WO2012018258A1 - Markers of febrile seizures and temporal lobe epilepsy - Google Patents

Markers of febrile seizures and temporal lobe epilepsy Download PDF

Info

Publication number
WO2012018258A1
WO2012018258A1 PCT/NL2011/050551 NL2011050551W WO2012018258A1 WO 2012018258 A1 WO2012018258 A1 WO 2012018258A1 NL 2011050551 W NL2011050551 W NL 2011050551W WO 2012018258 A1 WO2012018258 A1 WO 2012018258A1
Authority
WO
WIPO (PCT)
Prior art keywords
srp9
complex
srp14
febrile seizures
syndrome
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/NL2011/050551
Other languages
French (fr)
Inventor
Pierre Nicolaas Ernst De Graan
Ellen Victorine Susan Hessel
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
UMC Utrecht Holding BV
Original Assignee
UMC Utrecht Holding BV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by UMC Utrecht Holding BV filed Critical UMC Utrecht Holding BV
Publication of WO2012018258A1 publication Critical patent/WO2012018258A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/136Screening for pharmacological compounds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/178Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/28Neurological disorders
    • G01N2800/2857Seizure disorders; Epilepsy

Definitions

  • the present invention is in the field of medicine, more particular in the field of neurosciences. It relates to early diagnostic markers for febrile seizures and diseases and conditions associated herewith such as complex epilepsy syndromes such as Dravet's Syndrome, epilepsies with mental retardation, and temporal lobe epilepsy, and methods of diagnosis using such markers. It also relates to a method for preventing and/or treating such febrile seizures and diseases and conditions associated therewith using gene modulation therapy, such as RNA interference. Finally, the invention provides for kits suitable for identifying a subject at risk of developing febrile seizures and diseases and conditions associated therewith.
  • a febrile seizure also known as a fever fit or febrile convulsion, is a convulsion associated with a significant rise in body temperature.
  • I LEA it is defined as a seizure occurring in childhood after 6 months of age, associated with a febrile illness not caused by an infection of the central nervous system, without previous neonatal seizures or a previous unprovoked seizure, and not meeting criteria for other acute symptomatic seizures (1993). They most commonly occur in children between the ages of 6 months and 5 years.
  • FS temporal lobe epilepsy
  • GEFS+ Generalised Epilepsy with FS
  • This panel has proven to be a powerful tool in detecting quantitive trait loci (QTLs) for complex traits (Singer et al., 2004. Science 304, 445-448; Mozhui et al. 2008. PloS Genet. Vol. 4, 1 1 ; eiooo26o ).
  • QTLs quantitive trait loci
  • Complex FS occur in childhood and are considered harmful for normal brain development. Complex FS increase the risk to develop hippocampal sclerosis and TLE about tenfold. The decision to treat complex FS with anti-epileptic drug is a difficult one, because the treatment per se may affect normal brain development. Thus, an early diagnosis of children with complex FS is of paramount importance for clinical practice.
  • the present invention provides for the use of an SRP9 protein and/or an Srp9 nucleic acid sequence and/or an SRP14 protein and/or an Srp14 nucleic acid sequence as a diagnostic marker.
  • Said diagnostic marker may be for febrile seizures, complex febrile seizures, for complex epilepsy syndromes including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or for temporal lobe epilepsy.
  • the present invention relates to the use of an SRP9 protein and/or an Srp9 nucleic acid sequence and/or an SRP14 protein and/or an Srp14 nucleic acid sequence in identifying a subject at risk of developing febrile seizures (FS), a subject at risk of developing complex FS, a subject at risk of developing a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or a subject at risk of developing temporal lobe epilepsy.
  • FS febrile seizures
  • a subject at risk of developing complex FS a subject at risk of developing a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation
  • a subject at risk of developing temporal lobe epilepsy such as Dravet's syndrome and epilepsies with mental retardation
  • the invention further pertains to a method for identifying a subject at risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy, said method comprising the steps of: a) providing a sample of a subject; b) subject; b) determining the level of at least one biomarker selected from SRP9 polypeptide, Srp9 mRNA, SRP14 protein and/or Srp14 mRNA in said sample; c) comparing the level of said biomarker to a reference level; and d) determining whether the level of said biomarker is indicative of a risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
  • FS such as Dravet's syndrome and epilep
  • said subject is an infant or child.
  • Said sample may be selected from the group consisting of a whole blood sample, serum, and plasma.
  • an increased level of said biomarker is indicative of a risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
  • the present invention is further concerned with the use of a SNP in the promoter region of the Srp9 gene, said SNP being selected from the group consisting of rs6688819 (T/C), rs12403575 (G/A), rs16845266 (G/C), rs120398148 (T/C), and rs6659660 (G/A), for determining the risk in a subject of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
  • Said SNP preferably is rs12403575 G/A.
  • the present invention is also directed to a method for identifying a subject at risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy, said method comprising the step of: a) determining in a sample of a subject a SNP in the promoter region of the Srp9 gene, wherein the SNP is selected from rs12403575 G/A, rs6688819 T/C, rs16845266 G/C, rs120398148 T/C, and rs6659660 G/A, and preferably is rs12403575 G/A.
  • Said SNP preferably is rs12403575 G/A.
  • the A allele of rs12403575 G/A is associated with an increased risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
  • the genotype of said subject for rs12403575 is determined, and an AA genotype is associated with an increased risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
  • Said method may further comprise the step of providing a sample of a subject.
  • Said sample may comprise or may be derived from blood, an amniotic fluid, cerebrospinal fluid, tissue from skin, muscle, buccal or conjunctival mucosa, placenta, gastrointestinal tract or chorionic villi.
  • the invention also concerns a method for identifying a subject at risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy, said method comprising the steps of: a) determining in a sample of a subject the sequence of the Srp9 promoter sequence, wherein the presence of one or more de novo mutations is indicative of a risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
  • FS such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy
  • the present invention relates to a kit comprising a probe or primer that distinguishes an allele of a SNP in a Srp9 gene in a sample from a subject, wherein the allele is selected from the A or G allele in the SNP rs12403575.
  • Said kit may be for determining an increased risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy in a subject.
  • the probe or primer may be detectably labelled.
  • the invention provides a method for screening chemical compounds or compositions interfering with the function of the SRP complex, said method comprising the step of identifying chemical compounds or compositions that suppress expression of SRP9 and/or SRP14 polypeptide, that interact with SRP9 and/or SRP14 polypeptide and thereby prevent formation of the SRP9/SRP14 complex, and/or that interact with the SRP9/SRP14 complex and thereby prevent formation of the SRP complex.
  • the invention also relates to a compound capable of selectively binding to SRP9 and/or SRP14 polypeptide, preferably an antibody capable of selectively binding to SRP9 and/or SRP14 polypeptide, for use as a medicament, such as for use in preventing and/or treating febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
  • a compound capable of selectively binding to SRP9 and/or SRP14 polypeptide preferably an antibody capable of selectively binding to SRP9 and/or SRP14 polypeptide
  • a medicament such as for use in preventing and/or treating febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
  • the present invention is concerned with the use of therapeutic gene modulation for suppressing the level of SRP9 protein and/or SRP14 protein in a mammal, such as for preventing and/or treating febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
  • FS complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
  • the invention also pertains to a Srp9 and/or Srp14 nucleic acid modulator selected from the group consisting of antisense DNA, siRNA, miRNA, shRNA, ribozyme specifically binding to and cleaving Srp9 and/or Srp14 mRNA and zinc finger nuclease specifically targeting a nucleic acid sequence in the Srp9 and/or Srp14 gene resulting in suppression of Srp9 and/or Srp14 expression for use in preventing and/or treating febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
  • FS complex epilepsy syndrome
  • Dravet's syndrome and epilepsies with mental retardation and/or temporal lobe epilepsy.
  • the invention is directed to a recombinant nucleic acid construct comprising at least one transcriptional unit comprising: - a promoter; - a nucleic acid sequence encoding a gene suppressor selected from: - an antisense DNA sequence complementary to the sense strand of the Srp9 and/or Srp14 gene; - an interfering RNA molecule which is complementary to Srp9 mRNA and/or Srp14 mRNA; - a nucleic acid sequence encoding a zinc finger nuclease specifically targeting a nucleic acid sequence in the Srp9 gene and/or Srp14 gene; - a nucleic acid sequence encoding a ribozyme specifically binding to and cleaving Srp9 and/or Srp14 mRNA; and - a terminator, for use in preventing and/or treating febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsy
  • the invention further relates to a vector comprising a recombinant nucleic acid construct of the invention for use in preventing and/or treating febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy, which vector may comprise more than one transcriptional unit, as well as a cell comprising a recombinant nucleic acid construct or a vector of the invention for use in preventing and/or treating febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
  • FS such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy
  • the invention further includes a method for suppressing the level of SRP9 protein and/or SRP14 protein in a cell, said method comprising the step of including an Srp9 and/or Srp14 nucleic acid modulator of the invention or recombinant nucleic acid construct of the invention in said cell.
  • kits comprising means for detecting the level of Srp9 mRNA and/or SRP9 protein and/or Srp mRNA and/or SRP14 protein in a sample derived from a subject.
  • Said kit may be for use in identifying a subject at risk of developing febrile seizures (FS), a subject at risk of developing complex FS, a subject at risk of developing a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or a subject at risk of developing temporal lobe epilepsy.
  • FS febrile seizures
  • a subject at risk of developing complex FS a subject at risk of developing a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation
  • a subject at risk of developing temporal lobe epilepsy such as Dravet's syndrome and epilepsies with mental retardation
  • the kit may comprise a primer pair allowing selective amplification of Srp9 and/or Srp14 mRNA, or an antibody that specifically binds to SRP9 protein and/or SRP14 protein.
  • Said sample derived from a subject may be a blood sample or a sample derived from blood.
  • Figure 1 shows FS QTL mapping on chromosome 1 .
  • Figure 2 shows brain Srp9 mRNA expression in CSS1 is lower than in C57BL/6J.
  • Figure 3 shows that down-regulation of Srp9 mRNA in C57BL/6J in vivo reduces FS susceptibility.
  • AS Srp9 antisense oligonucleotide AS Srp9 antisense oligonucleotide
  • Figure 4 demonstrates SRP9 expression and sequencing in mTLE patients with and without FS.
  • SRP9 mRNA levels normalized qPCR data: Rn
  • FIG. 5 demonstrates that CSS2 mice are more susceptible to FS than C57BL/6J mice.
  • B) C57BL/6J and CSS2 mice do not differ in the time course of temperature increase. Data are expressed as means ⁇ SEM (n 9). * significantly different p ⁇ 0.05.
  • Figure 6 represents FS QTL mapping on chromosome 2.
  • Figure 7 shows Srp14 mRNA expression levels in mouse and human hippocampus as determined by quantitative PCR.
  • Data are expressed as means ⁇ SEM. * significantly different p ⁇ 0.02.
  • Srp68 is another protein subunit of the SRP complex.
  • Figure 8 shows sequencing of the human SRP9 gene in TLE patients, FS patients and healthy controls.
  • SRP9 refers to a SRP9 polypeptide
  • Srp9 refers to a Srp9 nucleic acid such as the Srp9 gene or Srp9 RNA, such as Srp9 mRNA
  • SRP14 refers to a SRP9 polypeptide
  • Srp14 refers to a Srp14 nucleic acid such as the Srp14 gene or Srp14 RNA, such as Srp14 mRNA.
  • complex epilepsy syndromes refers to epilepsy syndromes with a variety of epileptic phenotypes, one of which is febrile seizures, preferably complex febrile seizures.
  • the term includes, without limitation, Dravet's Syndrome, genetic epilepsy with febrile seizures plus (GEFS+), and epilepsies wiih mental retardation.
  • GEFS+ genetic epilepsy with febrile seizures plus
  • epilepsies wiih mental retardation The skilled person is well aware which diseases and conditions are encompassed by the term “complex epilepsy syndromes”.
  • nucleic acid may include any polymer or oligomer of pyrimidine and purine bases, preferably cytosine, thymine, and uracil, and adenine and guanine, respectively (See Albert L. Lehninger, Principles of Biochemistry, at 793-800 (Worth Pub. 1982) which is herein incorporated by reference in its entirety for all purposes).
  • the present invention contemplates any deoxyribonucleotide, ribonucleotide or peptide nucleic acid component, and any chemical variants thereof, such as methylated, hydroxymethylated or glycosylated forms of these bases, and the like.
  • the polymers or oligomers may be heterogenous or homogenous in composition, and may be isolated from naturally occurring sources or may be artificially or synthetically produced.
  • the nucleic acids may be DNA or RNA, or a mixture thereof, and may exist permanently or transitionally in single-stranded or double-stranded form, including homoduplex, heteroduplex, and hybrid states.
  • gene means a DNA sequence comprising a region (transcribed region), which is transcribed into an RNA molecule (e.g. an mRNA) in a cell, operably linked to suitable regulatory regions (e.g. a promoter).
  • a gene may thus comprise several untranslated operably linked sequences, such as a promoter, a 5' leader sequence comprising e.g. sequences involved in transcription initiation and regulation, a (protein) coding region (cDNA or genomic DNA) and a 3' non-translated sequence (3'UTR) comprising e.g. transcription termination and regulatory sites.
  • promoter refers to a nucleic acid sequence that functions to control the transcription of one or more genes, located upstream with respect to the direction of transcription of the transcription initiation site of the gene, and is structurally identified by the presence of a binding site for DNA-dependent RNA polymerase, transcription initiation sites and any other DNA sequences, including, but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to one of skill in the art to act directly or indirectly to regulate the amount of transcription from the promoter.
  • promoter includes herein also the 5'UTR region (e.g.
  • the promoter may herein include one or more parts upstream (5') of the translation initiation codon of a gene, as this region may have a role in regulating transcription and/or translation.
  • a "constitutive” promoter is a promoter that is active in most tissues under most physiological and developmental conditions.
  • An “inducible” promoter is a promoter that is physiologically (e.g. by external application of certain compounds) or developmental ⁇ regulated.
  • a “tissue specific” promoter is only active in specific types of tissues or cells.
  • a “promoter active in plants or plant cells” refers to the general capability of the promoter to drive transcription within a plant or plant cell. It does not make any implications about the spatiotemporal activity of the promoter.
  • a "3' UTR” or “3' non-translated sequence” refers to the nucleic acid sequence found downstream of the coding sequence of a gene, which comprises for example a transcription termination site and (in most, but not all eukaryotic mRNAs) a polyadenylation signal (such as e.g. AAUAAA or variants thereof).
  • a polyadenylation signal such as e.g. AAUAAA or variants thereof.
  • the mRNA transcript may be cleaved downstream of the polyadenylation signal and a poly(A) tail may be added, which is involved in the transport of the mRNA to the cytoplasm (where translation takes place).
  • a “5' UTR” or “leader sequence” or “5' untranslated region” is a region of the mRNA transcript, and the corresponding DNA, between the +1 position where mRNA transcription begins and the translation start codon of the coding region (usually AUG on the mRNA or ATG on the DNA).
  • the 5'UTR usually contains sites important for translation, mRNA stability and/or turnover, and other regulatory elements.
  • “Expression of a gene” refers to the process wherein a DNA region, which is operably linked to appropriate regulatory regions, particularly a promoter, is transcribed into an RNA, which is biologically active, i.e. which is capable of being translated into a biologically active protein or peptide (or active peptide fragment) or which is active itself (e.g. in posttranscriptional gene silencing or RNAi).
  • An active protein in certain embodiments refers to a protein being constitutively active.
  • the coding sequence is preferably in sense- orientation and encodes a desired, biologically active protein or peptide, or an active peptide fragment.
  • the DNA sequence is preferably present in the form of an antisense DNA or an inverted repeat DNA, comprising a short sequence of the target gene in antisense or in sense and antisense orientation.
  • the expression level is to be understood as the amount of RNA transcript that is transcribed by a gene and/or the amount of protein that may be translated from an RNA transcript, e.g. mRNA.
  • the amount of Luciferase expression also correlates with the expression level of the particular gene.
  • the amount of protein that may be translated from an RNA transcript may also be measured to determine the expression level of a gene. Methods are known in the art, such as ELISA and Western blot. Alternatively, the expression level of a protein may also be indirectly measured.
  • a reporter gene construct may be used which comprises the RNA transcription factor binding site.
  • the expression level may than be subsequently determined by measuring the reporter gene construct expression, e.g. in case GFP is used, green fluorescence intensity may be determined as a measure of the expression level of the RNA transcription factor.
  • nucleic acid construct or "vector” is herein understood to mean a man-made nucleic acid molecule resulting from the use of recombinant DNA technology and which is used to deliver exogenous DNA into a host cell.
  • Vectors usually comprise further genetic elements to facilitate their use in molecular cloning, such as e.g. selectable markers, multiple cloning sites and the like.
  • polymorphism refers to the presence of two or more variants of a nucleotide sequence in a population.
  • a polymorphism may comprise one or more base changes, an insertion, a repeat, or a deletion.
  • a polymorphism includes e.g. a simple sequence repeat (SSR) and a single nucleotide polymorphism (herein referred to as "SNP"), which is a variation, occurring when a single nucleotide: adenine (A), thymine (T), cytosine (C) or guanine (G) - is altered.
  • SNPs make up e.g.
  • allele(s) means any of one or more alternative forms of a gene at a particular locus. In a diploid cell of an organism, alleles of a given gene are located at a specific location, or locus (loci plural) on a chromosome. One allele is present on each chromosome of the pair of homologous chromosomes.
  • loci plural locus on a chromosome.
  • loci plural locus
  • rs12403575" represents an internationally known coding system to identify each SNP in the dbSNP of the NCBI's Entrez system.
  • the rs number can also be queried in the Entrez database such as pubmed (http://www.ncbi.nlm.nih.gov/pubmed/) and GenBank (http://www.ncbi.nlm.nih.gov/).
  • the SNP rs12403575 is located in the promoter of the Srp9 gene.
  • the nucleotide at its position can be either adenine (A) or guanine (G). If adenine is present in SNP rs12403575, it is called the A allele when it is present in this polymorphism. If guanine is present in SNP rs12403575, it is called the G allele when it is present in this polymorphism. Since each individual has one pair of the same chromosome, each individual has the SNP rs12403575 genotype either AA, AG, or GG.
  • primer refers to an oligonucleotide complementary to a nucleic acid strand for initiating the nucleic acid synthesis in the presence of four nucleoside triphosphates, a polymerase and buffer in a hybridization condition.
  • probe refers to an oligonucleotide that selectively hybridizes to a target nucleic acid under a suitable condition.
  • protein or “polypeptide” are used interchangeably and refer to molecules consisting of a chain of amino acids, without reference to a specific mode of action, size, 3 dimensional structure or origin. A “fragment” or “portion” of a protein may thus still be referred to as a “protein”.
  • isolated protein is used to refer to a protein which is no longer in its natural environment, for example in vitro or in a recombinant bacterial or plant host cell.
  • antibody refers to any immunoglobulin or fragment thereof, and encompasses any polypeptide comprising an antigen-binding site with at least one complementarity determining region (CDR).
  • CDR complementarity determining region
  • the term includes, but is not limited to, polyclonal, monoclonal, monospecific, polyspecific, non-specific, humanized, chimeric, human, single-chain, synthetic, recombinant, hybrid, mutated, grafted and in vitro generated antibodies.
  • antibody also includes antibody fragments such Fab, F(ab') 2 , Fv, scFv, Fd, dAb, and other antibody fragments or other constructs comprising CDRs that retain antigen-binding function.
  • Such fragments would comprise an antigen-binding domain.
  • the details of the preparation of such antibodies are well known to those skilled in the art.
  • the antibodies may be neutralizing antibodies.
  • neutralizing refers to the ability of an antibody to inhibit (i.e., eliminate or reduce) at least one activity of another compound or molecule.
  • the antibody or fragment thereof may be any of the known antibody isotypes and their conformations, for example, IgA, such as lgA1 or lgA2, IgD, IgE, IgG, such as lgG1 , lgG2a, lgG2b, lgG3, lgG4, or IgM class, or may constitute mixtures thereof in any thereof in any combination, such as a mixture of antibodies from the lgG1 and lgG2a class.
  • IgA such as lgA1 or lgA2
  • IgD IgD
  • IgE IgG
  • IgG such as lgG1 , lgG2a, lgG2b, lgG3, lgG4, or IgM class
  • the antibody may display specific binding to SRP9 and/or SRP14.
  • Specific binding of the antibody to SRP9 and/or SRP14 means that the protein and the antibody form a complex that is relatively stable under physiological conditions. Specific binding is characterized by a high affinity and a low to moderate capacity as distinguished from nonspecific binding which usually has a low affinity with a moderate to high capacity. Typically, binding is considered specific when the affinity constant K a is higher than 10 6 M "1 . If necessary, non-specific binding can be reduced without substantially affecting specific binding by varying the binding conditions in an in vitro test.
  • an antibody that specifically binds to SRP9 and/or SRP14 is an antibody in which SRP9 and/or SRP14 is the only target that is bound with high affinity, i.e. other polypeptides are not bound by said specific antibody or bound only with low affinity (non-specific binding).
  • the term "effective amount" refers to a quantity sufficient to achieve a desired therapeutic and/or prophylactic effect, e.g., an amount which results in the treatment and/or prevention of, febrile seizures, complex febrile seizures, a complex epilepsy syndrome such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
  • the amount of antibody administered to the subject will depend on the type and severity of the disease or condition and on the characteristics of the subject, such as general health, age, sex, body weight and tolerance to drugs. It will also depend on the degree, severity and type of disease or condition. The skilled artisan will be able to determine appropriate dosages depending on these and other factors.
  • the antibody can also be administered in combination with one or more additional therapeutic compounds.
  • a "therapeutically effective amount" of the binding member is meant levels in which the physiological effects of a disease or condition associated with febrile seizures are, at a minimum, ameliorated. The skilled person will be capable of determining when such disease or condition has been treated and/or prevented.
  • RNA interference refers to a process of sequence-specific, post-transcriptional gene silencing (PTGS).
  • RNA interference is a system within living cells that takes part in controlling which genes are active and how active they are. RNAs are the direct products of genes, and these small RNAs can bind to other specific RNAs (mRNA) and decrease their activity, for example by preventing a messenger RNA from producing a protein.
  • RNA molecules capable of RNA interference include, without limitation, siRNA, shRNA, and miRNA.
  • the verb "to comprise” and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded.
  • the verb "to consist” may be replaced by "to consist essentially of” meaning that a composition of the invention may comprise additional component(s) than the ones specifically identified, said additional component(s) not altering the unique characteristics of the invention.
  • indefinite article “a” or “an” does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements.
  • the indefinite article “a” or “an” thus usually means “at least one”.
  • a level in a test sample is increased or decreased when it is at least 5%, such as 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% higher or lower, respectively, than the corresponding level in a control sample or reference sample.
  • the present inventors mapped a FS susceptibility QTL on chromosome 1 by QTL analysis and showed differential expression of Srp9, a gene within this protective QTL which is part of the ubiquitous signal recognition particle (SRP) which is involved in regulating ER- dependent protein synthesis (secreted and membrane proteins).
  • SRP ubiquitous signal recognition particle
  • the Srp9 gene in the C57BL/6J and chromosome substitution strain 1 (CSS1 ) was sequenced.
  • Srp9 gene in the C57BL/6J strain is set forth in SEQ I D NO:1
  • Srp9 gene of the CSS1 strain is set forth in SEQ ID NO:2.
  • the differences in sequences are depicted in Table 6 below. A deletion of approximately 200 bp in the promoter region was identified which most likely is responsible for the differential expression in the two mice strains.
  • the inventors further mapped 2 FS susceptibility QTLs to mouse chromosome 2 one of which (QTL2b) contains the Srp14 gene.
  • SRP14 is the binding partner of SRP9 in the SRP complex and thus also involved in regulation of ER-dependent protein synthesis.
  • Hippocampal Srp14 mRNA expression was found to be up-regulated in CSS2 mice compared to C57BL/6J and in TLE patients with hippocampal sclerosis (which have a high incidence of antecedent FS) compared to non-sclerotic TLE patients and autopsy controls.
  • the human Srp14 gene sequence is set forth in SEQ ID NO:4.
  • the present invention relates to the use of an SRP9 protein and/or an Srp9 nucleic acid sequence and/or an SRP14 protein and/or an Srp14 nucleic acid sequence as a diagnostic marker. It was found that both the SRP9 polypeptide and Srp9 mRNA and/or both the SPR14 polypeptide and Srp14 mRNA could be used as diagnostic markers, particularly for diagnosing and/or identifying an increased risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome such as Dravet's Syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy (TLE; herein also referred to as "mesial temporal lobe epilepsy; "mTLE").
  • TLE temporal lobe epilepsy
  • the nucleotide sequence of the human Srp9 gene sequence is set forth in SEQ ID NO: 1
  • amino acid sequence of human SRP9 polypeptide is set forth in SEQ I D NO:5.
  • the nucleotide sequence of the human Srp14 gene sequence is set forth in SEQ ID NO:4.
  • the amino acid sequence of human SRP14 polypeptide is set forth in SEQ ID NO:6.
  • the nucleotide sequences of the human Srp9 and Srp14 genes and the amino acid sequences of the human SRP9 and SRP14 polypeptides can also be found in GenBank.
  • the present invention relates to use of an SRP9 protein and/or an Srp9 nucleic acid sequence and/or an SRP14 protein and/or an Srp14 nucleic acid sequence in identifying a subject at risk of developing febrile seizures (FS), a subject at risk of developing complex FS, a subject at risk of developing a complex epilepsy syndrome such as Dravet's Syndrome and epilepsies with mental retardation, and/or a subject at risk of developing temporal lobe epilepsy.
  • the subject is at increased risk of developing FS, complex FS, a complex epilepsy syndrome including FS, and/or TLE, preferably when compared to the risk of a healthy subject of developing these conditions and/or diseases.
  • the present invention pertains to a method for identifying identifying a subject at risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's Syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy, said method comprising the steps of: a) providing a sample derived from a subject;
  • an increased level of said biomarker is indicative of a risk, preferably an increased risk, of developing febrile seizures, complex febrile seizures, and/or temporal lobe epilepsy.
  • This method of the invention is preferably performed postnatally, such as in a child or infant.
  • said subject may optionally be started on therapy capable of preventing febrile seizures, such as complex febrile seizures, and associated temporal lobe epilepsy, complex epilepsy syndrome including FS, such as Dravet's Syndrome and epilepsies with mental retardation.
  • the present invention is concerned with a method for identifying a subject at risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's Syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy, said method comprising the step of:
  • the A allele of rs12403575 G/A is associated with an increased risk of developing febrile seizure, complex febrile seizure and/or temporal lobe epilepsy, whereas the G allele of rs12403575, is not.
  • the A allele of rs12403575 G/A may be considered the risk allele.
  • the method may comprise a further step of providing a sample of a subject. The latter method is considered particularly suitable for prenatal screening purposes.
  • the baby may be further screened after birth for SRP9/Srp9, e.g., in accordance with the methods taught herein, and may optionally be started on therapy capable of preventing febrile seizures, such as complex febrile seizures, and associated complex epilepsy syndromes, temporal lobe epilepsy and epilepsy and hippocampal sclerosis.
  • febrile seizures such as complex febrile seizures, and associated complex epilepsy syndromes, temporal lobe epilepsy and epilepsy and hippocampal sclerosis.
  • the method may also comprise the step of determined the genotype of said subject for SNP rs12403575, wherein an AA genotype is associated with an increased risk of developing FS, complex FS, complex epilepsy syndromes and/or TLE.
  • SNPs in the Srp9 gene as depicted in fig. 4C which provides sequence data idenfying 5 promotor SNPs in the human Srp9 gene, may also be useful for identifying a subject at risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome such as Dravet's Syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
  • detection of de novo mutations in the Srp9 gene sequence may also be useful for identifying persons at risk for the above diseases and conditions.
  • the present invention also provides for a method for identifying a subject at risk of developing febrile seizures, complex febrile seizures, complex epilepsy syndromes including FS, such as Dravet's Syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy, said method comprising the step of: a) determining in a sample of a subject a SNP in the Srp9 gene, wherein the SNP is selected from among those depicted in fig. 4C.
  • the method may further comprise a step of providing a sample derived from a subject.
  • the sample comprises or is derived from blood, amniotic fluid, cerebrospinal fluid, tissue from skin, muscle, buccal or conjunctival mucosa, placenta, gastrointestinal tract, or chorionic villi.
  • the risk of developing the above-referenced conditions may be increased for such subject, in particular compared to one or more healthy subjects.
  • Healthy subjects as referred to herein do not suffer neurological disorders, particularly not from febrile seizures, and preferably have no positive family history of febrile seizures, complex febrile seizures and/or temporal lobe epilepsy.
  • a healthy subject does not suffer from any conditions or diseases.
  • the uses and methods of the invention encompass ex vivo (or in vitro) analyzing a sample derived from a subject for the level of one, two, three, or four of the biomarkers of the invention, SRP9 protein, Srp9 nucleic acid sequence, SRP14 protein and/or Srp14 nucleic acid sequence.
  • the level of such biomarker or biomarkers may then be compared to a reference level.
  • a reference level may be a level of said biomarkers or biomarkers in a healthy subject or may be a default reference level determined by taking the average level of said biomarker(s) of a plurality of healthy subjects.
  • the reference level is age- matched to the subject.
  • the reference level may be stored, e.g., in a computer, and used for the comparative purposes herein set forth. Alternatively, the reference level may be known to the skilled physician and compared mentally. It is to be noted that the level of each biomarker is measured independently and compared to the reference level of the same biomarker in order to establish whether the level in said subject is increased, similar, or decreased.
  • SRP9 protein and/or Srp9 nucleic acid sequence may be used as a biomarker in the application of the present invention
  • SRP14 protein and/or Srp14 nucleic acid sequence may be used as a biomarker in the applications of the present invention
  • one of SRP9 protein and Srp9 nucleic acid sequence and one of SRP14 protein and Srp14 nucleic acid sequence or three or all of SRP9 protein and/or Srp9 nucleic acid sequence and/or SRP14 protein and/or Srp14 nucleic acid sequence may be used as biomarkers in the applications and uses of the present invention.
  • SRP9 protein and/or Srp9 nucleic acid sequence is employed as a biomarker in the present invention
  • either levels of SRP9 polypeptide and/or levels of Srp9 mRNA may be determined. Measurement of the levels of either SRP9 polypeptide or Srp9 mRNA would suffice for the present invention. However, both of the levels of either SRP9 polypeptide and Srp9 mRNA could be measured for the purposes of the present invention.
  • SRP14/Srp74 is employed as a biomarker in the present invention, either levels of SRP14 polypeptide and/or levels of Srp14 mRNA may be determined. Measurement of the levels of either SRP14 polypeptide or Srp14 mRNA would suffice for the present invention. However, both of the levels of either SRP14 polypeptide and Srp14 mRNA could be measured for the purposes of the present invention.
  • a subject may be an animal or a human being.
  • any subject could be diagnosed using any of the methods or uses of the invention.
  • the methods and uses of the invention may be applied as often as necessary in a subject.
  • the subject is a human being.
  • the subject is an infant, such as in the ages of between about 1 day and about 8 years, for example about 2 months and about 7 years, or about 6 months and about 6 years.
  • the subject may have a positive family history of febrile seizures, complex febrile seizures and/or temporal lobe epilepsy.
  • the invention may be used for prenatal screening for a subject at risk of developing FS, complex FS, a complex epilepsy syndrome including FS, such as Dravet's Syndrome and epilepsies with mental retardation and/or TLE.
  • the subject may also be a foetus.
  • sample may be any sample derived from a subject, but is preferably a biological sample.
  • a biological sample refers to a biological tissue or biological fluid from a subject.
  • samples can be useful in practicing the invention including, for example, blood, amniotic fluid, cerebrospinal fluid, tissue or cells from skin, muscle, buccal or conjunctival mucosa, brain, placenta, gastrointestinal tract or chorionic villi.
  • the sample is preferably selected from amniotic fluid, tissue or cells from placenta and/or tissue or cells from chorionic villi.
  • the sample is preferably selected from a whole blood sample, plasma, and serum.
  • the difference in the level of said biomarkers in said sample compared to a reference level may be determined as the fold increase/decrease, or alternatively as the relative increase or decrease of biomarker in the sample of said subject as compared to biomarker in a reference level.
  • the level of proteins or polypeptides may be determined by methods well known in the art, e.g., using an enzyme immunoassay or western blotting.
  • a number of monoclonal or polyclonal antibodies can be generated that specifically recognize SRP9 polypeptide or SRP14 polypeptide. Utilizing current antibody detection techniques that can quantitate the binding of monoclonal antibodies, one can determine the level or amount of said SRP9 or SRP14 polypeptide in a sample obtained from a subject.
  • EIA enzyme immunoassay
  • ELISA enzyme-linked immunosorbent assay
  • Performing an ELISA involves at least one antibody or other binding partners with high affinity for the biomarker with specificity for a particular antigen.
  • the sample with an unknown amount of antigen may be immobilized on a solid support (for example, a polystyrene microtiter plate) either non-specifically (via adsorption to the surface) or specifically (via capture by another antibody specific to the same antigen, in a "sandwich” ELISA).
  • a solid support for example, a polystyrene microtiter plate
  • the detection antibody is added, forming a complex with the antigen.
  • the detection antibody can be covalently linked to an enzyme, or can itself be detected by a secondary antibody which is linked to an enzyme through bioconjugation.
  • the plate is typically washed with a mild detergent solution to remove any proteins or antibodies that are not specifically bound.
  • the plate is is developed by adding an enzymatic substrate to produce a visible signal, which indicates the quantity of antigen in the sample.
  • the substrates may utilize chromogenic substrates, though fluorogenic substrates and chemoluminescent substrates are used more commonly as they enable higher sensitivity.
  • monoclonal antibodies may be commercially available from various suppliers all of which may be successfully applied, taking into account the manufacturers recommendations for use.
  • the level of polypeptide biomarker or biomarkers may be determined using any other routine techniques known to the skilled person, including, but not limited to, capillary action, precipitation, turbidimetric, diffusion, agglutination, potentiometric, amperometric, piezoelectric and evanescent-wave immunosensors, or any combination of the methods recited herein.
  • the level of Srp9 or Srp14 mRNA may be determined using routine techniques, including, without limitation, hybridization, and amplification reactions such as quantitative PCR or LCR.
  • nucleic acid arrays are ordered sequences of DNA or RNA that can be used to selectively isolate and later on quantify specific nucleic acid sequences in complex mixtures - by changing the hybridization and washing conditions the specificity of the detected nucleic acid duplexes can be modulated.
  • oligonucleotide sequences used to detect a target sequence will be referred to hereinbelow as a "probe".
  • Suitable hybridisation conditions i.e. buffers used, salt strength, temperature, duration
  • these conditions may vary, depending on factors such the size of the probes, the G+C-content of the probes and whether the probes are bound to an array as described below.
  • hybridisation conditions are preferably chosen such that each probe will only form a hybrid (duplex) with a target sequence with which the probe is essentially complementary, if such a target sequence is present, and otherwise will not form any hybrid.
  • the term "essentially complementary” as used herein does not mean that the complementarity of a probe to a target target sequence should be perfect, and mismatches up to 2 nucleotides can be envisaged.
  • the probe should at least in part be complementary to a specific target sequence.
  • the probe may be any nucleic acid (i.e. DNA or RNA) but is preferably DNA.
  • the probe will generally have a size of about 10 to 100 base pairs, preferably about 10 to 40 base pairs.
  • the probes may all be of the same size, or may be of different sizes.
  • the probes can be obtained in any suitable manner, e.g., using an automated DNA-synthesizer or in any other manner known per se. Also, solid phase nucleic acid synthesis techniques may be used, which may result directly in an array with the desired probes.
  • the probes may be obtained using techniques of genetic engineering, for instance by primer extension using the target sequence as a template, and/or by using one or more restriction enzymes, optionally using amplification.
  • the probes may comprise one or more "alternative nucleosides".
  • alternative nucleosides include the bases Inosine (I) and Uracil (U), as well as dUTP and dITP, and these are included within the term "labeled nucleotide analog". It is to be understood that the presence of such alternative nucleosides does not prevent the probe and its target sequence to be essentially complementary to one another as defined above.
  • Quantitative nucleic acid-based amplification reactions may also be used to detect and quantify specific nucleic acid sequences in complex mixtures as in the present invention. These include the well known Polymerase Chain Reaction (PCR) and Ligase Chain Reaction (LCR) and modifications thereof (see McPherson & Moller, 2006. PCR, second edition. Taylor & Francis Group; Wiedman et al., 1994. PCR Meth Appl; 3:S51 -S64). LCR is a method of DNA amplification similar to PCR but differs from PCR because it amplifies the probe molecule rather than producing amplicons through polymerization of nucleotides.
  • PCR Polymerase Chain Reaction
  • LCR Ligase Chain Reaction
  • LCR uses both a DNA polymerase enzyme and a DNA ligase enzyme to drive the reaction.
  • the resulting polynucleotide can be amplified by PCR and analyzed separately or, notably when in multiplex samples, hybridized to arrays.
  • the target for DNA arrays and quantitative nucleic acid-based amplification reactions such as PCR or LCR are nucleic acids, so DNA or RNA.
  • nucleic acids include, without limitation, Srp9 DNA and mRNA and Srp14 DNA and mRNA.
  • probes or primers may be employed distinguishing said SNP in a Srp9 gene. There are many methods for determining polymorphisms in the Srp9 gene.
  • Suitable methods include, without limitation, primer extension (PinPoint assay, MassextendTM, SPC-SBE, or GOOD assay), hybridization (TaqMan assay , bead array, or SNP chip), ligation (combinatorial fluorescence energy transfer (CFET) tags), and enzymatic cleavage (RFLP, Invader® assay), PCR-SSCP (single-strand conformation polymorphism), MRD (mismatch repair detection), BeadArrayTM, detection), BeadArrayTM, or SNPlexTM.
  • primer extension PinPoint assay, MassextendTM, SPC-SBE, or GOOD assay
  • hybridization TaqMan assay , bead array, or SNP chip
  • ligation combininatorial fluorescence energy transfer (CFET) tags
  • RFLP enzymatic cleavage
  • PCR-SSCP single-strand conformation polymorphism
  • MRD mismatch repair detection
  • BeadArrayTM detection
  • the invention is also directed to a kit comprising a probe or primer that distinguishes an allele of a SNP in an Srp9 gene in a sample derived from a subject, wherein the allele is selected from the A or G allele in the SNP rs12403575.
  • Said kit is preferably for determining an increased risk of developing febrile seizures, complex febrile seizures, complex epilepsy syndromes including FS, such as Dravet's Syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy in a subject.
  • the probe or primer is not specifically limited in the context of the invention as long as it is capable of distinguishing between the two alleles in the respective SNPs.
  • the probe or primer can be further detectably labelled, such as by fluorescence or detectable materials, such as radioactive materials, chemiluminescence, biotin, or the like.
  • the kit may further comprise a polymerase, deoxynucleotides, a restriction enzyme, a buffer, or the like for detection.
  • An electronic hardware component such as arrays (DNA chips), microfluidic systems ("lab-on-a-chip” systems) and so on may also be used for the detection.
  • the kit may further comprise means for determining the amount of a target nucleic acid, and means for comparing the amount with a standard, and may comprise instructions for using the kit to detect the SNP-containing nucleic acid molecule of interest.
  • the invention further provides for a method for identifying a subject at risk of developing febrile seizures, complex febrile seizures, complex epilepsy syndromes including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy, said method comprising the steps of: a) determining in a sample of a subject the sequence of the Srp9 promoter sequence, wherein the presence of one or more de novo mutations is indicative of a risk of developing febrile seizures, complex febrile seizures, complex epilepsy syndromes including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
  • FS such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy
  • the present inventors found that in a control population of humans de novo mutations in the Srp9 promoter sequence were very rare and infrequent. In contrast, de novo mutations in the Srp9 promoter sequence were frequent. This led the present inventors to conclude that the presence of one or more de novo mutation(s) in the Srp9 promoter sequence of a subject was indicative of a propensity to develop febrile seizures, and would have to lead to a decision to investigate further whether the subject had an increased risk of developing febrile seizures.
  • the present invention relates to a method for screening chemical compounds or compositions, said method comprising the step of identifying chemical compounds or compositions targeting the SRP complex, and in particular the SRP9/SRP14 complex.
  • the present invention deals with a method for screening chemical compounds or compositions interfering with the function of the SRP complex, said method comprising the step of identifying chemical compounds or compositions that suppress expression of SRP9 and/or SRP14 polypeptide, that interact with SRP9 and/or SRP14 polypeptide and thereby prevent formation of the SRP9/SRP14 complex, and/or that interact with the SRP9/SRP14 complex and thereby prevent formation of the SRP complex.
  • compounds can be tested on their efficacy to interfere with SRP- mediated translation arrest and/or transport into the endoplasmic reticulum in cell culture.
  • Such studies can be performed in cell systems using known membrane receptor (such as glutamate receptors) proteins as indicators.
  • the method may comprise the steps of: providing a cell or cell line; exposing said cell or cell line to a chemical compound or composition to be tested; determining the level of a selected membrane protein in the endoplasmatic reticulum and/or cell membrane of said exposed cell or cell line; comparing the level of said selected membrane protein in the endoplasmatic reticulum and/or cell membrane of said exposed cell or cell line with the level of said selected membrane protein in the endoplasmatic reticulum and/or cell membrane of the same cell or cell line that has not been contacted with the chemical compound or composition to be tested; in which a decreased level of said selected membrane protein after exposure to said chemical compound or composition is indicative of the chemical compound or composition interfering with the function of the SRP, in particular the SRP9/SRP14 complex.
  • the cell or cell line may be any eukaryotic cell line.
  • the membrane protein may be any protein, and may optionally be labelled, for example, using green fluorescent protein.
  • the chemical compound or composition to be tested may be any chemical compound or composition, such as those contained in a combinatorial library.
  • the invention also pertains to a compound capable of selectively binding to SRP9 and/or SRP14 polypeptide for use as a medicament.
  • the compound may be an antibody, or a peptide selectively binding to SRP9 and/or SRP14 polypeptide.
  • said compound is for use in preventing and/or treating febrile seizures, complex febrile seizures, complex epilepsy syndromes including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
  • said compound blocks the formation of the SRP9/SRP14 complex.
  • the compound such as antibody
  • said method comprises the step of identifying chemical compounds or compositions targeting the SRP9/14 heterodimer (herein also referred to as "SRP9/SRP14 complex").
  • the present invention provides for use of therapeutic gene modulation for suppressing the level of SRP9 protein and/or SRP14 protein in a mammal.
  • Gene modulation may be directed at suppressing or down-regulating expression of the Srp9 gene (modulation at transcriptional level), or at inhibiting or preventing Srp9 mRNA from being translated into SRP9 protein (modulation at translational level).
  • Said use is preferably for preventing and/or treating febrile seizures, complex febrile seizures, a complex epilepsy syndrome such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
  • RNA interference is a naturally occurring mechanism for suppressing gene expression and subsequent protein translation. RNA interference suppresses protein translation by either degrading the mRNA before it can be translated or by binding the mRNA and directly preventing its translation. Generally, RNAi has been used to suppress the expression of both gene alleles that lead to the production of a given protein. It is also possible to suppress the expression of only one allele.
  • the present invention relates to an Srp9 and/or Srp14 nucleic acid modulator selected from the group consisting of antisense DNA, siRNA, miRNA, shRNA, ribozyme specifically binding to and cleaving Srp9 and/or Srp14 mRNA and zinc finger nuclease specifically targeting a nucleic acid sequence in the Srp9 and/or Srp14 gene resulting in suppression of Srp9 and/or Srp14 expression, for use in preventing and/or treating febrile seizures, complex febrile seizures, complex epilepsy syndromes including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
  • FS such as Dravet's syndrome and epilepsies with mental retardation
  • temporal lobe epilepsy such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
  • the invention is concerned with a recombinant nucleic acid construct comprising at least one transcriptional unit comprising:
  • Srp14 mRNA a nucleic acid sequence encoding a zinc finger nuclease specifically targeting a nucleic acid sequence in the Srp9 gene and/or Srp14 gene;
  • nucleic acid sequence encoding a ribozyme specifically binding to and cleaving Srp9 and/or Srp14 mRNA
  • FS complex febrile seizures
  • epilepsy syndromes including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
  • the interfering RNA molecule may be selected from the group consisting of siRNA, miRNA and shRNA.
  • the present invention also pertains to a vector comprising a recombinant nucleic acid construct according to the invention for use in preventing and/or treating febrile seizures, complex febrile seizures, a complex epilepsy syndrome such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
  • Said vector may comprise more than one transcriptional unit.
  • the invention is directed to a (host) cell comprising a recombinant nucleic acid construct according to the invention or a vector according to the invention for use in preventing and/or treating febrile seizures, complex febrile seizures, complex epilepsy syndromes including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
  • a (host) cell comprising a recombinant nucleic acid construct according to the invention or a vector according to the invention for use in preventing and/or treating febrile seizures, complex febrile seizures, complex epilepsy syndromes including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
  • the to Srp9 and/or Srp14 nucleic acid modulator, recombinant nucleic acid construct, vector, host cell of the present invention are administered to a subject in need thereof in an effective amount to achieve the purpose of preventing and/or treating febrile seizures, complex febrile seizures, complex epilepsy syndromes including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
  • FS such as Dravet's syndrome and epilepsies with mental retardation
  • temporal lobe epilepsy such as Dravet's syndrome and epilepsies with mental retardation
  • the present invention provides for a method for suppressing the level of SRP9 protein and/or SRP14 protein in a cell, said method comprising the step of including an Srp9 and/or Srp14 nucleic acid modulator according to the invention or recombinant nucleic acid construct according to the invention in said cell.
  • the present invention provides for a kit comprising means for detecting the level of Srp9 mRNA and/or SRP9 protein and/or Srp14 mRNA and/or SRP14 protein in a sample derived from a subject.
  • the kit is for use in identifying a subject at risk of developing febrile seizures (FS), a subject at risk of developing complex FS, a subject at risk of developing a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or a subject at risk of developing temporal lobe epilepsy.
  • FS febrile seizures
  • a subject at risk of developing complex FS a subject at risk of developing a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation
  • a subject at risk of developing temporal lobe epilepsy such as Dravet's syndrome and epilepsies with mental retardation
  • the kit may comprise a primer pair allowing selective amplification of Srp9 and/or Srp14 mRNA, or a fragment thereof. Selective amplification denotes that only (part of) the Srp9 and/or Srp14 mRNA is amplified using said primer pair.
  • the kit may comprise an antibody that specifically binds to SRP9 protein and/or SRP14 protein.
  • the kit of the present invention is preferably for determining the level of Srp9 mRNA, SRP9 protein, Srp14 mRNA and/or SRP14 protein in a sample derived from blood.
  • SEQ ID NO:1 depicts the nucleic acid sequence of the Srp9 gene in C57BL/6J mice.
  • SEQ ID NO:2 depicts the nucleic acid sequence of the Srp9 gene in A J and CSS1 mice.
  • SEQ ID NO:3 depicts the nucleic acid sequence of the Srp9 gene in human.
  • SEQ ID NO:4 depicts the nucleic acid sequence of the Srp14 gene in human.
  • SEQ ID NO:5 depicts the amino acid sequence of the SRP9 protein in human.
  • SEQ ID NO:6 depicts the amino acid sequence of the SRP14 protein in human.
  • Example 1 Identification of Srp9 as a susceptibility gene in febrile seizures and TLE.
  • C57BL/6J and C57BL/6J-Chr 1A NaJ mice were obtained from The Jackson Laboratory (Bar Harbor, ME, USA).
  • We generated a CSS1 -F2 by intercrossing F1 hybrid animals from a (reciprocal) outcross between CSS1 and C57BL/6J (n 129; 28 males and 31 females; 36 males and 34 females originating from CSS1 and C57BL/6J mothers, respectively), which was pheno- and genotyped. All experimental procedures were approved by the ethical committee of Utrecht University.
  • FS susceptibility assay were approved by the ethical committee of Utrecht University.
  • FS susceptibility was determined by inducing hyperthermia in 14-day-old pups by exposure to a warm-air stream and measuring the latency to tonic-clonic seizures (FSL) (Hessel et al., Genes, Brain and Behavior 8, 248-255, 2009). Video/EEG monitoring has proven that the onset of these seizures coincides with FSL to be the most reliable behavioural correlate of the latency to spike-wave discharges in the brain.
  • FSL tonic-clonic seizures
  • Map construction was performed as described earlier (Cox et al., Genetics 182, 1335-1344, 2009). None of the individual markers showed a segregation ratio distortion (P>0.05) in the chi-squared goodness-of-fit-test (AA:AB:BB ratio 1 :2:1 ). Data were tested for normal distribution and transformed where appropriate. QTL location and variance explained by each locus was determined using MapQTL (version 4.0). LOD scores>1 .65 were considered significant.
  • Radioactive in situ hybridization was performed as described (van der Hel et al., Epilepsia 50, 1717-1728, 2009) and transcript levels were expressed as nCi/g33.
  • Sense and antisense probes were synthesized using mouse RNA as a template (Primers, Table 2) (Sigma Aldrich Chemie BV, Zwijndrecht, The Netherlands). Hybridization was quantified with ImageJ (version 1 .4.0).
  • ip intraperitoneally
  • Hippocampal and neocortical tissue was obtained from pharmacoresistant mTLE patients with complex partial seizures who had surgical resective treatment.
  • Hippocampal tissue from autopsy controls was obtained from the Netherlands Brain Bank. Selection of patients (for clinical data see Table 3), collection and processing of tissue for qPCR analysis was as described (van Gassen et al., Epilepsia 49, 1055-1065, 2008).
  • qPCR was performed as described earlier (van Gassen et al., Epilepsia 49, 1055-1065, 2008).
  • Primers for SRP9, SRP68 and two reference genes, PSMD2 and DDX48 were from Sigma Genosys (Cambridge, U.K.).
  • srp9-4-2 AGGAAACAGCTATGACCATTTTCTGTCCCAACACTTTCTC 486 rs12403575 GAGGGTGGCCAGTGGCCTCAAATAC GAGGGTGGCCAGTGGCCTCAAATAC
  • QTL1 interval harboured 22 brain-expressed genes and accounted for 23.9% of the variance in FS susceptibility in the CSS1 -F2 population.
  • the heterozygous genotype showed a phenotype intermediate between the two homozygous genotypes, indicating an additive mode of inheritance at this QTL).
  • Fig. 2A brain-expressed candidate genes based on known SNPs differences and differential gene expression (http://www.genenetwork.org/) between the A/J and C57BL/6J (Fig. 2A). Only for Srp9 we found lower expression in CSS1 compared to C57BL/6J (total brain -23.1 %; hippocampus - 35.6%) (Fig. 2B). Sequencing of Srp9 (184,053,433 - 184,063,607 bp) in C57BL/6J, CSS1 and A/J mice identified 1 new SNP in the 3'UTR and 52 polymorphisms in intronic and promoter regions.
  • SRP14 forms a functional heterodimer with SRP9 in the SRP complex, which in total comprises 6 proteins. This observation, combined with the differential expression of Srp9, prompted us to prompted us to select Srp9 for further study.
  • Srp9 antisense (AS) oligonucleotides intracerebroventricularly (ICV) in C57BL/6J pups 20 hours prior to inducing hyperthermia This significantly prolonged FSL in C57BL/6J (899.0 ⁇ 77.7 s) compared with scrambled oligonucleotide injected littermates (574.0 ⁇ 23.5 s) (Fig. 3A) and was accompanied by a down-regulation (-16.7%) of Srp9 transcript levels in the cortex.
  • Srp9 down-regulation in vivo decreased FS susceptibility and induced the CSS1 FS phenotype in C57BL/6J, providing strong evidence for a functional role of Srp9 in FS susceptibility in mice.
  • SRP9 is part of the SRP complex, which couples the cytoplasmic protein synthesis machinery to the membrane-bound protein translocation machinery of the endoplasmic reticulum (ER).
  • ER endoplasmic reticulum
  • SRP9 is a subunit of SRP, a ubiquitous, highly conserved cytoplasmic ribonucleoprotein complex that plays a key role in targeting nascent membrane and secretory proteins to the rough ER membrane (Walter and Blobel, Federation Proceedings 40, 1557, 1981 ).
  • SRP consists of six polypeptides and one RNA (7SL) together forming two functional domains, the S-domain primarily involved in recognition of the signal sequence of nascent peptide chains, and the ALU domain (7SL RNA and the SRP9/SRP14 heterodimer) thought to be responsible for elongation arrest facilitating targeting of nascent chains to the ER.
  • SRP lacking SRP9/14 lacks elongation arrest activity, but is still translocation competent, albeit, at lower efficiency.
  • our data implicate ER-dependent protein synthesis in FS susceptibility.
  • SRP9 conveys its effect on FS susceptibility needs to be further investigated. Presumably loss of SRP9 from the SRP complex leads to loss of elongation arrest and decreased translocation efficiency due to the strict time dependence of the functional interaction between polysome and microsomal membrane. Therefore, reduced SRP9 levels could affect the amount and/or composition of proteins targeted to the ER, thus affecting secretion, plasticity and cell growth. Fever and FS, but also other risk factors for mTLE, such as viral infection, stroke or head trauma, are known to disrupt ER function and trigger the ER stress response. ER stress has been implicated in the pathogenesis of various other neurological degeneration syndromes including mTLE, Alzheimer's and Parkinson's disease.
  • susceptibility to FS is, at least in part, determined by susceptibility to increased body temperature (without an infection).
  • SRP9-mediated changes in FS susceptibility involve temperature-induced changes in ER function and protein trafficking.
  • the identification of SRP9 as FS susceptibility gene implicates (local) ER- dependent protein synthesis as key factor in FS susceptibility and opens new possibilities for early diagnosis and treatment of FS.
  • the Srp9 sequence of A J and CSS1 were identical.
  • a J/CSS1 and C57BL/6J differences are in parentheses (with the nucleotide(s) present in the Srp9 gene of C57BL/6J being indicated before the slash and the the nucleotide(s) present in the Srp9 gene of A J/CSS1 being indicated after the slash).
  • the exon region is in bold. Newly identified polymorphisms are in bold and underlined (known polymorphisms are available on http://www.ensembl.org).
  • the 210 bp underlined promoter region in bold was not present in the A/J/CSS1 :
  • AAAG ( /A) AAG AAG AAAG AAAAAG ( /AAAAAG A) AAAAAG AAAAAG ATAGGGAA
  • Example 2 Evidence supporting a role of Srp14 in the susceptibility for febrile seizures.
  • Phenotypic screen for eFS experimental febrile seizure susceptibility.
  • a temperature sensitive transponder IPTT-300, (BioMedic Data Systems) Plexx BV, Elst, The Netherlands
  • IPTT-300 thermosensitive transponder
  • P14 individual pups (weighing 6.5 - 8.0 gram) were exposed to a pre-heated warm-air stream of 50 ⁇ 0.5 °C until they develop FSL.
  • Core body temperature was measured with a wireless temperature reader (WRS-6007, (BioMedic Data Systems), Plexx BV) throughout the experiment. Mice were immediately sacrificed after hyperthermia and tail, spleen and brain were collected for genotyping. All experiments were performed between 10:00 a.m. - 4:00 p.m.
  • DNA was isolated from tails as described by Kas et al. (Genes Brain and Behavior 98, 13-22, 2009). DNA concentration was measured on agarose gel and diluted to 10 ng/ ⁇ . To generate a genetic map fifteen microsatellite markers distributed over chromosome 2 were chosen from the mouse genome database based on the presence of allelic differences between the A J and C57BL/6J inbred strains (Mouse Genome Informatics, http:/7www.informatics.jax.Oi"9). Microsatellite marker genotyping (Williams et al., 2001 ) was performed by PCR.
  • the two SNP markers were selected using Genenetwork (http://www.genenetwork.org/): rs27498297 and rs27434812.
  • Primers (Taqman SNP genotyping Assay, Applied Biosystems, USA) were used to amplify the DNA (10 ng/reaction) using TaqMan Universal PCR Master Mix, Applied Biosystems, USA.
  • SNP analyses were done with a sequence detection system (7900HT, Applied Biosystems, Foster City, CA, USA). Segregation ratio of the genotypes of individual markers was checked by means of the Chi-squared goodness-of-fit-test.
  • the phenotypic characteristics of C57BL/6J and CSS2 mice were normally distributed and subjected to a two-way analysis of variance (ANOVA) with strain and gender as main factors.
  • a Type IV sum of squares was used for the ANOVA since the data were unbalanced. unbalanced.
  • Homoscedasticity was tested using the Levene's test, which is a powerful and robust test based on the F statistic. If the ANOVA showed significant effects the group means were further compared with the unpaired Student's f test.
  • the unpaired Student's f tests were performed using pooled (for equal variances) or separate (for unequal variances) variance estimates. The equality of variances was tested with the Levene's test. For the unpaired Student's f test with separate variance estimates, SPSS® uses the Welch- Satterthwaite correction.
  • Radioactive in situ hybridization was performed as described (van der Hel et al., Genes Brain and Behaviour 8, 248-255, 2009).
  • Coronal (16 ⁇ " ⁇ ) sections were cut with a cryostat (Leica CM3050, Rijswijk, The Netherlands), collected on glass slides (Superfrost Plus, Thermo Scientific, Braunschweig, Germany) and stored at -80°C.
  • Sense and antisense probes for Srp14 were synthesized using mouse cDNA as a template.
  • the primers were designed using the mRNA sequence of Srp14 provided by the PubMed nucleotide database (http://www.ncbi.nlm.nih.gov/pubmed; NM_009273.4) and the online Primer3 program (http://frodo.wi.mit.edu/primer3/input.htm): forward primer: 5' G AGAG CG AG CAGTTC CTG AC 3' and reverse primer: 3' G C C AC AC AG C AC AAATC AAA 5'. DNA sequences were confirmed by sequencing, and used for the preparation of the probe (BaseClear (Leiden, the Netherlands). Partial cDNA was inserted in a p-GemT easy vector and verified by digestion with restriction enzyme NC01 . Riboprobes were synthesized using T7 and SP6 RNA polymerase and labeled with [a- 33 P] UTP (ICN Biomedicals, Irvine, CA, USA).
  • Hippocampal and neocortical tissue used for qPCR analysis was obtained from patients who had surgical treatment for pharmaco-resistant TLE (van der Hel et al., 2005). Patient details are summarized in supplementary table 3. Informed and written consent was obtained from the patients for all procedures as approved by the Institutional Review Board.
  • RNA expression was studied in human brain homogenates. Extracted RNA was DNAse treated with RNeasy mini kit (Qiagen, Valencia, CA). cDNA was synthesized with superscript 2. The qPCR reaction was performed using the LightCycler (Roche, Almere, NL) and the Fast Start DNA Master PLUS SYBRgreen I kit (Roche). Primer (Sigma Genosys, Cambridge, U.K.) Forward primer: 5' AG G GTACTGTG G AG G G CTTT 3'; Reverse primer: 3' CTGTTGTTGGTGCTGTTGCT 5'.
  • Gene expression was calculated as normalized ratio and normalized to two reference genes. cDNA from the common reference pool was used for calibration.
  • the reference genes Proteasome 26S subunit, non-ATPase, 2 (PSMD2) and DEAD (Asp-Glu-Ala-Asp) box polypeptide 48 (DDX48)) were selected because of their housekeeping function and their microarray expression strength and stability (van Gassen et al., Epilepsia 49, 1055-1065, 2008). All samples were analyzed in duplicate and reported as mean ⁇ standard error of the mean (SEM). Both reference genes gave similar results.
  • the 1 -LOD support interval of QTL2a was 52,581 ,428 - 66,278,629 bp.
  • QTL2b (LOD score 6.8) was responsible for 19.8% of the F 2 phenotypic variance and the effect is also recessive for the A J grandparent's allele.
  • the 1 -LOD support interval for QTL2b was 1 14,875,854 - 133,817,501 bp (fig. 6b).
  • One way ANOVA was performed for each marker and genotype. Taking body weight parent of origin or gender as covariate did not effect the 1 -LOD scores significantly (data not shown).
  • the 1 -LOD support interval of QTL2b contains 273 genes (excluding 65 predicted (GM) genes) of which 165 are known to be expressed in brain.
  • the number of potential candidate genes in QTL2b can be reduced to 1 14, of which 49 are brain expressed.
  • the most interesting of these 49 brain expressed genes are ⁇ 1 ⁇ and Srp14.
  • 111 ⁇ (129.190.306-129.196.875 bp) has previously been associated with FS in mouse (Dube et al., Ann. Neurol 57, 152-155, 2005) and human (Virta et al., Epilepsia 42, 9320-923, 2002; , Kira et al., Neurosci.Lett. 384, 239-244, 2005). No known SNP or haplotype differences were found for 111 ⁇ between CSS2 and C57BL/6J.
  • the second interesting candidate gene in QTL2b is Srp (1 18301579..1 18305432).
  • SRP14 is part of the ubiquitous signal recognition particle (SRP) and forms a heterodimer with SRP9.
  • the Srp9 gene is a functional and positional eFS susceptibility gene as identified above after QTL mapping on chromosome 1 ; Srp9 shows differential expression between CSS1 and C57BL/6J (Hessel et al., example 1 ).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Described is the use of the Srp9 gene and/or Srp14 gene and/or SRP9 polypeptide and/or SRP14 polypeptide as a diagnostic marker, in particular for febrile seizures, complex febrile seizures, for complex epilepsy syndromes including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or for temporal lobe epilepsy. Additionally, the genes and/or polypeptides may be used for identifying subjects at risk of developing febrile seizures. The invention further provides for kits for identifying subjects at risk of developing febrile seizures and methods of preventing and/or treating febrile seizures, as well as compounds suitable for these purposes.

Description

Title: Markers of febrile seizures and temporal lobe epilepsy
Field of the invention
The present invention is in the field of medicine, more particular in the field of neurosciences. It relates to early diagnostic markers for febrile seizures and diseases and conditions associated herewith such as complex epilepsy syndromes such as Dravet's Syndrome, epilepsies with mental retardation, and temporal lobe epilepsy, and methods of diagnosis using such markers. It also relates to a method for preventing and/or treating such febrile seizures and diseases and conditions associated therewith using gene modulation therapy, such as RNA interference. Finally, the invention provides for kits suitable for identifying a subject at risk of developing febrile seizures and diseases and conditions associated therewith.
Background
A febrile seizure (FS), also known as a fever fit or febrile convulsion, is a convulsion associated with a significant rise in body temperature. According to the I LEA it is defined as a seizure occurring in childhood after 6 months of age, associated with a febrile illness not caused by an infection of the central nervous system, without previous neonatal seizures or a previous unprovoked seizure, and not meeting criteria for other acute symptomatic seizures (1993). They most commonly occur in children between the ages of 6 months and 5 years.
There are two types of febrile seizures: simple febrile seizures (also referred to as
"febrile seizure") and complex febrile seizures. A simple FS lasts less than 15 minutes, does not recur in 24 hours, and involves the entire body (classically a generalized tonic-clonic seizure). On the other hand, complex or prolonged FS last more than 15 minutes, are often recurrent, and increase the risk of developing temporal lobe epilepsy (TLE) in later life. Thirty to 50% of patients with TLE have a history of prolonged FS during childhood (French et al. 1993 Annals of Neurology 34, 774-780). Complex FS maybe part of more complex epilepsy syndromes, such as for instance Generalised Epilepsy with FS (GEFS+).
Genetic factors are known to play an important role in determining FS susceptibility. About 25% of children experiencing FS have a positive family history and concordance for FS in monozygotic twins is about 40% compared to 10% for dizygous twins. Several mutations have been identified in families with complex epilepsy syndromes with FS as a central feature, such as GEFS+, but the genetic factors involved in sporadic FS remain elusive.
To study the genetics of FS a rat model for hyperthermia induced seizures (Chen et al. 1999. Nat. Med. Vol. 5:888-894) was adapted to mice (Van Gassen et al. 2008. Genes Brain and Behav. Vol. 7:578-586) enabling large scale phenotypic screening of inbred strains for FS susceptibility. In this model, the rise in core-body temperature of mouse induces tonic- clonic seizures, the onset of which coincides with spike-wave discharges in the hippocampus. Recently, this mouse model was used in a phenotype driven screen for FS susceptibility employing the C57BL/6J-Chr#A/NaJ chromosome substitution panel. This panel has proven to be a powerful tool in detecting quantitive trait loci (QTLs) for complex traits (Singer et al., 2004. Science 304, 445-448; Mozhui et al. 2008. PloS Genet. Vol. 4, 1 1 ; eiooo26o ). Three chromosome substitution strains (CSS1 , -10 and -13) carrying a protective QTL and three (CSS2, -6 and -X) with a susceptibility QTL for experimental FS (Hessel et al. 2009. Genes Brain and Behav. Vol. 8: 248-2550) were identified.
Complex FS occur in childhood and are considered harmful for normal brain development. Complex FS increase the risk to develop hippocampal sclerosis and TLE about tenfold. The decision to treat complex FS with anti-epileptic drug is a difficult one, because the treatment per se may affect normal brain development. Thus, an early diagnosis of children with complex FS is of paramount importance for clinical practice.
Summary of the invention
In a first aspect, the present invention provides for the use of an SRP9 protein and/or an Srp9 nucleic acid sequence and/or an SRP14 protein and/or an Srp14 nucleic acid sequence as a diagnostic marker. Said diagnostic marker may be for febrile seizures, complex febrile seizures, for complex epilepsy syndromes including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or for temporal lobe epilepsy.
Also, the present invention relates to the use of an SRP9 protein and/or an Srp9 nucleic acid sequence and/or an SRP14 protein and/or an Srp14 nucleic acid sequence in identifying a subject at risk of developing febrile seizures (FS), a subject at risk of developing complex FS, a subject at risk of developing a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or a subject at risk of developing temporal lobe epilepsy.
The invention further pertains to a method for identifying a subject at risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy, said method comprising the steps of: a) providing a sample of a subject; b) subject; b) determining the level of at least one biomarker selected from SRP9 polypeptide, Srp9 mRNA, SRP14 protein and/or Srp14 mRNA in said sample; c) comparing the level of said biomarker to a reference level; and d) determining whether the level of said biomarker is indicative of a risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy. In an embodiment, said subject is an infant or child. Said sample may be selected from the group consisting of a whole blood sample, serum, and plasma. In an embodiment, an increased level of said biomarker is indicative of a risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
The present invention is further concerned with the use of a SNP in the promoter region of the Srp9 gene, said SNP being selected from the group consisting of rs6688819 (T/C), rs12403575 (G/A), rs16845266 (G/C), rs120398148 (T/C), and rs6659660 (G/A), for determining the risk in a subject of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy. Said SNP preferably is rs12403575 G/A.
The present invention is also directed to a method for identifying a subject at risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy, said method comprising the step of: a) determining in a sample of a subject a SNP in the promoter region of the Srp9 gene, wherein the SNP is selected from rs12403575 G/A, rs6688819 T/C, rs16845266 G/C, rs120398148 T/C, and rs6659660 G/A, and preferably is rs12403575 G/A. Said SNP preferably is rs12403575 G/A. In an embodiment, the A allele of rs12403575 G/A is associated with an increased risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy. In an embodiment, the genotype of said subject for rs12403575 is determined, and an AA genotype is associated with an increased risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy. Said method may further comprise the step of providing a sample of a subject. Said sample may comprise or may be derived from blood, an amniotic fluid, cerebrospinal fluid, tissue from skin, muscle, buccal or conjunctival mucosa, placenta, gastrointestinal tract or chorionic villi.
The invention also concerns a method for identifying a subject at risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy, said method comprising the steps of: a) determining in a sample of a subject the sequence of the Srp9 promoter sequence, wherein the presence of one or more de novo mutations is indicative of a risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
In a further aspect, the present invention relates to a kit comprising a probe or primer that distinguishes an allele of a SNP in a Srp9 gene in a sample from a subject, wherein the allele is selected from the A or G allele in the SNP rs12403575. Said kit may be for determining an increased risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy in a subject. The probe or primer may be detectably labelled.
In another aspect, the invention provides a method for screening chemical compounds or compositions interfering with the function of the SRP complex, said method comprising the step of identifying chemical compounds or compositions that suppress expression of SRP9 and/or SRP14 polypeptide, that interact with SRP9 and/or SRP14 polypeptide and thereby prevent formation of the SRP9/SRP14 complex, and/or that interact with the SRP9/SRP14 complex and thereby prevent formation of the SRP complex.
The invention also relates to a compound capable of selectively binding to SRP9 and/or SRP14 polypeptide, preferably an antibody capable of selectively binding to SRP9 and/or SRP14 polypeptide, for use as a medicament, such as for use in preventing and/or treating febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
In yet another aspect, the present invention is concerned with the use of therapeutic gene modulation for suppressing the level of SRP9 protein and/or SRP14 protein in a mammal, such as for preventing and/or treating febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
The invention also pertains to a Srp9 and/or Srp14 nucleic acid modulator selected from the group consisting of antisense DNA, siRNA, miRNA, shRNA, ribozyme specifically binding to and cleaving Srp9 and/or Srp14 mRNA and zinc finger nuclease specifically targeting a nucleic acid sequence in the Srp9 and/or Srp14 gene resulting in suppression of Srp9 and/or Srp14 expression for use in preventing and/or treating febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy. Further, the invention is directed to a recombinant nucleic acid construct comprising at least one transcriptional unit comprising: - a promoter; - a nucleic acid sequence encoding a gene suppressor selected from: - an antisense DNA sequence complementary to the sense strand of the Srp9 and/or Srp14 gene; - an interfering RNA molecule which is complementary to Srp9 mRNA and/or Srp14 mRNA; - a nucleic acid sequence encoding a zinc finger nuclease specifically targeting a nucleic acid sequence in the Srp9 gene and/or Srp14 gene; - a nucleic acid sequence encoding a ribozyme specifically binding to and cleaving Srp9 and/or Srp14 mRNA; and - a terminator, for use in preventing and/or treating febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
The invention further relates to a vector comprising a recombinant nucleic acid construct of the invention for use in preventing and/or treating febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy, which vector may comprise more than one transcriptional unit, as well as a cell comprising a recombinant nucleic acid construct or a vector of the invention for use in preventing and/or treating febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
The invention further includes a method for suppressing the level of SRP9 protein and/or SRP14 protein in a cell, said method comprising the step of including an Srp9 and/or Srp14 nucleic acid modulator of the invention or recombinant nucleic acid construct of the invention in said cell.
Finally, the present invention provides for a kit comprising means for detecting the level of Srp9 mRNA and/or SRP9 protein and/or Srp mRNA and/or SRP14 protein in a sample derived from a subject. Said kit may be for use in identifying a subject at risk of developing febrile seizures (FS), a subject at risk of developing complex FS, a subject at risk of developing a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or a subject at risk of developing temporal lobe epilepsy. The kit may comprise a primer pair allowing selective amplification of Srp9 and/or Srp14 mRNA, or an antibody that specifically binds to SRP9 protein and/or SRP14 protein. Said sample derived from a subject may be a blood sample or a sample derived from blood.
Figures and Drawings
Figure 1 shows FS QTL mapping on chromosome 1 . A) The FSL (s) of CSS1 (n=9; 915.3±37.5 s) is significantly longer than of C57BL/6J (n=9; 631 .9±26.9 s) mice (FStrain (1 ,14)=1 1.355, P<0.001,) showing that CSS1 is less susceptible to FS. No sex differences were found in either strain (Fgender (1 ,14)=0.736, P=0.406, interaction effect, interaction (1 ,14)=0.104, P=0.752). Strains did not differ in core body-temperature increase during hyperthermia (time F(1 ,14)=1478.191 , P=0.0001 ; timexstrain F(1 ,14)=0.715, P=0.51 1 ). Data are expressed as means ± SEM. *significantly different P<0.05. B) Frequency histogram of FS latencies of CSS1 -F2 progeny (n=129) shows that, as expected, the majority of these genetically unique CSS1 -F2 mice have a longer FSL than C57BL/6J (black bar is C57BL/6J average). C) QTL1 (rs31997386, LOD=7.8) located at 183,756,349-187,980,365 bp (1 -LOD support interval) accounts for 23.9% of the phenotypic variance. No sex or (grand) parent of origin differences in FSL were observed for QTL mapping.
Figure 2 shows brain Srp9 mRNA expression in CSS1 is lower than in C57BL/6J. A)
In situ hybridization of hippocampal gene expression (nCi/g) of candidate genes (Table 1 below) in QTL1 in CSS1 (n=6) and C57BL/6J mice (n=6). Data are expressed as means ± SEM *P<0.006 was considered as significant after multiple testing correction. B) Quantification shows a significant (t10=5.090, P=0.001 ) decrease in Srp9 expression in CSS1 (78.7±7.0 nCi/g; right) compared to C57BL/6J (122.3±4.5 nCi/g; left).
Figure 3 shows that down-regulation of Srp9 mRNA in C57BL/6J in vivo reduces FS susceptibility. A) ICV injection of Srp9 antisense oligonucleotide (AS Srp9) probe in C57BL/6J pups 20 hours prior to hyperthermia significantly (t10=-3.41 1 , P=0.007) prolonged FSL (s) in C57BL/6J (n=7; 899.0±77.7 s) mice compared to scrambled (Scr) probe injected littermate controls (n=5; 574.0±23.5 s). This in vivo treatment resulted in down-regulation of Srp9 transcript levels (-16.7%; t10=2.533, P=0.032) in the cortex compared to controls. B) IP injection of cycloheximide (CHX, n=9; 769.1 ±41 .1 s) 20 min prior to hyperthermia delayed FSL (t16=-2.141 , P=0.048) compared to vehicle controls (n=9; 662.6±28.0 s). IP injection of rapamycin (RAP, n=9; 708.1 ±35.9 s) 30 min prior to hyperthermia delayed FSL (t16—2.700, P=0.018) compared to controls (n=9; 591 .9±1 1 .4s). Data are expressed as means ± SEM; *significantly different P<0.05. ICV and IP injections did not affect temperature curves during hyperthermia induction.
Figure 4 demonstrates SRP9 expression and sequencing in mTLE patients with and without FS. A) SRP9 mRNA levels (normalized qPCR data: Rn) in hippocampal homogenates of autopsy control patients (n=5; Rn=40.4±6.1 ), mTLE patients without hippocampal sclerosis (non-HS; n=16; Rn=100.0±14.9) and mTLE patients with hippocampal sclerosis (HS; n=20; Rn=169.3±17.0) (F2,38=10.175, P=0.0001 ; non-HS vs HS: P=0.008; autopsy vs HS: P=0.001 ; Autopsy vs non-HS: P=0.240). SRP68 mRNA levels did not differ between non-HS and HS groups (autopsy Rn=38.7±7.8; non-HS Rn=100.0±5.4; HS Rn=1 13.7±1 1 .8; F2,13=18.601 , P=0.0001 ; non-HS vs HS: P=0.898). B) SRP9 mRNA levels in hippocampal homogenates of HS patients without (n=13; Rn=144.7±19.2) and with (n=7; Rn=215.0±26.8) FS (t18=2.150, P=0.045). Data are expressed as means ± SEM. *P<0.025 was considered as significant after multiple testing correction. C) Sequencing of SRP9 exons, intron/exon bounderies and promoter region (5 kb) in healthy controls (n=169), mTLE patients (n=368) and mTLE patients with FS (n=91 ) revealed a significant (P<0.01 bold) difference in allelic frequencies of one common promoter SNP (rs12403575 G/A) in mTLE patients. D) Further single SNP analysis using a larger control cohort (n=730) identified a significant association between rs12403575 and mTLE (P=0.01 , ODDS-ratio (OR)=1 .238) and mTLE+FS (P=0.045, ODDS-ratio=1 .321 ) E) Patients with AA genotype had a significantly (F(2,33)=4.096, P=0.026j higher hippocampal SRP9 expression (Rn=180.4±23.8) than patients with AG genotype (Rn=105.9±16.7, P=0.022). Data are expressed as means ± SEM. *significantly different P<0.05.
Figure 5 demonstrates that CSS2 mice are more susceptible to FS than C57BL/6J mice. A) febrile seizure latency (FSL) of C57BL/6J and CSS2 mice. B) C57BL/6J and CSS2 mice do not differ in the time course of temperature increase. Data are expressed as means ± SEM (n=9). * significantly different p<0.05.
Figure 6 represents FS QTL mapping on chromosome 2. QTL analysis was performed on n=144 CSS2-F2 mice. A) CSS2-F2 phenotypic histogram showing a right shift toward shorter FSL (black bar indicates C57BL/6J average). B) Identification of 2 FS QTLs on mouse chromosome 2. QTL2a (D2Mit156; LOD=3.6; 1 -LOD support interval 52,581 ,428- 66,278,629 bp), which is homologous to the human FEB3 locus, was responsible for 13.5% of the F2 phenotypic variance and the effect was recessive with respect to the A J grandparents allele. QTL2b (D2Mit277; LOD=6.2; 1 -LOD support interval 1 14,875,854- 133,817,501 bp) was responsible for 19.8% of the F2 phenotypic variance and the effect was also recessive for the A/J grandparents allele. 1 -LOD support intervals are indicated by the dotted lines. C) Standard genetic map of murine chromosome 2 showing positions of markers (Cox et al., Genetics 182, 1335-1344, 2008).
Figure 7 shows Srp14 mRNA expression levels in mouse and human hippocampus as determined by quantitative PCR. A) Hippocampal Srp14 expression is higher in CSS2 than in C57BL/6J mice. B) Hippocampal Srp14 expression is higher in TLE patients with hippocampal sclerosis (HS; n = 6) than in patients without hippocampal sclerosis (non-HS; n = 6) and autopsy controls (n = 7). Data are expressed as means ± SEM. * significantly different p < 0.02. Srp68 is another protein subunit of the SRP complex.
Figure 8 shows sequencing of the human SRP9 gene in TLE patients, FS patients and healthy controls. A) Known transcripts of the Srp9 gene. B) On top the known variants (available on the web). At the bottom the newly discovered variants in the human SRP9 gene gene detected in TLE patients (n>300), FS patients (n>300) and healthy controls (n>400). The amplicons represent the sequenced domains (black and gray bars).
Definitions
As used herein, the term "SRP9" refers to a SRP9 polypeptide, whereas "Srp9" refers to a Srp9 nucleic acid such as the Srp9 gene or Srp9 RNA, such as Srp9 mRNA. Similarly, the term "SRP14" refers to a SRP9 polypeptide, whereas "Srp14" refers to a Srp14 nucleic acid such as the Srp14 gene or Srp14 RNA, such as Srp14 mRNA. When one refers to the human Srp9 gene, reference may be made to "hSrp9", whereas the mouse Srp9 gene may be referred to as "mSrp9".
The term "complex epilepsy syndromes" as used in the context of the present invention refers to epilepsy syndromes with a variety of epileptic phenotypes, one of which is febrile seizures, preferably complex febrile seizures. The term includes, without limitation, Dravet's Syndrome, genetic epilepsy with febrile seizures plus (GEFS+), and epilepsies wiih mental retardation. The skilled person is well aware which diseases and conditions are encompassed by the term "complex epilepsy syndromes".
A "nucleic acid", "nucleic acid sequence", or "nucleotide sequence" according to the present invention may include any polymer or oligomer of pyrimidine and purine bases, preferably cytosine, thymine, and uracil, and adenine and guanine, respectively (See Albert L. Lehninger, Principles of Biochemistry, at 793-800 (Worth Pub. 1982) which is herein incorporated by reference in its entirety for all purposes). The present invention contemplates any deoxyribonucleotide, ribonucleotide or peptide nucleic acid component, and any chemical variants thereof, such as methylated, hydroxymethylated or glycosylated forms of these bases, and the like. The polymers or oligomers may be heterogenous or homogenous in composition, and may be isolated from naturally occurring sources or may be artificially or synthetically produced. In addition, the nucleic acids may be DNA or RNA, or a mixture thereof, and may exist permanently or transitionally in single-stranded or double-stranded form, including homoduplex, heteroduplex, and hybrid states.
The term "gene" means a DNA sequence comprising a region (transcribed region), which is transcribed into an RNA molecule (e.g. an mRNA) in a cell, operably linked to suitable regulatory regions (e.g. a promoter). A gene may thus comprise several untranslated operably linked sequences, such as a promoter, a 5' leader sequence comprising e.g. sequences involved in transcription initiation and regulation, a (protein) coding region (cDNA or genomic DNA) and a 3' non-translated sequence (3'UTR) comprising e.g. transcription termination and regulatory sites. As used herein, the term "promoter" refers to a nucleic acid sequence that functions to control the transcription of one or more genes, located upstream with respect to the direction of transcription of the transcription initiation site of the gene, and is structurally identified by the presence of a binding site for DNA-dependent RNA polymerase, transcription initiation sites and any other DNA sequences, including, but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to one of skill in the art to act directly or indirectly to regulate the amount of transcription from the promoter. Optionally the term "promoter" includes herein also the 5'UTR region (e.g. the promoter may herein include one or more parts upstream (5') of the translation initiation codon of a gene, as this region may have a role in regulating transcription and/or translation. A "constitutive" promoter is a promoter that is active in most tissues under most physiological and developmental conditions. An "inducible" promoter is a promoter that is physiologically (e.g. by external application of certain compounds) or developmental^ regulated. A "tissue specific" promoter is only active in specific types of tissues or cells. A "promoter active in plants or plant cells" refers to the general capability of the promoter to drive transcription within a plant or plant cell. It does not make any implications about the spatiotemporal activity of the promoter.
A "3' UTR" or "3' non-translated sequence" (also often referred to as 3' untranslated region, or 3'end) refers to the nucleic acid sequence found downstream of the coding sequence of a gene, which comprises for example a transcription termination site and (in most, but not all eukaryotic mRNAs) a polyadenylation signal (such as e.g. AAUAAA or variants thereof). After termination of transcription, the mRNA transcript may be cleaved downstream of the polyadenylation signal and a poly(A) tail may be added, which is involved in the transport of the mRNA to the cytoplasm (where translation takes place).
A "5' UTR" or "leader sequence" or "5' untranslated region" is a region of the mRNA transcript, and the corresponding DNA, between the +1 position where mRNA transcription begins and the translation start codon of the coding region (usually AUG on the mRNA or ATG on the DNA). The 5'UTR usually contains sites important for translation, mRNA stability and/or turnover, and other regulatory elements.
"Expression of a gene" refers to the process wherein a DNA region, which is operably linked to appropriate regulatory regions, particularly a promoter, is transcribed into an RNA, which is biologically active, i.e. which is capable of being translated into a biologically active protein or peptide (or active peptide fragment) or which is active itself (e.g. in posttranscriptional gene silencing or RNAi). An active protein in certain embodiments refers to a protein being constitutively active. The coding sequence is preferably in sense- orientation and encodes a desired, biologically active protein or peptide, or an active peptide fragment. In gene silencing approaches, the DNA sequence is preferably present in the form of an antisense DNA or an inverted repeat DNA, comprising a short sequence of the target gene in antisense or in sense and antisense orientation.
When reference is made to the "expression level" of a gene, the expression level is to be understood as the amount of RNA transcript that is transcribed by a gene and/or the amount of protein that may be translated from an RNA transcript, e.g. mRNA. Furthermore, in case the 3'UTR sequence is from a particular gene, the amount of Luciferase expression also correlates with the expression level of the particular gene. The amount of protein that may be translated from an RNA transcript may also be measured to determine the expression level of a gene. Methods are known in the art, such as ELISA and Western blot. Alternatively, the expression level of a protein may also be indirectly measured. For example, in case the expression level of an RNA transcription factor needs to be determined, a reporter gene construct may be used which comprises the RNA transcription factor binding site. The expression level may than be subsequently determined by measuring the reporter gene construct expression, e.g. in case GFP is used, green fluorescence intensity may be determined as a measure of the expression level of the RNA transcription factor.
A "nucleic acid construct" or "vector" is herein understood to mean a man-made nucleic acid molecule resulting from the use of recombinant DNA technology and which is used to deliver exogenous DNA into a host cell. Vectors usually comprise further genetic elements to facilitate their use in molecular cloning, such as e.g. selectable markers, multiple cloning sites and the like.
The term "polymorphism" refers to the presence of two or more variants of a nucleotide sequence in a population. A polymorphism may comprise one or more base changes, an insertion, a repeat, or a deletion. A polymorphism includes e.g. a simple sequence repeat (SSR) and a single nucleotide polymorphism (herein referred to as "SNP"), which is a variation, occurring when a single nucleotide: adenine (A), thymine (T), cytosine (C) or guanine (G) - is altered. A variation must generally occur in at least 1 % of the population to be considered a SNP. SNPs make up e.g. 90% of all human genetic variations, and occur every 100 to 300 bases along the human genome. Two of every three SNPs substitute Cytosine (C) with Thymine (T). Variations in the DNA sequences of e.g. humans or plants can affect how they handle diseases, bacteria, viruses, chemicals, drugs, etc.
As used herein, the term "allele(s)" means any of one or more alternative forms of a gene at a particular locus. In a diploid cell of an organism, alleles of a given gene are located at a specific location, or locus (loci plural) on a chromosome. One allele is present on each chromosome of the pair of homologous chromosomes. The term "de novo mutations" refers to mutations that occur spontaneously in a nucleotide sequence within the gene, which has not previously been reported.
"rs12403575" represents an internationally known coding system to identify each SNP in the dbSNP of the NCBI's Entrez system. The original database with additional information of the SNP rs number is available at the website of http://www.ncbi. nl.nih.gov/sites/entrez?db=snp. The rs number can also be queried in the Entrez database such as pubmed (http://www.ncbi.nlm.nih.gov/pubmed/) and GenBank (http://www.ncbi.nlm.nih.gov/). The SNP rs12403575 is located in the promoter of the Srp9 gene. The nucleotide at its position can be either adenine (A) or guanine (G). If adenine is present in SNP rs12403575, it is called the A allele when it is present in this polymorphism. If guanine is present in SNP rs12403575, it is called the G allele when it is present in this polymorphism. Since each individual has one pair of the same chromosome, each individual has the SNP rs12403575 genotype either AA, AG, or GG.
The term "primer" refers to an oligonucleotide complementary to a nucleic acid strand for initiating the nucleic acid synthesis in the presence of four nucleoside triphosphates, a polymerase and buffer in a hybridization condition. The term "probe" refers to an oligonucleotide that selectively hybridizes to a target nucleic acid under a suitable condition.
The terms "protein" or "polypeptide" are used interchangeably and refer to molecules consisting of a chain of amino acids, without reference to a specific mode of action, size, 3 dimensional structure or origin. A "fragment" or "portion" of a protein may thus still be referred to as a "protein". An "isolated protein" is used to refer to a protein which is no longer in its natural environment, for example in vitro or in a recombinant bacterial or plant host cell.
The term "antibody" used herein refers to any immunoglobulin or fragment thereof, and encompasses any polypeptide comprising an antigen-binding site with at least one complementarity determining region (CDR). The term includes, but is not limited to, polyclonal, monoclonal, monospecific, polyspecific, non-specific, humanized, chimeric, human, single-chain, synthetic, recombinant, hybrid, mutated, grafted and in vitro generated antibodies. The term "antibody" also includes antibody fragments such Fab, F(ab')2, Fv, scFv, Fd, dAb, and other antibody fragments or other constructs comprising CDRs that retain antigen-binding function. Typicallly, such fragments would comprise an antigen-binding domain. The details of the preparation of such antibodies are well known to those skilled in the art. The antibodies may be neutralizing antibodies. The term "neutralizing" refers to the ability of an antibody to inhibit (i.e., eliminate or reduce) at least one activity of another compound or molecule. The antibody or fragment thereof may be any of the known antibody isotypes and their conformations, for example, IgA, such as lgA1 or lgA2, IgD, IgE, IgG, such as lgG1 , lgG2a, lgG2b, lgG3, lgG4, or IgM class, or may constitute mixtures thereof in any thereof in any combination, such as a mixture of antibodies from the lgG1 and lgG2a class.
The antibody may display specific binding to SRP9 and/or SRP14. "Specific binding" of the antibody to SRP9 and/or SRP14 means that the protein and the antibody form a complex that is relatively stable under physiological conditions. Specific binding is characterized by a high affinity and a low to moderate capacity as distinguished from nonspecific binding which usually has a low affinity with a moderate to high capacity. Typically, binding is considered specific when the affinity constant Ka is higher than 106 M"1. If necessary, non-specific binding can be reduced without substantially affecting specific binding by varying the binding conditions in an in vitro test. In the present invention an antibody that specifically binds to SRP9 and/or SRP14 is an antibody in which SRP9 and/or SRP14 is the only target that is bound with high affinity, i.e. other polypeptides are not bound by said specific antibody or bound only with low affinity (non-specific binding).
As used herein, the term "effective amount" refers to a quantity sufficient to achieve a desired therapeutic and/or prophylactic effect, e.g., an amount which results in the treatment and/or prevention of, febrile seizures, complex febrile seizures, a complex epilepsy syndrome such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy. In the context of therapeutic or prophylactic applications, the amount of antibody administered to the subject will depend on the type and severity of the disease or condition and on the characteristics of the subject, such as general health, age, sex, body weight and tolerance to drugs. It will also depend on the degree, severity and type of disease or condition. The skilled artisan will be able to determine appropriate dosages depending on these and other factors. The antibody can also be administered in combination with one or more additional therapeutic compounds. For example, a "therapeutically effective amount" of the binding member is meant levels in which the physiological effects of a disease or condition associated with febrile seizures are, at a minimum, ameliorated. The skilled person will be capable of determining when such disease or condition has been treated and/or prevented.
As used in the context of the invention, the term "RNA interference" refers to a process of sequence-specific, post-transcriptional gene silencing (PTGS). RNA interference (RNAi) is a system within living cells that takes part in controlling which genes are active and how active they are. RNAs are the direct products of genes, and these small RNAs can bind to other specific RNAs (mRNA) and decrease their activity, for example by preventing a messenger RNA from producing a protein. RNA molecules capable of RNA interference include, without limitation, siRNA, shRNA, and miRNA.
In this document and in its claims, the verb "to comprise" and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition, the verb "to consist" may be replaced by "to consist essentially of" meaning that a composition of the invention may comprise additional component(s) than the ones specifically identified, said additional component(s) not altering the unique characteristics of the invention.
In addition, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article "a" or "an" thus usually means "at least one".
The terms "increased level" and "decreased level" as used throughout this document refers to a significantly increased level or significantly decreased level. Generally, a level in a test sample is increased or decreased when it is at least 5%, such as 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% higher or lower, respectively, than the corresponding level in a control sample or reference sample.
Detailed description of the invention
The present inventors mapped a FS susceptibility QTL on chromosome 1 by QTL analysis and showed differential expression of Srp9, a gene within this protective QTL which is part of the ubiquitous signal recognition particle (SRP) which is involved in regulating ER- dependent protein synthesis (secreted and membrane proteins). Partial knock-down of Srp9 expression in C57BL/6J mice in vivo significantly reduced FS susceptibility, thus identifying Srp9 as a new FS susceptibility gene in mouse. The Srp9 gene in the C57BL/6J and chromosome substitution strain 1 (CSS1 ) was sequenced. The sequence of the Srp9 gene in the C57BL/6J strain is set forth in SEQ I D NO:1 , whereas the Srp9 gene of the CSS1 strain is set forth in SEQ ID NO:2. The differences in sequences are depicted in Table 6 below. A deletion of approximately 200 bp in the promoter region was identified which most likely is responsible for the differential expression in the two mice strains.
In TLE patients with FS the inventors found increased hippocampal Srp9 mRNA levels compared to TLE patients without FS. These findings provide new insight into the genetics of FS and open new roads to the early diagnosis and treatment of complex FS and associated temporal lobe epilepsy.
In a cohort of 368 Dutch mTLE patients (compared to 730 healthy controls) an association was found of a single Srp9 promoter SNP (rs12403575 G/A) with FS and mTLE. Patients with AA genotype had a significantly higher hippocampal Srp9 expression than those with AG genotype, indicating that this SNP contributes to regulation of Srp9 expression. The human Srp9 gene sequence is set forth in SEQ ID NO:3. It was also found that in TLE patients the frequency of de novo mutations in the Srp9 promoter region was significantly higher than in the control population. It could be concluded that the presence of one or more de novo mutations in the Srp9 promoter indicated a propensity to develop FS in a subject.
The inventors further mapped 2 FS susceptibility QTLs to mouse chromosome 2 one of which (QTL2b) contains the Srp14 gene. SRP14 is the binding partner of SRP9 in the SRP complex and thus also involved in regulation of ER-dependent protein synthesis. Hippocampal Srp14 mRNA expression was found to be up-regulated in CSS2 mice compared to C57BL/6J and in TLE patients with hippocampal sclerosis (which have a high incidence of antecedent FS) compared to non-sclerotic TLE patients and autopsy controls. The human Srp14 gene sequence is set forth in SEQ ID NO:4.
In an aspect, the present invention relates to the use of an SRP9 protein and/or an Srp9 nucleic acid sequence and/or an SRP14 protein and/or an Srp14 nucleic acid sequence as a diagnostic marker. It was found that both the SRP9 polypeptide and Srp9 mRNA and/or both the SPR14 polypeptide and Srp14 mRNA could be used as diagnostic markers, particularly for diagnosing and/or identifying an increased risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome such as Dravet's Syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy (TLE; herein also referred to as "mesial temporal lobe epilepsy; "mTLE").
The nucleotide sequence of the human Srp9 gene sequence is set forth in SEQ ID
NO:3, whereas the amino acid sequence of human SRP9 polypeptide is set forth in SEQ I D NO:5. The nucleotide sequence of the human Srp14 gene sequence is set forth in SEQ ID NO:4. The amino acid sequence of human SRP14 polypeptide is set forth in SEQ ID NO:6. The nucleotide sequences of the human Srp9 and Srp14 genes and the amino acid sequences of the human SRP9 and SRP14 polypeptides can also be found in GenBank.
In another aspect, the present invention relates to use of an SRP9 protein and/or an Srp9 nucleic acid sequence and/or an SRP14 protein and/or an Srp14 nucleic acid sequence in identifying a subject at risk of developing febrile seizures (FS), a subject at risk of developing complex FS, a subject at risk of developing a complex epilepsy syndrome such as Dravet's Syndrome and epilepsies with mental retardation, and/or a subject at risk of developing temporal lobe epilepsy. In one embodiment of the invention, the subject is at increased risk of developing FS, complex FS, a complex epilepsy syndrome including FS, and/or TLE, preferably when compared to the risk of a healthy subject of developing these conditions and/or diseases.
In a further aspect, the present invention pertains to a method for identifying identifying a subject at risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's Syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy, said method comprising the steps of: a) providing a sample derived from a subject;
b) determining the level of at least one biomarker selected from SRP9 polypeptide, Srp9 mRNA, SRP14 polypeptide and/or Srp14 mRNA in said sample;
c) comparing the level of said biomarker to a reference level; and
d) determining whether the level of said biomarker is indicative of a risk of developing febrile seizure, complex febrile seizure, a complex epilepsy syndrome including FS, such as Dravet's Syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
In an embodiment, an increased level of said biomarker is indicative of a risk, preferably an increased risk, of developing febrile seizures, complex febrile seizures, and/or temporal lobe epilepsy. This method of the invention is preferably performed postnatally, such as in a child or infant. After establishing a risk of developing the conditions or diseases referred to herein, said subject may optionally be started on therapy capable of preventing febrile seizures, such as complex febrile seizures, and associated temporal lobe epilepsy, complex epilepsy syndrome including FS, such as Dravet's Syndrome and epilepsies with mental retardation.
In yet another aspect, the present invention is concerned with a method for identifying a subject at risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's Syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy, said method comprising the step of:
a) determining in a sample of a subject a SNP in the promoter region of the Srp9 gene, wherein the SNP is selected from rs12403575 G/A, said SNP being selected from the group consisting of rs6688819 (T/C), rs12403575 (G/A), rs16845266 (G/C), rs120398148 (T/C), and rs6659660 (G/A).
There are many methods for determining polymorphisms in the Srp9 gene. One of ordinary skill in the art will select the appropriate method and protocol to use. These and many other methods will be readily apparent to those of ordinary skill in the art.
In an embodiment, the A allele of rs12403575 G/A, is associated with an increased risk of developing febrile seizure, complex febrile seizure and/or temporal lobe epilepsy, whereas the G allele of rs12403575, is not. Thus the A allele of rs12403575 G/A may be considered the risk allele. The method may comprise a further step of providing a sample of a subject. The latter method is considered particularly suitable for prenatal screening purposes. Once the genotype of the allele has been established, the baby may be further screened after birth for SRP9/Srp9, e.g., in accordance with the methods taught herein, and may optionally be started on therapy capable of preventing febrile seizures, such as complex febrile seizures, and associated complex epilepsy syndromes, temporal lobe epilepsy and epilepsy and hippocampal sclerosis.
The method may also comprise the step of determined the genotype of said subject for SNP rs12403575, wherein an AA genotype is associated with an increased risk of developing FS, complex FS, complex epilepsy syndromes and/or TLE.
Other SNPs in the Srp9 gene as depicted in fig. 4C, which provides sequence data idenfying 5 promotor SNPs in the human Srp9 gene, may also be useful for identifying a subject at risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome such as Dravet's Syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy. Moreover, detection of de novo mutations in the Srp9 gene sequence, not found in the control population, may also be useful for identifying persons at risk for the above diseases and conditions. Thus, the present invention also provides for a method for identifying a subject at risk of developing febrile seizures, complex febrile seizures, complex epilepsy syndromes including FS, such as Dravet's Syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy, said method comprising the step of: a) determining in a sample of a subject a SNP in the Srp9 gene, wherein the SNP is selected from among those depicted in fig. 4C.
The method may further comprise a step of providing a sample derived from a subject. Preferably, the sample comprises or is derived from blood, amniotic fluid, cerebrospinal fluid, tissue from skin, muscle, buccal or conjunctival mucosa, placenta, gastrointestinal tract, or chorionic villi.
The risk of developing the above-referenced conditions may be increased for such subject, in particular compared to one or more healthy subjects. Healthy subjects as referred to herein do not suffer neurological disorders, particularly not from febrile seizures, and preferably have no positive family history of febrile seizures, complex febrile seizures and/or temporal lobe epilepsy. Preferably, a healthy subject does not suffer from any conditions or diseases.
The uses and methods of the invention encompass ex vivo (or in vitro) analyzing a sample derived from a subject for the level of one, two, three, or four of the biomarkers of the invention, SRP9 protein, Srp9 nucleic acid sequence, SRP14 protein and/or Srp14 nucleic acid sequence. The level of such biomarker or biomarkers may then be compared to a reference level. A reference level may be a level of said biomarkers or biomarkers in a healthy subject or may be a default reference level determined by taking the average level of said biomarker(s) of a plurality of healthy subjects. Preferably, the reference level is age- matched to the subject. It is not necessary to determine the level of said biomarker(s) each time a sample is measured; once the reference level of said biomarker(s) is reliably determined, the reference level may be stored, e.g., in a computer, and used for the comparative purposes herein set forth. Alternatively, the reference level may be known to the skilled physician and compared mentally. It is to be noted that the level of each biomarker is measured independently and compared to the reference level of the same biomarker in order to establish whether the level in said subject is increased, similar, or decreased. Moreover, SRP9 protein and/or Srp9 nucleic acid sequence may be used as a biomarker in the application of the present invention, SRP14 protein and/or Srp14 nucleic acid sequence may be used as a biomarker in the applications of the present invention, or one of SRP9 protein and Srp9 nucleic acid sequence and one of SRP14 protein and Srp14 nucleic acid sequence, or three or all of SRP9 protein and/or Srp9 nucleic acid sequence and/or SRP14 protein and/or Srp14 nucleic acid sequence may be used as biomarkers in the applications and uses of the present invention.
When SRP9 protein and/or Srp9 nucleic acid sequence is employed as a biomarker in the present invention, either levels of SRP9 polypeptide and/or levels of Srp9 mRNA may be determined. Measurement of the levels of either SRP9 polypeptide or Srp9 mRNA would suffice for the present invention. However, both of the levels of either SRP9 polypeptide and Srp9 mRNA could be measured for the purposes of the present invention. Similarly, when SRP14/Srp74 is employed as a biomarker in the present invention, either levels of SRP14 polypeptide and/or levels of Srp14 mRNA may be determined. Measurement of the levels of either SRP14 polypeptide or Srp14 mRNA would suffice for the present invention. However, both of the levels of either SRP14 polypeptide and Srp14 mRNA could be measured for the purposes of the present invention.
In the context of the invention, a subject may be an animal or a human being. In principle, any subject could be diagnosed using any of the methods or uses of the invention. The methods and uses of the invention may be applied as often as necessary in a subject. Preferably, the subject is a human being. In a suitable embodiment, the subject is an infant, such as in the ages of between about 1 day and about 8 years, for example about 2 months and about 7 years, or about 6 months and about 6 years. The subject may have a positive family history of febrile seizures, complex febrile seizures and/or temporal lobe epilepsy. Alternatively, the invention may be used for prenatal screening for a subject at risk of developing FS, complex FS, a complex epilepsy syndrome including FS, such as Dravet's Syndrome and epilepsies with mental retardation and/or TLE. Thus, the subject may also be a foetus.
The uses and methods of the invention are carried out ex vivo, i.e., on an ex vivo sample. Said sample may be any sample derived from a subject, but is preferably a biological sample. As used herein, a "biological sample" refers to a biological tissue or biological fluid from a subject. A variety of samples can be useful in practicing the invention including, for example, blood, amniotic fluid, cerebrospinal fluid, tissue or cells from skin, muscle, buccal or conjunctival mucosa, brain, placenta, gastrointestinal tract or chorionic villi. For prenatal screening purposes (using the genotyping method of the invention), the sample is preferably selected from amniotic fluid, tissue or cells from placenta and/or tissue or cells from chorionic villi. For postnatal screening purposes (using the levels of SRP polypeptide and/or Srp mRNA), the sample is preferably selected from a whole blood sample, plasma, and serum.
The difference in the level of said biomarkers in said sample compared to a reference level may be determined as the fold increase/decrease, or alternatively as the relative increase or decrease of biomarker in the sample of said subject as compared to biomarker in a reference level.
In the context of the invention, the level of proteins or polypeptides may be determined by methods well known in the art, e.g., using an enzyme immunoassay or western blotting. A number of monoclonal or polyclonal antibodies can be generated that specifically recognize SRP9 polypeptide or SRP14 polypeptide. Utilizing current antibody detection techniques that can quantitate the binding of monoclonal antibodies, one can determine the level or amount of said SRP9 or SRP14 polypeptide in a sample obtained from a subject.
The term "enzyme immunoassay" ("EIA"), also called enzyme-linked immunosorbent assay (ELISA), is a biochemical technique that is well known in the art. It is used mainly in immunology to detect the presence of an antibody or an antigen in a sample. In ELISA, an unknown amount of antigen is affixed to a surface, and then a specific antibody is washed over the surface so that it can bind to the antigen. This antibody is linked to an enzyme, and in the final step a substance is added that the enzyme can convert to some detectable signal. Thus in the case of fluorescence ELISA, when light of the appropriate wavelength is shone upon the sample, any antigen/antibody complexes will fluorescence so that the amount of antigen in the sample can be inferred through the magnitude of the fluorescence signal.
Performing an ELISA involves at least one antibody or other binding partners with high affinity for the biomarker with specificity for a particular antigen. The sample with an unknown amount of antigen may be immobilized on a solid support (for example, a polystyrene microtiter plate) either non-specifically (via adsorption to the surface) or specifically (via capture by another antibody specific to the same antigen, in a "sandwich" ELISA). After the antigen is immobilized the detection antibody is added, forming a complex with the antigen. The detection antibody can be covalently linked to an enzyme, or can itself be detected by a secondary antibody which is linked to an enzyme through bioconjugation. Between each step the plate is typically washed with a mild detergent solution to remove any proteins or antibodies that are not specifically bound. After the final wash step the plate is is developed by adding an enzymatic substrate to produce a visible signal, which indicates the quantity of antigen in the sample. The substrates may utilize chromogenic substrates, though fluorogenic substrates and chemoluminescent substrates are used more commonly as they enable higher sensitivity. For some of the biomarkers of the invention, monoclonal antibodies may be commercially available from various suppliers all of which may be successfully applied, taking into account the manufacturers recommendations for use.
Alternatively, the level of polypeptide biomarker or biomarkers may be determined using any other routine techniques known to the skilled person, including, but not limited to, capillary action, precipitation, turbidimetric, diffusion, agglutination, potentiometric, amperometric, piezoelectric and evanescent-wave immunosensors, or any combination of the methods recited herein.
The level of Srp9 or Srp14 mRNA may be determined using routine techniques, including, without limitation, hybridization, and amplification reactions such as quantitative PCR or LCR.
For clinical diagnostics the use of nucleic acid arrays is highly advantageous as it couples accuracy and speed to quantitative analysis. Nucleic acid arrays are ordered sequences of DNA or RNA that can be used to selectively isolate and later on quantify specific nucleic acid sequences in complex mixtures - by changing the hybridization and washing conditions the specificity of the detected nucleic acid duplexes can be modulated.
The oligonucleotide sequences used to detect a target sequence, whether on nucleic acid arrays or in solution, will be referred to hereinbelow as a "probe".
Suitable hybridisation conditions (i.e. buffers used, salt strength, temperature, duration) can be selected by the skilled person, on the basis of experience or optionally after some preliminary experiments. These conditions may vary, depending on factors such the size of the probes, the G+C-content of the probes and whether the probes are bound to an array as described below.
Suitable hybridisation conditions are for instance described in Sambrook et al., Molecular Cloning: A Laboratory manual, (1989) 2nd. Ed. Cold Spring Harbour, N.Y.; Berger and Kimmel, "Guide to Molecular Cloning Techniques", Methods in Enzymology", (1987), Volume 152, Academic Press Inc., San Diego, CA; Young and Davis (1983) Proc. Natl. Acad. Sci.(USA) 80: 1 194; Laboratory Techniques in Biochemistry and Molecular Biology, Vol.24, Hybridization with Nucleic Acid Probes, P. Thijssen, ed., Elsevier, N.Y. (1993).
The hybridisation conditions are preferably chosen such that each probe will only form a hybrid (duplex) with a target sequence with which the probe is essentially complementary, if such a target sequence is present, and otherwise will not form any hybrid. The term "essentially complementary" as used herein does not mean that the complementarity of a probe to a target target sequence should be perfect, and mismatches up to 2 nucleotides can be envisaged.
Each probe should at least in part be complementary to a specific target sequence. The probe may be any nucleic acid (i.e. DNA or RNA) but is preferably DNA. The probe will generally have a size of about 10 to 100 base pairs, preferably about 10 to 40 base pairs. The probes may all be of the same size, or may be of different sizes. The probes can be obtained in any suitable manner, e.g., using an automated DNA-synthesizer or in any other manner known per se. Also, solid phase nucleic acid synthesis techniques may be used, which may result directly in an array with the desired probes. Furthermore, the probes may be obtained using techniques of genetic engineering, for instance by primer extension using the target sequence as a template, and/or by using one or more restriction enzymes, optionally using amplification.
Also, the probes may comprise one or more "alternative nucleosides". Examples thereof include the bases Inosine (I) and Uracil (U), as well as dUTP and dITP, and these are included within the term "labeled nucleotide analog". It is to be understood that the presence of such alternative nucleosides does not prevent the probe and its target sequence to be essentially complementary to one another as defined above.
Quantitative nucleic acid-based amplification reactions may also be used to detect and quantify specific nucleic acid sequences in complex mixtures as in the present invention. These include the well known Polymerase Chain Reaction (PCR) and Ligase Chain Reaction (LCR) and modifications thereof (see McPherson & Moller, 2006. PCR, second edition. Taylor & Francis Group; Wiedman et al., 1994. PCR Meth Appl; 3:S51 -S64). LCR is a method of DNA amplification similar to PCR but differs from PCR because it amplifies the probe molecule rather than producing amplicons through polymerization of nucleotides. Two probes are used per each DNA strand and are ligated together to form a single polynucleotide. LCR uses both a DNA polymerase enzyme and a DNA ligase enzyme to drive the reaction. In a specific application of LCR, the resulting polynucleotide can be amplified by PCR and analyzed separately or, notably when in multiplex samples, hybridized to arrays.
The target for DNA arrays and quantitative nucleic acid-based amplification reactions such as PCR or LCR are nucleic acids, so DNA or RNA. Such nucleic acids include, without limitation, Srp9 DNA and mRNA and Srp14 DNA and mRNA.
For the purposes of genotyping the Srp9 gene with respect to SNP rs12403575 G/A, probes or primers may be employed distinguishing said SNP in a Srp9 gene. There are many methods for determining polymorphisms in the Srp9 gene. Suitable methods include, without limitation, primer extension (PinPoint assay, Massextend™, SPC-SBE, or GOOD assay), hybridization (TaqMan assay , bead array, or SNP chip), ligation (combinatorial fluorescence energy transfer (CFET) tags), and enzymatic cleavage (RFLP, Invader® assay), PCR-SSCP (single-strand conformation polymorphism), MRD (mismatch repair detection), BeadArray™, detection), BeadArray™, or SNPlex™. One of ordinary skill will select the appropriate method and protocol to use.
The invention is also directed to a kit comprising a probe or primer that distinguishes an allele of a SNP in an Srp9 gene in a sample derived from a subject, wherein the allele is selected from the A or G allele in the SNP rs12403575. Said kit is preferably for determining an increased risk of developing febrile seizures, complex febrile seizures, complex epilepsy syndromes including FS, such as Dravet's Syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy in a subject.
The probe or primer is not specifically limited in the context of the invention as long as it is capable of distinguishing between the two alleles in the respective SNPs. For easy detection, the probe or primer can be further detectably labelled, such as by fluorescence or detectable materials, such as radioactive materials, chemiluminescence, biotin, or the like.
The kit may further comprise a polymerase, deoxynucleotides, a restriction enzyme, a buffer, or the like for detection. An electronic hardware component, such as arrays (DNA chips), microfluidic systems ("lab-on-a-chip" systems) and so on may also be used for the detection. The kit may further comprise means for determining the amount of a target nucleic acid, and means for comparing the amount with a standard, and may comprise instructions for using the kit to detect the SNP-containing nucleic acid molecule of interest.
The invention further provides for a method for identifying a subject at risk of developing febrile seizures, complex febrile seizures, complex epilepsy syndromes including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy, said method comprising the steps of: a) determining in a sample of a subject the sequence of the Srp9 promoter sequence, wherein the presence of one or more de novo mutations is indicative of a risk of developing febrile seizures, complex febrile seizures, complex epilepsy syndromes including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
The present inventors found that in a control population of humans de novo mutations in the Srp9 promoter sequence were very rare and infrequent. In contrast, de novo mutations in the Srp9 promoter sequence were frequent. This led the present inventors to conclude that the presence of one or more de novo mutation(s) in the Srp9 promoter sequence of a subject was indicative of a propensity to develop febrile seizures, and would have to lead to a decision to investigate further whether the subject had an increased risk of developing febrile seizures.
In a further aspect, the present invention relates to a method for screening chemical compounds or compositions, said method comprising the step of identifying chemical compounds or compositions targeting the SRP complex, and in particular the SRP9/SRP14 complex. In one embodiment, the present invention deals with a method for screening chemical compounds or compositions interfering with the function of the SRP complex, said method comprising the step of identifying chemical compounds or compositions that suppress expression of SRP9 and/or SRP14 polypeptide, that interact with SRP9 and/or SRP14 polypeptide and thereby prevent formation of the SRP9/SRP14 complex, and/or that interact with the SRP9/SRP14 complex and thereby prevent formation of the SRP complex.
To this end, compounds can be tested on their efficacy to interfere with SRP- mediated translation arrest and/or transport into the endoplasmic reticulum in cell culture. Such studies can be performed in cell systems using known membrane receptor (such as glutamate receptors) proteins as indicators. The method may comprise the steps of: providing a cell or cell line; exposing said cell or cell line to a chemical compound or composition to be tested; determining the level of a selected membrane protein in the endoplasmatic reticulum and/or cell membrane of said exposed cell or cell line; comparing the level of said selected membrane protein in the endoplasmatic reticulum and/or cell membrane of said exposed cell or cell line with the level of said selected membrane protein in the endoplasmatic reticulum and/or cell membrane of the same cell or cell line that has not been contacted with the chemical compound or composition to be tested; in which a decreased level of said selected membrane protein after exposure to said chemical compound or composition is indicative of the chemical compound or composition interfering with the function of the SRP, in particular the SRP9/SRP14 complex. The cell or cell line may be any eukaryotic cell line. The membrane protein may be any protein, and may optionally be labelled, for example, using green fluorescent protein. The chemical compound or composition to be tested may be any chemical compound or composition, such as those contained in a combinatorial library.
The invention also pertains to a compound capable of selectively binding to SRP9 and/or SRP14 polypeptide for use as a medicament. The compound may be an antibody, or a peptide selectively binding to SRP9 and/or SRP14 polypeptide. Preferably, said compound is for use in preventing and/or treating febrile seizures, complex febrile seizures, complex epilepsy syndromes including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy. Preferably, said compound blocks the formation of the SRP9/SRP14 complex. The compound, such as antibody, may be administered to a subject in need thereof in an effective amount to achieve the purpose of preventing and/or treating febrile seizures, complex febrile seizures, complex epilepsy syndromes including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy. In an embodiment, said method comprises the step of identifying chemical compounds or compositions targeting the SRP9/14 heterodimer (herein also referred to as "SRP9/SRP14 complex"). These could include compounds binding to/scavenging excess SRP9 and/or SRP14, compounds interfering with SRP9/SRP14 interaction, or compounds or compositions that inhibit binding of the SRP/SRP14 complex to SRP complex or to a signal peptide of nascent protein at the ribosome.
In another aspect, the present invention provides for use of therapeutic gene modulation for suppressing the level of SRP9 protein and/or SRP14 protein in a mammal. Gene modulation may be directed at suppressing or down-regulating expression of the Srp9 gene (modulation at transcriptional level), or at inhibiting or preventing Srp9 mRNA from being translated into SRP9 protein (modulation at translational level). Said use is preferably for preventing and/or treating febrile seizures, complex febrile seizures, a complex epilepsy syndrome such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
RNA interference is a naturally occurring mechanism for suppressing gene expression and subsequent protein translation. RNA interference suppresses protein translation by either degrading the mRNA before it can be translated or by binding the mRNA and directly preventing its translation. Generally, RNAi has been used to suppress the expression of both gene alleles that lead to the production of a given protein. It is also possible to suppress the expression of only one allele.
Thus, in a further aspect the present invention relates to an Srp9 and/or Srp14 nucleic acid modulator selected from the group consisting of antisense DNA, siRNA, miRNA, shRNA, ribozyme specifically binding to and cleaving Srp9 and/or Srp14 mRNA and zinc finger nuclease specifically targeting a nucleic acid sequence in the Srp9 and/or Srp14 gene resulting in suppression of Srp9 and/or Srp14 expression, for use in preventing and/or treating febrile seizures, complex febrile seizures, complex epilepsy syndromes including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
In a further aspect, the invention is concerned with a recombinant nucleic acid construct comprising at least one transcriptional unit comprising:
- a promoter,
- a nucleic acid sequence encoding a gene suppressor selected from:
- an antisense DNA sequence complementary to the sense strand of the Srp9 and/or Srp14 gene;
- an interfering RNA molecule which is complementary to Srp9 mRNA and/or
Srp14 mRNA; - a nucleic acid sequence encoding a zinc finger nuclease specifically targeting a nucleic acid sequence in the Srp9 gene and/or Srp14 gene;
- a nucleic acid sequence encoding a ribozyme specifically binding to and cleaving Srp9 and/or Srp14 mRNA; and
- a terminator,
for use in preventing and/or treating febrile seizures, complex febrile seizures, complex epilepsy syndromes including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
The interfering RNA molecule may be selected from the group consisting of siRNA, miRNA and shRNA.
The present invention also pertains to a vector comprising a recombinant nucleic acid construct according to the invention for use in preventing and/or treating febrile seizures, complex febrile seizures, a complex epilepsy syndrome such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy. Said vector may comprise more than one transcriptional unit.
Further, the invention is directed to a (host) cell comprising a recombinant nucleic acid construct according to the invention or a vector according to the invention for use in preventing and/or treating febrile seizures, complex febrile seizures, complex epilepsy syndromes including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
In an embodiment, the to Srp9 and/or Srp14 nucleic acid modulator, recombinant nucleic acid construct, vector, host cell of the present invention are administered to a subject in need thereof in an effective amount to achieve the purpose of preventing and/or treating febrile seizures, complex febrile seizures, complex epilepsy syndromes including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
In yet another aspect, the present invention provides for a method for suppressing the level of SRP9 protein and/or SRP14 protein in a cell, said method comprising the step of including an Srp9 and/or Srp14 nucleic acid modulator according to the invention or recombinant nucleic acid construct according to the invention in said cell.
In a final aspect, the present invention provides for a kit comprising means for detecting the level of Srp9 mRNA and/or SRP9 protein and/or Srp14 mRNA and/or SRP14 protein in a sample derived from a subject. In an embodiment, the kit is for use in identifying a subject at risk of developing febrile seizures (FS), a subject at risk of developing complex FS, a subject at risk of developing a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or a subject at risk of developing temporal lobe epilepsy. The kit may comprise a primer pair allowing selective amplification of Srp9 and/or Srp14 mRNA, or a fragment thereof. Selective amplification denotes that only (part of) the Srp9 and/or Srp14 mRNA is amplified using said primer pair.
Alternatively, the kit may comprise an antibody that specifically binds to SRP9 protein and/or SRP14 protein.
The kit of the present invention is preferably for determining the level of Srp9 mRNA, SRP9 protein, Srp14 mRNA and/or SRP14 protein in a sample derived from blood.
All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety.
It will be clear that the above description and figures is included to illustrate some embodiments of the invention, and not to limit the scope of protection. Starting from this disclosure, many more embodiments will be evident to a skilled person which are within the scope of protection and the essence of this invention and which are obvious combinations of prior art techniques and the disclosure of this patent.
Sequence Listing
SEQ ID NO:1 depicts the nucleic acid sequence of the Srp9 gene in C57BL/6J mice.
SEQ ID NO:2 depicts the nucleic acid sequence of the Srp9 gene in A J and CSS1 mice. SEQ ID NO:3 depicts the nucleic acid sequence of the Srp9 gene in human.
SEQ ID NO:4 depicts the nucleic acid sequence of the Srp14 gene in human.
SEQ ID NO:5 depicts the amino acid sequence of the SRP9 protein in human.
SEQ ID NO:6 depicts the amino acid sequence of the SRP14 protein in human.
Examples
Example 1. Identification of Srp9 as a susceptibility gene in febrile seizures and TLE.
Methods Animals
C57BL/6J and C57BL/6J-Chr 1A NaJ (chromosome substitution strain 1 , CSS1 ) mice were obtained from The Jackson Laboratory (Bar Harbor, ME, USA). We generated a CSS1 -F2 by intercrossing F1 hybrid animals from a (reciprocal) outcross between CSS1 and C57BL/6J (n=129; 28 males and 31 females; 36 males and 34 females originating from CSS1 and C57BL/6J mothers, respectively), which was pheno- and genotyped. All experimental procedures were approved by the ethical committee of Utrecht University. FS susceptibility assay
FS susceptibility was determined by inducing hyperthermia in 14-day-old pups by exposure to a warm-air stream and measuring the latency to tonic-clonic seizures (FSL) (Hessel et al., Genes, Brain and Behavior 8, 248-255, 2009). Video/EEG monitoring has proven that the onset of these seizures coincides with FSL to be the most reliable behavioural correlate of the latency to spike-wave discharges in the brain.
Genotyping
Genomic DNA was isolated from spleen. SNP and microsatellite markers across chromosome 1 were selected based on allelic differences between C57BL/6J and A/J database. SNP genotyping was performed as described (Kas et al, Genes, Brain and Behavior 8, 13-22, 2009). Microsatellite marker genotyping was performed by PCR. SNP genotyping was performed with TaqMan SNP Genotyping Assays (Applied Biosystems, Foster City, CA) using automatic genotype detection on an ABI PRISM 9 7900 Sequence Detection System and SDS 2.2.3 software for allelic discrimination (Applied Biosystems).
Table 1 . Known brain-expressed genes in the 1 -LOD region of QTL1
Figure imgf000027_0001
Map construction and QTL analysis
Map construction was performed as described earlier (Cox et al., Genetics 182, 1335-1344, 2009). None of the individual markers showed a segregation ratio distortion (P>0.05) in the chi-squared goodness-of-fit-test (AA:AB:BB ratio 1 :2:1 ). Data were tested for normal distribution and transformed where appropriate. QTL location and variance explained by each locus was determined using MapQTL (version 4.0). LOD scores>1 .65 were considered significant.
In situ hybridization
Radioactive in situ hybridization was performed as described (van der Hel et al., Epilepsia 50, 1717-1728, 2009) and transcript levels were expressed as nCi/g33. CSS1 (n=6) and C57BL/6J (n=6) brains were dissected from naive P14 mice, snap frozen and stored at - 80°C until coronal (Ι θμηι) cryosections were cut. Sense and antisense probes were synthesized using mouse RNA as a template (Primers, Table 2) (Sigma Aldrich Chemie BV, Zwijndrecht, The Netherlands). Hybridization was quantified with ImageJ (version 1 .4.0).
Table 2. Primers used for sequencing mouse Srp9, mouse in situ hybridization and human quantitative PCR.
Primer Forward Reverse Proi size (bp)
Sequence Mouse Srp9
1 CCATAGCCCCTGCAATATGT AATTAGATCCGATGCCCTCC 650
2 CTTTCCGCAAACTCATGACA GTCACACAGCCACAGAGCAT 641
3 GGCCAGGAGTGAAGACAGAG ATAGTGCCTGTGCTGCCTTT 847
4 GCCTGAGGGAAAGACTCAAA GTCTGGAACTGAGGCATCG 801
5 CTCGTGAGCCTCCGTCTTT AGGTGCTTCCTAACTGGGAC 673
6 GTGCCCCTTTCCTTTCCTAC TGGAGAGATGGCTTAGCTGC 592
7 AATTTGCCCTCTGACCACAC GTTGCCTTAAAAAGGGAGCC 698
8 CCGGCCCTTCTTTTTATTTC ATTCCCGCACACAAATCCTA 641
9 TCTGGTCCTCGTAGGGCTAA TTGTGAAAACCCACACTGGA 579
10 GAACCTGGGTCCTCTGAACA AAAGCCAAGACAAGGAGTGG 623
1 1 CGACTTGGTCCTCATGTCCT ACCACCCGTACCTGCAATAA 653
12 TGCCTCTGCTGGGATTAAAG CCTGGCTCTGTTTGTCATCA 683
13 GTCTGTTTTCCTGGCTGTCC TTTCTCCCTCTCTCCCCTTC 574
14 GGGAGTTGGGAAGGGAGTAG AACCTCTGAACCTGGAAGCC 635
15 TTTAATTGGACCTGGCTTCC CGTTAGAGGGGACATGAGGA 612
16 AGCCTGCTGGAATGATTTTT TTACTGCCGGATTCTGCTCT 620
17 GGTATGGCACCTGAGAGAGC TGTGTGTGTTGTAAACGGCA 625
18 TGCCGTTTACAACACACACA AGGACAACCAGGGCTAGTGA 650
in situ hybridization Mouse
Srp9 TGAAGGTACGGGTGGTTCTC CATAACTGCGTCTCGCTCTG 752
DuspW TGAAGGTACGGGTGGTTCTC GGTGGGGACAGACTGAGGTA 466
Bpntl GATGACCAAATGCAGCAAGA GGTGGGGACAGACTGAGGTA 410
Eprs AGACCTTGTGGTTTGGGTTG CCCACTTCTTACACCCAGGA 500
Enah GGCAGGACTTGAATCTGGAG ACACCACCCTCTGAAAGCAC 502
HLX G CAG AAG G ACAAG G ACAAG G CCAGCCAGTGTAGAGGAAGC 468
Markl GGATGCACCACACCTGAGTA AGTCCCAACCACACCTTGTC 558
Rab3gap2 GCAGTTCCCTTGTAGCCTTG GACATCGTCGCTCACTTGAA 796
Quantitative PCR Human
Srp9 TCCCGGACGTAGGTAGTTTG CTTCATAGGGTCAGCGAGGT 145
Srp68 GAAAATCCCAGCAAGTTCCA TGACCAAAGGCAATCAATCA 243 PSMD2 GATTCGTCGTCGCAGAAGCCTAA GGCACTGATGAGAACCACCT 148
DDX48 AGAACAAGGACCACGGAATG CACGATTTGAGCCAGCAGCATAA 282
Functional interference studies
Srp9 antisense (T*G*A*G*GCATCGTGGCT*T*C*A*G*G; n=7) (The asterisks (*) represent phosphorothioate bonds in the nucleic acid sequence) or scrambled (T*C*A*G*G*GTACGCGTCGT*A*G*C*G*T*; n=5) (The asterisks (*) represent phosphorothioate bonds in the nucleic acid sequence) oligonucleotides (18 nM in 1 .5 μΙ) (Sigma-Aldrich, Zwijndrecht, the Netherlands) were injected intracerebroventricularly in C57BL/6J mice using a stereotactic device (coordinates: 10 mediolateral +1 .0 mm, anteriorposterior -1 .0 mm, depth, +2.6 mm, angle 0 degrees) 20h prior to hyperthermia induction (0.3 μΙ/min, 1 .5 μΙ). Prior to injection mice were anesthetized with Ketamine (75 mg/kg), Medetomidine (1 mg/kg) and Atropine (0.04 mg/kg), antagonized with antisedan 0.5 mg/kg (0.1 ml/10g) and returned to their mother. After hyperthermia animals were sacrificed and brains were dissected and snap frozen for expression studies. Cycloheximide (20 mg/kg; n=9; Sigma, St. Louis, MO, USA), rapamycin (30 mg/kg; n=9; Santa Cruz Biotechnology, Inc. Santa Cruz, CA, USA) or saline (n=9) were injected intraperitoneally (ip) (total volume 0.1 ml/g) in C57BL/6J mice 20 or 30 min before hyperthermia induction, respectively.
Human brain tissue and DNA isolation
Hippocampal and neocortical tissue was obtained from pharmacoresistant mTLE patients with complex partial seizures who had surgical resective treatment. Hippocampal tissue from autopsy controls was obtained from the Netherlands Brain Bank. Selection of patients (for clinical data see Table 3), collection and processing of tissue for qPCR analysis was as described (van Gassen et al., Epilepsia 49, 1055-1065, 2008). DNA was isolated from neocortex of mTLE patients (n=368, 91 with FS) and from blood of healthy controls (n=730). Informed and written consent was obtained from the patients for all procedures as approved by the Institutional Review Board.
Table 3. Clinical data of patients used for the qPCR analyses.
Patient Age Sex AO/PMD Epilepsy AEDS Early life incident Neuropathological
focus diagnosis
Autopsy
1 56 F 16 x x ND normal hippocampus
2 32 F 13 x x ND normal hippocampus
3 47 F 4 x x ND normal hippocampus
4 51 M 8 x x ND normal hippocampus
5 52 F 12 x x ND normal hippocampus
Mean 47.6 5F,1 M 10
Non - HS
1 41 M 33 L LEV, CBZ vascular malformation
2 31 M 13 L CBZ, CLB, LTG tumor
3 47 M 16 R VPA, LEV, LTG trauma posttraumatic epilepsy
4 24 M 21 L CBZ, LTG, LEV trauma posttraumatic epilepsy
5 48 F 26 L NA contusio cerebri
6 23 F 12 R LTG, OXC trauma posttraumatic epilepsy
7 37 M 18 R CBZ, PHT trauma posttraumatic epilepsy
8 39 M 4 R CBZ tumor
9 51 F 46 R TMD tumor
10 36 M 17 R LEV, VPA tumor
1 1 45 M 27 L LTG, PHT FCD
12 34 F 4 L CBZ cavernoma in cortex
13 28 M 16 R CBZ, TPR NA
14 54 M 19 L LTG, OXC, CLB ganglioglioom
15 42 F 20 R CBZ, LTG, LEV tumor
16 46 F 30 R CBZ, VPA FCD
Mean 39.1 6F,10M 20 9R,7L
HS - FS
1 34 F 6 L CBZ MTS W4
2 39 F 28 R LTG, OXC meningitis MTS W4
3 19 M 13 L OXC MTS W4
4 26 F 9 R NA MTS W4
5 32 F 1 R LTG meningitis MTS W4
6 37 F 1 1 R LEV, TPM MTS W4
7 32 F 14 L NA MTS W4
8 19 F 2 L CBZ, LTG MTS W4
9 50 M 3 L CBZ, GBP meningitis MTS W4
10 51 M 48 R NA meningitis MTS W4
1 1 49 F 12 L OXC, CLB MTS W4
12 42 M 1 L LEV, LTG MTS W4
13 50 M 3 L CBZ, GBP meningitis MTS W4
Mean 36.9 8F,5M 12 5R,8L
HS + FS
1 37 F 1 R NA FS MTS W4
2 38 M 9 L CBZ, CLB FS MTS W4
3 40 M 1 R VPA, CLB FS MTS W4
4 33 M 1 1 L CBZ, AZA FS MTS W4
5 24 M 1 L VPA, CBZ, CLB FS MTS W4
6 36 M 5 L OXC, PGB FS MTS W4
PHT, CLB, CBZ,
7 41 M 6 R LTG FS MTS W4
Mean 35.6 1F,6M 5 3R,4L
AO=Age of onset. PMD=post mortem delay in hours. AED=Antipileptic Drugs, PHT=phenytoin, CLB=Clobazam, CBZ=Carbamazepine, LTG=lamotrigine, LEV=Levetiracetam, VPA=Valproic acid, OXZ=oxcabrazepine, PGB=Pregabaline, AZA=Acetazolamide, TPM=Topiramate, TMD=Tramadol, NA=information not available, FCD=Focal Cortical Dysplasia
Quantitative PCR
qPCR was performed as described earlier (van Gassen et al., Epilepsia 49, 1055-1065, 2008). cDNA was synthesized from hippocampal RNA of human autopsy controls (n=5), and mTLE patients with (HS; n=20) and without sclerosis (non-HS; n=16). In a group of HS-mTLE patients we compared hippocampal RNA of mTLE patients with (+FS; n=7) and without (-FS; n=13) antecedent FS. Primers for SRP9, SRP68 and two reference genes, PSMD2 and DDX48 were from Sigma Genosys (Cambridge, U.K.). Expression data was calculated as normalized ratio's and normalized to two reference genes. Sequencing Mouse Srp9 was sequenced as described (Kas et al., Genes, Brain and Behavior 8, 13-22, 2009). Primers 1-18 (Table 2 above) were chosen (Mus musculus Srp9 gene sequence in Ensembl (ENSMUSG0000002651 1 , 183,755,349 - 187,980,365 bp) to amplify the promoter, 5' UTR, exons, introns and 3'UTR in C57BL/6J, A/J and CSS1 mice (n=3). Human Srp9 exons, exon-intron boundaries and the promoter region (5 kb upstream) was sequenced with nested PCR (Smits,B.M. et al. Generation of gene knockouts and mutant models in the laboratory rat by ENU-driven target-selected mutagenesis. Pharmacogenet Genomics 16, 159-169 (2006)) as described. Primers (Table 4) were chosen using LIMSTILL (http://limstill.niob.knaw.nl/).
Table 4. Primers used for nesting PCR to sequence human Srp9 and the Taqman assay for SNP rs12403575.
Primer Forward Reverse bp
Srp9p-c1-1 AATGAGAGCCCTTGTGAAAG CAGCACTGTAGCTGCTTTAGAC 553
Srp9p-c1-2 TGTAAAACGACGGCCAGT GTCCACCAACATGATTTCAG AGGAAACAGCTATGACCAT CTTGCCAGGAATGTGTGTC 408
Srp9p-c2-1 AATCCATGAAACTTGGGAAG TTATAGGCCAGTCATTGTGC 545
Srp9p-c2-2 TGTAAAACGACGGCCAGT CAAGCCAGCAGCACTTC AGGAAACAGCTATGACCAT AATAGCTGAAGCTGGAGAGC 346
Srp9p-c3-1 GCAGACCTTTGGGAAGATAC CTCTGTCCTGACCTCCTCTG 603
Srp9p-c3-2 TGTAAAACGACGGCCAGT CCTCAGGGATTAGACTGCTC AGGAAACAGCTATGACCAT CCAAGACACCAGCCTCTG 471
Srp9p-c4-1 CCTCATAGCATGGAGGTTG GGTGATGAAGAAACCAAACC 662
Srp9p-c4-2 TGTAAAACGACGGCCAGT GGGTATTGTCCAGGAAGAAC AGGAAACAGCTATGACCAT GGATTGTCCAGCAAATGG 562
Srp9p-c5-1 GCTTTACCGATCTAGCTTCTG TGTGGTTATCCTTTCTGCTTC 551
Srp9p-c5-2 TGTAAAACGACGGCCAGT CCTGTCACTTCCGGTTATG AGGAAACAGCTATGACCAT TGAGCTTTCAAACAACTCTG 447
Srp9p-c6-1 CCAAACACACCAAGTGAAAC CACTATCACAAGAACAGCAAGG 645
TGTAAAACGACGGCCAGTGGAATTGTAATAAGGCTCACTG
Srp9p-c6-2 AGGAAACAGCTATGACCAT CCCAACACTGGGAATTAGAG 462
Srp9p-c7-1 GAGCTAAACAATGGGCACTC CCCAGTCACACTAGGATGC 654
Srp9p-c7-2 TGTAAAACGACGGCCAGT CCCAAATCTCATGTTGAACTC AGGAAACAGCTATGACCAT TGTGCATGTTTGTTACATGG 550
Srp9p-c8-1 ACCTAATGCCCACCAGTATG TGTGTGTGTGTGTGTGTGTG 573
Srp9p-c8-2 TGTAAAACGACGGCCAGT ACAAACATGCACATGTACCC AGGAAACAGCTATGACCAT TAAAGAGCAATGAGCAGAGG 500
Srp9p-c9-1 TTGGCATTGTCTTAACTTCC TAGGGTCTGTCTCCAGCAAC 577
Srp9p-c9-2 TGTAAAACGACGGCCAGT GTCATTCTGCCCAACTCTG AGGAAACAGCTATGACCATCATGAGGAAGAAGAACAAAGG 441
Srp9p-c10-1
TTTCCTTTAATCCTGGTTCC AGACAGGAGACCACCTTCG 752
Srp9p-c10-2
TGTAAAACGACGGCCAGT TGACCCTTTGTTCTTCTTCC AGGAAACAGCTATGACCAT ATCCTTGAGGAGAAGGTTTG 682
Srp9p-c11-1
GGCTTCCTTATTCATTTCTCAC ACTGGTGTTTAGGAGATGAGG 595
Srp9p-c11-2
TGTAAAACGACGGCCAGT TTCTCCTCAAGGATCCAAAC AGGAAACAGCTATGACCAT AAATCTGATCCTCCAAGCAG 501
Srp9p-c12-1
CGATCATGGCTCACTGC CTACCTACGTCCGGGAGTC 689
Srp9p-c12-2
TGTAAAACGACGGCCAGT TCCTGCTTGGAGGATCAG AGGAAACAGCTATGACCAT GGATGTTGTCAGGGAGTGG 519 srp9-1-1 CGACTCCCGGACGTAGG GGTCCATTTGTGTTCATTCC 270 srp9-1-2 TGTAAAACGACGGCCAGTGAGGCCTTGCTTCTCTTTAC AGGAAACAGCTATGACCATGATGGCGGGAAGACATC 168 srp9-2-1 ATGGTAGCAAAGGAATGAAC AAAGTAGCTGCTAGAATGAGG 419 srp9-2-2 TGTAAAACGACGGCCAGTTGTCATTTGTCTTCACTGTTTC AGGAAACAGCTATGACCATGCATCCTAATGGGTAATCTCC 216 srp9-3-1 ACATGAGTGCTTACCCTTGG CAGAAAGATGGCTTGAGTCC 315 srp9-3-2 TGTAAAACGACGGCCAGTGTTTGTTGATTGGTTGGTTG AGGAAACAGCTATGACCATATTAGCTGAGTGTGGTGGTG 189 srp9-4-1 GAGATAATCTAATACCTAATTCGAAGG CCTCTAAGCTTCTGAACAGC 584
TGTAAAACGACGGCCAGTTCTTCTCATCAGACCATAGCAG
srp9-4-2 AGGAAACAGCTATGACCATTTTCTGTCCCAACACTTTCTC 486 rs12403575 GAGGGTGGCCAGTGGCCTCAAATAC GAGGGTGGCCAGTGGCCTCAAATAC
Statistical Analysis
Data were analyzed with SPSS (version 15.0) and expressed as means ± SEM. One Way Analysis of Variance (ANOVAs) was performed with a post-hoc Bonferroni-Dun test. Significance levels (a=0.05) were corrected with the Dunnett method to account for the multiple (strain, expression, treatment or gene) comparison. Equality of variances was tested with Levene's test. ISH expression, treatment effect of AS oligo's and cycloheximide/ rapamycin treatment were analyzed with an independent t-test (a=0.05). P-values (2-tailed) of allele frequencies were calculated by means of chi-square analysis with a 2 x 2 contingency table. Distribution of genotypes was in Hardy-Weinberg equilibrium.
Results
To identify genetic susceptibility factors for EEG-verified prolonged FS induced by hyperthermia, we performed a phenotypic screen for FS latency (FSL) in a mouse chromosome substitution (CSS) panel C57BL/6J-Chr#A NaJ and found that chromosome 1 (CSS1 ) has a strong contribution. Indeed, FSL was higher in CSS1 (915.3±37.5 s) than in C57BL/6J (631 .9±26.9 s) (Fig. 1A), showing that CSS1 mice were less susceptible to FS than C57BL/6J.
To map genes contributing to reduced FS susceptibility on mouse chromosome 1 we bred a CSS1 -F2 generation (n=129). Phenotypic analysis of all individuals showed that the majority of these genetically unique CSS1 -F2 mice had a longer FSL than C57BL/6J mice (Fig. 1 B).
QTL analysis (Table 5) revealed a highly significant peak (LOD=7.6) (Fig. 1 C). The 1 -LOD support interval of this QTL1 was located between 183,756,349-187,980,365 bp. This
QTL1 interval harboured 22 brain-expressed genes and accounted for 23.9% of the variance in FS susceptibility in the CSS1 -F2 population. The heterozygous genotype showed a phenotype intermediate between the two homozygous genotypes, indicating an additive mode of inheritance at this QTL).
Table 5. Co-segregation analysis in the CSS1 -F2 progeny ΛΒ ( >; ι :. ! :'
.¾»*
"··>·± SJ0
778.7 + ·.·:·> > +
(tt
:;κ i-HS 4 ±
37.» ¾<>64 =a=.> I =65) e.s
7S».S ± 838 .4 aeco niMkl« »o ± :;« ? ami*
* e.Ciftl .4 •ll <:l
7
8¾7 ± 6,0001 ftOrXil
To further analyze QTL1 , we selected eight brain-expressed candidate genes (Fig. 2A) based on known SNPs differences and differential gene expression (http://www.genenetwork.org/) between the A/J and C57BL/6J (Fig. 2A). Only for Srp9 we found lower expression in CSS1 compared to C57BL/6J (total brain -23.1 %; hippocampus - 35.6%) (Fig. 2B). Sequencing of Srp9 (184,053,433 - 184,063,607 bp) in C57BL/6J, CSS1 and A/J mice identified 1 new SNP in the 3'UTR and 52 polymorphisms in intronic and promoter regions.
Database analysis (WebQTL: http://www.genenetwork.org/) revealed a strong cisQTL for Srp9 mRNA regulation in the AXB eye tissue (LOD=12.1 ) and BXD brain (LOD=1 1 .7). Such high cisQTLs (LOD>1 1 ) have a mean gene-to-QTL distance of about 450 kb10, indicating an upstream region regulating gene expression. Indeed, sequencing 2500 bp upstream revealed a major 210 bp deletion in A/J and CSS1 , containing a SI NE B2 element (RepeatMasker: http://www.repeatmasker.org/). What sequence differences contribute to differential Srp9 expression remains to be determined. Interestingly, using the same mapping strategy, we identified Srp14 as a strong candidate gene for FS susceptibility in QTL2b (LOD=6.2; 1 -LOD interval 1 14,875,854 - 133,817,501 ) on chromosome 2 (Figure 5). SRP14 forms a functional heterodimer with SRP9 in the SRP complex, which in total comprises 6 proteins. This observation, combined with the differential expression of Srp9, prompted us to prompted us to select Srp9 for further study.
To investigate a causal relationship between Srp9 expression levels and FS susceptibility, we microinjected Srp9 antisense (AS) oligonucleotides intracerebroventricularly (ICV) in C57BL/6J pups 20 hours prior to inducing hyperthermia. This significantly prolonged FSL in C57BL/6J (899.0±77.7 s) compared with scrambled oligonucleotide injected littermates (574.0±23.5 s) (Fig. 3A) and was accompanied by a down-regulation (-16.7%) of Srp9 transcript levels in the cortex. Thus, Srp9 down-regulation in vivo decreased FS susceptibility and induced the CSS1 FS phenotype in C57BL/6J, providing strong evidence for a functional role of Srp9 in FS susceptibility in mice.
SRP9 is part of the SRP complex, which couples the cytoplasmic protein synthesis machinery to the membrane-bound protein translocation machinery of the endoplasmic reticulum (ER). To independently assess the importance of protein synthesis in FS susceptibility, we injected protein synthesis inhibitors in C57BL/6J pups prior to hyperthermia induction. Cycloheximide significantly prolonged FSL (769.1 ±41 .1 s) compared with saline injected littermates (662.6±28.0 s) (Fig. 3B), as did rapamycin, which inhibits protein synthesis via mTOR (mammalian target of rapamycin) (708.1 ±35.9 compared to 591 .9±1 1 .4 s) (Fig. 3B). Thus, both our genetic and pharmacological studies point to the importance of protein synthesis in conveying FS susceptibility.
Several deletions have been described in the human orthologous region of QTL1 (1 q41 -1 q43) presenting in patients with complex seizure phenotypes often including febrile seizures13,14. To investigate a role of Srp9 in FS susceptibility in humans, we measured Srp9 transcript levels in hippocampal tissue obtained during surgery performed to treat patients with mTLE. We compared mTLE patients with hippocampal sclerosis (HS), known to have a high incidence of antecedent FS, with mTLE patients without HS and autopsy controls. SRP9 expression (Fig. 4A) was highest in mTLE patients with HS (Rn=169.3±17.0), intermediate in mTLE patients without HS (Rn=100.0±14.9) and lowest in autopsy controls (Rn=40.4±6.1 ). Expression of SRP68, an SRP protein not directly interacting with SRP9, did not differ between the mTLE patient groups, indicating that not all SRP proteins are differentially expressed. In a separate cohort of HS-mTLE patients we found significantly higher SRP9 levels (+48.6%) in patients with antecedent FS compared with patients without antecedent FS (Fig. 4B). These data strongly suggest that also in humans increased SRP9 expression is linked to FS susceptibility.
In search for a genetic variant associated with FS and mTLE, we sequenced all four exons of the human SRP9 gene (including intron-exon boundaries) and its promoter region (5 kb) in a Dutch mTLE patient cohort (n=368) including 91 patients with antecedent FS, and ethnically matched healthy controls (n=169) (Fig. 4C, 8). We identified a large number of new and known variants. We did not find significant differences in frequency of total number of sporadic mutations between groups nor did we find variants in coding sequences that are predicted to affect protein function. However, we found a significant increase in the frequency of sporadic mutations in the promoter region (p< 0.001 ) in patients with TLE (fig. 8). Analysis of the frequency of 5 common SNPs revealed a significant association of a single SNP in the promoter region (rs12403575 G/A) (Fig. 4C, fig. 8) with mTLE. Further analysis of this SNP in the cohort and a larger control sample (n=730) resulted in significant association with mTLE (P=0.01 , ODDS-ratio 1 .238) and FS (P=0.045, ODDS-ratio=1 .321 ) (Fig 4D).
These data identify SRP9 as risk factor for FS and mTLE, providing compelling evidence for a common genetic predisposition. Correlating SNP genotype and hippocampal SRP9 expression levels in individual mTLE patients, we found a significantly higher SRP9 expression in patients with AA compared to AG genotype (Fig. 4E), indicating that this SNP contributes to regulation of SRP9 expression.
SRP9 is a subunit of SRP, a ubiquitous, highly conserved cytoplasmic ribonucleoprotein complex that plays a key role in targeting nascent membrane and secretory proteins to the rough ER membrane (Walter and Blobel, Federation Proceedings 40, 1557, 1981 ). SRP consists of six polypeptides and one RNA (7SL) together forming two functional domains, the S-domain primarily involved in recognition of the signal sequence of nascent peptide chains, and the ALU domain (7SL RNA and the SRP9/SRP14 heterodimer) thought to be responsible for elongation arrest facilitating targeting of nascent chains to the ER. SRP lacking SRP9/14 lacks elongation arrest activity, but is still translocation competent, albeit, at lower efficiency. Thus, our data implicate ER-dependent protein synthesis in FS susceptibility.
We confirmed involvement of protein synthesis by showing that reduction of protein synthesis led to a decrease in FS susceptibility using either cycloheximide, which inhibits translation initiation (Baliga et al., Federation Proceedings 27, 766, 1968) or rapamicin, which inhibits activation of eukaryotic translation initiation factor 4B (elF4B, Burnett et al., PNAS 95, 1432-1437, 1998)) through inhibition of mTOR. mTOR signalling has been implicated in the pathogenesis of tuberous sclerosis complex, a syndrome with a prominent epilepsy phenotype. The rapid effect of protein synthesis inhibitors (20-30 min) indicates involvement of local protein synthesis, possibly in dendrites and/or synapses. Specialized ER has been identified in dendrites and in neurons local protein synthesis plays a key role in regulating
neuronal plasticity.
The precise mechanism by which SRP9 conveys its effect on FS susceptibility needs to be further investigated. Presumably loss of SRP9 from the SRP complex leads to loss of elongation arrest and decreased translocation efficiency due to the strict time dependence of the functional interaction between polysome and microsomal membrane. Therefore, reduced SRP9 levels could affect the amount and/or composition of proteins targeted to the ER, thus affecting secretion, plasticity and cell growth. Fever and FS, but also other risk factors for mTLE, such as viral infection, stroke or head trauma, are known to disrupt ER function and trigger the ER stress response. ER stress has been implicated in the pathogenesis of various other neurological degeneration syndromes including mTLE, Alzheimer's and Parkinson's disease. Not only ER function, but also post-ER trafficking maybe affected by SRP9 levels. In HELA cells down-regulation of several proteins in the SRP complex resulted in reduced expression of membrane proteins, possibly involving trafficking. Interestingly, temperature- dependent receptor trafficking defects have previously been implicated in FS. Thus, it is tempting to speculate that variations in SRP9 levels observed in the present study, affect the composition of receptors and ion channels at the synaptic membrane in a temperature- dependent manner, resulting in altered susceptibility to FS.
Our data show that susceptibility to FS is, at least in part, determined by susceptibility to increased body temperature (without an infection). We propose that SRP9-mediated changes in FS susceptibility involve temperature-induced changes in ER function and protein trafficking. The identification of SRP9 as FS susceptibility gene implicates (local) ER- dependent protein synthesis as key factor in FS susceptibility and opens new possibilities for early diagnosis and treatment of FS.
Table 6. Srp9 sequence differences between C57BL/6J and A J/CSS1 mice. Srp9 was sequenced (n=3) in the CSS1 , A J and C57BL/6J mice. The Srp9 sequence of A J and CSS1 were identical. A J/CSS1 and C57BL/6J differences are in parentheses (with the nucleotide(s) present in the Srp9 gene of C57BL/6J being indicated before the slash and the the nucleotide(s) present in the Srp9 gene of A J/CSS1 being indicated after the slash). The exon region is in bold. Newly identified polymorphisms are in bold and underlined (known polymorphisms are available on http://www.ensembl.org). The 210 bp underlined promoter region in bold was not present in the A/J/CSS1 :
ACCAATCTAAAAGAGGTAGGGTTAGAGGGTGTGAACATGATCAAGGCACATTGTGGA CATGTGTGAAGATGTCATAACGAAACTCATTGTTATGTACACTGCTAAAAATGTTTACA AACTCCTCTTCCAAGAAGGCCTTTCTGCTGGACTGTCCTTTGTCTCGTCTCGTTTGTTT CTGCTCTTCAGCGTCCCCATAGCCCCTGCAATATGTCCCTTGTTCTAAGGGAATAGAA G CCTTCTTCTG AAG CTAATCTTATTCACAAGTG ACTTTAACCTTC (G/T )TAG AG ATG ACT CAGCTAACCACCCAGCCTCCTGGGAAC(T. )TGAGCTGTAAAGCCCTAATGTTTGAGC AGACCTTCAAGCATCCCCCbAjGGGAGGCTGACTTCAGAGTCCCTTTGTT
TCACCCCCTTTAAAAAAAA|^1TCAAAATAATT(G/A)CTATCTATTTAGCCCAGGTA(C/ T)CATGATGGCCTCTTGCTAGGACTGCCATCATTCTTGTTTCTTTCTTCCTTTCTTTTCTT TGCTTATTTCTTTTTTTAAAAA|iAlG£QATTTATTTAiGGGGG TCAGTGGGTAAGAGCACCCGACTGTTCTTTCGAAGATCCGGAGTTCAAATCCCAGC AACCACATGGTGGCTCACAACCATGTGTAAGGAGTGTCTGAAGACAGCTACAGTGT ACTTACATATAATAAATAAATAAATCTTAAAAAAAAAGGACTGAAGGTTTGTCCCAGA TTTATW
ATTACAGGTGGTTGTAAGGCACCATGTGGTTGCTGGGATTTGAACTCAGGACCTTTGG AAGAGTAGTCGGTGCTCTTAACTGCTGAGGCATCTCTCCAGCCCTGCTTGTTTATTTC TAAGTAG CCCAGTTTG G CCTTG G ACTAAATAG CTG G G ACTTTCCG CAAACTC ATG ACA TAAAAAAAG AAAAAG AAAG AG CAAAAG AAAAAAAG G AAG G AAG G AAAG AAG G AAG AA AAGAGAAAGAAAATGAATGAAAGGAAAGAAAAGAGAAA(A/C)AATGAAAGAAA(G T)AA AAAGAAAGAGAAAGAAGGAAAAAGAAAAGAAG(TC/CT)GGGCAGGGGTGGC(G/A)CA( C/T)GCCTTTAATCCCAGCACTTGG(G/A)AGGCAGAGGCAGGCGGATTTCTGAGTTCAA GGCCAGCCTGGTCTACAGAG(A/T)GAGTTCCAGGACAGCC(A/G)GGGATACACAGA(A/ G )AAACCCTGTCTTGAAAAACAAACAAACAAACAAACA(— /AAG }AA(C/
G } AAAG ( /A) AAG AAG AAAG AAAAAG ( /AAAAAG A) AAAAAG AAAAAG ATAGGGAA
GAG G AAG G CAAG ATG G AG ACCTTG TCTAG AATG CACAATCCTTAG CACTG AAAACCC AAAACAATACAAGACAAAACAAAACAAAAAACCCAACAAAACTGTTTAAAGCTGATCA ATGGGGGCTGGTGAGAGGGCTCAGGGTTAAGAGCACQ C GACTGCTCTTCC(A/ GIGAGGTCATGAATGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGT AATGAGAAACAAAAAATAAAAACAACAACAGCAACAACAACAACAAACiC/TiTTTGGGC CCGGAT(T/C)GAGGA(G/A)GGGCAGAGCAAGATGGAGAAGGGAAGGGGGAAAAAG(C/ G)AGCTCAATGGACAGGGGGATGTAATTTTTAGTAAGAGTAAACATTCGTGGGGCCAG G AGTG AAG AC AG AG G AAATG AATTAC AAG GAG G C ATG AAG A{ A/G ) ATTTCTAG AG GTG AAAAATACCCCC ATATATTG ATTATG ACATTAG G CAAG TAGGTAT ATG CTCTGTG G CTG TGTGACGTGTGTGTATATGTATTTTTTT|iI CAGAATCCATGATCG(T/C)A
TATTCTCAAAGCCGATGTTTACTGCACACATAAACTATATACCCCAATAAAATT(T/G)CT TTTAAAAGCTGTCCTGTGTCACACTCTG(C/A)CTGAGG(G/A)AAAGACTCAAATTTCGTA TCCTAGCAGATGCCACAGTGTAGCTTCCTTCTCTCTGTGCTTCTTCTCTTCCTCCATTC CCTTGAACACTACTGTTC(C/A)TCTTAAGTACACGTACACTGCAGATCTTAAATGT GCCTAGAGGTCTCGCCCTTCTCTACTCCCTATTCAGTTTGTCTCACCTCTGGGAGCCT TGCTCCTTTTTGTTCCACTGACCCGATACAAAAGTCTACCACAGAAAGTTTTTGGTTGC
GCGTCCGTTATGTCTCCCCAACTCCTTGATTAGGCTTTGAGTGTGACAGCTGCG|C T\ CTTGTCATCACCACGACTGTGACTTGGGTACCAGGTCACAGAGCTCCTGCTTTGAGT GTGACAGCTGCGCCTTGTCATCACCACGACTGTGACTTGGGTACCAGGTCACAGAGC TCCTTAGTCTTTG G AAAG G C AG C AC AG G C ACTATTAGTCTTTG G AAAG G C AG C AC AG GCACTATCCCCTCCAGCCCTGCAGGCGGCGCTGTGGCAGCCGCCCTCTCCTCTCCC
C/GJGACCTCTCAGAGCGGAGGCCCCCCCTCCAGCCCTGCAGGCGGCGCTGTGGCA GCCGCCCTCTCCTCTCCCGACCTCTCAGAGCGGAGGCCCCGCCCCCCGACATCAC GCCTCCTGCCCATTCGCCCCCCGACATCACGCCTCCTGC| /T}CATTGGACAGGCGC GCGGCCGAGGCTGGCCAATGGCGTGAGCGTCGTGAGCCTCCGTCTTTGCGCCGCC GGAGTGC(A T)GCGCTGTGGGCGGTTGCGGGAGAGCGGCGGGCCGCCGGGGCGA CAGCGCCGTG|A/C}CTCGCTTCGCGGCCTTGTTCCTCGCTGCCTGAAGCCACGATG CCTCAGTTCCAGACCTGGGAGGAGTTCAGCCGGGCGGCCGAGAAGCTCTACCTGG CGGACCCCATGAAGGTGAGTCGCTGCAGGGACCGCCCTGGGGCCCGGGGCTTCTC TACCCTTGGCGCGGCCTGAGCACGCCCAGGAAACAGTCGGCCCACCCGGTGCCAC TGTCCCTTCGTCTGCTTCCGACTGACCCGGAGACCCAGTGACCCAGCGAGGCGACC CCAGCAGCTACAGGCAGGGCGGTTTCCGCAGCGCCGGACCCCACAGCGGCC(T/C)G CACCCGGGGGAGCTCCTAACTTCCGCTCGGGATCTGGTTGGTTTACGTGTCGCTGAG TGGGCTCCTCCCCC(T7C)GCACCGTCGCTTTCCTGTCCGT(C/G)GCTTAGTTTAGTGC CCCTTTCCTTTCCTACCC(A/T}GACCCGAGAGTACCAGCTTATAAAATGGTGCTACTGT ACTGTACGTCCCAGTTAGGAAGCACCTGCTCTACTTTTTTTTTTTTTTTTTT(- · - n~TT)GGATAGTGGGGATTTTTAGTCTTTTCCTGGACCAGTTGAAACATGGAGACT GTTTGCACTCTCACGTTAGACATAAATGTTTGCAAGCGGTTTCATTCCCCAAAGCAAA CTACCCAGTCCCATCTCAGCAGTTCAGAACA(A G)GTTCCGGGAGGGGGACACAAAG GTCAGCTTCATCATTCCTTAAAGGATTGTTGAAGGTATGGTAGACGC(A/G)TGTTTTAT GAATATACACGTTAAGGAAAAAGAAAACAAAAACAAAAAAACCGATGAGCAGCTAACA ATCTCAAGAACCCGGGCTCAGTGCATAACACGAACTCTGTGTGTGTGTGTGTGTATCA TAATG AG ACTG CAG AG ACACTCAG CATG C AG AACTCACTTAAG G ATG G AAAG AG G G A ATCTACTCCTTTCTGACCACACATCTCTCACACTAACATGTACACACACAG ACACACACA([!7CiGTAAGTAAAAATCAAAAATATATTGGTACTGGCAGCTTGCGGTGG CAGTACTTACTACAG G ATTTTACAG G GAG C ( A/T }TCTTTTACTTTTGGTTGTG AG CAT AG CCTTTAGCAGCTAAGCCATCTCTCCAAGCCCACAGGA(A/G)GCATCTTTTAAGAAGGT CAGTCCATTAATTCTTACGTATGTCAGTGTTTGCTTGTGCACATGGGGTGCCTGCCCT GCTGGGGTCAGAAGAGGGCATTGAATCCCCGGGAAATGGAGTTAGGCATGGGTGTG AGCCACCTTGTGGAGTTAGGCATGGGTGTGAGCCACCTTGTGGGTGCTGGGA(G/A)C CAAATCTGTGTCTACCTGCATTAGAACCACAGGAAGACCAGAGTAGACAGTAGAACAT TCGGAACCATCCTTGTGTA I I I I I AAGCTCCT(A/G)TCT(T/C)CTCATGCGTCCTAGATG GGCCTCATTAATGTCCTGTGGAGATGAGA(G/A)TGATCTT|GHAACTCT
GGGTGTTAGCTCCCCCGGCCCTTCTTTTTATTTCTCAGGAACTCAGAGATC(C/T)GCCT GCCTCTGCCTCCC(G/A)AGTGCTGGGATTAAAGGCiG/A)TGTGCCAC(C/T)AC(AC/TG) CC (G/T)G G CTG CAG G CTCCCTTTTTAAG G CAAC ATTTAAAACTAATG ATCTTATTAAAGT GATAATAAATGGCTAGGTAGATTAGGTATTTTTGAAATTGTGTAGTTTGTGACAGTGGT GGCTTCTTGTATGTACTTTCATGTGGTTCATTTCCTCAGTTGGGCAGTGTGCTGTAAGG TGGTATAAGGTTTGTCCAGAAGGGCCTGATACTGACAACAGTATACAGTGTCTGCATT TAGTAAAGAGACTGTAGATACACCAGCACACATTGAGTGACTATTTGAA
GATGTAGTTGCGGGGCCAGTGAAAGTAGAAGTGTCAGGGAGTTGTGATGAGAAGGA GACACAGAGGAGGAGCTGGCCAGATCTGTCCAGGAGAAAATCCTTGTGGCCTCCAA ACTTAAGTATAAACCCTGGATCTGAACTCCAGTCCATTCTGGTCCTCGTAGGGCTAAC GAAGACAGTTTGTTGGTCTCTAGGATTTGTGTGCGGGAATTCTGCTTTCTGTACCCAG CACATTCAGTGTGGAACC|iC AATGTACCTTTTCACCCTTTAC(T/C)CTTCCCTT
TATGGCTTGAACTGAAATGCTGTTGCTGGTGAGCTGAAAGAGCCCGTGG(T/C)TGCTC TGTCTTCCTTTTAGTCCCTCCCTTACGTTTCTGCTACCGTGGTCTGAGAATACCGACAC TGCCGTGTCCTCTGCTTAAAACCAGTTCTTCATTGATTACTGAATGAAGTCCT GA(C/T)TCCCAGTCGCACTGTCTTGATTCAGTCATTCTGGCTTCAGACTTGGTGAAGCC ATA(G/T)ATACATCAGCTCTTTGTTCAGAGTGCTTATACTTT(C/T)TTCAGCCTTCTCTAT ATGAAAACAAAACATGTATTTTCAAAGCCACATCCCAAGAAAAGTGGTTCTTGGCCTC TTTTTCCTTTAGCACTTTTACCAGTATTTTTCTTTATAGGACTTTTTTTTTTT( flAAA (IHAAACTTAATTCACTTTATTTTTCTTGTA(T/A1AAAAACCCTCATATGATA|∞1CCA CAiG/A]ATGGAACC(T^^^
TCACAAGGTGGCCAGTGAATTCCTGATAAAGAGACTTGATAACAAAG^^
AGGGGGGGTTTTCACAAAGGTGGCCAGTGAATTCCTGATAGGAGACTTGGTGAAACA GTCTCTTTCCAGAGGTCAGGGGTCAGGTAGCTGTATTTCCGAGGTCGGGGGTCAGGT AGCTGTAGGTCTTGGAGGTTGCACCACTGGTGGCCTTGGCAGTGTTATCCAGGGTGG CAG TG CAG CCCCTG G CTG ATTAATG GCACTTATCAATATTG G CCATCATTAGTAGTTTT TTG G G C AC AG GAG CAG AG AC AATG CCAGTG CTTCTG G G G G C AG AAATAAG ATG CAC CAG CAC AG AG CC ACAGTG G CCTG TCACCTTG CATG G G AC ATTGTG G G G CTTG CTAGT CTTG TTCCCCAGTAG CCTCTCC AAATAG G G ACAATG GAG AG CTTG G CCAAG ATG G CG GCCCCTAGATGGCTGTGGGTTCCTCCTTGGAGCATGGAACACCAAGACCAACATGAC CATTGTAGTTCCCAGTAGTGTCAAAAGCCTTGAACC( G1GTCCACCGGCCGCCAAGC GTCTGTTTCTGTATGAGCAGGGTTTTAGAACCTCCCTTGAGGGAGGGATGTGCTCAG GGAAGATGAGTAGTCTGGGAGCTCCACGACTTGGTCCTCATGTCCTTACCTTGGTGA CGGGGACCCACTCCTTGTCTTGGCTTTGCCTCCAAGAGCTCCCTGGCCTCGTCTGA(T TCTGA(T/C)CACAGCCCCCACGGCTGCCAGATCACTGCCTCCACCTCTTACT|C QCT GGCCCCAGGTCCTCCATGCCTCCTGGGGTTCCAGGATCATCTCCATTTCCCGAATAA GAG G CTG CCTTTCTAGG ACCTTTATTTTAATTCACTCTGTTTTGTAT(T C) G ATTATTTTi^ /TiGGTTGTTGAATTAAAAGTTCTTAACTAGACAGGAACCTTGAC(C/T
)TTTTTGTCTCTGTGACTCTATTGAAATGGATGCTTATTTTGAACTGTAACAGTATTTTTT ATCTAACAGTTAAAATCCTTCAG GTTG CCACACTG AACTAACTTTAAGTTTGTG G G G CT TTGGGAAGTGTAGGGAGCAGGGAAAGGCTGGTGATTCTTGGTGTTTGTTTTTGTTTTG CTTTGTTTTGTTGGGGGGTGTTGGTTTTGTTTTTGTTT(T/G)T(G/C)TTTTTCTGAGACAG GGTTTCTCTGTCTAGCCCTAGTAGCTATCCTGGAATTCACTCTAGACCAGGCTGGCCT CAAACTCAGGCCTGCCTCTGCTGGGATTAAAGG(T/C)GTGTGCCACCAGTGCCCTCT GTCTGTTGCTGCTTTTAAATAAGTATTTTTATTGCAGGTACGGGTGGTTCTCAAATACA GGCATGTTGATGGGAATTTGTGTATCAAAGTAACGGATGATCTAGTTGTAAGTATAC ACTTTTACTTGTTGGGTCGGGGGATTTGAGTTGACTACTTGTTTGAGGTTGTTCATGTA GAGTCT(G/A)CAGATGACCTACTAGGTGCATGCGTCCCACATGGAAGAACTTGGTTCT AAAGTTCTTCTTTTAGACTCAACAAATAACGAACTTGCTCCATGAAGACAGTGTGTCAG CTGTGGCTCAGTAGACCTTCTTCAGACCTGGCCAGAGAAACAAGACAAACTGAGTAG GTTTCCTTCTCATG G G AAG AAG CAAATG ATTATATAG AGTCTTTGTTTTTG G G ACAG GT TCTGTCTGTTTTCCTGGCTGTCCATGAACTCAGTATGTAGI—
i ¾lACCAGGCCGGCCTCGAACTCAGAGTGCTATTATCAACATATACTACCATGCT TTGCTCTGTAAATGATGACAAAC(A/C)GAGCCAGGGACTCGTTACTGTCCGTCTGTCT
GTCTGCCTCCC(-/T)CCC( - TCCCTTCCCTDCCTCCCTGTGCAGCCCTCCACT
GGTA(C/T)TGCfcCTTGTGTGAGCTC
TCACCTCCTGTTCCTTTTTTGTGGTGTGAAGACC(A/G)TTCTCTGATTTTCTAGCCCTGG TA{G/A)CTCTACTTTATGTTGCCTTTGCTTTTCTGTGTTCCCC| TCTGCTAAT
TATTAGATGTTTCTATTGTGTTTTATAACAAAGGAAAAAGAGCCAAGGATGTGTTTGATA
A(G/A)AGGCGCGGTATGGTGAGGTGGGAGGGGTGCCTCGGCGGGCCCATGCAGAG CCAAGGATGTGTTTGATAA(G/A)AGGCGCGGTATGGTGAGGTGGGAGGGGTGCCTCG GCGGGCCCATGCTGAAGTTTCCCTTCCCC(^|TGAGAGACCAGCTGAAGTTTC CCTTCCCCCTGAGAGACCAGCCATAGGACAGGTATAGTGTAGAATAGTGTATTTAGG GCATGGGAA(A/G)GGGAGTTGGGAAGGGAGTAGAGACAGAAGGGGGTGGGGGAAG GAG AG GAG AG G CTG G CCAG G AACATGTG G G G AAG GAG GAG AG G G G AAG G G G AG A GAGGGAGAAAGAGTTCAGAGAGAAGAGATGGCCAGGAACATGTGGGGAAGGAGGA GAG G G G AAG G G G AG AG AG G G AG AAAG AGTTC AG AG AG AAG AG AG G CAG AG AAAG A GAAGGGGCAGAGAGCAAGGGCAGAGAAAGAGAAGGGGCAGAGAGCAAGAGAGAGG AGGGGGCAAACGGCCCCTTTTATAGTAATCCAGCCATATTAGCGGTTGCC|A G|TGTA ACTGTGGGGTGGAGCCTAGAAGGAATGCTAACAGTTTCCCCATAAATACTGCATTTTA CCAG CATTCTG G CCTTG G CTATTCTTCTG AG CAGTTCATTTG ATTCCTG CAGTCTGGT GCTTCCTATAGCATGTCTGCTTGGGCATTTATGTATGTGGTCCGTCTTTCTTCTGAGGC TCTGACTAACTCTGAAGTCAGGTAATTTTTCTTCATGCAGCTGTTAGAGTTAGCCTTCC CAGAGTGGATCTTTTCAGCTCTTCCTGCCAGTAGGCATGCTGTC(A/C)ACCACCTGCC AGAAACCTGGT(A/G)TCTTAGGGTTTTACTGCTGTGAACAGATACCATGACCAAGTCAA GTCTTATAAAGGACAAC(A G)TTTAATTGG(A G)CCTGGCTTCCAGGTTCAGAGGTTCA GTCCATTATGAAGGTGGGAGCATGGCAGTGTCCAGGCAGGCATGGTGCAGGAGGAG CTG AG AGTTCTAC ATCTTCACCTG AAG G CTTCCAG G CAG CTAG G ATG AG G GTCTTAAA GCCCA(AA/TG)CC(T7C)ACAGTGACATGCCTACTCCAACAAGGCCACATCTCCTAATAG TG CCACTCCCTG G G CC AAG CAC ATACAAG C ( AT/C A)TCACAG CTG G CATG G CATTTTC CCCTTCCCTTCTCCTGTTATG CCTACTG CTG GTTTACTTG AAAAAGTG G CATTTTG ATC
Figure imgf000039_0001
TCTCCCCC(C£OCCCCCCCATTCAAGGGTCTTCCACAGCTACACCTGCTGTACTATTG AGCATATCTCTAGCCTGCTGGAATGATTTTTAAAAGTGCAAACTTGATTAATTCCTTTTA AAAAATCCTCTTACTTTTGGTATAGCATTGGAAATGTAAATGAGTTAAATACCTAATAAA AAATGGAAAAAAAAAAATCCTOTj^
GTTTTTTTCTACTTTACTTAAGAGACTATTTTTCTCAAGTTGGAAAT(C/A)TATAAATATAT AAATTC|C/AlCCTTAATAGTAAAiiT}AGTCTTCTTTTGTTTCCTGATACAGGGTCTC ATGAiC^CCCACACTAACCTGACTTGCTGTGTATCTGAGAATAATGTTAAACATTTTG ACATTTATTTATTTTAGGTGTTTGGGTATTTTGCTGCATGTCTGTGTGCCA(A G]ATGCA TGCCTGTGCCTTAGCAAGCCTGAACAGGGCGCCAGTTCCCTGGAGCTGGAiC/GlCTA (T7C)AGG(TC ^
CTAl^lAA^GTTTCTTTACTTTCCTCTATGGCAATGGCATTTAAAAATAGA
AAATTAAG CTAG G ATTAAAG AAAAG G GTAAG AAAG CAGTTG CTG G CTG CTCG GTATG GCACCTGAGAGAGCAGAGCAGAATCCGGCAGTAAAGGCTCCCGCGTGTTTGCCTAC TCACTG G CTTCTGTCACTACTG CTATCTG G ATTTG CTCAGTTTGTGTATCTTTCCTTTCT CTGACAGTGTTTGGTGTACAGAACAGACCAAGCGCAAGACGTAAAGAAGATTGAGA AATTCCACAGTCAGTTAATGCGACTTATGGTGGCCAAGGAATCCCGCAATGTCACT ATGGAAACAGAATGAATGGTTTGACATGAAGACGACTGTT|C/A1CGTT|A/G1TTGGGA AGT AATC AG CTTT Q7»}G AAACTG AG AGTGTTG G G (A/G) AG G A ATACTTAC (G A TAAIX^IGGAGCTGTCAAAGCCGAGAGACCAGCCTGCGTCCTAAAGTTTGCTT^
GAGTAGGAATGTCGGGGTTTCCAGTTAGAAAACCTTTATTTTTGGAAACGGAATAAA AATCTCTTAGAAACTTTTGCAGATAATTTGATGTTGGGCAAATATATATAATTATTTTT TCTGGTAAATTCATGTCAGTAATTTGTTGAAGAGTTAACAAGAAAAGGTCTTTCTAG ATTGTGTCTAAGATGAAATAAAATGTAACTTTTGCTGCAGTGGTATGTTTCTTTTGGA GTACAACATGTATGCCGTTTACAACACACACATGGTAACGGGGATCACATGCTCCA TGGTGCGCACGATCCTGTGGTGTGAAGAGCAGGTCTGCTTTACCTTTCTTGCCAGGT TCAAACTGTGTTTTTAAATGGAAGGGAT(T7C)TGTGGCATCCACTTGCTGAGCGGTGAA CAGAGCGAGACGCAGTTATGTGTGCACCGGCAGATACTGACACTGATGGCTGACAGT GTGTGCGTCCTTCACGCCGGTGTGCA(A/G }CGTACGCAGTGT(T7G }TACTCAGTGTGG CTCCiC/T)GCCTCAGACTGAATTAAAGTATTACTATAGCATGCCTCTCAGAACTGCTAG CTTCCT(A/C)ATAAACCACAAATCCACCGTTTCTATGTAGCTTGTATTTGTAAAGTCTGA GTTTACCGTCTGAATGTAAAGTTCCGTGTTGTCCGCTCACGACGGAAGTGAAGAAGAT ACTGCATTCAAGTGTTTTTTGTAAAAGTTTGTCATGGTGAATAACTTGAAATTTTTATTA GTTATAAGAATTTTAGTCTGTTTTAGAGGTCAGTAAATAAAATACAAGCATCCTGG(T7C) TTTGTTGAAGTTTTGGATTTCTTGTATAGGTTTCTTTTGTTTCCTTCTCTTTGTTTAGCTA GGGTCTCACTAGCCCTGGTTGTCCTGGAACTCATTGTAGAGGCCAGGCTGGCCTTGA ACTTACAGAGA
Example 2. Evidence supporting a role of Srp14 in the susceptibility for febrile seizures.
Animals
Breeding pairs for C57BL6/J, C57BL/6J-Chr 2A/NaJ (CSS2) and C57BL/6J-Chr 2PWD/Ph/ForeJ (CSS2-PWD) were obtained from The Jackson Laboratory (Bar Harbor, ME, USA). To produce F-i hybrids, C57BL/6J and CSS2 males and females were reciprocally outcrossed. Thereafter, F-i hybrids were intercrossed producing 143 F2 progeny (61 (male:female = 25 : 36) originated from CSS2 mothers and 82 (male:female = 52 : 30) from C57BL/6J mothers.
Animals were kept in a controlled 12 hour light-dark cycle (lights on: 7:00 a.m. to 7:00 p.m) with a room temperature of 22 ± 1 °C and a humidity of 50-70%. Food and water were available ad libitum (21 1 1 RMH-TM diet; Hope Farms/Arie Blok BV, Woerden, the Netherlands). All animals were housed in wire topped (Macrolon© Type II) cages (Techniplast, Milan, Italy) with sawdust bedding and a paper tissue for nest building. All experiments were performed according to the institutional guidelines of the University Medical Center Utrecht.
Phenotypic screen for eFS (experimental febrile seizure) susceptibility.
FS susceptibility in inbred mice was measured as described earlier (Hessel et al., Genes Brain and Behavior 8, 248-255, 2009). Prolonged eFS were induced by exposing 14-day-old mice (P14) to a warm-air stream to induced hyperthermia. Susceptibility to eFS was determined by measuring the latency to tonic-clonic seizures (febrile seizure latency = FSL), a phenotypic parameter which has previously been validated by video/EEG monitoring (Hessel et al., Brain and Behavior 8, 248-255, 2009). On P1 litters were culled to 4-6 pups with a balanced male:female ratio, when possible. On P10 a temperature sensitive transponder (IPTT-300, (BioMedic Data Systems) Plexx BV, Elst, The Netherlands) was injected subcutaneously (separation time from the mother < 2 min) in pups weighing > 5.0g. At P14 individual pups (weighing 6.5 - 8.0 gram) were exposed to a pre-heated warm-air stream of 50 ± 0.5 °C until they develop FSL. Core body temperature was measured with a wireless temperature reader (WRS-6007, (BioMedic Data Systems), Plexx BV) throughout the experiment. Mice were immediately sacrificed after hyperthermia and tail, spleen and brain were collected for genotyping. All experiments were performed between 10:00 a.m. - 4:00 p.m. Parents of origin, gender and body weight (BW) were recorded for covariate analysis. FSL of the complete CSS2-F2 progeny was determined within a period of two months. During that period FSL of C57BL/6J (n=9) and CSS2 (n=9) was also measured to monitor stability of the eFS susceptibility phenotype.
Genotyping and genetic map construction
DNA was isolated from tails as described by Kas et al. (Genes Brain and Behavior 98, 13-22, 2009). DNA concentration was measured on agarose gel and diluted to 10 ng/μΙ. To generate a genetic map fifteen microsatellite markers distributed over chromosome 2 were chosen from the mouse genome database based on the presence of allelic differences between the A J and C57BL/6J inbred strains (Mouse Genome Informatics, http:/7www.informatics.jax.Oi"9). Microsatellite marker genotyping (Williams et al., 2001 ) was performed by PCR. Primers (150 nM forward/reverse) flanking these markers (Sigma-Aldrich, Zwijndrecht, the Netherlands) were used to amplify the DNA (50 μg reaction) in a Veriti 96 wells thermocycler (PCR system, Applied Bioscience Inc., Foster city, CA, USA) using Super Taq polymerase (SphaeroQ, Gorinchem, The Netherlands: 0.25 units/reaction). The PCR products were separated on 3% agarose gels and visualized by ethidium bromide staining. Two additional TaqMan SNP primers were used for fine-mapping. SNP genotyping was performed as described (Kas et al., Genes Brain and Behavior 98, 13-22, 2009). The two SNP markers were selected using Genenetwork (http://www.genenetwork.org/): rs27498297 and rs27434812. Primers (Taqman SNP genotyping Assay, Applied Biosystems, USA) were used to amplify the DNA (10 ng/reaction) using TaqMan Universal PCR Master Mix, Applied Biosystems, USA. SNP analyses were done with a sequence detection system (7900HT, Applied Biosystems, Foster City, CA, USA). Segregation ratio of the genotypes of individual markers was checked by means of the Chi-squared goodness-of-fit-test. None of the markers showed (p < 0.05) segregation distortion (AA:AB:BB ratio 1 :2: 1 ) for any of the sub- F2 populations. Cox et al. (Genetics 182, 1335-1344, 2009) have constructed a revised genetic map of the mouse genome and demonstrated that utilization of the revised map improves QTL mapping. Therefore, marker positions (in cM) were taken from this map by using the 'mouse map converter' (http://cgd.jax.Qrq/mousernapconverter/ ). QTL mapping
The location of the FS susceptibility QTLs and the variance explained by each locus were determined using the MapQTL® software package, version 4.0 (Van Ooijen et al., 2002). Because the parameters were normally distributed, the interval mapping module was used. Results were expressed as LOD scores. Based on Lander and Botstein (Genetics 121 ,185- 199, 1989), having an average distance between markers of 4.95 cM, and taking into account that a genetic scan was performed across a single, complete chromosome rather than the entire genome, an association was assumed significant when the LOD score was≥ 1 .63. Output from MapQTL® was converted to figures using the graphics program MapChart. Epistatic interactions for marker pairs were tested with a two-way ANOVA. Homogeneity of variances was tested using the Levene's test. All within-group FSL data were normally distributed and subjected to a one-way ANOVA with genotype-group as main factor.
Statistics
The phenotypic characteristics of C57BL/6J and CSS2 mice were normally distributed and subjected to a two-way analysis of variance (ANOVA) with strain and gender as main factors. A Type IV sum of squares was used for the ANOVA since the data were unbalanced. unbalanced. Homoscedasticity was tested using the Levene's test, which is a powerful and robust test based on the F statistic. If the ANOVA showed significant effects the group means were further compared with the unpaired Student's f test. The unpaired Student's f tests were performed using pooled (for equal variances) or separate (for unequal variances) variance estimates. The equality of variances was tested with the Levene's test. For the unpaired Student's f test with separate variance estimates, SPSS® uses the Welch- Satterthwaite correction.
Performing many ANOVA's in the F2 population increases the risk of a Type I error. To avoid this, the level of statistical significance for these ANOVA's was adjusted by using the so- called Dunn— Sidak method (a = 1 - [1 - 0.05]1/ γ; γ = total number of DNA markers [17, α ~ 0.003]). In all other cases (i.e. the Kolmogorov-Smirnov one sample test, Levene's test, statistical testing of host and consomic strain, Pearson product moment correlation, Chi- squared goodness-of-fit-test) the probability of a Type I error < 0.05 was taken as the criterion of significance.
Candidate gene selection
The 1 -LOD support interval was estimated using linear interpolation calculations. Coordinates were obtained with NCBI Build 37. Genes present in the 1 -LOD support interval were selected on http://www.informatics.jax.org/. Genes on chromosome 2 previously implicated in human FS or epilepsy were studied using OMIM (http://www.ncbi.nlm.nih.gov/sites/entrez?db=:OIVllM) or CarpeDB http://www.carpedb.ua.edu/. Haplotype mapping was done with perlegen (http://mouse.perlegen.com/mouse/index.htmn. SNP differences between A/J and C57BL/6J were studied with genenetwork (www.genenetwork.org ) and mouse phenome database (http://www.informatics.jax.org/). Pathway analysis on brain expressed genes in all mouse FS susceptibility QTLs we mapped so far, was performed on (http://bioinfo.vanderbilt.edu/webgestalt). In situ hybridization
Radioactive in situ hybridization was performed as described (van der Hel et al., Genes Brain and Behaviour 8, 248-255, 2009). CSS2 (n = 6) and C57BL/6J (n = 6) brains were dissected from naive P14 mice, snap frozen and stored at -80°C. Coronal (16μη"ΐ) sections were cut with a cryostat (Leica CM3050, Rijswijk, The Netherlands), collected on glass slides (Superfrost Plus, Thermo Scientific, Braunschweig, Germany) and stored at -80°C. Sense and antisense probes for Srp14 were synthesized using mouse cDNA as a template. The primers were designed using the mRNA sequence of Srp14 provided by the PubMed nucleotide database (http://www.ncbi.nlm.nih.gov/pubmed; NM_009273.4) and the online Primer3 program (http://frodo.wi.mit.edu/primer3/input.htm): forward primer: 5' G AGAG CG AG CAGTTC CTG AC 3' and reverse primer: 3' G C C AC AC AG C AC AAATC AAA 5'. DNA sequences were confirmed by sequencing, and used for the preparation of the probe (BaseClear (Leiden, the Netherlands). Partial cDNA was inserted in a p-GemT easy vector and verified by digestion with restriction enzyme NC01 . Riboprobes were synthesized using T7 and SP6 RNA polymerase and labeled with [a-33P] UTP (ICN Biomedicals, Irvine, CA, USA).
Dehydrated air-dried slides were exposed to X-ray film (Kodak Bio-Max MR, VWR,
14
Amsterdam, The Netherlands) for 3 days with C-microscales (Amersham Pharmacia Biotech, Buckinghamshire, United Kingdom). Hybridization of P-labeled probes was quantified with ImageJ 1.43 (Maryland, USA). Human tissue
Hippocampal and neocortical tissue used for qPCR analysis was obtained from patients who had surgical treatment for pharmaco-resistant TLE (van der Hel et al., 2005). Patient details are summarized in supplementary table 3. Informed and written consent was obtained from the patients for all procedures as approved by the Institutional Review Board. For qPCR analysis we compared TLE patients with hippocampal sclerosis (HS; n= 6) and without hipppocampal sclerosis (non-HS; n= 6) with autopsy control patients (n=7) obtained from the Netherlands Brain Bank (NBB). Hippocampal sclerosis was graded according to Wyler et al. (1992), only patients with severe hippocampal sclerosis (Wyler grade 4) or patients without hippocampal sclerosis (Wyler grade 0) were selected. RNA was isolated as described (van Gassen et al. 2008).
Quantitative RT-PCR
Srp14 mRNA expression was studied in human brain homogenates. Extracted RNA was DNAse treated with RNeasy mini kit (Qiagen, Valencia, CA). cDNA was synthesized with superscript 2. The qPCR reaction was performed using the LightCycler (Roche, Almere, NL) and the Fast Start DNA Master PLUS SYBRgreen I kit (Roche). Primer (Sigma Genosys, Cambridge, U.K.) Forward primer: 5' AG G GTACTGTG G AG G G CTTT 3'; Reverse primer: 3' CTGTTGTTGGTGCTGTTGCT 5'.
Gene expression was calculated as normalized ratio and normalized to two reference genes. cDNA from the common reference pool was used for calibration. The reference genes (Proteasome 26S subunit, non-ATPase, 2 (PSMD2) and DEAD (Asp-Glu-Ala-Asp) box polypeptide 48 (DDX48)) were selected because of their housekeeping function and their microarray expression strength and stability (van Gassen et al., Epilepsia 49, 1055-1065, 2008). All samples were analyzed in duplicate and reported as mean ± standard error of the mean (SEM). Both reference genes gave similar results.
Results:
C57BU6J versus CSS 2
First we confirmed that CSS2 (445.1 ± 15.1 sec) mice have a shorter FSL than C57BL/6J (597.4 ± 36.2 sec) mice (Fig.5, panel A) in a separate group of male and female CSS2 (n = 9) and C57BL/6J (n = 9) (two-way ANOVA: strain effect, Fstra 1 ) = 1 1 .867, p = 0.0001 ; gender effect, Fgender(1r 14) = 0.298, p = 0.594; interaction effect, Finteraction(i, i4) = 0.008, p = 0.929). The time-course of body temperature increase during exposure to hyperthermia did not differ between C57BL/6J and CSS2 mice (Fig. 5, panel B (time F(1,14) = 1704.63, p = 0.0001; timexgroup F(1 16) = 1 .363, p = 0.264). There was neither a difference in P14 body weight between the C57BL/6J (7.36 ± 0.24 g) and CSS2 (7.07 ± 0.13 g) (two-way ANOVA: strain effect, Fstra ^ U) - 3.091 , p = 0.101 ; gender effect, Fgender(1, ) = 0.439, P = 0.518; interaction effect, Finteraction(i, i4) - 1 .137, p = 0.304) nor a difference in the start temperature between the C57BL/6J (T start = 36.0 ± 0.1 °C) and CSS2 (T start = 35.9 ± 0.2 °C) (two-way ANOVA: strain effect, Fstrain(i, U) = 0.202, p = 0.660; gender effect, Fgender(1r 14) = 1 .153, p = 0.301 ; interaction effect, Finteraction(i, i4) - 2.502, p = 0.136)
QTL analysis CSS2
To map the QTLs for eFS susceptibility on chromosome 2, we bred a CSS2-F2 generation (n=143) by intercrossing F-i hybrids from a CSS2 x C57BL/6J outcross. As expected, phenotyping these genetically unique F2 mice revealed a (left) shift toward a shorter FSL compared to C57BL/6J mice (fig 6a). Two distinct QTLs were mapped on chromosome 2 (fig. 2b). The most proximal QTL2a (LOD-score 4.5) was responsible for 13.5% of the F2 phenotypic variance and the effect was recessive with respect to the A J grandparent's allele. The 1 -LOD support interval of QTL2a was 52,581 ,428 - 66,278,629 bp. QTL2b (LOD score 6.8) was responsible for 19.8% of the F2 phenotypic variance and the effect is also recessive for the A J grandparent's allele. The 1 -LOD support interval for QTL2b was 1 14,875,854 - 133,817,501 bp (fig. 6b). One way ANOVA was performed for each marker and genotype. Taking body weight parent of origin or gender as covariate did not effect the 1 -LOD scores significantly (data not shown). QTL2b
The 1 -LOD support interval of QTL2b contains 273 genes (excluding 65 predicted (GM) genes) of which 165 are known to be expressed in brain. To fine-map the QTLs on chromosome 2 we measured FSL in CSS2 from the PWD/Ph donor strain (CSS2-PWD, fig. 3) and compared it to FSL of CSS2 and C57BL/6J with a one-way ANOVA ( Fstrain 2,25 = 36.080, P< 0.0001 . The FSL of CSS2-PWD (1037.1 ± 75.2 sec) is significantly longer compared to the CSS2 (445.1 ± 15.1 sec; p = 0.0001 ) and C57BL/6J (597.4 ± 36.2 sec; p=0.001 ). Based on haplotype mapping of the three strains
(http://mouse.perlegen.com/mouse/index.html) the number of potential candidate genes in QTL2b can be reduced to 1 14, of which 49 are brain expressed. The most interesting of these 49 brain expressed genes are ΙΙ1β and Srp14.
111 β (129.190.306-129.196.875 bp) has previously been associated with FS in mouse (Dube et al., Ann. Neurol 57, 152-155, 2005) and human (Virta et al., Epilepsia 42, 9320-923, 2002; , Kira et al., Neurosci.Lett. 384, 239-244, 2005). No known SNP or haplotype differences were found for 111 β between CSS2 and C57BL/6J. Re-sequenced (forward and reverse) of the 111 β sequence in C57BL/6J, A/J and CSS2 (129,189,728-129,197,401 bp) did not identify any new SNPs,, and the haplotype did not differ between the strains. To further assess a possible role of I L1 β in FS susceptibility, we injected I L1 β in C57BL/6J mice 45 min before hyperthermia. The FSL of the I L1 β group (786.5s ± 308.15 sec) did not differ from the saline group (779.2s ± 144.54 sec) ( t10 = 0.053, p = 0.959). The start temperature of the I L1 β group (Tstart = 35.9 ± 0.1 °C) was significantly higher than that of the saline group (Tstart = 34.9 ± 0.2 °C) (tio = -3.972, p = 0.003), confirming the pyrogenic properties of IL1 β. No significant differences were found in the temperature increase during the experiment between the two groups (data not shown). Together these data show that it is highly unlikely that IL1 β contributes to the phenotypic difference between CSS2 and C57BL/6J.
The second interesting candidate gene in QTL2b is Srp (1 18301579..1 18305432). SRP14 is part of the ubiquitous signal recognition particle (SRP) and forms a heterodimer with SRP9. The Srp9 gene is a functional and positional eFS susceptibility gene as identified above after QTL mapping on chromosome 1 ; Srp9 shows differential expression between CSS1 and C57BL/6J (Hessel et al., example 1 ). In situ hybridization revealed a significantly higher Srp14 expression in the hippocampus of CSS2 (16.7 ± 0.7 KBq/g) compared to C57BL/6J (14.4 ± 0.6 KBq/g) (Figure 7a; t10 = 2.450., p = 0.034).
Interestingly, qPCR analysis of Srp14 expression in hippocampal homogenates resected from epilepsy patients to treat pharmaco-resistant TLE, showed (fig. 7b) that HS-TLE patients (3.42 ± 1 .2) have a higher Srp14 expression than non-HS TLE patients (1.00 ± 0.08) and autopsy controls (0.96 ± 0.22) (F 2,is = 5.949, p = 0.018; Autopsy vs non-HS, p = 0.538; Autopsy vs HS p = 0.015; non-HS vs HS p = 0.012 ). No difference between HS and non-HS patients was found in the expression of SRP68, another gene within the SRP complex, (F 2,ie = 14.346, p = 0.001 ;, autopsy vs non-HS p = 0.001 ; autopsy vs HS p = 0.0001 ; non-HS vs HS p = 0.361 ) indicating that the increase in Srp14 is not due to the altered hippocampal morphology related to the sclerosis.

Claims

1 . Use of an SRP9 protein and/or an Srp9 nucleic acid sequence and/or an SRP14 protein and/or an Srp14 nucleic acid sequence as a diagnostic marker.
2. Use according to claim 1 , wherein said diagnostic marker is for febrile seizures, complex febrile seizures, for complex epilepsy syndromes including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or for temporal lobe epilepsy.
3. Use of an SRP9 protein and/or an Srp9 nucleic acid sequence and/or an SRP14 protein and/or an Srp14 nucleic acid sequence in identifying a subject at risk of developing febrile seizures (FS), a subject at risk of developing complex FS, a subject at risk of developing a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or a subject at risk of developing temporal lobe epilepsy.
4. Method for identifying a subject at risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy, said method comprising the steps of:
a) providing a sample of a subject;
b) determining the level of at least one biomarker selected from SRP9 polypeptide,
Srp9 mRNA, SRP14 protein and/or Srp14 mRNA in said sample;
c) comparing the level of said biomarker to a reference level; and
d) determining whether the level of said biomarker is indicative of a risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
5. Method according to claim 4, wherein said subject is an infant or child.
6. Method according to claim 4 or 5, wherein said sample is selected from the group consisting of a whole blood sample, serum, and plasma.
7. Method according to any one of claims 4-6, wherein an increased level of said biomarker is indicative of a risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
8. Use of a SNP in the promoter region of the Srp9 gene, said SNP being selected from 5 the group consisting of rs6688819 (T/C), rs12403575 (G/A), rs16845266 (G/C), rs120398148 (T/C), and rs6659660 (G/A), for determining the risk in a subject of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
10 9. Use according to claim 8, wherein said SNP is rs12403575 G/A.
10. A method for identifying a subject at risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy, said method comprising 15 the steps of:
a) determining in a sample of a subject a SNP in the promoter region of the Srp9 gene, wherein the SNP is selected from rs12403575 G/A, rs6688819 T/C, rs16845266 G/C, rs120398148 T/C, and rs6659660 G/A, and preferably is rs12403575 G/A.
20 1 1 . Method according to claim 10, wherein the A allele of rs12403575 G/A is associated with an increased risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
25 12. Method according to any one of claims 10 or 1 1 , wherein the genotype of said subject for rs12403575 is determined, and wherein an AA genotype is associated with an increased risk of developing febrile seizure, complex febrile seizure and/or temporal lobe epilepsy.
30 13. Method according to any one of claims 10-12, comprising a further step of providing a sample of a subject.
14. Method according to any one of claims 10-13, wherein said sample comprises or is derived from blood, an amniotic fluid, cerebrospinal fluid, tissue from skin, muscle, buccal or 35 conjunctival mucosa, placenta, gastrointestinal tract or chorionic villi.
15. Method for identifying a subject at risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy, said method comprising the steps of:
5 a) determining in a sample of a subject the sequence of the Srp9 promoter sequence, wherein the presence of one or more de novo mutations is indicative of a risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
10
16. A kit comprising a probe or primer that distinguishes an allele of a SNP in a Srp9 gene in a sample from a subject, wherein the allele is selected from the A or G allele in the SNP rs12403575.
15
17. Kit according to claim 16 for determining an increased risk of developing febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy in a subject.
20
18. Kit according to claim 16 or 17, wherein the probe or primer is detectably labelled.
19. A method for screening chemical compounds or compositions interfering with the function of the SRP complex, said method comprising the step of identifying chemical
25 compounds or compositions that suppress expression of SRP9 and/or SRP14 polypeptide, that interact with SRP9 and/or SRP14 polypeptide and thereby prevent formation of the SRP9/SRP14 complex, and/or that interact with the SRP9/SRP14 complex and thereby prevent formation of the SRP complex.
30 20. A compound capable of selectively binding to SRP9 and/or SRP14 polypeptide, preferably an antibody capable of selectively binding to SRP9 and/or SRP14 polypeptide, for use as a medicament.
21 . A compound capable of selectively binding to SRP9 and/or SRP14, preferably an 35 antibody capable of selectively binding to SRP9 and/or SRP14 polypeptide, for use in preventing and/or treating febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
22. Use of therapeutic gene modulation for suppressing the level of SRP9 protein and/or SRP14 protein in a mammal.
23. Use according to claim 22, which is for preventing and/or treating febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
24. Srp9 and/or Srp14 nucleic acid modulator selected from the group consisting of antisense DNA, siRNA, miRNA, shRNA, ribozyme specifically binding to and cleaving Srp9 and/or Srp14 mRNA and zinc finger nuclease specifically targeting a nucleic acid sequence in the Srp9 and/or Srp14 gene resulting in suppression of Srp9 and/or Srp14 expression for use in preventing and/or treating febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
25. A recombinant nucleic acid construct comprising at least one transcriptional unit comprising:
- a promoter,
- a nucleic acid sequence encoding a gene suppressor selected from:
- an antisense DNA sequence complementary to the sense strand of the Srp9 and/or Srp14 gene;
- an interfering RNA molecule which is complementary to Srp9 mRNA and/or
Srp14 mRNA;
- a nucleic acid sequence encoding a zinc finger nuclease specifically targeting a nucleic acid sequence in the Srp9 gene and/or Srp14 gene;
- a nucleic acid sequence encoding a ribozyme specifically binding to and cleaving Srp9 and/or Srp14 mRNA; and
- a terminator,
for use in preventing and/or treating febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
26. A vector comprising a recombinant nucleic acid construct according to claim 25 for use in preventing and/or treating febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
27. A vector according to claim 26 comprising more than one transcriptional unit.
28. A cell comprising a recombinant nucleic acid construct according to claim 25 or a vector according to any one of claims 26-27 for use in preventing and/or treating febrile seizures, complex febrile seizures, a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or temporal lobe epilepsy.
29. A method for suppressing the level of SRP9 protein and/or SRP14 protein in a cell, said method comprising the step of including an Srp9 and/or Srp14 nucleic acid modulator according to claim 24 or recombinant nucleic acid construct according to claim 25 in said cell.
30. A kit comprising means for detecting the level of Srp9 mRNA and/or SRP9 protein and/or Srp14 mRNA and/or SRP14 protein in a sample derived from a subject.
31 . A kit according to claim 30 for use in identifying a subject at risk of developing febrile seizures (FS), a subject at risk of developing complex FS, a subject at risk of developing a complex epilepsy syndrome including FS, such as Dravet's syndrome and epilepsies with mental retardation, and/or a subject at risk of developing temporal lobe epilepsy.
32. A kit according to any one of claims 30 or 31 , wherein the kit comprises a primer pair allowing selective amplification of Srp9 and/or Srp14 mRNA.
33. A kit according to any one of claims 30 or 31 , wherein the kit comprises an antibody that specifically binds to SRP9 protein and/or SRP14 protein.
34. A kit according to any one of claims 30-33, wherein said sample derived from a subject is a sample derived from blood.
PCT/NL2011/050551 2010-08-05 2011-08-05 Markers of febrile seizures and temporal lobe epilepsy Ceased WO2012018258A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US37082510P 2010-08-05 2010-08-05
US61/370,825 2010-08-05

Publications (1)

Publication Number Publication Date
WO2012018258A1 true WO2012018258A1 (en) 2012-02-09

Family

ID=44583317

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/NL2011/050551 Ceased WO2012018258A1 (en) 2010-08-05 2011-08-05 Markers of febrile seizures and temporal lobe epilepsy

Country Status (1)

Country Link
WO (1) WO2012018258A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2499262C1 (en) * 2012-08-07 2013-11-20 Федеральное Государственное Бюджетное Учреждение "Научно-Исследовательский Институт Психического Здоровья" Сибирского Отделения Российской Академии Медицинских Наук Method for prediction of epilepsy severity
EP2770325A1 (en) * 2013-02-26 2014-08-27 Institut du Cerveau et de la Moelle Epiniere-ICM Mutations of DEPDC5 for diagnosing epilepsic diseases, disorders or conditions
CN111378744A (en) * 2020-05-14 2020-07-07 潍坊市妇幼保健院(潍坊市妇幼保健计划生育服务中心) Application of miR-148a-3p as diagnosis and treatment marker for febrile convulsion
RU2767271C1 (en) * 2021-06-11 2022-03-17 федеральное государственное бюджетное образовательное учреждение высшего образования "Ростовский государственный медицинский университет" Министерства здравоохранения Российской Федерации Method for diagnosing neuroimmune disorders in young children with epilepsy

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010071881A1 (en) * 2008-12-19 2010-06-24 Columbia University Method for confirming a diagnosis of rolandic epilepsy

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010071881A1 (en) * 2008-12-19 2010-06-24 Columbia University Method for confirming a diagnosis of rolandic epilepsy

Non-Patent Citations (39)

* Cited by examiner, † Cited by third party
Title
"Hybridization with Nucleic Acid Probes", vol. 24, 1993, ELSEVIER, article "Laboratory Techniques in Biochemistry and Molecular Biology"
"SNP rs12403575", NCBI DBSNP, 20 April 2004 (2004-04-20), XP055008522, Retrieved from the Internet <URL:http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=12403575> [retrieved on 20110930] *
ALBERT L. LEHNINGER: "Principles of Biochemistry", 1982, WORTH PUB., pages: 793 - 800
BACH DANIEL ET AL: "Characterization of APOBEC3G binding to 7SL RNA", RETROVIROLOGY, BIOMED CENTRAL LTD., LONDON, GB, vol. 5, no. 1, 2 July 2008 (2008-07-02), pages 54, XP021038057, ISSN: 1742-4690 *
BALIGA ET AL., FEDERATION PROCEEDINGS, vol. 27, 1968, pages 766
BERGER, KIMMEL: "Methods in Enzymology", vol. 152, 1987, ACADEMIC PRESS INC., article "Guide to Molecular Cloning Techniques"
BOVIA F ET AL: "The SRP9/14 subunit of the signal recognition particle (SRP) is present in more than 20-fold excess over SRP in primate cells and exists primarily free but also in complex with small cytoplasmic Alu RNAs.", MOLECULAR BIOLOGY OF THE CELL APR 1995 LNKD- PUBMED:7542942, vol. 6, no. 4, April 1995 (1995-04-01), pages 471 - 484, XP055008507, ISSN: 1059-1524 *
BURNETT ET AL., PNAS, vol. 95, 1998, pages 1432 - 1437
CHEN ET AL., NAT. MED., vol. 5, 1999, pages 888 - 894
COX ET AL., GENETICS, vol. 182, 2008, pages 1335 - 1344
COX ET AL., GENETICS, vol. 182, 2009, pages 1335 - 1344
DUBE ET AL., ANN.NEUROL, vol. 57, 2005, pages 152 - 155
FRENCH ET AL., ANNALS OF NEUROLOGY, vol. 34, 1993, pages 774 - 780
HESSEL ET AL., BRAIN AND BEHAVIOR, vol. 8, 2009, pages 248 - 255
HESSEL ET AL., GENES BRAIN AND BEHAV., vol. 8, 2009, pages 248 - 2550
HESSEL ET AL., GENES BRAIN AND BEHAVIOR, vol. 8, 2009, pages 248 - 255
HESSEL ET AL., GENES, BRAIN AND BEHAVIOR, vol. 8, 2009, pages 248 - 255
JUNG-HYUN RHO ET AL: "Proteomic Expression Analysis of Surgical Human Colorectal Cancer Tissues: Up-Regulation of PSB7, PRDX1, and SRP9 and Hypoxic Adaptation in Cancer", JOURNAL OF PROTEOME RESEARCH, vol. 7, no. 7, 1 July 2008 (2008-07-01), pages 2959 - 2972, XP055008502, ISSN: 1535-3893, DOI: 10.1021/pr8000892 *
KAS ET AL., GENES BRAIN AND BEHAVIOR, vol. 98, 2009, pages 13 - 22
KAS ET AL., GENES, BRAIN AND BEHAVIOR, vol. 8, 2009, pages 13 - 22
KAS ET AL., GENES,BRAIN AND BEHAVIOR, vol. 8, 2009, pages 13 - 22
KIRA ET AL., NEUROSCI.LETT., vol. 384, 2005, pages 239 - 244
LANDER, BOTSTEIN, GENETICS, vol. 121, 1989, pages 185 - 199
M VIRTA: "Increased frequency of interleukin-1[beta] (-511) allele 2 in febrile seizures", PEDIATRIC NEUROLOGY, vol. 26, no. 3, 1 March 2002 (2002-03-01), pages 192 - 195, XP055008510, ISSN: 0887-8994, DOI: 10.1016/S0887-8994(01)00380-0 *
MCPHERSON, MOLLER: "PCR", 2006, TAYLOR & FRANCIS GROUP
MORI MAYRA ET AL: "Differential early expression of novel genes in the hippocampus after pilocarpine-induced status epilepticus in inbred mouse strains with high and low seizure susceptibility", EPILEPSIA, RAVEN PRESS LTD, NEW YORK, US, vol. 42, no. Supple 7, 1 January 2001 (2001-01-01), pages 294, XP008143563, ISSN: 0013-9580, [retrieved on 20030820] *
MOZHUI ET AL., PLOS GENET., vol. 4, no. 11, 2008, pages E1000260
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory manual", 1989, COLD SPRING HARBOUR, N.Y.
SINGER ET AL., SCIENCE, vol. 304, 2004, pages 445 - 448
SMITS,B.M. ET AL.: "Generation of gene knockouts and mutant models in the laboratory rat by ENU-driven target-selected mutagenesis", PHARMACOGENET GENOMICS, vol. 16, 2006, pages 159 - 169
STEPHEN CUSACK ET AL, NATURE, vol. 408, no. 6809, 9 November 2000 (2000-11-09), pages 167 - 173, XP055008512, ISSN: 0028-0836, DOI: 10.1038/35041507 *
VAN DER HEL ET AL., EPILEPSIA, vol. 50, 2009, pages 1717 - 1728
VAN DER HEL ET AL., GENES BRAIN AND BEHAVIOUR, vol. 8, 2009, pages 248 - 255
VAN GASSEN ET AL., EPILEPSIA, vol. 49, 2008, pages 1055 - 1065
VAN GASSEN ET AL., GENES BRAIN AND BEHAV., vol. 7, 2008, pages 578 - 586
VIRTA ET AL., EPILEPSIA, vol. 42, 2002, pages 9320 - 923
WALTER, BLOBEL, FEDERATION PROCEEDINGS, vol. 40, 1981, pages 1557
WIEDMAN ET AL., PCR METH APPL, vol. 3, 1994, pages S51 - S64
YOUNG, DAVIS, PROC. NATL. ACAD. SCI.(USA, vol. 80, 1983, pages 1194

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2499262C1 (en) * 2012-08-07 2013-11-20 Федеральное Государственное Бюджетное Учреждение "Научно-Исследовательский Институт Психического Здоровья" Сибирского Отделения Российской Академии Медицинских Наук Method for prediction of epilepsy severity
EP2770325A1 (en) * 2013-02-26 2014-08-27 Institut du Cerveau et de la Moelle Epiniere-ICM Mutations of DEPDC5 for diagnosing epilepsic diseases, disorders or conditions
WO2014131468A1 (en) * 2013-02-26 2014-09-04 Icm (Institut Du Cerveau Et De La Moelle Épinière) Mutations of depdc5 for diagnosing epileptic diseases
CN111378744A (en) * 2020-05-14 2020-07-07 潍坊市妇幼保健院(潍坊市妇幼保健计划生育服务中心) Application of miR-148a-3p as diagnosis and treatment marker for febrile convulsion
CN111378744B (en) * 2020-05-14 2022-11-04 潍坊市妇幼保健院(潍坊市妇幼保健计划生育服务中心) Application of miR-148a-3p as a marker for diagnosis and treatment of febrile seizures
RU2767271C1 (en) * 2021-06-11 2022-03-17 федеральное государственное бюджетное образовательное учреждение высшего образования "Ростовский государственный медицинский университет" Министерства здравоохранения Российской Федерации Method for diagnosing neuroimmune disorders in young children with epilepsy

Similar Documents

Publication Publication Date Title
DeJesus-Hernandez et al. Expanded GGGGCC hexanucleotide repeat in noncoding region of C9ORF72 causes chromosome 9p-linked FTD and ALS
EP1978107A1 (en) Fto gene polymorphisms associated to obesity and/or type II diabetes
EP1907576B1 (en) SUSCEPTIBILITY GENES FOR AGE-RELATED MACULOPATHY (ARM) ON CHROMOSOME 10q26
KR20220153109A (en) Methods of diagnosing inflammatory bowel disease through rnaset2
EP2519653A2 (en) Methods for detecting and regulating alopecia areata and gene cohorts thereof
JP2009539960A (en) Protection and treatment against age-related macular degeneration
JP2020089370A (en) Method for predicting onset of extrapyramidal symptoms (eps) induced by antipsychotic-based treatment
JP6095889B2 (en) Chromosome 21q, 6q, and 15q gene mutations and methods for using them to diagnose and treat type 1 diabetes
WO2012018258A1 (en) Markers of febrile seizures and temporal lobe epilepsy
CA2790502C (en) Markers for obesity and methods of use thereof
KR102252926B1 (en) Genetic markers for antipsychotic induced weight gain and methods for use thereof
Ali et al. Association study of Klotho gene polymorphism with calcium oxalate stones in the Uyghur population of Xinjiang, China
US20090298764A1 (en) Gene and pathway and their use in methods and compositions for predicting onset or progression of autoimmune and/or autoinflammatory diseases
Rungroj et al. Prothrombin haplotype associated with kidney stone disease in Northeastern Thai patients
WO2012034189A1 (en) Methods of using mirnas transcribed from the 14q32 region of human chromosome 14 as biomarkers for schizophrenia or symptoms thereof
CA2568729A1 (en) Biomarkers for the prediction of responsiveness to clozapine treatment
EP2233585A1 (en) Test method for type-2 diabetes using gene polymorphism
US20080194419A1 (en) Genetic Association of Polymorphisms in the Atf6-Alpha Gene with Insulin Resistance Phenotypes
WO2021180858A1 (en) Therapeutic methods for the treatment of subjects with risk alelles in il33
WO2010033825A2 (en) Genetic variants associated with abdominal aortic aneurysms
Carstens Renin-angiotensin-aldosterone system genes and the complex hypertrophic phenotype of hypertrophic cardiomyopathy
Cunnington Investigation of the mechanisms mediating genetic susceptibility to cardiovascular disease on chromosomes 9p21 and 2q24
Långberg Impact of candidate genes on obesity and type 2 diabetes
KR20070022710A (en) Biomarkers to Predict Responsiveness to Clozapine Therapy
HK1149054A (en) Test method for type-2 diabetes using gene polymorphism

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11745837

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11745837

Country of ref document: EP

Kind code of ref document: A1