WO2012020307A2 - Therapeutic uses of microvesicles and related micrornas - Google Patents

Therapeutic uses of microvesicles and related micrornas Download PDF

Info

Publication number
WO2012020307A2
WO2012020307A2 PCT/IB2011/002028 IB2011002028W WO2012020307A2 WO 2012020307 A2 WO2012020307 A2 WO 2012020307A2 IB 2011002028 W IB2011002028 W IB 2011002028W WO 2012020307 A2 WO2012020307 A2 WO 2012020307A2
Authority
WO
WIPO (PCT)
Prior art keywords
mirna
microvesicles
cells
seq
disease
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2011/002028
Other languages
French (fr)
Other versions
WO2012020307A3 (en
Inventor
Paul Shiels
Wayne Davies
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Glasgow
Original Assignee
University of Glasgow
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CN2011800497589A priority Critical patent/CN103210089A/en
Priority to CA2845280A priority patent/CA2845280A1/en
Priority to JP2013523676A priority patent/JP2013537538A/en
Priority to EP11763986.4A priority patent/EP2603592A2/en
Priority to AU2011288262A priority patent/AU2011288262A1/en
Application filed by University of Glasgow filed Critical University of Glasgow
Publication of WO2012020307A2 publication Critical patent/WO2012020307A2/en
Publication of WO2012020307A3 publication Critical patent/WO2012020307A3/en
Priority to US13/766,666 priority patent/US20130143314A1/en
Anticipated expiration legal-status Critical
Priority to US14/987,931 priority patent/US20160243171A1/en
Priority to US15/829,160 priority patent/US20180338997A1/en
Priority to US16/034,059 priority patent/US20190167732A1/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/37Digestive system
    • A61K35/407Liver; Hepatocytes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14Blood; Artificial blood
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/22Urine; Urinary tract, e.g. kidney or bladder; Intraglomerular mesangial cells; Renal mesenchymal cells; Adrenal gland
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/37Digestive system
    • A61K35/39Pancreas; Islets of Langerhans
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/48Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/5005Wall or coating material
    • A61K9/5063Compounds of unknown constitution, e.g. material from plants or animals
    • A61K9/5068Cell membranes or bacterial membranes enclosing drugs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/02Drugs for disorders of the nervous system for peripheral neuropathies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/88Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microencapsulation, e.g. using amphiphile liposome vesicle
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5061Muscle cells
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/507Pancreatic cells
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5073Stem cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K2035/124Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells the cells being hematopoietic, bone marrow derived or blood cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • C12N2310/141MicroRNAs, miRNAs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/10Applications; Uses in screening processes
    • C12N2320/11Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00Production
    • C12N2330/10Production naturally occurring

Definitions

  • Microvesicles were historically regarded as cellular debris with no apparent function. However, and more recently, a growing body of experimental data suggest that microvesicles have numerous biological activities. For example, platelet-derived microvesicles were shown to stimulate selected cells via surface proteins on the microvesicles (e.g., CD 154, RANTES, and/or PF-4; see Thromb. Haemost. (1999), 82:794, or J. Biol. Chem. (1999), 274:7545).
  • surface proteins on the microvesicles e.g., CD 154, RANTES, and/or PF-4; see Thromb. Haemost. (1999), 82:794, or J. Biol. Chem. (1999), 274:7545).
  • bioactive lipids e.g., sphingosine-1 -phosphate, HETE, or arachidonic acid
  • platelet microvesicles increased adhesion of mobilized CD34+ endothelial cells by transfer of certain microvesicle surface components to the mobilized cells (see e.g., Blood (2001), 89:3143).
  • microvesicles have been proposed. While such proposed uses provide at least some promising perspectives, several largely unexplained problems remain. For example, biological activity of microvesicles is often difficult to predict. Moreover, currently contemplated therapeutic use typically necessitates sterilization and antiviral treatment to prevent infections of the people receiving microvesicle containing preparations, which is time- consuming and inefficient. Therefore, there is still a need for improved compositions and methods of use based on microvesicles. SUMMARY OF THE INVENTION
  • the present invention provides improved methods and compositions based on microvesicles for the treatment of various diseases, disorders and conditions.
  • the present invention encompasses the recognition that microvesicles contain specific microRNAs which may function as intercellular regulators involved in cell or tissue regeneration, remodeling, reconstruction, reprogramming or transdifferentiation.
  • the present invention provides methods and compositions based on microvesicles and/or associated microRNAs that provide more predictable and effective therapeutic results.
  • the present invention provides a method of treating a disease, disorder or condition comprising administering to a patient in need of treatment a therapeutically effective amount of microvesicles.
  • inventive methods according to the present invention can be used to treat a disease, disorder or condition selected from the group consisting of diabetes mellitus, myocardial infarct, kidney disease, wound healing, Fistulas regeneration, neural regeneration (e.g., CNS regeneration, or peripheral nervous system regeneration), breast augmentation following mastectomy, conditions associated with a cosmetic surgical procedure, and combination thereof.
  • the present invention provides a method of inducing tissue repair, remodeling, differentiation or transdifferentiation in vivo comprising administering to a patient in need of treatment a therapeutically effective amount of microvesicles.
  • suitable microvesicles are derived from a tissue that is the same as the diseased tissue (i.e., target tissue).
  • suitable microvesicles are derived from a tissue that is different from the diseased tissue (i.e., target tissue).
  • suitable microvesicles are derived from pancreatic cells, kidney cells, liver cells, spleen cells, lymph nodes, myometrium cells, peripheral blood cells, chord blood cells, bone marrow cells, serum, or combination thereof.
  • suitable microvesicles are derived from pancreas- derived pathfinder cells.
  • suitable microvesicles are derived from autologous cells.
  • suitable microvesicles are derived from non-auto logous cells.
  • suitable microvesicles are derived from cells grown on a nonwoven substrate.
  • the nonwoven substrate comprise an aliphatic polyester fiber.
  • a aliphatic polyester fiber suitable for the present invention is selected from the group consisting of homopolymers or copolymers of lactide (which includes lactic acid D-,L- and meso lactide), glycolide (including glycolic acid), epsilon- caprolactone, p-dioxanone (l,4-dioxan-2-one), trimethylene carbonate (l,3-dioxan-2-one), and combinations thereof.
  • lactide which includes lactic acid D-,L- and meso lactide
  • glycolide including glycolic acid
  • epsilon- caprolactone p-dioxanone
  • trimethylene carbonate l,3-dioxan-2-one
  • suitable microvesicles are derived from cells grown under a culture condition where oxygen pressure is less than or equal to 5%. In some embodiments, suitable microvesicles are derived from cells grown under room air oxygen conditions. In some embodiments, suitable microvesicles are derived from cells grown to approximately 80-99% of confluence.
  • suitable microvesicles are derived from cells grown under serum starvation conditions. In some embodiments, suitable microvesicles are derived from cells grown under serum starvation conditions for about 24 hours. In some embodiments, suitable microvesicles are derived from cells grown under serum replete conditions.
  • suitable microvesicles are isolated or purified by differential ultracentrifugation. In some embodiments, suitable microvesicles are isolated or purified by precipitation.
  • suitable microvesicles contain one or more microR As selected from those listed in Table 1 and Tables 7-13.
  • suitable microvesicles contains one or more microRNAs selected form the group consisting of miRNA-122, miRNA-127, miRNA-133b, miRNA-323, miRNA-433, miRNA-451, miRNA-466h, miRNA-467c, miRNA-467e, miRNA-468, miRNA- 491, miRNA-495, miRNA-546, miRNA-666, miRNA-680, miRNA-346, miRNA- 136, miRNA- 202, miRNA-369, miRNA-370, miRNA-375, miRNA-376b, miRNA-381, miRNA-434, miRNA- 452, miRNA-465a, miRNA-465b, miRNA-470, miRNA-487b, miRNA-543, miRNA-547, miRNA-590, miRNA-741, miRNA-881, miRNA-206, miRNA-224, miRNA-327, miRNA-347, and combination thereof.
  • microRNAs selected form the group consisting of miRNA-122, miRNA-127, miRNA-133b, miRNA
  • suitable microvesicles contain one or more microRNAs selected form the group consisting of miRNA-122, miRNA-127, miRNA-133b, miRNA-323, miRNA-433, miRNA-451 , miRNA-466h, miRNA-467c, miRNA-467e, miRNA-468, miRNA- 491, miRNA-495, miRNA-546, miRNA-666, miRNA-680, miRNA-346, and combination thereof.
  • suitable microvesicles do not contain miRNA-129-5p, miRNA-190, miRNA-203, miRNA-32, miRNA-34c, miRNA-376c, miRNA-384-3p, miRNA- 499b, miRNA-455, miRNA-582-5p, miRNA-615-3p, miRNA-615-5p, miRNA-7b, miRNA-17- 3p, miRNA-381, and miRNA-505.
  • a therapeutically effective amount of microvesicles ranges from lfg-lmg/kg body weight (e.g., lOfg-lmg/kg, lOOfg-lmg/kg, lpg-lmg/kg, lOpg-lmg/kg, lOOpg-lmg/kg body weight).
  • the microvesicles are administered intravenously, intra-arterially, intramuscularly, subcutaneously, cutaneously, intradermally, intracranially, intratheccally, intrapleurally, intra-orbitally, intra nasally, orally, intra
  • the microvesicles are administered daily. In some embodiments, the microvesicles are administered weekly. In some embodiments, the microvesicles are administered biweekly. In some embodiments, the microvesicles are administered monthly.
  • the present invention provides a method of treating a disease, disorder or condition by administering one or more microRNAs obtained, isolated or purified from microvesicles.
  • the microvesicles are derived from cells grown under serum starvation conditions.
  • the microvesicles are derived from cells grown under serum starvation conditions for about 24 hours.
  • the microvesicles are derived from cells grown under serum replete conditions.
  • the microRNAs obtained, isolated or purified from microvesicles are differentially expressed in cells and/or microvesicles derived from cells grown under stress conditions (e.g., oxygen pressure, cell culture confluence, serum amounts in medium, etc.).
  • stress conditions e.g., oxygen pressure, cell culture confluence, serum amounts in medium, etc.
  • the present invention provides a method of treating a disease, disorder or condition comprising administering to a patient in need of treatment a therapeutically effective amount of one or more microRNAs having a sequence at least 70% (e.g., 75%, 80%>, 85%, 90%, 95%, 98%, 99%) identical to any of SEQ ID NOs: l-72 (e.g., SEQ ID NOs:l-29).
  • the one or more microRNAs have a sequence identical to any of SEQ ID NO: 1-72 (e.g., SEQ ID NOs: l-29).
  • the present invention provides a method of treating a disease, disorder or condition comprising administering to a patient in need of treatment a therapeutically effective amount of one or more microRNAs having a sequence at least 70% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, 99%) identical to any of the sequences in Tables 7-13.
  • the present invention provides a method of inducing tissue repair, remodeling, differentiation or transdiferentiation in vivo comprising administering to a patient in need of treatment a therapeutically effective amount of one or more microRNAs having a sequence at least 70% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, 99%) identical to any one of SEQ ID NO: 1-72 (e.g., SEQ ID NOs: 1-29).
  • the one or more microRNAs have a sequence identical to any of SEQ ID NO: l-72 (e.g., SEQ ID NOs:l-29).
  • the present invention provides a method of inducing tissue repair, remodeling, differentiation or transdiferentiation in vivo comprising administering to a patient in need of treatment a therapeutically effective amount of one or more microRNAs having a sequence at least 70% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, 99%) identical to any of the sequences in Tables 7-13.
  • inventive methods according to the present invention can be used to treat a disease, disorder or condition selected from the group consisting of diabetes mellitus, myocardial infarct, kidney disease, wound healing, Fistulas regeneration, neural regeneration (e.g., CNS regeneration, or peripheral nervous system regeneration), breast augmentation following mastectomy, conditions associated with a cosmetic surgical procedure, and combination thereof.
  • a disease, disorder or condition selected from the group consisting of diabetes mellitus, myocardial infarct, kidney disease, wound healing, Fistulas regeneration, neural regeneration (e.g., CNS regeneration, or peripheral nervous system regeneration), breast augmentation following mastectomy, conditions associated with a cosmetic surgical procedure, and combination thereof.
  • the therapeutically effective amount of the one or more miRNAs ranges from lfg-lmg/kg body weight (e.g., lOfg-lmg/kg, lOOfg-lmg/kg, lpg-lmg/kg, lOpg-lmg/kg, lOOpg-lmg/kg body weight).
  • the one or more miRNAs are administered intravenously, intra-arterially, intramuscularly, subcutaneously, cutaneously, intradermally, intracranially, intratheccally, intrapleurally, intra-orbitally, intra nasally, orally, intra alimentrally, colorectally, and/or intra-cerebrospinally.
  • the one or more miRNAs are administered intravenously, intra-arterially, intramuscularly, subcutaneously, cutaneously, intradermally, intracranially, intratheccally, intrapleurally, intra-orbitally, intra nasally, orally, intra alimentrally, colorectally, and/or intra-cerebrospinally.
  • the one or more miRNAs are administered daily, weekly, biweekly, or monthly.
  • the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of microvesicles for the treatment of various diseases, disorders or conditions.
  • the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of microvesicles for the treatment of diabetes mellitus, myocardial infarct, kidney disease, wound healing, Fistulas regeneration, neural regeneration (e.g., CNS regeneration, or peripheral nervous system regeneration), breast augmentation following mastectomy, conditions associated with a cosmetic surgical procedure, and combination thereof.
  • the present invention provides a pharmaceutical composition comprising one or more microRNAs having a sequence at least 70% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, 99%) identical to any one of SEQ ID NO: 1-72 (e.g., SEQ ID NOs: l-29) and a pharmaceutically acceptable carrier.
  • the present invention provides a pharmaceutical composition comprising one or more microRNAs having a sequence identical to any one of SEQ ID NO: 1-72 (e.g., SEQ ID NOs: l-29) and a
  • the present invention provides a pharmaceutical composition comprising one or more microRNAs having a sequence at least 70% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, 99%) identical to any of the sequences in Tables 7-13 and a pharmaceutically acceptable carrier. In some embodiments, the present invention provides a pharmaceutical composition comprising one or more microRNAs having a sequence identical to any of the sequences in Tables 7-13 and a pharmaceutically acceptable carrier.
  • the one or more miR As are present in a therapeutically effective amount for the treatment of diabetes mellitus, myocardial infarct, kidney disease, wound healing, Fistulas regeneration, neural regeneration (e.g., CNS regeneration, or peripheral nervous system regeneration), breast augmentation following mastectomy, conditions associated with a cosmetic surgical procedure, or combination thereof.
  • the present invention provides a method for identifying a miRNA that induces cell growth and/or regeneration, comprising providing cells grown in a microvesicle-depleted medium; adding an miRNA to the medium; determining if the addition of the miRNA increases cell proliferation rate as compared to a control, thereby identifying if the miRNA induces cell growth and/or regeneration.
  • the cells are pancreas- derived pathfinder cells.
  • the cell proliferation rate is determined by doubling time.
  • the miRNA is isolated from micro vesicles.
  • the present invention provides a method for identifying a miRNA that induces cell growth and/or regeneration, comprising creating a wounded area in cells grown to confluence; treating the cells with an miRNA; determining a rate of re-growth of the treated cells across the wounded area as compared to a control, thereby identifying if the miRNA induces cell growth and/or regeneration.
  • the cells are fibroblasts or cardiomyocytes.
  • the rate of re-growth is determined quantitatively.
  • control is untreated cells but otherwise grown under identical conditions.
  • miRNA is isolated from micro vesicles.
  • the present invention provides an miRNA that induces cell growth and/or regeneration identified using a method described herein.
  • the term “approximately” or “about” refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%), 2%>, 1%), or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
  • Figures 1A and IB depict exemplary scanning electron microscopy pictures of sub-confluent rat PDPCs adapted for growth in medium with fetal bovine serum (FBS) depleted for bovine micro vesicles. Nascent micro vesicles can be seen at the surfaces of cells in both figures.
  • FBS fetal bovine serum
  • Figures 2A and 2B show exemplary effects of MVs on growth rates of rat
  • FIG. 2 A depicts the effect of bovine MV depletion on doubling time of rat PDPCs. (Plotted on the y-axis is electrical impedence; negative values indicate cell death and therefore negative growth.) MV depletion was performed at 43 hours. A negative effect on doubling time was seen, with a later recovery.
  • Figure 2B depicts dose-dependent recovery of rat PDPC doubling time after addition of rat PDPC-derived MVs. Cultures were MV-depleted at 48 hours, and then exogenous MVs were added 10 hours later. The rapid recovery of doubling time of cells receiving exogenous MV occurred well in advance of the normal recovery time.
  • Figure 3 depicts an exemplary differential centrifugation fractionation of microvesicle-containing cell culture medium.
  • Figure 4 shows an exemplary diagram comparing miRNA expression profiles for rat PCs, MV fractions, and exosome fractions. The diagram shows the number of miRNAs whose expression is altered by growth under serum starvation conditions for 24 hours as compared with growth under serum replete conditions.
  • Total rat miRNA genes analyzed 584.
  • Figure 5 shows an exemplary graph comparison of miRNA expression profiled for rat PCs, MV fractions, and exosome fractions.
  • the graph shows miRNAs with increased gene expression following growth under serum starvation conditions for 24 hours as compared with growth under serum replete conditions.
  • Figure 6 shows an exemplary diagram comparing miRNA expression profiles for rat PCs, rat MSC, and human PC.
  • the chart shows the number of miRNAs whose expression is altered by growth under serum starvation conditions for 24 hours as compared with growth under serum replete conditions.
  • Total rat miRNA genes analyzed 584.
  • Total human miRNA genes analyzed 761.
  • Figure 7 shows an exemplary diagram comparing miRNA expression profiles for human PCs and microvesicles (MVs) obtained from human PCs.
  • the chart shows the number of miRNAs whose expression is altered by growth under serum starvation conditions for 24 hours as compared with growth under serum replete conditions.
  • Figure 8 shows an exemplary diagram comparing miRNA expression profiles for
  • FIG. 9 shows an exemplary graph comparison of miRNA expression profile for
  • MVs obtained from rat PCs and MVs obtained from human PCs The graph shows miRNAs with increased or decreased gene expression following growth under serum starvation conditions for 24 hours as compared with growth under serum replete conditions.
  • animal refers to any member of the animal kingdom. In some embodiments, “animal” refers to humans, at any stage of development. In some embodiments, “animal” refers to non-human animals, at any stage of development. In certain embodiments, the non-human animal is a mammal ⁇ e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, and/or a pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, and/or worms. In some embodiments, an animal may be a transgenic animal, genetically-engineered animal, and/or a clone.
  • Autoimmune disorder refers to a value that is similar to a stated reference value. In certain embodiments, the term “approximately” or “about” refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%
  • autoimmune disorder refers to a disorder resulting from attack of a body's own tissue by its immune system.
  • autoimmune diseases is diabetes mellitus, multiple sclerosis, premature ovarian failure, scleroderma, Sjogren's disease, lupus, alopecia (baldness), polyglandular failure, Grave's disease, hypothyroidism, polymyosititis, Celiac disease, Crohn's disease, inflammatory bowel disease, ulcerative colitis, autoimmune hepatitis, hypopituitarism, Guillain-Barre syndrome, myocardititis, Addison's disease, autoimmune skin diseases (e.g., psoriasis), uveititis, pernicious anemia, polymyalgia rheumatica, Goodpasture's syndrome, hypoparathyroidism, Hashimoto's thyoriditis, Raynaud's phenomenon, polymyagli
  • Autologous and non-autologus means from the same organism. In the context of the present application, the term is used to mean that the population of cells and/or microvesicles referred to as “autologous” to each other do not contain any material which could be regarded as allogenic or xenogenic, that is to say derived from a “foreign” cellular source. As used herein, the term “non-autologous” means not from the same organism.
  • Diabetes mellitus refers to a metabolic disease characterized by abnormally high levels of glucose in the blood, caused by an inherited inability to produce insulin (Type 1) or an acquired resistance to insulin (Type 2).
  • Type 1 diabetes is a severe, chronic form of diabetes caused by insufficient production of insulin and resulting in abnormal metabolism of carbohydrates, fats, and proteins. The disease, which typically appears in childhood or adolescence, is characterized by increased sugar levels in the blood and urine, excessive thirst, frequent urination, acidosis, and wasting. Type 1 diabetes is also called insulin-dependent diabetes.
  • Type 2 diabetes is a mild form of diabetes that typically appears first in adulthood and is exacerbated by obesity and an inactive lifestyle. This disease often has no symptoms, is usually diagnosed by tests that indicate glucose intolerance, and is treated with changes in diet and an exercise regimen. Type 2 diabetes is also called non-insulin- dependent diabetes.
  • Control has its art-understood meaning of being a standard against which results are compared. Typically, controls are used to augment integrity in experiments by isolating variables in order to make a conclusion about such variables.
  • a control is a reaction or assay that is performed
  • a control is a historical control (i.e., of a test or assay performed previously, or an amount or result that is previously known).
  • a control is or comprises a printed or otherwise saved record.
  • a control may be a positive control or a negative control.
  • a control is also referred to as a reference.
  • Cosmetic surgical procedure refers to a procedure that is not directed to the therapy of a disease but is, rather, directed to the improvement of an individual's aesthetic appearance, particularly the appearance of the skin or hair of an individual.
  • cosmetic surgical procedures include procedures that result in reduction in skin wrinkles, an increase in skin firmness, an increase in hair growth or shine, a reduction in grey hairs, a regrowth of hair in cases of baldness (especially male pattern baldness), reduction in hair growth (especially facial hair growth), an aesthetic enhancement of breast size or shape, and a reduction in cellulite.
  • Crude when used in connection with a biological sample, refers to a sample which is in a substantially unrefined state.
  • a crude sample can be cell lysates or biopsy tissue sample.
  • a crude sample may exist in solution or as a dry preparation.
  • Derivative thereof when used in connection with microvesicles or cells, refers to a fraction or extract (especially those containing R A and/or DNA and/or protein) of the original microvesicle or population of cells which retains at least some biological activity (especially the ability to induce differentiation and/or the ability to provide therapeutic benefit) of the original.
  • the term also include complexed, encapsulated or formulated microvesicles or cells (for example, microvesicles that have been encapsulated, complexed or formulated to facilitate administration). Examples of derivatives include lysates, lyophilates and homogenates.
  • Dysfunction refers to an abnormal function.
  • Dysfunction of a molecule ⁇ e.g., a protein
  • Dysfunction of a molecule can be caused by an increase or decrease of an activity associated with such molecule.
  • Dysfunction of a molecule can be caused by defects associated with the molecule itself or other molecules that directly or indirectly interact with or regulate the molecule.
  • a "functional" biological molecule is a biological molecule in a form in which it exhibits a property and/or activity by which it is characterized.
  • Functional derivative denotes, in the context of a functional derivative of a nucleotide sequence (e.g., microRNA), a molecule that retains a biological activity (either function or structural) that is substantially similar to that of the original sequence.
  • a functional derivative or equivalent may be a natural derivative or is prepared synthetically.
  • Exemplary functional derivatives include nucleotide sequences having substitutions, deletions, or additions of one or more nucleotides, provided that the biological activity of the nucleic acids (e.g., microR As) is conserved.
  • Inflammation includes inflammatory conditions occurring in many disorders which include, but are not limited to: Systemic
  • Inflammatory Response SIRS
  • Alzheimer's Disease and associated conditions and symptoms including: chronic neuroinflammation, glial activation; increased microglia; neuritic plaque formation; and response to therapy
  • ALS Amyotropic Lateral Sclerosis
  • arthritis and associated conditions and symptoms including, but not limited to: acute joint inflammation, antigen-induced arthritis, arthritis associated with chronic lymphocytic thyroiditis, collagen- induced arthritis, juvenile arthritis; rheumatoid arthritis, osteoarthritis, prognosis and
  • asthma and associated conditions and symptoms, including: bronchial asthma; chronic obstructive airway disease; chronic obstructive pulmonary disease, juvenile asthma and occupational asthma);
  • cardiovascular diseases and associated conditions and symptoms, including atherosclerosis; autoimmune myocarditis, chronic cardiac hypoxia, congestive heart failure, coronary artery disease, cardiomyopathy and cardiac cell dysfunction, including: aortic smooth muscle cell activation; cardiac cell apoptosis; and immunomodulation of cardiac cell function; diabetes and associated conditions and symptoms, including autoimmune diabetes, insulin-dependent (Type 1) diabetes, diabetic periodontitis, diabetic retinopathy, and diabetic nephropathy);
  • Type 1 diabetes diabetes, diabetic periodontitis, diabetic retinopathy, and diabetic nephropathy
  • gastrointestinal inflammations and related conditions and symptoms, including celiac disease, associated osteopenia, chronic colitis, Crohn's disease, inflammatory bowel disease and ulcerative colitis); gastric ulcers; hepatic inflammations such as viral and other types of hepatitis, cholesterol gallstones and hepatic fibrosis, HIV infection (and associated conditions and symptoms, including degenerative responses, neurodegenerative responses, and HIV associated Hodgkin's Disease), Kawasaki's Syndrome (and associated diseases and conditions, including mucocutaneous lymph node syndrome, cervical lymphadenopathy, coronary artery lesions, edema, fever, increased leukocytes, mild anemia, skin peeling, rash, conjunctiva redness, thrombocytosis; multiple sclerosis, nephropathies (and associated diseases and conditions, including diabetic nephropathy, endstage renal disease, acute and chronic glomerulonephritis, acute and chronic interstitial nephritis, lupus nephritis
  • Immunological disorders including autoimmune diseases, such as alopecia aerata, autoimmune myocarditis, Graves' disease, Graves opthalmopathy, lichen sclerosis, multiple sclerosis, psoriasis, systemic lupus erythematosus, systemic sclerosis, thyroid diseases (e.g. goiter and struma lymphomatosa (Hashimoto's thyroiditis, lymphadenoid goiter), sleep disorders and chronic fatigue syndrome and obesity (non-diabetic or associated with diabetes).
  • autoimmune diseases such as alopecia aerata, autoimmune myocarditis, Graves' disease, Graves opthalmopathy, lichen sclerosis, multiple sclerosis, psoriasis, systemic lupus erythematosus, systemic sclerosis, thyroid diseases (e.g. goiter and struma lymphomatosa (Hashimoto's thyroiditis, lymphadenoid goiter
  • infectious diseases such as Leishmaniasis, Leprosy, Lyme Disease, Lyme Carditis, malaria, cerebral malaria, meningitis, tubulointerstitial nephritis associated with malaria
  • bacteria e.g. cytomegalovirus, encephalitis, Epstein-Barr Virus, Human Immunodeficiency Virus, Influenza Virus
  • protozoans e.g., Plasmodium falciparum, trypanosomes.
  • Trauma including cerebral trauma (including strokes and ischemias, encephalitis, encephalopathies, epilepsy, perinatal brain injury, prolonged febrile seizures, SIDS and subarachnoid hemorrhage), low birth weight (e.g. cerebral palsy), lung injury (acute hemorrhagic lung injury, Goodpasture's syndrome, acute ischemic reperfusion), myocardial dysfunction, caused by occupational and environmental pollutants (e.g. susceptibility to toxic oil syndrome silicosis), radiation trauma, and efficiency of wound healing responses (e.g. burn or thermal wounds, chronic wounds, surgical wounds and spinal cord injuries).
  • cerebral trauma including strokes and ischemias, encephalitis, encephalopathies, epilepsy, perinatal brain injury, prolonged febrile seizures, SIDS and subarachnoid hemorrhage
  • low birth weight e.g. cerebral palsy
  • lung injury acute hemorrhagic lung injury, Goodpasture's syndrome, acute ischemic reperfusion
  • Hormonal regulation including fertility/fecundity, likelihood of a pregnancy, incidence of preterm labor, prenatal and neonatal complications including preterm low birth weight, cerebral palsy, septicemia, hypothyroidism, oxygen dependence, cranial abnormality, early onset menopause.
  • a subject's response to transplant rejection or acceptance
  • acute phase response e.g. febrile response
  • general inflammatory response acute respiratory distress response
  • acute systemic inflammatory response e.g. fever response
  • wound healing esion
  • immunoinflammatory response e.g. acute respiratory distress response
  • neuroendocrine response e.g. fever development and resistance
  • acute -phase response e.g., stress response, disease susceptibility, repetitive motion stress, tennis elbow, and pain management and response.
  • inducer refers to any molecule or other substance capable of inducing a change in the fate of differentiation of a cell to which it is applied.
  • in vitro refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within a multi-cellular organism.
  • Isolated refers to a substance and/or entity that has been (1) separated from at least some of the components with which it was associated when initially produced (whether in nature and/or in an experimental setting), and/or (2) produced, prepared, and/or manufactured by the hand of man.
  • Isolated substances and/or entities may be separated from at least about 10%, about 20%>, about 30%>, about 40%>, about 50%>, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, about 99%, substantially 100%, or 100% of the other components with which they were initially associated.
  • isolated agents are more than about 80%>, about 85%, about 90%>, about 91%>, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, substantially 100%), or 100%) pure.
  • a substance is "pure” if it is substantially free of other components.
  • isolated cell refers to a cell not contained in a multi-cellular organism.
  • microRNAs refers to post- transcriptional regulators that typically bind to complementary sequences in the three prime untranslated regions (3' UTRs) of target messenger RNA transcripts (mRNAs), usually resulting in gene silencing.
  • miRNAs are short ribonucleic acid (RNA) molecules, for example, 21 or 22 nucleotides long.
  • RNA ribonucleic acid
  • Microvesicle refers to a membranaceus particle comprising fragments of plasma membrane derived from various cell types. Typically, microvesicles have a diameter (or largest dimension where the particle is not spheroid) of between about 10 nm to about 5000 nm (e.g., between about 50 nm and 1500 nm, between about 75 nm and 1500 nm, between about 75 nm and 1250 nm, between about 50 nm and 1250 nm, between about 30 nm and 1000 nm, between about 50 nm and 1000 nm, between about 100 nm and 1000 nm, between about 50 nm and 750 nm, etc.).
  • microvesicles suitable for use in the present invention may originate from cells by membrane inversion, exocytosis, shedding, blebbing, and/or budding. Depending on the manner of generation (e.g., membrane inversion, exocytosis, shedding, or budding), the microvesicles contemplated herein may exhibit different surface/lipid characteristics.
  • Alternative names for microvesicles include, but are not limited to, exosomes, ectosomses, membrane particles, exosome-like particles, and apoptotic vesicles.
  • an abbreviated form "MV" is sometime used to refer to microvesicle.
  • Pathfinder cells refers to cells that have the capacity to induce or stimulate tissue repair, regeneration, remodeling or differentiation. Typically, pathfinder cells induce or stimulate tissue repair, regeneration, remodeling or differentiation without being a source of new tissue themselves. In some embodiments, pathfinder cells are also referred to as "progenitor cells.” As used herein, an abbreviated form "PC" is sometime used to refer to pathfinder cell.
  • Subject refers to a human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat, cattle, swine, sheep, horse or primate).
  • a human includes pre and post natal forms.
  • a subject is a human being.
  • a subject can be a patient, which refers to a human presenting to a medical provider for diagnosis or treatment of a disease.
  • the term "subject” is used herein interchangeably with “individual” or "patient.”
  • a subject can be afflicted with or is susceptible to a disease or disorder but may or may not display symptoms of the disease or disorder.
  • the term “substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest.
  • One of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, go to completion and/or proceed to completeness or achieve or avoid an absolute result.
  • the term “substantially” is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.
  • Susceptible to An individual who is "susceptible to" a disease, disorder, and/or condition has not been diagnosed with the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition may not exhibit symptoms of the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will develop the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will not develop the disease, disorder, and/or condition.
  • therapeutically effective amount As used herein, the term "therapeutically effective amount" of a therapeutic agent means an amount that is sufficient, when administered to a subject suffering from or susceptible to a disease, disorder, and/or condition, to treat, diagnose, prevent, and/or delay the onset of the symptom(s) of the disease, disorder, and/or condition. It will be appreciated by those of ordinary skill in the art that a therapeutically effective amount is typically administered via a dosing regimen comprising at least one unit dose.
  • Therapeutic agent refers to any agent that, when administered to a subject, has a therapeutic effect and/or elicits a desired biological and/or pharmacological effect.
  • a therapeutic agent of the invention refers to a peptide inhibitor or derivatives thereof according to the invention.
  • Transdifferentiation refers to a process in which a non-stem cell transforms into a different type of cell, or an already differentiated stem cell creates cells outside its already established differentiation path.
  • transdifferentiation include de- and then re-differentiation of adult cell types (or differentiated cell types).
  • Treating refers to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of and/or reduce incidence of one or more symptoms or features of a particular disease, disorder, and/or condition. Treatment may be administered to a subject who does not exhibit signs of a disease and/or exhibits only early signs of the disease for the purpose of decreasing the risk of developing pathology associated with the disease. DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS
  • the present invention provides, among other things, improved compositions and methods based on microvesicles or microvesicles-associated microRNAs for inducing tissue repair, remodeling, reconstruction, differentiation or transdifferentiation, and/or for treating associated diseases, disorders and conditions.
  • microvesicle refers to a membranaceus particle comprising fragments of plasma membrane derived from various cell types.
  • microvesicles are small particles that have a diameter (or largest dimension where the particle is not spheroid) of between about 10 nm to about 5000 nm (e.g., between about 50 nm and 1500 nm, between about 75 nm and 1500 nm, between about 75 nm and 1250 nm, between about 50 nm and 1250 nm, between about 30 nm and 1000 nm, between about 50 nm and 1000 nm, between about 100 nm and 1000 nm, between about 50 nm and 750 nm, etc.).
  • microvesicles suitable for use in the present invention may originate from cells by membrane inversion, exocytosis, shedding, blebbing, and/or budding. Depending on the manner of generation (e.g., membrane inversion, exocytosis, shedding, or budding), the microvesicles contemplated herein may exhibit different surface/lipid characteristics.
  • Alternative names for microvesicles include, but are not limited to, exosomes, ectosomses, membrane particles, exosome-like particles, and apoptotic vesicles.
  • microvesicles can serve as a means by which RNA and protein molecules can pass between cells. Without wishing to be bound by any particular theory, it is contemplated that microvesicles derived from pancreas-derived Pathfinder cells (PDPCs) may stimulate repair processes through the transfer of specific mR As, miRNAs, and/or proteins. Prior to the present invention, however, the specific microRNAs associated with microvesicles have not yet been characterized. As discussed in the microRNA and the Examples sections, the present inventors have developed an effective in vitro assay to analyze and identify microRNAs.
  • PDPCs pancreas-derived Pathfinder cells
  • microRNAs are specifically present in microvesicles (i.e., present only in microvesicles and not cells). This finding demonstrated for the first time that microvesicles do not just contain randomly sampled cytoplasmic or endosomal contents. It is contemplated that those microRNAs that are specifically present in the
  • microvesicles may be intracellularar regulators important for inducing tissue repair, remodeling, reconstruction, differentiation or transdifferentiation.
  • Microvesicles used in accordance with the present invention may be obtained from any cell types.
  • cells that produce microvesicles are also referred to as donor cells.
  • Suitable donor cells may include prokaryotic cells, archaebacterial cells, fungal cells, and single- and multi-cellular eukaryotic cells.
  • microvesicles are obtained from a eukaryotic cell (e.g., a eukaryotic cell from a multi-cellular organism, and particularly, a vertebrate cell (e.g., mammal)).
  • a eukaryotic cell e.g., a eukaryotic cell from a multi-cellular organism, and particularly, a vertebrate cell (e.g., mammal)
  • the donor cell may be nucleated or non-nucleated.
  • suitable donor cells include lymphocytes (e.g., polynucleated, polymorpho-nuclear lymphocytes, etc), fibroblasts, hepatocytes, as well as erythrocytes, and thrombocytes.
  • lymphocytes e.g., polynucleated, polymorpho-nuclear lymphocytes, etc
  • fibroblasts e.g., fibroblasts, hepatocytes, as well as erythrocytes, and thrombocytes.
  • Suitable donor cells may be derived from any desirable developmental stage with respect to its cell lineage.
  • suitable donor cells may include stem cells (which may or may not be committed to a particular cell line), partially differentiated stem cell, and fully differentiated cells.
  • suitable donor cells may be human embryonic stem cell-derived mesenchymal stem cells.
  • suitable donor cells are pathfinder cells.
  • pathfinder cells encompasses pluripotent cells that have the capacity to induce or stimulate tissue repair, regeneration, remodeling or differentiation.
  • Pathfinder cells may be obtained from any of a variety of tissue types, including, but not limited to, pancreas, kidney, lymph node, liver, spleen, myometrium, blood cells (including cells from peripheral blood and chord blood), and bone marrow.
  • Suitable donor cells may also be in any stage of their individual cellular age, ranging from just separated from their progenitor cell to a senescent or even dead cell. In some embodiments, shedding of microvesicles may be associated with apoptotic blebbing (which may be from the plasma membrane and/or the nucleus). Thus, donor cells may include pre-apoptotic donor cells, or cell committed to apoptosis.
  • suitable donor cells also include non-diseased and diseased cells, wherein diseased cells may be affected by one or more pathogens and/or conditions.
  • a diseased donor cell may be infected with a virus, an intracellular parasite, or bacterium.
  • a diseased cell may be a metabolically diseased cell (e.g., due to genetic defect, due to an enzyme, receptor, and/or transporter dysfunction, or due to metabolic insult), a neoplastic cell, or cell that has one or more mutations that render the cell susceptible to uncontrolled cell growth.
  • donor cells may be native (e.g., obtained by biopsy), cultured (e.g., native, or immortalized), or treated.
  • donor cells may be chemically and/or mechanically treated, resulting in a donor cell that exhibits a cell-specific stress response.
  • suitable donor cells may be treated with a natural or synthetic ligand to which the cell has a receptor or otherwise complementary structure.
  • a donor cell may also be treated with a drug or compound that alters at least one of a metabolism, cell growth, cell division, cell structure, and/or secretion.
  • suitable donor cells are recombinant cells.
  • recombinant donor cells may contain one or more nucleic acid molecules introduced by recombinant DNA technology. All known manners of introducing nucleic acids are deemed suitable for use herein (e.g., viral transfection, chemical transfection, electroporation, ballistic transfection, etc.).
  • the nucleic is a DNA
  • the DNA may be integrated into the genome of the donor cell, or that the DNA may reside as extrachromosomal unit within the cell.
  • Such DNA may be employed as a template for RNA production, which may have regulatory and/or protein encoding function.
  • nucleic acid is an RNA
  • such RNA may be used as a regulatory entity (e.g., via antisense or interference) and/or as a protein encoding entity.
  • nucleic acids encompass all known nucleic acid analogs (e.g., phosphorothioate analogs, peptide nucleic acid analogs, etc.)
  • Suitable donor cells may have any desirable origin, including endothelial, mesothelial, and ectothelial origin.
  • suitable donor cells include those found in a gland, an organ, muscle, a structural tissue, etc.
  • Suitable donor cells may be heterologous (or non- autologous) or autologous relative to recipient.
  • suitable donor cells may be derived from a tissue the same as or different than the recipient tissue (e.g., a diseased tissue to be treated).
  • micro vesicles obtained from donor cells such as fibroblast may be used to treat recipient diseased tissue pancreatic.
  • donor cells may be derived from a different organism (i.e., non-auto logous).
  • a donor cell may be a porcine pancreatic cell, while the recipient is human pancreatic.
  • microvesicles are obtained from whole blood, serum, plasma, or any other biological fluid, including urine, ascites fluid, milk, tears, spinal fluid, amniotic fluid, etc., which may be obtained from a living mammal.
  • microvesicles may also be obtained from stored materials (e.g., biological fluids, tissues, organs, etc.). Such storage may include storage at reduced temperature (e.g., 4 °C) or even storage in frozen form.
  • microvesicles may also be obtained from an in vitro source, and most typically from cell or tissue culture (see the Cell Culture Condition section below), or even organ culture.
  • microvesicles are obtained from cultured donor cells.
  • suitable donor cells may be cultured in a liquid medium that contains nutrients for the cells and are incubated in an environment where the temperature and/or gas composition is controlled.
  • specific cell culture conditions may vary depending on the type of cells used. For example, cell culture conditions for pathfinder cells have been described. See, e.g., International Patent Publication
  • An exemplary suitable medium for culture of pathfinder cells contains is CMRL 1066 medium (Invitrogen) supplemented with fetal bovine serum (e.g., at 10%).
  • media is supplemented with glutamine or glutamine-containing mixtures such as GLUTAMAXTM (Invitrogen) and/or with antibiotics (e.g., amphotericin, penicillin, and/or streptomycin).
  • cells are grown such they are attached on a surface. In some such embodiments, cells are grown as a monolayer on the surface. In some embodiments, cells are grown until they are confluent, i.e., until they cover the entire surface on which they are growing and there is nowhere else on the surface for cells to grow. In some embodiments, cells are grown until they are close to but not yet at confluence, i.e., until they cover most of the surface on which they are growing, but there is still some room for cells to grow.
  • cells are grown until they are approximately or more than 50%, 60%>, 70%>, 80%>, 85%, 90%, 95%, 97%, 98%, 99%, or more confluent, wherein x% confluent is defined as coverage of approximately x% of the growing surface. In some embodiments, cells are grown until they are approximately 50-99% (e.g., 60-99%, 70-99%, 75-99%, 80-99%, 85-99%, 90-99%, or 95-99%) confluent.
  • cells are grown on a substrate that may affect one or more properties of the cell, such as microvesicle production rate, cell proliferation rate, or miRNA expression pattern.
  • a nonwoven substrate such as a nonwoven fabric comprised of fibers.
  • nonwoven fabric includes, but is not limited to, bonded fabrics, formed fabrics, or engineered fabrics, that are manufactured by processes other than, weaving or knitting.
  • nonwoven fabric refers to a porous, textile-like material, usually in flat sheet form, composed primarily or entirely of fibers, such as staple fibers assembled in a web, sheet or batt.
  • Nonwoven fabrics can be created by a variety of techniques known in the textile industry. Various methods may create carded, wet laid, melt blown, spunbonded, or air laid nonwovens. Exemplary methods and substrates are described in U.S. Application
  • the density of the nonwoven fabrics may be varied depending upon the processing conditions. In one embodiment, the nonwoven fabrics have a density of about about 60 mg/mL to about 350 mg/mL. [0083] In some embodiments, the nonwoven substrates are biocompatible and/or bioabsorbable.
  • suitable biocompatible, bioabsorbable polymers include polymers selected from the group consisting of aliphatic polyesters, poly(amino acids), copoly(ether-esters), polyalkylene oxalates, polyamides, poly(iminocarbonates), polyorthoesters, polyoxaesters, polyamidoesters, polyoxaesters containing amine groups, poly(anhydrides), polyphosphazenes, and blends thereof.
  • the aliphatic polyesters are homopolymers and/or copolymers of monomers selected from the group consisting of lactide (which includes lactic acid, D-,L- and meso lactide), glycolide (including glycolic acid), epsilon-caprolactone, p- dioxanone (l ,4-dioxan-2-one), trimethylene carbonate (l ,3-dioxan-2-one), alkyl derivatives of trimethylene carbonate, delta-valerolactone, beta-butyrolactone, gamma-butyrolactone, epsilon- decalactone, hydroxybutyrate (repeating units), hydroxyvalerate (repeating units), 1 ,4-dioxepan- 2-one (including its dimer l ,5,8, 12-tetraoxacyclotetradecane-7, 14-dione), l ,5-dioxepan
  • aliphatic polyesters which include, but are not limited to homopolymers and/or copolymers of lactide (which includes lactic acid, D-,L- and meso lactide), glycolide (including glycolic acid), epsilon- caprolactone, p-dioxanone (l ,4-dioxan-2-one), trimethylene carbonate (l ,3-dioxan-2-one) and combinations thereof.
  • lactide which includes lactic acid, D-,L- and meso lactide
  • glycolide including glycolic acid
  • epsilon- caprolactone p-dioxanone
  • trimethylene carbonate l ,3-dioxan-2-one
  • the aliphatic polyesters are homopolymers and/or copolymers of monomers selected from the group consisting of lactide (which includes lactic acid, D-,L- and meso lactide), glycolide (including glycolic acid), epsilon-caprolactone, p- dioxanone (l ,4-dioxan-2-one), trimethylene carbonate (l ,3-dioxan-2-one) and combinations thereof.
  • lactide which includes lactic acid, D-,L- and meso lactide
  • glycolide including glycolic acid
  • epsilon-caprolactone p- dioxanone
  • trimethylene carbonate l ,3-dioxan-2-one
  • the aliphatic polyesters are homopolymers and/or copolymers of monomers selected from the group consisting of lactide (which includes lactic acid, D-,L- and meso lactide), glycolide (including glycolic acid), and p-dioxanone (1 ,4-dioxan- 2-one) and combinations thereof.
  • lactide which includes lactic acid, D-,L- and meso lactide
  • glycolide including glycolic acid
  • p-dioxanone (1 ,4-dioxan- 2-one
  • suitable fabrics include those that comprise aliphatic polyester fibers, e.g., fibers that comprise homopolymers or copolymers of lactide (e.g., lactic acid D-.
  • L- and meso lactide L- and meso lactide
  • glycolide e.g., glycolic acid
  • epsilon- caprolactone p-dioxanone
  • p-dioxanone l ,4-dioxan-2-one
  • trimethylene carbonate l ,3-dioxan-2-one
  • suitable farbics may contain poly(glycolide-co-lactide) (PGA/PL A); poly(lactide-co-glycolide) (PL A/PGA); 1 ,3 propanediol (PDO), and/or blends thereof.
  • cells are grown on a solid surface that has been textured in a particular way so as to confer special properties to the surface (e.g., repulsion or attraction of certain substances, reduced adsorption of proteins, etc.), which in turn may influence behavior of cells on such surfaces.
  • cells may be grown on a nano-textured surface
  • Nanosurface See, e.g., US 7,597,950; Sun et al. (2009) “Combining nanosurface chemistry and microfluidics for molecular analysis and cell biology,” Analytica Chimica Acta, 650(1):98- 105; the entire contents of each of which are herein incorporated by reference. Nanosurfaces and other textured surfaces may be generated, for example by any of a variety of methods known in the art, including sanding, chemical etching, sandblasting, and/or dewetting.
  • cells are grown in suspension.
  • Various growth medium may be used to culture donor cells.
  • Growth medium generally refers to any substance or preparation used for the cultivation of living cells.
  • the growth medium is renal growth medium.
  • the growth medium is Dulbecco's Modification of Eagle's medium (DMEM).
  • DMEM Dulbecco's Modification of Eagle's medium
  • cells are grown in media that does not contain serum.
  • cells are grown for at least a period of time in media that has been depleted of micro vesicles from media components.
  • media containing fetal bovine serum may be depleted of bovine micro vesicles.
  • commercially available medium that is depleted of microviescles e.g. , bovine microvesicles is used.
  • cells are grown at or about 37 °C. In some embodiments, cells are grown in the presence of at or about 5% C0 2 . In some embodiments, cells are grown under room air oxygen conditions. In some embodiments, cells are grown under conditions where the oxygen pressure is less than or equal to 5% 0 2 . In some embodiments, cells are grown in conditions of normal oxygen (e.g., about 5% 0 2 ). In some embodiments, cells are grown in hypoxic conditions (e.g., low oxygen such as ⁇ 5%, ⁇ 4%, ⁇ 3 %, ⁇ 2%, or ⁇ 1% 0 2 ). [0090] In some embodiments, donor cells are grown under serum starvation conditions.
  • serum starvation includes, but is not limited to, serum repletion, serum-free medium or conditions.
  • serum starvation conditions are known in the art and can be used to practice the present invention.
  • cells may be grown under serum starvation conditions for about 6, about 12, about 18, about 24, about 30, about 36, about 42, about 48 hours, or longer.
  • cells may be grown under conditions where the serum concentration is less than or equal to 10%, less than or equal to 9%, less than or equal to 8%, less than or equal to 7%, less than or equal to 6%, less than or equal to 5%, less than or equal to 4%, less than or equal to 3%, less than or equal to 2%, less than or equal to 1.5%, less than or equal to 1%, or less than or equal to 0.5%.
  • cells may be grown under conditions where the serum concentration is 0% (i.e., serum is absent).
  • cells may be grown under conditions where the serum concentration is decreased in a step-wise manner over time.
  • cells may be grown under conditions where the serum concentration is between about 2% to about 11% (e.g., about 2%, 3%), 4%), 5%, 6%, 7%, 8%), 9%), 10%, or 11%) and is subsequently reduced in one or more steps to a serum concentration between about 0% to about 5% (e.g., about 0%, 0.5%, 1%, 1.5%, 2%, 3%, 4%, or 5%).
  • the serum concentration is between about 2% to about 11% (e.g., about 2%, 3%), 4%), 5%, 6%, 7%, 8%), 9%), 10%, or 11%) and is subsequently reduced in one or more steps to a serum concentration between about 0% to about 5% (e.g., about 0%, 0.5%, 1%, 1.5%, 2%, 3%, 4%, or 5%).
  • microvesicles Various methods of isolating or enriching microvesicles known in the art may be used to practice the present invention.
  • the terms “isolation” or “isolating” in conjunction with microvesicles are interchangeably used with the terms “enrichment” or “enriching,” and refer to one or more process steps that result in an increase of the fraction of microvesicles in a sample as compared to the fraction of microvesicles in the obtained biological sample.
  • microvesicles may be purified to homogeneity, purified to at least 90% (with respect to non-microvesicle particulate matter), at least 80%, at least 70%, at least 60%, at least 50%), at least 40%, at least 30%, or at least 20% (or even less).
  • physical properties of microvesicles- may be employed to separate them from a medium or other source material.
  • microvesicles may be separated on the basis of electrical charge (e.g.,
  • electrophoretic separation size (e.g., filtration, molecular sieving, etc), density (e.g., regular or gradient centrifugation), Svedberg constant (e.g., sedimentation with or without external force, etc).
  • size e.g., filtration, molecular sieving, etc
  • density e.g., regular or gradient centrifugation
  • Svedberg constant e.g., sedimentation with or without external force, etc.
  • microvesicles are isolated or purified by centrifugation
  • a sample may be centrifuged at a fairly low centrifugal force (e.g., approximately 16,000 x g) sufficient to pellet larger microvesicles (e.g., approximately 1000 nm or more).
  • a fairly low centrifugal force e.g., approximately 16,000 x g
  • a sample e.g., the resulting supernatant from the initial low speed spin
  • a higher centrifugal force e.g., approximately 120,000 x g
  • a microvesicle preparation prepared using this method may contain substantially small particles, for example, particles with a size ranging from about lOnm to 1000 nm (e.g., about 50-1000 nm, 75-1000 nm, 100-1000 nm, 10-750 nm, 50-750 nm, 100-75 Onm, 100-500 nm).
  • microvesicle fractionation schematic is depicted in Figure 3.
  • small particles are also referred to as exosomes, exosome-like vesicles, and/or membrane particles.
  • such fraction is referred to as exosome fraction.
  • microvesicles are isolated or purified by precipitation. It will be appreciated that various precipitation conditions may be used in order to obtain a desired fraction of isolated or purified microvesicles. For example, various kits are available for exosome precipitation, such as ExoQuickTM and Exo-Quick-TCTM (available from System Biosciences, Mountain View, California) and may be used in accordance with the present invention.
  • ExoQuickTM and Exo-Quick-TCTM available from System Biosciences, Mountain View, California
  • isolation may be based on one or more biological properties, and may employ surface markers (e.g., for precipitation, reversible binding to solid phase, FACS separation, specific ligand binding, non-specific ligand binding such as annexin V, etc.).
  • the microvesicles may also be fused using chemical and/or physical methods, including PEG-induced fusion and/or ultrasonic fusion.
  • microvesicles are obtained from conditioned media from cultures of microvesicle-producing cells.
  • microvesicles suitable for the present invention may be synthetically produced.
  • Synthetic microvesicles typically include one or more membrane components obtained from a donor cell.
  • synthetic microvesicles include at least one microRNA described herein.
  • synthetic microvesicles may be prepared by disintegration of a donor cell (e.g., via detergent, sonication, shear forces, etc.) and use of the crude preparation or an at least partially enriched membrane fraction to reconstitute one or more microvesicles.
  • exogenous microRNAs may be added to microvesicles.
  • microvesicles comprise one or more specific microRNAs.
  • microvesicle-specific microRNAs include those microRNAs only present in microvesicles not in cells and those microRNAs that are substantially enriched in microvesicles as compared to cells.
  • Microvesicle-specific microRNAs encompass microRNAs isolated or purified from microvesicles or synthesized using recombinant or chemical techniques.
  • microRNA molecules may be generated by in vitro transcription of DNA sequences encoding the relevant molecule. Such DNA sequences may be incorporated into a wide variety of vectors with suitable RNA polymerase promoters such as T7, T3, or SP6.
  • miRNAs refers to post-transcriptional regulators that typically bind to complementary sequences in the three prime untranslated regions (3 ' UTRs) of target messenger RNA transcripts (mRNAs), usually resulting in gene silencing.
  • miRNAs are short ribonucleic acid (RNA) molecules.
  • microRNAs may be approximately 18-25 nucleotides long (e.g., approximately 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides long).
  • microvesicle specific microRNAs may be used to induce or stimulate tissue or cell growth, remodeling, reconstruction, differentiation and/or transdifferentitation, among other functions.
  • the present invention provides, among other things, methods of identifying microvesicle-specific microRNAs or any microRNAs that can induce or stimulate tissue or cell growth, remodeling, reconstruction, differentiation and/or transdifferentitation.
  • inventive methods according to the present invention may include one or more of the following steps of: providing cells grown in a micro vesicle-depleted medium, adding an miRNA to the medium, and determining if addition of the miRNA increases cell proliferation rate as compared to a control, thereby identifying if the miRNA induces cell growth and/or regeneration.
  • doubling time e.g., the time it takes to double the population of cells in a cell culture vessel is used as an indication of cell proliferation rate.
  • Cell proliferation assays are known in the art, and any of a variety of such assays may be employed to determine cell proliferation rates. For example, cell numbers (e.g., per volume of media; or for an entire cell culture vessel, etc.) may be counted using standard cell counting techniques known in the art. In some such cell counting methods, cells are labeled with a dye to ease detection. In some methods of assessing cell proliferation, cells are brought into a suspension of a known volume and the density (e.g., optical density) of at least an aliquot of the cell suspension is measured using standard spectrophotometry techniques.
  • density e.g., optical density
  • Some cell proliferation assays measure DNA synthesis. For example, incorporation of a labeled nucleotide or nucleotide analog (e.g., BrdU (bromodeoxyuridine), tritium-labeled thymidine, etc. can be employed in a cell proliferation assay.
  • Some cell proliferation assays measure conversion of a substrate by a metabolic enzyme. For example, an "MTT" assay measures the cleavage of a tetrazolium salt WST-1 to formazan by cellular mitochondrial dehydrogenases.
  • inventive methods for identifying microR A according to the present invention may include one or more of the following steps of: creating a wounded area in cells grown to confluence; treating the cells with an miRNA; and determining a rate of re- growth of the treated cells across the wounded area as compared to a control, thereby identifying if the miRNA induces cell growth and/or regeneration.
  • Re-growth over wounded areas in a confluent cell culture can be measured by methods known in the art.
  • re-growth is measured quantitatively.
  • re-growth can be measured quantitatively using, e.g. , an XCELLIGENCETM System (Roche Applied Science).
  • methods are performed in a high-throughput fashion, e.g., with many miRNAs being tested in parallel.
  • Multi-well plates e.g., 24- well, 48-well, 96-well, 324-well, etc.
  • Any type of cells that can be grown in culture can be used in methods of the invention.
  • various donor cells described herein may be used.
  • various donor cells described herein may be used.
  • suitable cells include pancreas-derived pathfinder cells, fibroblasts, and cardiomyocytes.
  • miRNAs that are isolated from microvesicles may be used.
  • miRNAs that have been identified in the literature or in other experiments as being of potential interest e.g. , as being associated with a disease, with transdifferentiation, with potential therapeutic applications, etc.
  • a miRNA library is used.
  • a collection of cloned miRNAs from an expression library may be used in accordance with methods of the invention to identify one or more miRNAs that induce cell growth and/or regeneration.
  • an miRNA expression library from a cell type of interest is used.
  • Appropriate controls in the step of determining include, but are not limited to, untreated cells that are otherwise grown under identical conditions (e.g. , cells to which no miR A is added), and/or cells to which a "control" miRNA is added that are otherwise grown under identical conditions.
  • the "control" miRNA if used, generally has a known effect on cell growth and/or regeneration. In some embodiments, more than one control is used. In some embodiments, a negative control (one for which no inducement of cell growth and/or regeneration is expected) is used. In some embodiments, a positive control (one for which inducement of cell growth and/or regeneration is expected) is used. In some embodiments, both a positive and negative control is used.
  • Table 1 shows exemplary microRNAs that are specifically present in
  • micro vesicles In some embodiments, it was found that miRNA-122, miRNA-127, miRNA- 133b, miRNA-323, miRNA-433, miRNA-451 , miRNA-466h, miRNA-467c, miRNA-467e, miRNA-468, miRNA-491, miRNA-495, miRNA-546, miRNA-666, miRNA-680, and miRNA- 346 (SEQ ID NOs: l-29) are present in microvesicles at relatively higher concentrations.
  • Tables 3-13 Additonal microRNAs identified according to the present invention are listed in Tables 3-13.
  • Table 1 lists exemplary miRNA sequences for each miRNA of interest; corresponding miRNA sequences in other species, including, but not limited to, Homo sapiens, Rattus norvegicus, Mus musculus, Danio rerio, and Gallus gallus,are publicly available (e.g., see
  • miR127 CUGAAGCUCAGAGGGCUCUGAU SEQ ID NO:3 (Homo sapiens, miR127-5p)
  • CACAUUACACGGUCGACCUCU (SEQ ID NO:9) (Homo sapiens, miR323-3p)
  • CACAUUACACGGUCGACCUCU (SEQ ID NO: 10) (Rattus novergicus)
  • AAACCGUUACCAUUACUGAGUU (Homo sapiens)
  • AAACCGUUACCAUUACUGAGUU SEQ ID NO: 17 (Rattus norvegicus)
  • AAACAAACAUGGUGCACUUCUU (SEQ ID NO:25) (Homo sapiens)
  • AAACAAACAUGGUGCACUUCUU (SEQ ID NO:26) (Rattus norvegicus)
  • AGC GGGC AC GGCUGUG AG AGC C (SEQ ID NO:28) miR666
  • ACUCCAUUUGUUUUGAUGAUGGA SEQ ID NO:30 (Homo sapiens)
  • CAUCAUCGUCUCAAAUGAGUCU (SEQ ID NO:31) (Homo sapiens, variant)
  • UUCCUAUGCAUAUACUUCUUU (SEQ ID NO:34) (Rattus norvegicus)
  • AUCAUAGAGGAAAAUCCAUGUU (SEQ ID NO:50) (Homo sapiens)
  • AUCAUAGAGGAACAUCCACUU (SEQ ID NO:52) (Rattus norvegicus, miR376-3p)
  • GAUCAGGGCCUUUCUAAGUAGA SEQ ID NO:59
  • GAUCAGGGCCUUUCUAAGUAGA SEQ ID NO:61
  • AACCAGUACCUUUCUGAGAAGA (SEQ ID NO:63) (Mus musculus, variant)
  • AAACAUUCGCGGUGCACUUCUU (SEQ ID NO:65) (Homo sapiens)
  • AAACAUUCGCGGUGCACUUCU (SEQ ID NO:67) (Rattus norvegicus, variant)
  • GAGCUUAUUCAUAAAAGUGCAG SEQ ID NO:69
  • miR590 Homo sapiens, miR590-5p
  • UAAUUUUAUGUAUAAGCUAGU SEQ ID NO:70
  • microRNAs identified according to the present invention may be used to induce or stimulate tissue or cell growth, remodeling, reconstruction, differentiation and/or
  • suitable microRNAs may include microRNAs having a sequence at least 70% (e.g., 75%, 80%>, 85%, 90%, 95%, 96%, 97%, 98%, 99%) identical to any one of microRNAs identified in Table 1 and Tables 7-13.
  • suitable microRNAs are functional variants of microRNAs that are present at a relatively higher concentration in micro vesicles.
  • suitable microRNAs may include microRNAs having a sequence at least 70% (e.g., 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%) identical to any one of SEQ ID NO: l to 16.
  • Percent (%) nucleic acid sequence identity with respect to microRNA sequences identified herein is defined as the percentage of nucleotides in a candidate sequence that are identical with the nucleotides in a reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.
  • the WU-BLAST-2 software is used to determine amino acid sequence identity (Altschul et ah, Methods in Enzymology, 266, 460-480 (1996); http://blast.wustl/edu/blast/README.html).
  • WU-BLAST-2 uses several search parameters, most of which are set to the default values.
  • HSP score (S) and HSP S2 parameters are dynamic values and are established by the program itself, depending upon the composition of the particular sequence, however, the minimum values may be adjusted and are set as indicated above.
  • Suitable microRNAs may be comprised entirely of natural R A nucleotides, or may instead include one or more nucleotide analogs and/or modifications.
  • the microRNA structure may be stabilized, for example by including nucleotide analogs at one or more free strand ends in order to reduce digestion, e.g., by exonucleases.
  • Suitable microRNAs may contain modified ribonucleotides, that is, ribonucleotides that contain a modification in the chemical structure of an unmodified nucleotide base, sugar and/or phosphate (or phospodiester linkage).
  • an "unmodified ribonucleotide” has one of the bases adenine, cytosine, guanine, and uracil joined to the 1 ' carbon of beta-D-ribo-furanose.
  • Modified microRNA molecules may also contain modified backbones or non-natural internucleoside linkages, e.g., modified phosphorous-containing backbones and non-phosphorous backbones such as morpholino backbones; siloxane, sulfide, sulfoxide, sulfone, sulfonate, sulfonamide, and sulfamate backbones; formacetyl and thioformacetyl backbones; alkene-containing backbones; methyleneimino and methylenehydrazino backbones; amide backbones, and the like.
  • modified backbones or non-natural internucleoside linkages e.g., modified phosphorous-containing backbones and non-phosphorous backbones such as morpholino backbones; siloxane, sulfide, sulfoxide, sulfone, sulfonate, sulfonamide, and sulfamate back
  • the present invention provides methods of using microvesicles and/or microRNAs for inducing or stimulating tissue or cell growth, remodeling, reconstruction, differentiation and/or transdifferentitation, or treating associated diseases, disorders or conditions. While not wishing to be bound by a particular theory or hypothesis, it is contemplated that microvesicles may induce changes within target tissue or cells to convert them into active repair mode by providing microRNAs and/or other components (e.g., membrane associated polypeptide, transcription factors, etc.) that will regulate expression of genes relating to, e.g., increased cell mobility, tissue remodeling and reprogramming, growth, angiogenesis, cell adhesion and cell signaling, etc.
  • microRNAs and/or other components e.g., membrane associated polypeptide, transcription factors, etc.
  • microvesicles will typically not be part of the new tissue or cells.
  • microvesicles or microRNAs from different tissues, cell types or organisms may be used.
  • microvesicles or microRNAs may be used without inducing immuno reaction.
  • microvesicles or microRNAs may be used without an immunosuppressant.
  • microvesicles or microRNAs can be derived from autologous cells
  • microvesicles are derived from tissue that is the same as the diseased tissue.
  • tissue i.e., cells from the same individual as the patient
  • non-auto logous cells i.e., cells from a different individual as the patient
  • microvesicles are derived from tissue that is the same as the diseased tissue.
  • microvesicles may be taken from healthy kidney cells from the same or different individual being treated.
  • microvesicles are derived from tissue that is different than the diseased tissue.
  • methods of treatment comprise one or more steps that are performed in vitro or ex vivo to induce cells ("recipient cells”) to differentiate or
  • transdifferentiate into a desirable cell type. Such recipient cells can then be transferred into a patient.
  • provided methods comprise co-culturing donor cells (i.e., cells that produce microvesicles) and recipient cells (i.e., cells that received microvesicles and/or contents of such microvesicles) ex vivo and then transferring recipient cells into an patient.
  • recipient cells are transferred back into the same individual from whom recipient cells were obtained.
  • pathfinder cells can be co-cultured with bone marrow cells obtained from an patient for a period of time ex vivo to allow transfer of microvesicles and/or their contents, then bone marrow cells may be transferred back into the individual.
  • recipient cells are tested for expression of specific biomarkers such as certain microRNAs after co-culturing with donor cells before transfer into a patient.
  • methods of treatment comprise a step of administering to a patient in need of treatment a therapeutically effective amount of one or more microRNAs as described herein.
  • miR As may be used in the absence or presence of microvesicles or derivatives thereof.
  • methods and compositions may be used to treat diseases, disorders, or conditions in various tissues including, but not limited to, central nervous system (CNS), peripheral nervous system, cardiovascular system, respiratory system, gastrointestinal tract and associated glands, integumentary system, musculoskeletal system, and other systems of the body.
  • CNS central nervous system
  • methods and compositions e.g., microvesicles and/or microRNAs
  • methods and compositions may be used to treat age-related degeneration.
  • methods and compositions e.g., microvesicles and/or microRNAs
  • methods and compositions e.g., microvesicles and/or microRNAs
  • inflammation includes inflammatory conditions occurring in many disorders which include, but are not limited to:
  • SIRS Systemic Inflammatory Response
  • Alzheimer's Disease and associated conditions and symptoms including: chronic neuroinflammation, glial activation; increased microglia; neuritic plaque formation; and response to therapy
  • ALS Amyotropic Lateral Sclerosis
  • arthritis and associated conditions and symptoms including, but not limited to: acute joint inflammation, antigen-induced arthritis, arthritis associated with chronic lymphocytic thyroiditis, collagen- induced arthritis, juvenile arthritis; rheumatoid arthritis, osteoarthritis, prognosis and
  • asthma and associated conditions and symptoms, including: bronchial asthma; chronic obstructive airway disease;
  • cardiovascular diseases and associated conditions and symptoms, including atherosclerosis; autoimmune myocarditis, chronic cardiac hypoxia, congestive heart failure, coronary artery disease, cardiomyopathy and cardiac cell dysfunction, including: aortic smooth muscle cell activation; cardiac cell apoptosis; and immunomodulation of cardiac cell function; diabetes and associated conditions and symptoms, including autoimmune diabetes, insulin-dependent (Type 1) diabetes, diabetic periodontitis, diabetic retinopathy, and diabetic nephropathy);
  • Type 1 diabetes diabetes, diabetic periodontitis, diabetic retinopathy, and diabetic nephropathy
  • gastrointestinal inflammations and related conditions and symptoms, including celiac disease, associated osteopenia, chronic colitis, Crohn's disease, inflammatory bowel disease and ulcerative colitis); gastric ulcers; hepatic inflammations such as viral and other types of hepatitis, cholesterol gallstones and hepatic fibrosis, HIV infection (and associated conditions and symptoms, including degenerative responses, neurodegenerative responses, and HIV associated Hodgkin's Disease), Kawasaki's Syndrome (and associated diseases and conditions, including mucocutaneous lymph node syndrome, cervical lymphadenopathy, coronary artery lesions, edema, fever, increased leukocytes, mild anemia, skin peeling, rash, conjunctiva redness, thrombocytosis; multiple sclerosis, nephropathies (and associated diseases and conditions, including diabetic nephropathy, endstage renal disease, acute and chronic glomerulonephritis, acute and chronic interstitial nephritis, lupus nephritis
  • Immunological disorders including autoimmune diseases, such as alopecia aerata, autoimmune myocarditis, Graves' disease, Graves opthalmopathy, lichen sclerosis, multiple sclerosis, psoriasis, systemic lupus erythematosus, systemic sclerosis, thyroid diseases (e.g. goiter and struma lymphomatosa (Hashimoto's thyroiditis, lymphadenoid goiter), sleep disorders and chronic fatigue syndrome and obesity (non-diabetic or associated with diabetes).
  • autoimmune diseases such as alopecia aerata, autoimmune myocarditis, Graves' disease, Graves opthalmopathy, lichen sclerosis, multiple sclerosis, psoriasis, systemic lupus erythematosus, systemic sclerosis, thyroid diseases (e.g. goiter and struma lymphomatosa (Hashimoto's thyroiditis, lymphadenoid goiter
  • viral trauma including strokes and ischemias, encephalitis, encephalopathies, epilepsy, perinatal brain injury, prolonged febrile seizures, SIDS and subarachnoid hemorrhage), low birth weight (e.g.
  • febrile response general inflammatory response
  • acute respiratory distress response acute systemic inflammatory response
  • wound healing acute systemic inflammatory response
  • adhesion immunoinflammatory response
  • neuroendocrine response fever development and resistance
  • acute -phase response stress response
  • disease susceptibility repetitive motion stress, tennis elbow, and pain management and response.
  • methods and compositions of the present invention can be used to treat or ameliorate inflammation associated with an immunodeficiency disease, disorder, or condition.
  • diseases, disorders, and conditions that may be characterized by immunodeficiency include hypgammaglobulinemia, agammaglobulinemia, ataxia telengiectasia, severe combined immunodeficiency disease (SCID), acquired
  • AIDS immunodeficiency syndrome
  • pathfinder cells and/or cells differentiated from pathfinder cells treat or ameliorate immunodeficiency by stimulating reconstitution of one or more blood cell types, i.e., cells of the immune system. It is contemplated that pathfinder cell-associated microRNAs disclosed herein would similarly be useful in treating or ameliorating immunodeficiency.
  • methods and compositions of the present invention are used to treat or ammeliorate an autoimmune diesase, disorder or condition.
  • autoimmunity is the failure of an organism to recognize its own constituent parts as "self,” which results in an immune response against the organism's own tissues and cells.
  • Exemplary autoimmune diseases and/or suspected autoimmune diseases include, but are not limited to, Acute disseminated encephalomyelitis (ADEM), Addison's disease, Alopecia universalis, Ankylosing spondylitisis, Antiphospholipid antibody syndrome (APS), Aplastic anemia, Autoimmune hemolytic anemia, Autoimmune hepatitis, Autoimmune inner ear disease (AIED), Autoimmune lymphoproliferative syndrome (ALPS), Autoimmune oophoritis, Balo disease, Behcet's disease, Bullous pemphigoid, Cardiomyopathy, Chagas' disease, Chronic fatigue immune dysfunction syndrome (CFIDS), Chronic inflammatory demyelinating polyneuropathy, Crohn's disease, Cicatrical pemphigoid, Coeliac sprue-dermatitis herpetiformis, Cold agglutinin disease, CREST syndrome, Degos disease, Diabetes mellitus, Discoid lupus, Dys
  • Hidradenitis suppurativa Idiopathic and/or acute thrombocytopenic purpura, Idiopathic pulmonary fibrosis, IgA neuropathy, Interstitial cytisis, Juvenile arthritis, Kawasaki's disease, Lichen planus, Lupus erythematosus, Lyme disease, Meniere disease, Mixed connective tissue disease (MCTD), Multiple sclerosis, Myasthenia gravis, Neuromyotonia, Opsoclonus myoclonus syndrome (OMS), Optic neuritis, Ord's thyroiditis, Osteoarthritis, Pemphigus vulgaris,
  • Pernicious anemia Polyarthritis, Polychondritis, Polymyositis and dermatomyositis, Primary biliary cirrhosis, Psoriasis, Polyarteritis nodosa, Polyglandular syndromes, Polymyalgia rheumatica, Primary agammaglobulinemia, Raynaud phenomenon, Reiter's syndrome,
  • tissue/organ transplantation may cause acute tissue damage and microvesicles disclosed herein may be administered into an organ/tissue transplant recipient to stimulate tissue repair, regeneration, reconstitution, remodeling, and/or inducing immune tolerance, thereby alleviating transplantation stress.
  • the present invention may be used to facilitate any organ transplantation including, but not limited to, heart, kidney, liver, lung, pancreas, intestine, thymus, and skin transplantation.
  • methods and compositions of the present invention are used to treat or ameliorate a disease, disorder, or condition associated with graft rejection.
  • graft rejection may result from functional immune cells in a recipient recognizing a donor organ or tissue as a foreign entity and mounting of an immunologic attack on the donor organ or tissue.
  • graft rejection arises in an acute phase following transplantation of donor organs or tissues to a recipient.
  • graft rejection arises in a chronic phase following transplantation of donor organs or tissues to a recipient. It is to be understood that the present invention encompasses methods and compositions for treatment of acute and/or chronic graft rejection.
  • graft versus host disease may result from functional immune cells in a transplanted tissue or organ from a donor recognizing the recipient as a foreign entity and mounting an immunologic attack on the recipient's cells and/or tissues.
  • GVHD may result from functional immune cells in a transplanted tissue or organ from a donor recognizing the recipient as a foreign entity and mounting an immunologic attack on the recipient's cells and/or tissues.
  • GVHD arises in an acute phase following transplantation of donor organs or tissues to a recipient.
  • GVHD arises in a chronic phase following transplantation of donor organs or tissues to a recipient. It is to be understood that the present invention encompasses methods and compositions for treatment of acute and/or chronic GVHD.
  • pathfinder cells or their extracellular secretomes induce immune tolerance and thus are particularly useful in treating inflammation and suppressing, inhibiting or reducing transplantation associated stress.
  • the pathfinder cells or their extracellular secretomes induce immune tolerance by inducing increased IL-2 response, resulting in expansion of regulatory T cells (e.g., increased level and/or activity of T regulatory cells), decreased level and/or activity of cytotoxic T cells and/or helper T cells, and/or suppression of T cell or non T cell lymphocyte responses.
  • pathfinder cells or their extracellular secretomes suppress pro-inflammatory and/or anti-angiogenic cytokine or chemokine response.
  • Pro-inflammatory and/or anti-angiogenic cytokines or chemokines are well known in the art.
  • Exemplary pro-inflammatory and/or anti- angiogenic cytokines or chemokines include, but are not limited to, IL-4, IL-5, IL-6, IL-10, IL- 12, IL-13, IL-17, GMCSF, TGF- ⁇ , TNF-a, IFN- ⁇ , MCAF, and MIP1.
  • cells or their extracellular secretomes increase anti-inflammatory and/or pro-angiogenic cytokine or chemokine response.
  • Anti-inflammatory and/or pro-angiogenic cytokines or chemokines are known in the art.
  • Exemplary anti-inflammatory and/or pro- angiogenic cytokines or chemokines include, but are not limited to, IL- ⁇ , GSCF, and IL-8.
  • severe adverse effects include, but are not limited to, substantial immune response, toxicity, or death.
  • substantial immune response refers to severe or serious immune responses, such as adaptive T-cell immune responses.
  • inventive methods according to the present invention do not involve concurrent immunosuppressant therapy (i.e., any immunosuppressant therapy used as pre -treatment/pre-conditioning or in parallel to the method).
  • inventive methods according to the present invention do not involve an immune tolerance induction in the subject being treated.
  • inventive methods according to the present invention do not involve a pre-treatment or preconditioning of the subject using T-cell immunosuppressive agent.
  • pathfinder cells or their extracellular secretomes can mount an immune response against these agents.
  • Immune tolerance may be induced using various methods known in the art. Any immunosuppressant agent known to the skilled artisan may be employed together with a combination therapy of the invention.
  • immunosuppressant agents include but are not limited to cyclosporine, FK506, rapamycin, CTLA4-Ig, and anti-TNF agents such as etanercept (see e.g.
  • the anti-IL2 receptor (.alpha.- subunit) antibody daclizumab (e.g. Zenapax.TM.), which has been demonstrated effective in transplant patients, can also be used as an immunosuppressant agent (see e.g. Wiseman et al, 1999, Drugs 58, 1029-1042; Beniaminovitz et al, 2000, N. Engl J. Med. 342, 613-619; Ponticelli et al, 1999, Drugs R. D.
  • Additionalimmunosuppressant agents include but are not limited to anti-CD2 (Branco et al., 1999, Transplantation 68, 1588-1596; Przepiorka et al, 1998, Blood 92, 4066-4071), anti-CD4 (Marinova-Mutafchieva et al, 2000, Arthritis Rheum. 43, 638-644; Fishwild et al, 1999, Clin. Immunol.
  • methods and compositions e.g., pathfinder cells, cells differentiated from pathfinder cells, microvesicles and/or microRNAs
  • methods and compositions may be used to treat diseases, disorders, or conditions in various tissues including, but not limited to, central nervous system (CNS), peripheral nervous system, cardiovascular system, respiratory system, gastrointestinal tract and associated glands, integumentary system, musculoskeletal system, and other systems of the body.
  • CNS central nervous system
  • methods and compositions according to the present invention may be used to treat age-related degeneration as well as progerias.
  • methods and compositions according to the present invention may be used to treat inflammation.
  • cells and/or microRNAs according to the present invention may be suitable for cosmetic uses or for treating a condition or disorder associated with a cosmetic surgical procedure.
  • Examples of CNS-related diseases, disorders or conditions that may be treated by the methods and compositions of the present invention include motor neurone disease, multiple sclerosis, degenerative diseases of the CNS, dementive illnesses such as Alzheimer's disease, age related dysfunction of the CNS, Parkinson's disease, cerebrovascular accidents, epilepsy, temporary ischaemic accidents, disorders of mood, psychotic illnesses, specific lobe dysfunction, pressure related injury, cognitive dysfunction or impairments, deafness, blindness anosmia, diseases of the special senses, motor deficits, sensory deficits, head injury and trauma to the CNS.
  • Methods and products of the present invention may also be used to enhance brain function or ameliorate deficiencies at a functional level or to facilitate post surgical repair of the CNS.
  • Examples of diseases, disorders or conditions of the cardiovascular system that may be treated by the methods and compositions of the present invention include arrhythmias, myocardial infarction and other heart attacks, pericarditis, congestive heart diseases, valve- related pathologies, myocardial, endocardial and pericardial dysfunctions or degeneration, age- related cardiovascular disorders, dysfunctions, degeneration or diseases, sclerosis and thickening of valve flaps, fibrosis of cardiac muscle, decline in cardiac reserve, congenital defects of the heart or circulatory system, developmental defects of the heart or circulatory system, repair of hypoxic or necrotic damage, blood vessel damage and cardiovascular diseases or dysfunction (e.g., angina, dissected aorta, thrombotic damage, aneurysm, atherosclerosis, emboli damage and other problems associated with blood flow, pressure or impediment).
  • arrhythmias e.g., myocardial infarction and other heart attacks
  • pericarditis congestive heart diseases
  • Methods and compositions of the present invention may also be used to enhance cardiovascular function or health and to revascularise tissues. Moreover, methods and compositions of the present invention may be used to repair, modify, enhance or regenerate traumatic damage to the heart or blood vessels and as a technique to enhance the transplantation/implantation of a whole organ or its parts. Examples of this latter embodiment include heart transplantation, valve replacement surgeries, implantation of prosthetic devices and the development of novel surgical techniques.
  • diseases, disorders or conditions of the respiratory system include damage, pathology, ageing and trauma of the nose and paranasal sinuses, nasopharynx, oropharynx, laryngopharynx, larynx, vocal ligaments, vocal cords, vestibular folds, glottis, epiglottis, trachea, mucocilliary mucosa, trachealis muscle, primary bronchi, lobar bronchi, segmental bronchi, terminal bronchioles, respiratory zone structures and plural membranes.
  • Such damage include obstructive pulmonary diseases, restrictive disorders, emphysema, chronic bronchitis, pulmonary infections, asthma, tuberculosis, genetic disorders (e.g., cystic fibrosis), gas exchange problems, burns, barotraumas and disorders affecting blood supply to the respiratory system.
  • Methods and medicaments of the present invention may also be used to repair, modify, enhance or regenerate the respiratory system following damage.
  • methods and compositions of the present invention may be used as a technique to enhance the transplantation/implantation of whole respiratory structures or organs or their parts. Gastrointestinal tract and associated glands
  • Examples of diseases, disorders or conditions of the gastrointestinal tract and associated glands that may be treated by the methods and medicaments of the present invention include disorders, damage and age related changes of both the gastrointestinal tract and the large accessory glands (liver and pancreas), salivary glands, mouth, teeth, oesophagus, stomach, duodenum, jejunum, ileum, ascending colon, transverse colon, descending colon, sigmoid colon, rectum and anal canal and enteric nervous system of the canal.
  • these disorders, damage and age related changes include dental caries, periodontal disease, deglutition problems, ulcers, enzymatic disturbances/deficiencies, motility problems, paralysis, dysfunction of absorption or absorptive surfaces, diverticulosis, inflammatory bowel problems, hepatitis, cirrhosis and portal hypertension.
  • Methods and medicaments of the present invention may also be used to repair, modify, enhance or regenerate the gastrointestinal tract following damage, or be used as a technique to enhance any of these processes following surgery, such as resection of the stomach, ileostomy and reconstructive surgery (eg ileoanal juncture).
  • Examples of this latter embodiment include reconstructive surgery involving specific anatomical structures of the mouth, such as labia, vestibule, oral cavity proper, red margin, labial frenulum, hard palate palatine bones, soft palate, uvula, tongue, intrinsic muscles of the tongue and extrinsic muscles of the tongue.
  • specific anatomical structures of the mouth such as labia, vestibule, oral cavity proper, red margin, labial frenulum, hard palate palatine bones, soft palate, uvula, tongue, intrinsic muscles of the tongue and extrinsic muscles of the tongue.
  • diseases, disorders or conditions of the integumentary system that may be treated by the methods and medicaments of the present invention include disorders, damage and age related changes of the skin and integumentary system, such as age related decline in thickness or function, disorders of sweat gland and sebaceous glands, piloerectile dysfunction, follicular problems, hair loss, epidermal disease, diseases of the dermis or hypodermis, burns, ulcers, sores and infections.
  • Methods and products of the present invention may also be used to enhance, regenerate or repair skin structures or functions, for example in plastic reconstruction, cosmetic repair, tattoo removal, wound healing, modulation of wrinkles and in the treatment of striae, seborrhoea, rosacea, port wine stains, skin colour and the improvement of blood supply to the skin.
  • methods and products of the present invention may be used to enhance skin grafts, surgical reconstruction, cosmetic surgical procedures, wound healing and cosmetic appearance.
  • diseases, disorders or conditions of the musculoskeletal system that may be treated by the methods and products of the present invention include disease, damage and age related changes of the musculoskeletal system.
  • these may be in components of the axial skeleton, including the skull, cranium, face, skull associated bones, auditory ossicles, hyoid bone, sternum, ribs, vertebrae, sacrum and coccyx.
  • the appendicular skeleton including the clavicle, scapula, humerus, radius, ulna, carpal bones, metacarpal bones, phalanges (proximal, middle, distal), pelvic girdle, femur, patella, tibia, fibula, tarsal bones and metatarsal bones.
  • Methods and compositions of the present invention may also be used to correct problems associated with ossification and osteogenesis, such as intramembranous ossification, endochondral ossification, bone remodelling and repair, osteoporosis, osteomalacia, rickets, pagets disease, rheumatism and arthritis.
  • methods and products of the present invention may be used to treat disease, damage and age related changes of the skeletal muscle, elastic cartilages, fibrocartilages, long bones, short bones, flat bones and irregular bones.
  • the present invention may be used to enhance function or treat disease, damage and age related changes in other systems of the body, including special senses, endocrine system, lymphatic system, urinary system,
  • Methods and compositions of the present invention may be used to treat, ameliorate, reduce or compensate for general age-related degeneration. Similarly, methods and compositions of the present invention can be used to retain youthful functions of the body.
  • methods and products of the present invention may be used to treat specific age related system dysfunction, such as cognitive impairment, hearing loss, loss of visual activity, endocrine imbalances, skeletal changes and loss of reproductive function.
  • methods and compositions of the present invention may be used to prevent or reduce scars at a site of injury or infection.
  • microvesicles or microRNAs may be employed to regenerate tissue that would otherwise scar or necrotize, including hepatic tissue in the treatment of hepatic fibrosis and/or cirrhosis, facial epidermal tissue to treat acne, and cardiac tissue in the treatment of ischemic infarction.
  • methods and compositions e.g., microvesicles and/or microRNAs
  • methods and compositions may be used to enhance breast augmentation following mastectomy.
  • the present invention provides pharmaceutical compositions comprising a therapeutically effective amount of microvesicles or microRNAs for the treatment of various diseases, disorders or conditions described herein.
  • the present invention provides pharmaceutical compositions comprising a therapeutically effective amount of microvesicles or microRNAs for the treatment of diabetes mellitus, myocardial infarct, kidney disease, wound healing, fistulas generation or regeneration, neural regeneration, breast augmentation following mastectomy, and/or conditions associated with a cosmetic surgical procedure.
  • the present invention provides pharmaceutical compositions comprising one or more microRNAs having a sequence at least 70% (e.g., 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%) identical to any of microRNAs identified in Table 1 and Tables 7-13 (e.g., SEQ ID NOS. 1-29) and a pharmaceutically acceptable carrier.
  • the term "pharmaceutically acceptable carrier” includes carriers that are approved by a regulatory agency of government or listed in the United States Pharmocopeia, the European Pharmocopeia, the United Kingdom Pharmocopeia, or other generally recognized pharmocopeia for use in animals, and in particular humans.
  • carrier refers to a diluent, adjuvant, excipient, or vehicle with which a therapeutic agent (e.g., microvesicles and/or microRNAs) is administered.
  • compositions may also contain minor amounts of wetting agents, emulsifying agents, and/or pH buffering agents.
  • Provided compositions can take any of a variety of solid, liquid, or gel forms, including solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained-release formulations, and the like.
  • suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E.W.
  • compositions will generally contain a therapeutically effective amount of microvesicles and/or microRNAs, optionally in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient.
  • compositions for intravenous administration may be formulated as solutions in sterile isotonic aqueous buffer.
  • Such compositions may also include a solubilizing agent and/or a local anesthetic such as lidocaine (also known as lignocaine, xylocaine, or xylocard) to ease pain at the site of injection.
  • lidocaine also known as lignocaine, xylocaine, or xylocard
  • compositions for topical and/or local use may be formulated, for example, as a lotion or cream comprising a liquid or semi-solid oil-in- water or water-in-oil emulsion and ointments. Such compositions may also comprise a preservative.
  • compositions for delivery to the eye include may be formulated, for example, as eye drops that comprise the active ingredien in aqueous or oily solution and eye ointments that may be manufactured in sterile form.
  • Compositions for delivery to the nose may be formulated, for example, as aerosols or sprays, coarse powders to be rapidly inhaled, or nose drops that comprise the active ingredient (e.g., microvesicles and/or microRNAs) in aqueous or oily solution.
  • compositions for local delivery to the buccal cavity may be formulated, for example, as lozenges that comprise the active ingredient in a mass generally formed of sugar and gum arabic or tragacanth, and pastilles that comprise the active ingredient in an inert mass (for example of gelatine and glycerine or sugar and gum arabic). Flavoring ingredients may be added to lozenges or pastilles.
  • Aerosol and spray formulations may comprise, for example, a suitable
  • Aerosol and spray formulations may be mixed with a propellant gas, such as an inert gas under elevated pressure or with a volatile liquid (e.g. , a liquid that boils under normal atmospheric pressure below customary room temperature, for example from -30 to +10 °C).
  • a propellant gas such as an inert gas under elevated pressure or with a volatile liquid (e.g. , a liquid that boils under normal atmospheric pressure below customary room temperature, for example from -30 to +10 °C).
  • microvesicles, miRNAs, or a pharmaceutical composition thereof will generally be administered in such amounts and for such a time as is necessary or sufficient to achieve at least one desired result.
  • miRNAs can be administered in such amounts and for such a time that it amelioriates one or more symptoms of a disease, disorder, or condition; prolongs the survival time of patients; or otherwise yields clinical benefits.
  • a dosing regimen according to the present invention may consist of a single dose or a plurality of doses over a period of time. Administration may be, e.g., one or multiple times daily, weekly (or at some other multiple day interval), biweekly, monthly, or on an intermittent schedule. Typically an effective amount is administered. The effective amount of microvesicles, microRNAs, or a pharmaceutical composition thereof, will vary from subject to subject and will depend on several factors (see below). [0150] Microvesicles, microR As, or pharmaceutical compositions thereof, may be administered using any administration route effective for achieving the desired therapeutic effect. Both systemic and local routes of administration may be used in accordance with methods of the invention.
  • Suitable routes of administration include, but are not limited to, intravenous, intraarterial, intramuscular, subcutaneous, cutaneous (e.g., topical), intradermal, intracranial, intrathecal, intrapleural, intra-orbital, intranasal, oral, intra-alimentary (e.g. , via suppository), colorectal (e.g., via suppository), and intra-cerebrospinal.
  • effective doses may be calculated according to, e.g. , the body weight and/or body surface area of the patient, the extent of damaged or diseased tissue, etc. Optimization of the appropriate dosages can readily be made by one skilled in the art, e.g. , by a clinician.
  • the final dosage regimen is typically determined by the attending physician, considering various factors that might modify the action of the
  • microvesicles, miRNAs, or pharmaceutical compositions thereof e.g., the drug's specific activity, the severity of tissue damage and the responsiveness of the patient, the age, condition, body weight, sex and diet of the patient, the severity of any present infection, time of administration, the use (or not) of other therapies, and other clinical factors.
  • drug e.g., the drug's specific activity, the severity of tissue damage and the responsiveness of the patient, the age, condition, body weight, sex and diet of the patient, the severity of any present infection, time of administration, the use (or not) of other therapies, and other clinical factors.
  • Typical dosages comprise 1 fg/kg body weight to 1 mg/kg body weight. In some embodiments, dosages range from 100 pg/kg body weight to 1 mg/kg body weight, 10 pg/kg body weight to 1 mg/kg body weight, 1 pg/kg body weight to 1 mg/kg body weight, 100 ng/kg body weight to 1 mg/kg body weight, 10 ng/kg body weight to 1 mg/kg body weight, or 1 ng/kg body weight to 1 mg/kg body weight.
  • Example 1 Morphological examination of pancreas-derived Pathfinder cells (PDPC) and identification of microvesicles (MVs)
  • PDPC pancreas-derived pathfinder cells
  • EM scanning electron microscopy
  • Pathfinder cells were isolated from rat pancreas cultured as previously described.
  • rat PDPCs were grown in medium containing fetal bovine serum (FBS) that was depleted of bovine microvesicles.
  • FBS fetal bovine serum
  • Figure 1 A shows a representative picture, showing PDPCs of both the fibroblastoid and small round cell types.
  • both cell types have very great numbers of thin projections and interconnect with other cells at multiple points in a complex manner.
  • these cells produce large numbers of small spheres on their surfaces, which are identified as nascent microvesicles ( Figure IB).
  • the flat cell type depicted in Figure 1 A is approximately 15-20 ⁇ in diameter, and is the predominant cell type in cultures that were studied.
  • the other cell type is
  • these spherical cells may be derived from a cell that has recently undergone cell division.
  • MVs microvesicles
  • Figure IB Clusters of MVs were observed in some areas, typically at the end of a cell protrusion. Identified MVs typically had a size range of 300-600 nm in diameter.
  • Example 2 Analysis of miRNA expression in rat PDPCs and in MVs isolated from rat PDPCs
  • Results from Example 1 may shed light into the mechanism of PC action on other cells and tissues.
  • microvesicles obtained from PDPCs were studied in further detail.
  • MVs were purified from supernatants of rat PDPC cultures in medium with serum depleted of bovine microvesicles using a differential
  • RNA was prepared from both MVs and PDPCs using standard procedures. RNA samples were reverse-transcribed (RT) and amplified in a quantitative PCR assay in order to analyze expression of miRNAs.
  • RNA extraction RNA from cells and microvesicles (MVs) was extracted using
  • miRNA analysis RNA from cells and MVs was analysed for expression of microRNAs (miRNAs) using Appplied Biosystem's Taqman Low Density Arrays (TLDA) cards.
  • TLDA Taqman Low Density Arrays
  • TLDA Taqman Low Density Arrays
  • MV RNA was analysed by Array A according to manufacturer's protocol; analysis with Array B is ongoing. Results
  • Table 1 depicts results from analysis of 373 miRNAs from rat PDPC MV RNA preparations. As shown in Table 2, of the 373 miRNAs analyzed, 20 were found to be present only in MVs, with undetectable levels in the cell RNA population. 23 further miRNAs were also only detectable in MVs, but these miRNAs were expressed at low levels. Seventeen miRNAs were detected in cell RNA but could not be detected in MV RNA.
  • Table 2 Comparison of miRNA distribution between rat PDPC RNA preparations and rat PDPC-derived MV RNA preparations
  • Table 3 shows an updated list of miRNAS found in MVs but not cells. Exemplary sequences for these miRNAs are shown in Table 1 and in Appendix 1. Without wishing to be bound by any particular theory, the presence of some miRNAs in MVs but not in cells suggest that these MVs were likely produced in the MVs.
  • Table 4 lists the miRNAs that were found in cells but not in micro vesicles.
  • Sequences shown are sequences from Rattus norvegicus. Sequences of corresponding miRNAs from other species including Homo sapiens and ra musculus are also known in the art; e.g., see http://diana.cslab.ece.ntua.gr/mirgen/.
  • MVs do not contain a merely random sample of cytoplasmic or endosomal content.
  • miRNAs that are specifically present in MVs may be candidates for intercellular regulators. These MV-specific miRNAs may be individually validated using assays such as those described in Examples 3 and 4.
  • Example 3 Assays for characterizing effects of MVs or miRNAs on cell growth
  • the present Example demonstrates the effects of MVs on growth of rat PDPCs.
  • An XCELLINGENCETM machine was used to measure cell growth in rat PDPC cultures that were depleted of bovine MVs, or depleted of MVs and then had rat PDPC MVs added back.
  • Rat PDPCs were cultured in medium containing bovine serum, and then at 43 hours were switched to bovine MV-depleted medium. Depleting MVs resulted in a decrease in cell proliferation, with a doubling time slowing to 31 hours ( Figure 2A). A negative effect on doubling time was seen, with a later recovery.
  • MVs can increase cell proliferation; they also provide a possible assay for characterize effects of individual miRNAs on PDPC growth rate. Similar assays may also be developed for PC effects on target cell types.
  • MVs human kidney-derived Pathfinder cells
  • LNDPCs lymph node-derived pathfinder cells
  • This Example demonstrates that an in vitro assay has been successfully developed to assess the effects of MVs or miRNAs on stimulate wound repair or recovery from cell damage.
  • Fibroblasts are grown to confluence in wells of an XCELLIGENCETM machine
  • This Example is designed to show that MV production in PC cells and/or the
  • RNA expression profiles may be optimized by varying certain cell culture conditions. It is postulated that growing cells in hypoxic conditions during culture may reduce secretions of cytokines, which could extend lifespan of cells producing MVs, thereby increasing MV production.
  • PCs of various cell types are grown in conditions of low oxygen (less than 5% 0 2 ); cultures are also grown in conditions of normal ⁇ e.g., about 5% 0 2 ) oxygen to be used as controls.
  • MV production may be quantitated using standard methods or adaptations of known methods, such as, e.g., electron microscopy, FACS, measurement of MV weight and calculation based on known number/weight ratios, etc.
  • MVs are isolated from cultures as described in Example 2. RNA preparations are made from MVs and quantified and amounts are compared between the two groups (low oxygen vs. normal oxygen).
  • Example 6 Isolation and enrichment of MVs from conditioned media
  • This Example describes isolation and enrichment of MVs from conditioned media.
  • PCs of various cell types are isolated and cultured as previously described. (See, e.g., International Patent Publication WO2006/120476 Al). PCs are expanded to near confluence (sub-confluence) in tissue culture fiasks in media free of serum. (Bovine microvesicle-depleted media may also be used.) Media from sub-confluent cultures (“conditioned media”) are collected and analyzed immediately or frozen for further analysis. Conditioned media may be analyzed for MV production by methods known in the art, such as those mentioned in Example 5. MVs may be harvested from conditional media using standard methods. RNA is extracted from conditioned media and total RNA content and amount of specific miRNAs associated with MVs are analyzed.
  • Example 7 Culture of PCs on nonwoven substrates to increase MV production in conditioned media
  • This Example describes a modified culture method that may increase MV production in conditioned media.
  • PCs are grown on nonwoven fabrics of various compositions and microvesicle production in conditioned culture media is assessed.
  • Circular substrates of one centimeter in diameter are made from nonwoven fabrics of various compositions:
  • PGA/PLA poly(glycolide-co-lactide) sold under the tradename VICRYLTM (Ethicon, Inc., Somerville, NJ);
  • Fabrics used in this Example are of 1 mm or 1.5 mm thickness and density ranged from about 60 to about 300 mg/mL.
  • Fabric substrates are placed in low-cluster 24-well plates and sterilized by soaking in 100% ethanol for four hours. Substrates are then washed with phosphate-buffered saline (PBS) and placed in medium containing fetal bovine serum (FBS) that was depleted of bovine micro vesicles.
  • PBS phosphate-buffered saline
  • FBS fetal bovine serum
  • PCs of various tissue origins are seeded onto the substrates within the wells.
  • 24-well tissue culture plate without substrates is seeded with PCs as a control.
  • Cell-seeded substrates and control wells are cultured until cultures reach sub-confluence.
  • conditioned media Media from sub-confluent cultures
  • MVs may be harvested from conditioned media using standard methods.
  • RNA expression profiling was performed on rat PDPCs.
  • PDPCs were cultured and RNA extracted as described in Example 2.
  • Table 5 shows miRNAs that were found to be expressed in PDPCs that may be useful for therapeutic applications described herein. miRNAs that were expressed abundantly are shown in bold. Sequences of these miRNAs can be found in Appendix 1.
  • MVs were purified from supernatants of rat PC cultures grown under serum replete or serum starvation conditions using a differential centrifugation protocol according to the schematic in Figure 3 or a commercially available exosome precipitation kit (Exo-QuickTM Exosome Preciptitation, System Biosciences, Mountain View, California). Control MVs from rat mesenchymal stem cells (MSC) grown in serum replete or serum starvation conditions were also purified.
  • MSC mesenchymal stem cells
  • the SI supernatant fraction was centrifuged at 120,000 x g for 120 minutes at 4°C and the resulting pellet, P3 was washed with 5 mis of PBS and centrifuged at 120,000 x g for 120 minutes at 4°C.
  • the resulting pellet fraction, P4 was resuspended in 0.2 ml buffer.
  • Total protein and total RNA were quantitated for fractions obtained by each purification method (differential centrifugation and precipitation) using standard methods. Table 6 shows exemplary total protein and total RNA amounts obtained in each fraction for the purification methods tested.
  • Table 6 Total protein and total RNA from MV purification.
  • MVs were purified from supernatants of rat or human PC cultures grown under serum starvation conditions for about 24 hours using a differential centrifugation protocol (described in Example 10). RNA was prepared from PCs and MVs as described in Example 2.
  • microRNA expression profiles for rat PCs, MV fractions, and exosome fractions were determined and compared. As shown in Figure 4, microRNA whose expression was altered by growth under serum starvation conditions for 24 hours as compared with growth under serum replete conditions was determined and overlapping microRNA sequences among rat PC's, MV fractions and exosome fractions were identified. As can be seen in Figure 4, there were 35 miRNAs in common to all samples which had increased expression in response to serum starvation.
  • Figure 5 shows an exemplary graph comparison of miRNA expression profiles for rat PCs, MV fractions, and exosome fractions. As can be seen in Figure 5, microRNAs whose expression was increased in response to serum starvation may play roles in various cellular functions, including cell cycle, damage responses, stress responses, cell survival, and immune signalling.
  • microRNA expression profiles for rat PCs, rat MSC, and human PC were determined and compared. As shown in Figure 6, microRNA whose expression was altered by growth under serum starvation conditions for 24 hours as compared with growth under serum replete conditions were determined and overlappind microRNA sequences among rat PCs, rat MSC, and human PCs were identified. As can be seen in Figure 6, there were 26 miRNAs in common to all samples which had increased expression in response to serum starvation.
  • mmu-miR-667-4386769 (SEQ ID NO: 150) MIMAT0003734 mmu-miR-743b-5p- UGUUCAGACUGGUGUCCAUCA (SEQ ID NO: 150) MIMAT0003734 mmu-miR-743b-5p- UGUUCAGACUGGUGUCCAUCA (SEQ ID NO: 150) MIMAT0003734 mmu-miR-743b-5p- UGUUCAGACUGGUGUCCAUCA (SEQ ID NO: 150) MIMAT0003734 mmu-miR-743b-5p- UGUUCAGACUGGUGUCCAUCA (SEQ ID NO: 150) MIMAT0003734 mmu-miR-743b-5p- UGUUCAGACUGGUGUCCAUCA (SEQ ID NO: 150) MIMAT0003734 mmu-miR-743b-5p- UGUUCAGACUGGUGUCCAUCA (SEQ ID NO: 150) MIMAT0003734 mmu-mi
  • mmu-miR-872*-4395672 (SEQ ID NO: 192) MIMAT0004935 mmu-miR-875-5p- UAUACCUCAGUUUUAUCAGGUG
  • snoRNA202-4380914 (SEQ ID NO:276)
  • Table 9 lists miRNAs in common between rat PCs grown under serum starvation conditions (identified in Table 8) and MVs from rat PCs grown under serum starvation
  • snoRNA135-4380912 Mature miRNA Control
  • Table 10 lists miRNAs found in rat PC MVs, including exosomes.
  • Table 11 lists miRNAs found in rat PC MVs and PCs, excluding exosomes.
  • MIMAT0000536 mmu-miR-320- AAAAGCUGGGUUGAGAGGGCGA (SEQ ID MIMAT0000666
  • Table 12 lists miRNAs found in rat PC exosomes and PCs, excluding
  • MIMAT0003484 MIMAT0003741 mmu-miR-720-4381052 AUCUCGCUGGGGCCUCCA (SEQ ID NO:485) MIMAT0003484
  • PCs grown under serum starvation conditions were determined and compared.
  • microRNA whose expression was altered by growth under serum starvation conditions for 24 hours as compared with growth under serum replete conditions was determined and overlapping microRNA sequences among human PCs and MVs were identified.
  • miRNAs from MVs obtained from human PCs grown under serum starvation conditions were compared to those obtained from rat PCs grown under comparable conditions. As can be seen in Figure 8, there were 7 miRNAs in common that had increased expression in response to serum starvation.
  • Figure 9 shows an exemplary graph comparison of miRNA expression profiles for rat MVs and human MVs obtained from PCs grown under serum starvation conditions. As can be seen in Figure 9, microRNAs whose expression was increased in response to serum starvation may play roles in various cellular functions, including cell cycle, MAPK signalling pathways, TGF beta signalling pathways, and DNA methylation, among others. [0201] Table 13 depicts results from analysis of miRNAs from MVs obtained from human PC RNA preparations.
  • MIMAT0003236 hsa-miR-601- UGGUCUAGGAUUGUUGGAGGAG (SEQ ID NO:577)
  • MIMAT0003294 hsa-miR-639- AUCGCUGCGGUUGCGAGCGCUGU (SEQ ID NO:579)
  • any particular embodiment of the present invention that falls within the prior art may be explicitly excluded from any one or more of the claims. Since such embodiments are deemed to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not set forth explicitly herein.
  • Any particular embodiment of the compositions of the invention ⁇ e.g., any cell type; any neuronal cell system; any reporter of synaptic vesicle cycling; any electrical stimulation system; any imaging system; any synaptic vesicle cycling assay; any synaptic vesicle cycle modulator; any method of use; etc.) can be excluded from any one or more claims, for any reason, whether or not related to the existence of prior art.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Organic Chemistry (AREA)
  • Developmental Biology & Embryology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Virology (AREA)
  • Epidemiology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • General Physics & Mathematics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Toxicology (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Plant Pathology (AREA)

Abstract

The present invention provides improved methods and compositions based on microvesicles for the treatment of various diseases, disorders and conditions. In particular, the present invention encompasses the recognition that microvesicles contain specific microRNAs which may function as intercellular regulators involved in cell or tissue regeneration, remodeling, reconstruction, reprogramming or transdifferentiation. Thus, among other things, the present invention provides methods and compositions based on microvesicles and/or associated microRNAs that provide more predictable and effective therapeutic results.

Description

THERAPEUTIC USES OF MICROVESICLES AND RELATED MICRORNAS
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to United States Provisional Patent Application serial numbers 61/373,715, filed August 13, 2010 and 61/380,766, filed September 8, 2010, the entirety of each of which is incorporated herein by reference.
[0002] This application relates to US application entitled "Cellular and Molecular
Therapies" filed on even date, the entirety of which is incorporated herein by reference.
BACKGROUND
[0003] Microvesicles were historically regarded as cellular debris with no apparent function. However, and more recently, a growing body of experimental data suggest that microvesicles have numerous biological activities. For example, platelet-derived microvesicles were shown to stimulate selected cells via surface proteins on the microvesicles (e.g., CD 154, RANTES, and/or PF-4; see Thromb. Haemost. (1999), 82:794, or J. Biol. Chem. (1999), 274:7545). In other examples, specific effects of bioactive lipids (e.g., sphingosine-1 -phosphate, HETE, or arachidonic acid) in platelet microvesicles on certain target cells were reported (see e.g., J. Biol. Chem. (2001), 276: 19672; or Cardiovasc. Res. (2001), 49(5):88). Furthermore, platelet microvesicles increased adhesion of mobilized CD34+ endothelial cells by transfer of certain microvesicle surface components to the mobilized cells (see e.g., Blood (2001), 89:3143).
[0004] Various clinical uses of microvesicles have been proposed. While such proposed uses provide at least some promising perspectives, several largely unexplained problems remain. For example, biological activity of microvesicles is often difficult to predict. Moreover, currently contemplated therapeutic use typically necessitates sterilization and antiviral treatment to prevent infections of the people receiving microvesicle containing preparations, which is time- consuming and inefficient. Therefore, there is still a need for improved compositions and methods of use based on microvesicles. SUMMARY OF THE INVENTION
[0005] The present invention provides improved methods and compositions based on microvesicles for the treatment of various diseases, disorders and conditions. In particular, the present invention encompasses the recognition that microvesicles contain specific microRNAs which may function as intercellular regulators involved in cell or tissue regeneration, remodeling, reconstruction, reprogramming or transdifferentiation. Thus, the present invention provides methods and compositions based on microvesicles and/or associated microRNAs that provide more predictable and effective therapeutic results.
[0006] In some embodiments, the present invention provides a method of treating a disease, disorder or condition comprising administering to a patient in need of treatment a therapeutically effective amount of microvesicles. In some embodiments, inventive methods according to the present invention can be used to treat a disease, disorder or condition selected from the group consisting of diabetes mellitus, myocardial infarct, kidney disease, wound healing, Fistulas regeneration, neural regeneration (e.g., CNS regeneration, or peripheral nervous system regeneration), breast augmentation following mastectomy, conditions associated with a cosmetic surgical procedure, and combination thereof.
[0007] In some embodiments, the present invention provides a method of inducing tissue repair, remodeling, differentiation or transdifferentiation in vivo comprising administering to a patient in need of treatment a therapeutically effective amount of microvesicles. In some embodiments, suitable microvesicles are derived from a tissue that is the same as the diseased tissue (i.e., target tissue). In some embodiments, suitable microvesicles are derived from a tissue that is different from the diseased tissue (i.e., target tissue). In some embodiments, suitable microvesicles are derived from pancreatic cells, kidney cells, liver cells, spleen cells, lymph nodes, myometrium cells, peripheral blood cells, chord blood cells, bone marrow cells, serum, or combination thereof. In some embodiments, suitable microvesicles are derived from pancreas- derived pathfinder cells. In some embodiments, suitable microvesicles are derived from autologous cells. In some embodiments, suitable microvesicles are derived from non-auto logous cells. [0008] In some embodiments, suitable microvesicles are derived from cells grown on a nonwoven substrate. In some embodiments, the nonwoven substrate comprise an aliphatic polyester fiber. In some embodiments, a aliphatic polyester fiber suitable for the present invention is selected from the group consisting of homopolymers or copolymers of lactide (which includes lactic acid D-,L- and meso lactide), glycolide (including glycolic acid), epsilon- caprolactone, p-dioxanone (l,4-dioxan-2-one), trimethylene carbonate (l,3-dioxan-2-one), and combinations thereof.
[0009] In some embodiments, suitable microvesicles are derived from cells grown under a culture condition where oxygen pressure is less than or equal to 5%. In some embodiments, suitable microvesicles are derived from cells grown under room air oxygen conditions. In some embodiments, suitable microvesicles are derived from cells grown to approximately 80-99% of confluence.
[0010] In some embodiments, suitable microvesicles are derived from cells grown under serum starvation conditions. In some embodiments, suitable microvesicles are derived from cells grown under serum starvation conditions for about 24 hours. In some embodiments, suitable microvesicles are derived from cells grown under serum replete conditions.
[0011] In some embodiments, suitable microvesicles are isolated or purified by differential ultracentrifugation. In some embodiments, suitable microvesicles are isolated or purified by precipitation.
[0012] In some embodiments, suitable microvesicles contain one or more microR As selected from those listed in Table 1 and Tables 7-13.
[0013] In some embodiments, suitable microvesicles contains one or more microRNAs selected form the group consisting of miRNA-122, miRNA-127, miRNA-133b, miRNA-323, miRNA-433, miRNA-451, miRNA-466h, miRNA-467c, miRNA-467e, miRNA-468, miRNA- 491, miRNA-495, miRNA-546, miRNA-666, miRNA-680, miRNA-346, miRNA- 136, miRNA- 202, miRNA-369, miRNA-370, miRNA-375, miRNA-376b, miRNA-381, miRNA-434, miRNA- 452, miRNA-465a, miRNA-465b, miRNA-470, miRNA-487b, miRNA-543, miRNA-547, miRNA-590, miRNA-741, miRNA-881, miRNA-206, miRNA-224, miRNA-327, miRNA-347, and combination thereof.
[0014] In some embodiments, suitable microvesicles contain one or more microRNAs selected form the group consisting of miRNA-122, miRNA-127, miRNA-133b, miRNA-323, miRNA-433, miRNA-451 , miRNA-466h, miRNA-467c, miRNA-467e, miRNA-468, miRNA- 491, miRNA-495, miRNA-546, miRNA-666, miRNA-680, miRNA-346, and combination thereof.
[0015] In some embodiments, suitable microvesicles do not contain miRNA-129-5p, miRNA-190, miRNA-203, miRNA-32, miRNA-34c, miRNA-376c, miRNA-384-3p, miRNA- 499b, miRNA-455, miRNA-582-5p, miRNA-615-3p, miRNA-615-5p, miRNA-7b, miRNA-17- 3p, miRNA-381, and miRNA-505.
[0016] In some embodiments, a therapeutically effective amount of microvesicles ranges from lfg-lmg/kg body weight (e.g., lOfg-lmg/kg, lOOfg-lmg/kg, lpg-lmg/kg, lOpg-lmg/kg, lOOpg-lmg/kg body weight). In some embodiments, the microvesicles are administered intravenously, intra-arterially, intramuscularly, subcutaneously, cutaneously, intradermally, intracranially, intratheccally, intrapleurally, intra-orbitally, intra nasally, orally, intra
alimentrally, colorectally, and/or intra-cerebrospinally.
[0017] In some embodiments, the microvesicles are administered daily. In some embodiments, the microvesicles are administered weekly. In some embodiments, the microvesicles are administered biweekly. In some embodiments, the microvesicles are administered monthly.
[0018] In some embodiments, the present invention provides a method of treating a disease, disorder or condition by administering one or more microRNAs obtained, isolated or purified from microvesicles. In some embodiments, the microvesicles are derived from cells grown under serum starvation conditions. In some embodiments, the microvesicles are derived from cells grown under serum starvation conditions for about 24 hours. In some embodiments, the microvesicles are derived from cells grown under serum replete conditions. In some embodiments, the microRNAs obtained, isolated or purified from microvesicles are differentially expressed in cells and/or microvesicles derived from cells grown under stress conditions (e.g., oxygen pressure, cell culture confluence, serum amounts in medium, etc.). In some
embodiments, the present invention provides a method of treating a disease, disorder or condition comprising administering to a patient in need of treatment a therapeutically effective amount of one or more microRNAs having a sequence at least 70% (e.g., 75%, 80%>, 85%, 90%, 95%, 98%, 99%) identical to any of SEQ ID NOs: l-72 (e.g., SEQ ID NOs:l-29). In some embodiments, the one or more microRNAs have a sequence identical to any of SEQ ID NO: 1-72 (e.g., SEQ ID NOs: l-29). In some embodiments, the present invention provides a method of treating a disease, disorder or condition comprising administering to a patient in need of treatment a therapeutically effective amount of one or more microRNAs having a sequence at least 70% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, 99%) identical to any of the sequences in Tables 7-13.
[0019] In some embodiments, the present invention provides a method of inducing tissue repair, remodeling, differentiation or transdiferentiation in vivo comprising administering to a patient in need of treatment a therapeutically effective amount of one or more microRNAs having a sequence at least 70% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, 99%) identical to any one of SEQ ID NO: 1-72 (e.g., SEQ ID NOs: 1-29). In some embodiments, the one or more microRNAs have a sequence identical to any of SEQ ID NO: l-72 (e.g., SEQ ID NOs:l-29). In some embodiments, the present invention provides a method of inducing tissue repair, remodeling, differentiation or transdiferentiation in vivo comprising administering to a patient in need of treatment a therapeutically effective amount of one or more microRNAs having a sequence at least 70% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, 99%) identical to any of the sequences in Tables 7-13.
[0020] In some embodiments, inventive methods according to the present invention can be used to treat a disease, disorder or condition selected from the group consisting of diabetes mellitus, myocardial infarct, kidney disease, wound healing, Fistulas regeneration, neural regeneration (e.g., CNS regeneration, or peripheral nervous system regeneration), breast augmentation following mastectomy, conditions associated with a cosmetic surgical procedure, and combination thereof. [0021] In some embodiments, the therapeutically effective amount of the one or more miRNAs ranges from lfg-lmg/kg body weight (e.g., lOfg-lmg/kg, lOOfg-lmg/kg, lpg-lmg/kg, lOpg-lmg/kg, lOOpg-lmg/kg body weight). In some embodiments, the one or more miRNAs are administered intravenously, intra-arterially, intramuscularly, subcutaneously, cutaneously, intradermally, intracranially, intratheccally, intrapleurally, intra-orbitally, intra nasally, orally, intra alimentrally, colorectally, and/or intra-cerebrospinally. In some embodiments, the one or more miRNAs are administered intravenously, intra-arterially, intramuscularly, subcutaneously, cutaneously, intradermally, intracranially, intratheccally, intrapleurally, intra-orbitally, intra nasally, orally, intra alimentrally, colorectally, and/or intra-cerebrospinally. In some
embodiments, the one or more miRNAs are administered daily, weekly, biweekly, or monthly.
[0022] In some embodiments, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of microvesicles for the treatment of various diseases, disorders or conditions. In some embodiments, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of microvesicles for the treatment of diabetes mellitus, myocardial infarct, kidney disease, wound healing, Fistulas regeneration, neural regeneration (e.g., CNS regeneration, or peripheral nervous system regeneration), breast augmentation following mastectomy, conditions associated with a cosmetic surgical procedure, and combination thereof.
[0023] In some embodiments, the present invention provides a pharmaceutical composition comprising one or more microRNAs having a sequence at least 70% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, 99%) identical to any one of SEQ ID NO: 1-72 (e.g., SEQ ID NOs: l-29) and a pharmaceutically acceptable carrier. In some embodiments, the present invention provides a pharmaceutical composition comprising one or more microRNAs having a sequence identical to any one of SEQ ID NO: 1-72 (e.g., SEQ ID NOs: l-29) and a
pharmaceutically acceptable carrier. In some embodiments, the present invention provides a pharmaceutical composition comprising one or more microRNAs having a sequence at least 70% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, 99%) identical to any of the sequences in Tables 7-13 and a pharmaceutically acceptable carrier. In some embodiments, the present invention provides a pharmaceutical composition comprising one or more microRNAs having a sequence identical to any of the sequences in Tables 7-13 and a pharmaceutically acceptable carrier. In some embodiments, the one or more miR As are present in a therapeutically effective amount for the treatment of diabetes mellitus, myocardial infarct, kidney disease, wound healing, Fistulas regeneration, neural regeneration (e.g., CNS regeneration, or peripheral nervous system regeneration), breast augmentation following mastectomy, conditions associated with a cosmetic surgical procedure, or combination thereof.
[0024] In some embodiments, the present invention provides a method for identifying a miRNA that induces cell growth and/or regeneration, comprising providing cells grown in a microvesicle-depleted medium; adding an miRNA to the medium; determining if the addition of the miRNA increases cell proliferation rate as compared to a control, thereby identifying if the miRNA induces cell growth and/or regeneration. In some embodiments, the cells are pancreas- derived pathfinder cells. In some embodiments, the cell proliferation rate is determined by doubling time. In some embodiments, the miRNA is isolated from micro vesicles.
[0025] In some embodiments, the present invention provides a method for identifying a miRNA that induces cell growth and/or regeneration, comprising creating a wounded area in cells grown to confluence; treating the cells with an miRNA; determining a rate of re-growth of the treated cells across the wounded area as compared to a control, thereby identifying if the miRNA induces cell growth and/or regeneration. In some embodiments, the cells are fibroblasts or cardiomyocytes. In some embodiments, the rate of re-growth is determined quantitatively.
[0026] In some embodiments, the control is untreated cells but otherwise grown under identical conditions. In some embodiments, the miRNA is isolated from micro vesicles.
[0027] In some embodiments, the present invention provides an miRNA that induces cell growth and/or regeneration identified using a method described herein.
[0028] In this application, the use of "or" means "and/or" unless stated otherwise. As used in this application, the term "comprise" and variations of the term, such as "comprising" and "comprises," are not intended to exclude other additives, components, integers or steps. As used in this application, the terms "about" and "approximately" are used as equivalents. Any numerals used in this application with or without about/approximately are meant to cover any normal fluctuations appreciated by one of ordinary skill in the relevant art. In certain embodiments, the term "approximately" or "about" refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%), 2%>, 1%), or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
[0029] Other features, objects, and advantages of the present invention are apparent in the detailed description, drawings and claims that follow. It should be understood, however, that the detailed description, the drawings, and the claims, while indicating embodiments of the present invention, are given by way of illustration only, not limitation. Various changes and modifications within the scope of the invention will become apparent to those skilled in the art.
BRIEF DESCRIPTION OF THE DRAWINGS
[0030] The drawings are for illustration purposes only not for limitation.
[0031] Figures 1A and IB depict exemplary scanning electron microscopy pictures of sub-confluent rat PDPCs adapted for growth in medium with fetal bovine serum (FBS) depleted for bovine micro vesicles. Nascent micro vesicles can be seen at the surfaces of cells in both figures.
[0032] Figures 2A and 2B show exemplary effects of MVs on growth rates of rat
PDPCs. Figure 2 A depicts the effect of bovine MV depletion on doubling time of rat PDPCs. (Plotted on the y-axis is electrical impedence; negative values indicate cell death and therefore negative growth.) MV depletion was performed at 43 hours. A negative effect on doubling time was seen, with a later recovery. Figure 2B depicts dose-dependent recovery of rat PDPC doubling time after addition of rat PDPC-derived MVs. Cultures were MV-depleted at 48 hours, and then exogenous MVs were added 10 hours later. The rapid recovery of doubling time of cells receiving exogenous MV occurred well in advance of the normal recovery time.
[0033] Figure 3 depicts an exemplary differential centrifugation fractionation of microvesicle-containing cell culture medium. [0034] Figure 4 shows an exemplary diagram comparing miRNA expression profiles for rat PCs, MV fractions, and exosome fractions. The diagram shows the number of miRNAs whose expression is altered by growth under serum starvation conditions for 24 hours as compared with growth under serum replete conditions. Total rat miRNA genes analyzed = 584. Total human miRNA genes analyzed = 761. Data presented is from an N=l experiment with a single gene expression analysis on the TLDA card.
[0035] Figure 5 shows an exemplary graph comparison of miRNA expression profiled for rat PCs, MV fractions, and exosome fractions. The graph shows miRNAs with increased gene expression following growth under serum starvation conditions for 24 hours as compared with growth under serum replete conditions. Total rat miRNA genes analyzed = 584. Data presented is from an N=l experiment with a single gene expression analysis on the TLDA card.
[0036] Figure 6 shows an exemplary diagram comparing miRNA expression profiles for rat PCs, rat MSC, and human PC. The chart shows the number of miRNAs whose expression is altered by growth under serum starvation conditions for 24 hours as compared with growth under serum replete conditions. Total rat miRNA genes analyzed = 584. Total human miRNA genes analyzed = 761. Data presented is from an N=l experiment with a single gene expression analysis on the TLDA card.
[0037] Figure 7 shows an exemplary diagram comparing miRNA expression profiles for human PCs and microvesicles (MVs) obtained from human PCs. The chart shows the number of miRNAs whose expression is altered by growth under serum starvation conditions for 24 hours as compared with growth under serum replete conditions. Total human miRNA genes analyzed = 761. Data presented is from an N=l experiment with a single gene expression analysis on the TLDA card.
[0038] Figure 8 shows an exemplary diagram comparing miRNA expression profiles for
MVs obtained from rat PCs and MVs obtained from human PCs. The diagram shows the number of miRNAs whose expression is altered by growth under serum starvation conditions for 24 hours as compared with growth under serum replete conditions. Total rat and mouse miRNA genes analyzed = 584. Total human miRNA genes analyzed = 761. Data presented is from an N=l experiment with a single gene expression analysis on the TLDA card. [0039] Figure 9 shows an exemplary graph comparison of miRNA expression profile for
MVs obtained from rat PCs and MVs obtained from human PCs. The graph shows miRNAs with increased or decreased gene expression following growth under serum starvation conditions for 24 hours as compared with growth under serum replete conditions. Total rat and mouse miRNA genes analyzed = 584. Data presented is from an N=l experiment with a single gene expression analysis on the TLDA card.
DEFINITIONS
[0040] In order for the present invention to be more readily understood, certain terms are first defined below. Additional definitions for the following terms and other terms are set forth throughout the specification.
[0041] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to humans, at any stage of development. In some embodiments, "animal" refers to non-human animals, at any stage of development. In certain embodiments, the non-human animal is a mammal {e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, and/or a pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, and/or worms. In some embodiments, an animal may be a transgenic animal, genetically-engineered animal, and/or a clone.
[0042] Approximately: As used herein, the term "approximately" or "about," as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain embodiments, the term "approximately" or "about" refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value). [0043] Autoimmune disorder. As used herein, the term "autoimmune disorder" refers to a disorder resulting from attack of a body's own tissue by its immune system. In some embodiments, autoimmune diseases is diabetes mellitus, multiple sclerosis, premature ovarian failure, scleroderma, Sjogren's disease, lupus, alopecia (baldness), polyglandular failure, Grave's disease, hypothyroidism, polymyosititis, Celiac disease, Crohn's disease, inflammatory bowel disease, ulcerative colitis, autoimmune hepatitis, hypopituitarism, Guillain-Barre syndrome, myocardititis, Addison's disease, autoimmune skin diseases (e.g., psoriasis), uveititis, pernicious anemia, polymyalgia rheumatica, Goodpasture's syndrome, hypoparathyroidism, Hashimoto's thyoriditis, Raynaud's phenomenon, polymyaglia rheumatica, and rheumatoid arthritis.
[0044] Autologous and non-autologus: As used herein, the term "autologous" means from the same organism. In the context of the present application, the term is used to mean that the population of cells and/or microvesicles referred to as "autologous" to each other do not contain any material which could be regarded as allogenic or xenogenic, that is to say derived from a "foreign" cellular source. As used herein, the term "non-autologous" means not from the same organism.
[0045] Diabetes mellitus: As used herein, the term "diabetes mellitus" refers to a metabolic disease characterized by abnormally high levels of glucose in the blood, caused by an inherited inability to produce insulin (Type 1) or an acquired resistance to insulin (Type 2). Type 1 diabetes is a severe, chronic form of diabetes caused by insufficient production of insulin and resulting in abnormal metabolism of carbohydrates, fats, and proteins. The disease, which typically appears in childhood or adolescence, is characterized by increased sugar levels in the blood and urine, excessive thirst, frequent urination, acidosis, and wasting. Type 1 diabetes is also called insulin-dependent diabetes. Type 2 diabetes is a mild form of diabetes that typically appears first in adulthood and is exacerbated by obesity and an inactive lifestyle. This disease often has no symptoms, is usually diagnosed by tests that indicate glucose intolerance, and is treated with changes in diet and an exercise regimen. Type 2 diabetes is also called non-insulin- dependent diabetes.
[0046] Control: As used herein, the term "control" has its art-understood meaning of being a standard against which results are compared. Typically, controls are used to augment integrity in experiments by isolating variables in order to make a conclusion about such variables. In some embodiments, a control is a reaction or assay that is performed
simultaneously with a test reaction or assay to provide a comparator. In one experiment, the "test" (i.e., the variable being tested) is applied. In the second experiment, the "control," the variable being tested is not applied. In some embodiments, a control is a historical control (i.e., of a test or assay performed previously, or an amount or result that is previously known). In some embodiments, a control is or comprises a printed or otherwise saved record. A control may be a positive control or a negative control. In some embodiments, a control is also referred to as a reference.
[0047] Cosmetic surgical procedure: As used herein, the term "cosmetic surgical procedure" refers to a procedure that is not directed to the therapy of a disease but is, rather, directed to the improvement of an individual's aesthetic appearance, particularly the appearance of the skin or hair of an individual. Examples of cosmetic surgical procedures include procedures that result in reduction in skin wrinkles, an increase in skin firmness, an increase in hair growth or shine, a reduction in grey hairs, a regrowth of hair in cases of baldness (especially male pattern baldness), reduction in hair growth (especially facial hair growth), an aesthetic enhancement of breast size or shape, and a reduction in cellulite.
[0048] Crude: As used herein, the term "crude," when used in connection with a biological sample, refers to a sample which is in a substantially unrefined state. For example, a crude sample can be cell lysates or biopsy tissue sample. A crude sample may exist in solution or as a dry preparation.
[0049] Derivative thereof: As used herein, the term "derivative thereof," when used in connection with microvesicles or cells, refers to a fraction or extract (especially those containing R A and/or DNA and/or protein) of the original microvesicle or population of cells which retains at least some biological activity (especially the ability to induce differentiation and/or the ability to provide therapeutic benefit) of the original. The term also include complexed, encapsulated or formulated microvesicles or cells (for example, microvesicles that have been encapsulated, complexed or formulated to facilitate administration). Examples of derivatives include lysates, lyophilates and homogenates. [0050] Dysfunction: As used herein, the term "dysfunction" refers to an abnormal function. Dysfunction of a molecule {e.g., a protein) can be caused by an increase or decrease of an activity associated with such molecule. Dysfunction of a molecule can be caused by defects associated with the molecule itself or other molecules that directly or indirectly interact with or regulate the molecule.
[0051] Functional: As used herein, a "functional" biological molecule is a biological molecule in a form in which it exhibits a property and/or activity by which it is characterized.
[0052] Functional derivative: As used herein, the term "functional derivative" denotes, in the context of a functional derivative of a nucleotide sequence (e.g., microRNA), a molecule that retains a biological activity (either function or structural) that is substantially similar to that of the original sequence. A functional derivative or equivalent may be a natural derivative or is prepared synthetically. Exemplary functional derivatives include nucleotide sequences having substitutions, deletions, or additions of one or more nucleotides, provided that the biological activity of the nucleic acids (e.g., microR As) is conserved.
[0053] Inflammation: As used herein, the term "inflammation" includes inflammatory conditions occurring in many disorders which include, but are not limited to: Systemic
Inflammatory Response (SIRS); Alzheimer's Disease (and associated conditions and symptoms including: chronic neuroinflammation, glial activation; increased microglia; neuritic plaque formation; and response to therapy); Amyotropic Lateral Sclerosis (ALS), arthritis (and associated conditions and symptoms including, but not limited to: acute joint inflammation, antigen-induced arthritis, arthritis associated with chronic lymphocytic thyroiditis, collagen- induced arthritis, juvenile arthritis; rheumatoid arthritis, osteoarthritis, prognosis and
streptococcus-induced arthritis, spondyloarthopathies, gouty arthritis), asthma (and associated conditions and symptoms, including: bronchial asthma; chronic obstructive airway disease; chronic obstructive pulmonary disease, juvenile asthma and occupational asthma);
cardiovascular diseases (and associated conditions and symptoms, including atherosclerosis; autoimmune myocarditis, chronic cardiac hypoxia, congestive heart failure, coronary artery disease, cardiomyopathy and cardiac cell dysfunction, including: aortic smooth muscle cell activation; cardiac cell apoptosis; and immunomodulation of cardiac cell function; diabetes and associated conditions and symptoms, including autoimmune diabetes, insulin-dependent (Type 1) diabetes, diabetic periodontitis, diabetic retinopathy, and diabetic nephropathy);
gastrointestinal inflammations (and related conditions and symptoms, including celiac disease, associated osteopenia, chronic colitis, Crohn's disease, inflammatory bowel disease and ulcerative colitis); gastric ulcers; hepatic inflammations such as viral and other types of hepatitis, cholesterol gallstones and hepatic fibrosis, HIV infection (and associated conditions and symptoms, including degenerative responses, neurodegenerative responses, and HIV associated Hodgkin's Disease), Kawasaki's Syndrome (and associated diseases and conditions, including mucocutaneous lymph node syndrome, cervical lymphadenopathy, coronary artery lesions, edema, fever, increased leukocytes, mild anemia, skin peeling, rash, conjunctiva redness, thrombocytosis; multiple sclerosis, nephropathies (and associated diseases and conditions, including diabetic nephropathy, endstage renal disease, acute and chronic glomerulonephritis, acute and chronic interstitial nephritis, lupus nephritis, Goodpasture's syndrome, hemodialysis survival and renal ischemic reperfusion injury), neurodegenerative diseases (and associated diseases and conditions, including acute neurodegeneration, induction of IL-1 in aging and neurodegenerative disease, IL-1 induced plasticity of hypothalamic neurons and chronic stress hyperresponsiveness), ophthalmopathies (and associated diseases and conditions, including diabetic retinopathy, Graves' opthalmopathy, and uveitis, osteoporosis (and associated diseases and conditions, including alveolar, femoral, radial, vertebral or wrist bone loss or fracture incidence, postmenopausal bone loss, mass, fracture incidence or rate of bone loss), otitis media (adult or pediatric), pancreatitis or pancreatic acinitis, periodontal disease (and associated diseases and conditions, including adult, early onset and diabetic); pulmonary diseases, including chronic lung disease, chronic sinusitis, hyaline membrane disease, hypoxia and pulmonary disease in SIDS; restenosis of coronary or other vascular grafts; rheumatism including rheumatoid arthritis, rheumatic Aschoff bodies, rheumatic diseases and rheumatic myocarditis; thyroiditis including chronic lymphocytic thyroiditis; urinary tract infections including chronic prostatitis, chronic pelvic pain syndrome and urolithiasis. Immunological disorders, including autoimmune diseases, such as alopecia aerata, autoimmune myocarditis, Graves' disease, Graves opthalmopathy, lichen sclerosis, multiple sclerosis, psoriasis, systemic lupus erythematosus, systemic sclerosis, thyroid diseases (e.g. goiter and struma lymphomatosa (Hashimoto's thyroiditis, lymphadenoid goiter), sleep disorders and chronic fatigue syndrome and obesity (non-diabetic or associated with diabetes). Resistance to infectious diseases, such as Leishmaniasis, Leprosy, Lyme Disease, Lyme Carditis, malaria, cerebral malaria, meningitis, tubulointerstitial nephritis associated with malaria), which are caused by bacteria, viruses (e.g. cytomegalovirus, encephalitis, Epstein-Barr Virus, Human Immunodeficiency Virus, Influenza Virus) or protozoans (e.g., Plasmodium falciparum, trypanosomes). Response to trauma, including cerebral trauma (including strokes and ischemias, encephalitis, encephalopathies, epilepsy, perinatal brain injury, prolonged febrile seizures, SIDS and subarachnoid hemorrhage), low birth weight (e.g. cerebral palsy), lung injury (acute hemorrhagic lung injury, Goodpasture's syndrome, acute ischemic reperfusion), myocardial dysfunction, caused by occupational and environmental pollutants (e.g. susceptibility to toxic oil syndrome silicosis), radiation trauma, and efficiency of wound healing responses (e.g. burn or thermal wounds, chronic wounds, surgical wounds and spinal cord injuries). Hormonal regulation including fertility/fecundity, likelihood of a pregnancy, incidence of preterm labor, prenatal and neonatal complications including preterm low birth weight, cerebral palsy, septicemia, hypothyroidism, oxygen dependence, cranial abnormality, early onset menopause. A subject's response to transplant (rejection or acceptance), acute phase response (e.g. febrile response), general inflammatory response, acute respiratory distress response, acute systemic inflammatory response, wound healing, adhesion, immunoinflammatory response, neuroendocrine response, fever development and resistance, acute -phase response, stress response, disease susceptibility, repetitive motion stress, tennis elbow, and pain management and response.
[0054] Inducer. As used herein, the term "inducer" refers to any molecule or other substance capable of inducing a change in the fate of differentiation of a cell to which it is applied.
[0055] In vitro: As used herein, the term "in vitro" refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within a multi-cellular organism.
[0056] In vivo: As used herein, the term "in vivo" refers to events that occur within a multi-cellular organism such as a non-human animal. [0057] Isolated: As used herein, the term "isolated" refers to a substance and/or entity that has been (1) separated from at least some of the components with which it was associated when initially produced (whether in nature and/or in an experimental setting), and/or (2) produced, prepared, and/or manufactured by the hand of man. Isolated substances and/or entities may be separated from at least about 10%, about 20%>, about 30%>, about 40%>, about 50%>, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, about 99%, substantially 100%, or 100% of the other components with which they were initially associated. In some embodiments, isolated agents are more than about 80%>, about 85%, about 90%>, about 91%>, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, substantially 100%), or 100%) pure. As used herein, a substance is "pure" if it is substantially free of other components. As used herein, the term "isolated cell" refers to a cell not contained in a multi-cellular organism.
[0058] microRNA: As used herein, the term "microRNAs (miRNAs)" refers to post- transcriptional regulators that typically bind to complementary sequences in the three prime untranslated regions (3' UTRs) of target messenger RNA transcripts (mRNAs), usually resulting in gene silencing. Typically, miRNAs are short ribonucleic acid (RNA) molecules, for example, 21 or 22 nucleotides long. The terms "microRNA" and "miRNA" are used interchangeably.
[0059] Microvesicle: As used herein, the term "microvesicle" refers to a membranaceus particle comprising fragments of plasma membrane derived from various cell types. Typically, microvesicles have a diameter (or largest dimension where the particle is not spheroid) of between about 10 nm to about 5000 nm (e.g., between about 50 nm and 1500 nm, between about 75 nm and 1500 nm, between about 75 nm and 1250 nm, between about 50 nm and 1250 nm, between about 30 nm and 1000 nm, between about 50 nm and 1000 nm, between about 100 nm and 1000 nm, between about 50 nm and 750 nm, etc.). Typically, at least part of the membrane of the microvesicle is directly obtained from a cell (also known as a donor cell). Microvesicles suitable for use in the present invention may originate from cells by membrane inversion, exocytosis, shedding, blebbing, and/or budding. Depending on the manner of generation (e.g., membrane inversion, exocytosis, shedding, or budding), the microvesicles contemplated herein may exhibit different surface/lipid characteristics. Alternative names for microvesicles include, but are not limited to, exosomes, ectosomses, membrane particles, exosome-like particles, and apoptotic vesicles. As used herein, an abbreviated form "MV" is sometime used to refer to microvesicle.
[0060] Pathfinder cells: As used herein, the term "pathfinder cells" refers to cells that have the capacity to induce or stimulate tissue repair, regeneration, remodeling or differentiation. Typically, pathfinder cells induce or stimulate tissue repair, regeneration, remodeling or differentiation without being a source of new tissue themselves. In some embodiments, pathfinder cells are also referred to as "progenitor cells." As used herein, an abbreviated form "PC" is sometime used to refer to pathfinder cell.
[0061] Subject: As used herein, the term "subject" refers to a human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat, cattle, swine, sheep, horse or primate). A human includes pre and post natal forms. In many embodiments, a subject is a human being. A subject can be a patient, which refers to a human presenting to a medical provider for diagnosis or treatment of a disease. The term "subject" is used herein interchangeably with "individual" or "patient." A subject can be afflicted with or is susceptible to a disease or disorder but may or may not display symptoms of the disease or disorder.
[0062] Substantially: As used herein, the term "substantially" refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, go to completion and/or proceed to completeness or achieve or avoid an absolute result. The term "substantially" is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.
[0063] Suffering from: An individual who is "suffering from" a disease, disorder, and/or condition has been diagnosed with or displays one or more symptoms of the disease, disorder, and/or condition.
[0064] Susceptible to: An individual who is "susceptible to" a disease, disorder, and/or condition has not been diagnosed with the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition may not exhibit symptoms of the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will develop the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will not develop the disease, disorder, and/or condition.
[0065] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" of a therapeutic agent means an amount that is sufficient, when administered to a subject suffering from or susceptible to a disease, disorder, and/or condition, to treat, diagnose, prevent, and/or delay the onset of the symptom(s) of the disease, disorder, and/or condition. It will be appreciated by those of ordinary skill in the art that a therapeutically effective amount is typically administered via a dosing regimen comprising at least one unit dose.
[0066] Therapeutic agent: As used herein, the phrase "therapeutic agent" refers to any agent that, when administered to a subject, has a therapeutic effect and/or elicits a desired biological and/or pharmacological effect. In some embodiments, a therapeutic agent of the invention refers to a peptide inhibitor or derivatives thereof according to the invention.
[0067] Transdifferentiation: As used herein, the term "transdifferentiation" refers to a process in which a non-stem cell transforms into a different type of cell, or an already differentiated stem cell creates cells outside its already established differentiation path.
Typically, transdifferentiation include de- and then re-differentiation of adult cell types (or differentiated cell types).
[0068] Treating: As used herein, the term "treat," "treatment," or "treating" refers to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of and/or reduce incidence of one or more symptoms or features of a particular disease, disorder, and/or condition. Treatment may be administered to a subject who does not exhibit signs of a disease and/or exhibits only early signs of the disease for the purpose of decreasing the risk of developing pathology associated with the disease. DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS
[0069] The present invention provides, among other things, improved compositions and methods based on microvesicles or microvesicles-associated microRNAs for inducing tissue repair, remodeling, reconstruction, differentiation or transdifferentiation, and/or for treating associated diseases, disorders and conditions.
[0070] Various aspects of the invention are described in detail in the following sections.
The use of sections is not meant to limit the invention. Each section can apply to any aspect of the invention. In this application, the use of "or" means "and/or" unless stated otherwise.
I. Microvesicles
[0071] As used herein, the term "microvesicle" refers to a membranaceus particle comprising fragments of plasma membrane derived from various cell types. Typically, microvesicles are small particles that have a diameter (or largest dimension where the particle is not spheroid) of between about 10 nm to about 5000 nm (e.g., between about 50 nm and 1500 nm, between about 75 nm and 1500 nm, between about 75 nm and 1250 nm, between about 50 nm and 1250 nm, between about 30 nm and 1000 nm, between about 50 nm and 1000 nm, between about 100 nm and 1000 nm, between about 50 nm and 750 nm, etc.). Typically, at least part of the membrane of the microvesicle is directly obtained from a cell (also known as a donor cell). Microvesicles suitable for use in the present invention may originate from cells by membrane inversion, exocytosis, shedding, blebbing, and/or budding. Depending on the manner of generation (e.g., membrane inversion, exocytosis, shedding, or budding), the microvesicles contemplated herein may exhibit different surface/lipid characteristics. Alternative names for microvesicles include, but are not limited to, exosomes, ectosomses, membrane particles, exosome-like particles, and apoptotic vesicles.
[0072] It is contemplated that microvesicles can serve as a means by which RNA and protein molecules can pass between cells. Without wishing to be bound by any particular theory, it is contemplated that microvesicles derived from pancreas-derived Pathfinder cells (PDPCs) may stimulate repair processes through the transfer of specific mR As, miRNAs, and/or proteins. Prior to the present invention, however, the specific microRNAs associated with microvesicles have not yet been characterized. As discussed in the microRNA and the Examples sections, the present inventors have developed an effective in vitro assay to analyze and identify microRNAs. Unexpectedly, the inventors found that certain microRNAs are specifically present in microvesicles (i.e., present only in microvesicles and not cells). This finding demonstrated for the first time that microvesicles do not just contain randomly sampled cytoplasmic or endosomal contents. It is contemplated that those microRNAs that are specifically present in the
microvesicles may be intracelullar regulators important for inducing tissue repair, remodeling, reconstruction, differentiation or transdifferentiation.
Donor Cells
[0073] Microvesicles used in accordance with the present invention may be obtained from any cell types. As used herein, cells that produce microvesicles are also referred to as donor cells. Suitable donor cells may include prokaryotic cells, archaebacterial cells, fungal cells, and single- and multi-cellular eukaryotic cells. In some embodiments, microvesicles are obtained from a eukaryotic cell (e.g., a eukaryotic cell from a multi-cellular organism, and particularly, a vertebrate cell (e.g., mammal)). Furthermore, it should be recognized that the donor cell may be nucleated or non-nucleated. Thus, suitable donor cells include lymphocytes (e.g., polynucleated, polymorpho-nuclear lymphocytes, etc), fibroblasts, hepatocytes, as well as erythrocytes, and thrombocytes.
[0074] Suitable donor cells may be derived from any desirable developmental stage with respect to its cell lineage. For example, suitable donor cells may include stem cells (which may or may not be committed to a particular cell line), partially differentiated stem cell, and fully differentiated cells. In some embodiments, suitable donor cells may be human embryonic stem cell-derived mesenchymal stem cells. In some embodiments, suitable donor cells are pathfinder cells. As used herein, the term "pathfinder cells" encompasses pluripotent cells that have the capacity to induce or stimulate tissue repair, regeneration, remodeling or differentiation.
Pathfinder cells may be obtained from any of a variety of tissue types, including, but not limited to, pancreas, kidney, lymph node, liver, spleen, myometrium, blood cells (including cells from peripheral blood and chord blood), and bone marrow.
[0075] Suitable donor cells may also be in any stage of their individual cellular age, ranging from just separated from their progenitor cell to a senescent or even dead cell. In some embodiments, shedding of microvesicles may be associated with apoptotic blebbing (which may be from the plasma membrane and/or the nucleus). Thus, donor cells may include pre-apoptotic donor cells, or cell committed to apoptosis.
[0076] Furthermore, it is contemplated that suitable donor cells also include non-diseased and diseased cells, wherein diseased cells may be affected by one or more pathogens and/or conditions. For example, a diseased donor cell may be infected with a virus, an intracellular parasite, or bacterium. In other examples, a diseased cell may be a metabolically diseased cell (e.g., due to genetic defect, due to an enzyme, receptor, and/or transporter dysfunction, or due to metabolic insult), a neoplastic cell, or cell that has one or more mutations that render the cell susceptible to uncontrolled cell growth. Similarly, donor cells may be native (e.g., obtained by biopsy), cultured (e.g., native, or immortalized), or treated. For example, donor cells may be chemically and/or mechanically treated, resulting in a donor cell that exhibits a cell-specific stress response. In some embodiments, suitable donor cells may be treated with a natural or synthetic ligand to which the cell has a receptor or otherwise complementary structure. In some embodiments, a donor cell may also be treated with a drug or compound that alters at least one of a metabolism, cell growth, cell division, cell structure, and/or secretion.
[0077] In some embodiments, suitable donor cells are recombinant cells. For example, recombinant donor cells may contain one or more nucleic acid molecules introduced by recombinant DNA technology. All known manners of introducing nucleic acids are deemed suitable for use herein (e.g., viral transfection, chemical transfection, electroporation, ballistic transfection, etc.). Where the nucleic is a DNA, it is contemplated that the DNA may be integrated into the genome of the donor cell, or that the DNA may reside as extrachromosomal unit within the cell. Such DNA may be employed as a template for RNA production, which may have regulatory and/or protein encoding function. Similarly where the nucleic acid is an RNA, such RNA may be used as a regulatory entity (e.g., via antisense or interference) and/or as a protein encoding entity. As used herein, nucleic acids encompass all known nucleic acid analogs (e.g., phosphorothioate analogs, peptide nucleic acid analogs, etc.)
[0078] Suitable donor cells may have any desirable origin, including endothelial, mesothelial, and ectothelial origin. Thus, suitable donor cells include those found in a gland, an organ, muscle, a structural tissue, etc. Suitable donor cells may be heterologous (or non- autologous) or autologous relative to recipient. For example, suitable donor cells may be derived from a tissue the same as or different than the recipient tissue (e.g., a diseased tissue to be treated). As a non- limiting example, micro vesicles obtained from donor cells such as fibroblast may be used to treat recipient diseased tissue pancreatic. In some embodiments, donor cells may be derived from a different organism (i.e., non-auto logous). For example, a donor cell may be a porcine pancreatic cell, while the recipient is human pancreatic.
[0079] In some embodiments, microvesicles are obtained from whole blood, serum, plasma, or any other biological fluid, including urine, ascites fluid, milk, tears, spinal fluid, amniotic fluid, etc., which may be obtained from a living mammal. Alternatively, microvesicles may also be obtained from stored materials (e.g., biological fluids, tissues, organs, etc.). Such storage may include storage at reduced temperature (e.g., 4 °C) or even storage in frozen form. Similarly, microvesicles may also be obtained from an in vitro source, and most typically from cell or tissue culture (see the Cell Culture Condition section below), or even organ culture.
Cell Culture Conditions
[0080] In some embodiments, microvesicles are obtained from cultured donor cells. For example, suitable donor cells may be cultured in a liquid medium that contains nutrients for the cells and are incubated in an environment where the temperature and/or gas composition is controlled. As will be appreciated by one of ordinary skill in the art, specific cell culture conditions may vary depending on the type of cells used. For example, cell culture conditions for pathfinder cells have been described. See, e.g., International Patent Publication
WO2006120476, the entire contents of which are herein incorporated by reference. An exemplary suitable medium for culture of pathfinder cells contains is CMRL 1066 medium (Invitrogen) supplemented with fetal bovine serum (e.g., at 10%). In some embodiments, media is supplemented with glutamine or glutamine-containing mixtures such as GLUTAMAX™ (Invitrogen) and/or with antibiotics (e.g., amphotericin, penicillin, and/or streptomycin).
[0081] In some embodiments, cells are grown such they are attached on a surface. In some such embodiments, cells are grown as a monolayer on the surface. In some embodiments, cells are grown until they are confluent, i.e., until they cover the entire surface on which they are growing and there is nowhere else on the surface for cells to grow. In some embodiments, cells are grown until they are close to but not yet at confluence, i.e., until they cover most of the surface on which they are growing, but there is still some room for cells to grow. In some embodiments, cells are grown until they are approximately or more than 50%, 60%>, 70%>, 80%>, 85%, 90%, 95%, 97%, 98%, 99%, or more confluent, wherein x% confluent is defined as coverage of approximately x% of the growing surface. In some embodiments, cells are grown until they are approximately 50-99% (e.g., 60-99%, 70-99%, 75-99%, 80-99%, 85-99%, 90-99%, or 95-99%) confluent.
[0082] In some embodiments, cells are grown on a substrate that may affect one or more properties of the cell, such as microvesicle production rate, cell proliferation rate, or miRNA expression pattern. In some embodiments, cells are grown on a nonwoven substrate such as a nonwoven fabric comprised of fibers. As used herein, the term "nonwoven fabric" includes, but is not limited to, bonded fabrics, formed fabrics, or engineered fabrics, that are manufactured by processes other than, weaving or knitting. In some embodiments, the term "nonwoven fabric" refers to a porous, textile-like material, usually in flat sheet form, composed primarily or entirely of fibers, such as staple fibers assembled in a web, sheet or batt. The structure of the nonwoven fabric is based on the arrangement of, for example, staple fibers that are typically arranged more or less randomly. Nonwoven fabrics can be created by a variety of techniques known in the textile industry. Various methods may create carded, wet laid, melt blown, spunbonded, or air laid nonwovens. Exemplary methods and substrates are described in U.S. Application
Publication No. 20100151575, the teachings of which are incorporated herein by reference. The density of the nonwoven fabrics may be varied depending upon the processing conditions. In one embodiment, the nonwoven fabrics have a density of about about 60 mg/mL to about 350 mg/mL. [0083] In some embodiments, the nonwoven substrates are biocompatible and/or bioabsorbable. Examples of suitable biocompatible, bioabsorbable polymers that could be used include polymers selected from the group consisting of aliphatic polyesters, poly(amino acids), copoly(ether-esters), polyalkylene oxalates, polyamides, poly(iminocarbonates), polyorthoesters, polyoxaesters, polyamidoesters, polyoxaesters containing amine groups, poly(anhydrides), polyphosphazenes, and blends thereof.
[0084] In some embodiments, the aliphatic polyesters are homopolymers and/or copolymers of monomers selected from the group consisting of lactide (which includes lactic acid, D-,L- and meso lactide), glycolide (including glycolic acid), epsilon-caprolactone, p- dioxanone (l ,4-dioxan-2-one), trimethylene carbonate (l ,3-dioxan-2-one), alkyl derivatives of trimethylene carbonate, delta-valerolactone, beta-butyrolactone, gamma-butyrolactone, epsilon- decalactone, hydroxybutyrate (repeating units), hydroxyvalerate (repeating units), 1 ,4-dioxepan- 2-one (including its dimer l ,5,8, 12-tetraoxacyclotetradecane-7, 14-dione), l ,5-dioxepan-2-one, 6,6-dimethyl-l ,4-dioxan-2-one and polymer blends thereof. In another embodiment, aliphatic polyesters which include, but are not limited to homopolymers and/or copolymers of lactide (which includes lactic acid, D-,L- and meso lactide), glycolide (including glycolic acid), epsilon- caprolactone, p-dioxanone (l ,4-dioxan-2-one), trimethylene carbonate (l ,3-dioxan-2-one) and combinations thereof.
[0085] In some embodiments, the aliphatic polyesters are homopolymers and/or copolymers of monomers selected from the group consisting of lactide (which includes lactic acid, D-,L- and meso lactide), glycolide (including glycolic acid), epsilon-caprolactone, p- dioxanone (l ,4-dioxan-2-one), trimethylene carbonate (l ,3-dioxan-2-one) and combinations thereof. In yet another embodiment, the aliphatic polyesters are homopolymers and/or copolymers of monomers selected from the group consisting of lactide (which includes lactic acid, D-,L- and meso lactide), glycolide (including glycolic acid), and p-dioxanone (1 ,4-dioxan- 2-one) and combinations thereof. Non-limiting examples of suitable fabrics include those that comprise aliphatic polyester fibers, e.g., fibers that comprise homopolymers or copolymers of lactide (e.g., lactic acid D-. L- and meso lactide), glycolide (e.g., glycolic acid), epsilon- caprolactone, p-dioxanone (l ,4-dioxan-2-one), trimethylene carbonate (l ,3-dioxan-2-one), and combinations thereof. For example, suitable farbics may contain poly(glycolide-co-lactide) (PGA/PL A); poly(lactide-co-glycolide) (PL A/PGA); 1 ,3 propanediol (PDO), and/or blends thereof.
[0086] In some embodiments, cells are grown on a solid surface that has been textured in a particular way so as to confer special properties to the surface (e.g., repulsion or attraction of certain substances, reduced adsorption of proteins, etc.), which in turn may influence behavior of cells on such surfaces. For example, cells may be grown on a nano-textured surface
("nanosurface"). See, e.g., US 7,597,950; Sun et al. (2009) "Combining nanosurface chemistry and microfluidics for molecular analysis and cell biology," Analytica Chimica Acta, 650(1):98- 105; the entire contents of each of which are herein incorporated by reference. Nanosurfaces and other textured surfaces may be generated, for example by any of a variety of methods known in the art, including sanding, chemical etching, sandblasting, and/or dewetting.
[0087] In some embodiments, cells are grown in suspension.
[0088] Various growth medium may be used to culture donor cells. Growth medium, generally refers to any substance or preparation used for the cultivation of living cells. In some embodiments, the growth medium is renal growth medium. In some embodiments the growth medium is Dulbecco's Modification of Eagle's medium (DMEM). In some embodiments, cells are grown in media that does not contain serum. In some embodiments, cells are grown for at least a period of time in media that has been depleted of micro vesicles from media components. For example, media containing fetal bovine serum may be depleted of bovine micro vesicles. Alternatively or additionally, commercially available medium that is depleted of microviescles (e.g. , bovine microvesicles) is used.
[0089] In some embodiments, cells are grown at or about 37 °C. In some embodiments, cells are grown in the presence of at or about 5% C02. In some embodiments, cells are grown under room air oxygen conditions. In some embodiments, cells are grown under conditions where the oxygen pressure is less than or equal to 5% 02. In some embodiments, cells are grown in conditions of normal oxygen (e.g., about 5% 02). In some embodiments, cells are grown in hypoxic conditions (e.g., low oxygen such as < 5%, < 4%, < 3 %, < 2%, or < 1% 02). [0090] In some embodiments, donor cells are grown under serum starvation conditions.
As used herein, the term "serum starvation" includes, but is not limited to, serum repletion, serum-free medium or conditions. Various serum starvation conditions are known in the art and can be used to practice the present invention. In some embodiments, cells may be grown under serum starvation conditions for about 6, about 12, about 18, about 24, about 30, about 36, about 42, about 48 hours, or longer. In some embodiments, cells may be grown under conditions where the serum concentration is less than or equal to 10%, less than or equal to 9%, less than or equal to 8%, less than or equal to 7%, less than or equal to 6%, less than or equal to 5%, less than or equal to 4%, less than or equal to 3%, less than or equal to 2%, less than or equal to 1.5%, less than or equal to 1%, or less than or equal to 0.5%. In some embodiments, cells may be grown under conditions where the serum concentration is 0% (i.e., serum is absent). In some embodiments, cells may be grown under conditions where the serum concentration is decreased in a step-wise manner over time. For example, in some embodiments, cells may be grown under conditions where the serum concentration is between about 2% to about 11% (e.g., about 2%, 3%), 4%), 5%, 6%, 7%, 8%), 9%), 10%, or 11%) and is subsequently reduced in one or more steps to a serum concentration between about 0% to about 5% (e.g., about 0%, 0.5%, 1%, 1.5%, 2%, 3%, 4%, or 5%).
Preparation of microvesicles
[0091] Various methods of isolating or enriching microvesicles known in the art may be used to practice the present invention. As used herein, the terms "isolation" or "isolating" in conjunction with microvesicles are interchangeably used with the terms "enrichment" or "enriching," and refer to one or more process steps that result in an increase of the fraction of microvesicles in a sample as compared to the fraction of microvesicles in the obtained biological sample. Thus, microvesicles may be purified to homogeneity, purified to at least 90% (with respect to non-microvesicle particulate matter), at least 80%, at least 70%, at least 60%, at least 50%), at least 40%, at least 30%, or at least 20% (or even less). For example, physical properties of microvesicles- may be employed to separate them from a medium or other source material. For example, microvesicles may be separated on the basis of electrical charge (e.g.,
electrophoretic separation), size (e.g., filtration, molecular sieving, etc), density (e.g., regular or gradient centrifugation), Svedberg constant (e.g., sedimentation with or without external force, etc).
[0092] In some embodiments, microvesicles are isolated or purified by centrifugation
(e.g., ultracentrifugation). It will be appreciated that various centrifugation conditions (e.g., speed, centrifugal force, centrifugation time, etc.) may be used in order to obtain a desired fraction of isolated or purified microvesicles. For example, in some embodiments, a sample may be centrifuged at a fairly low centrifugal force (e.g., approximately 16,000 x g) sufficient to pellet larger microvesicles (e.g., approximately 1000 nm or more). In some embodiments, a sample (e.g., the resulting supernatant from the initial low speed spin) may be centrifuged at a higher centrifugal force (e.g., approximately 120,000 x g) sufficient to pellet microvesicles of a smaller size (e.g., less then 1000 nm). In some embodiments, a microvesicle preparation prepared using this method may contain substantially small particles, for example, particles with a size ranging from about lOnm to 1000 nm (e.g., about 50-1000 nm, 75-1000 nm, 100-1000 nm, 10-750 nm, 50-750 nm, 100-75 Onm, 100-500 nm). An exemplary microvesicle fractionation schematic is depicted in Figure 3. In some embodiments, such small particles are also referred to as exosomes, exosome-like vesicles, and/or membrane particles. In some embodiments, such fraction is referred to as exosome fraction.
[0093] In some embodiments, microvesicles are isolated or purified by precipitation. It will be appreciated that various precipitation conditions may be used in order to obtain a desired fraction of isolated or purified microvesicles. For example, various kits are available for exosome precipitation, such as ExoQuick™ and Exo-Quick-TC™ (available from System Biosciences, Mountain View, California) and may be used in accordance with the present invention.
[0094] Alternatively, or additionally, isolation may be based on one or more biological properties, and may employ surface markers (e.g., for precipitation, reversible binding to solid phase, FACS separation, specific ligand binding, non-specific ligand binding such as annexin V, etc.). In yet further contemplated methods, the microvesicles may also be fused using chemical and/or physical methods, including PEG-induced fusion and/or ultrasonic fusion. [0095] In some embodiments, microvesicles are obtained from conditioned media from cultures of microvesicle-producing cells.
Synthetic Microvesicles
[0096] In some embodiments, microvesicles suitable for the present invention may be synthetically produced. Synthetic microvesicles typically include one or more membrane components obtained from a donor cell. In some embodiments, synthetic microvesicles include at least one microRNA described herein. For example, synthetic microvesicles may be prepared by disintegration of a donor cell (e.g., via detergent, sonication, shear forces, etc.) and use of the crude preparation or an at least partially enriched membrane fraction to reconstitute one or more microvesicles. In some embodiments, exogenous microRNAs may be added to microvesicles.
II. MicroRNAs
[0097] In some embodiments, microvesicles comprise one or more specific microRNAs.
As used herein, microvesicle-specific microRNAs include those microRNAs only present in microvesicles not in cells and those microRNAs that are substantially enriched in microvesicles as compared to cells. Microvesicle-specific microRNAs encompass microRNAs isolated or purified from microvesicles or synthesized using recombinant or chemical techniques. For example, microRNA molecules may be generated by in vitro transcription of DNA sequences encoding the relevant molecule. Such DNA sequences may be incorporated into a wide variety of vectors with suitable RNA polymerase promoters such as T7, T3, or SP6. As used herein, the term "microRNAs (miRNAs)" refers to post-transcriptional regulators that typically bind to complementary sequences in the three prime untranslated regions (3 ' UTRs) of target messenger RNA transcripts (mRNAs), usually resulting in gene silencing. Typically, miRNAs are short ribonucleic acid (RNA) molecules. For example, microRNAs may be approximately 18-25 nucleotides long (e.g., approximately 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides long).
[0098] It is contemplated that microvesicle specific microRNAs, individually or in combination, may be used to induce or stimulate tissue or cell growth, remodeling, reconstruction, differentiation and/or transdifferentitation, among other functions. Thus, the present invention provides, among other things, methods of identifying microvesicle-specific microRNAs or any microRNAs that can induce or stimulate tissue or cell growth, remodeling, reconstruction, differentiation and/or transdifferentitation.
[0099] In some embodiments, inventive methods according to the present invention may include one or more of the following steps of: providing cells grown in a micro vesicle-depleted medium, adding an miRNA to the medium, and determining if addition of the miRNA increases cell proliferation rate as compared to a control, thereby identifying if the miRNA induces cell growth and/or regeneration. In some embodiments, doubling time (e.g., the time it takes to double the population of cells in a cell culture vessel) is used as an indication of cell proliferation rate.
[0100] Cell proliferation assays are known in the art, and any of a variety of such assays may be employed to determine cell proliferation rates. For example, cell numbers (e.g., per volume of media; or for an entire cell culture vessel, etc.) may be counted using standard cell counting techniques known in the art. In some such cell counting methods, cells are labeled with a dye to ease detection. In some methods of assessing cell proliferation, cells are brought into a suspension of a known volume and the density (e.g., optical density) of at least an aliquot of the cell suspension is measured using standard spectrophotometry techniques.
[0101] Some cell proliferation assays measure DNA synthesis. For example, incorporation of a labeled nucleotide or nucleotide analog (e.g., BrdU (bromodeoxyuridine), tritium-labeled thymidine, etc. can be employed in a cell proliferation assay. Some cell proliferation assays measure conversion of a substrate by a metabolic enzyme. For example, an "MTT" assay measures the cleavage of a tetrazolium salt WST-1 to formazan by cellular mitochondrial dehydrogenases.
[0102] In some embodiments, cell viability is also measured and taken into account such that only viable cells are counted. For example, the ability to exclude trypan blue dye is taken as a sign of membrane integrity and therefore cell viability, and cell counting methods typically include using trypan blue. [0103] In some embodiments, inventive methods for identifying microR A according to the present invention may include one or more of the following steps of: creating a wounded area in cells grown to confluence; treating the cells with an miRNA; and determining a rate of re- growth of the treated cells across the wounded area as compared to a control, thereby identifying if the miRNA induces cell growth and/or regeneration.
[0104] Re-growth over wounded areas in a confluent cell culture can be measured by methods known in the art. In some embodiments, re-growth is measured quantitatively. For example, re-growth can be measured quantitatively using, e.g. , an XCELLIGENCE™ System (Roche Applied Science).
[0105] In some embodiments, methods are performed in a high-throughput fashion, e.g., with many miRNAs being tested in parallel. Multi-well plates (e.g., 24- well, 48-well, 96-well, 324-well, etc.) may facilitate such parallel testing, as each miRNA may be tested in an individual well.
[0106] Any type of cells that can be grown in culture can be used in methods of the invention. For example, various donor cells described herein may be used. In some
embodiments, suitable cells include pancreas-derived pathfinder cells, fibroblasts, and cardiomyocytes.
[0107] Various candidate miRNAs may be tested using inventive methods described herein. For example, miRNAs that are isolated from microvesicles may be used. Alternatively or additionally, miRNAs that have been identified in the literature or in other experiments as being of potential interest (e.g. , as being associated with a disease, with transdifferentiation, with potential therapeutic applications, etc.) may be used in methods of the invention to determine of such miRNAs induce cell growth and/or regeneration. In some embodiments, a miRNA library is used. For example, a collection of cloned miRNAs from an expression library may be used in accordance with methods of the invention to identify one or more miRNAs that induce cell growth and/or regeneration. In some embodiments, an miRNA expression library from a cell type of interest is used. [0108] Appropriate controls in the step of determining include, but are not limited to, untreated cells that are otherwise grown under identical conditions (e.g. , cells to which no miR A is added), and/or cells to which a "control" miRNA is added that are otherwise grown under identical conditions. The "control" miRNA, if used, generally has a known effect on cell growth and/or regeneration. In some embodiments, more than one control is used. In some embodiments, a negative control (one for which no inducement of cell growth and/or regeneration is expected) is used. In some embodiments, a positive control (one for which inducement of cell growth and/or regeneration is expected) is used. In some embodiments, both a positive and negative control is used.
[0109] Table 1 shows exemplary microRNAs that are specifically present in
micro vesicles. In some embodiments, it was found that miRNA-122, miRNA-127, miRNA- 133b, miRNA-323, miRNA-433, miRNA-451 , miRNA-466h, miRNA-467c, miRNA-467e, miRNA-468, miRNA-491, miRNA-495, miRNA-546, miRNA-666, miRNA-680, and miRNA- 346 (SEQ ID NOs: l-29) are present in microvesicles at relatively higher concentrations.
Additonal microRNAs identified according to the present invention are listed in Tables 3-13. Table 1 lists exemplary miRNA sequences for each miRNA of interest; corresponding miRNA sequences in other species, including, but not limited to, Homo sapiens, Rattus norvegicus, Mus musculus, Danio rerio, and Gallus gallus,are publicly available (e.g., see
http://diana.cslab.ece.ntua.gr/mirgen/). As can be seen in Table 1 and Tables 7-13, some miRNA sequences are well conserved across species, and some miRNA sequence variants exist even in the same species. Tables 7-13 show exemplary microRNAs that may be used in accordance with the present invention.
Table 1: microRNA sequences
Sequence
microRNA
(species, variant (if applicable))
UGGAGUGUGAC AAUGGUGUUUG (SEQ ID NO : 1 )
(Homo sapiens)
miR122
UGGAGUGUGAC AAUGGUGUUUG (SEQ ID NO :2)
(Rattus norvegicus)
miR127 CUGAAGCUCAGAGGGCUCUGAU (SEQ ID NO:3) (Homo sapiens, miR127-5p)
UCGGAUCCGUCUGAGCUUGGCU (SEQ ID NO:4) (Homo sapiens, miR127-3p)
UCGGAUCCGUCUGAGCUUGGCU (SEQ ID NO:5) (Rattus norvegicus)
UUUGGUCCCCUUCAACCAGCUA (SEQ ID NO:6) (Homo sapiens)
miR133b
UUUGGUCCCCUUCAACCAGCUA (SEQ ID NO:7) (Rattus novergicus)
AGGUGGUCCGUGGCGCGUUCGC (SEQ ID NO: 8) (Homo sapiens, miR323-5p)
CACAUUACACGGUCGACCUCU (SEQ ID NO:9) (Homo sapiens, miR323-3p)
miR323
CACAUUACACGGUCGACCUCU (SEQ ID NO: 10) (Rattus novergicus)
AGGUGGUCCGUGGCGCGUUCGC (SEQ ID NO: 11) (Rattus novergicus, variant)
UGUCUGCCCGCAUGCCUGCCUCU (SEQ ID NO: 12) (Homo sapiens)
miR346
UGUCUGCCUGAGUGCCUGCCUCU (SEQ ID NO: 13) (Rattus novergicus)
AUCAUGAUGGGCUCCUCGGUGU (SEQ ID NO: 14) (Homo sapiens)
miR433
AUCAUGAUGGGCUCCUCGGUGU (SEQ ID NO: 15) (Rattus norvegicus)
AAACCGUUACCAUUACUGAGUU (SEQ ID NO: 16) (Homo sapiens)
miR451
AAACCGUUACCAUUACUGAGUU (SEQ ID NO: 17) (Rattus norvegicus)
UGUGUGCAUGUGCUUGUGUGUA (SEQ ID NO: 18) miR466h
(Mus musculus)
UAAGUGCGUGCAUGUAUAUGUG (SEQ ID NO: 19) miR467c
(Mus musculus) AUAAGUGUGAGCAUGUAUAUGU (SEQ ID NO:20) (Mus musculus)
miR467e
AUAUACAUACACACACCUAUAU (SEQ ID NO:21) (Mus musculus, variant)
UAUGACUGAUGUGCGUGUGUCUG (SEQ ID NO:22) miR468
(Mus musculus)
AGUGGGGAACCCUUCCAUGAGG (SEQ ID NO:23) (Homo sapiens, miR491-5p)
miR491
CUUAUGCAAGAUUCCCUUCUAC (SEQ ID NO:24) (Homo sapiens, miR491-3p)
AAACAAACAUGGUGCACUUCUU (SEQ ID NO:25) (Homo sapiens)
miR495
AAACAAACAUGGUGCACUUCUU (SEQ ID NO:26) (Rattus norvegicus)
AUGGUGGCACGGAGUC (SEQ ID NO:27) miR546
(Mus musculus)
AGC GGGC AC GGCUGUG AG AGC C (SEQ ID NO:28) miR666
(Rattus norvegicus)
GGGCAUCUGCUGACAUGGGGG (SEQ ID NO:29) miR680
(Mus musculus)
ACUCCAUUUGUUUUGAUGAUGGA (SEQ ID NO:30) (Homo sapiens)
miR136
CAUCAUCGUCUCAAAUGAGUCU (SEQ ID NO:31) (Homo sapiens, variant)
AGAGGUAUAGGGCAUGGGAA (SEQ ID NO:32) (Homo sapiens)
UUCCUAUGCAUAUACUUCUUUG (SEQ ID NO:33) miR202 (Homo sapiens, variant)
UUCCUAUGCAUAUACUUCUUU (SEQ ID NO:34) (Rattus norvegicus)
UGGAAUGUAAGGAAGUGUGUGG (SEQ ID NO:35) (Homo sapiens)
miR206
UGGAAUGUAAGGAAGUGUGUGG (SEQ ID NO:36) (Rattus norvegicus) CAAGUCACUAGUGGUUCCGUU (SEQ ID NO:37) (Homo sapiens)
AAAAUGGUGCCCUAGUGACUACA (SEQ ID NO:38) miR224
(Homo sapiens, variant)
CAAGUCACUAGUGGUUCCGUUUA (SEQ ID NO:39) (Rattus norvegicus)
CCUUGAGGGGCAUGAGGGU (SEQ ID NO:40) miR327
(Rattus norvegicus)
UGUCCCUCUGGGUCGCCCA (SEQ ID NO:41) miR347
(Rattus norvegicus)
AGAUCGACCGUGUUAUAUUCGC (SEQ ID NO:42) (Homo sapiens, miR369-5p)
AAUAAUACAUGGUUGAUCUUU (SEQ ID NO:43) (Homo sapiens, miR369-3p)
miR369
AGAUCGACCGUGUUAUAUUCGC (SEQ ID NO:44) (Rattus norvegicus, miR369-5p)
AAUAAUACAUGGUUGAUCUUU (SEQ ID NO:45) (Rattus norvegicus, miR369-3p)
GCCUGCUGGGGUGGAACCUGGU (SEQ ID NO:46) (Homo sapiens)
miR370
GCCUGCUGGGGUGGAACCUGGUU (SEQ ID NO:47) (Rattus norvegicus)
UUUGUUCGUUCGGCUCGCGUGA (SEQ ID NO:48) (Homo sapiens)
miR375
UUUGUUCGUUCGGCUCGCGUGA (SEQ ID NO:49) (Rattus norvegicus)
AUCAUAGAGGAAAAUCCAUGUU (SEQ ID NO:50) (Homo sapiens)
GUGGAUAUUCCUUCUAUGGUUA (SEQ ID NO:51) miR376b
(Rattus norvegicus, miR376-5p)
AUCAUAGAGGAACAUCCACUU (SEQ ID NO:52) (Rattus norvegicus, miR376-3p)
UAUACAAGGGCAAGCUCUCUGU (SEQ ID NO:53) miR381
(Homo sapiens) UAUACAAGGGCAAGCUCUC (SEQ ID NO:54) (Rattus norvegicus)
UUUGAACCAUCACUCGACUCCU (SEQ ID NO:55) miR434
(Rattus norvegicus)
AACUGUUUGCAGAGGAAACUGA (SEQ ID NO:56) (Homo sapiens)
miR452
CUCAUCUGCAAAGAAGUAAGUG (SEQ ID NO:57) (Homo sapiens, variant)
UAUUUAGAAUGGCACUGAUGUGA (SEQ ID NO:58) (Mus musculus, miR465a-5p)
miR465a
GAUCAGGGCCUUUCUAAGUAGA (SEQ ID NO:59) (Mus musculus, miR465-3p)
UAUUUAGAAUGGUGCUGAUCUG (SEQ ID NO:60) (Mus musculus, miR465b-5p)
miR465b
GAUCAGGGCCUUUCUAAGUAGA (SEQ ID NO:61) (Mus musculus, miR465b-3p)
UUCUUGGACUGGCACUGGUGAGU (SEQ ID NO:62) (Mus musculus)
miR470
AACCAGUACCUUUCUGAGAAGA (SEQ ID NO:63) (Mus musculus, variant)
AAUC AUAC AGGG AC AUC C AGUU (SEQ ID NO:64) miR487b
(Homo sapiens)
AAACAUUCGCGGUGCACUUCUU (SEQ ID NO:65) (Homo sapiens)
AAGUUGCCCGCGUGUUUUUCGC (SEQ ID NO:66) miR543 (Rattus norvegicus)
AAACAUUCGCGGUGCACUUCU (SEQ ID NO:67) (Rattus norvegicus, variant)
UUGGUACUUCUUUAAGUGAG (SEQ ID NO:68) miR547
(Rattus norvegicus)
GAGCUUAUUCAUAAAAGUGCAG (SEQ ID NO:69) miR590 (Homo sapiens, miR590-5p) UAAUUUUAUGUAUAAGCUAGU (SEQ ID NO:70)
(Homo sapiens, miR590-3p)
UGAGAGAUGCCAUUCUAUGUAGA (SEQ ID NO:71)
miR741
(Mus musculus)
AACUGUGGCAUUUCUGAAUAGA (SEQ ID NO:72)
miR881
(Rattus norvegicus)
[0110] It is contemplated that one or more microRNAs identified according to the present invention (e.g., SEQ ID NOs 1-72 and those listed in Tables 7-13, may be used to induce or stimulate tissue or cell growth, remodeling, reconstruction, differentiation and/or
transdifferentitation, and/or to treat associated diseases, disorders or conditions. In some embodiments, functional variants of microRNAs described herein may be used. For example, suitable microRNAs may include microRNAs having a sequence at least 70% (e.g., 75%, 80%>, 85%, 90%, 95%, 96%, 97%, 98%, 99%) identical to any one of microRNAs identified in Table 1 and Tables 7-13. In some embodiments, suitable microRNAs are functional variants of microRNAs that are present at a relatively higher concentration in micro vesicles. Accordingly, in some embodiments, suitable microRNAs may include microRNAs having a sequence at least 70% (e.g., 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%) identical to any one of SEQ ID NO: l to 16.
[0111] "Percent (%) nucleic acid sequence identity" with respect to microRNA sequences identified herein is defined as the percentage of nucleotides in a candidate sequence that are identical with the nucleotides in a reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. Preferably, the WU-BLAST-2 software is used to determine amino acid sequence identity (Altschul et ah, Methods in Enzymology, 266, 460-480 (1996); http://blast.wustl/edu/blast/README.html). WU-BLAST-2 uses several search parameters, most of which are set to the default values. The adjustable parameters are set with the following values: overlap span=l, overlap fraction=0.125, world threshold (T)=l 1. HSP score (S) and HSP S2 parameters are dynamic values and are established by the program itself, depending upon the composition of the particular sequence, however, the minimum values may be adjusted and are set as indicated above.
[0112] Suitable microRNAs may be comprised entirely of natural R A nucleotides, or may instead include one or more nucleotide analogs and/or modifications. The microRNA structure may be stabilized, for example by including nucleotide analogs at one or more free strand ends in order to reduce digestion, e.g., by exonucleases. Suitable microRNAs may contain modified ribonucleotides, that is, ribonucleotides that contain a modification in the chemical structure of an unmodified nucleotide base, sugar and/or phosphate (or phospodiester linkage). As is known in the art, an "unmodified ribonucleotide" has one of the bases adenine, cytosine, guanine, and uracil joined to the 1 ' carbon of beta-D-ribo-furanose. Modified microRNA molecules may also contain modified backbones or non-natural internucleoside linkages, e.g., modified phosphorous-containing backbones and non-phosphorous backbones such as morpholino backbones; siloxane, sulfide, sulfoxide, sulfone, sulfonate, sulfonamide, and sulfamate backbones; formacetyl and thioformacetyl backbones; alkene-containing backbones; methyleneimino and methylenehydrazino backbones; amide backbones, and the like.
III. Therapeutic Applications
[0113] In some embodiments, the present invention provides methods of using microvesicles and/or microRNAs for inducing or stimulating tissue or cell growth, remodeling, reconstruction, differentiation and/or transdifferentitation, or treating associated diseases, disorders or conditions. While not wishing to be bound by a particular theory or hypothesis, it is contemplated that microvesicles may induce changes within target tissue or cells to convert them into active repair mode by providing microRNAs and/or other components (e.g., membrane associated polypeptide, transcription factors, etc.) that will regulate expression of genes relating to, e.g., increased cell mobility, tissue remodeling and reprogramming, growth, angiogenesis, cell adhesion and cell signaling, etc. It is further contemplated that microvesicles will typically not be part of the new tissue or cells. Thus, according to the present invention, microvesicles or microRNAs from different tissues, cell types or organisms may be used. In some embodiments, microvesicles or microRNAs may be used without inducing immuno reaction. In some embodiments, microvesicles or microRNAs may be used without an immunosuppressant.
[0114] Thus, suitable microvesicles or microRNAs can be derived from autologous cells
(i.e., cells from the same individual as the patient) or non-auto logous cells (i.e., cells from a different individual as the patient) or both. In some embodiments, microvesicles are derived from tissue that is the same as the diseased tissue. For example, in methods of treating a kidney disease, microvesicles may be taken from healthy kidney cells from the same or different individual being treated. In some embodiments, microvesicles are derived from tissue that is different than the diseased tissue.
[0115] In some embodiments, methods of treatment comprise one or more steps that are performed in vitro or ex vivo to induce cells ("recipient cells") to differentiate or
transdifferentiate into a desirable cell type. Such recipient cells can then be transferred into a patient.
[0116] In some embodiments, provided methods comprise co-culturing donor cells (i.e., cells that produce microvesicles) and recipient cells (i.e., cells that received microvesicles and/or contents of such microvesicles) ex vivo and then transferring recipient cells into an patient. In some embodiments, recipient cells are transferred back into the same individual from whom recipient cells were obtained. For example, pathfinder cells can be co-cultured with bone marrow cells obtained from an patient for a period of time ex vivo to allow transfer of microvesicles and/or their contents, then bone marrow cells may be transferred back into the individual.
[0117] In some embodiments, recipient cells are tested for expression of specific biomarkers such as certain microRNAs after co-culturing with donor cells before transfer into a patient.
[0118] In certain embodiments, methods of treatment comprise a step of administering to a patient in need of treatment a therapeutically effective amount of one or more microRNAs as described herein. miR As may be used in the absence or presence of microvesicles or derivatives thereof.
[0119] In some embodiments, methods and compositions (e.g., microvesicles and/or microRNAs) according to the present invention may be used to treat diseases, disorders, or conditions in various tissues including, but not limited to, central nervous system (CNS), peripheral nervous system, cardiovascular system, respiratory system, gastrointestinal tract and associated glands, integumentary system, musculoskeletal system, and other systems of the body. In some embodiments, methods and compositions (e.g., microvesicles and/or microRNAs) according to the present invention may be used to treat age-related degeneration. In some embodiments, methods and compositions (e.g., microvesicles and/or microRNAs) according to the present invention may be used to treat inflammation. In some embodiments, microvesicles and/or microRNAs according to the present invention may be suitable for cosmetic uses or for treating a condition or disorder associated with a cosmetic surgical procedure.
Inflammation
[0120] In some embodiments, methods and compositions of the present invention are used to treat or ameliorate inflammation. As used herein, the term "inflammation" includes inflammatory conditions occurring in many disorders which include, but are not limited to:
Systemic Inflammatory Response (SIRS); Alzheimer's Disease (and associated conditions and symptoms including: chronic neuroinflammation, glial activation; increased microglia; neuritic plaque formation; and response to therapy); Amyotropic Lateral Sclerosis (ALS), arthritis (and associated conditions and symptoms including, but not limited to: acute joint inflammation, antigen-induced arthritis, arthritis associated with chronic lymphocytic thyroiditis, collagen- induced arthritis, juvenile arthritis; rheumatoid arthritis, osteoarthritis, prognosis and
streptococcus-induced arthritis, spondyloarthopathies, gouty arthritis), asthma (and associated conditions and symptoms, including: bronchial asthma; chronic obstructive airway disease;
chronic obstructive pulmonary disease, juvenile asthma and occupational asthma);
cardiovascular diseases (and associated conditions and symptoms, including atherosclerosis; autoimmune myocarditis, chronic cardiac hypoxia, congestive heart failure, coronary artery disease, cardiomyopathy and cardiac cell dysfunction, including: aortic smooth muscle cell activation; cardiac cell apoptosis; and immunomodulation of cardiac cell function; diabetes and associated conditions and symptoms, including autoimmune diabetes, insulin-dependent (Type 1) diabetes, diabetic periodontitis, diabetic retinopathy, and diabetic nephropathy);
gastrointestinal inflammations (and related conditions and symptoms, including celiac disease, associated osteopenia, chronic colitis, Crohn's disease, inflammatory bowel disease and ulcerative colitis); gastric ulcers; hepatic inflammations such as viral and other types of hepatitis, cholesterol gallstones and hepatic fibrosis, HIV infection (and associated conditions and symptoms, including degenerative responses, neurodegenerative responses, and HIV associated Hodgkin's Disease), Kawasaki's Syndrome (and associated diseases and conditions, including mucocutaneous lymph node syndrome, cervical lymphadenopathy, coronary artery lesions, edema, fever, increased leukocytes, mild anemia, skin peeling, rash, conjunctiva redness, thrombocytosis; multiple sclerosis, nephropathies (and associated diseases and conditions, including diabetic nephropathy, endstage renal disease, acute and chronic glomerulonephritis, acute and chronic interstitial nephritis, lupus nephritis, Goodpasture's syndrome, hemodialysis survival and renal ischemic reperfusion injury), neurodegenerative diseases (and associated diseases and conditions, including acute neurodegeneration, induction of IL-1 in aging and neurodegenerative disease, IL-1 induced plasticity of hypothalamic neurons and chronic stress hyperresponsiveness), ophthalmopathies (and associated diseases and conditions, including diabetic retinopathy, Graves' opthalmopathy, and uveitis, osteoporosis (and associated diseases and conditions, including alveolar, femoral, radial, vertebral or wrist bone loss or fracture incidence, postmenopausal bone loss, mass, fracture incidence or rate of bone loss), otitis media (adult or pediatric), pancreatitis or pancreatic acinitis, periodontal disease (and associated diseases and conditions, including adult, early onset and diabetic); pulmonary diseases, including chronic lung disease, chronic sinusitis, hyaline membrane disease, hypoxia and pulmonary disease in SIDS; restenosis of coronary or other vascular grafts; rheumatism including rheumatoid arthritis, rheumatic Aschoff bodies, rheumatic diseases and rheumatic myocarditis; thyroiditis including chronic lymphocytic thyroiditis; urinary tract infections including chronic prostatitis, chronic pelvic pain syndrome and urolithiasis. Immunological disorders, including autoimmune diseases, such as alopecia aerata, autoimmune myocarditis, Graves' disease, Graves opthalmopathy, lichen sclerosis, multiple sclerosis, psoriasis, systemic lupus erythematosus, systemic sclerosis, thyroid diseases (e.g. goiter and struma lymphomatosa (Hashimoto's thyroiditis, lymphadenoid goiter), sleep disorders and chronic fatigue syndrome and obesity (non-diabetic or associated with diabetes). Resistance to infectious diseases, such as
Leishmaniasis, Leprosy, Lyme Disease, Lyme Carditis, malaria, cerebral malaria, meningitis, tubulointerstitial nephritis associated with malaria), which are caused by bacteria, viruses (e.g. cytomegalovirus, encephalitis, Epstein-Barr Virus, Human Immunodeficiency Virus, Influenza Virus) or protozoans (e.g., Plasmodium falciparum, trypanosomes). Response to trauma, including cerebral trauma (including strokes and ischemias, encephalitis, encephalopathies, epilepsy, perinatal brain injury, prolonged febrile seizures, SIDS and subarachnoid hemorrhage), low birth weight (e.g. cerebral palsy), lung injury (acute hemorrhagic lung injury, Goodpasture's syndrome, acute ischemic reperfusion), myocardial dysfunction, caused by occupational and environmental pollutants (e.g. susceptibility to toxic oil syndrome silicosis), radiation trauma, and efficiency of wound healing responses (e.g. burn or thermal wounds, chronic wounds, surgical wounds and spinal cord injuries). Hormonal regulation including fertility/fecundity, likelihood of a pregnancy, incidence of preterm labor, prenatal and neonatal complications including preterm low birth weight, cerebral palsy, septicemia, hypothyroidism, oxygen dependence, cranial abnormality, early onset menopause. A subject's response to transplant (rejection or acceptance), acute phase response (e.g. febrile response), general inflammatory response, acute respiratory distress response, acute systemic inflammatory response, wound healing, adhesion, immunoinflammatory response, neuroendocrine response, fever development and resistance, acute -phase response, stress response, disease susceptibility, repetitive motion stress, tennis elbow, and pain management and response.
[0121] In particular embodiments, methods and compositions of the present invention can be used to treat or ameliorate inflammation associated with an immunodeficiency disease, disorder, or condition. Non-limiting examples of diseases, disorders, and conditions that may be characterized by immunodeficiency include hypgammaglobulinemia, agammaglobulinemia, ataxia telengiectasia, severe combined immunodeficiency disease (SCID), acquired
immunodeficiency syndrome (AIDS) such as that caused by infection by human
immunodeficiency virus (HIV), Chediak-Higashi syndrome, combined immunodeficiency disease, complement deficiencies, diGeorge syndrome, Job syndrome, leukocyte adhesion defects, panhypogammaglobulinemia (e.g., Bruton disease, congential agammaglobulinemia, selective deficiency of IgA, Wiscott-Aldrich syndrome. In some embodiments, pathfinder cells and/or cells differentiated from pathfinder cells treat or ameliorate immunodeficiency by stimulating reconstitution of one or more blood cell types, i.e., cells of the immune system. It is contemplated that pathfinder cell-associated microRNAs disclosed herein would similarly be useful in treating or ameliorating immunodeficiency.
[0122] In certain embodiments, methods and compositions of the present invention are used to treat or ammeliorate an autoimmune diesase, disorder or condition. In general, autoimmunity is the failure of an organism to recognize its own constituent parts as "self," which results in an immune response against the organism's own tissues and cells. Exemplary autoimmune diseases and/or suspected autoimmune diseases include, but are not limited to, Acute disseminated encephalomyelitis (ADEM), Addison's disease, Alopecia universalis, Ankylosing spondylitisis, Antiphospholipid antibody syndrome (APS), Aplastic anemia, Autoimmune hemolytic anemia, Autoimmune hepatitis, Autoimmune inner ear disease (AIED), Autoimmune lymphoproliferative syndrome (ALPS), Autoimmune oophoritis, Balo disease, Behcet's disease, Bullous pemphigoid, Cardiomyopathy, Chagas' disease, Chronic fatigue immune dysfunction syndrome (CFIDS), Chronic inflammatory demyelinating polyneuropathy, Crohn's disease, Cicatrical pemphigoid, Coeliac sprue-dermatitis herpetiformis, Cold agglutinin disease, CREST syndrome, Degos disease, Diabetes mellitus, Discoid lupus, Dysautonomia, Endometriosis, Essential mixed cryoglobulinemia, Fibromyalgia-fibromyositis, Goodpasture's syndrome, Grave's disease, Guillain-Barre syndrome (GBS), Hashimoto's thyroiditis,
Hidradenitis suppurativa, Idiopathic and/or acute thrombocytopenic purpura, Idiopathic pulmonary fibrosis, IgA neuropathy, Interstitial cytisis, Juvenile arthritis, Kawasaki's disease, Lichen planus, Lupus erythematosus, Lyme disease, Meniere disease, Mixed connective tissue disease (MCTD), Multiple sclerosis, Myasthenia gravis, Neuromyotonia, Opsoclonus myoclonus syndrome (OMS), Optic neuritis, Ord's thyroiditis, Osteoarthritis, Pemphigus vulgaris,
Pernicious anemia, Polyarthritis, Polychondritis, Polymyositis and dermatomyositis, Primary biliary cirrhosis, Psoriasis, Polyarteritis nodosa, Polyglandular syndromes, Polymyalgia rheumatica, Primary agammaglobulinemia, Raynaud phenomenon, Reiter's syndrome,
Rheumatic fever, Sarcoidosis, Schizophrenia, Scleroderma, Sjogren's syndrome, Stiff person syndrome, Takayasu's arteritis, Temporal arteritis (also known as "giant cell arteritis"), Ulcerative colitis, Uveitis, Vasculitis, Vitiligo, Vulvodynia ("vulvar vestibulitis"), and
Wegener's granulomatosis.
Transplantation Stress
[0123] In certain embodiments, methods and compositions of the present invention are used to alleviate transplantation stress. It is contemplated that tissue/organ transplantation may cause acute tissue damage and microvesicles disclosed herein may be administered into an organ/tissue transplant recipient to stimulate tissue repair, regeneration, reconstitution, remodeling, and/or inducing immune tolerance, thereby alleviating transplantation stress. It is contemplated that the present invention may be used to facilitate any organ transplantation including, but not limited to, heart, kidney, liver, lung, pancreas, intestine, thymus, and skin transplantation.
[0124] In certain embodiments, methods and compositions of the present invention are used to treat or ameliorate a disease, disorder, or condition associated with graft rejection. In general, graft rejection may result from functional immune cells in a recipient recognizing a donor organ or tissue as a foreign entity and mounting of an immunologic attack on the donor organ or tissue. In some cases, graft rejection arises in an acute phase following transplantation of donor organs or tissues to a recipient. In some cases, graft rejection arises in a chronic phase following transplantation of donor organs or tissues to a recipient. It is to be understood that the present invention encompasses methods and compositions for treatment of acute and/or chronic graft rejection.
[0125] In certain embodiments, methods and compositions of the present invention are used to treat or ameliorate a graft versus host disease, disorder, or condition. In general, Graft versus Host disease (GVHD) may result from functional immune cells in a transplanted tissue or organ from a donor recognizing the recipient as a foreign entity and mounting an immunologic attack on the recipient's cells and/or tissues. In some cases, GVHD arises in an acute phase following transplantation of donor organs or tissues to a recipient. In some cases, GVHD arises in a chronic phase following transplantation of donor organs or tissues to a recipient. It is to be understood that the present invention encompasses methods and compositions for treatment of acute and/or chronic GVHD.
Immune Tolerance
[0126] It is contemplated that pathfinder cells or their extracellular secretomes (e.g., microvesicles) induce immune tolerance and thus are particularly useful in treating inflammation and suppressing, inhibiting or reducing transplantation associated stress. Without wishing to be bound by particular theory, it is contemplated that the pathfinder cells or their extracellular secretomes (e.g., microvesicles) induce immune tolerance by inducing increased IL-2 response, resulting in expansion of regulatory T cells (e.g., increased level and/or activity of T regulatory cells), decreased level and/or activity of cytotoxic T cells and/or helper T cells, and/or suppression of T cell or non T cell lymphocyte responses. In some embodiments, pathfinder cells or their extracellular secretomes (e.g., microvesicles) suppress pro-inflammatory and/or anti-angiogenic cytokine or chemokine response. Pro-inflammatory and/or anti-angiogenic cytokines or chemokines are well known in the art. Exemplary pro-inflammatory and/or anti- angiogenic cytokines or chemokines include, but are not limited to, IL-4, IL-5, IL-6, IL-10, IL- 12, IL-13, IL-17, GMCSF, TGF-β, TNF-a, IFN-γ, MCAF, and MIP1. In some embodiments, cells or their extracellular secretomes (e.g., microvesicles) increase anti-inflammatory and/or pro-angiogenic cytokine or chemokine response. Anti-inflammatory and/or pro-angiogenic cytokines or chemokines are known in the art. Exemplary anti-inflammatory and/or pro- angiogenic cytokines or chemokines include, but are not limited to, IL-Ιβ, GSCF, and IL-8.
[0127] Accordingly, administration of pathfinder cells or their extracellular secretomes
(e.g., microvesicles) according to the present invention does not result in severe adverse effects in the subject. As used herein, severe adverse effects include, but are not limited to, substantial immune response, toxicity, or death. As used herein, the term "substantial immune response" refers to severe or serious immune responses, such as adaptive T-cell immune responses.
[0128] Thus, in many embodiments, inventive methods according to the present invention do not involve concurrent immunosuppressant therapy (i.e., any immunosuppressant therapy used as pre -treatment/pre-conditioning or in parallel to the method). In some embodiments, inventive methods according to the present invention do not involve an immune tolerance induction in the subject being treated. In some embodiments, inventive methods according to the present invention do not involve a pre-treatment or preconditioning of the subject using T-cell immunosuppressive agent.
[0129] In some embodiments, however, administration of pathfinder cells or their extracellular secretomes (e.g., microvesicles) according to the present invention can mount an immune response against these agents. Thus, in some embodimnets, it may be useful to render the subject receiving the cells or their extracellular secretomes (e.g., microvesicles) tolerant to the therapy. Immune tolerance may be induced using various methods known in the art. Any immunosuppressant agent known to the skilled artisan may be employed together with a combination therapy of the invention. Such immunosuppressant agents include but are not limited to cyclosporine, FK506, rapamycin, CTLA4-Ig, and anti-TNF agents such as etanercept (see e.g. Moder, 2000, Ann. Allergy Asthma Immunol. 84, 280-284; Nevins, 2000, Curr. Opin. Pediatr. 12, 146-150; Kurlberg et al, 2000, Scand. J. Immunol. 51, 224-230; Ideguchi et al, 2000, Neuroscience 95, 217-226; Potteret al, 1999, Ann. N.Y. Acad. Sci. 875, 159-174; Slavik et al, 1999, Immunol. Res. 19, 1-24; Gaziev et al, 1999, Bone Marrow Transplant. 25, 689-696; Henry, 1999, Clin. Transplant. 13, 209-220; Gummert et al, 1999, J. Am. Soc. Nephrol. 10, 1366-1380; Qi et al, 2000, Transplantation 69, 1275-1283). The anti-IL2 receptor (.alpha.- subunit) antibody daclizumab (e.g. Zenapax.TM.), which has been demonstrated effective in transplant patients, can also be used as an immunosuppressant agent (see e.g. Wiseman et al, 1999, Drugs 58, 1029-1042; Beniaminovitz et al, 2000, N. Engl J. Med. 342, 613-619; Ponticelli et al, 1999, Drugs R. D. 1, 55-60; Berard et al, 1999, Pharmacotherapy 19, 1127-1137; Eckhoff et al, 2000, Transplantation 69, 1867-1872; Ekberg et al, 2000, Transpl. Int. 13, 151-159). Additionalimmunosuppressant agents include but are not limited to anti-CD2 (Branco et al., 1999, Transplantation 68, 1588-1596; Przepiorka et al, 1998, Blood 92, 4066-4071), anti-CD4 (Marinova-Mutafchieva et al, 2000, Arthritis Rheum. 43, 638-644; Fishwild et al, 1999, Clin. Immunol. 92, 138-152), and anti-CD40 ligand (Hong et al, 2000, Semin. Nephrol. 20, 108-125; Chirmule et al, 2000, J. Virol. 74, 3345-3352; Ito et al, 2000, J. Immunol. 164, 1230-1235). [0130] In addition, methods and compositions (e.g., pathfinder cells, cells differentiated from pathfinder cells, microvesicles and/or microRNAs) according to the present invention may be used to treat diseases, disorders, or conditions in various tissues including, but not limited to, central nervous system (CNS), peripheral nervous system, cardiovascular system, respiratory system, gastrointestinal tract and associated glands, integumentary system, musculoskeletal system, and other systems of the body. In some embodiments, methods and compositions according to the present invention may be used to treat age-related degeneration as well as progerias. In some embodiments, methods and compositions according to the present invention may be used to treat inflammation. In some embodiments, cells and/or microRNAs according to the present invention may be suitable for cosmetic uses or for treating a condition or disorder associated with a cosmetic surgical procedure.
Central Nervous System (CNS)
[0131] Examples of CNS-related diseases, disorders or conditions that may be treated by the methods and compositions of the present invention include motor neurone disease, multiple sclerosis, degenerative diseases of the CNS, dementive illnesses such as Alzheimer's disease, age related dysfunction of the CNS, Parkinson's disease, cerebrovascular accidents, epilepsy, temporary ischaemic accidents, disorders of mood, psychotic illnesses, specific lobe dysfunction, pressure related injury, cognitive dysfunction or impairments, deafness, blindness anosmia, diseases of the special senses, motor deficits, sensory deficits, head injury and trauma to the CNS. Methods and products of the present invention may also be used to enhance brain function or ameliorate deficiencies at a functional level or to facilitate post surgical repair of the CNS.
Cardiovascular system
[0132] Examples of diseases, disorders or conditions of the cardiovascular system that may be treated by the methods and compositions of the present invention include arrhythmias, myocardial infarction and other heart attacks, pericarditis, congestive heart diseases, valve- related pathologies, myocardial, endocardial and pericardial dysfunctions or degeneration, age- related cardiovascular disorders, dysfunctions, degeneration or diseases, sclerosis and thickening of valve flaps, fibrosis of cardiac muscle, decline in cardiac reserve, congenital defects of the heart or circulatory system, developmental defects of the heart or circulatory system, repair of hypoxic or necrotic damage, blood vessel damage and cardiovascular diseases or dysfunction (e.g., angina, dissected aorta, thrombotic damage, aneurysm, atherosclerosis, emboli damage and other problems associated with blood flow, pressure or impediment). Methods and compositions of the present invention may also be used to enhance cardiovascular function or health and to revascularise tissues. Moreover, methods and compositions of the present invention may be used to repair, modify, enhance or regenerate traumatic damage to the heart or blood vessels and as a technique to enhance the transplantation/implantation of a whole organ or its parts. Examples of this latter embodiment include heart transplantation, valve replacement surgeries, implantation of prosthetic devices and the development of novel surgical techniques.
Respiratory system
[0133] Examples of diseases, disorders or conditions of the respiratory system that may be treated by the methods and compositions of the present invention include damage, pathology, ageing and trauma of the nose and paranasal sinuses, nasopharynx, oropharynx, laryngopharynx, larynx, vocal ligaments, vocal cords, vestibular folds, glottis, epiglottis, trachea, mucocilliary mucosa, trachealis muscle, primary bronchi, lobar bronchi, segmental bronchi, terminal bronchioles, respiratory zone structures and plural membranes. Examples of such damage include obstructive pulmonary diseases, restrictive disorders, emphysema, chronic bronchitis, pulmonary infections, asthma, tuberculosis, genetic disorders (e.g., cystic fibrosis), gas exchange problems, burns, barotraumas and disorders affecting blood supply to the respiratory system. Methods and medicaments of the present invention may also be used to repair, modify, enhance or regenerate the respiratory system following damage. Moreover, methods and compositions of the present invention may be used as a technique to enhance the transplantation/implantation of whole respiratory structures or organs or their parts. Gastrointestinal tract and associated glands
[0134] Examples of diseases, disorders or conditions of the gastrointestinal tract and associated glands that may be treated by the methods and medicaments of the present invention include disorders, damage and age related changes of both the gastrointestinal tract and the large accessory glands (liver and pancreas), salivary glands, mouth, teeth, oesophagus, stomach, duodenum, jejunum, ileum, ascending colon, transverse colon, descending colon, sigmoid colon, rectum and anal canal and enteric nervous system of the canal. In specific embodiments, these disorders, damage and age related changes include dental caries, periodontal disease, deglutition problems, ulcers, enzymatic disturbances/deficiencies, motility problems, paralysis, dysfunction of absorption or absorptive surfaces, diverticulosis, inflammatory bowel problems, hepatitis, cirrhosis and portal hypertension. Methods and medicaments of the present invention may also be used to repair, modify, enhance or regenerate the gastrointestinal tract following damage, or be used as a technique to enhance any of these processes following surgery, such as resection of the stomach, ileostomy and reconstructive surgery (eg ileoanal juncture). Examples of this latter embodiment include reconstructive surgery involving specific anatomical structures of the mouth, such as labia, vestibule, oral cavity proper, red margin, labial frenulum, hard palate palatine bones, soft palate, uvula, tongue, intrinsic muscles of the tongue and extrinsic muscles of the tongue.
Integumentary system
[0135] Examples of diseases, disorders or conditions of the integumentary system that may be treated by the methods and medicaments of the present invention include disorders, damage and age related changes of the skin and integumentary system, such as age related decline in thickness or function, disorders of sweat gland and sebaceous glands, piloerectile dysfunction, follicular problems, hair loss, epidermal disease, diseases of the dermis or hypodermis, burns, ulcers, sores and infections. Methods and products of the present invention may also be used to enhance, regenerate or repair skin structures or functions, for example in plastic reconstruction, cosmetic repair, tattoo removal, wound healing, modulation of wrinkles and in the treatment of striae, seborrhoea, rosacea, port wine stains, skin colour and the improvement of blood supply to the skin. Moreover, methods and products of the present invention may be used to enhance skin grafts, surgical reconstruction, cosmetic surgical procedures, wound healing and cosmetic appearance.
Musculoskeletal system
[0136] Examples of diseases, disorders or conditions of the musculoskeletal system that may be treated by the methods and products of the present invention include disease, damage and age related changes of the musculoskeletal system. In some embodiment, these may be in components of the axial skeleton, including the skull, cranium, face, skull associated bones, auditory ossicles, hyoid bone, sternum, ribs, vertebrae, sacrum and coccyx. In other
embodiments they may be in components of the appendicular skeleton, including the clavicle, scapula, humerus, radius, ulna, carpal bones, metacarpal bones, phalanges (proximal, middle, distal), pelvic girdle, femur, patella, tibia, fibula, tarsal bones and metatarsal bones. Methods and compositions of the present invention may also be used to correct problems associated with ossification and osteogenesis, such as intramembranous ossification, endochondral ossification, bone remodelling and repair, osteoporosis, osteomalacia, rickets, pagets disease, rheumatism and arthritis. Moreover, methods and products of the present invention may be used to treat disease, damage and age related changes of the skeletal muscle, elastic cartilages, fibrocartilages, long bones, short bones, flat bones and irregular bones.
Other systems of the body
[0137] Diseases, disorders or conditions of other systems of the body may be treated by the methods and products of the present invention. For example, the present invention may be used to enhance function or treat disease, damage and age related changes in other systems of the body, including special senses, endocrine system, lymphatic system, urinary system,
reproductive system and alterations in metabolism and energetics. Treatment of general age-related degeneration
[0138] Methods and compositions of the present invention may be used to treat, ameliorate, reduce or compensate for general age-related degeneration. Similarly, methods and compositions of the present invention can be used to retain youthful functions of the body.
Moreover, methods and products of the present invention may be used to treat specific age related system dysfunction, such as cognitive impairment, hearing loss, loss of visual activity, endocrine imbalances, skeletal changes and loss of reproductive function.
Cosmetic use
[0139] In some embodiments, methods and compositions of the present invention may be used to prevent or reduce scars at a site of injury or infection. For example, microvesicles or microRNAs may be employed to regenerate tissue that would otherwise scar or necrotize, including hepatic tissue in the treatment of hepatic fibrosis and/or cirrhosis, facial epidermal tissue to treat acne, and cardiac tissue in the treatment of ischemic infarction.
[0140] In some embodiments, methods and compositions (e.g., microvesicles and/or microRNAs) according to the present invention may be used to enhance breast augmentation following mastectomy.
IV. Pharmaceutical compositions
[0141] In certain embodiments, the present invention provides pharmaceutical compositions comprising a therapeutically effective amount of microvesicles or microRNAs for the treatment of various diseases, disorders or conditions described herein. In some
embodiments, the present invention provides pharmaceutical compositions comprising a therapeutically effective amount of microvesicles or microRNAs for the treatment of diabetes mellitus, myocardial infarct, kidney disease, wound healing, fistulas generation or regeneration, neural regeneration, breast augmentation following mastectomy, and/or conditions associated with a cosmetic surgical procedure. [0142] In certain embodiments, the present invention provides pharmaceutical compositions comprising one or more microRNAs having a sequence at least 70% (e.g., 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%) identical to any of microRNAs identified in Table 1 and Tables 7-13 (e.g., SEQ ID NOS. 1-29) and a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier" includes carriers that are approved by a regulatory agency of government or listed in the United States Pharmocopeia, the European Pharmocopeia, the United Kingdom Pharmocopeia, or other generally recognized pharmocopeia for use in animals, and in particular humans. As used herein, the term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which a therapeutic agent (e.g., microvesicles and/or microRNAs) is administered.
[0143] Provided compositions may also contain minor amounts of wetting agents, emulsifying agents, and/or pH buffering agents. Provided compositions can take any of a variety of solid, liquid, or gel forms, including solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained-release formulations, and the like. Non-limiting examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E.W.
Martin. Compositions will generally contain a therapeutically effective amount of microvesicles and/or microRNAs, optionally in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient.
[0144] Formulations are typically adapted to suit the mode of administration. For example, compositions for intravenous administration may be formulated as solutions in sterile isotonic aqueous buffer. Such compositions may also include a solubilizing agent and/or a local anesthetic such as lidocaine (also known as lignocaine, xylocaine, or xylocard) to ease pain at the site of injection.
[0145] As further example, compositions for topical and/or local use may be formulated, for example, as a lotion or cream comprising a liquid or semi-solid oil-in- water or water-in-oil emulsion and ointments. Such compositions may also comprise a preservative.
[0146] Compositions for delivery to the eye include may be formulated, for example, as eye drops that comprise the active ingredien in aqueous or oily solution and eye ointments that may be manufactured in sterile form. Compositions for delivery to the nose may be formulated, for example, as aerosols or sprays, coarse powders to be rapidly inhaled, or nose drops that comprise the active ingredient (e.g., microvesicles and/or microRNAs) in aqueous or oily solution. Compositions for local delivery to the buccal cavity may be formulated, for example, as lozenges that comprise the active ingredient in a mass generally formed of sugar and gum arabic or tragacanth, and pastilles that comprise the active ingredient in an inert mass (for example of gelatine and glycerine or sugar and gum arabic). Flavoring ingredients may be added to lozenges or pastilles.
[0147] Aerosol and spray formulations may comprise, for example, a suitable
pharmaceutically acceptable solvent (such as ethanol and water) or a mixture of such solvents. In some embodiments, such formulations comprise other pharmaceutical adjuncts (such as non- ionic or anionic surface-active agents, emulsifiers, and stabilizers) and/or active ingredients of other kinds. Aerosol and spray formulations may be mixed with a propellant gas, such as an inert gas under elevated pressure or with a volatile liquid (e.g. , a liquid that boils under normal atmospheric pressure below customary room temperature, for example from -30 to +10 °C).
Routes of administration and dosage regimens
[0148] In methods of treatment or of inducing tissue repair, remodeling or differentiation in vivo of the present invention, microvesicles, miRNAs, or a pharmaceutical composition thereof, will generally be administered in such amounts and for such a time as is necessary or sufficient to achieve at least one desired result. For example, miRNAs can be administered in such amounts and for such a time that it amelioriates one or more symptoms of a disease, disorder, or condition; prolongs the survival time of patients; or otherwise yields clinical benefits.
[0149] A dosing regimen according to the present invention may consist of a single dose or a plurality of doses over a period of time. Administration may be, e.g., one or multiple times daily, weekly (or at some other multiple day interval), biweekly, monthly, or on an intermittent schedule. Typically an effective amount is administered. The effective amount of microvesicles, microRNAs, or a pharmaceutical composition thereof, will vary from subject to subject and will depend on several factors (see below). [0150] Microvesicles, microR As, or pharmaceutical compositions thereof, may be administered using any administration route effective for achieving the desired therapeutic effect. Both systemic and local routes of administration may be used in accordance with methods of the invention. Suitable routes of administration include, but are not limited to, intravenous, intraarterial, intramuscular, subcutaneous, cutaneous (e.g., topical), intradermal, intracranial, intrathecal, intrapleural, intra-orbital, intranasal, oral, intra-alimentary (e.g. , via suppository), colorectal (e.g., via suppository), and intra-cerebrospinal.
[0151] Depending on the route of administration, effective doses may be calculated according to, e.g. , the body weight and/or body surface area of the patient, the extent of damaged or diseased tissue, etc. Optimization of the appropriate dosages can readily be made by one skilled in the art, e.g. , by a clinician. The final dosage regimen is typically determined by the attending physician, considering various factors that might modify the action of the
microvesicles, miRNAs, or pharmaceutical compositions thereof (collectively referred herein as "drug"), e.g., the drug's specific activity, the severity of tissue damage and the responsiveness of the patient, the age, condition, body weight, sex and diet of the patient, the severity of any present infection, time of administration, the use (or not) of other therapies, and other clinical factors.
[0152] Typical dosages comprise 1 fg/kg body weight to 1 mg/kg body weight. In some embodiments, dosages range from 100 pg/kg body weight to 1 mg/kg body weight, 10 pg/kg body weight to 1 mg/kg body weight, 1 pg/kg body weight to 1 mg/kg body weight, 100 ng/kg body weight to 1 mg/kg body weight, 10 ng/kg body weight to 1 mg/kg body weight, or 1 ng/kg body weight to 1 mg/kg body weight.
EXEMPLIFICATION
Example 1 - Morphological examination of pancreas-derived Pathfinder cells (PDPC) and identification of microvesicles (MVs)
[0153] In the present Example, morphological studies of rat pancreas-derived pathfinder cells (PDPC) were conducted by scanning electron microscopy (EM). Scanning EM images revealed protrusions from surfaces of PDPCs that are provisionally identified as nascent microvesicles (MVs).
[0154] Pathfinder cells were isolated from rat pancreas cultured as previously described.
(See, e.g., International Patent Publication No. WO2006/120476 Al, the entire contents of which are herein incorporated by reference.) These rat PDPCs were grown in medium containing fetal bovine serum (FBS) that was depleted of bovine microvesicles.
[0155] Pictures of a subconfluent culture of rat PDPCs were taken by a scanning electron microscope. Figure 1 A shows a representative picture, showing PDPCs of both the fibroblastoid and small round cell types. As can be seen in Figure 1 A, both cell types have very great numbers of thin projections and interconnect with other cells at multiple points in a complex manner. Furthermore, these cells produce large numbers of small spheres on their surfaces, which are identified as nascent microvesicles (Figure IB).
[0156] The flat cell type depicted in Figure 1 A is approximately 15-20 μιη in diameter, and is the predominant cell type in cultures that were studied. The other cell type is
approximately 3-5 μιη in size, spherical in morphology, and is commonly found adjoined to an identical cell type. Without wishing to be bound by any particular theory, these spherical cells may be derived from a cell that has recently undergone cell division.
[0157] Protrusions of varying length can be seen radiating from the edges of the flatter, larger cell type in particular. Putative microvesicles (MVs) were clearly observed at the ends of these cell protrusions. In some cases, the MVs were not actually attached to the cells but were still within the vicinity of cells and of attached MVs. MVs were also clearly seen close to and surrounding the membrane of the small cell type (Figure IB). Clusters of MVs were observed in some areas, typically at the end of a cell protrusion. Identified MVs typically had a size range of 300-600 nm in diameter.
Example 2 - Analysis of miRNA expression in rat PDPCs and in MVs isolated from rat PDPCs
[0158] Results from Example 1 may shed light into the mechanism of PC action on other cells and tissues. To further investigate the mechanism of PC action, microvesicles obtained from PDPCs were studied in further detail.
[0159] In the present Example, MVs were purified from supernatants of rat PDPC cultures in medium with serum depleted of bovine microvesicles using a differential
centrifugation protocol. RNA was prepared from both MVs and PDPCs using standard procedures. RNA samples were reverse-transcribed (RT) and amplified in a quantitative PCR assay in order to analyze expression of miRNAs.
Materials and Methods
[0160] RNA extraction. RNA from cells and microvesicles (MVs) was extracted using
TRI Reagent (Sigma), with the following modifications to the manufacturer's protocol. After addition of l/5th volume chloroform to the TRI Reagent, samples were spun at 6 °C for 15 minutes at 16,000 x g. Aqueous phases were then subject to an extraction by
phenol:choloform:isoamyl alcohol (pH 6.6; Ambion) at 10 °C for 10 minutes at 16,000 x g. Aqueous phases were precipitated for a maximum of 2 hours at -20 °C. After centrifugation at 6 °C for 30 minutes at 16,000 x g, the resultant RNA was washed in 95% ice-cold ethanol. The RNA was then resuspended in DEPC-water and quantified using a NanoDrop 1000
sp ectrophotometer .
[0161] miRNA analysis. RNA from cells and MVs was analysed for expression of microRNAs (miRNAs) using Appplied Biosystem's Taqman Low Density Arrays (TLDA) cards. For rat PDPCs, Taqman Rodent MicroRNA Arrays A and B were used in combination with MegaPlex RT Rodent Pool A and Pool B primers. MV RNA was analysed by Array A according to manufacturer's protocol; analysis with Array B is ongoing. Results
[0162] miRNA distributions in cells and MVs were compared. Table 1 depicts results from analysis of 373 miRNAs from rat PDPC MV RNA preparations. As shown in Table 2, of the 373 miRNAs analyzed, 20 were found to be present only in MVs, with undetectable levels in the cell RNA population. 23 further miRNAs were also only detectable in MVs, but these miRNAs were expressed at low levels. Seventeen miRNAs were detected in cell RNA but could not be detected in MV RNA.
Table 2: Comparison of miRNA distribution between rat PDPC RNA preparations and rat PDPC-derived MV RNA preparations
Figure imgf000057_0001
[0163] Further work refined the number of miRNAs present in MVs but not in PDPCs to
38, of which 22 miRNAs were present at low levels. Table 3 shows an updated list of miRNAS found in MVs but not cells. Exemplary sequences for these miRNAs are shown in Table 1 and in Appendix 1. Without wishing to be bound by any particular theory, the presence of some miRNAs in MVs but not in cells suggest that these MVs were likely produced in the MVs.
Table 3: miRNAs found in rat PDPC MVs but not cells
Figure imgf000058_0001
[0164] Table 4 lists the miRNAs that were found in cells but not in micro vesicles.
Sequences shown are sequences from Rattus norvegicus. Sequences of corresponding miRNAs from other species including Homo sapiens and ra musculus are also known in the art; e.g., see http://diana.cslab.ece.ntua.gr/mirgen/.
Table 4: miRNAs found in rat PDPCs but not MVs
Exemplary Sequence(s) (5 ' to 3 )
miRNA
UGGAAGACUUGUGAUUUUGUUGU (SEQ ID
miR7b
NO:73) miR17-3p ACUGCAGUGAAGGCACUUGUGG (SEQ ID NO:74) miR32 UAUUGCACAUUACUAAGUUGCA (SEQ ID NO:75)
AGGCAGUGUAGUUAGCUGAUUGC (SEQ ID
NO:76)
miR34c
AAUCACUAACCACACAGCCAGG (SEQ ID NO:77)
(variant) miR129-5p CUUUUUGCGGUCUGGGCUUGC (SEQ ID NO:78) miR190 UGAUAUGUUUGAUAUAUUAGGU (SEQ ID NO:79) miR203 GUGAAAUGUUUAGGACCACUAG (SEQ ID NO: 80) miR376c AAC AUAG AGGAAAUUUC ACGU (SEQ ID NO : 81 ) miR381 UAUACAAGGGCAAGCUCUC (SEQ ID NO:82) miR384-3p AUUCCUAGAAAUUGUUCACAAU (SEQ ID NO: 83) miR455 UAUGUGCCUUUGGACUACAUCG (SEQ ID NO: 84) miR499 UUAAGACUUGCAGUGAUGUUU (SEQ ID NO: 85) miR505 GUCAACACUUGCUGGUUUCC (SEQ ID NO: 86) miR582-5p UACAGUUGUUCAACCAGUUACU (SEQ ID NO: 87) miR615-3p UCCGAGCCUGGGUCUCCCUCUU (SEQ ID NO:88) miR615-5p GGGGGUCCCCGGUGCUCGGAUC (SEQ ID NO:89)
[0165] These results demonstrate that MVs do not contain a merely random sample of cytoplasmic or endosomal content. Without wishing to be bound by any particular theory, miRNAs that are specifically present in MVs may be candidates for intercellular regulators. These MV-specific miRNAs may be individually validated using assays such as those described in Examples 3 and 4.
Example 3 - Assays for characterizing effects of MVs or miRNAs on cell growth
[0166] The present Example demonstrates the effects of MVs on growth of rat PDPCs.
[0167] An XCELLINGENCE™ machine was used to measure cell growth in rat PDPC cultures that were depleted of bovine MVs, or depleted of MVs and then had rat PDPC MVs added back.
[0168] Rat PDPCs were cultured in medium containing bovine serum, and then at 43 hours were switched to bovine MV-depleted medium. Depleting MVs resulted in a decrease in cell proliferation, with a doubling time slowing to 31 hours (Figure 2A). A negative effect on doubling time was seen, with a later recovery.
[0169] In a separate set of experiments, cultures were MV-depleted at 48 hours, and then exogenous MVs are added 10 hours later. A dose-dependent recovery of rat PDPC doubling time (i.e., increase in cell proliferation) was observed after addition of rat PDPC-derived MVs (Figure 2B). The increase in cell proliferation persisted for 48 hours and then faded. The rapid recovery of doubling time of cells receiving exogenous MV occurred well in advance of the normal recovery time.
[0170] These results not only show that MVs can increase cell proliferation; they also provide a possible assay for characterize effects of individual miRNAs on PDPC growth rate. Similar assays may also be developed for PC effects on target cell types.
[0171] The effects of MVs on growth rates of other PCs may be tested similarly. For example, human kidney-derived Pathfinder cells (KDPCs) and lymph node-derived pathfinder cells (LNDPCs) may be used instead of PDPCs. Example 4 - In vitro cell damage assay
[0172] This Example demonstrates that an in vitro assay has been successfully developed to assess the effects of MVs or miRNAs on stimulate wound repair or recovery from cell damage.
[0173] Fibroblasts are grown to confluence in wells of an XCELLIGENCE™ machine
(Roche Applied Science) for use as target cells. Cultures are then scored with a pipette tip to mimic a wound. Cultures are grown in the presence of (1) PCs of various tissue origins; (2) MVs derived from PCs; (3) specific miRNAs analyzed, for example, as described in Example 2; or (4) media without any of the above, as a negative control.
[0174] Regrowth of cells across the area of damage is read by the XCELLIGENCE™ machine, which gives a quantitative readout. The effects of PCs, MVs, and particular miRNAs on wound repair may be determined by regrowth rates from the various cultures.
Example 5 - Production of MVs from cells cultured in low oxygen conditions
[0175] This Example is designed to show that MV production in PC cells and/or the
RNA expression profiles may be optimized by varying certain cell culture conditions. It is postulated that growing cells in hypoxic conditions during culture may reduce secretions of cytokines, which could extend lifespan of cells producing MVs, thereby increasing MV production.
[0176] In the present Example, PCs of various cell types are grown in conditions of low oxygen (less than 5% 02); cultures are also grown in conditions of normal {e.g., about 5% 02) oxygen to be used as controls. MV production may be quantitated using standard methods or adaptations of known methods, such as, e.g., electron microscopy, FACS, measurement of MV weight and calculation based on known number/weight ratios, etc.
[0177] For example, to examine possible effects of low oxygen on RNA content of MVs,
MVs are isolated from cultures as described in Example 2. RNA preparations are made from MVs and quantified and amounts are compared between the two groups (low oxygen vs. normal oxygen).
Example 6 - Isolation and enrichment of MVs from conditioned media
[0178] This Example describes isolation and enrichment of MVs from conditioned media. PCs of various cell types are isolated and cultured as previously described. (See, e.g., International Patent Publication WO2006/120476 Al). PCs are expanded to near confluence (sub-confluence) in tissue culture fiasks in media free of serum. (Bovine microvesicle-depleted media may also be used.) Media from sub-confluent cultures ("conditioned media") are collected and analyzed immediately or frozen for further analysis. Conditioned media may be analyzed for MV production by methods known in the art, such as those mentioned in Example 5. MVs may be harvested from conditional media using standard methods. RNA is extracted from conditioned media and total RNA content and amount of specific miRNAs associated with MVs are analyzed.
Example 7 - Culture of PCs on nonwoven substrates to increase MV production in conditioned media
[0179] This Example describes a modified culture method that may increase MV production in conditioned media. PCs are grown on nonwoven fabrics of various compositions and microvesicle production in conditioned culture media is assessed.
[0180] Circular substrates of one centimeter in diameter are made from nonwoven fabrics of various compositions:
(1) a fabric comprising fibers of 90/10 poly(glycolide-co-lactide) (PGA/PLA) sold under the tradename VICRYL™ (Ethicon, Inc., Somerville, NJ);
(2) a fabric comprising fibers of 95/5 poly(lactide-co-glycolide) (PLA/PGA) sold under the tradename 95/5 PLA/PGA™; and
(3) a fabric comprising 50% (90/10 PGA/PLA) fibers and 50% PDO fibers. [0181] Fabrics used in this Example are of 1 mm or 1.5 mm thickness and density ranged from about 60 to about 300 mg/mL.
[0182] Fabric substrates are placed in low-cluster 24-well plates and sterilized by soaking in 100% ethanol for four hours. Substrates are then washed with phosphate-buffered saline (PBS) and placed in medium containing fetal bovine serum (FBS) that was depleted of bovine micro vesicles.
[0183] PCs of various tissue origins are seeded onto the substrates within the wells. A
24-well tissue culture plate without substrates is seeded with PCs as a control. Cell-seeded substrates and control wells are cultured until cultures reach sub-confluence.
[0184] Media from sub-confluent cultures ("conditioned media") is collected from wells and analyzed for MV production, e.g., as described in Example 5. MVs may be harvested from conditioned media using standard methods.
Example 8 - RNA Expression Profiling of Rat PDPCs
[0185] In the present Example, RNA expression profiling was performed on rat PDPCs.
PDPCs were cultured and RNA extracted as described in Example 2. Table 5 shows miRNAs that were found to be expressed in PDPCs that may be useful for therapeutic applications described herein. miRNAs that were expressed abundantly are shown in bold. Sequences of these miRNAs can be found in Appendix 1.
Table 5: miRNAs expressed in PDPCs miRNAs
• let-7 a*, let-7c-l *, let-7g*
• miR-7a*, -9*, 15a*, -15b*, -16*, -17*, -18a*, -21 *, -22*, -24-1 *, 24-2*, -26b*, -27a*, -
27b*, -28*, -29a*, -29b*, -29c*, -30a*, -30e*, -31 *, -33*, -34c*, -93*, -99b*, rno-miR-
7a*, -20a*, -20b-5p, -28*, -30d*, -99a*
• miR-lOlb, -106b*, -125b*, -135a*, -149, -181a-l * -191 *, -193*, -199b*, rno-miR- 125b*, -148b-5p miR-200a*, -200b*, -206, -214*, -218-1 *, -218-2* miR-322*, -326, -374, -378, -378*, rno-miR-352 miR-425*, -455*, -467a*, -467b*, -470*, -499c miR-503*, -592 miR-674*, -678, -690, -699, rno-miR-664 miR-709, -720, -721, -744*, -760, -763, rno-miR-743a miR-872*, -877, -877*
Example 10 -Microvesicle (MV) purification
[0186] In the present Example, MVs were purified from supernatants of rat PC cultures grown under serum replete or serum starvation conditions using a differential centrifugation protocol according to the schematic in Figure 3 or a commercially available exosome precipitation kit (Exo-Quick™ Exosome Preciptitation, System Biosciences, Mountain View, California). Control MVs from rat mesenchymal stem cells (MSC) grown in serum replete or serum starvation conditions were also purified.
[0187] Briefly, for purification using differential centrifugation, 10 mis culture medium was centrifuged at 1000 x g for 10 minutes to remove cellular debris. The sample was further centrifuged at 16,0000 x g for 90 minutes at 4°C. Pellet (PI) and supernatant (SI) fractions were separated and the pellet fraction was washed with 10 mis of PBS and centrifuged at 16,000 x g for 90 minutes at 4°C. The resulting pellet fraction, P2 was resuspended in 0.2 ml buffer. The SI supernatant fraction was centrifuged at 120,000 x g for 120 minutes at 4°C and the resulting pellet, P3 was washed with 5 mis of PBS and centrifuged at 120,000 x g for 120 minutes at 4°C. The resulting pellet fraction, P4 was resuspended in 0.2 ml buffer.
[0188] For purification of MVs using Exo-Quick™ Exosome Preciptitation (System
Biosciences, Mountain View, California), 1 ml of culture medium was treated with Exo-Quick reagent according to the manufacturer instructions. MV pellets were recovered and resuspended in buffer.
[0189] Total protein and total RNA were quantitated for fractions obtained by each purification method (differential centrifugation and precipitation) using standard methods. Table 6 shows exemplary total protein and total RNA amounts obtained in each fraction for the purification methods tested.
Table 6 - Total protein and total RNA from MV purification.
Figure imgf000065_0001
Example 11 - RNA Expression Profiling of MVs from Serum-Starved PCs
[0190] In the present Example, MVs were purified from supernatants of rat or human PC cultures grown under serum starvation conditions for about 24 hours using a differential centrifugation protocol (described in Example 10). RNA was prepared from PCs and MVs as described in Example 2.
[0191] microRNA expression profiles for rat PCs, MV fractions, and exosome fractions were determined and compared. As shown in Figure 4, microRNA whose expression was altered by growth under serum starvation conditions for 24 hours as compared with growth under serum replete conditions was determined and overlapping microRNA sequences among rat PC's, MV fractions and exosome fractions were identified. As can be seen in Figure 4, there were 35 miRNAs in common to all samples which had increased expression in response to serum starvation. Figure 5 shows an exemplary graph comparison of miRNA expression profiles for rat PCs, MV fractions, and exosome fractions. As can be seen in Figure 5, microRNAs whose expression was increased in response to serum starvation may play roles in various cellular functions, including cell cycle, damage responses, stress responses, cell survival, and immune signalling.
[0192] microRNA expression profiles for rat PCs, rat MSC, and human PC were determined and compared. As shown in Figure 6, microRNA whose expression was altered by growth under serum starvation conditions for 24 hours as compared with growth under serum replete conditions were determined and overlappind microRNA sequences among rat PCs, rat MSC, and human PCs were identified. As can be seen in Figure 6, there were 26 miRNAs in common to all samples which had increased expression in response to serum starvation.
[0193] As described above, miRNAs in MVs obtained from rat PC cells grown under serum starvation conditions were identified. Table 7 depicts results from analysis of miRNAs from MVs obtained from rat PC RNA preparations.
Table 7. Exemplary miRNA sequences in MVs from serum starved rat PCs
Exemplary Sequence(s) (5' to 3') Alternative miRNA in MVs from
Rat PCs Description
AGAGGUAGUAGGUUGCAUAGUU
mmu-let-7d-4395394 (SEQ ID NO:90) MIMAT0000383
CAAAGUGCUAACAGUGCAGGUAG
mmu-miR-106a-4395589 (SEQ ID NO:91) MIMAT0000385
UAAAGUGCUGACAGUGCAGAU (SEQ
mmu-miR-106b-4373155 ID NO:92) MIMAT0000386
UACCCUGUAGAUCCGAAUUUGUG
mmu-miR- 1 Oa-4373153 (SEQ ID NO:93) MIMAT0000648 mmu-miR- 126-3p- UCGUACCGUGAGUAAUAAUGCG
4395339 (SEQ ID NO:94) MIMAT0000138 mmu-miR- 13 Oa-4373145 CAGUGCAAUGUUAAAAGGGCAU MIMAT0000141
Figure imgf000067_0001
ACAGCAGGCACAGACAGGCAGU
mmu-miR-214-4395417 (SEQ ID NO: 118) MIMAT0000661
UUGUGCUUGAUCUAACCAUGU (SEQ
mmu-miR-218-4373081 ID NO: 119) MIMAT0000663
AUCACAUUGCCAGGGAUUACC (SEQ
mmu-miR-23b-4373073 ID NO: 120) MIMAT0000125
UGGCUCAGUUCAGCAGGAACAG
mmu-miR-24-4373072 (SEQ ID NO: 121) MIMAT0000219
CAUUGCACUUGUCUCGGUCUGA
mmu-miR-25 -4373071 (SEQ ID NO: 122) MIMAT0000652
UUCAAGUAAUCCAGGAUAGGCU
mmu-miR-26a-4395166 (SEQ ID NO: 123) MIMAT0000533
UUCAAGUAAUUCAGGAUAGGU (SEQ
mmu-miR-26b-4395167 ID NO: 124) MIMAT0000534
UUCACAGUGGCUAAGUUCUGC (SEQ
mmu-miR-27b-4373068 ID NO: 125) MIMAT0000126 mmu-miR-296-5p- AGGGCCCCCCCUCAAUCCUGU (SEQ
4373066 ID NO: 126) MIMAT0000374
UAGCACCAUUUGAAAUCGGUUA
mmu-miR-29c-4395171 (SEQ ID NO: 127) MIMAT0000536
CAGUGCAAUAGUAUUGUCAAAGC
mmu-miR-301 a-4373064 (SEQ ID NO: 128) MIMAT0000379
CAGUGCAAUGGUAUUGUCAAAGC
mmu-miR-301 b-4395730 (SEQ ID NO: 129) MIMAT0004186
UGUAAACAUCCUCGACUGGAAG
mmu-miR-3 Oa-4373061 (SEQ ID NO: 130) MIMAT0000128
UGUAAACAUCCUACACUCUCAGC
mmu-miR-3 Oc-4373060 (SEQ ID NO: 131) MIMAT0000514
UGUAAACAUCCCCGACUGGAAG
mmu-miR-30d-4373059 (SEQ ID NO: 132) MIMAT0000515
UGUAAAC AUC CUUG ACUGG AAG
mmu-miR-30e-4395334 (SEQ ID NO: 133) MIMAT0000248
AAAAGCUGGGUUGAGAGGGCGA
mmu-miR-320-4395388 (SEQ ID NO: 134) MIMAT0000666
CAGCAGCAAUUCAUGUUUUGGA
mmu-miR-322-4378107 (SEQ ID NO: 135) MIMAT0000548 mmu-miR-324-3p- CCACUGCCCCAGGUGCUGCU (SEQ ID
4395639 NO: 136) MIMAT0000556
CUGGCCCUCUCUGCCCUUCCGU (SEQ
mmu-miR-328-4373049 ID NO: 137) MIMAT0000565 mmu-miR-331 -3p- GCCCCUGGGCCUAUCCUAGAA (SEQ
4373046 ID NO: 138) MIMAT0000571 mmu-miR-335 -3p- UUUUUCAUUAUUGCUCCUGACC
4395296 (SEQ ID NO: 139) MIMAT0004704
UGGCAGUGUCUUAGCUGGUUGU
mmu-miR-34a-4395168 (SEQ ID NO: 140) MIMAT0000542 mmu-miR-34b-3p- AAUCACUAACUCCACUGCCAUC
4395748 (SEQ ID NO: 141) MIMAT0004581
UCCCUGAGGAGCCCUUUGAGCCUG
mmu-miR-351 -4373345 (SEQ ID NO: 142) MIMAT0000609
AAUUGCACGGUAUCCAUCUGUA
mmu-miR-363 -4378090 (SEQ ID NO: 143) MIMAT0000708
UAAUGCCCCUAAAAAUCCUUAU
mmu-miR-365 -4373194 (SEQ ID NO: 144) MIMAT0000711
AAUAUA AC AC AG AUGGC CUGU (SEQ
mmu-miR-410-4378093 ID NO: 145) MIMAT0001091 mmu-miR-434-3p- UUUGAACCAUCACUCGACUCCU
4395734 (SEQ ID NO: 146) MIMAT0001422
CAGCAGCACACUGUGGUUUGUA
mmu-miR-497-4381046 (SEQ ID NO: 147) MIMAT0003453 mmu-miR-574-3p- CACGCUCAUGCACACACCCACA (SEQ
4395460 ID NO: 148) MIMAT0004894
AAUGGCGCCACUAGGGUUGUG (SEQ
mmu-miR-652-4395463 ID NO: 1492) MIMAT0003711
UGACACCUGCCACCCAGCCCAAG
mmu-miR-667-4386769 (SEQ ID NO: 150) MIMAT0003734 mmu-miR-743b-5p- UGUUCAGACUGGUGUCCAUCA (SEQ
4395600 ID NO: 151) MIMAT0004839
C AAAGUGCUGUUC GUGC AGGUAG
mmu-miR-93 -4373302 (SEQ ID NO: 152) MIMAT0000540
CACCCGUAGAACCGACCUUGCG
mmu-miR-99b-4373007 (SEQ ID NO: 153) MIMAT0000132
UAGGUAGUUUCGUGUUGUUGGG
rno-miR-196c-4395750 (SEQ ID NO: 154) MIMAT0005303
UCCCUGAGGAGCCCUUUGAGCCUGA
rno-miR-351-4395764 (SEQ ID NO: 155) MIMAT0000608
CAUGCCUUGAGUGUAGGACUGU
rno-miR-532-5p-4395752 (SEQ ID NO: 156) MIMAT0005322
CTAAAATAGCTGGAATTACCGGCAG
ATTGGTAGTGGTGAGCCTATGGTTTT Mature miRNA snoRNA135-4380912 CTGAAG (SEQ ID NO: 157) Control
ACAATGATGACTTATGTTTTTGCCGT
TTACCCAGCTGAGGGTTTCTTTGAAG
AGAGAATC TTAAGACTGAGC Mature miRNA
U87-4386735 (SEQ ID NO: 158) Control
CUAUACAAUCUACUGUCUUUCC
mmu-let-7a*-4395608 (SEQ ID NO: 159) MIMAT0004620
ACAAGUCAGGUUCUUGGGACCU
mmu-miR-125b*-4395638 (SEQ ID NO: 160) MIMAT0004529
ACUCUUUCCCUGUUGCACUACU
mmu-miR- 13 Ob* -4395590 (SEQ ID NO: 161) MIMAT0004583 mmu-miR- 135 a* -4395343 UAUAGGGAUUGGAGCCGUGGCG MIMAT0004531
Figure imgf000070_0001
GGAGGCAGAGGCAGGAGGA (SEQ ID
mmu-miR-709-4381063 NO: 185) MIMAT0003499
CUCCGUGCACACCCCCGCGUG (SEQ
mmu-miR-715 -4381067 ID NO: 186) MIMAT0003506
AUCUCGCUGGGGCCUCCA (SEQ ID
mmu-miR-720-4381052 NO: 187) MIMAT0003484
CAGUGCAAUUAAAAGGGGGAA
mmu-miR-721-4381073 (SEQ ID NO: 188) MIMAT0003515
CGGCUCUGGGUCUGUGGGGA (SEQ
mmu-miR-760-4395439 ID NO: 189) MIMAT0003898
GAUUGCUGUGCGUGCGGAAUCGAC
mmu-miR-801 -4395562 (SEQ ID NO: 190)
GAAUUGAUCAGGACAUAGGG (SEQ
mmu-miR-805 -4395577 ID NO: 191) MIMAT0004211
UGAACUAUUGCAGUAGCCUCCU
mmu-miR-872*-4395672 (SEQ ID NO: 192) MIMAT0004935 mmu-miR-875-5p- UAUACCUCAGUUUUAUCAGGUG
4395314 (SEQ ID NO: 193) MIMAT0004937
UGUCCUCUUCUCCCUCCUCCCA (SEQ
mmu-miR-877*-4395678 ID NO: 194) MIMAT0004862
GUAG AGG AG AUGGC GC AGGG (SEQ
mmu-miR-877-4395402 ID NO: 195) MIMAT0004861 mmu-miR-878-3p- GC AUG AC AC C AC ACUGGGUAG A
4395671 (SEQ ID NO: 196) MIMAT0004933
ACUGCUGAGCUAGCACUUCCCG
mmu-miR-93 *-4395250 (SEQ ID NO: 197) MIMAT0004636
CAAGCUCGUGUCUGUGGGUCCG
mmu-miR-99b * -4395307 (SEQ ID NO: 198) MIMAT0004525
UGAUAGACGCCAAUUUGGGUAG
rno-miR-463-4395751 (SEQ ID NO: 199) MIMAT0005317
UAUUCAUUUACUCCCCAGCCUA
rno-miR-664-4381103 (SEQ ID NO:200) MIMAT0003382
GAAAGACGCCAAACUGGGUAGA
rno-miR-743a-4395757 (SEQ ID NO:201) MIMAT0005334
CTAAAATAGCTGGAATTACCGGCAG
ATTGG
TAGTGGTGAGCCTATGGTTTTCTGAA
G Mature miRNA snoRNA135-4380912 (SEQ ID NO:202) Control
ACAATGATGACTTATGTTTTTGCCGT
TTAC
CCAGCTGAGGGTTTCTTTGAAGAGAG
AATC TTAAGACTGAGC Mature miRNA
U87-4386735 (SEQ ID NO:203) Control [0194] Table 8 depicts results from analysis of miRNAs from rat PC RNA preparations.
Table 8. Exemplary miRNA sequences in serum starved rat PCs
Figure imgf000072_0001
Figure imgf000073_0001
mmu-miR-345-5p- GCUGACCCCUAGUCCAGUGCUU (SEQ ID
4395658 NO:245) MIMAT0000595 mmu-miR-350- UUCACAAAGCCCAUACACUUUC (SEQ ID
4395660 NO:246) MIMAT0000605 mmu-miR-351- UCCCUGAGGAGCCCUUUGAGCCUG (SEQ ID
4373345 NO:247) MIMAT0000609 mmu-miR-361- UUAUCAGAAUCUCCAGGGGUAC (SEQ ID
4373035 NO:248) MIMAT0000704 mmu-miR-362-3p- AACACACCUGUUCAAGGAUUCA (SEQ ID
4395746 NO:249) MIMAT0004684 mmu-miR-384-5p- UGUAAACAAUUCCUAGGCAAUGU (SEQ ID
4395732 NO:250) MIMAT0004745 mmu-miR-429- UAAUACUGUCUGGUAAUGCCGU (SEQ ID
4373355 NO:251) MIMAT0001537 mmu-miR-450a-5p- UUUUGCGAUGUGUUCCUAAUAU (SEQ ID
4395414 NO:252) MIMAT0001546 mmu-miR-494- UGAAACAUACACGGGAAACCUC (SEQ ID
4395476 NO:253) MIMAT0003182 mmu-miR-500- AAUGC AC CUGGGC AAGGGUUC A (SEQ ID
4395736 NO:254) MIMAT0003507 mmu-miR-503- UAGCAGCGGGAACAGUACUGCAG (SEQ ID
4395586 NO:255) MIMAT0003188 mmu-miR-542-3p- UGUGACAGAUUGAUAACUGAAA (SEQ ID
4378101 NO:256) MIMAT0003172 mmu-miR-582-3p- CCUGUUGAACAACUGAACCCAA (SEQ ID
4395697 NO:257) MIMAT0005292 mmu-miR-582-5p- UACAGUUGUUCAACCAGUUACU (SEQ ID
4395696 NO:258) MIMAT0005291 mmu-miR-598- UACGUCAUCGUCGUCAUCGUUA (SEQ ID
4395606 NO:259) MIMAT0004942 mmu-miR-652- AAUGGCGCCACUAGGGUUGUG (SEQ ID
4395463 NO:260) MIMAT0003711 mmu-miR-667- UGACACCUGCCACCCAGCCCAAG (SEQ ID
4386769 NO:261) MIMAT0003734 mmu-miR-685- UCAAUGGCUGAGGUGAGGCAC
4386748 (SEQ ID NO:262) MIMAT0003463 mmu-miR-743b-5p- UGUUCAGACUGGUGUCCAUCA (SEQ ID
4395600 NO:263) MIMAT0004839 mmu-miR-744- UGCGGGGCUAGGGCUAACAGCA (SEQ ID
4395435 NO:264) MIMAT0004187 mmu-miR-883a-3p- UAACUGCAACAGCUCUCAGUAU (SEQ ID
4395591 NO:265) MIMAT0004849 mmu-miR-883b-3p- UAACUGCAACAUCUCUCAGUAU (SEQ ID
4395695 NO:266) MIMAT0004851
UGAGGUAGUAAGUUGUAUUGUU (SEQ ID
mmu-miR-98-4373009 NO:267) MIMAT0000545 UGAUAUGUUUGAUAUUAGGUU (SEQ ID
rno-miR-190b-4395749 NO:268) MIMAT0005302
GCUUCUCCUGGCUCUCCUCCCUU (SEQ ID
rno-miR-207-4381096 NO:269) MIMAT0003115
GUGGUGUGCUAGUUACUUUU
rno-miR-333-4381109 (SEQ ID NO:270)
rno-miR-339-3p- UGAGCGCCUCGACGACAGAGCCA (SEQ ID
4395760 NO:271) MIMAT0004648 rno-miR-345-3p- CCCUGAACUAGGGGUCUGGAGA (SEQ ID
4395762 NO:272) MIMAT0004655
UCCCUGAGGAGCCCUUUGAGCCUGA (SEQ
rno-miR-351-4395764 ID NO:273) MIMAT0000608
UGUGAUGUGUGCAUGUACAUG (SEQ ID
rno-miR-466c-4395768 NO:274) MIMAT0005279
G AAAG AC AC C AUACUG AAUAG A (SEQ ID
rno-miR-743b-4395769 NO:275) MIMAT0005280
GCTGTACTGACTTGATGAAAGTACTTTTGA
ACCCTTTTCCATCTGATG
snoRNA202-4380914 (SEQ ID NO:276)
CUAUACAAUCUAUUGCCUUCCC (SEQ ID
mmu-let-7f*-4395528 NO:277) MIMAT0004623
ACUGUACAGGCCACUGCCUUGC (SEQ ID
mmu-let-7g*-4395622 NO:278) MIMAT0004519
CUGCGCAAGCUACUGCCUUGCU (SEQ ID
mmu-let-7i*-4395283 NO:279) MIMAT0004520 mmu-miR- 106b * - CCGCACUGUGGGUACUUGCUGC (SEQ ID
4395491 NO:280) MIMAT0004582 mmu-miR- 10a* - C AAAUUC GUAUCU AGGGG AAUA (SEQ ID
4395399 NO:281) MIMAT0004659 mmu-miR- 1 Ob * - C AG AUUC GAUUCU AGGGG AAUA (SEQ ID
4395702 NO:282) MIMAT0004538 mmu-miR- 13 Ob * - ACUCUUUCCCUGUUGCACUACU (SEQ ID
4395590 NO:283) MIMAT0004583 mmu-miR- 135a*- UAUAGGGAUUGGAGCCGUGGCG (SEQ ID
4395343 NO:284) MIMAT0004531 mmu-miR- 149- UCUGGCUCCGUGUCUUCACUCCC (SEQ ID
4395366 NO:285) MIMAT0000159 mmu-miR- 15b*- CGAAUCAUUAUUUGCUGCUCUA (SEQ ID
4395284 NO:286) MIMAT0004521 mmu-miR- 16*- CCAGUAUUGACUGUGCUGCUGA (SEQ ID
4395619 NO:287) MIMAT0004625 mmu-miR- 17*- ACUGCAGUGAGGGCACUUGUAG (SEQ ID
4395673 NO:288) MIMAT0000650 mmu-miR- 18a*- ACUGCCCUAAGUGCUCCUUCUG (SEQ ID
4395620 NO:289) MIMAT0004626 mmu-miR-191 *- GCUGCACUUGGAUUUCGUUCCC (SEQ ID MIMAT0004542
Figure imgf000076_0001
Figure imgf000077_0001
[0195] Table 9 lists miRNAs in common between rat PCs grown under serum starvation conditions (identified in Table 8) and MVs from rat PCs grown under serum starvation
conditions (identified in Table 7).
Table 9. miRNA sequences in both serum starved rat PDPCs and MVs from serum starved rat PDPCs
Exemplary Sequence(s) (5' to 3') Alternative Description miRNA in MVs from Rat
PCs
UG AG AACUG AAUUC C AUGGGUU (SEQ
mmu-miR- 146a-4373132 ID NO:334) MIMAT0000158
CAUCCCUUGCAUGGUGGAGGG (SEQ
mmu-miR-188-5p-4395431 ID NO:335) MIMAT0000217
UAGGUAGUUUCCUGUUGUUGGG (SEQ
mmu-miR- 196b-4395326 ID NO:336) MIMAT0001081
UUCCCUUUGUCAUCCUAUGCCU (SEQ
mmu-miR-204-4373094 ID NO:337) MIMAT0000237
CUGUGCGUGUGACAGCGGCUGA (SEQ
mmu-miR-210-4373089 ID NO:338) MIMAT0000658
AUCACAUUGCCAGGGAUUACC (SEQ
mmu-miR-23b-4373073 ID NO:339) MIMAT0000125
UAGCACCAUUUGAAAUCGGUUA (SEQ
mmu-miR-29c-4395171 ID NO:340) MIMAT0000536
AAAAGCUGGGUUGAGAGGGCGA (SEQ
mmu-miR-320-4395388 ID NO:341) MIMAT0000666
UUUUUCAUUAUUGCUCCUGACC (SEQ
mmu-miR-335-3p-4395296 ID NO:342) MIMAT0004704
AAUGGCGCCACUAGGGUUGUG (SEQ
mmu-miR-652-4395463 ID NO:343) MIMAT0003711
UAUAGGGAUUGGAGCCGUGGCG (SEQ
mmu-miR- 135 a* -4395343 ID NO:344) MIMAT0004531
UGGAAUGUAAGGAAGUGUGUGG (SEQ
mmu-miR-206-4373092 ID NO:345) MIMAT0000239
CCUGUUCUCCAUUACUUGGCUC (SEQ
mmu-miR-26b * -4395555 ID NO:346) MIMAT0004630
GCUGGUUUCAUAUGGUGGUUUA
mmu-miR-29b * -4395627 (SEQ ID NO:347) MIMAT0004523
ACUGGACUUGGAGUCAGAAGG (SEQ
mmu-miR-378-4395354 ID NO:348) MIMAT0003151
UAUAC AUAC AC GC AC AC AUAG (SEQ
mmu-miR-466d-3p-4395665 ID NO:349) MIMAT0004931 mmu-miR-467b * -4381092 AUAUACAUACACACACCAACAC (SEQ MIMAT0003478
Figure imgf000079_0001
snoRNA135-4380912 (SEQ ID NO:359) Mature miRNA Control
[0196] Table 10 lists miRNAs found in rat PC MVs, including exosomes.
Table 10. miRNAs found in rat PC 04 MV (including exosomes)
Exemplary Sequence(s) (5' to 3') Alternative
miRNA in MVs from Rat
PDPCs Description
CAAAGUGCUAACAGUGCAGGUA
mmu-miR-106a-4395589 G (SEQ ID NO:360) MIMAT0000385
UAAAGUGCUGACAGUGCAGAU
mmu-miR-106b-4373155 (SEQ ID NO:361) MIMAT0000386
UACCCUGUAGAUCCGAAUUUGU
mmu-miR- 1 Oa-4373153 G (SEQ ID NO:362) MIMAT0000648
UCGUACCGUGAGUAAUAAUGCG
mmu-miR-126-3p-4395339 (SEQ ID NO:363) MIMAT0000138
CAGUGCAAUGUUAAAAGGGCAU
mmu-miR- 13 Oa-4373145 (SEQ ID NO:364) MIMAT0000141
CAGUGGUUUUACCCUAUGGUAG
mmu-miR- 140-4373374 (SEQ ID NO:365) MIMAT0000151
GUCCAGUUUUCCCAGGAAUCCCU
mmu-miR- 145-4395389 (SEQ ID NO:366) MIMAT0000157
mmu-miR- 146a-4373132 UGAGAACUGAAUUCCAUGGGUU MIMAT0000158
Figure imgf000080_0001
Figure imgf000081_0001
Figure imgf000082_0001
Figure imgf000083_0001
[0197] Table 11 lists miRNAs found in rat PC MVs and PCs, excluding exosomes.
Table 11 - miRNAs found in rat MV and cells (excluding exosomes)
Exemplary Sequence(s) (5' to 3') Alternative miRNA in MVs
from Rat PDPCs Description mmu-miR- 10a- UACCCUGUAGAUCCGAAUUUGUG (SEQ ID
4373153 NO:448) MIMAT0000648 mmu-miR- 142-3p- UGUAGUGUUUCCUACUUUAUGGA (SEQ ID
4373136 NO:449) MIMAT0000155 mmu-miR- 146a- UGAGAACUGAAUUCCAUGGGUU (SEQ ID
4373132 NO:450) MIMAT0000158 mmu-miR- 148b- UCAGUGCAUCACAGAACUUUGU (SEQ ID
4373129 NO:451) MIMAT0000580 mmu-miR- 188-5p- CAUCCCUUGCAUGGUGGAGGG (SEQ ID
4395431 NO:452) MIMAT0000217 mmu-miR- 196b- UAGGUAGUUUCCUGUUGUUGGG (SEQ ID
4395326 NO:453) MIMAT0001081 mmu-miR-204- UUCCCUUUGUCAUCCUAUGCCU (SEQ ID
4373094 NO:454) MIMAT0000237 mmu-miR-210- CUGUGCGUGUGACAGCGGCUGA (SEQ ID
4373089 NO:455) MIMAT0000658 mmu-miR-21- UAGCUUAUCAGACUGAUGUUGA (SEQ ID
4373090 NO:456) MIMAT0000530 mmu-miR-23b- AUCACAUUGCCAGGGAUUACC (SEQ ID
4373073 NO:457) MIMAT0000125 mmu-miR-26a- UUCAAGUAAUCCAGGAUAGGCU (SEQ ID
4395166 NO:458) MIMAT0000533 mmu-miR-29c- UAGCACCAUUUGAAAUCGGUUA (SEQ ID
4395171 NO:459) MIMAT0000536 mmu-miR-320- AAAAGCUGGGUUGAGAGGGCGA (SEQ ID MIMAT0000666
Figure imgf000084_0001
Figure imgf000085_0001
: ontro
[0198] Table 12 lists miRNAs found in rat PC exosomes and PCs, excluding
extrasectetory vesicles larger than exosomes.
Table 12 - miRNAs found in rat PC04 exosomes and cells (excluding extrasecretory
vesicles larger than exosomes)
Exemplarv Seauence(s) (5' to 3') Alternative miRNA in MVs from
Rat PCs Description
UACCCUGUAGAUCCGAAUUUGUG (SEQ ID
mmu-miR- 1 Oa-4373153 NO:450) MIMAT0000648 mmu-miR- 125 a-5p- UCCCUGAGACCCUUUAACCUGUGA (SEQ
4395309 ID NO:451) MIMAT0000135
UCACAGUCAACCGGUCUCUUU
mmu-miR-128a-4395327 (SEQ ID NO:452) MIMAT0000424 mmu-miR- 129-3p- AAGCCCUUACCCCAAAAAGCAU (SEQ ID
4373297 NO:453) MIMAT0000544
UGAGAACUGAAUUCCAUGGGUU (SEQ ID
mmu-miR- 146a-4373132 NO:454) MIMAT0000158 mmu-miR- 151 -3p- CUAGACUGAGGCUCCUUGAGG (SEQ ID
4373304 NO:455) MIMAT0000161
UCGUGUCUUGUGUUGCAGCCGG (SEQ ID
mmu-miR- 187-4373307 NO:456) MIMAT0000216 mmu-miR- 188-5p- CAUCCCUUGCAUGGUGGAGGG (SEQ ID
4395431 NO:457) MIMAT0000217
UUCACCACCUUCUCCACCCAGC
mmu-miR- 197-4373102 (SEQ ID NO:458) MIMAT0000227 mmu-miR- 199a-3p- ACAGUAGUCUGCACAUUGGUUA (SEQ ID MIMAT0000230
Figure imgf000086_0001
mmu-miR-466d-3p- UAUACAUACACGCACACAUAG (SEQ ID
4395665 NO:482) MIMAT0004931 mmu-miR-467b * - AUAUACAUACACACACCAACAC (SEQ ID
4381092 NO:483) MIMAT0003478
CACAGCUCCCAUCUCAGAACAA (SEQ ID
mmu-miR-674*-4386773 NO:484) MIMAT0003741 mmu-miR-720-4381052 AUCUCGCUGGGGCCUCCA (SEQ ID NO:485) MIMAT0003484
CAGUGCAAUUAAAAGGGGGAA
mmu-miR-721 -4381073 (SEQ ID NO:486) MIMAT0003515
GAUUGCUGUGCGUGCGGAAUCGAC
mmu-miR-801 -4395562 (SEQ ID NO:487)
GUAGAGGAGAUGGCGCAGGG (SEQ ID
mmu-miR-877-4395402 NO:488) MIMAT0004861
AUAAAGCUAGAUAACCGAAAGU (SEQ ID
mmu-miR-9 * -4395342 NO:489) MIMAT0000143
CAAGCUCGUGUCUGUGGGUCCG(SEQ ID
mmu-miR-99b * -4395307 NO:490) MIMAT0004525
CTAAAATAGCTGGAATTACCGGCAGATTGG TAGTGGTGAGCCTATGGTTTTCTGAAG Mature miRNA snoRNA135-4380912 (SEQ ID NO:491) Control
[0199] microRNA expression profiles for human PCs and MVs obtained from human
PCs grown under serum starvation conditions were determined and compared. As shown in Figure 7, microRNA whose expression was altered by growth under serum starvation conditions for 24 hours as compared with growth under serum replete conditions was determined and overlapping microRNA sequences among human PCs and MVs were identified. As can be seen in Figure 7, there were 43 miRNAs in common to all samples which had decreased expression in response to serum starvation.
[0200] miRNAs from MVs obtained from human PCs grown under serum starvation conditions were compared to those obtained from rat PCs grown under comparable conditions. As can be seen in Figure 8, there were 7 miRNAs in common that had increased expression in response to serum starvation. Figure 9 shows an exemplary graph comparison of miRNA expression profiles for rat MVs and human MVs obtained from PCs grown under serum starvation conditions. As can be seen in Figure 9, microRNAs whose expression was increased in response to serum starvation may play roles in various cellular functions, including cell cycle, MAPK signalling pathways, TGF beta signalling pathways, and DNA methylation, among others. [0201] Table 13 depicts results from analysis of miRNAs from MVs obtained from human PC RNA preparations.
Table 13. miRNAs from MVs obtained from human PCs grown under serum starvation conditions mi RN A in
MVs from Exemplary Sequence(s) (5' to 3') Alternative
Human PCs Description has-miR-155- UUAAUGCUAAUCGUGAUAGGGGU (SEQ ID
4395459 NO:492) MIMAT0000646 hsa-let-7b- UGAGGUAGUAGGUUGUGUGGUU (SEQ ID
4395446 NO:493) MIMAT0000063 hsa-let-7d- AGAGGUAGUAGGUUGCAUAGUU (SEQ ID
4395394 NO:494) MIMAT0000065 hsa-let-7e- UGAGGUAGGAGGUUGUAUAGUU (SEQ ID
4395517 NO:495) MIMAT0000066 hsa-miPv-lOO- AACCCGUAGAUCCGAACUUGUG (SEQ ID
4373160 NO:496) MIMAT0000098
125a-5p- UCCCUGAGACCCUUUAACCUGUGA (SEQ ID
4395309 NO:497) MIMAT0000443 hsa-miPv- UCCCUGAGACCCUAACUUGUGA (SEQ ID
125b-4373148 NO:498) MIMAT0000423 hsa-miR-126- UCGUACCGUGAGUAAUAAUGCG (SEQ ID
4395339 NO:499) MIMAT0000445 hsa-miR-134- UGUGACUGGUUGACCAGAGGGG (SEQ ID
4373299 NO:500) MIMAT0000447 hsa-miR-138- AGCUGGUGUUGUGAAUCAGGCCG (SEQ ID
4395395 NO:501) MIMAT0000430 hsa-miR-139- UCUACAGUGCACGUGUCUCCAG (SEQ ID
5p-4395400 NO:502) MIMAT0000250 hsa-miR-140- CAGUGGUUUUACCCUAUGGUAG (SEQ ID
5p-4373374 NO:503) MIMAT0000431 hsa-miR-143- UGAGAUGAAGCACUGUAGCUC (SEQ ID
4395360 NO:504) MIMAT0000435 hsa-miR-145- GUCCAGUUUUCCCAGGAAUCCCU (SEQ ID
4395389 NO:505) MIMAT0000437 hsa-miR-149- UCUGGCUCCGUGUCUUCACUCCC (SEQ ID
4395366 NO:506) MIMAT0000450 hsa-miR-152- UCAGUGCAUGACAGAACUUGG (SEQ ID
4395170 NO:507) MIMAT0000438 hsa-miR-153- UUGCAUAGUCACAAAAGUGAUC (SEQ ID
4373305 NO:508) MIMAT0000439
Figure imgf000089_0001
Figure imgf000090_0001
Figure imgf000091_0001
hsa-miR-378- ACUGGACUUGGAGUCAGAAGG (SEQ ID
002243 NO:575) MIMAT0000732 hsa-miR-
520c-3p- AAAGUGCUUCCUUUUAGAGGGU (SEQ ID
002400 NO:576) MIMAT0002846 hsa-miR-571- UGAGUUGGCCAUCUGAGUGAG (SEQ ID
001613 NO:577) MIMAT0003236 hsa-miR-601- UGGUCUAGGAUUGUUGGAGGAG (SEQ ID
001558 NO:578) MIMAT0003269 hsa-miR- AGGGGGAAAGUUCUAUAGUCC (SEQ ID
625#-002432 NO:579) MIMAT0003294 hsa-miR-639- AUCGCUGCGGUUGCGAGCGCUGU (SEQ ID
001583 NO:580) MIMAT0003309 hsa-miR-643- ACUUGUAUGCUAGCUCAGGUAG (SEQ ID
001594 NO:581) MIMAT0003313 hsa-miR-720-
002895 UCUCGCUGGGGCCUCCA (SEQ ID NO:582) MIMAT0005954 hsa-miR-767- UCUGCUCAUACCCCAUGGUUUCU (SEQ ID
3p-001995 NO:583) MIMAT0003883 hsa-miR-875- UAUACCUCAGUUUUAUCAGGUG (SEQ ID
5p-002203 NO:584) MIMAT0004922 hsa-miR- CACUGGCUCCUUUCUGGGUAGA (SEQ ID
892b-002214 NO:585) MIMAT0004918 hsa-miR-93#- CAAAGUGCUGUUCGUGCAGGUAG (SEQ ID
002139 NO:586) MIMAT0000093
GATGACCCCAGGTAACTCTGAGTGTGTCGC
RNU48- TGATGCCATCACCGCAGCGCTCTGACC (SEQ Mature miRNA
001006 ID NO:587) Control
EQUIVALENTS AND SCOPE
[0202] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments, described herein. The scope of the present invention is not intended to be limited to the above Description, but rather is as set forth in the appended claims.
[0203] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments in accordance with the invention described herein. The scope of the present invention is not intended to be limited to the above Description, but rather is as set forth in the appended claims.
[0204] In the claims articles such as "a," "an," and "the" may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include "or" between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process. Furthermore, it is to be understood that the invention encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, descriptive terms, etc., from one or more of the listed claims is introduced into another claim. For example, any claim that is dependent on another claim can be modified to include one or more limitations found in any other claim that is dependent on the same base claim. Furthermore, where the claims recite a composition, it is to be understood that methods of using the composition for any of the purposes disclosed herein are included, and methods of making the composition according to any of the methods of making disclosed herein or other methods known in the art are included, unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise.
[0205] Where elements are presented as lists, e.g., in Markush group format, it is to be understood that each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should it be understood that, in general, where the invention, or aspects of the invention, is/are referred to as comprising particular elements, features, etc., certain embodiments of the invention or aspects of the invention consist, or consist essentially of, such elements, features, etc. For purposes of simplicity those embodiments have not been specifically set forth in haec verba herein. It is also noted that the term "comprising" is intended to be open and permits the inclusion of additional elements or steps.
[0206] Where ranges are given, endpoints are included. Furthermore, it is to be understood that unless otherwise indicated or otherwise evident from the context and
understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.
[0207] In addition, it is to be understood that any particular embodiment of the present invention that falls within the prior art may be explicitly excluded from any one or more of the claims. Since such embodiments are deemed to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not set forth explicitly herein. Any particular embodiment of the compositions of the invention {e.g., any cell type; any neuronal cell system; any reporter of synaptic vesicle cycling; any electrical stimulation system; any imaging system; any synaptic vesicle cycling assay; any synaptic vesicle cycle modulator; any method of use; etc.) can be excluded from any one or more claims, for any reason, whether or not related to the existence of prior art.
INCORPORATION OF REFERENCES
[0208] All publications and patent documents cited in this application are incorporated by reference in their entirety to the same extent as though the contents of each individual publication or patent document were incorporated herein.
[0209] What is claimed is:

Claims

1. A method of treating a disease, disorder or condition comprising administering to a patient in need of treatment a therapeutically effective amount of microvesicles.
2. The method of claim 1, wherein the disease, disorder or condition is diabetes mellitus.
3. The method of claim 1, wherein the disease, disorder or condition is myocardial infarct.
4. The method of claim 1, wherein the disease, disorder or condition is a kidney disease.
5. The method of claim 1, wherein the disease, disorder or condition is wound healing.
6. The method of claim 1, wherein the disease, disorder or condition is Fistulas regeneration.
7. The method of claim 1, wherein the disease, disorder or condition is neural regeneration.
8. The method of claim 7, wherein the neural regeneration comprises CNS regeneration.
9. The method of claim 7, wherein the neural regeneration comprises peripheral nervous system regeneration.
10. The method of claim 1, wherein the disease, disorder or condition is breast augmentation following mastectomy.
11. The method of claim 1 , wherein the disease, disorder or condition is associated with a cosmetic surgical procedure.
12. A method of inducing tissue repair, remodeling or differentiation in vivo comprising administering to a patient in need of treatment a therapeutically effective amount of
microvesicles.
13. The method of any one of the preceding claims, wherein the microvesicles are derived from a tissue that is the same as the diseased tissue.
14. The method of any one of claims 1-12, wherein the microvesicles are derived from a tissue that is different from the diseased tissue.
15. The method of any one of claims 1-12, wherein the microvesicles are derived from pancreatic cells, kidney cells, liver cells, spleen cells, lymph nodes, myometrium cells, peripheral blood cells, chord blood cells, bone marrow cells, serum, mesenchymal stem cells, or
combination thereof.
16. The method of claim 15, wherein the microvesicles are derived from pancreas-derived pathfinder cells.
17. The method of any one of the preceding claims, wherein the microvesicles are derived from autologous cells.
18. The method of any one of the preceding claims, wherein the microvesicles are derived from non-autologous cells.
19. The method of any one of the preceding claims, wherein the microvesicles are derived from cells grown on a nonwoven substrate.
20. The method of claim 19, wherein the nonwoven substrate comprise an aliphatic polyester fiber.
21. The method of claim 20, wherein the aliphatic polyester fiber is selected from the group consisting of homopolymers or copolymers of lactide (which includes lactic acid D-,L- and meso lactide), glycolide (including glycolic acid), epsilon-caprolactone, p-dioxanone (l,4-dioxan-2- one), trimethylene carbonate (l,3-dioxan-2-one), and combinations thereof.
22. The method of any one of the preceding claims, wherein the microvesicles are derived from cells grown under a culture condition where oxygen pressure is less than or equal to 5%.
23. The method of any one of the preceding claims, wherein the microvesicles are derived from cells grown under room air oxygen conditions.
24. The method of any one of the preceding claims, wherein the microvesicles are derived from cells grown to approximately 80-99% confluency.
25. The method of any one of the preceding claims, wherein the microvesicles are derived from cells grown under serum starvation conditions.
26. The method of claim 25, wherein the cells are grown under serum starvation conditions for about 24 hours.
27. The method of any one of the preceding claims, wherein the microvesicles are derived from cells grown under serum replete conditions.
28. The method of any one of the preceding claims, wherein the microvesicles are derived from cells grown in serum-free medium.
29. The method of any one of the preceding claims, wherein the microvesicles are isolated or purified by differential ultracentrifugation.
30. The method of any one of the preceding claims, wherein the microvesicles are isolated or purified by precipitation.
31. The method of any one of the preceding claims, wherein a substantial fraction of
microvesicles have a size greater than about 100 nm.
32. The method of any one of the preceding claims, wherein a substantial fraction of
microvesicles have a size greater than about 1 μιη.
33. The method of any one of the preceding claims, wherein a substantial fraction of
microvesicles have a size ranging between approximately 100 nm and 1 μιη.
34. The method of any one of the preceding claims, wherein the microvesicles comprise one or more microR As selected form the group consisting of miRNA-122, miRNA-127, miRNA- 133b, miRNA-323, miRNA-433, miRNA-451 , miRNA-466h, miRNA-467c, miRNA-467e, miRNA-468, miRNA-491, miRNA-495, miRNA-546, miRNA-666, miRNA-680, miRNA-346, miRNA-136, miRNA-202, miRNA-369, miRNA-370, miRNA-375, miRNA-376b, miRNA-381, miRNA-434, miRNA-452, miRNA-465a, miRNA-465b, miRNA-470, miRNA-487b, miRNA- 543, miRNA-547, miRNA-590, miRNA-741, miRNA-881, miRNA-206, miRNA-224, miRNA- 327, miRNA-347, and combination thereof.
35. The method of any one of the preceding claims, wherein the microvesicles comprise one or more microRNAs selected form the group consisting of miRNA-122, miRNA-127, miRNA- 133b, miRNA-323, miRNA-433, miRNA-451 , miRNA-466h, miRNA-467c, miRNA-467e, miRNA-468, miRNA-491, miRNA-495, miRNA-546, miRNA-666, miRNA-680, miRNA-346, and combination thereof.
36. The method of any one of the preceding claims, wherein the microvesicles do not contain miRNA-129-5p, miRNA-190, miRNA-203, miRNA-32, miRNA-34c, miRNA-376c, miRNA- 384-3p, miRNA-499b, miRNA-455, miRNA-582-5p, miRNA-615-3p, miRNA-615-5p, miRNA- 7b, miRNA-17-3p, miRNA-381, and miRNA-505.
37. The method of any one of the preceding cells, wherein the therapeutically effective amount of microvesicles ranges from lfg-lmg/kg body weight.
38. The method of any one of the preceding claims, wherein the microvesicles are administered intravenously, intra-arterially, intramuscularly, subcutaneously, cutaneously, intradermally, intracranially, intratheccally, intrapleurally, intra-orbitally, intra nasally, orally, intra
alimentrally, colorectally, and/or intra-cerebrospinally.
39. The method of any one of the preceding claims, the microvesicles are administered daily.
40. The method of any one of claims 1-38, the microvesicles are administered weekly.
41. The method of any one of claims 1-38, the microvesicles are administered biweekly.
42. The method of any one of claims 1-29, the microvesicles are administered monthly.
43. A method of treating a disease, disorder or condition by administering one or more microRNAs obtained, isolated or purified from microvesicles.
44. The method of claim 43, wherein the microvesicles are derived from cells grown under serum starvation conditions.
45. The method of claim 44, wherein the cells are grown under serum starvation conditions for about 24 hours.
46. The method of claim 43, wherein the microvesicles are derived from cells grown under serum replete conditions.
47. The method of claim 43, wherein the microvesicles are derived from cells grown in serum- free medium.
48. The method of claim 43, wherein the microRNAs obtained, isolated or purified from microvesicles comprises microRNAs differentially expressed in microvesicles.
49. The method of claim 48, wherein the microRNAs obtained, isolated or purified from microvesicles comprises microRNAs differentially expressed in microvesicles derived from cells grown under stress conditions.
50. The method of claim 49, wherein the stress condition is selected from oxygen pressure, cell culture confluency, serum depletion in cell culture medium, and combinations thereof.
51. A method of treating a disease comprising administering to a patient in need of treatment a therapeutically effective amount of one or more microRNAs having a sequence at least 80% identical to any of SEQ ID NO: 1-587.
52. The method of claim 51 , wherein the disease is diabetes mellitus.
53. The method of claim 51 , wherein the disease is myocardial infarct.
54. The method of claim 51 , wherein the disease is a kidney disease.
55. The method of claim 51 , wherein the disease, disorder or condition is wound healing.
56. The method of claim 51 , wherein the disease, disorder or condition is Fistulas regeneration.
57. The method of claim 51 , wherein the disease, disorder or condition is neural regeneration.
58. The method of claim 57, wherein the neural regeneration comprises CNS regeneration.
59. The method of claim 57, wherein the neural regeneration comprises peripheral nervous system regeneration.
60. The method of claim 51 , wherein the disease, disorder or condition is breast augmentation following mastectomy.
61. The method of claim 51 , wherein the disease, disorder or condition is associated with a cosmetic surgical procedure.
62. A method of inducing tissue repair, remodeling or differentiation in vivo comprising administering to a patient in need of treatment a therapeutically effective amount of one or more microRNAs having a sequence at least 80% identical to any one of SEQ ID NO: 1-587.
63. The method of any one of claims 51-62, wherein the one or more microRNAs have a sequence at least 80% identical to any one of SEQ ID NO: 1-29.
64. The method of any one of claims 51-62, wherein the one or more microRNAs are selected from SEQ ID NO: 1-587.
65. The method of any one of claims 51-64, wherein the therapeutically effective amount of the one or more miRNAs ranges from lfg-lmg/kg body weight.
66. The method of any one of claims 51-65, wherein the one or more miRNAs are administered intravenously, intra-arterially, intramuscularly, subcutaneously, cutaneously, intradermally, intracranially, intratheccally, intrapleurally, intra-orbitally, intra nasally, orally, intra
alimentrally, colorectally, and/or intra-cerebrospinally.
67. The method of any one of claims 51-62, wherein the one or more miRNAs are administered daily.
68. The method of any one of claims 51-62, wherein the one or more miRNAs are administered weekly.
69. The method of any one of claims 5162, wherein the one or more miRNAs are administered biweekly.
70. The method of any one of claims 51-62, wherein the one or more miRNAs are administered monthly.
71. A pharmaceutical composition comprising a therapeutically effective amount of
microvesicles for the treatment of diabetes mellitus, myocardial infarct, kidney disease, wound healing, Fistulas regeneration, neural regeneration, breast augmentation following mastectomy, and/or conditions associated with a cosmetic surgical procedure.
72. A pharmaceutical composition comprising one or more microRNAs having a sequence at least 80% identical to any one of SEQ ID NO: 1-587 and a pharmaceutically acceptable carrier.
73. The pharmaceutical composition of claim 72, wherein the one or more microRNAs comprise a sequence at least 80% identical to any one of SEQ ID NO: 1-29.
74. The pharmaceutical composition of claim 72, wherein the one or more microRNAs are selected from SEQ ID NO: 1-587.
75. The pharmaceutical composition of any one of claims 71-74, wherein the one or more miRNAs are present in a therapeutically effective amount for the treatment of diabetes mellitus, myocardial infarct, or kidney disease.
76. A method for identifying an miRNA that induces cell growth and/or regeneration, comprising providing cells grown in a microvesicle-depleted medium; adding an miRNA to the medium;
determining if the addition of the miRNA increases cell proliferation rate as compared to a control, thereby identifying if the miRNA induces cell growth and/or regeneration.
77. The method of claim 76, wherein the cells are pancreas-derived pathfinder cells.
78. The method of claim 76 or 77, wherein the cell proliferation rate is determined by doubling time.
79. The method of any one of claims 76-78, wherein the miRNA is isolated from microvesicles.
80. A method for identifying an miRNA that induces cell growth and/or regeneration, comprising
creating a wounded area in cells grown to confluence;
treating the cells with an miRNA;
determining a rate of re-growth of the treated cells across the wounded area as compared to a control, thereby identifying if the miRNA induces cell growth and/or regeneration.
81. The method of claim 80, wherein the cells are fibroblasts or cardiomyocytes.
82. The method of claim 80 or 81, wherein the rate of re-growth is determined quantitatively.
83. The method of any one of claims 80-82, wherein the control is untreated cells but otherwise grown under identical conditions.
84. The method of any one of claims 80-83, wherein the miRNA is isolated from microvesicles.
85. An miRNA that induces cell growth and/or regeneration identified using a method according to any one of claims 76-84.
PCT/IB2011/002028 2010-08-13 2011-08-12 Therapeutic uses of microvesicles and related micrornas Ceased WO2012020307A2 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
CN2011800497589A CN103210089A (en) 2010-08-13 2011-08-12 Therapeutic uses of microvesicles and related microRNAs
CA2845280A CA2845280A1 (en) 2010-08-13 2011-08-12 Therapeutic uses of microvesicles and related micrornas
JP2013523676A JP2013537538A (en) 2010-08-13 2011-08-12 Therapeutic applications of microbubbles and related microRNAs
EP11763986.4A EP2603592A2 (en) 2010-08-13 2011-08-12 Therapeutic uses of microvesicles and related micrornas
AU2011288262A AU2011288262A1 (en) 2010-08-13 2011-08-12 Therapeutic uses of microvesicles and related microRNAs
US13/766,666 US20130143314A1 (en) 2010-08-13 2013-02-13 Therapeutic uses of microvesicles and related micrornas
US14/987,931 US20160243171A1 (en) 2010-08-13 2016-01-05 Therapeutic uses of microvesicles and related micrornas
US15/829,160 US20180338997A1 (en) 2010-08-13 2017-12-01 Therapeutic uses of microvesicles and related micrornas
US16/034,059 US20190167732A1 (en) 2010-08-13 2018-07-12 Therapeutic uses of microvesicles and related micrornas

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US37371510P 2010-08-13 2010-08-13
US61/373,715 2010-08-13
US38076610P 2010-09-08 2010-09-08
US61/380,766 2010-09-08

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13/766,666 Continuation US20130143314A1 (en) 2010-08-13 2013-02-13 Therapeutic uses of microvesicles and related micrornas

Publications (2)

Publication Number Publication Date
WO2012020307A2 true WO2012020307A2 (en) 2012-02-16
WO2012020307A3 WO2012020307A3 (en) 2012-11-29

Family

ID=45567981

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/IB2011/002028 Ceased WO2012020307A2 (en) 2010-08-13 2011-08-12 Therapeutic uses of microvesicles and related micrornas
PCT/IB2011/002048 Ceased WO2012020308A2 (en) 2010-08-13 2011-08-12 Cellular and molecular therapies

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/IB2011/002048 Ceased WO2012020308A2 (en) 2010-08-13 2011-08-12 Cellular and molecular therapies

Country Status (7)

Country Link
US (5) US20130143314A1 (en)
EP (1) EP2603592A2 (en)
JP (3) JP2013537538A (en)
CN (1) CN103210089A (en)
AU (1) AU2011288262A1 (en)
CA (1) CA2845280A1 (en)
WO (2) WO2012020307A2 (en)

Cited By (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013093870A1 (en) 2011-12-23 2013-06-27 International Centre For Genetic Engineering And Biotechnology - Icgeb microRNAs FOR CARDIAC REGENERATION THROUGH INDUCTION OF CARDIAC MYOCYTE PROLIFERATION
WO2013138427A1 (en) * 2012-03-16 2013-09-19 The General Hospital Corporation Microvesicle-mediated delivery of therapeutic molecules
WO2013169202A1 (en) * 2012-05-10 2013-11-14 Biomatcell Ab Osteogenic differentiation of mesenchymal stem cells
WO2014004424A1 (en) * 2012-06-26 2014-01-03 Temple University - Of The Commonwealth System Of Higher Education Method for detecting injury to the brian
EP2687219A1 (en) * 2012-07-18 2014-01-22 Universität Duisburg-Essen Use of preparations comprising exosomes derived from mesenchymal stem cells (MSCs) in the prevention and therapy of inflammatory conditions
US8642751B2 (en) 2010-12-15 2014-02-04 Miragen Therapeutics MicroRNA inhibitors comprising locked nucleotides
WO2014049125A1 (en) * 2012-09-28 2014-04-03 Fundación Centro Nacional De Investigaciones Cardiovasculares Carlos Iii (Cnic) Nucleotide sequence motifs directing nucleic acid location to extracellular vesicles
US20140256792A1 (en) * 2011-10-17 2014-09-11 Pharmahungary 2000 Kft. Compounds for the treatment of ischemic injury
US8846396B2 (en) 2003-07-31 2014-09-30 Universita Degli Studi Di Roma “La Sapienza” Methods for the isolation of cardiac stem cells
WO2014159662A1 (en) 2013-03-13 2014-10-02 University Of Miami Method for isolation and purification of microvesicles from cell culture supernatants and biological fluids
CN104117071A (en) * 2013-04-27 2014-10-29 中国科学院上海药物研究所 Application of microRNA-491-3p in antagonizing drug resistance of multidrug resistance gene 1 (MDR1) mediated tumors
WO2015052527A1 (en) * 2013-10-09 2015-04-16 Reneuron Limited Microparticles, mirna and wound therapy
JP2015514760A (en) * 2012-04-16 2015-05-21 ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア Ophthalmic treatment using embryonic stem cell microvesicles
US9334498B2 (en) 2012-05-10 2016-05-10 Uab Research Foundation Methods and compositions for modulating MIR-204 activity
EP2882445A4 (en) * 2012-08-13 2016-06-15 Cedars Sinai Medical Center EXOSOMES AND MICRO-RIBONUCLEIC ACIDS FOR THE REGENERATION OF TISSUES
CN105663153A (en) * 2014-11-21 2016-06-15 中国农业大学 Application of microRNA-22 in hair growth and androgen-induced alopecia
US9428749B2 (en) 2011-10-06 2016-08-30 The Board Of Regents, The University Of Texas System Control of whole body energy homeostasis by microRNA regulation
EP2875348A4 (en) * 2012-07-19 2016-11-02 Atlantic Cancer Res Inst METHOD FOR ISOLATING MICROVESICLES
US9803202B2 (en) 2012-06-21 2017-10-31 MiRagen Therapeutics, Inc. Oligonucleotide-based inhibitors comprising locked nucleic acid motif
WO2017191234A1 (en) * 2016-05-06 2017-11-09 Unicyte Ev Ag Pharmaceutical carriers containing mirnas for use in the treatment of fibrotic diseases caused by hyperglycemia
US9845457B2 (en) 2010-04-30 2017-12-19 Cedars-Sinai Medical Center Maintenance of genomic stability in cultured stem cells
US9879260B2 (en) 2013-08-20 2018-01-30 The Board Of Regents Of The University Of Texas System Micro-RNA regulation of bone loss
US9885042B2 (en) 2015-01-20 2018-02-06 MiRagen Therapeutics, Inc. miR-92 inhibitors and uses thereof
US9884076B2 (en) 2012-06-05 2018-02-06 Capricor, Inc. Optimized methods for generation of cardiac stem cells from cardiac tissue and their use in cardiac therapy
WO2018178608A1 (en) * 2017-03-31 2018-10-04 Catrina Sergiu Bogdan Methods of treatment of diabetic ulcers with microrna
EP3351251A4 (en) * 2015-09-16 2019-05-22 Tohoku University NUCLEIC ACID MOLECULE
US10406182B2 (en) 2013-10-09 2019-09-10 Reneuron Limited Stem cell microparticles and miRNA
WO2019182372A1 (en) * 2018-03-21 2019-09-26 ㈜로제타엑소좀 Bacterial extracellular vesicles having reduced toxicity and use thereof
WO2020079253A1 (en) * 2018-10-18 2020-04-23 Institut National De La Sante Et De La Recherche Medicale (Inserm) Myelinosome as a vector for intracellular delivery of molecules of interest
US10717981B2 (en) 2018-01-18 2020-07-21 Advanced ReGen Medical Technologies, LLC Therapeutic compositions and methods of making and using the same
EP3468568B1 (en) 2016-06-08 2020-09-02 Lysatpharma GmbH Human platelet lysate derived extracellular vesicles for use in medicine
US10772911B2 (en) 2013-12-20 2020-09-15 Advanced ReGen Medical Technologies, LLC Cell free compositions for cellular restoration and methods of making and using same
EP3787648A4 (en) * 2018-04-30 2021-08-25 Instytut Medycyny Doswiadczalnej I Klinicznej IM. USE OF STEM CELL-OBTAINED MICROVESICLES IN THE TREATMENT OF NEUROINFLAMMATION, ESPECIALLY FROM STROKE
US11203754B2 (en) 2016-04-29 2021-12-21 Advanced ReGen Medical Technologies, LLC Microrna compositions and methods of making and using same
US11219643B2 (en) 2013-12-20 2022-01-11 Advanced ReGen Medical Technologies, LLC Compositions for cellular restoration and methods of making and using same
US11253551B2 (en) 2016-01-11 2022-02-22 Cedars-Sinai Medical Center Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of heart failure with preserved ejection fraction
US11286463B2 (en) 2012-03-08 2022-03-29 Advanced ReGen Medical Technologies, LLC Reprogramming of aged adult stem cells
US11351200B2 (en) 2016-06-03 2022-06-07 Cedars-Sinai Medical Center CDC-derived exosomes for treatment of ventricular tachyarrythmias
US11357799B2 (en) 2014-10-03 2022-06-14 Cedars-Sinai Medical Center Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of muscular dystrophy
US11541078B2 (en) 2016-09-20 2023-01-03 Cedars-Sinai Medical Center Cardiosphere-derived cells and their extracellular vesicles to retard or reverse aging and age-related disorders
US11660317B2 (en) 2004-11-08 2023-05-30 The Johns Hopkins University Compositions comprising cardiosphere-derived cells for use in cell therapy
US11660355B2 (en) 2017-12-20 2023-05-30 Cedars-Sinai Medical Center Engineered extracellular vesicles for enhanced tissue delivery
US11759482B2 (en) 2017-04-19 2023-09-19 Cedars-Sinai Medical Center Methods and compositions for treating skeletal muscular dystrophy
US12146137B2 (en) 2018-02-05 2024-11-19 Cedars-Sinai Medical Center Methods for therapeutic use of exosomes and Y-RNAS
US12558316B2 (en) 2013-03-13 2026-02-24 University Of Miami Methods and compositions for the treatment of epidermolysis bullosa

Families Citing this family (73)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9249392B2 (en) 2010-04-30 2016-02-02 Cedars-Sinai Medical Center Methods and compositions for maintaining genomic stability in cultured stem cells
US9119974B2 (en) * 2011-03-04 2015-09-01 Ahmed H. Al-Qahtani Skin cream
US9901600B2 (en) 2011-03-11 2018-02-27 Children's Medical Center Corporation Methods and compositions relating to mesenchymal stem cell exosomes
EP3536789A1 (en) 2012-06-06 2019-09-11 Boehringer Ingelheim International GmbH Cell engineering using rnas
US10357517B1 (en) * 2012-10-01 2019-07-23 University Of South Florida Methods of treating epilepsy using neural stem cells that express nanog, SSEA-4, OCT-4, MIR-34B, MIR-34C and MIR-592
WO2014091373A1 (en) * 2012-12-11 2014-06-19 The University Court Of The University Of Glasgow Cellular and molecular therapies for peripheral vascular disease
US20160008401A1 (en) * 2013-03-01 2016-01-14 Apceth Gmbh & Co. Kg Protection of the vascular endothelium from immunologically mediated cytotoxic reactions with human cd34-negative progenitor cells
US9994814B2 (en) 2013-04-09 2018-06-12 Advanced ReGen Medical Technologies, LLC Method for cellular restoration
CA2914615C (en) 2013-06-05 2023-10-17 Biotime, Inc. Compositions and methods for induced tissue regeneration in mammalian species
EP3036345A2 (en) * 2013-08-19 2016-06-29 Notre Dame Du Lac Method and composition for detection of oncogenic hpv
WO2015080758A1 (en) * 2013-11-27 2015-06-04 Al-Qahtani Ahmed H Method and composition for the treatment of moderate to severe keratoconjunctivitis sicca
US11078462B2 (en) 2014-02-18 2021-08-03 ReCyte Therapeutics, Inc. Perivascular stromal cells from primate pluripotent stem cells
US10568945B2 (en) 2014-04-25 2020-02-25 University Of Cincinnati Compositions and methods for inducing liver regeneration by administering hepatocyte-derived exosomes
US10624929B2 (en) * 2014-05-18 2020-04-21 Children's Medical Center Corporation Methods and compositions relating to exosomes
EP3146321B1 (en) 2014-05-22 2020-12-02 University of Notre Dame du Lac Integrated membrane sensor for rapid molecular detection
US10240127B2 (en) 2014-07-03 2019-03-26 ReCyte Therapeutics, Inc. Exosomes from clonal progenitor cells
KR101670469B1 (en) * 2014-10-23 2016-10-28 고려대학교 산학협력단 Composition comprising microRNA for preventing or treating PCV2 infection
EP3029466A1 (en) * 2014-12-03 2016-06-08 Fundació Hospital Universitari Vall d' Hebron - Institut de Recerca Methods for differentiating ischemic stroke from hemorrhagic stroke
AU2016206491A1 (en) 2015-01-16 2017-08-31 University Of Iowa Research Foundation Methods to prevent or treat periodontitis or peri-implantitis
MX2017013852A (en) * 2015-04-28 2019-04-15 Texas A & M Univ Sys Scalable production of standardized extracellular vesicles, extracellular vesicle preparations and uses thereof.
IL256175B2 (en) 2015-06-10 2024-10-01 Univ Texas Use of exosomes for the treatment of disease
CN105063052B (en) * 2015-08-31 2018-06-29 北京泱深生物信息技术有限公司 Acute myeloid leukemia miRNA markers
EP4328324B1 (en) * 2015-11-18 2026-03-25 Dignity Health Methods of diagnosing epilepsy
SG11201804117XA (en) 2015-11-18 2018-06-28 Univ Georgia Neural cell extracellular vessicles
CN108779435B (en) 2015-12-07 2022-05-03 再生疗法有限公司 Method for the re-derivation of different pluripotent stem cell-derived brown adipocytes
EP3427060B1 (en) 2016-03-07 2025-08-13 Father Flanagan's Boys' Home doing Business as Boys Town National Research Hospital Noninvasive molecular controls
US10946047B2 (en) * 2016-06-17 2021-03-16 United Therapeutics Corporation Extracellular vesicles with enhanced potency
CN106048037A (en) * 2016-07-06 2016-10-26 上海市内分泌代谢病研究所 A detection method for human circulating miR‑122
AU2017311684B2 (en) * 2016-08-14 2023-05-04 Ramot At Tel-Aviv University Ltd. Mesenchymal cell-derived exosomes to treat neurological disorders
US11883434B2 (en) 2017-03-15 2024-01-30 Nutech Ventures Extracellular vesicles and methods of using
CN110520140A (en) * 2017-04-19 2019-11-29 菲格内有限责任公司 Fibroblast-derived exosomes stimulate angiogenesis
CN111163787A (en) * 2017-04-20 2020-05-15 北卡罗来纳州立大学 Platelet vesicle-engineered cells and extracellular vesicles for targeted tissue repair
WO2018219998A1 (en) * 2017-05-30 2018-12-06 Siemens Aktiengesellschaft Mirnas as biomarkers for a systemic inflammatory response syndrome
CN107320484B (en) * 2017-06-08 2022-05-17 中国人民解放军第四军医大学第一附属医院 Use of mir-452-3p in the preparation of a pharmaceutical composition for treating liver cancer
ES2936149T3 (en) * 2017-09-21 2023-03-14 Codiak Biosciences Inc Production of Extracellular Vesicles in Single Cell Suspension Using Chemically Defined Cell Culture Media
CN107760717B (en) * 2017-11-08 2020-07-31 吉林省农业科学院 Sheep TNPO1 gene dual-luciferase reporter gene vector and construction method and application thereof
CN109893655B (en) * 2017-12-11 2021-07-20 义慧科技(深圳)有限公司 Application of miR-327 inhibitor and/or FGF10 promoter in medicine for preventing and/or treating diabetes
CN109893656B (en) * 2017-12-11 2021-07-20 义慧科技(深圳)有限公司 Application of miR-327 inhibitor and/or FGF10 promoter in preparation of medicines for preventing and/or treating lipodystrophy
US12017066B2 (en) 2018-01-05 2024-06-25 Mayo Foundation For Medical Education And Research Modulation of extracellular vesicles with electrical stimulation
EP3758756B1 (en) * 2018-03-02 2025-09-03 The Regents of The University of California Stem cell-derived exosomes for the treatment of corneal scarring
JP2021521141A (en) 2018-04-09 2021-08-26 オージェネシス インコーポレイテッド Bioxome particles, redoxomes, methods of their preparation, and compositions containing them.
US12521418B2 (en) 2018-04-30 2026-01-13 Children's Medical Center Corporation Mesenchymal stromal cell exosomes and uses thereof
WO2019236873A1 (en) * 2018-06-06 2019-12-12 Board Of Regents Of The University Of Nebraska Extracellular vesicles and methods of using
WO2020023767A1 (en) * 2018-07-26 2020-01-30 Joslin Diabetes Center Targeting micro-rnas for exosomal delivery or cellular retention
CA3116860A1 (en) * 2018-10-17 2020-04-23 Ochsner Health System Plasma and cerebrospinal fluid mirna biomarkers in intracerebral and subarachnoid hemorrhage
US12577726B2 (en) 2018-11-15 2026-03-17 The Regents Of The University Of California Vesicle-coated fibers and methods of making and using
KR102178922B1 (en) * 2018-11-26 2020-11-13 순천향대학교 산학협력단 Biomarker microRNA let-7 or microRNA-150 for diagnosing diabetic nephropathy and use thereof
WO2020128163A1 (en) * 2018-12-20 2020-06-25 Itä-Suomen Yliopisto Synthetic microrna mimics
US20220251552A1 (en) * 2019-03-25 2022-08-11 The Trustees Of The University Of Pennsylvania Regenerative Therapy Based on miRNA-302 Mimics for Enhancing Host Recovery from Pneumonia Caused by Streptococcus pneumoniae
WO2020247675A1 (en) * 2019-06-06 2020-12-10 Spiritus Therapeutics, Inc. Methods for attenuating viral infection and for treating lung injury
US12097222B2 (en) 2019-06-06 2024-09-24 Spiritus Therapeutics, Inc. Methods for attenuating viral infection and for treating lung injury
WO2020247610A1 (en) 2019-06-06 2020-12-10 Spiritus Therapeutics, Inc. Mesenchymal stem cell-derived extracellular vesicles and uses thereof for treating and diagnosing fibrotic diseases
AU2020295303A1 (en) * 2019-06-20 2022-02-17 Cellapeutics Bio Method for producing exosomes by electrical stimulation
US12624015B2 (en) 2019-06-24 2026-05-12 University Of Iowa Research Foundation JNK inhibitors as anticancer agents
CN110623975B (en) * 2019-10-09 2022-07-05 新乡医学院 microRNA328 for regulating TERT gene expression and application thereof
US11904006B2 (en) 2019-12-11 2024-02-20 University Of Iowa Research Foundation Poly(diaminosulfide) particle-based vaccine
US20230070923A1 (en) * 2020-02-05 2023-03-09 Logan D. Gulla Aesthetic-Enhancing Formulations And Methods Thereof
CN111840513A (en) * 2020-06-12 2020-10-30 广东工业大学 A composite exosome loaded with pro-tumor apoptosis protein and anti-cancer small molecule and its preparation method and application
WO2022020534A1 (en) * 2020-07-23 2022-01-27 The Regents Of The University Of California Compositions comprising mir-690 and methods therefor
KR102480430B1 (en) * 2020-10-21 2022-12-21 순천향대학교 산학협력단 MicroRNA-31-5p for diagnosing rosacea and use thereof
CN113265459B (en) * 2021-05-28 2022-05-17 沈阳体育学院 Application of miRNA-601 as a molecular marker in the diagnosis and treatment of osteoarthritis
CN113384595B (en) * 2021-07-13 2022-08-02 浙江中医药大学 Application of a miR-674-3p in the preparation of drugs for preventing or treating stress-induced hypertension
CN114748497B (en) * 2022-04-27 2024-10-18 广州市妇女儿童医疗中心 A miRNA molecule miR-206 for regulating uterine muscle contraction and its application
CN115192710A (en) * 2022-05-27 2022-10-18 华南理工大学 Application of miRNA-200s protective agent in preparation of nervous system disease drugs, drugs and model construction method
WO2024040126A2 (en) * 2022-08-16 2024-02-22 The Regents Of The University Of California Improved glycemic control by administration of micro-rna 192
AU2023365480A1 (en) * 2022-10-20 2025-03-13 Assistance Publique – Hôpitaux De Paris Generation of secretome-containing compositions, and methods of using and analyzing the same
CN120584186A (en) 2023-02-07 2025-09-02 特罗姆瑟大学-挪威北极圈大学 Pharmaceutical composition for use in the treatment of venous thromboembolism
CN116159071B (en) * 2023-04-26 2023-06-27 中山大学中山眼科中心 Application of miR-543 in preparation of medicine for treating nerve injury
CN116763809B (en) * 2023-05-31 2024-01-26 广东医科大学附属医院 Application of miR-376b-3p inhibitor in preparation of epilepsy treatment drugs
CN116617244B (en) * 2023-06-05 2026-03-24 湖南光琇高新生命科技有限公司 Application of nucleic acid molecules in the preparation of drugs for treating liver diseases
CN116850201A (en) * 2023-06-29 2023-10-10 南昌市高新区人民医院(南昌大学第一附属医院高新医院) Application of miR-221-3p
CN117815257B (en) * 2024-01-08 2024-08-02 南方医科大学深圳医院 Application of miR-760-3p in the preparation of drugs for the prevention and treatment of type 2 diabetes
WO2026058945A1 (en) * 2024-09-13 2026-03-19 ロート製薬株式会社 Anti-aging composition, anti-inflammatory composition, and method for screening aging amelioration substances

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080268429A1 (en) * 2004-06-02 2008-10-30 Sourcepharm, Inc. Rna - Containing Microvesicles and Methods Therefor
US7597950B1 (en) 2005-02-28 2009-10-06 Massachusetts Institute Of Technology Nanoparticles having sub-nanometer features
GB0509748D0 (en) * 2005-05-13 2005-06-22 Univ Glasgow Materials and methods relating to cell based therapies
US9085778B2 (en) * 2006-05-03 2015-07-21 VL27, Inc. Exosome transfer of nucleic acids to cells
WO2008036765A2 (en) * 2006-09-19 2008-03-27 Asuragen, Inc. Micrornas differentially expressed in pancreatic diseases and uses thereof
US20100233216A1 (en) * 2007-10-15 2010-09-16 Vincenzo Cantaluppi Use of microvesicles (mvs) for preparing a medicament having adjuvant activity on endothelial cell transplantation, particularly in the treatment of diabetes by pancreatic islet transplantation, and related method
US8568771B2 (en) * 2007-10-29 2013-10-29 Fresenius Medical Care Deutschland G.M.B.H. Use of microvesicles (MVs) derived from stem cells for preparing a medicament for endo/epithellal regeneration of damaged or injured tissues or organs, and related in vitro and in vivo methods
ES2936256T3 (en) * 2008-02-01 2023-03-15 Massachusetts Gen Hospital Use of microvesicles in the diagnosis, and prognosis of diseases and medical conditions
WO2009136168A1 (en) * 2008-05-09 2009-11-12 The University Court Of The University Of Glasgow Materials and methods relating to cell based therapies
US20110177054A1 (en) * 2008-06-06 2011-07-21 Derrick Gibbings Use of endo-lysosomal system and secreted vesicles (exosome-like) in treatments and diagnostics based on small rna and experimental study of small rna
US20100179213A1 (en) * 2008-11-11 2010-07-15 Mirna Therapeutics, Inc. Methods and Compositions Involving miRNAs In Cancer Stem Cells
US20100151575A1 (en) 2008-12-15 2010-06-17 Colter David C Method of Making Conditioned Media from Kidney Derived Cells

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
None

Cited By (78)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8846396B2 (en) 2003-07-31 2014-09-30 Universita Degli Studi Di Roma “La Sapienza” Methods for the isolation of cardiac stem cells
US11660317B2 (en) 2004-11-08 2023-05-30 The Johns Hopkins University Compositions comprising cardiosphere-derived cells for use in cell therapy
US9845457B2 (en) 2010-04-30 2017-12-19 Cedars-Sinai Medical Center Maintenance of genomic stability in cultured stem cells
US8642751B2 (en) 2010-12-15 2014-02-04 Miragen Therapeutics MicroRNA inhibitors comprising locked nucleotides
US9428749B2 (en) 2011-10-06 2016-08-30 The Board Of Regents, The University Of Texas System Control of whole body energy homeostasis by microRNA regulation
US20140256792A1 (en) * 2011-10-17 2014-09-11 Pharmahungary 2000 Kft. Compounds for the treatment of ischemic injury
US9457046B2 (en) * 2011-10-17 2016-10-04 PharmalHungary 2000 Kft. Compounds for the treatment of ischemic injury
WO2013093870A1 (en) 2011-12-23 2013-06-27 International Centre For Genetic Engineering And Biotechnology - Icgeb microRNAs FOR CARDIAC REGENERATION THROUGH INDUCTION OF CARDIAC MYOCYTE PROLIFERATION
US11286463B2 (en) 2012-03-08 2022-03-29 Advanced ReGen Medical Technologies, LLC Reprogramming of aged adult stem cells
WO2013138427A1 (en) * 2012-03-16 2013-09-19 The General Hospital Corporation Microvesicle-mediated delivery of therapeutic molecules
JP2015514760A (en) * 2012-04-16 2015-05-21 ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア Ophthalmic treatment using embryonic stem cell microvesicles
US9334498B2 (en) 2012-05-10 2016-05-10 Uab Research Foundation Methods and compositions for modulating MIR-204 activity
WO2013169202A1 (en) * 2012-05-10 2013-11-14 Biomatcell Ab Osteogenic differentiation of mesenchymal stem cells
US9884076B2 (en) 2012-06-05 2018-02-06 Capricor, Inc. Optimized methods for generation of cardiac stem cells from cardiac tissue and their use in cardiac therapy
US9803202B2 (en) 2012-06-21 2017-10-31 MiRagen Therapeutics, Inc. Oligonucleotide-based inhibitors comprising locked nucleic acid motif
US10337005B2 (en) 2012-06-21 2019-07-02 MiRagen Therapeutics, Inc. Oligonucleotide-based inhibitors comprising locked nucleic acid motif
US9989539B2 (en) 2012-06-26 2018-06-05 Temple University—Of the Commonwealth System of Higher Education Method for detecting injury to the brain
WO2014004424A1 (en) * 2012-06-26 2014-01-03 Temple University - Of The Commonwealth System Of Higher Education Method for detecting injury to the brian
US9877989B2 (en) 2012-07-18 2018-01-30 Universitaet Duisburg-Essen Use of preparations comprising exosomes derived from mesenchymal stem cells (MSCs) in the prevention and therapy of inflammatory conditions
EP2687219A1 (en) * 2012-07-18 2014-01-22 Universität Duisburg-Essen Use of preparations comprising exosomes derived from mesenchymal stem cells (MSCs) in the prevention and therapy of inflammatory conditions
WO2014013029A1 (en) 2012-07-18 2014-01-23 Universität Duisburg-Essen Use of preparations comprising exosomes derived from mesenchymal stem cells (mscs) in the prevention and therapy of inflammatory conditions
EP3299814A3 (en) * 2012-07-19 2018-04-11 Atlantic Cancer Research Institute Method for the isolation of microvesicles
US10488403B2 (en) 2012-07-19 2019-11-26 Atlantic Cancer Research Institute Method for the isolation of microvesicles
EP2875348A4 (en) * 2012-07-19 2016-11-02 Atlantic Cancer Res Inst METHOD FOR ISOLATING MICROVESICLES
US12584127B2 (en) 2012-08-13 2026-03-24 Cedars-Sinai Medical Center Exosomes and micro-ribonucleic acids for tissue regeneration
EP2882445A4 (en) * 2012-08-13 2016-06-15 Cedars Sinai Medical Center EXOSOMES AND MICRO-RIBONUCLEIC ACIDS FOR THE REGENERATION OF TISSUES
EP3563859A1 (en) * 2012-08-13 2019-11-06 Cedars-Sinai Medical Center Cardiosphere-derived exosomes for tissue regeneration
US10457942B2 (en) 2012-08-13 2019-10-29 Cedars-Sinai Medical Center Exosomes and micro-ribonucleic acids for tissue regeneration
US11220687B2 (en) 2012-08-13 2022-01-11 Cedars-Sinai Medical Center Exosomes and micro-ribonucleic acids for tissue regeneration
US9828603B2 (en) 2012-08-13 2017-11-28 Cedars Sinai Medical Center Exosomes and micro-ribonucleic acids for tissue regeneration
AU2013302799B2 (en) * 2012-08-13 2018-03-01 Cedars-Sinai Medical Center Exosomes and micro-ribonucleic acids for tissue regeneration
WO2014049125A1 (en) * 2012-09-28 2014-04-03 Fundación Centro Nacional De Investigaciones Cardiovasculares Carlos Iii (Cnic) Nucleotide sequence motifs directing nucleic acid location to extracellular vesicles
US12558316B2 (en) 2013-03-13 2026-02-24 University Of Miami Methods and compositions for the treatment of epidermolysis bullosa
US11730768B2 (en) 2013-03-13 2023-08-22 University Of Miami Method for isolation and purification of microvesicles from cell culture supernatants and biological fluids
EP4218774A1 (en) * 2013-03-13 2023-08-02 University Of Miami Method for isolation and purification of microvesicles from cell culture supernatants and biological fluids
CN105209881A (en) * 2013-03-13 2015-12-30 迈阿密大学 Method for isolation and purification of microvesicles from cell culture supernatants and biological fluids
AU2018211351C1 (en) * 2013-03-13 2020-12-10 University Of Miami Method for isolation and purification of microvesicles from cell culture supernatants and biological fluids
CN105209881B (en) * 2013-03-13 2021-01-22 迈阿密大学 Methods of isolation and purification of microvesicles from cell culture supernatants and biological fluids
WO2014159662A1 (en) 2013-03-13 2014-10-02 University Of Miami Method for isolation and purification of microvesicles from cell culture supernatants and biological fluids
EP2972193A1 (en) 2013-03-13 2016-01-20 University Of Miami Method for isolation and purification of microvesicles from cell culture supernatants and biological fluids
JP2016518109A (en) * 2013-03-13 2016-06-23 ユニバーシティ・オブ・マイアミUniversity Of Miami Methods for isolation and purification of microvesicles from cell culture supernatants and biological fluids
EP3677271A1 (en) * 2013-03-13 2020-07-08 University Of Miami Method for isolation and purification of microvesicles from cell culture supernatants and biological fluids
US12453745B2 (en) 2013-03-13 2025-10-28 University Of Miami Method for isolation and purification of microvesicles from cell culture supernatants and biological fluids
US10500231B2 (en) 2013-03-13 2019-12-10 University Of Miami Method for isolation and purification of microvesicles from cell culture supernatants and biological fluids
CN112795533A (en) * 2013-03-13 2021-05-14 迈阿密大学 Method for isolation and purification of microvesicles from cell culture supernatants and biological fluids
AU2018211351B2 (en) * 2013-03-13 2020-05-28 University Of Miami Method for isolation and purification of microvesicles from cell culture supernatants and biological fluids
CN104117071A (en) * 2013-04-27 2014-10-29 中国科学院上海药物研究所 Application of microRNA-491-3p in antagonizing drug resistance of multidrug resistance gene 1 (MDR1) mediated tumors
US9879260B2 (en) 2013-08-20 2018-01-30 The Board Of Regents Of The University Of Texas System Micro-RNA regulation of bone loss
US10406182B2 (en) 2013-10-09 2019-09-10 Reneuron Limited Stem cell microparticles and miRNA
WO2015052527A1 (en) * 2013-10-09 2015-04-16 Reneuron Limited Microparticles, mirna and wound therapy
US11219643B2 (en) 2013-12-20 2022-01-11 Advanced ReGen Medical Technologies, LLC Compositions for cellular restoration and methods of making and using same
US10772911B2 (en) 2013-12-20 2020-09-15 Advanced ReGen Medical Technologies, LLC Cell free compositions for cellular restoration and methods of making and using same
US12544409B2 (en) 2014-10-03 2026-02-10 Cedars-Sinai Medical Center Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of muscular dystrophy
US11357799B2 (en) 2014-10-03 2022-06-14 Cedars-Sinai Medical Center Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of muscular dystrophy
CN105663153A (en) * 2014-11-21 2016-06-15 中国农业大学 Application of microRNA-22 in hair growth and androgen-induced alopecia
US9885042B2 (en) 2015-01-20 2018-02-06 MiRagen Therapeutics, Inc. miR-92 inhibitors and uses thereof
US10280422B2 (en) 2015-01-20 2019-05-07 MiRagen Therapeutics, Inc. MiR-92 inhibitors and uses thereof
EP3351251A4 (en) * 2015-09-16 2019-05-22 Tohoku University NUCLEIC ACID MOLECULE
US10881683B2 (en) 2015-09-16 2021-01-05 Tohoku University Nucleic acid molecule
US11253551B2 (en) 2016-01-11 2022-02-22 Cedars-Sinai Medical Center Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of heart failure with preserved ejection fraction
US11872251B2 (en) 2016-01-11 2024-01-16 Cedars-Sinai Medical Center Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of heart failure with preserved ejection fraction
US11203754B2 (en) 2016-04-29 2021-12-21 Advanced ReGen Medical Technologies, LLC Microrna compositions and methods of making and using same
US10716813B2 (en) 2016-05-06 2020-07-21 Unicyte Ev Ag Pharmaceutical carriers containing miRNAs for use in the treatment of fibrotic diseases caused by hyperglycemia
EA037967B1 (en) * 2016-05-06 2021-06-16 Униците Эф Аг Pharmaceutical carriers containing mirnas for use in the treatment of fibrotic diseases caused by hyperglycemia
US11110130B2 (en) 2016-05-06 2021-09-07 Unicyte Ev Ag Pharmaceutical carriers containing miRNAs for use in the treatment of fibrotic diseases caused by hyperglycemia
WO2017191234A1 (en) * 2016-05-06 2017-11-09 Unicyte Ev Ag Pharmaceutical carriers containing mirnas for use in the treatment of fibrotic diseases caused by hyperglycemia
US11351200B2 (en) 2016-06-03 2022-06-07 Cedars-Sinai Medical Center CDC-derived exosomes for treatment of ventricular tachyarrythmias
EP3468568B1 (en) 2016-06-08 2020-09-02 Lysatpharma GmbH Human platelet lysate derived extracellular vesicles for use in medicine
RU2735139C2 (en) * 2016-06-08 2020-10-28 Лизатфарма Гмбх Derived from human thrombocyte lysate, extracellular vesicles for use in medicine
US11541078B2 (en) 2016-09-20 2023-01-03 Cedars-Sinai Medical Center Cardiosphere-derived cells and their extracellular vesicles to retard or reverse aging and age-related disorders
WO2018178608A1 (en) * 2017-03-31 2018-10-04 Catrina Sergiu Bogdan Methods of treatment of diabetic ulcers with microrna
US11759482B2 (en) 2017-04-19 2023-09-19 Cedars-Sinai Medical Center Methods and compositions for treating skeletal muscular dystrophy
US11660355B2 (en) 2017-12-20 2023-05-30 Cedars-Sinai Medical Center Engineered extracellular vesicles for enhanced tissue delivery
US10717981B2 (en) 2018-01-18 2020-07-21 Advanced ReGen Medical Technologies, LLC Therapeutic compositions and methods of making and using the same
US12146137B2 (en) 2018-02-05 2024-11-19 Cedars-Sinai Medical Center Methods for therapeutic use of exosomes and Y-RNAS
WO2019182372A1 (en) * 2018-03-21 2019-09-26 ㈜로제타엑소좀 Bacterial extracellular vesicles having reduced toxicity and use thereof
EP3787648A4 (en) * 2018-04-30 2021-08-25 Instytut Medycyny Doswiadczalnej I Klinicznej IM. USE OF STEM CELL-OBTAINED MICROVESICLES IN THE TREATMENT OF NEUROINFLAMMATION, ESPECIALLY FROM STROKE
WO2020079253A1 (en) * 2018-10-18 2020-04-23 Institut National De La Sante Et De La Recherche Medicale (Inserm) Myelinosome as a vector for intracellular delivery of molecules of interest

Also Published As

Publication number Publication date
JP2016056210A (en) 2016-04-21
US20190167732A1 (en) 2019-06-06
WO2012020308A3 (en) 2013-04-11
US20160243171A1 (en) 2016-08-25
EP2603592A2 (en) 2013-06-19
WO2012020307A3 (en) 2012-11-29
JP2013537538A (en) 2013-10-03
US20130143314A1 (en) 2013-06-06
US20180338997A1 (en) 2018-11-29
CN103210089A (en) 2013-07-17
JP2017125065A (en) 2017-07-20
CA2845280A1 (en) 2012-02-16
WO2012020308A2 (en) 2012-02-16
AU2011288262A1 (en) 2013-04-04
US20140234263A1 (en) 2014-08-21

Similar Documents

Publication Publication Date Title
US20190167732A1 (en) Therapeutic uses of microvesicles and related micrornas
JP2013537538A5 (en)
Bei et al. Bone‐a‐petite: engineering exosomes towards bone, osteochondral, and cartilage repair
Eulalio et al. Functional screening identifies miRNAs inducing cardiac regeneration
Xu et al. An cell-assembly derived physiological 3D model of the metabolic syndrome, based on adipose-derived stromal cells and a gelatin/alginate/fibrinogen matrix
CN104703609B (en) stem cell microparticles
JP6450673B2 (en) Stem cell microparticles
Rooney et al. Gene-modified mesenchymal stem cells express functionally active nerve growth factor on an engineered poly lactic glycolic acid (PLGA) substrate
Zhu et al. Three-in-one customized bioink for islet organoid: GelMA/ECM/PRP orchestrate pro-angiogenic and immunoregulatory function
JP2013520168A (en) Method for generating engineered innervating tissue and use thereof
AU2008266019A1 (en) Peptide linked cell matrix materials for stem cells and methods of using the same
JP2017530977A (en) Cardiomyocyte-derived cells (CDC) as therapeutic agents for pulmonary hypertension
Wang et al. Graphene oxide-modified concentric microgrooved titanium surfaces for the dual effects of osteogenesis and antiosteoclastogenesis
EP3541929A1 (en) In vitro production of muscle stem cells
US10221389B2 (en) Method of producing cell population with high target cell purity
Liu et al. A hiPSC-derived lineage-specific vascular smooth muscle cell-on-a-chip identifies aortic heterogeneity across segments
WO2014091373A1 (en) Cellular and molecular therapies for peripheral vascular disease
JP4710008B2 (en) Method for producing cultured myocytes with high metabolic capacity
KR102927837B1 (en) Transformed human hepatic stellate cell line and use thereof
WO2019098944A1 (en) Systems for expanding pancreatic islets and transplantation thereof
US20190105342A1 (en) Nucleic acid molecule
HK1186495A (en) Therapeutic uses of microvesicles and related micrornas
EP3795677B1 (en) Composition for promoting stem cell differentiation, comprising progenitor cell culture solution and multilayer graphene film, and use thereof
JP2019076008A (en) Precursor cells capable of differentiating into osteocytes, chondrocytes, adipocytes or neurons, method for producing the same, and method for using the same
Rao Biomedical research and healthcare: Opportunities, expectations, and limitations

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref document number: 2013523676

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2011763986

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2011763986

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2011288262

Country of ref document: AU

Date of ref document: 20110812

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2845280

Country of ref document: CA