of the stomach, ileostomy and reconstructive surgery (eg ileoanal juncture). Examples of this latter embodiment include reconstructive surgery involving specific anatomical structures of the mouth, such as labia, vestibule, oral cavity proper, red margin, labial frenulum, hard palate palatine bones, soft palate, uvula, tongue, intrinsic muscles of the tongue and extrinsic muscles of the tongue.
Integumentary system
[0161] Examples of diseases, disorders or conditions of the integumentary system that may be treated by the methods and medicaments of the present invention include disorders, damage and age related changes of the skin and integumentary system, such as age related decline in thickness or function, disorders of sweat gland and sebaceous glands, piloerectile dysfunction, follicular problems, hair loss, epidermal disease, diseases of the dermis or hypodermis, burns, ulcers, sores and infections. Methods and products of the present invention may also be used to enhance, regenerate or repair skin structures or functions, for example in plastic reconstruction, cosmetic repair, tattoo removal, wound healing, modulation of wrinkles and in the treatment of striae, seborrhoea, rosacea, port wine stains, skin colour and the improvement of blood supply to the skin. Moreover, methods and products of the present invention may be used to enhance skin grafts, surgical reconstruction, cosmetic surgical procedures, wound healing and cosmetic appearance. Musculoskeletal system
[0162] Examples of diseases, disorders or conditions of the musculoskeletal system that may be treated by the methods and products of the present invention include disease, damage and age related changes of the musculoskeletal system. In some embodiment, these may be in components of the axial skeleton, including the skull, cranium, face, skull associated bones, auditory ossicles, hyoid bone, sternum, ribs, vertebrae, sacrum and coccyx. In other
embodiments they may be in components of the appendicular skeleton, including the clavicle, scapula, humerus, radius, ulna, carpal bones, metacarpal bones, phalanges (proximal, middle, distal), pelvic girdle, femur, patella, tibia, fibula, tarsal bones and metatarsal bones. Methods and compositions of the present invention may also be used to correct problems associated with ossification and osteogenesis, such as intramembranous ossification, endochondral ossification, bone remodelling and repair, osteoporosis, osteomalacia, rickets, pagets disease, rheumatism and arthritis. Moreover, methods and products of the present invention may be used to treat disease, damage and age related changes of the skeletal muscle, elastic cartilages, fibrocartilages, long bones, short bones, flat bones and irregular bones.
Other systems of the body
[0163] Diseases, disorders or conditions of other systems of the body may be treated by the methods and products of the present invention. For example, the present invention may be used to enhance function or treat disease, damage and age related changes in other systems of the body, including special senses, endocrine system, lymphatic system, urinary system,
reproductive system and alterations in metabolism and energetics.
Treatment of general age-related degeneration
[0164] Methods and compositions of the present invention may be used to treat, ameliorate, reduce or compensate for general age-related degeneration. Similarly, methods and compositions of the present invention can be used to retain youthful functions of the body.
Moreover, methods and products of the present invention may be used to treat specific age related system dysfunction, such as cognitive impairment, hearing loss, loss of visual activity, endocrine imbalances, skeletal changes and loss of reproductive function.
Cosmetic use
[0165] In some embodiments, methods and compositions of the present invention may be used to prevent or reduce scars at a site of injury or infection. For example, cells or microRNAs may be employed to regenerate tissue that would otherwise scar or necrotize, including hepatic tissue in the treatment of hepatic fibrosis and/or cirrhosis, facial epidermal tissue to treat acne, and cardiac tissue in the treatment of ischemic infarction.
[0166] In some embodiments, methods and compositions (e.g., cells and/or microRNAs) according to the present invention may be used to enhance breast augmentation following mastectomy.
IV. Pharmaceutical compositions
[0167] In certain embodiments, the present invention provides pharmaceutical compositions comprising a therapeutically effective amount of cells and/or microRNAs for the treatment of various diseases, disorders or conditions described herein. Provided compositions typically comprise a therapeutically effective amount of cells (e.g., pathfinder cells, cells differentiated from pathfinder cells, and/or microRNAs associated with pathfinder cells) and a pharmaceutically acceptable carrier. In some embodiments, provided are pharmaceutical compositions comprising a therapeutically effective amount of cells and/or microRNAs for the treatment of an acute condition (e.g, myocardial infarct, renal ischemia, stroke, renal failure, liver failure, and complications of Type I diabetes). In some embodiments, provided are pharmaceutical compositions comprising a therapeutically effective amount of cells and/or microRNAs for alleviating transplantation stress. In some embodiments, provided are pharmaceutical compositions comprising a therapeutically effective amount of cells and/or microRNAs for the treatment of an immunodeficiency disease, disorder, or condition. [0168] In certain embodiments, provided are pharmaceutical compositions comprising one or more microRNAs having a sequence at least 70% (e.g., 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%) identical to any of microRNAs identified in Table 1 and Tables 6-10 (e.g., SEQ ID NOs: 1-610, or SEQ ID NOS. 1- 225) and a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier" includes carriers that are approved by a regulatory agency of government or listed in the United States Pharmocopeia, the European Pharmocopeia, the United Kingdom Pharmocopeia, or other generally recognized pharmocopeia for use in animals, and in particular humans. As used herein, the term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which a therapeutic agent (e.g., cells and/or microRNAs) is administered.
Preparation of compositions comprising cells
[0169] Various methods of preparing cells from biological materials and/or from cell cultures are known in the art and may be used to practice the present invention. In some embodiments, cells are enriched from their source material or culture. As used herein, the terms "isolation" or "isolating" in conjunction with cells are interchangeably used with the terms "enrichment" or "enriching," and refer to one or more process steps that result in an increase of the fraction of cells in a sample or solution as compared to the fraction of cells in the material or culture from which it was derived.
[0170] Pathfinder cells (and/or cells that are differentiated from pathfinder cells) can be enriched or purified to homogeneity, to at least 90% (with respect to non-pathfinder cells), at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, or at least 20% (or even less). For example, physical properties of pathfinder cells may be employed to separate them from a medium or other source material. For example, cells may be separated on the basis of size (e.g., filtration, molecular sieving, etc), density (e.g., regular or gradient centrifugation), or Svedberg constant (e.g., sedimentation with or without external force, etc). In some embodiments, cells are isolated or purified by centrifugation.
[0171] In some embodiments, the percentage of desired cells (e.g., pathfinder cells and/or cells differentiated from pathfinder cells) in a population of cells is assessed by methods based on one or more distinctive biological properties or set of biological properties of those cells. Especially suitable assessment methods may employ surface markers (e.g., for precipitation, reversible binding to solid phase, (fiuorescence-activated cell sorting) FACS analyses or sorting, specific ligand binding, non-specific ligand binding such as annexin V, etc.). In some embodiments, cells having a particular set of characteristics (e.g., cell surface biomarker profile) are selected for using cell separation methods known in the art (e.g., marker-based cell separation methods). Thus, in some embodiments, a composition of cells comprising mostly or only cells of a desired type (e.g., pathfinder cells and/or cells differentiated from pathfinder cells) is obtained.
[0172] In some embodiments, cells are reconstituted in a suitable solution (such as pharmaceutically acceptable diluent or carrier) such that the cells are present in the solution at a known concentration. In some embodiments, the known concentration is chosen for convenience for dosing. In some embodiments, the known concentration is a concentration at which cells are known to be stable (e.g., retain viability and/or their therapeutic properties) for at least a period of time under clinically approved storage conditions. Provided compositions may also contain minor amounts of wetting agents, emulsifying agents, and/or pH buffering agents. Provided compositions can take any of a variety of solid, liquid, or gel forms, including solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained-release formulations, and the like. Non-limiting examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E.W. Martin. Compositions will generally contain a
therapeutically effective amount of cells and/or microRNAs, optionally in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient.
[0173] Formulations are typically adapted to suit the mode of administration. For example, compositions for intravenous administration may be formulated as solutions in sterile isotonic aqueous buffer. Such compositions may also include a solubilizing agent and/or a local anesthetic such as lidocaine (also known as lignocaine, xylocaine, or xylocard) to ease pain at the site of injection. [0174] As further example, compositions for topical and/or local use may be formulated, for example, as a lotion or cream comprising a liquid or semi-solid oil-in- water or water-in-oil emulsion and ointments. Such compositions may also comprise a preservative.
[0175] Compositions for delivery to the eye include may be formulated, for example, as eye drops that comprise the active ingredient in aqueous or oily solution and eye ointments that may be manufactured in sterile form. Compositions for delivery to the nose may be formulated, for example, as aerosols or sprays, coarse powders to be rapidly inhaled, or nose drops that comprise the active ingredient (e.g., cells and/or microR As) in aqueous or oily solution.
Compositions for local delivery to the buccal cavity may be formulated, for example, as lozenges that comprise the active ingredient in a mass generally formed of sugar and gum arabic or tragacanth, and pastilles that comprise the active ingredient in an inert mass (for example of gelatine and glycerine or sugar and gum arabic). Flavoring ingredients may be added to lozenges or pastilles.
[0176] Aerosol and spray formulations may comprise, for example, a suitable
pharmaceutically acceptable solvent (such as ethanol and water) or a mixture of such solvents. In some embodiments, such formulations comprise other pharmaceutical adjuncts (such as non- ionic or anionic surface-active agents, emulsifiers, and stabilizers) and/or active ingredients of other kinds. Aerosol and spray formulations may be mixed with a propellant gas, such as an inert gas under elevated pressure or with a volatile liquid (e.g. , a liquid that boils under normal atmospheric pressure below customary room temperature, for example from -30 to +10 °C).
Routes of administration and dosage regimens
[0177] In methods of treatment or of inducing tissue repair, remodeling or differentiation in vivo of the present invention, cells, miRNAs, or a pharmaceutical composition thereof, will generally be administered in such amounts and for such a time as is necessary or sufficient to achieve at least one desired result. For example, cells or miRNAs can be administered in such amounts and for such a time that it amelioriates one or more symptoms of a disease, disorder, or condition; prolongs the survival time of patients; or otherwise yields clinical benefits. [0178] A dosing regimen according to the present invention may consist of a single dose or a plurality of doses over a period of time. Administration may be, e.g., one or multiple times daily, weekly (or at some other multiple day interval), biweekly, monthly, or on an intermittent schedule. Typically an effective amount is administered. The effective amount of cells, microRNAs, or a pharmaceutical composition thereof, will vary from subject to subject and will depend on several factors (see below).
[0179] Cells, microRNAs, or pharmaceutical compositions thereof, may be administered using any administration route effective for achieving the desired therapeutic effect. Both systemic and local routes of administration may be used in accordance with methods of the invention. Suitable routes of administration include, but are not limited to, intravenous, intraarterial, intramuscular, subcutaneous, cutaneous (e.g., topical), intradermal, intracranial, intrathecal, intrapleural, intra-orbital, intranasal, oral, intra-alimentary (e.g. , via suppository), colorectal (e.g., via suppository), and intra-cerebrospinal.
[0180] Depending on the route of administration, effective doses may be calculated according to, e.g. , the body weight and/or body surface area of the patient, the extent of damaged or diseased tissue, etc.. Optimization of the appropriate dosages can readily be made by one skilled in the art, e.g. , by a clinician. The final dosage regimen is typically determined by the attending physician, considering various factors that might modify the action of the cells, miRNAs, or pharmaceutical compositions thereof (collectively referred herein as "drug"), e.g., the drug's specific activity, the severity of tissue damage and the responsiveness of the patient, the age, condition, body weight, sex and diet of the patient, the severity of any present infection, time of administration, the use (or not) of other therapies, and other clinical factors.
[0181] In some embodiments, dosing is given by number of cells per body weight of the individual to which cells are administered. In some embodiments, approximately lx 106 to 3 x 108 cells per kg per dose are administered. In some embodiments, approximately 1 x 106 to approximately 3 x 108, approximately 1 x 107 to approximately 3 x 108, or approximately 3 x 107 to approximately 3 x 108 cells are administered per kg per dose. In some embodiments, dosing is not calculated based on body weight and/or dosing is not calculated based on number of cells administered. For example, in some embodiments, a standard unit may be developed based on effectiveness in a particular measure for a particular condition. Alternatively or additionally, in some embodiments, recommended dosages are developed for adult and/or child individuals without regard to body weight.
EXEMPLIFICATION
Example 1 - Stimulation of repair by pancreas-derived pathfinder cell (PDPC) in a kidney ischemic damage model
[0182] The present Example demonstrates that pancreas-derived pathfinder cells
(PDPCs) can stimulate repair in a model of renal ischemic reperfusion injury that has direct relevance to acute renal failure and decreased allograft survival in the context of kidney transplantation. (See, e.g., Hochegger et al. (2007) "p21 and mTERT are novel markers for determining different ischemic time periods in renal ischemia-reperfusion injury," Am. J.
Physiol. Renal Physiol., 292:762-768, the entire contents of which are herein incorporated by reference.) In this well-accepted model of renal cell damage, the extent of tissue damage depends on the length of the ischemic period.
Materials and Methods
Renal ischemia model
[0183] Renal ischemia was induced in mice using protocols as previously described
(Hochegger et al. (2007)). C57BL/6 male mice were maintained on a standard diet with water available ad libitum. Mice were anesthetized and an incision was made on the central abdomen. Clamps were applied to bilateral renal pedicles. After 20 or 30 minutes of renal ischemia, clamps were removed, and the incision was closed.
Transplantation of rat PDPCs
[0184] PDPCs were isolated and cultured from male rats as previously described, for example, in International Patent Publications WO 2006/120476 and WO 2009/136168, the entire contents of each of which are incorporated by reference. Rat PDPCs were counted and reconstituted in phosphate-buffered saline solution (PBS) and injected into the tail vein of mice after renal ischemia. Varied cell treatment regimens were used depending on the experiment. (See below.)
[0185] Control animals were given an injection of saline or an equivalent number of
C57BL/6 bone marrow cells.
Assessment of renal function
[0186] Renal function was monitored for two weeks after the ischemic event by determining serum creatinine levels and the urinary protein to creatinine ratio (UPCR).
Increased levels of these markers correspond to increased extent of tissue damage. Serum and urine samples were collected at two weeks after renal ischemia. Creatinine levels were measured using a creatinine analyzer and UPCR was determined by standard methodology.
Kidney histology
[0187] Animals were sacrificed at the end of the experiment for histological analyses to assess extent of tubular epithelial necrosis and tissue senescence. Kidney tissue was either frozen or fixed in 4% formalin overnight and then embedded in OCT embedding medium.
Paraffin-embedded kidneys were sectioned and stained with periodic acid-Schiff or hematoxylin and eosin using standard protocols. To assess tubular injury in periodic acid-Schiff-stained sections, the percentage of cortical tubules was scored by a reviewer blind to the identity of each sample, using a semiquantitative scale as previously described. (See, e.g., Ramesh et al. (2004) "Inflammatory cytokines in acute renal failure," Kidney Int. SuppL, S56-S61 and Ramesh et al. (2004) "Salicylate reduces cisplatin nephrotoxicity by inhibition of tumor necrosis factor-alpha," Kidney Int., 65:490-499, the entire contents of each of which are herein incorporated by reference.) In the semiquantitative scoring system, 0 = no tubular necrosis; 1 = < 10%; 2 = 10- 25%; 3 = 26-75%; 4 = > 75% tubular necrosis.
Analysis of apoptosis
[0188] Apoptosis was evaluated by TUNEL staining of kidney sections as follows using a Chemicon ApopTag Plus Peroxidase In Situ Apoptosis Detection Kit (S7101). Frozen kidney sections were fixed by incubating slides in 95% ethanol for 10 minutes and then allowed to air dry. Slides were stored at 4 °C until further use. Sections were rehydrated at room temperature in DPBS for 10 minutes and then digested by incubation in Proteinase K (20 μg/mL) at 25 °C for 15 minutes, then washed twice in dH20 for 2 minutes each.
[0189] Sections were treated with H202 for 5 minutes at room temperature on a stirrer, washed in 1 x TBS (Tris-buffered saline), and then incubated in equilibration buffer at 25 °C for 10 minutes in a humidified chamber. After removal of equilibration buffer, sections were incubated in a TdT enzyme solution (Chemicon; Rosemont, Illinois) at 37 °C for 1 hour in a humidified chamber. Slides were placed in a stop/wash buffer and agitated for 15 seconds, then washed for 10 minutes on a stirrer at room temperature. Slides were washed in 1 x TBS, then incubated in a solution of anti-digoxygenin conjugate (Chemicon), then washed in 1 * TBS. Sections were incubated in a peroxidase substrate solution (Chemicon), and incubated at room temperature for 10 minutes, then washed in running water for ten minutes. Finally, sections were counterstained in Harris hematoxylin, dehydrated, and mounted using standard protocols.
Analysis of markers of cell stress and senescence
[0190] Cell stress and senescence was analyzed by immunohistochemical staining for markers of cell stress and senescence (CDKN1A (p21cipl/waf), CDKN2A9 (pl6ink4a), and SA gal). Tissue sections were fixed in 95% ethanol and rehydrated as described above, and then stained using appropriate reagents for each markers.
[0191] For pl6ink4a staining, a mouse monoclonal antibody against pl6 (F12, Santa
Cruz sc#1661) was used as the primary antibody and an anti-mouse secondary antibody was used. To reduce binding of the anti-mouse secondary antibody to endogenous mouse
immunoglobulins in the tissue, the Vector Mouse on Mouse (MOM) Peroxidase Kit (Vector #Pk- 2200) was used. A biotinylated anti-mouse IgG (H+L) antibody from Vector MOM kit was used as the secondary antibody. Immunohistochemical staining was performed according to the Vector protocol for the MOM kit.
[0192] For p21cipl/waf staining, a rabbit polyclonal antibody against p21 (CI 9, Santa
Cruz sc#397) was used as the primary antibody and a horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG secondary antibody (DAKO, P0448) was used. Twenty percent goat serum prpared in 1 x TBS was used as blocking solution to reduce background staining from the secondary antibody. Staining was performed according to standard procedures.
[0193] For SA gal staining, two solutions containing final concentrations of lmg/mL xl-
Gal, 5 mM potassoium ferricyanide , 5 mM potassium ferrocyanide, 2 mM MgCl2, 150 mM NaCl, and 40 mM (citric acid/sodium phosphate solution) were prepared in phosphate-buffered solution (PBS), one using a citric acid/sodium phosphate solution at pH 6.0 and the other using a citric acid/sodium phosphate solution at pH 4.0. Sections were stained in the pH 6.0 solution (except for positive controls, which were stained with the pH 4.0 solution) at 37 °C for approximately 48 hours. Sections were washed in running water and counterstained in a filtered Aluminum Potassium Sulphate Dodecahydrate (50 g/L) and Nuclear Fast Red (1 g/L) solution for 30 seconds, then washed, dehydrated, and mounted according to standard procedures.
Fluorescence in situ hybridization (FISH)
[0194] Frozen sections were rehydrated for 20 minutes in PBS and incubated in 1
M sodium thiocyanate at 80 °C, then washed TBS and dried. Tissue sections were then digested in pepsin (DAKO; Carpenteria, CA) at 37 °C for 25 minutes. Pepsin was quenched in 0.2% glycine for 5 minutes at room temperature. Slides were washed in TBS and then incubated in 4% paraformaldehyde for 5 minutes at room temperature. After checking digestion by pepsin, denaturation, and dehydration, sections were incubated with either a probe solution containing hybridization buffer (Vysys #30-804828) and a denatured probe for the human X chromosome (VYSIS CEP X FITC probe #32-112023) or a premixed solution (available from the
manufacturer as such) containing a denatured probe for the rat Y chromosome (Cambio Rat Y (Cy3)/12)FITC #CA-1631-BF) for 10 minutes at 80 °C, then overnight at 42 °C. Slides were then washed, mounted, and coverslipped using standard procedures. Coverslips were sealed with clear nail polish.
Experiment 1
[0195] A small-scale preliminary experiment was carried out using 2 ischemic controls and 2 rat PDPC-treated mice. Ischemia was carried out for 20 minutes to mimic a conservative damange level, and rat PDPCs were delivered 24 hours after ischemic damage. 1.5 x 106 cells were used for each injection, with one injection given at 24 hours post ischemia and second injection given 7 days post ischemia. Data from this preliminary experiment were suggestive of a beneficial effect from PDPCs. Although no significant improvement in serum creatinine levels were observed at 1 week after surgery, the UPCR was decreased in PDPC- treated mice, indicating less tubular epithelium damage. Decreased damage was confirmed by histological analyses.
Experiment 2
[0196] The surprising positive results from the preliminary experiment prompted a fuller experiment in a second study. For this second study, renal ischemic mice were assigned into one of four groups of six mice each. In addition to control ischemic mice injected with saline only, groups of mice were subject to various treatment regimens as follows.
Group A: Saline only injection at 24 hours after ischemia.
Group B: 1.5 x 106 rat PDPCs were injected 24 hours after ischemia and again at 7 days Group C: 1.5 x 106 rat PDPCs were injected immediately after ischemia and again at 7 days
Group D: 3 x 106 rat PDPCs were injected 24 hours after ischemia.
[0197] Experiments were terminated at 14 days after ischemia. All three the
PDPC treatment regimens resulted in statstically significant benefits for maintenance of kidney function and tissue integrity. As shown in Figure 1, serum creatinine levels at day 14 were significantly lower in all treated groups (p=0.028, 0.022, and 0.045 respectively) as compared to that of saline-injected ischemic controls. No significant differences were observed between serum creatinine levels of the three treatment groups.
[0198] Apoptosis in kidneys were evaluated by TUNEL-staining of tissue sections.
Virtually no apoptosis was observed in kidney tubular epithelium of PDPC-treated mice, whereas saline-injected controls exhibited high levels of apoptosis. p21cipl/waf, pl6ink4a, and SA gal expression was used as a marker of cell stress and senescence. As determined by immunohistochemical staining, expression of these three markers was reduced in kidney tissues of PDPC-treated mice compared to ischemic controls, indicative of lower levels of cell stress and senescence (Figure 2). Figure 3 shows a quantitative results of analysis of p21 expression levels measured in tissue taken from two areas of the heart. Animals with ischemia and no treatment (left-most bars in each group in Figure 3) showed an increased level of p21, which was made worse by saline injection (second-left most bars in each group in Figure 3). PDPC-treated animals had p21 levels that were essentially the same as animals without any ischemia.
[0199] The fate of PDPC cells in mouse transplant recipients was analyzed by FISH, which revealed that approximately 0.019% of cells in the kidney are PDPC-derived (54 rat signals in 281,320 nuclei examined in tissue from a mouse in group B). Thus, PDPC-derived cells are still present, but make up only a small proportion of the tissue.
Experiment 3
[0200] In a further study, renal ischemic mice were assigned into one of four groups. In addition to control ischemic mice injected with saline only, groups of mice were subject to various treatment regimens as follows.
Group A: Saline only injection at 24 hours after ischemia (6 mice).
Group B: 1.5 x 106 rat PDPCs were injected 24 hours after ischemia and again at 7 days (5 mice).
Group C: 3 x 106 rat PDPCs were injected 24 hours after ischemia (3 mice).
Group D: 1.5 x 106 rat PDPCs were injected immediately after ischemia and again at 7 days (4 mice).
[0201] Experiments were terminated at 14 days after ischemia. All three the PDPC treatment regimens resulted in statstically significant benefits for maintenance of kidney function and tissue integrity. As shown in Figure 4, serum creatinine levels at day 14 were significantly lower in all treated groups (p=0.005, 0.005, and 0.01 respectively) as compared to that of saline- injected ischemic controls. No significant differences were observed between serum creatinine levels of the three treatment groups. Figure 5 shows serum creatinine levels for untreated control mice (Group A, n = 6) as compared to mice treated with rat PDPCs (n = 12). As can be seen in Figure 5, serum creatinine levels at day 14 were significantly lower in groups B, C, and D combined (p<0.0001) as compared to that of saline-injected ischemic controls
[0202] Serum creatinine levels adjusted for body weight were determined. As shown in
Figure 6, serum creatinine levels adjusted for body weight at day 14 were significantly lower in all treated groups (p=0.008, 0.007, and 0.01 respectively) as compared to that of saline-injected ischemic controls. No significant differences were observed between serum creatinine levels adjusted for body weight of the three treatment groups. Figure 7 shows serum creatinine levels adjusted for body weight for untreated control mice (Group A, n = 6) as compared to mice treated with rat PDPCs (n = 12). As can be seen in Figure 7, serum creatinine levels adjusted for body weight at day 14 were significantly lower in groups B, C, and D combined (p<0.0001) as compared to that of saline-injected ischemic controls
[0203] Taken together, these results demonstrate that Pathfinder cells can stimulate repair in a tissue that is not the same as the tissue of origin of Pathfinder cells. Furthermore, Pathfinder cells can alleviate acute damage to kidneys that have undergone ischemic stress. These findings support a potential for Pathfinder cells in treating acute conditions such as acute kidney damage and in alleviating transplantation stress.
Example 2 - Stimulation of repair by PDPCs in a cardiac ischemic damage model
[0204] The present Example demonstrates that pancreas-derived pathfinder cells
(PDPCs) can stimulate repair in an established model of cardiac ischemic damage with directed relevance to acute myocardial infarction (MI). (See, e.g., Metzler et al. (2002) "Plasma cardiac troponin T closely correlates with infarct size in a mouse model of acute myocardial infarction," Clinica Chimica Acta, 325:87-90, the entire contents of which are herein incorporated by reference.) The level of plasma cardiac troponin T (cTnT) after the surgery performed to induce ischemia has been shown to be proportional to the size of the induced infarct. In this model, the extent of tissue damage depends on the length of the ischemic period. Materials and Methods
Cardiac ischemia model
[0205] Cardiac ischemia was induced in mice using protocols as previously described
(Metzler et al. (2002)). C57BL/6 mice were anesthetized. A midline incision was made from the xiphoid process to the submentium. After separating the salivary glands, a tracheotomy was performed by inserting a polyethylene tube carefully into the trachea. The tube was taped in place to prevent dislodgment and connected to a rodent ventilator. After ventialtion was started, the chest was opened by a lateral cut along the left side of the sternum. Large intercostal blood vessels were coagulated using an electrocautery. The chest walls were retracted to better visualize the heart. After the pericardial sac was removed and the left auricle was slightly retracted, the left descending artery (LAD) was clearly visible. The LAD was ligated using 8-0 silk; ischemia was evident from discoloration of corresponding regions of the left ventricle. The LAD was left ligated for 30 minutes, after which retraction sutures were removed and the pericardium, chest wall, and skin were closed with sutures.
Transplantation of rat PDPCs
[0206] PDPCs were isolated from rats and transplated into mouse hosts as described in
Example 1.
Assessment of cardiac function
[0207] Cardiac function was assessed before termination of the experiment, at 14 days after ischemia. In vivo ultrasound imaging of systolic left ventricle was used to determine left ventricle size and fractional shortening (FS). A smaller left ventricle size corresponding to less muscle damage and to better function. FS represents the ratio of heart size when full with blood (LVEDD, left ventricle diastolic diameter) to heart size after emptying (LVESD, left ventricle systolic diameter), which reflects how much the heart muscle needs to contract to eject a nomral volume of blood. Increased fractional shortening corresponds to increased heart function (with 50% being a normal measurement).
[0208] Cardiac function was also assessed by taking and analyzing electrocardiograms. Cardiac troponin (cTnT) measurements
[0209] Cardiac troponin (cTnT) levels in plasma were measured weekly using protocols as described in Metzler et al. (2002). A quantitative rapid cTnT assay available from Roche Diagnostics (Cardiac T, Troponin T quantitative, Cardiac Reader) was used according to manufacturer's instructions.
Histology
[0210] Post-mortem histological analysis of the heart was conducted using standard protocols similar to those described for kidney histology in Example 1. Histological analyses focusing on the size of infract and residual scarring were performed as described in Metzler et al. (2002).
Fluorescence in situ hybridization (FISH)
[0211] FISH was conducted to examine the number, location, and nature of rat cells remaining and the extent and location of any senescent tissue using protocols as described in Example 1.
Experiment 1
[0212] A small-scale pilot experiment was conducted with three mice injected intravenously with 1.5 x 106 rat PDPCs 24 hours after surgery. Clear benefits were observed as compared to ischemic controls that were injected with saline. Cardiac function in one PDPC- treated mouse returned almost to normal.
Experiment 2
[0213] The suprising successful results from the pilot experiment prompted a fuller experiment in a second study. For this second study, mice in which cardiac ischemia was induced were assigned to one of three groups as folllows:
Group A: No treatment (4 mice) Group B: Saline injection at 24 hours after infarct induction (6 mice)
Group C: 1.5 x 106 PDPCs were injected 24 hours after infarct induction (6 mice)
[0214] cTnT levels were not significantly different between the treatment groups, indicating that infarct sizes were comparable across all ischemic mice. Cardiac function was assessed two weeks after surgery. As determined by analyses on 4 of the 6 PDPC-treated mice, FS (fractional shortening) and LVESD (left ventricle systolic diameter) data showed statistically significant improvements in cardiac function after PDPC treatment, and there was likewise a clear trend in the LVEDD data (Figure 8). The p-value for the difference in LVESD in PDPC- treated versus no treatment controls is at the 0.016 level (0.047 with Bonferroni correction). The p-value for the difference in LVESD in PDPC-treated versus saline treated groups is at the 0.032 level (0.096 with Bonferroni correction). Analyses including all 6 mice in the PDPC-treated group is expected to show p-values consistently less than 0.05.
Experiment 3
[0215] In a further study, mice in which cardiac ischemia was induced were assigned to one of three groups as folllows:
Group A: No treatment (5 mice)
Group B: Saline injection at 24 hours after infarct induction (10 mice)
Group C: 1.5 x 106 PDPCs were injected 24 hours after infarct induction (6 mice)
[0216] cTnT levels were not significantly different between the treatment groups, indicating that infarct sizes were comparable across all ischemic mice. Cardiac function was assessed two weeks after surgery. As determined by analyses of PDPC-treated mice, FS (fractional shortening), LVEDD (left ventricle diastolic diameter), and LVESD (left ventricle systolic diameter) data showed statistically significant improvements in cardiac function after PDPC treatment (Figures 9, 10, and 11, respectively). The p-value for the difference in FS in PDPC-treated versus no treatment controls was <0.001. The p-value for the difference in LVEDD in PDPC-treated versus saline treated groups was 0.013. The p-value for the difference in LVESD in PDPC-treated versus saline treated groups was <0.001. [0217] Typically, recovery is considered successful when patients achieve an FS of over
30% (such as 35%). PDPC-treated mice attain levels of FS well within the range regarded as normal after clinical recovery in human patients, namely up to 40-45%. Thus, these results support a possible therapeutic application of Pathfinder cells in treating acute myocardial infarct.
Example 3 - Reconstitution of bone marrow by PDPCs in a post-irradiation reconstitution model
[0218] The present Example demonstrates that pancreas-derived pathfinder cells
(PDPCs) can stimulate reconstitution of the blood system.
Preliminary experiment
[0219] A preliminary set of experiments used the NOG multiply immunodeficient strain
(non obese diabetic/severe combined immunodeficient/gammac (null); NOD/SCID/Gammac). (See, e.g., Dewan et al. (2003) "Rapid Tumor Formation of Human T-Cell Leukemia Virus Type 1 -Infected Cell Lines in Novel NOD-SCID/ycnull Mice: Suppression by an Inhibitor against NF- KB," Journal of Virology, 77(9):5286-5294, the entire contents of which are herein incorporated by reference.) Irradiated NOG mice would not normally be able to reconstitute their blood system.
[0220] NOG mice were irradiated at a level to which they would not normally recover
(3.5 Gy). Three irradiated NOG mice were administered 1.5 x 106 PDPCs intravenously (by tail vein injection-yes) immediately after irradiation; two of these mice received rat PDPCs and one of these mice received human PDPCs. Three irradiated NOG mice were given saline as controls.
[0221] All three control mice died within two weeks, while all three mice that received
PDPCs lived well beyond the survival time until they contracted a laboratory virus infection at beyond 56 days post-irradiation and died. These results demonstrated that PDPC-treated mice were able to produce blood cells and reconstitute their blood system. [0222] It was not possible to obtain high quality DNA from the mouse carcasses.
Nevertheless, the DNA that could be obtained was assayed by PCR for rat Y and human X chromosomes. In these assays, no rat signal was detectable, and only a weak human signal was found in the spleen of one carcass. On the other hand, the control mouse actin gene was detectable. These results suggest that the reconstituted blood cells were at least mostly of host (and not PDPC) origin.
[0223] Survival of the PDPC-treated mice to at least 56 days also suggested a lack of tumor formation from the introduction of rat or human PDPCs.
Further experiments
[0224] A further set of experiments is performed on male NOD/SCID (non obese diabetic/severe combined immunodeficient) mice. Experimental groups include:
Group A: a control group of unirradiated mice, injected with saline
Group B: a control group of irradiated mice, injected with saline
Group C: a control group of irradiated mice, administered 1.5 x 106 mouse NOD/SCID bone marrow cells
Group D: an experimental group of irradiated mice, administered 1.5 x 106 rat PDPCs.
[0225] The experiment is terminated at a definitive timepoint (e.g., 14 days or later) after injection, or when a mouse's body weight falls under 40% 50%> of body weight at the beginning of the experiment. Survival time is noted and used as an indicator of reconstitution of the blood system. Blood samples are collected and analyzed by FACS for rat- specific blood cell markers to determine the extent, if any, of contribution from rat PDPCs to the reconstituted blood cell population. Additionaly FACS analyses and/or PCR analyses may be used to (1) determine cell origin and/or (2) verify production of functional blood cells.
[0226] It is expected that results from these further experiments will confirm positive results from the preliminary experiments.
[0227] These results indicate that pathfinder cells can reconstitute blood system. [0228] Examples 1-3 demonstrate that PCs enhance the survival and repair of various tissues in several in vivo models of acute damage in various tissues. No tumors formed in any of the models. The data thus far indicate that PCs themselves do not contribute a significant percentage of the repaired tissue population, but rather, stimulate repair of damaged host cells.
Example 4 - Efficacy of kidney-derived Pathfinder cells (KDPCs) in a streptozocin (STZ)- induced diabetes model
[0229] Previously reported results demonstrated that PDPCs exhibited a therapeutic effect in a chemically-induced (streptozocin, STZ) model of diabetes. (See International Patent Publication No. WO 2006/120476.) The present Example demonstrates that kidney-derived Pathfinder cells (KDPCs) similarly show repair stimulatory effects in the STZ-induced model of diabetes.
[0230] Human KDPCs were isolated by a procedure similar to that described for PDPCs in International Patent Publication No. WO 2006/120476.
[0231] Female mice were made diabetic by administration of 250 mg/kg streptozocin
(STZ). Blood glucose was monitored to confirm the animals were diabetic, with levels increasing to above 15 mM/L. Three days after induction of diabetes, 1.5 x 106 human KDPCs were administered by injection into the tail vein. Control animals were given saline injections. Blood glucose was monitored every three days thereafter. A second injection of the same number of KDPCs was administered seven days later and blood glucose was again monitored every three days thereafter.
[0232] Control animals (n=2) rapidly showed elevated blood glucose levels to over 30 mM/L and died within 6 days post injection. STZ diabetic mice (n=2) that received human kDPCs showed initial elevation in blood glucose levels, then stabilization of blood glucose levels around 25 mM/L, as shown in Table 2. Body weight was maintained until the two test animals were reported found dead at day 14. Maintenance of body weight indicates that the test animals were otherwise healthy. Table 2: Blood glucose levels in control animals and KDPC-treated mice
Figure imgf000088_0001
[0233] The survival of test animals beyond the survival of controls, and the relative stabilization of blood glucose levels similar to previously reported levels of PDPC-treated animals at the same timepoint after induction of diabetes, suggested that administration of human KDPCs arrested or ameliorated the diabetic process. Thus, KDPCs appear to act similarly to PDPCs, indicating that PCs are not restricted to the pancreas. Thus, it is contemplated that KDPCs would show similar repair stimulatory effects in acute models of damage as PDPCs have, and would be useful in reconstituting an immune system.
Example 5 - PDPC effects in the non-obese diabetic (NOD) mouse type I diabetes model
[0234] As mentioned herein, methods and compositions of the present invention can be used to treat acute complications of chronic diseases. The present Example demonstrates that PDPCs can stabilize glucose blood levels in non-obese diabetic (NOD) mice treated with PDPCs.
[0235] The NOD model is widely accepted as a much closer model of human Type I diabetes than chemical damage models such as STZ (streptozocin). The NOD mouse also allows further investigation of how repair-stimulatory effects of pathfinder cells can be established and maintained in the face of pre-existing immune attack.
[0236] NOD mice become spontaneously diabetic as they age. Diabetes can also be induced. In the present Example, diabetes was allowed to develope spontaneously. Animals were entered into a trial with rat PDPC delivery as they became diabetic. The trial is currently underway. [0237] NOD mice were divided into three groups (1) untreated, (2) treated with PDPCs, and (3) treated with PDPCs and cyclosporin A (CsA, an immunosuppressant). Each group consisted of six mice each. In groups (2) and (3), PDPCs were administered intravenously by tail vein injection. CsA was also administered for group (3) animals at the time of PDPC administration.
[0238] As the trial is underway, some mice in Group I are still in the study and do not yet show elevated glucose levels (indicating development of diabetes). The other mice in the study (including all mice in groups 2 and 3) developed diabetes according to one of two patterns: intense hyperglycemia with rapid onset or milder hyperglycemia with slower onset.
[0239] Thus, some of the mice in this study present an opportunity to observe PDPC effects in the context of acute onset of hyperglycemia. Figures 12-14 show blood glucose levels in groups 1, 2, and 3 respectively. As shown in Figure 13, two of the mice treated with PDPCs (group 2) showed a lowering of blood glucose levels. One of these mice maintained low blood glucose levels until necropsy at day 50; the other of these mice also showed a lowering of blood glucose levels until day 30 of the study, followed by onset of hyperglycemia. No efficacy was observed in group 3 (cells + CsA) animals.
Example 6 - Morphological examination of pancreas-derived Pathfinder cells (PDPC) and identification of microvesicles (MVs)
[0240] In the present Example, morphological studies of rat pancreas-derived pathfinder cells (PDPC) were conducted by scanning electron microscopy (EM). Scanning EM images revealed protrusions from surfaces of PDPCs that are provisionally identified as nascent microvesicles (MVs).
[0241] Pathfinder cells were isolated from rat pancreas cultured as previously described.
(See, e.g., International Patent Publication No. WO2006/120476 Al, the entire contents of which are herein incorporated by reference.) These rat PDPCs were grown in medium containing fetal bovine serum (FBS) that was depleted of bovine microvesicles. [0242] Pictures of a subconfluent culture of rat PDPCs were taken by a scanning electron microscope. Figure 15A shows a representative picture, showing PDPCs of both the
fibroblastoid and small round cell types. As can be seen in Figure 15 A, both cell types have very great numbers of thin projections and interconnect with other cells at multiple points in a complex manner. Furthermore, these cells produce large numbers of small spheres on their surfaces, which are identified as nascent microvesicles (Figure 15B).
[0243] The flat cell type depicted in Figure 15A is approximately 15-20 μιη in diameter, and is the predominant cell type in cultures that were studied. The other cell type is
approximately 3-5 μιη in size, spherical in morphology, and is commonly found adjoined to an identical cell type. Without wishing to be bound by any particular theory, these spherical cells may be derived from a cell that has recently undergone cell division.
[0244] Protrusions of varying length can be seen radiating from the edges of the flatter, larger cell type in particular. Putative microvesicles (MVs) were clearly observed at the ends of these cell protrusions. In some cases, the MVs were not actually attached to the cells but were still within the vicinity of cells and of attached MVs. MVs were also clearly seen close to and surrounding the membrane of the small cell type (Figure 15B). Clusters of MVs were observed in some areas, typically at the end of a cell protrusion. Identified MVs typically had a size range of 300-600 nm in diameter.
Example 7 - Characterization of protein and mRNA profiles of Pathfinder cell isolates
[0245] To further characterize Pathfinder cell isolates, protein and mRNA profiles of various Pathfinder cells were studied. Protein and mRNA profiles may facilitate methods of identifying Pathfinder cells and potentially shed light on the mechanism of Pathfinder cell stimulation of repair.
[0246] Fluorescent antibody staining was performed on a panel of protein markers.
Results are presented on Table 1. Markers were noted as positive if in the opinion of an experienced observer the fluorescent signal for the marker is significantly higher in the cells of interest than the background level of fluorescence for the experimental conditions used. Some of the proteins studied are typically found in stem cells, e.g., Oct3/4, Nanog, c-myc, which were found to be expressed in both human PDPCs and kDPCs. Sox2, another stem cell marker, was detectable in hPDPCs but not in hKPDCs. The overall protein expression patterns of hPDPCs and hkDPCs were consistent with that of an "unspecialized" cell type.
Table 3: Expression of proteins in hPatfinders ( I removed tissue source as we believe our cells are not tissue specific and as determined
b fluorescent antibod stainin
Figure imgf000091_0001
*CD24 appears to be expressed above background only in small round cells in these cultures.
[0247] mRNA samples were prepared from human kidney-derived Pathfinder cells
(hKDPCs) and lymph-node derived Pathfinder cells (hLNDPCs). mRNA expression profiles were determined for two large sets of genes by reverse-transcription-PCR (RT-PR) using ABI gene cards for a) genes known to be involved in stem cell pluripotency and b) genes known to be involved in cell cycle control. Tables 4 and 5 summarize results from these mRNA expression profiling experiments. Table 4: mRNA expression results for genes known to be involved in stem cell pluripotency
Pluripotency genes expressed in Pathinder Pluripotency genes NOT expressed in both cells Patfinder cells
RAF1 ACTB FOXA2 LAMA1
MYOD1 ACTC FOXD3 LEFTB
SST AFP GABRB3 LIFR
PAX6 BPJZ GAL LIN28
ISL1 CD34 GAPDH MYF5
FN1 CD9 GATA4* NANOG
LAMB1 CDH5 GATA6 NES
IL6ST CDX2 GBX2 NEUROD1
CGB GCG NODAL
COL1A1 GCM1 NOG
COL2A1 GFAP NPPA
COMMD3 GFAP NR6A1
CRABP2 GRB7 NR5A2
CTNNB1 HBB OLIG2
DDX4 HBZ PAX4*
DES HLXB9 PECAM1
DNMT3B IAPP PODXL
EBAF IFITM1 POU5F1
EEF1A1 IFITM2 PTEN
EOMES IMP2 PTF1A
FGF4 INS REST
FGF5 IPF1 RUNX2
FLT1 KIT SERPINA1
FN1 KRT1 SFRP2
Not yet validated
LIN28 has a role in embryo cell differentiation and is a negative regulator of the let-7 miRNA family. Absence of LIN28 thus correlates with high levels of expression of the let-7 mRNA family in Pathfinder cells.
Table 5: mRNA expression results for genes known to be involved in cell cycle control
Cell cycle genes expressed in Pathfinder Cell cycle genes NOT expressed in both cells Pathfinder cells
ATR CDKN2C/pl8 GAPDH CDC2 HDAC2
CCNB2 E2F3 HPRT1 CDC25A HDAC3
CCND1 E2F4 GUSB CDK4 HDAC5
CCNE1 HDAC4 ATM CDKNIB (p27) HDAC6
CDK2 HDAC9 CCNA1 CDKN2A (pl6) HDAC7
CDK6 PP2CA CCNA2 CDKN2B (pi 5) RBI CDKNlA/p21 RAF 1 CCNB1 CDK 2D ( i 9) TGFB1
CDK7 TGF 3 CCND2 E2F1 TGFB2
CCND3 E2F2 TP53
CCNE2 GSK3B
CCNH HDAC1
[0248] The degree of concordance in cell cycle control gene expression between human
KDPCs and human LNDPCs is extraordinary, and strongly suggests that they are identical or closely related cell types. It is noteworthy that the cells do not express CDK 2A, which is typically required for senescence, indicating that our cell growth conditions and techniques are good. CDK 1 A expression is observed, indicating that the cells can still undergo replicative senescence. Such an observation is desirable because it indicates that the cells are not transformed (i.e., not cancerous). Furthermore, the chromatin structure of the cells appears to be open (in keeping with a non-specialized status), as no expression was detected for a number of key histone deacetylase molecules. Only two HDACs, HDAC 4 and HDAC 9, were found to be expressed.
Example 9 - Characterization of microRNA expression in Pathfinder cell isolates
[0249] To further characterize and elucidate the mechanism of Pathfinder cell action, microRNA expression in hPDPCs, hKPDCs, and hLNDPCs were compared by RT-PCR using commercially available miRNA test cards. The resulting data show strong conservataion of the miRNA expression profile of Pathfinder cell isolates from three different human tissues. (See Table 6.) Seventy-nine percent of the miRNAs with detectable levels of expression in the RNA preparations from these cell isolates were common to two or more of the isolates, while 64% were common to all three.
[0250] Further analyses are directed to determining if the observed differences are meaningful. Many of these miRNAs are present in very small amounts, which can lead to apparent differences between experiments and preparations. Many of the observed differences are due to a somewhat different miRNA expression profile of hPDPCs specifically. Without wishing to be bound by theory, these differences may relate to differences in timing of isolation and in adaptation of preparations to culture conditions.
Table 6: MicroRNA expression profiles of hPDPCs, hKDPCs, and hLNDPCs*
Expression Pattern miRNAs
Expressed in hPDPCs, Let-7a, 7b, 7c, 7d, 7e, 7f, 7g
hKDPCs, and
miPv-9, miPv-lOa, miR-lOb, miR-15a, miR-15b, miR-16, miR-17, miR- hLNDPCs (159)
18a, miR-19a, miR-19b, miR-20a, miR-20b, miR-21, miR-22, miR- 23b, miR-24, miR-25, miR-26a, miR-26b, miR-27a, miR-27b, miR-28- 3p, miR-28-5p, miR-29a, miR-29c, miR-30a, miR-30b, miR-30c, miR- 30d, miR-30e, miR-32, miR-34a, miR-34c, miR-92a, miR-93, miR-98, miR-99a, miR-99b, miR-100, miR-101, miR-103, miR-106a, miR- 106b, miR-107, miR-125a-3p, miR-125a-5p, miR-125b, miR-126, miR-128, miR-130a, miR-130b, miR-132, miR-133a, miR-138, miR- 139-5p, miR-140-3p, miR-140-5p, miR-143, miR-145, miR-146a, miR- 146b-5p, miR-148b, miR-149, miR-150, miR-151-3p, miR-152, miR- 155, miR-181a, miR-181c, miR-184, miR-185, miR-186, miR-188-5p, miR-190, miR-191, miR-192, miR-193a-3p, miR-193a-5p, miR-193b, miR-194, miR-195, miR-197, miR-199a-3p, miR-199a-5p, miR-199b- 5p, miR-200b, miR-200c, miR-206, miR-210, miR-212, miR-214, miR-218, miR-221, miR-222, miR-223, miR-224, miR-296-5p, miR- 301a, miR-301b, miR-320, miR-323-3p, miR-324-3p, miR-324-5p, miR-328, miR-331-3p, miR-331-5p, miR-339-3p, miR-339-5p, miR- 361-5p, miR-365, miR-367, miR-374b, miR-378, miR-140, miR-422a, miR-423-5p, miR-425, miR-449b, miR-450a, miR-452, miR-483-5p, miR-484, miR-485-3p, miR-489, miR-494, miR-497, miR-509-3p, miR-516a-3p, miR-532-3p, miR-532-5p, miR-542-3p, miR-550, miR- 564, miR-572, miR-574-3p, miR-596, miR-610, miR-629, miR-639, miR-652, miR-661, miR-671-3p, miR-708, miR-744, miR-760, miR- 770-5p, miR-801, miR-875-5p, miR-877, miR-923, miR-939
Expressed in hKPDCs miR-7, miR-135b, miR-187, miR142-3p, miR-142-5p, miR-147b, miR- and hLNDPCs but not 18b, miR-196b, miR-204, miR-216a, miR-296-3p, miR-449a, miR- in hPDPCs (18) 502-5p, miR-509-5p, moR-582-5p, miR-615-3p, miR-636, miR-872
Expressed in hPDPCs miR-200a, miR-361-3p, miR-374p, miR-374a, miR-455
and hLNDPCs but not
in hKPDCs (4)
Expressed in hPDPCs miR-129-3p, miR-133b, miR-190b, miR-342-3p, miR-513-3p, miR- and hKDPCs but not 571, miR-592. miR-638, miR-657, miR-659, miR-766
in hLNDPCs (11)
Expressed in hKDPCs miR-216b, miR-363, miR-505, miR-646
(4)
Expressed in hPDPCs miR-3, miR-122, miR-127, miR-134, miR-137, miR-148a, miR-299- 5p, miR-302b. miR-337-5p, miR-340, miR-345, miR-362-5p, miR- (51)
369-5p, miR-370, miR-376a, miR-376, miR-379, miR-409-3p, miR- 411, miR-424, miR-432, miR-433, miR-450b, miR-454, miR-455-3p, miR-486, miR-487b, miR-490-3p, miR-491-5p, miR-493, miR-495, miR-500, miR-501-5p, miR-502-3p, miR-503, miR-539, miR-542-5p, iR-543, miR-549, miR-565, miR-590-5p, miR-625, miR-628-5p, miR- 655, miR-660, miR-668, miR-758, miR-768-3p, miR-769, miR-886-3p, miR-886-5p
"Star miRNA" forms are also present in all rat and human progenitor cells
* The data are based on RT-PCR and thus depend on RNA quality and amount used, and on primer sets used by the manufacturer. Example 10 - Analysis of secreted factors of Pathfinder cell isolates
[0251] Our data thus far suggest that Pathfinder cells stimulate repair of damaged tissue by acting on host cells, rather than by integrating with the damaged tissue and making up a significant part of it. To explore the mechanism of Pathfinder cell action on host cells, ELISAs (enzyme-linked immunosorbent assays) for a number of secreted protein factors were carried out on supernatants from hKDPCs and hPDPCs that were grown for thirty days in the original standard medium (i.e., not depleted of bovine microvesicles). Preliminary data from these experiments suggest that IL6, IGF-1 (hKDPCs and hPDPCs), and VEGF (hPDPCs only) are produced by these cells, and that the level of secretion of these factors changes with time in culture. These preliminary data are consistent with a capability of PDPCs to influence their local micro environment.
[0252] Pathfinder cells could act to assist repair of tissue damage (e.g, acute tissue damage) by direct or indirect mechanisms, or a combination of both. Stimulation of tissue repair from a state of complete loss of beta cells in the pancreas (as described in International Patent Publication No. WO 2006/120476) and reduction of cell senescence in a kidney damage model (as shown in Example 1) argue for predominantly direct effects of these cells.
[0253] Without wishing to be bound by any particular theory, the inventors propose a working model by which Pathfinder cells are attracted by soluble proteins and other signals from danaged tissue and possibly from macrophages. According to this working model, cell surface changes, (e.g., in cell adhesion molecules) in cells near a damage site make the damaged region recognizable, and this effect may extend for some distance. Reception of damage signals by Pathfinder cells may induce changes within these cells to convert them into active repair mode, e.g., increased cell mobility; production of secreted factors for tissue remodeling and
reprogramming, growth factors, and pro-angiogenic and anti-coagulant factors; and changes in cell adhesion molecules and cell surface receptor proteins. Pathfinder cells may act on target cells of the damaged tissue to simulate the repair response, which may include activation of dormant stem cells or progenitors or induction of transdifferentiation (or de- and then re- differentiation) of adult cell type(s). This action could be via direct cell interaction and membrane protein-protein contact, and/or by the action of secreted proteins or nucleic acids. [0254] As discussed in co-pending provisional patent application USSN 61/373,715, filed on August 13, 2010, regulatory microRNAs may be delivered within secreted microvesicles from pathfinder cells.
Example 11 - Exemplary protocols for differentiation of pathfinder cells
[0255] The present Example provides examples of protocols for differentiation of pathfinder cells. See International Patent Publication WO2009/136168 for further details on methods used and for results previously obtained with these protocols.
Pancreatic differentiation
[0256] For pancreatic differentiation, pathfinder cells are plated at 6600 cells/cm2 cell density. After 24 hours maintenance media is removed and monolayers are washed thrice with HBSS. Cells are subsequently cultured in DMEM :F12 (Lonza) supplemented with IxITS, 1.25μg/ml Amphotericin B , and 100 u/ml Penicillin/Streptomycin (all Invitrogen ,UK),
Nicotinamide 10 mM(Sigma), KGF 10 ng/ml (Sigma) and 0.2%BSA (Sigma). Medium changes are performed thrice weekly.
Hepatogenic differentation
[0257] For hepatogenic differentiation cells are plated at 6600cells/cm2 in T75 and 6 well plates, and at 2500 cells/ cm2 in chamber slides (Nunc). At 24 hours, maintenance media is replaced. After washing thrice with HBSS, cells are incubated in DMEM :F12 (Lonza) supplemented with Fibroblast Growth Factor-4 10 ng/ml (Sigma), 1 x ITS, 100 u/ml
Penicinllin/Streptomycin (Invitrogen), and 0.2% Bovine serum albumin (Sigma). Medium changes are performed thrice weekly.
Preparation for analyses
[0258] If desired, analyses to determine characteristics of differentiated cells, including morphological analyses, RT-PCR analysis, and staining for cell-specific markers can be determined as described previously. To prepare cells for analyses, cells are harvested for RNA extraction from undifferentiated pathfinder cells at day 0 and at day 28 for pancreatic differentiation and at Day 0, 7, 14, 21 and 28 for hepatic differentiation. Cells undergoing hepatic differentiation in a chamber slide are washed twice with PBS and fixed with 4% paraformaldehyde for 15 minutes at room temperature between days 10-14. Undifferentiated pathfinder cells also grown in chamber slides concurrently and were fixed at 90% confluency.
Example 12 - Stimulation and suppression of cytokine production by pancreas-derived pathfinder cell (PDPC) in a mixed lymphocyte reaction (MLR)
[0259] The present Example demonstrates that pancreas-derived pathfinder cells
(PDPCs) can stimulate and/or suppress cytokine response in a mixed lymphocyte reaction (MLR).
Mixed Lymphocyte Reaction
[0260] On Day 1 , flasks confluent with PDPCs with Mitomycin C (Sigma Aldrich, St.
Louis, MO, USA) in order to inhibit their proliferation. On Day 2, peripheral blood lymphocytes (PBLs) were harvested in Histopaque 1077 (Sigma Aldrich, St. Louis, MO, USA) using standard procedures and optionally fractionated. PBLs were washed twice and counted to obtain 5xl06 cells/ml in proliferation medium (CMRL supplemented with FCS and beta-mercaptoethanol). PBLs were stored on ice until required. PDPCs were washed twice in HBSS, trypsinised and counted to obtain a top dose of 5xl04 cells/ml in proliferation medium. PDPCs were stored on ice until required. PDPCs were dispensed in an appropriate dose into a 96-well flat bottomed culture plate at lOOul/well. Concanavalin A (Con A; Sigma Aldrich, St. Louis, MO, USA) or phytohemagglutinin (PHA; Sigma Aldrich, St. Louis, MO, USA) was added to the wells as appropriate. PBLs in an appropriate dose in 100 ul/well were added on top of PDPCs and incubated for 48hrs. On Day 4, at least 150ul culture supernatant was harvested from each well and transferred to a 96-well U-bottom plate and stored at-20°C for cytokine ELISAs, which were performed using standard methods.
[0261] Mixed lymphocyte reactions using various amounts of PDPCs or control cells
(FIBS) were performed and cytokine production was measured by ELISA. Figures 16-21 depict IL-1B, IL-2, IL-4, IL-5, IL-6, IL-7, IL-8, IL-10, IL-12, IL-13, IL-17, GCSF, GMCSF, IFN-g, MCAF, MIP-1B, and TNFa expression in response to incubation of MLR with PDPCs as compared to incubation of MLR with control cells. As can be seen, the PCs induce suppression of pro-inflammatory cytokines and anti-angiogenic factors. They appear to facilitate a suppression of T cell responses and provide a platform for the induction of immunological tolerance.
[0262] Taken together, these data suggest that PDPC induce an anti-inflammatory response, which may lead to immune tolerance. Without wishing to be bound by any particular theory, it is contemplated that PDPC induce expansion of cell types and/or expression of cytokines associated with anti-inflammatory response and induce decreased level and/or activity of cell types and/or cytokines associated with pro-inflammatory response.
Example 13 - Stimulation and suppression of cytokine production by pancreas-derived pathfinder cell (PDPC) in mixed lymphocyte reaction (MLR) fractions
[0263] The present Example demonstrates that pancreas-derived pathfinder cells
(PDPCs) can stimulate and/or suppress cytokine response in a mixed lymphocyte reaction (MLR).
Sorting Peripheral Blood Leukocytes (PBLs) into T cell fractions
[0264] Blood was collected into EDTA and diluted 1 :2 in MACS buffer. PBLs were harvested in Histopaque 1077 (Sigma Aldrich, St. Louis, MO, USA) using standard procedures, as described in Example 12. T cells were isolated using Pan T Cell Isolation Kit (Miltenyi Biotec GmbH, Germany). Briefly, T cells pass through into the eluted fraction, leaving non-T cells bound to a magnetized column. The column was removed from the magnet and non-T cells were harvested (Fraction 1). T cells from the flow-through were then sorted for CD4 and CD25 using a CD4+CD25+ Regulatory T Cell Isolation Kit (Miltenyi Biotec GmbH, Germany), which yielded 3 further fractions: Fraction 2 (CD4- T cells), Fraction 3 (CD4+/CD25- T cells), and Fraction 4 (CD4+/CD25+ T cells). [0265] Mixed lymphocyte reactions using various amounts of PDPCs (e.g., 0-1,000
PCs/ml) were performed as described in Example 12 and cytokine production was measured by ELISA by standard methods. Figures 22 and 23 depict IL-2 and IL-6 release by each of
Fractions 1-4.
[0266] In another experiment, mixed lymphocyte reactions using various amounts of
PDPCs (e.g., 0-10,000 PCs/ml) were performed as described in Example 12 and cytokine production was measured by ELISA by standard methods. Figures 24-35 depict IL-4, IL-5, IL-6, IL-7, IL-8, IL-10, IL-13, and IL-17, GCSF, GMCSF, and MCAF release by each of Fractions 1- 4. It will be appreciated that differences in scale among MLR experiments may be due to different responses to PBLs in the reaction originating from different individuals.
[0267] Taken together, these data are consistent with a scenario of expansion of T regulatory cells and suppression of T cell responses, which may lead to induction of tolerance. Although IL-6 repsonses are complex, the data are consistent with induction of immunological tolerance and anergy.
Example 14 - Stimulation and suppression of cytokine production by pancreas-derived pathfinder cells (PDPC) and mesenchymal stem cells (MSCs) in mixed lymphocyte reaction (MLR)
[0268] The present Example demonstrates a comparison of cytokine and/or chemokine responses induced by pancreas-derived pathfinder cells (PDPCs) as compared to mesenchymal stem cells (MSCs) in a mixed lymphocyte reaction (MLR). Fractionation of PBLs was performed as described in Example 13. MLRs were performed as described in Example 12 by addition of PDPCs, MSCs or control, and cytokine and/or chemokine production was measured by ELISA by standard methods. Table 7 shows whether particular cytokines and/or chemokines are increased or decreased in response to PDPCs or MSCs as compared to a control in a mixed lymphocyte reaction. As can be seen, PDPCs induce a different cytokine profile than MSCs in the MLR (e.g., see IL-6, IL-4, IL-10 responses, among others). Table 7 - Cytokine / Chemokine profile induced by PDPCs or MSCs in a mixed lymphocyte reaction (MLR)
Figure imgf000101_0001
[0269] Without wishing to be bound by any particular theory, it is contemplated that PCs induce an increase in cytokines and/or chemokines that are typically associated with antiinflammatory (e.g., tolerogenic) responses (e.g., IL-Ιβ, GSCF, and IL-8), and induce a decrease in cytokines and/or chemokines that are typically associated with pro-inflammatory responses (e.g., IL-4, IL-5, IL-6, IL-10, IL-12, IL-13, IL-17, GMCSF, , TGF-β, TNF-a, IFN-γ, MCAF, MIP1). These data show that IL-5, IL-7, and IL-13 repsonses may be mediated by a CD 4- T cell fraction containing gamma delta T cells. IL-13 is also mediated by CD4+25- T cells. The IL-10 response is principally via non-T cells, as is GCSF. GMCSF is principally released by regulatory T cells (T regs), while MCAF release is principally via T regs cells and CD4+ CD25+ cells.
Example 15 - RNA Expression Profiling of Pathfinder Cells (PCs) cultured under serum starvation conditions
[0270] In the present Example, RNA from rat or human PDPC cells grown under serum starvation conditions were prepared using standard procedures. RNA samples were reverse- transcribed (RT) and amplified in a quantitative PCR assay in order to analyze expression of miRNAs.
Materials and Methods
[0271] RNA extraction. RNA from cells was extracted using TRI Reagent (Sigma), with the following modifications to the manufacturer's protocol. After addition of l/5th volume chloroform to the TRI Reagent, samples were spun at 6 °C for 15 minutes at 16,000 x g.
Aqueous phases were then subject to an extraction by phenol:choloform:isoamyl alcohol (pH 6.6; Ambion) at 10 °C for 10 minutes at 16,000 x g. Aqueous phases were precipitated for a maximum of 2 hours at -20 °C. After centrifugation at 6 °C for 30 minutes at 16,000 x g, the resultant RNA was washed in 95% ice-cold ethanol. The RNA was then resuspended in DEPC- water and quantified using a NanoDrop 1000 spectrophotometer.
[0272] miRNA analysis. RNA from cells was analysed for expression of microRNAs
(miRNAs) using Appplied Biosystem's Taqman Low Density Arrays (TLDA) cards. For rat PDPCs, Taqman Rodent MicroRNA Arrays A and B were used in combination with MegaPlex RT Rodent Pool A and Pool B primers.
Results
[0273] miRNAs in PCs were identified. Table 8 depicts results from analysis of miRNAs from rat PDPC RNA preparations. Table 8. Exemplary miRNA sequences in serum starved rat PCs
Exemplary Sequence(s) (5' to 3') Alternative miRNA
Description
UACAGUACUGUGAUAACUGAAG (SEQ ID MIMAT000013: mmu-miR- 101 a-4395364 NO:320)
UACCCUGUAGAUCCGAAUUUGUG (SEQ ID MIMAT000064! mmu-miR- 1 Oa-4373153 NO:321)
UACCCUGUAGAACCGAAUUUGUG (SEQ ID
mmu-miR- 10b-4395329 NO:322) MIMAT000020!
ACAGGUGAGGUUCUUGGGAGCC (SEQ ID
mmu-miR- 125a-3p-4395310 NO:323) MIMAT000452!
UCCCUGAGACCCUUUAACCUGUGA
mmu-miR-125a-5p-4395309 (SEQ ID NO:324) MIMAT000013:
ACGGGUUAGGCUCUUGGGAGCU (SEQ ID
mmu-miR-125b-3p-4395489 NO:325) MIMAT000466'
UCACAGUCAACCGGUCUCUUU
mmu-miR-128a-4395327 (SEQ ID NO:326) MIMAT000042-
AAGCCCUUACCCCAAAAAGCAU (SEQ ID
mmu-miR-129-3p-4373297 NO:327) ΜΙΜΑΤ00005
AGCUGGUGUUGUGAAUCAGGCCG (SEQ ID
mmu-miR-138-4395395 NO:328) MIMAT000015I
UGUAGUGUUUCCUACUUUAUGGA (SEQ ID
mmu-miR- 142-3p-4373136 NO:329) MIMAT000015:
CAUAAAGUAGAAAGCACUACU (SEQ ID
mmu-miR- 142-5p-4395359 NO:330) MIMAT000015-
UGAGAUGAAGCACUGUAGCUC (SEQ ID
mmu-miR- 143 -4395360 NO:341) MIMAT000024'
UGAGAACUGAAUUCCAUGGGUU (SEQ ID
mmu-miR- 146a-4373132 NO:342) MIMAT000015!
GUGUGCGGAAAUGCUUCUGCUA (SEQ ID
mmu-miR- 147-4395373 NO:343) MIMAT000485'
UCAGUGCACUACAGAACUUUGU (SEQ ID
mmu-miR-148a-4373130 NO:344) MIMAT000051I
UCAGUGCAUCACAGAACUUUGU (SEQ ID
mmu-miR- 148b-4373129 NO:345) MIMAT000058I
CUAGACUGAGGCUCCUUGAGG (SEQ ID
mmu-miR-151-3p-4373304 NO:346) MIMAT000016
UUUGGCAAUGGUAGAACUCACACCG (SEQ
mmu-miR- 182-4395729 ID NO:347) MIMAT000021
UCGUGUCUUGUGUUGCAGCCGG (SEQ ID
mmu-miR- 187-4373307 NO:348) MIMAT000021I
CAUCCCUUGCAUGGUGGAGGG (SEQ ID
mmu-miR- 188-5p-4395431 NO:349) ΜΙΜΑΤ00002Γ UAAGGUGCAUCUAGUGCAGAUAG (SEQ ID
mmu-miR- 18a-4395533 NO:350) MIMAT000052!
UGAUAUGUUUGAUAUAUUAGGU (SEQ ID
mmu-miR- 190-4373110 NO:351) MIMAT000022!
UAGGUAGUUUCCUGUUGUUGGG (SEQ ID
mmu-miR- 196b-4395326 NO:352) MIMAT000108
UUCACCACCUUCUCCACCCAGC
mmu-miR- 197-4373102 (SEQ ID NO:353) MIMAT000022'
ACAGUAGUCUGCACAUUGGUUA (SEQ ID
mmu-miR- 199a-3p-4395415 NO:354) MIMAT000023I
UAAUACUGCCGGGUAAUGAUGGA (SEQ ID
mmu-miR-200c-4395411 NO:355) MIMAT000065'
UUCCCUUUGUCAUCCUAUGCCU (SEQ ID
mmu-miR-204-4373094 NO:356) MIMAT000023'
CUGUGCGUGUGACAGCGGCUGA (SEQ ID
mmu-miR-210-4373089 NO:357) MIMAT000065!
UAGCUUAUCAGACUGAUGUUGA (SEQ ID
mmu-miR-21-4373090 NO:358) MIMAT000053I
AGCUACAUCUGGCUACUGGGU (SEQ ID
mmu-miR-222-4395387 NO:359) MIMAT000067I
AUCACAUUGCCAGGGAUUUCC (SEQ ID
mmu-miR-23a-4373074 NO:360) MIMAT000053:
AUCACAUUGCCAGGGAUUACC (SEQ ID
mmu-miR-23b-4373073 NO:361) MIMAT000012:
UUCAAGUAAUCCAGGAUAGGCU (SEQ ID
mmu-miR-26a-4395166 NO:362) MIMAT000053:
UAGCACCAUUUGAAAUCAGUGUU (SEQ ID
mmu-miR-29b-4373288 NO:363) MIMAT000012'
UAGCACCAUUUGAAAUCGGUUA (SEQ ID
mmu-miR-29c-4395171 NO:364) MIMAT000053I
AAAAGCUGGGUUGAGAGGGCGA (SEQ ID
mmu-miR-320-4395388 NO:365) MIMATOOOO661
CAGCAGCAAUUCAUGUUUUGGA (SEQ ID
mmu-miR-322-4378107 NO:366) MIMAT000054!
CGCAUCCCCUAGGGCAUUGGUGU (SEQ ID
mmu-miR-324-5p-4373052 NO:367) MIMAT000055:
CUAGGUAUGGUCCCAGGGAUCC (SEQ ID
mmu-miR-331-5p-4395344 NO:368) MIMAT000464:
UUUUUCAUUAUUGCUCCUGACC (SEQ ID
mmu-miR-335-3p-4395296 NO:369) MIMAT000470-
UCCCUGUCCUCCAGGAGCUCACG (SEQ ID
mmu-miR-339-5p-4395368 NO:370) MIMAT000058-
GCUGACCCCUAGUCCAGUGCUU (SEQ ID
mmu-miR-345-5p-4395658 NO:371) MIMAT000059:
UUCACAAAGCCCAUACACUUUC (SEQ ID
mmu-miR-350-4395660 NO:372) MIMAT000060: UCCCUGAGGAGCCCUUUGAGCCUG (SEQ
mmu-miR-351-4373345 ID NO:373) MIMAT000060'
UUAUCAGAAUCUCCAGGGGUAC (SEQ ID
mmu-miR-361 -4373035 NO:374) MIMAT000070-
AACACACCUGUUCAAGGAUUCA (SEQ ID
mmu-miR-362-3p-4395746 NO:375) MIMAT000468-
UGUAAACAAUUCCUAGGCAAUGU (SEQ ID
mmu-miR-384-5p-4395732 NO:376) MIMAT000474:
UAAUACUGUCUGGUAAUGCCGU (SEQ ID
mmu-miR-429-4373355 NO:377) MIMAT000153'
UUUUGCGAUGUGUUCCUAAUAU (SEQ ID
mmu-miR-450a-5p-4395414 NO:378) MIMAT000154I
UGAAACAUACACGGGAAACCUC (SEQ ID
mmu-miR-494-4395476 NO:379) MIMAT000318:
AAUGC AC CUGGGC AAGGGUUC A (SEQ ID
mmu-miR-500-4395736 NO:380) MIMAT000350'
UAGCAGCGGGAACAGUACUGCAG (SEQ ID
mmu-miR-503 -4395586 NO:381) MIMAT000318!
UGUGACAGAUUGAUAACUGAAA (SEQ ID
mmu-miR-542-3p-4378101 NO:382) MIMAT000317:
CCUGUUGAACAACUGAACCCAA (SEQ ID
mmu-miR-582-3p-4395697 NO:383) MIMAT000529:
UACAGUUGUUCAACCAGUUACU (SEQ ID
mmu-miR-582-5p-4395696 NO:384) MIMAT000529
UACGUCAUCGUCGUCAUCGUUA (SEQ ID
mmu-miR-598-4395606 NO:385) MIMAT000494:
AAUGGCGCCACUAGGGUUGUG (SEQ ID
mmu-miR-652-4395463 NO:386) MIMAT000371
UGACACCUGCCACCCAGCCCAAG (SEQ ID
mmu-miR-667-4386769 NO:387) MIMAT000373-
UCAAUGGCUGAGGUGAGGCAC
mmu-miR-685-4386748 (SEQ ID NO:388) MIMAT000346:
UGUUCAGACUGGUGUCCAUCA (SEQ ID
mmu-miR-743b-5p-4395600 NO:389) MIMAT000483'
UGCGGGGCUAGGGCUAACAGCA (SEQ ID
mmu-miR-744-4395435 NO:390) MIMAT000418'
UAACUGCAACAGCUCUCAGUAU (SEQ ID
mmu-miR-883a-3p-4395591 NO:391) MIMAT000484'
UAACUGCAACAUCUCUCAGUAU (SEQ ID
mmu-miR-883b-3p-4395695 NO:392) MIMAT000485
UGAGGUAGUAAGUUGUAUUGUU (SEQ ID
mmu-miR-98-4373009 NO:393) MIMAT000054:
UGAUAUGUUUGAUAUUAGGUU (SEQ ID
rno-miR-190b-4395749 NO:394) MIMAT000530:
GCUUCUCCUGGCUCUCCUCCCUU (SEQ ID
rno-miR-207-4381096 NO:395) MIMAT000311: GUGGUGUGCUAGUUACUUUU
rno-miR-333-4381109 (SEQ ID NO:396)
UGAGCGCCUCGACGACAGAGCCA (SEQ ID
rno-miR-339-3p-4395760 NO:397) MIMAT000464!
CCCUGAACUAGGGGUCUGGAGA (SEQ ID
rno-miR-345-3p-4395762 NO:398) MIMAT000465:
UCCCUGAGGAGCCCUUUGAGCCUGA (SEQ
rno-miR-351-4395764 ID NO:399) MIMAT000060!
UGUGAUGUGUGCAUGUACAUG (SEQ ID
rno-miR-466c-4395768 NO:400) MIMAT000527'
G AAAG AC AC C AUACUG AAUAG A (SEQ ID
rno-miR-743b-4395769 NO:401) MIMAT000528I
GCTGTACTGACTTGATGAAAGTACTTTTGA
ACCCTTTTCCATCTGATG
snoRNA202-4380914 (SEQ ID NO:402)
CUAUACAAUCUAUUGCCUUCCC (SEQ ID
mmu-let-7f*-4395528 NO:403) MIMAT000462:
ACUGUACAGGCCACUGCCUUGC (SEQ ID
mmu-let-7g*-4395622 NO:404) MIMAT000451'
CUGCGCAAGCUACUGCCUUGCU (SEQ ID
mmu-let-7i*-4395283 NO:405) MIMAT000452!
CCGCACUGUGGGUACUUGCUGC (SEQ ID
mmu-miR- 106b*-4395491 NO:406) MIMAT000458:
C AAAUUC GUAUCU AGGGG AAUA (SEQ ID
mmu-miR- 10a* -4395399 NO:407) MIMAT000465'
C AG AUUC GAUUCU AGGGG AAUA (SEQ ID
mmu-miR- 1 Ob * -4395702 NO:408) MIMAT000453!
ACUCUUUCCCUGUUGCACUACU (SEQ ID
mmu-miR- 13 Ob * -4395590 NO:409) MIMAT000458:
UAUAGGGAUUGGAGCCGUGGCG (SEQ ID
mmu-miR- 135 a* -4395343 NO:410) MIMAT000453
UCUGGCUCCGUGUCUUCACUCCC (SEQ ID
mmu-miR- 149-4395366 NO:411) MIMAT000015'
CGAAUCAUUAUUUGCUGCUCUA (SEQ ID
mmu-miR- 15b*-4395284 NO:412) MIMAT000452
CCAGUAUUGACUGUGCUGCUGA (SEQ ID
mmu-miR- 16* -4395619 NO:413) MIMAT000462:
ACUGCAGUGAGGGCACUUGUAG (SEQ ID
mmu-miR- 17 * -4395673 NO:414) MIMAT000065I
ACUGCCCUAAGUGCUCCUUCUG (SEQ ID
mmu-miR- 18a* -4395620 NO:415) MIMAT000462I
GCUGCACUUGGAUUUCGUUCCC (SEQ ID
mmu-miR- 191 * -4395706 NO:416) MIMAT000454:
CCCAGUGUUUAGACUACCUGUUC (SEQ ID
mmu-miR- 199b * -4373309 NO:417) MIMAT000067: mmu-miR-206-4373092 UGGAAUGUAAGGAAGUGUGUGG (SEQ ID MIMAT000023'
Figure imgf000107_0001
Figure imgf000108_0001
sno - : ontro
Table 9 depicts results from analysis of miRNAs from human PC RNA Table 9. Exemplary miRNA sequences in serum starved human PCs
Exemplary Sequence(s) (5' to 3') Alternative miRNA
Description
UUAAUGCUAAUCGUGAUAGGGGU
has-miR-155-4395459 (SEQ ID NO:460) MIMAT000064I
UGAGGUAGUAGGUUGUAUAGUU (SEQ ID
hsa-let-7a-4373169 NO:461) MIMAT000006:
AGAGGUAGUAGGUUGCAUAGUU (SEQ ID
hsa-let-7d-4395394 NO:462) MIMAT000006:
UGAGGUAGUAGAUUGUAUAGUU (SEQ ID
hsa-let-7f-4373164 NO:463) MIMAT000006'
UGAGGUAGUAGUUUGUACAGUU (SEQ ID
hsa-let-7g-4395393 NO:464) MIMAT000041<
AACCCGUAGAUCCGAACUUGUG (SEQ ID
hsa-miR-100-4373160 NO:465) MIMAT000009!
AGCAGCAUUGUACAGGGCUAUGA (SEQ ID
hsa-miR-103-4373158 NO:466) MIMAT000010
AAAAGUGCUUACAGUGCAGGUAG (SEQ ID
hsa-miR-106a-4395280 NO:467) MIMATOOOOIO:
UAAAGUGCUGACAGUGCAGAU (SEQ ID
hsa-miR-106b-4373155 NO:468) MIMAT000068!
UCCCUGAGACCCUUUAACCUGUGA (SEQ
hsa-miR-125a-5p-4395309 ID NO:469) MIMAT000044:
UCCCUGAGACCCUAACUUGUGA (SEQ ID
hsa-miR-125b-4373148 NO:470) MIMAT000042:
UCGUACCGUGAGUAAUAAUGCG (SEQ ID
hsa-miR-126-4395339 NO:471) MIMAT000044:
UCGGAUCCGUCUGAGCUUGGCU (SEQ ID
hsa-miR-127-3p-4373147 NO:472) MIMAT000044I
UAACAGUCUACAGCCAUGGUCG (SEQ ID
hsa-miR-132-4373143 NO:473) MIMAT000042I
UGUGACUGGUUGACCAGAGGGG (SEQ ID
hsa-miR-134-4373299 NO:474) MIMAT000044'
AGCUGGUGUUGUGAAUCAGGCCG (SEQ ID
hsa-miR-138-4395395 NO:475) MIMAT000043I
UCUACAGUGCACGUGUCUCCAG (SEQ ID
hsa-miR-139-5p-4395400 NO:476) MIMAT000025I
UACCACAGGGUAGAACCACGG (SEQ ID
hsa-miR-140-3p-4395345 NO:477) MIMAT000459'
CAGUGGUUUUACCCUAUGGUAG (SEQ ID
hsa-miR-140-5p-4373374 NO:478) MIMAT000043
UGAGAUGAAGCACUGUAGCUC (SEQ ID
hsa-miR-143-4395360 NO:479) MIMAT000043: GUCCAGUUUUCCCAGGAAUCCCU (SEQ ID
hsa-miR-145-4395389 NO:480) MIMAT000043'
UGAGAACUGAAUUCCAUAGGCU (SEQ ID
hsa-miR- 146b-5p-4373178 NO:481) MIMAT000280'
UCUGGCUCCGUGUCUUCACUCCC (SEQ ID
hsa-miR-149-4395366 NO:482) MIMAT000045I
UAGCAGCACAUCAUGGUUUACA (SEQ ID
hsa-miR-15b-4373122 NO:483) ΜΙΜΑΤ00004Γ
CAAAGUGCUUACAGUGCAGGUAG (SEQ ID
hsa-miR-17-4395419 NO:484) MIMAT000007I
AACAUUCAACGCUGUCGGUGAGU (SEQ ID
hsa-miR-181a-4373117 NO:485) MIMAT000025I
CAAAGAAUUCUCCUUUUGGGCU (SEQ ID
hsa-miR-186-4395396 NO:486) MIMAT000045I
CAACGGAAUCCCAAAAGCAGCUG (SEQ ID
hsa-miR-191-4395410 NO:487) MIMAT000044!
UGGGUCUUUGCGGGCGAGAUGA (SEQ ID
hsa-miR- 193 a-5p-4395392 NO:488) MIMAT000461<
AACUGGCCCUCAAAGUCCCGCU (SEQ ID
hsa-miR-193b-4395478 NO:489) MIMAT000281'
UAGCAGCACAGAAAUAUUGGC (SEQ ID
hsa-miR-195-4373105 NO:490) MIMAT000046
UUCACCACCUUCUCCACCCAGC (SEQ ID
hsa-miR-197-4373102 NO:491) MIMAT000022'
ACAGUAGUCUGCACAUUGGUUA (SEQ ID
hsa-miR- 199a-3p-4395415 NO:492) MIMAT000023:
UGUGCAAAUCUAUGCAAAACUGA (SEQ ID
hsa-miR- 19a-4373099 NO:493) MIMAT000007:
UGUGCAAAUCCAUGCAAAACUGA (SEQ ID
hsa-miR-19b-4373098 NO:494) MIMAT000007-
UUCCCUUUGUCAUCCUAUGCCU (SEQ ID
hsa-miR-204-4373094 NO:495) MIMAT000026:
UAAAGUGCUUAUAGUGCAGGUAG (SEQ ID
hsa-miR-20a-4373286 NO:496) MIMAT000007:
CUGUGCGUGUGACAGCGGCUGA (SEQ ID
hsa-miR-210-4373089 NO:497) MIMAT000026'
UAGCUUAUCAGACUGAUGUUGA (SEQ ID
hsa-miR-21-4373090 NO:498) MIMAT000007I
ACAGCAGGCACAGACAGGCAGU (SEQ ID
hsa-miR-214-4395417 NO:499) MIMAT000027
AGCUACAUUGUCUGCUGGGUUUC (SEQ ID
hsa-miR-221-4373077 NO:500) MIMAT000027!
AGCUACAUCUGGCUACUGGGU (SEQ ID
hsa-miR-222-4395387 NO:501) MIMAT000027'
UGGCUCAGUUCAGCAGGAACAG (SEQ ID
hsa-miR-24-4373072 NO:502) MIMAT000008I UUCAAGUAAUCCAGGAUAGGCU (SEQ ID
hsa-miR-26a-4395166 NO:503) MIMAT000008:
UUCAAGUAAUUCAGGAUAGGU (SEQ ID
hsa-miR-26b-4395167 NO:504) MIMAT000008:
UUCACAGUGGCUAAGUUCCGC (SEQ ID
hsa-miR-27a-4373287 NO:505) MIMAT000008-
UUCACAGUGGCUAAGUUCUGC (SEQ ID
hsa-miR-27b-4373068 NO:506) MIMAT000041'
CACUAGAUUGUGAGCUCCUGGA (SEQ ID
hsa-miR-28-3p-4395557 NO:507) MIMAT000450:
AAGGAGCUCACAGUCUAUUGAG (SEQ ID
hsa-miR-28-5p-4373067 NO:508) MIMAT000008:
UAGCACCAUCUGAAAUCGGUUA (SEQ ID
hsa-miR-29a-4395223 NO:509) MIMAT000008!
UAGCACCAUUUGAAAUCGGUUA (SEQ ID
hsa-miR-29c-4395171 NO:510) MIMAT000068
UGUAAACAUCCUACACUCAGCU (SEQ ID
hsa-miR-30b-4373290 NO:511) MIMAT000042!
UGUAAACAUCCUACACUCUCAGC (SEQ ID
hsa-miR-30c-4373060 NO:512) ΜΙΜΑΤ00002
AGGCAAGAUGCUGGCAUAGCU (SEQ ID
hsa-miR-31-4395390 NO:513) MIMAT000008'
AAAAGCUGGGUUGAGAGGGCGA
hsa-miR-320-4395388 (SEQ ID NO:514) MIMAT00005 H
CACAUUACACGGUCGACCUCU (SEQ ID
hsa-miR-323-3p-4395338 NO:515) MIMAT000075:
ACUGCCCCAGGUGCUGCUGG (SEQ ID
hsa-miR-324-3p-4395272 NO:516) MIMAT000076:
CUGGCCCUCUCUGCCCUUCCGU (SEQ ID
hsa-miR-328-4373049 NO:517) MIMAT000075:
GCCCCUGGGCCUAUCCUAGAA (SEQ ID
hsa-miR-331-3p-4373046 NO:518) MIMAT000076!
UGAGCGCCUCGACGACAGAGCCG (SEQ ID
hsa-miR-339-3p-4395295 NO:519) MIMAT000470:
UCUCACACAGAAAUCGCACCCGU (SEQ ID
hsa-miR-342-3p-4395371 NO:520) MIMAT000075:
GCUGACUCCUAGUCCAGGGCUC (SEQ ID
hsa-miR-345-4395297 NO:521) MIMAT000077:
UGGCAGUGUCUUAGCUGGUUGU (SEQ ID
hsa-miR-34a-4395168 NO:522) MIMAT000025:
AAUCCUUGGAACCUAGGUGUGAGU (SEQ
hsa-miR-362-5p-4378092 ID NO:523) MIMAT000070:
UAAUGCCCCUAAAAAUCCUUAU (SEQ ID
hsa-miR-365-4373194 NO:524) MIMAT000071!
UU AU AAU AC AAC CUG AU AAGUG (SEQ ID
hsa-miR-374a-4373028 NO:525) MIMAT000072' AUAUAAUACAACCUGCUAAGUG (SEQ ID
hsa-miR-374b-4381045 NO:526) MIMAT000495:
AUCAUAGAGGAAAAUCCACGU
hsa-miR-376a-4373026 (SEQ ID NO:527) MIMAT000072'
AACAUAGAGGAAAUUCCACGU
hsa-miR-376c-4395233 (SEQ ID NO:528) MIMAT000072!
UAGUAGACCGUAUAGCGUACG (SEQ ID
hsa-miR-411-4381013 NO:529) MIMAT000332'
AAUGACACGAUCACUCCCGUUGA (SEQ ID
hsa-miR-425-4380926 NO:530) MIMAT000339:
UGUCUUGCAGGCCGUCAUGCA (SEQ ID
hsa-miR-431-4395173 NO:531) MIMAT000162:
AACUGUUUGCAGAGGAAACUGA (SEQ ID
hsa-miR-452-4395440 NO:532) MIMAT000163:
UAGUGCAAUAUUGCUUAUAGGGU (SEQ ID
hsa-miR-454-4395434 NO:533) MIMAT000388:
AAGACGGGAGGAAAGAAGGGAG (SEQ ID
hsa-miR-483-5p-4395449 NO:534) MIMAT000476
UCAGGCUCAGUCCCCUCCCGAU (SEQ ID
hsa-miR-484-4381032 NO:535) MIMAT000217-
GUCAUACACGGCUCUCCUCUCU (SEQ ID
hsa-miR-485-3p-4378095 NO:536) MIMAT000217I
UCCUGUACUGAGCUGCCCCGAG (SEQ ID
hsa-miR-486-5p-4378096 NO:537) MIMAT000217'
AGUGGGGAACCCUUCCAUGAGG (SEQ ID
hsa-miR-491 -5p-4381053 NO:538) MIMAT000280'
AAACAAACAUGGUGCACUUCUU (SEQ ID
hsa-miR-495-4381078 NO:539) ΜΙΜΑΤ00028Γ
CCUCCCACACCCAAGGCUUGCA (SEQ ID
hsa-miR-532-3p-4395466 NO:540) MIMAT000478I
CAUGCCUUGAGUGUAGGACCGU (SEQ ID
hsa-miR-532-5p-4380928 NO:541) MIMAT000288!
GG AG AAAUUAUC CUUGGUGUGU (SEQ ID
hsa-miR-539-4378103 NO:542) MIMAT000316:
CACGCUCAUGCACACACCCACA (SEQ ID
hsa-miR-574-3p-4395460 NO:543) MIMAT000323'
GAGCUUAUUCAUAAAAGUGCAG (SEQ ID
hsa-miR-590-5p-4395176 NO:544) MIMAT000325!
AUGCUGACAUAUUUACUAGAGG (SEQ ID
hsa-miR-628-5p-4395544 NO:545) MIMAT000480'
UCCGGUUCUCAGGGCUCCACC (SEQ ID
hsa-miR-671-3p-4395433 NO:546) MIMAT000481'
AAGGAGCUUACAAUCUAGCUGGG (SEQ ID
hsa-miR-708-4395452 NO:547) MIMAT000492I
UGCGGGGCUAGGGCUAACAGCA (SEQ ID
hsa-miR-744-4395435 NO:548) MIMAT000494: CGCGGGUGCUUACUGACCCUU
hsa-miR-886-3p-4395305 (SEQ ID NO:549) MIMAT000490:
CGGGUC GG AGUUAGCUC AAGC GG
hsa-miR-886-5p-4395304 (SEQ ID NO:550) MIMAT000490:
UAUUGCACUUGUCCCGGCCUGU (SEQ ID
hsa-miR-92a-4395169 NO:551) MIMAT000009:
CAAAGUGCUGUUCGUGCAGGUAG (SEQ ID
hsa-miR-93-4373302 NO:552) MIMAT000009:
AACCCGUAGAUCCGAUCUUGUG (SEQ ID
hsa-miR-99a-4373008 NO:553) MIMAT000009'
GATGACCCCAGGTAACTCTGAGTGTGTCGC TGATGCCATCACCGCAGCGCTCTGACC Mature miRNA
RNU48-4373383 (SEQ ID NO:554) Control
UGAGGUAGUAGGUUGUGUGGUU
hsa-let-7b#-002404 (SEQ ID NO:555) MIMAT000006:
UACCCUGUAGAACCGAAUUUGUG
hsa-miR-10b#-002315 (SEQ ID NO:556) MIMAT000025-
UUUCCGGCUCGCGUGGGUGUGU (SEQ ID
hsa-miR- 1180-002847 NO:557) MIMAT000582:
AGCCUGAUUAAACACAUGCUCUGA (SEQ
hsa-miR- 1201-002781 ID NO:558)
UCACUGUUCAGACAGGCGGA (SEQ ID
hsa-miR-1208-002880 NO:559) MIMAT000587:
UGAGCCCUGUCCUCCCGCAG (SEQ ID
hsa-miR-1233-002768 NO:560) MIMAT000558!
ACCCGUCCCGUUCGUCCCCGGA (SEQ ID
hsa-miR- 1247-002893 NO:561) MIMAT000589'
ACGGGUUAGGCUCUUGGGAGCU
hsa-miR- 125b-l#-002378 (SEQ ID NO:562) MIMAT000459: hsa-miR- 1260-002896 AUCCCACCUCUGCCACCA (SEQ ID NO:563) MIMAT000591
CUUGGCACCUAGCAAGCACUCA (SEQ ID
hsa-miR- 1271-002779 NO:564) MIMAT000579I
GUCCCUGUUCAGGCGCCA
hsa-miR-1274A-002883 (SEQ ID NO:565)
hsa-miR-1274B-002884 UCCCUGUUCGGGCGCCA (SEQ ID NO:566) MIMAT000593! hsa-miR-1275-002840 GUGGGGGAGAGGCUGUC (SEQ ID NO:567) MIMAT000592'
UGGAUUUUUGGAUCAGGGA (SEQ ID
hsa-miR- 1290-002863 NO:568) MIMAT000588I
CAGUGCAAUGAUGAAAGGGCAU
hsa-miR-130b#-002114 (SEQ ID NO:569) MIMAT000069
GUCCAGUUUUCCCAGGAAUCCCU
hsa-miR- 145#-002149 (SEQ ID NO:570) MIMAT000043'
UCUGGCUCCGUGUCUUCACUCCC
hsa-miR- 149#-002164 (SEQ ID NO:571) MIMAT000045I
CUAGACUGAAGCUCCUUGAGG (SEQ ID
hsa-miR-151-3p-002254 NO:572) MIMAT000075' UCGAGGAGCUCACAGUCUAGU (SEQ ID
hsa-miR-151-5P-002642 NO:573) MIMAT000469'
ACCACUGACCGUUGACUGUACC MIMAT000455! hsa-miR-181a-2#-002317 (SEQ ID NO:574)
AACUGGCCCUCAAAGUCCCGCU
hsa-miR-193b#-002366 (SEQ ID NO:575) MIMAT000281'
ACCAUCGACCGUUGAUUGUACC
hsa-miR-213-000516 (SEQ ID NO:576) MIMAT000027I
ACAGCAGGCACAGACAGGCAGU
hsa-miR-214#-002293 (SEQ ID NO:577) MIMAT000027
AAGCUGC C AGUUG AAG A ACUGU
hsa-miR-22#-002301 (SEQ ID NO:578) MIMAT000007'
UGCCUACUGAGCUGAAACACAG
hsa-miR-24-2#-002441 (SEQ ID NO:579) MIMAT000449'
CCUAUUCUUGGUUACUUGCACG
hsa-miR-26a-l #-002443 (SEQ ID NO:580) MIMAT000449'
UUCACAGUGGCUAAGUUCCGC
hsa-miR-27a#-002445 (SEQ ID NO:581) MIMAT000008-
UUCACAGUGGCUAAGUUCUGC
hsa-miR-27b#-002174 (SEQ ID NO:582) MIMAT000041'
CUUUCAGUCGGAUGUUUGCAGC
hsa-miR-30a-3p-000416 (SEQ ID NO:583) MIMAT000008!
UGU AAAC AUC CUC G ACUG G AAG
hsa-miR-30a-5p-000417 (SEQ ID NO:584) MIMAT000008'
CUUUCAGUCGGAUGUUUACAGC
hsa-miR-30e-3p-000422 (SEQ ID NO:585) MIMAT000069:
AGGCAAGAUGCUGGCAUAGCU
hsa-miR-31#-002113 (SEQ ID NO:586) MIMAT000008'
UCAAGAGCAAUAACGAAAAAUGU
hsa-miR-335#-002185 (SEQ ID NO:587) MIMAT000281'
CAAUCACUAACUCCACUGCCAU (SEQ ID
hsa-miR-34b-002102 NO:588) MIMAT000467I
ACUGGACUUGGAGUCAGAAGG (SEQ ID
hsa-miR-378-002243 NO:589) MIMAT000073:
GAAUGUUGCUCGGUGAACCCCU (SEQ ID
hsa-miR-409-3p-002332 NO:590) MIMAT000163'
CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-424#-002309 (SEQ ID NO:591) MIMAT000134
AAUGACACGAUCACUCCCGUUGA
hsa-miR-425#-002302 (SEQ ID NO:592) MIMAT000339:
UCUUGGAGUAGGUCAUUGGGUGG (SEQ ID
hsa-miR-432-001026 NO:593) MIMAT000281<
AAAGUGCUUCUCUUUGGUGGGU (SEQ ID
hsa-miR-520D-3P-002743 NO:594) MIMAT000285I
AAACAUUCGCGGUGCACUUCUU (SEQ ID
hsa-miR-543-002376 NO:595) MIMAT000495- UCAGCAAACAUUUAUUGUGUGC
hsa-miR-545#-002266 (SEQ ID NO:596) MIMAT000316:
AAGCCUGCCCGGCUCCUCGGG (SEQ ID
hsa-miR-596-001550 NO:597) MIMAT000326-
AGGGGGAAAGUUCUAUAGUCC
hsa-miR-625#-002432 (SEQ ID NO:598) MIMAT000329-
AAAGACAUAGGAUAGAGUCACCUC (SEQ
hsa-miR-641-001585 ID NO:599) MIMAT000331
UAUUCAUUUAUCCCCAGCCUACA
hsa-miR-664-002897 (SEQ ID NO:600) MIMAT000594' hsa-miR-720-002895 UCUCGCUGGGGCCUCCA (SEQ ID NO:601) MIMAT000595-
ACUCCAGCCCCACAGCCUCAGC (SEQ ID
hsa-miR-766-001986 NO:601) MIMAT000388!
UCUGCUCAUACCCCAUGGUUUCU (SEQ ID
hsa-miR-767-3p-001995 NO:602) MIMAT000388:
UGAGACCUCUGGGUUCUGAGCU (SEQ ID
hsa-miR-769-5p-001998 NO:603) MIMAT000388I
UAUACCUCAGUUUUAUCAGGUG (SEQ ID
hsa-miR-875-5p-002203 NO:604) MIMAT000492:
CAAAGUGCUGUUCGUGCAGGUAG
hsa-miR-93#-002139 (SEQ ID NO:605) MIMAT000009:
CAACAAAUCACAGUCUGCCAUA
rno-miR-7#-001338 (SEQ ID NO:606) MIMAT000455:
CCTGGATGATGATAGCAAATGCTGACTGAA CATGAAGGTCTTAATTAGCTCTAACTGACT Mature miRNA
RNU44-001094 (SEQ ID NO:607) Control
GATGACCCCAGGTAACTCTGAGTGTGTCGC TGATGCCATCACCGCAGCGCTCTGACC Mature miRNA
RNU48-001006 (SEQ ID NO:608) Control
[0275] Table 10 depicts miRNAs in common between human and rat PCs grown under serum starvation conditions. As can be seen in Table 10, 22 miRNA sequences were found in
common between human and rat PCs grown under serum starvation conditions.
Table 10. miRNAs found in both serum starved rat and human PCs
Alternative
Exemplary Exemplary Alternative
Description
miRNA in Sequence(s) miRNA in Sequence(s) Description Rat PCs Human PCs
(5' to 3') (5' to 3')
UCCCUGAG UCCCUGAG ACCCUUUA ACCCUUUA
mmu-miR- ACCUGUGA ACCUGUGA
125a-5p- (SEQ ID MIMAT00001 hsa-miR-125a- (SEQ ID MIMAT00004
4395309 NO:324) 35 5p-4395309 NO:469) 43
ACGGGUUA UCCCUGAG GGCUCUUG ACCCUAAC
mmu-miR- GGAGCU UUGUGA
125b-3p- (SEQ ID MIMAT00046 hsa-miR-125b- (SEQ ID MIMAT00004
4395489 NO:325) 69 4373148 NO:470) 23
AGCUGGUG AGCUGGUG UUGUGAAU UUGUGAAU CAGGCCG CAGGCCG
mmu-miR- (SEQ ID MIMAT00001 hsa-miR-138- (SEQ ID MIMAT00004 138-4395395 NO:328) 50 4395395 NO:475) 30
UGAGAUGA UGAGAUGA AGCACUGU AGCACUGU
mmu-miR- AGCUC (SEQ MIMAT00002 hsa-miR-143- AGCUC (SEQ MIMAT00004 143-4395360 ID NO:341) 47 4395360 ID NO:479) 35
UUCACCAC UUCACCAC CUUCUCCA CUUCUCCA CCCAGC CCCAGC
mmu-miR- (SEQ ID hsa-miR-197- (SEQ ID MIMAT00002 197-4373102 NO:353) 4373102 NO:491) 27
ACAGUAGU ACAGUAGU CUGCACAU CUGCACAU
mmu-miR- UGGUUA UGGUUA
199a-3p- (SEQ ID MIMAT00002 hsa-miR-199a- (SEQ ID MIMAT00002
4395415 NO:354) 30 3p-4395415 NO:492) 32
CUGUGCGU CUGUGCGU GUGACAGC GUGACAGC GGCUGA GGCUGA
mmu-miR- (SEQ ID MIMAT00006 hsa-miR-210- (SEQ ID MIMAT00002 210-4373089 NO:357) 58 4373089 NO:497) 67
UAGCUUAU UAGCUUAU CAGACUGA CAGACUGA
mmu-miR-21- UGUUGA MIMAT00005 hsa-miR-21- UGUUGA MIMAT00000 4373090 (SEQ ID 30 4373090 (SEQ ID 76
Figure imgf000117_0001
CUUUCAGU CUUUCAGU
CGGAUGUU CGGAUGUU UGCAGC UGCAGC MIMAT00000 mmu-miR- (SEQ ID MIMAT00001 hsa-miR-30a- (SEQ ID 88
30a*-4373062 NO:428) 29 3p-000416 NO:583)
CUUUCAGU CUUUCAGU CGGAUGUU CGGAUGUU UACAGC UACAGC MIMAT00006 mmu-miR- (SEQ ID MIMAT00002 hsa-miR-30e- (SEQ ID 93
30e*-4373057 NO:431) 49 3p-000422 NO:585 )
ACUGGACU ACUGGACU UGGAGUCA UGGAGUCA GAAGG GAAGG
mmu-miR- (SEQ ID MIMAT00031 hsa-miR-378- (SEQ ID MIMAT00007 378-4395354 NO:435) 51 002243 NO:589) 32
AUCUCGCU UCUCGCUG GGGGCCUC GGGCCUCC
mmu-miR- CA (SEQ ID MIMAT00034 hsa-miR-720- A (SEQ ID MIMAT00059 720-4381052 NO:447) 84 002895 NO:601 ) 54
UAUACCUC UAUACCUC AGUUUUAU AGUUUUAU
mmu-miR- CAGGUG CAGGUG
875-5p- (SEQ ID MIMAT00049 hsa-miR-875- (SEQ ID MIMAT00049
4395314 NO:452) 37 5p-002203 NO:604) 22
EQUIVALENTS AND SCOPE
[0276] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments, described herein. The scope of the present invention is not intended to be limited to the above Description, but rather is as set forth in the appended claims.
[0277] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments in accordance with the invention described herein. The scope of the present invention is not intended to be limited to the above Description, but rather is as set forth in the appended claims.
[0278] In the claims articles such as "a," "an," and "the" may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include "or" between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process. Furthermore, it is to be understood that the invention encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, descriptive terms, etc., from one or more of the listed claims is introduced into another claim. For example, any claim that is dependent on another claim can be modified to include one or more limitations found in any other claim that is dependent on the same base claim. Furthermore, where the claims recite a composition, it is to be understood that methods of using the composition for any of the purposes disclosed herein are included, and methods of making the composition according to any of the methods of making disclosed herein or other methods known in the art are included, unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise.
[0279] Where elements are presented as lists, e.g., in Markush group format, it is to be understood that each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should it be understood that, in general, where the invention, or aspects of the invention, is/are referred to as comprising particular elements, features, etc., certain embodiments of the invention or aspects of the invention consist, or consist essentially of, such elements, features, etc. For purposes of simplicity those embodiments have not been specifically set forth in haec verba herein. It is also noted that the term "comprising" is intended to be open and permits the inclusion of additional elements or steps.
[0280] Where ranges are given, endpoints are included. Furthermore, it is to be understood that unless otherwise indicated or otherwise evident from the context and
understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise. [0281] In addition, it is to be understood that any particular embodiment of the present invention that falls within the prior art may be explicitly excluded from any one or more of the claims. Since such embodiments are deemed to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not set forth explicitly herein. Any particular embodiment of the compositions of the invention (e.g., any cell type; any neuronal cell system; any reporter of synaptic vesicle cycling; any electrical stimulation system; any imaging system; any synaptic vesicle cycling assay; any synaptic vesicle cycle modulator; any method of use; etc.) can be excluded from any one or more claims, for any reason, whether or not related to the existence of prior art.
INCORPORATION OF REFERENCES
[0282] All publications and patent documents cited in this application are incorporated by reference in their entirety to the same extent as though the contents of each individual publication or patent document were incorporated herein.
[0283] What is claimed is:

Claims

1. A method for treating acute tissue damage comprising a step of:
administering a population of cells to an individual suffering from a disease, disorder or condition characterized by acute damage to one or more tissues, wherein the cells are originated from an adult tissue and wherein the cells induce tissue repair, regeneration, remodeling, reconstitution or differentiation.
2. The method of claim 1, wherein the one or more tissues are selected from the group consisting of kidney, heart, liver, lungs, pancreas, brain, intestine, bones, tendons, cornea, skin, muscle, veins, spinal cord, spleen, blood, and combinations thereof.
3. The method of claim 1, wherein the one or more tissues are kidney and/or heart.
4. The method of any one of the preceding claims, wherein the acute damage is ischemic damage.
5. The method of any one of the preceding claims, wherein the acute damage is associated with tissue transplantation.
6. The method of any one of claims 1-4, wherein the acute damage is associated with radiation or chemical injury or therapy.
7. The method of any one of the preceding claims, wherein the disease, disorder or condition is selected from the group consisting of myocardial infarct, acute renal failure, type I diabetes, and combinations thereof.
8. The method of any one of the preceding claims, wherein the cells are originated from an adult tissue that is distinct from the damaged tissue.
9. The method of any one of the preceding claims, wherein the cells are originated from an adult tissue that is from a different species.
10. The method of any one of the preceding claims, wherein the adult tissue is a human adult tissue.
11. The method of any one of claims 1-9, wherein the adult tissue is a non-human adult tissue.
12. The method of any one of the preceding claims, wherein the adult tissue is selected from the group consisting of pancreas, kidney, breast, lymph node, liver, spleen, myometrium, peripheral blood, chord blood, and bone marrow, and combination thereof.
13. The method of any one of the preceding claims, wherein the cells are first cultivated in a cell culture medium under conditions and time sufficient for cell proliferation.
14. The method of claim 13, wherein the cell culture medium is a Matrigel free culture medium comprising serum.
15. The method of claim 13 or 14, wherein the cells are firs treated to reduce a telomeric attrition rate before the cultivating step.
16. The method of any one of the preceding claims, wherein the population of cells are substantially homogenous.
17. The method of any one of the preceding claims, wherein at least 50% of the population of cells express one or more markers selected from the group consisting of CD24, c-myc, HLA class 1 ABC, ICAM3, Nestin, Nanog, Oct4, Integrin a2 + bl, Ngn3, and CD130.
18. The method of any one of the preceding claims, wherein at least 80% of the population of cells express one or more markers selected from the group consisting of CD24, c-myc, HLA class 1 ABC, ICAM3, Nestin, Nanog, Oct4, Integrin a2 + bl, Ngn3, and CD130.
19. The method of any one of the preceding claims, wherein at least 90% of the population of cells express at least one or more markers selected from the group consisting of CD24, c-myc, HLA class 1 ABC, ICAM3, Nestin, Nanog, Oct4, Integrin a2 + bl, Ngn3, and CD130.
20. The method of any one of claims 17-19, wherein the one or more markers comprise Oct4, Nanog, and c-myc.
21. The method of any one of the preceding claims, wherein at least 50% of the population of cells express Nestin.
22. The method of any one of the preceding claims, wherein the cells do not express at least one marker selected from the group consisting of CD34, CD 105, VCAM1, CXCR2, CD44, CD73, ICAM1, and NCAM.
23. The method of any one of the preceding claims, wherein the cells express one or more microRNAs as shown in Table 1.
24. The method of any one of the preceding claims, wherin the cells express one or more microRNAs as shown in Tables 6-10.
25. The method of any one of the preceding claims, wherin the cells express one or more microRNAs as shown in Table 10.
26. The method of any one of the preceding claims, wherein the population of cells constitutes therapeutically effective amount of cells.
27. The method of claim 26, wherein the therapeutically effective amount ranges from approximately 1 x 106 to 3 x 108 cells per kg body weight per dose.
28. The method of any one of the preceding claims, wherein the cells are administered intravenously, intra-arterially, intramuscularly, subcutaneously, cutaenously, intradermally, intracranially, intrathecally, intrapleurally, intra-orbitally, intranasally, orally, intra alimentrally, colorectally, and/or intra-cerebrospinally.
29. The method of any one of the preceding claims, wherein the cells are administered daily.
30. The method of any one of the preceding claims, wherein the cells are administered weekly.
31. The method of any one of the preceding claims, wherein the cells are administered biweekly.
32. The method of any one of the preceding claims, wherein the cells are administered monthly.
33. The method of any one of the preceding claims, wherein the cells are not administered in conjunction with an immunosuppressant.
34. A method for treating tissue damage comprising a step of:
administering to an individual suffering from a disease, disorder or condition
characterized by tissue damage a therapeutically effective amount of one or more microRNAs having a sequence at least 80% identical to any of SEQ ID NOs: 1 to 610.
35. The method of claim 34, wherein the one or more microRNAs comprise a sequence identical to any of SEQ ID NOs: 1 to 610.
36. The method of claim 34 or 35, wherein the tissue damage is acute tissue damage.
37. A method of organ transplantation comprising a step of administering to an organ transplant recipient a therapeutically effective amount of cells, wherein the cells are originated from an adult tissue and wherein the cells induce tissue repair, regeneration, remodeling, reconstitution or differentiation.
38. A pharmaceutical composition for tissue repair or regeneration comprising a substantially homogeneous population of cells and a pharmaceutically acceptable carrier, wherein the cells are originated from an adult tissue and wherein the cells induce tissue repair, regeneration, remodeling, reconstitution or differentiation.
39. The pharmaceutical composition of claim 38, wherein at least 50% of the population of cells express one or more markers selected from the group consisting of CD24, c-myc, HLA class 1 ABC, ICAM3, Nestin, Nanog, Oct4, Integrin a2 + bl, Ngn3, and CD130.
40. The pharmaceutical composition of claim 38, wherein at least 80% of the population of cells express one or more markers selected from the group consisting of CD24, c-myc, HLA class 1 ABC, ICAM3, Nestin, Nanog, Oct4, Integrin a2 + bl, Ngn3, and CD 130.
41. The pharmaceutical composition of claim 38, wherein at least 90% of the population of cells express at least one or more markers selected from the group consisting of CD24, c-myc, HLA class 1 ABC, ICAM3, Nestin, Nanog, Oct4, Integrin a2 + bl, Ngn3, and CD130.
42. The pharmaceutical composition of any one of claims 38-41, wherein the one or more markers comprise Oct4, Nanog, and c-myc.
43. The pharmaceutical composition of any one of claims 38-42, wherein the cells do not express at least one marker selected from the group consisting of CD34, CD 105, VCAM1, CXCR2, CD44, CD73, ICAM1, and NCAM.
44. The pharmaceutical composition of any one of claims 38-43, wherein the cells express one or more microRNAs as shown in Table 1.
45. The pharmaceutical composition of any one of claims 38-43, wherein the cells express one or more microRNAs as shown in Tables 6-10.
46. The pharmaceutical composition of any one of claims 38-43, wherein the cells express one or more microRNAs as shown in Table 10.
47. The pharmaceutical composition of any one of claims 38-46, wherein the cells are originated from a human adult tissue.
48. The pharmaceutical composition of any one of claims 38-46, wherein the cells are originated from a non-human adult tissue.
49. The pharmaceutical composition of any one of claims 38-46, wherein the adult tissue is selected from the group consisting of pancreas, kidney, breast, lymph node, liver, spleen, myometrium, peripheral blood, chord blood, and bone marrow, and combination thereof.
50. A pharmaceutical composition for tissue repair or regeneration comprising a therapeutically effective amount of one or more microR As having a sequence at least 80% identical to any of SEQ ID NOs: 1 to 610 and a pharmaceutically acceptable carrier.
51. The pharmaceutical composition of claim 50, wherein the one or more microRNAs have a sequence identical to any of SEQ ID NOs: 1 to 610.
52. A method for treating inflammation comprising a step of: administering a population of cells, or extracellular secretomes thereof, to an individual suffering from a disease, disorder or condition characterized by inflammation of one or more tissues, wherein the cells are originated from an adult tissue and wherein the cells induce an anti-inflammatory response.
53. The method of claim 52, wherein the extracellular secretoms comprise micro vesicles.
54. The method of claim 52, wherein the cells induce increased IL-2 response.
55. The method of claim 52 or 53, wherein the cells induce expansion of regulatory T cells, suppression of T cell responses and/or immune tolerance.
56. The method of claim 54, wherein the expansion of regulatory T cells comprises increased level and/or activity of T regulatory cells.
57. The method of claim 54 or claim 55, wherein the cells induce decreased level and/or activity of cytotoxic T cells and/or helper T cells.
58. The method of any one claims 52-57, wherein the cells suppress pro-inflammatory and/or anti-angiogenic cytokine or chemokine response.
59. The method of claim 58, wherein the pro-inflammatory and/or anti-angiogenic cytokine or chemokine is selected from the group consisting of IL-4, IL-5, IL-6, IL-10, IL-12, IL-13, IL- 17, GMCSF, , TGF-β, TNF-a, IFN-γ, MCAF, MIP1, and combinations thereof.
60. The method of any one of claims 52-59, wherein the cells do not increase the expression or activity of IL-4, IL-6 and/or IL-10.
61. The method of any one of one claims 52-60, wherein the cells increase anti-inflammatory and/or pro-angiogenic cytokine or chemokine response.
62. The method of claim 61 , wherein the anti-inflammatory and/or pro-angiogenic cytokine or chemokine is selected from IL-Ιβ, GSCF, IL-8 and combinations thereof.
63. The method of any one claims 52-62, wherein the inflammation is associated with a disease, disorder, or condition selected from acute inflammatory conditions; adult respiratory distress syndrome (ARDS); Airway hyperresponsiveness (AHR); allergy disorders; alopecia areata; ankylosing spondylitis; asthma; atopic inflammatory disorders; autoimmune thyroiditis; bronchial hyperreactivity; cancers; cardiovascular disorders; Chronic Obstructive Pulmonary disease (COPD); cirrhosis; Crohn's disease, Congestive Heart Failure (CHF); colitis; dermatitis; diabetes mellitus (type I); disorders associated with wound healing; end-stage renal disease (ESRD); eosinophilic esophagitis; HIV; Graves' disease; infectious diseases; inflammatory bowel disease (IBD); inflammatory complications of diabetes mellitus; inflammatory conditions of the skin, cardiovascular system, nervous system, liver, kidney and pancreas; juvenile rheumatoid arthritis; lupus-associated arthritis; metabolic syndrome; multiple sclerosis; muscle fatigue; myasthenia gravis; neurodegenerative diseases; osteoarthritis; primary billiary cirrhosis; psoriatic arthritis; respiratory disorders; rheumatoid arthritis; sarcoidosis; scleroderma; Sjogren's syndrome; Systemic Inflammatory Response Syndrome (SIRS)/sepsis; systemic lupus erythematosis; transplant rejection; ulcerative colitis; and/or vasculitis.
64. The method of any one of claims 52-62, wherein the inflammation is associated with Graft- versus-host disease (GVHD).
65. The method of any one of claims 52-62, wherein the inflammation is associated with autoimmune disease.
66. The method of any one of claims 52-62, wherein the inflammation is associated with chronic renal disease.
67. The method of any one of claims 52-62, wherein the inflammation is associated with osteoarthritis.
68. The method of any one of claims 52-67, wherein the individual is a mammal.
69. The method of claim 68, wherein the mammal is a human.
70. The method of any one of claims 52-69, wherein the adult tissue is from a human.
71. The method of any one of claims 52-69, wherein the adult tissue is from a non-human mammal.
72. The method of claim 71, wherein the non-human mammal is selected from a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, and/or a pig.
73. The method of any one of claims 52-72, wherein the adult tissue is selected from the group consisting of bone marrow, liver, blood, heart, brain, gum, eye, skin, breast, chord blood, kidney, lymph node, myometrium, pancreas, peripheral blood, spleen, and combinations thereof.
PCT/IB2011/002048 2010-08-13 2011-08-12 Cellular and molecular therapies Ceased WO2012020308A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US13/766,637 US20140234263A1 (en) 2010-08-13 2013-02-13 Cellular and molecular therapies

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US37371510P 2010-08-13 2010-08-13
US61/373,715 2010-08-13
US38076610P 2010-09-08 2010-09-08
US61/380,766 2010-09-08

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13/766,637 Continuation US20140234263A1 (en) 2010-08-13 2013-02-13 Cellular and molecular therapies

Publications (2)

Publication Number Publication Date
WO2012020308A2 true WO2012020308A2 (en) 2012-02-16
WO2012020308A3 WO2012020308A3 (en) 2013-04-11

Family

ID=45567981

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/IB2011/002048 Ceased WO2012020308A2 (en) 2010-08-13 2011-08-12 Cellular and molecular therapies
PCT/IB2011/002028 Ceased WO2012020307A2 (en) 2010-08-13 2011-08-12 Therapeutic uses of microvesicles and related micrornas

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/IB2011/002028 Ceased WO2012020307A2 (en) 2010-08-13 2011-08-12 Therapeutic uses of microvesicles and related micrornas

Country Status (7)

Country Link
US (5) US20140234263A1 (en)
EP (1) EP2603592A2 (en)
JP (3) JP2013537538A (en)
CN (1) CN103210089A (en)
AU (1) AU2011288262A1 (en)
CA (1) CA2845280A1 (en)
WO (2) WO2012020308A2 (en)

Cited By (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013093870A1 (en) 2011-12-23 2013-06-27 International Centre For Genetic Engineering And Biotechnology - Icgeb microRNAs FOR CARDIAC REGENERATION THROUGH INDUCTION OF CARDIAC MYOCYTE PROLIFERATION
EP2687219A1 (en) 2012-07-18 2014-01-22 Universität Duisburg-Essen Use of preparations comprising exosomes derived from mesenchymal stem cells (MSCs) in the prevention and therapy of inflammatory conditions
WO2014091373A1 (en) * 2012-12-11 2014-06-19 The University Court Of The University Of Glasgow Cellular and molecular therapies for peripheral vascular disease
WO2014131877A1 (en) * 2013-03-01 2014-09-04 Apceth Gmbh & Co. Kg Protection of the vascular endothelium from immunologically mediated cytotoxic reactions with human cd34-negative progenitor cells
WO2015026827A3 (en) * 2013-08-19 2015-04-16 University Of Notre Dame Method and composition for detection of oncogenic hpv
WO2015080758A1 (en) * 2013-11-27 2015-06-04 Al-Qahtani Ahmed H Method and composition for the treatment of moderate to severe keratoconjunctivitis sicca
US9249392B2 (en) 2010-04-30 2016-02-02 Cedars-Sinai Medical Center Methods and compositions for maintaining genomic stability in cultured stem cells
US9334498B2 (en) 2012-05-10 2016-05-10 Uab Research Foundation Methods and compositions for modulating MIR-204 activity
WO2016115516A1 (en) * 2015-01-16 2016-07-21 University Of Iowa Research Foundation Methods to prevent or treat periodontitis or peri-implantitis
US9828603B2 (en) 2012-08-13 2017-11-28 Cedars Sinai Medical Center Exosomes and micro-ribonucleic acids for tissue regeneration
US9845457B2 (en) 2010-04-30 2017-12-19 Cedars-Sinai Medical Center Maintenance of genomic stability in cultured stem cells
US9879260B2 (en) 2013-08-20 2018-01-30 The Board Of Regents Of The University Of Texas System Micro-RNA regulation of bone loss
US9884076B2 (en) 2012-06-05 2018-02-06 Capricor, Inc. Optimized methods for generation of cardiac stem cells from cardiac tissue and their use in cardiac therapy
CN107760717A (en) * 2017-11-08 2018-03-06 吉林省农业科学院 Sheep TNPO1 gene dual luciferase reporter gene carrier and its construction method and application
WO2018219998A1 (en) * 2017-05-30 2018-12-06 Siemens Aktiengesellschaft Mirnas as biomarkers for a systemic inflammatory response syndrome
US10240127B2 (en) 2014-07-03 2019-03-26 ReCyte Therapeutics, Inc. Exosomes from clonal progenitor cells
US10247720B2 (en) 2014-05-22 2019-04-02 University Of Notre Dame Du Lac Integrated membrane sensor for rapid molecular detection
EP2859103B1 (en) * 2012-06-06 2019-04-17 Boehringer Ingelheim International GmbH CELL ENGINEERING USING RNAs
US10961531B2 (en) 2013-06-05 2021-03-30 Agex Therapeutics, Inc. Compositions and methods for induced tissue regeneration in mammalian species
US11078462B2 (en) 2014-02-18 2021-08-03 ReCyte Therapeutics, Inc. Perivascular stromal cells from primate pluripotent stem cells
US11253551B2 (en) 2016-01-11 2022-02-22 Cedars-Sinai Medical Center Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of heart failure with preserved ejection fraction
US11351200B2 (en) 2016-06-03 2022-06-07 Cedars-Sinai Medical Center CDC-derived exosomes for treatment of ventricular tachyarrythmias
US11357799B2 (en) 2014-10-03 2022-06-14 Cedars-Sinai Medical Center Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of muscular dystrophy
US11541078B2 (en) 2016-09-20 2023-01-03 Cedars-Sinai Medical Center Cardiosphere-derived cells and their extracellular vesicles to retard or reverse aging and age-related disorders
US11660355B2 (en) 2017-12-20 2023-05-30 Cedars-Sinai Medical Center Engineered extracellular vesicles for enhanced tissue delivery
US11660317B2 (en) 2004-11-08 2023-05-30 The Johns Hopkins University Compositions comprising cardiosphere-derived cells for use in cell therapy
US11759482B2 (en) 2017-04-19 2023-09-19 Cedars-Sinai Medical Center Methods and compositions for treating skeletal muscular dystrophy
US11904006B2 (en) 2019-12-11 2024-02-20 University Of Iowa Research Foundation Poly(diaminosulfide) particle-based vaccine
WO2024040126A3 (en) * 2022-08-16 2024-04-18 The Regents Of The University Of California Improved glycemic control by administration of micro-rna 192
WO2024165603A1 (en) 2023-02-07 2024-08-15 Universitetet I Tromsø - Norges Arktiske Universitet Pharmaceutical composition for use in treatment of venous thromboembolism
US12146137B2 (en) 2018-02-05 2024-11-19 Cedars-Sinai Medical Center Methods for therapeutic use of exosomes and Y-RNAS
US12404493B2 (en) 2015-12-07 2025-09-02 Agex Therapeutics, Inc. Methods for the re-derivation of diverse pluripotent stem cell-derived brown fat cells
WO2026058945A1 (en) * 2024-09-13 2026-03-19 ロート製薬株式会社 Anti-aging composition, anti-inflammatory composition, and method for screening aging amelioration substances

Families Citing this family (84)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ITRM20030376A1 (en) 2003-07-31 2005-02-01 Univ Roma PROCEDURE FOR THE ISOLATION AND EXPANSION OF CARDIOC STAMIN CELLS FROM BIOPSIA.
KR20140004646A (en) 2010-12-15 2014-01-13 미라젠 세러퓨틱스 Microrna inhibitors comprising locked nucleotides
US9119974B2 (en) * 2011-03-04 2015-09-01 Ahmed H. Al-Qahtani Skin cream
US9901600B2 (en) 2011-03-11 2018-02-27 Children's Medical Center Corporation Methods and compositions relating to mesenchymal stem cell exosomes
KR20140091688A (en) 2011-10-06 2014-07-22 미라젠 세러퓨틱스 인코포레이티드 Control of Whole Body Energy Homeostasis by Microrna Regulation
EP2584040A1 (en) * 2011-10-17 2013-04-24 Pharmahungary 2000 Kft. Compounds for treatment of ischemic injury
US11286463B2 (en) 2012-03-08 2022-03-29 Advanced ReGen Medical Technologies, LLC Reprogramming of aged adult stem cells
WO2013138427A1 (en) * 2012-03-16 2013-09-19 The General Hospital Corporation Microvesicle-mediated delivery of therapeutic molecules
EP2838995A4 (en) * 2012-04-16 2016-01-06 Univ California OCULAR THERAPY USING MICROVESICLES OF EMBRYONIC STEM CELLS
WO2013169202A1 (en) * 2012-05-10 2013-11-14 Biomatcell Ab Osteogenic differentiation of mesenchymal stem cells
CN107236735B (en) 2012-06-21 2019-11-08 米拉根医疗股份有限公司 Oligonucleotide-based inhibitors comprising locked nucleic acid motifs
WO2014004424A1 (en) * 2012-06-26 2014-01-03 Temple University - Of The Commonwealth System Of Higher Education Method for detecting injury to the brian
CA2879337C (en) * 2012-07-19 2021-11-30 Atlantic Cancer Research Institute Method for the isolation of microvesicles
WO2014049125A1 (en) * 2012-09-28 2014-04-03 Fundación Centro Nacional De Investigaciones Cardiovasculares Carlos Iii (Cnic) Nucleotide sequence motifs directing nucleic acid location to extracellular vesicles
US10357517B1 (en) * 2012-10-01 2019-07-23 University Of South Florida Methods of treating epilepsy using neural stem cells that express nanog, SSEA-4, OCT-4, MIR-34B, MIR-34C and MIR-592
WO2014159662A1 (en) 2013-03-13 2014-10-02 University Of Miami Method for isolation and purification of microvesicles from cell culture supernatants and biological fluids
US12558316B2 (en) 2013-03-13 2026-02-24 University Of Miami Methods and compositions for the treatment of epidermolysis bullosa
KR20160018482A (en) 2013-04-09 2016-02-17 어드밴스드 리젠 메디컬 테크놀로지스, 엘엘씨 Compositions for cellular restoration and methods of making and using same
CN104117071B (en) * 2013-04-27 2017-06-13 中国科学院上海药物研究所 The 3p of microRNA 491 are in antagonism p glycoprotein(MDR1)Application in the tumor drug resistance of mediation
GB201317887D0 (en) 2013-10-09 2013-11-20 Reneuron Ltd Product
GB201317889D0 (en) * 2013-10-09 2013-11-20 Reneuron Ltd Product and use
US10772911B2 (en) 2013-12-20 2020-09-15 Advanced ReGen Medical Technologies, LLC Cell free compositions for cellular restoration and methods of making and using same
US20150174166A1 (en) 2013-12-20 2015-06-25 Advanced ReGen Medical Technologies, LLC Compositions for Cellular Restoration and Methods of Making and Using Same
US10568945B2 (en) 2014-04-25 2020-02-25 University Of Cincinnati Compositions and methods for inducing liver regeneration by administering hepatocyte-derived exosomes
DK3145493T3 (en) 2014-05-18 2022-10-31 Childrens Medical Center METHODS AND COMPOSITIONS RELATING TO EXOSOMES
KR101670469B1 (en) * 2014-10-23 2016-10-28 고려대학교 산학협력단 Composition comprising microRNA for preventing or treating PCV2 infection
CN105663153B (en) * 2014-11-21 2018-02-16 中国农业大学 Applications of the microRNA 22 in hair development and androgen induction alopecia
EP3029466A1 (en) * 2014-12-03 2016-06-08 Fundació Hospital Universitari Vall d' Hebron - Institut de Recerca Methods for differentiating ischemic stroke from hemorrhagic stroke
EP3247716A4 (en) 2015-01-20 2018-10-17 Miragen Therapeutics, Inc. Mir-92 inhibitors and uses thereof
US11160834B2 (en) * 2015-04-28 2021-11-02 The Texas A&M University System Scalable production of standardized extracellular vesicles, extracellular vesicle preparations and uses thereof
EP3307890A1 (en) 2015-06-10 2018-04-18 Board of Regents, The University of Texas System Use of exosomes for the treatment of disease
CN105063052B (en) * 2015-08-31 2018-06-29 北京泱深生物信息技术有限公司 Acute myeloid leukemia miRNA markers
US10881683B2 (en) 2015-09-16 2021-01-05 Tohoku University Nucleic acid molecule
JP7075594B2 (en) 2015-11-18 2022-05-26 ユニバーシティ オブ ジョージア リサーチ ファウンデーション, インコーポレーテッド Extracellular vesicles of nerve cells
WO2017087726A1 (en) * 2015-11-18 2017-05-26 Dignity Health Methods of diagnosing epilepsy
US11753682B2 (en) 2016-03-07 2023-09-12 Father Flanagan's Boys'Home Noninvasive molecular controls
US11203754B2 (en) 2016-04-29 2021-12-21 Advanced ReGen Medical Technologies, LLC Microrna compositions and methods of making and using same
EP3452100B1 (en) 2016-05-06 2020-12-16 Unicyte EV AG Pharmaceutical carriers containing mirnas for use in the treatment of fibrotic diseases caused by hyperglycemia
EP3254684B1 (en) 2016-06-08 2019-10-23 Lysatpharma GmbH Human platelet lysate or fraction enriched in human platelet-derived extracellular vesicles, for use in medicine
US10946047B2 (en) * 2016-06-17 2021-03-16 United Therapeutics Corporation Extracellular vesicles with enhanced potency
CN106048037A (en) * 2016-07-06 2016-10-26 上海市内分泌代谢病研究所 A detection method for human circulating miR‑122
IL264825B (en) * 2016-08-14 2022-08-01 Univ Ramot Exosomes from mesenchymal cells for the treatment of neurological diseases
WO2018170332A1 (en) 2017-03-15 2018-09-20 Nutech Ventures Extracellular vesicles and methods of using
WO2018178608A1 (en) * 2017-03-31 2018-10-04 Catrina Sergiu Bogdan Methods of treatment of diabetic ulcers with microrna
CN110520140A (en) * 2017-04-19 2019-11-29 菲格内有限责任公司 Fibroblast-derived exosomes stimulate angiogenesis
US20200085875A1 (en) * 2017-04-20 2020-03-19 North Carolina State University Platelet vesicle-engineered cells for targeted tissue repair
CN107320484B (en) * 2017-06-08 2022-05-17 中国人民解放军第四军医大学第一附属医院 Use of mir-452-3p in the preparation of a pharmaceutical composition for treating liver cancer
FI3684381T3 (en) * 2017-09-21 2023-01-13 Production of extracellular vesicles in single-cell suspension using chemically-defined cell culture media
CN109893655B (en) * 2017-12-11 2021-07-20 义慧科技(深圳)有限公司 Application of miR-327 inhibitor and/or FGF10 promoter in medicine for preventing and/or treating diabetes
CN109893656B (en) * 2017-12-11 2021-07-20 义慧科技(深圳)有限公司 Application of miR-327 inhibitor and/or FGF10 promoter in preparation of medicines for preventing and/or treating lipodystrophy
US12017066B2 (en) 2018-01-05 2024-06-25 Mayo Foundation For Medical Education And Research Modulation of extracellular vesicles with electrical stimulation
EP3740576A4 (en) 2018-01-18 2021-10-20 Advanced Regen Medical Technologies, LLC Therapeutic compositions and methods of making and using the same
US12257266B2 (en) * 2018-03-02 2025-03-25 The Regents Of The University Of California Stem cell-derived exosomes for the treatment of corneal scarring
WO2019182372A1 (en) * 2018-03-21 2019-09-26 ㈜로제타엑소좀 Bacterial extracellular vesicles having reduced toxicity and use thereof
EP3773520A4 (en) 2018-04-09 2021-12-22 Orgenesis Inc. Bioxomes particles, redoxomes, method and composition
JP7538044B2 (en) 2018-04-30 2024-08-21 ザ チルドレンズ メディカル センター コーポレーション Mesenchymal stromal cell exosomes and their uses
PL425406A1 (en) * 2018-04-30 2019-11-04 Inst Medycyny Doswiadczalnej I Klinicznej Im Miroslawa Mossakowskiego Polskiej Akademii Nauk The use of microbubbles derived from stem cells in the treatment of inflammation in the brain, especially after stroke
WO2019236873A1 (en) * 2018-06-06 2019-12-12 Board Of Regents Of The University Of Nebraska Extracellular vesicles and methods of using
WO2020023767A1 (en) * 2018-07-26 2020-01-30 Joslin Diabetes Center Targeting micro-rnas for exosomal delivery or cellular retention
CN113195740A (en) * 2018-10-17 2021-07-30 奥克斯纳健康系统公司 Plasma and cerebrospinal fluid miRNA biomarkers in intracerebral and subarachnoid hemorrhage
WO2020079253A1 (en) * 2018-10-18 2020-04-23 Institut National De La Sante Et De La Recherche Medicale (Inserm) Myelinosome as a vector for intracellular delivery of molecules of interest
WO2020102605A1 (en) * 2018-11-15 2020-05-22 The Regents Of The University Of California Vesicle-coated fibers and methods of making and using
KR102178922B1 (en) * 2018-11-26 2020-11-13 순천향대학교 산학협력단 Biomarker microRNA let-7 or microRNA-150 for diagnosing diabetic nephropathy and use thereof
CN113227375A (en) * 2018-12-20 2021-08-06 原住民股份有限公司 Synthetic microRNA mimetics
US20220251552A1 (en) * 2019-03-25 2022-08-11 The Trustees Of The University Of Pennsylvania Regenerative Therapy Based on miRNA-302 Mimics for Enhancing Host Recovery from Pneumonia Caused by Streptococcus pneumoniae
US12097222B2 (en) 2019-06-06 2024-09-24 Spiritus Therapeutics, Inc. Methods for attenuating viral infection and for treating lung injury
US11607428B2 (en) 2019-06-06 2023-03-21 Spiritus Therapeutics, Inc. Mesenchymal stem cell-derived extracellular vesicles and uses thereof for treating and diagnosing fibrotic diseases
WO2020247675A1 (en) * 2019-06-06 2020-12-10 Spiritus Therapeutics, Inc. Methods for attenuating viral infection and for treating lung injury
AU2020295303A1 (en) * 2019-06-20 2022-02-17 Cellapeutics Bio Method for producing exosomes by electrical stimulation
CN110623975B (en) * 2019-10-09 2022-07-05 新乡医学院 microRNA328 for regulating TERT gene expression and application thereof
US20230070923A1 (en) * 2020-02-05 2023-03-09 Logan D. Gulla Aesthetic-Enhancing Formulations And Methods Thereof
CN111840513A (en) * 2020-06-12 2020-10-30 广东工业大学 A composite exosome loaded with pro-tumor apoptosis protein and anti-cancer small molecule and its preparation method and application
WO2022020534A1 (en) * 2020-07-23 2022-01-27 The Regents Of The University Of California Compositions comprising mir-690 and methods therefor
KR102480430B1 (en) * 2020-10-21 2022-12-21 순천향대학교 산학협력단 MicroRNA-31-5p for diagnosing rosacea and use thereof
CN113265459B (en) * 2021-05-28 2022-05-17 沈阳体育学院 Application of miRNA-601 as a molecular marker in the diagnosis and treatment of osteoarthritis
CN113384595B (en) * 2021-07-13 2022-08-02 浙江中医药大学 Application of a miR-674-3p in the preparation of drugs for preventing or treating stress-induced hypertension
CN114748497B (en) * 2022-04-27 2024-10-18 广州市妇女儿童医疗中心 A miRNA molecule miR-206 for regulating uterine muscle contraction and its application
CN115192710A (en) * 2022-05-27 2022-10-18 华南理工大学 Application of miRNA-200s protective agent in preparation of nervous system disease drugs, drugs and model construction method
WO2024086342A1 (en) * 2022-10-20 2024-04-25 FUJIFILM Cellular Dynamics, Inc. Generation of secretome-containing compositions, and methods of using and analyzing the same
CN116159071B (en) * 2023-04-26 2023-06-27 中山大学中山眼科中心 Application of miR-543 in preparation of medicine for treating nerve injury
CN116763809B (en) * 2023-05-31 2024-01-26 广东医科大学附属医院 Application of miR-376b-3p inhibitor in preparation of epilepsy treatment drugs
CN116617244B (en) * 2023-06-05 2026-03-24 湖南光琇高新生命科技有限公司 Application of nucleic acid molecules in the preparation of drugs for treating liver diseases
CN116850201A (en) * 2023-06-29 2023-10-10 南昌市高新区人民医院(南昌大学第一附属医院高新医院) Application of miR-221-3p
CN117815257B (en) * 2024-01-08 2024-08-02 南方医科大学深圳医院 Application of miR-760-3p in the preparation of drugs for the prevention and treatment of type 2 diabetes

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006120476A1 (en) 2005-05-13 2006-11-16 The University Court Of The University Of Glasgow Materials and methods relating to cell based therapies
US7597950B1 (en) 2005-02-28 2009-10-06 Massachusetts Institute Of Technology Nanoparticles having sub-nanometer features
WO2009136168A1 (en) 2008-05-09 2009-11-12 The University Court Of The University Of Glasgow Materials and methods relating to cell based therapies
US20100151575A1 (en) 2008-12-15 2010-06-17 Colter David C Method of Making Conditioned Media from Kidney Derived Cells

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008501336A (en) * 2004-06-02 2008-01-24 ソースフアーム・インコーポレイテツド Microvesicles containing RNA and methods therefor
US9085778B2 (en) * 2006-05-03 2015-07-21 VL27, Inc. Exosome transfer of nucleic acids to cells
US20090131348A1 (en) * 2006-09-19 2009-05-21 Emmanuel Labourier Micrornas differentially expressed in pancreatic diseases and uses thereof
US20100233216A1 (en) * 2007-10-15 2010-09-16 Vincenzo Cantaluppi Use of microvesicles (mvs) for preparing a medicament having adjuvant activity on endothelial cell transplantation, particularly in the treatment of diabetes by pancreatic islet transplantation, and related method
CN101854941B (en) * 2007-10-29 2013-03-27 弗雷森纽斯医疗护理德国有限责任公司 Use of microvesicles (MVs) derived from stem cells for the preparation of a medicament for endothelial/epithelial regeneration of damaged or damaged tissues or organs, and related in vitro and in vivo methods
KR101810799B1 (en) * 2008-02-01 2017-12-19 더 제너럴 하스피탈 코포레이션 Use of microvesicles in diagnosis, prognosis and treatment of medical diseases and conditions
WO2009147519A1 (en) * 2008-06-06 2009-12-10 Centre National De La Recherche Scientifique - Cnrs- Use of endo-lysosomal system and secreted vesicles (exosome-like) in treatments and diagnostics based on small rna and experimental study of small rna
WO2010056737A2 (en) * 2008-11-11 2010-05-20 Mirna Therapeutics, Inc. Methods and compositions involving mirnas in cancer stem cells

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7597950B1 (en) 2005-02-28 2009-10-06 Massachusetts Institute Of Technology Nanoparticles having sub-nanometer features
WO2006120476A1 (en) 2005-05-13 2006-11-16 The University Court Of The University Of Glasgow Materials and methods relating to cell based therapies
WO2009136168A1 (en) 2008-05-09 2009-11-12 The University Court Of The University Of Glasgow Materials and methods relating to cell based therapies
US20100151575A1 (en) 2008-12-15 2010-06-17 Colter David C Method of Making Conditioned Media from Kidney Derived Cells

Non-Patent Citations (30)

* Cited by examiner, † Cited by third party
Title
ALTSCHUL ET AL., METHODS IN ENZYMOLOGY, vol. 266, 1996, pages 460 - 480
BENIAMINOVITZ ET AL., N. ENGL J. MED., vol. 342, 2000, pages 613 - 619
BERARD ET AL., PHARMACOTHERAPY, vol. 19, 1999, pages 1127 - 1137
BRANCO ET AL., TRANSPLANTATION, vol. 68, 1999, pages 1588 - 1596
CHIRMULE ET AL., J. VIROL., vol. 74, 2000, pages 3345 - 3352
DEWAN ET AL.: "Rapid Tumor Formation of Human T-Cell Leukemia Virus Type 1-Infected Cell Lines in Novel NOD-SCID/ycnull Mice: Suppression by an Inhibitor against NF- KB", JOURNAL OF VIROLOGY, vol. 77, no. 9, 2003, pages 5286 - 5294, XP002309127, DOI: doi:10.1128/JVI.77.9.5286-5294.2003
ECKHOFF ET AL., TRANSPLANTATION, vol. 69, 2000, pages 1867 - 1872
EKBERG ET AL., TRANSPL. INT., vol. 13, 2000, pages 151 - 159
FISHWILD ET AL., CLIN. IMMUNOL., vol. 92, 1999, pages 138 - 152
GAZIEV ET AL., BONE MARROW TRANSPLANT., vol. 25, 1999, pages 689 - 696
GUMMERT ET AL., J. AM. SOC. NEPHROL., vol. 10, 1999, pages 1366 - 1380
HENRY, CLIN. TRANSPLANT., vol. 13, 1999, pages 209 - 220
HOCHEGGER ET AL.: "p21 and mTERT are novel markers for determining different ischemic time periods in renal ischemia-reperfusion injury", AM. J. PHYSIOL. RENAL PHYSIOL., vol. 292, 2007, pages 762 - 768
HONG ET AL., SEMIN. NEPHROL., vol. 20, 2000, pages 108 - 125
IDEGUCHI ET AL., NEUROSCIENCE, vol. 95, 2000, pages 217 - 226
ITO ET AL., J. IMMUNOL., vol. 164, 2000, pages 1230 - 1235
KURLBERG ET AL., SCAND. J. IMMUNOL., vol. 51, 2000, pages 224 - 230
MARINOVA-MUTAFCHIEVA ET AL., ARTHRITIS RHEUM., vol. 43, 2000, pages 638 - 644
METZLER ET AL.: "Plasma cardiac troponin T closely correlates with infarct size in a mouse model of acute myocardial infarction", CLINICA CHIMICA ACTA, vol. 325, 2002, pages 87 - 90
MODER, ANN. ALLERGY ASTHMA IMMUNOL., vol. 84, 2000, pages 280 - 284
NEVINS, CURR. OPIN. PEDIATR., vol. 12, 2000, pages 146 - 150
PONTICELLI ET AL., DRUGS R. D., vol. 1, 1999, pages 55 - 60
POTTERET, ANN. N.Y. ACAD. SCI., vol. 875, 1999, pages 159 - 174
PRZEPIORKA ET AL., BLOOD, vol. 92, 1998, pages 4066 - 407 1
QI ET AL., TRANSPLANTATION, vol. 69, 2000, pages 1275 - 1283
RAMESH ET AL.: "Inflammatory cytokines in acute renal failure", KIDNEY INT., 2004, pages S56 - S61
RAMESH ET AL.: "Salicylate reduces cisplatin nephrotoxicity by inhibition of tumor necrosis factor-alpha", KIDNEY INT., vol. 65, 2004, pages 490 - 499
SLAVIK ET AL., IMMUNOL. RES., vol. 19, 1999, pages 1 - 24
SUN ET AL.: "Combining nanosurface chemistry and microfluidics for molecular analysis and cell biology", ANALYTICA CHIMICA ACTA, vol. 650, no. 1, 2009, pages 98 - 105, XP026542471, DOI: doi:10.1016/j.aca.2009.05.018
WISEMAN ET AL., DRUGS, vol. 58, 1999, pages 1029 - 1042

Cited By (47)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11660317B2 (en) 2004-11-08 2023-05-30 The Johns Hopkins University Compositions comprising cardiosphere-derived cells for use in cell therapy
US9249392B2 (en) 2010-04-30 2016-02-02 Cedars-Sinai Medical Center Methods and compositions for maintaining genomic stability in cultured stem cells
US9845457B2 (en) 2010-04-30 2017-12-19 Cedars-Sinai Medical Center Maintenance of genomic stability in cultured stem cells
WO2013093870A1 (en) 2011-12-23 2013-06-27 International Centre For Genetic Engineering And Biotechnology - Icgeb microRNAs FOR CARDIAC REGENERATION THROUGH INDUCTION OF CARDIAC MYOCYTE PROLIFERATION
US9334498B2 (en) 2012-05-10 2016-05-10 Uab Research Foundation Methods and compositions for modulating MIR-204 activity
US9884076B2 (en) 2012-06-05 2018-02-06 Capricor, Inc. Optimized methods for generation of cardiac stem cells from cardiac tissue and their use in cardiac therapy
US11230725B2 (en) 2012-06-06 2022-01-25 Boehringer Ingelheim International Gmbh Cell engineering using MICRORNAs
EP2859103B1 (en) * 2012-06-06 2019-04-17 Boehringer Ingelheim International GmbH CELL ENGINEERING USING RNAs
WO2014013029A1 (en) 2012-07-18 2014-01-23 Universität Duisburg-Essen Use of preparations comprising exosomes derived from mesenchymal stem cells (mscs) in the prevention and therapy of inflammatory conditions
EP2687219A1 (en) 2012-07-18 2014-01-22 Universität Duisburg-Essen Use of preparations comprising exosomes derived from mesenchymal stem cells (MSCs) in the prevention and therapy of inflammatory conditions
US9828603B2 (en) 2012-08-13 2017-11-28 Cedars Sinai Medical Center Exosomes and micro-ribonucleic acids for tissue regeneration
US12584127B2 (en) 2012-08-13 2026-03-24 Cedars-Sinai Medical Center Exosomes and micro-ribonucleic acids for tissue regeneration
US11220687B2 (en) 2012-08-13 2022-01-11 Cedars-Sinai Medical Center Exosomes and micro-ribonucleic acids for tissue regeneration
US10457942B2 (en) 2012-08-13 2019-10-29 Cedars-Sinai Medical Center Exosomes and micro-ribonucleic acids for tissue regeneration
WO2014091373A1 (en) * 2012-12-11 2014-06-19 The University Court Of The University Of Glasgow Cellular and molecular therapies for peripheral vascular disease
AU2014222671B2 (en) * 2013-03-01 2017-04-27 Apceth Gmbh & Co. Kg Protection of the vascular endothelium from immunologically mediated cytotoxic reactions with human CD34-negative progenitor cells
WO2014131877A1 (en) * 2013-03-01 2014-09-04 Apceth Gmbh & Co. Kg Protection of the vascular endothelium from immunologically mediated cytotoxic reactions with human cd34-negative progenitor cells
US12492400B2 (en) 2013-06-05 2025-12-09 Reverse Bioengineering, Inc. Compositions and methods for induced tissue regeneration in mammalian species
US12421513B2 (en) 2013-06-05 2025-09-23 Reverse Bioengineering, Inc. Compositions and methods for induced tissue regeneration in mammalian species
US10961531B2 (en) 2013-06-05 2021-03-30 Agex Therapeutics, Inc. Compositions and methods for induced tissue regeneration in mammalian species
WO2015026827A3 (en) * 2013-08-19 2015-04-16 University Of Notre Dame Method and composition for detection of oncogenic hpv
US9879260B2 (en) 2013-08-20 2018-01-30 The Board Of Regents Of The University Of Texas System Micro-RNA regulation of bone loss
WO2015080758A1 (en) * 2013-11-27 2015-06-04 Al-Qahtani Ahmed H Method and composition for the treatment of moderate to severe keratoconjunctivitis sicca
US11078462B2 (en) 2014-02-18 2021-08-03 ReCyte Therapeutics, Inc. Perivascular stromal cells from primate pluripotent stem cells
US10247720B2 (en) 2014-05-22 2019-04-02 University Of Notre Dame Du Lac Integrated membrane sensor for rapid molecular detection
US11016079B2 (en) 2014-05-22 2021-05-25 University Of Notre Dame Du Lac Integrated membrane sensor for rapid molecular detection
US11274281B2 (en) 2014-07-03 2022-03-15 ReCyte Therapeutics, Inc. Exosomes from clonal progenitor cells
US10240127B2 (en) 2014-07-03 2019-03-26 ReCyte Therapeutics, Inc. Exosomes from clonal progenitor cells
US11357799B2 (en) 2014-10-03 2022-06-14 Cedars-Sinai Medical Center Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of muscular dystrophy
US12544409B2 (en) 2014-10-03 2026-02-10 Cedars-Sinai Medical Center Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of muscular dystrophy
US10669543B2 (en) 2015-01-16 2020-06-02 University Of Iowa Research Foundation Methods to prevent or treat periodontitis or peri-implantitis
WO2016115516A1 (en) * 2015-01-16 2016-07-21 University Of Iowa Research Foundation Methods to prevent or treat periodontitis or peri-implantitis
US12404493B2 (en) 2015-12-07 2025-09-02 Agex Therapeutics, Inc. Methods for the re-derivation of diverse pluripotent stem cell-derived brown fat cells
US11253551B2 (en) 2016-01-11 2022-02-22 Cedars-Sinai Medical Center Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of heart failure with preserved ejection fraction
US11872251B2 (en) 2016-01-11 2024-01-16 Cedars-Sinai Medical Center Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of heart failure with preserved ejection fraction
US11351200B2 (en) 2016-06-03 2022-06-07 Cedars-Sinai Medical Center CDC-derived exosomes for treatment of ventricular tachyarrythmias
US11541078B2 (en) 2016-09-20 2023-01-03 Cedars-Sinai Medical Center Cardiosphere-derived cells and their extracellular vesicles to retard or reverse aging and age-related disorders
US11759482B2 (en) 2017-04-19 2023-09-19 Cedars-Sinai Medical Center Methods and compositions for treating skeletal muscular dystrophy
WO2018219998A1 (en) * 2017-05-30 2018-12-06 Siemens Aktiengesellschaft Mirnas as biomarkers for a systemic inflammatory response syndrome
CN107760717B (en) * 2017-11-08 2020-07-31 吉林省农业科学院 Sheep TNPO1 gene dual-luciferase reporter gene vector and construction method and application thereof
CN107760717A (en) * 2017-11-08 2018-03-06 吉林省农业科学院 Sheep TNPO1 gene dual luciferase reporter gene carrier and its construction method and application
US11660355B2 (en) 2017-12-20 2023-05-30 Cedars-Sinai Medical Center Engineered extracellular vesicles for enhanced tissue delivery
US12146137B2 (en) 2018-02-05 2024-11-19 Cedars-Sinai Medical Center Methods for therapeutic use of exosomes and Y-RNAS
US11904006B2 (en) 2019-12-11 2024-02-20 University Of Iowa Research Foundation Poly(diaminosulfide) particle-based vaccine
WO2024040126A3 (en) * 2022-08-16 2024-04-18 The Regents Of The University Of California Improved glycemic control by administration of micro-rna 192
WO2024165603A1 (en) 2023-02-07 2024-08-15 Universitetet I Tromsø - Norges Arktiske Universitet Pharmaceutical composition for use in treatment of venous thromboembolism
WO2026058945A1 (en) * 2024-09-13 2026-03-19 ロート製薬株式会社 Anti-aging composition, anti-inflammatory composition, and method for screening aging amelioration substances

Also Published As

Publication number Publication date
US20160243171A1 (en) 2016-08-25
CA2845280A1 (en) 2012-02-16
AU2011288262A1 (en) 2013-04-04
JP2017125065A (en) 2017-07-20
US20140234263A1 (en) 2014-08-21
WO2012020307A3 (en) 2012-11-29
US20180338997A1 (en) 2018-11-29
EP2603592A2 (en) 2013-06-19
JP2013537538A (en) 2013-10-03
JP2016056210A (en) 2016-04-21
WO2012020307A2 (en) 2012-02-16
US20130143314A1 (en) 2013-06-06
WO2012020308A3 (en) 2013-04-11
CN103210089A (en) 2013-07-17
US20190167732A1 (en) 2019-06-06

Similar Documents

Publication Publication Date Title
US20140234263A1 (en) Cellular and molecular therapies
JP6644851B2 (en) Stem cell microparticles
US10752883B2 (en) Generation of neural stem cells and motor neurons
CN104703609B (en) stem cell microparticles
CN105658789B (en) Stem Cell Microparticles and miRNAs
ES2705052T3 (en) Microparticles of stem cells and RNAi
ES2927175T3 (en) Microparticle production method
EP3401393B1 (en) Micrornas for the generation of astrocytes
US20120219632A1 (en) Methods for monitoring cellular states and for immortalizing mesenchymal stem cell
US20210161967A1 (en) Extracellular vesicles and uses thereof
JP2013537538A5 (en)
EP2794882B1 (en) Micrornas for cardiac regeneration through induction of cardiac myocyte proliferation
Guess Characterization of microRNA Function During Skeletal Myogenesis
Gaston Utilizing microRNA to alter extracellular matrix protein expression for vocal fold wound healing
HK1186495A (en) Therapeutic uses of microvesicles and related micrornas

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11760839

Country of ref document: EP

Kind code of ref document: A2