WO2012015903A1 - Treatment of type i diabetes mellitus (t1dm) in young newly diagnosed patients - Google Patents

Abstract

Provided is treatment of young (about 5 to 18 year old) patients with newly diagnosed type I diabetes mellitus (TIDM) by treating them with a DNA vector encoding an autoantigen associated with TIDM, including repeated administration (e.g. weekly administration) of the plasmid for an extended dosing duration (e.g. for at least about 52 weeks). Articles of manufacture for use in the claimed methods are also disclosed.

Description

TREATMENT OF TYPE I DIABETES MELLITUS (TIDM) IN YOUNG

NEWLY DIAGNOSED PATIENTS

FIELD OF THE INVENTION

[0001] The present invention relates to the treatment of young patients (about 5 years old to 18 years old) with newly diagnosed type I diabetes mellitus (TIDM) by treating them with a DNA vector encoding an autoantigen associated with TIDM, including repeated

administration (e.g. weekly administration) of the plasmid for an extended dosing duration (e.g. for at least about 52 weeks). The invention also concerns articles of manufacture for use in these methods.

BACKGROUND

[0002] Type 1 diabetes mellitus (TIDM) or insulin dependent diabetes mellitus (IDDM) is an autoimmune disease of children and young adults, affecting roughly 1 out of every 400-600 children in many geographical regions. TIDM results from immune destruction of the insulin-producing beta cells of the pancreas. The immune system mistakenly responds to normal proteins produced by the beta cells as a sign of an infection and gradually destroys these cells. Beta cells control glucose in the body by using insulin as a signal for other cells to take up glucose from the blood and use it as a source of energy. When the beta cells are destroyed, the body loses the capacity to make insulin and control glucose.

[0003] Patients with TIDM die soon after diagnosis if they are not treated with replacement insulin. Fortunately, insulin injections allow patients to live a relatively normal life.

However, injected insulin does not regulate glucose levels as precisely as insulin released by beta cells. As a result, TIDM patients may suffer complications of chronically high glucose levels, including blindness, nerve damage, kidney failure, heart disease, and blockages in blood vessels, as well as complications of abnormally low glucose levels after insulin injections, including seizures, coma, and death.

[0004] Immune responses in TIDM can be altered by vaccination. Various approaches include delivering proteins, polypeptides, or peptides, alone or in combination with adjuvants (immunostimulatory agents); delivering an attenuated, replication deficient, and/or nonpathogenic form of a virus or bacterium; or delivering vector (e.g. plasmid) DNA. DNA vaccination, or polynucleotide therapy, is an efficient method to induce immunity against foreign pathogens (Davis et al. Springer Semin. ImmunopatholA9:195-209 (1997); Hassett and Whitton, Trends Microbiol. 4, 307-312 (1996); Ulmer et al. Immunology 89:59-67 (1996)) and cancer antigens (Stevenson et al. PNAS 101 (2): 14646-14652 (2004)) and to modulate autoimmune processes (Waisman et al., Nat. Med., 2:899-905 (1996)). Following intramuscular injection, plasmid DNA is taken up by, for example, muscle cells allowing for the expression of the encoded protein (Wolff et al. Hum. Mol. Genet. 1 :363-69 (1992)) and the mounting of a long-lived immune response to the expressed protein (Hassett et al. J. Virol. 74:2620-2627 (2000)). In the case of autoimmune disease, the effect is a shift in an ongoing immune response to suppress autoimmune destruction and is believed to include a shift in self-reactive lymphocytes from a Thl - to a Th2-type response. The modulation of the immune response may not be systemic but occur only locally at the target organ under autoimmune attack.

[0005] Patent publications describing DNA vaccination for treatment of Tl DM include US Pat. No. 7,579,328, and 2008-0108585-A1 , "DNA Vaccination for Treatment of Multiple Sclerosis and Insulin-Dependent Diabetes Mellitus" (Steinman et al.); US Pat. No. 7,544,669 and US-2003-0148983-A1, "Polynucleotide Therapy" (Fontoura et al.); US-2005-0261215- Al , "Methods and Immune Modulatory Nucleic Acid Compositions for Preventing and Treating Disease" (Garren et al.); US 2010-0160415-A1, "Compositions and Methods for Treatment of Autoimmune Disease" (Solvason et al.); and 2003-0003516-A1, "Therapeutic and Diagnostic Uses of Antibody Specificity Profiles" (Robinson et al.), all of which are incorporated herein by reference.

[0006] BHT-3021 , now called proinsulin tolerizing plasmid (PTP), is an antigen-specific immunotherapy for treatment of T1DM. PTP is a plasmid expression vector that expresses the human proinsulin protein under the control of the cytomegalovirus (CMV) immediate- early promoter. Without being bound by any one theory, the intended mechanism of action is tolerization of insulin-specific T cells by expressing peptides derived from insulin in the major histocompatibility complex on antigen-presenting cells (APCs) in a non-stimulatory manner. Insulin is a key auto-antigen recognized by autoreactive T-cells that are involved in destruction of the pancreatic beta cells in T1DM. Expression of insulin-derived peptides on APCs through this non-stimulatory manner is expected to promote tolerance to beta cell auto- antigens. [0007] PTP is intended to stop the immune system from destroying beta cells. In T1DM, insulin is one of the key chemicals that the immune system mistakes as a sign of an infection. PTP is designed to expose immune cells to fragments of insulin in a way that corrects this mistake and turns off the destructive immune cells, a process called "tolerization." By turning off the destructive immune cells, beta cells are preserved and the body continues to make its own insulin, and glucose control is more precise.

[0008] A safety study of PTP in adults with T1DM is underway and preliminary results have been recently presented at the following meetings: Gottlieb et al. "Interim Results of a Phase I/II Clinical Trial of a DNA Plasmid Vaccine (BHT-3021) for Type 1 Diabetes" American Diabetes Association, 69th Scientific Sessions (2009), New Orleans, Louisiana

(Abstract no. 1 14-OR) (June 5-9, 2009); Gottlieb et al. "Interim results of a phase I/II clinical trial of a DNA plasmid vaccine (BHT-3021) for type 1 diabetes" Abstracts of the EASD, Vienna 2009; Diabetologia, Volume 52, Supplement 1 (September, 2009); and Gottlieb et al. "One- Year Results from a Phase 1/2 Clinical Trial of BHT-3021 , a DNA Plasmid Vaccine for Type 1 Diabetes (TID)" American Diabetes Association, 70th Scientific Sessions (2010), Orlando, Florida (Abstract no. 66-OR) (June 25-29, 2010). In these phase I/II studies with PTP, patients were randomized (2:1 active :placebo) in a blinded, placebo-controlled trial in adult T1DM patients. Twelve weekly doses of PTP (0.3 mg, 1 mg, 3 mg or 6 mg) or saline placebo were given by intramuscular (IM) injection. Adverse event (AE) and laboratory data indicated that PTP was well-tolerated. The data further indicated that treatment with PTP may be associated with preservation of beta-cell function (as measured by C peptide levels) and improved glucose control (as measured by HbAlC).

[0009] Beta cell destruction and autoantibodies in children with T1DM have been studied. It has been observed that the rate of beta cell destruction is faster in young patients than in adults (Palmer J. Diabetes Metab. Res. Rev. 25:325-328 (2009)), and autoantibodies to insulin are more often detected in children than in indults (Wenzlau et al. Proc. Natl. Acad. Sci. USA 104: 17040-5 (2007)). Recently published studies investigating beta cell preservation therapies have indicated greater benefit in younger patients. Pescovitz et al. N. Engl. J. Med. 361 :2143-52 (2009); Keymeulen et al. Diabetologia 53:614-23 (2010). [0010] Effective treatments for young patients with newly diagnosed T1DM are needed. BRIEF SUMMARY OF THE INVENTION

[0011] The present invention relates to the use of PTP in patients most likely to benefit from therapy, specifically young patients recently diagnosed with TIDM. Patients, aged 5 to 18 who have been diagnosed with TIDM within the prior 3 months are treated according to the invention herein. Only patients who still have functioning beta cells, as determined by a blood test, are treated. Patients are treated for 1 year (52 weeks) with weekly intramuscular (IM) injections of 1 mg of PTP.

[0012] Accordingly, the invention provides method of treating early diagnosed type I diabetes mellitus (TIDM) in a patient aged about 5 years to 18 years comprising

administering to the patient a DNA vector encoding an autoantigen associated with TIDM.

[0013] In a further aspect, the invention concerns a method of treating type I diabetes mellitus (TIDM) in a patient aged 5 years to 18 years with diagnosis of TIDM within 3 months of initial treatment comprising administering to the patient weekly intramuscular (IM) injections of plasmid tolerizing plasmid (PTP) at a dose of 1.0 mg per injection for 52 weeks.

[0014] In one embodiment, the treatment will preserve beta cell function at the end of the 1-year treatment period, and/or improve glucose control, and/or reduce insulin requirements in the patient treated therewith.

[0015] The invention further concerns an article of manufacture comprising a container with a pharmaceutical composition comprising a DNA vector encoding an autoantigen associated with type I diabetes mellitus (TIDM) packaged together with a package insert providing instructions to administer the composition to a patient aged about 5 years to 18 years with early diagnosed TIDM.

BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1: Structural Vector Diagram of a PTP with component parts labeled. As depicted, PTP comprises a DNA vector including a DNA sequence encoding a human proinsulin autoantigen. A CMV promoter drives expression of human proinsulin. Bovine growth hormone termination and polyA sequences (bGH polyA) are incorporated 3' to human proinsulin. Vector propagation and selection is accomplished via pUC origin of replication and a kanamycin resistance gene, respectively. In this embodiment, PTP is 3324 basepairs and the location of each component is specified to the left of the vector map. [0017] Figures 2A and 2B: A PTP DNA sequence (SEQ ID NO: 1).

[0018] Figures 3A and 3B: A proinsulin DNA sequence (Fig. 3A; SEQ ID NO: 2) and a proinsulin amino acid sequence (Fig. 3B; SEQ ID NO: 3).

DETAILED DESCRIPTION OF THE INVENTION

I. Definitions

[0019] The terms "polynucleotide" and "nucleic acid" refer to a polymer composed of a multiplicity of nucleotide units (ribonucleotide or deoxyribonucleotide or related structural variants) linked via phosphodiester bonds. A polynucleotide or nucleic acid can be of substantially any length, typically from about six (6) nucleotides to about 10⁹ nucleotides or larger. Polynucleotides and nucleic acids include RNA, DNA, synthetic forms, and mixed polymers, both sense and antisense strands, double- or single-stranded, and can also be chemically or biochemically modified or can contain non-natural or derivatized nucleotide bases, as will be readily appreciated by the skilled artisan. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, and the like), charged linkages (e.g., phosphorothioates, phosphorodithioates, and the like), pendent moieties (e.g. , polypeptides), intercalators (e.g., acridine, psoralen, and the like), chelators, alkylators, and modified linkages (e.g. , alpha anomeric nucleic acids, and the like). Also included are synthetic molecules that mimic polynucleotides in their ability to bind to a designated sequence via hydrogen bonding and other chemical interactions. Such molecules are known in the art and include, for example, those in which peptide linkages substitute for phosphate linkages in the backbone of the molecule. [0020] A "DNA vector" refers to a genetic element that is capable of replication when present in a host cell. For purposes of this invention examples of vectors include, but are not limited to, plasmids, phage, transposons, cosmids, viruses, and the like. In one embodiment, the DNA vector is a DNA plasmid. The DNA vector is generally purified free of bacterial endotoxin for delivery to humans as a therapeutic agent. In addition to the DNA encoding one or more autoantigen(s), the DNA vector generally comprises one or more of the following DNA sequences: promoter, and optionally, enhancer, for regulating expression of the autoantigen (e.g. CMV promoter/enhancer); terminator/polyA sequence (e.g. bGH poly A); an origin of replication (e.g. pUC ori); marker gene(s) such as drug resistance gene(s) (e.g. kanamycin resistance gene); and/or introns or intronic sequence(s) for improving expression. Optionally, one or more CpG dinucleotides of the DNA vector have been substituted with non-cytosine nucleotide(s).

[0021] "Autoantigen" as used herein, refers to an endogenous molecule, typically a protein or fragment thereof, which elicits a pathogenic immune response in a subject, such as a patient with T1DM. Autoantigens and fragments thereof typically comprise one or more autoantigen epitope(s). [0022] By "autoantigen associated with T1DM" it is understood that the autoantigen is involved in the pathophysiology of T1DM either by inducing the pathophysiology (i.e., associated with the etiology of the disease), mediating or facilitating a pathophysiologic process, and/or by being the target of a pathophysiologic process. Autoantigens associated with T1DM include, for example, tyrosine phosphatase IA-2; ΙΑ-2β; glutamic acid decarboxylase (GAD) both the 65 kDa and 67 kDa forms; carboxypeptidase H; insulin, including mature insulin, proinsulin, and preproinsulin; heat shock proteins (HSP); glima 38; islet cell antigen 69 KDa (ICA69); p52; two ganglioside antigens (GT3 and GM2-1); islet- specific glucose-6-phosphatase-related protein (IGRP); zinc transporter Slc30A8, and an islet cell glucose transporter (GLUT 2). Unless indicated otherwise, the autoantigen herein is a human autoantigen, i.e. found in a human subject.

[0023] As used herein the term "autoantigen epitope" is understood to mean a portion of a protein having a particular shape or structure that is recognized by either B-cells or T-cells of a subject's immune system. The immunodominant epitopes of autoantigens targeted in T1DM have been described in the literature. See, e.g., Hawkes, et al, Diabetes 49(3):356- 366 (IA-2) (2000); Gebe, et al, Clinical Immunol 121(3) :294-304 (GAD) (2006); Lich, et ah, J Immunol 171 : 853-859 (GAD) (2003); Falorni, et al, Diabetologia 39(9):1091-98 (1996) (GAD); Patel, et al, PNAS 94(15):8082-8087 (1997) (GAD); Congia, et al., PNAS 95(7):3833-3838 (1998) (insulin); Higashide, et al., Pediatr Res. 59(3):445-50 (insulin) (2006); Marttila, et al, J Autoimmun. 31(2): 142-8 (2008) (insulin); Polanski, et al.;J

Autoimmun.\0(4):339-46 (1997) (insulin); Panagiotopoulos, et al., Curr Diab Rep. 4(2):87- 94 (2004) (review); and Descamps, et al, Adv Exp Med Biol. 535:69-77 (2003) (review). [0024] The term "human proinsulin" refers to a protein comprising a prohomone precursor to human insulin hormone. Human proinsulin may be processed in vivo or in a cell to generate mature insulin by proteolytic removal of the pro precursor sequence. The term includes amino acid sequence variants (including naturally occurring allelic variants) provided they are pharmaceutically active when administered via a DNA plasmid herein. In one embodiment, human proinsulin comprises the amino acid sequence of SEQ ID NO: 3.

[0025] The term "plasmid backbone" refers to the portion of a DNA vector other than the DNA encoding autoantigen(s).

[0026] The term "promoter" is used here to refer to the polynucleotide region recognized by RNA polymerases for the initiation of RNA synthesis, or transcription. Promoters are one of the functional elements of vectors that regulate the efficiency of transcription and thus the level of protein expression of a self-polypeptide encoded by a vector. Promoters can be "constitutive", allowing for continual transcription of the associated gene, or "inducible", and thus regulated by the presence or absence of different substances in the environment.

Additionally, promoters can also either be general, for expression in a broad range of different cell types, or cell-type specific, and thus only active or inducible in a particular cell type, such as a muscle cell. Promoters controlling transcription from vectors may be obtained from various sources, for example, the genomes of viruses such as: polyoma, simian virus 40 (SV40), adenovirus, retroviruses, hepatitis B virus and cytomegalovirus (CMV), or from heterologous mammalian promoters, e.g., β-actin promoter. The early and late promoters of the SV40 virus are conveniently obtained, as is the immediate early (IE) promoter of the human cytomegalovirus (CMV promoter). In one embodiment, the promoter comprises the DNA sequence of the CMV promoter within SEQ ID NO: 4.

[0027] "Enhancer" refers to cis-acting polynucleotide regions of about from 10-300 basepairs that act on a promoter to enhance transcription from that promoter. Enhancers are relatively orientation and position independent and can be placed 5' or 3' to the transcription unit, within introns, or within the coding sequence itself. An example of an enhancer herein is the CMV IE enhancer, e.g. comprising the DNA sequence of the CMV enhancer within SEQ ID NO:4. [0028] A "terminator sequence" as used herein means a polynucleotide sequence that signals the end of DNA transcription to the RNA polymerase. Often the 3' end of a RNA generated by the terminator sequence is then processed considerably upstream by polyadenylation. "Polyadenylation" is used to refer to the non-templated addition of about 50 to about 200 nucleotide chain of polyadenylic acid (polyA) to the 3' end of a transcribed messenger RNA. The "polyadenylation signal" (AAUAAA) is found within the 3' untranslated region (UTR) of an mRNA and specifies the site for cleavage of the transcript and addition of the polyA tail. Transcription termination and polyadenylation are

functionally linked and sequences required for efficient cleavage/polyadenylation may also constitute elements of termination sequences. An exemplary terminator/polyA sequence herein is the bovine growth hormone (bGH) polyA sequence, e.g. comprising SEQ ID NO: 6 or fragments thereof.

[0029] The term "intron" as used herein refers to intervening polynucleotide sequences within a gene or portion of a gene present in a vector that is situated upstream of or between "exons," polynucleotide sequences that are retained during RNA processing and most often code for a polypeptide. Introns do not function in coding for protein synthesis and are spliced out of RNA before it is translated into a polypeptide. An exemplary intron sequence for use in the vector herein comprises chimeric β-globin/Ig intron, e.g. comprising the DNA sequence in SEQ ID NO: 5.

[0030] An "origin of replication" comprises a sequence in a vector where DNA replication starts and/or which is involved in vector propagation. An exemplary origin of replication is the pUS ori, e.g. comprising SEQ ID NO: 8, or fragments thereof.

[0031] A "marker gene" is a DNA encoding protein(s) which can be used to identify host cells or host organisms that have been successfully transformed with DNA to which the marker gene is linked. The marker gene may encode a "drug resistance marker" or

"metabolic marker." Examples of drug resistance markers are antibiotic resistance biomarkers. One embodiment of the marker gene is a kanamycin resistance marker, which may, for example, comprise the DNA of SEQ ID NO: 7.

[0032] When used herein "proinsulin tolerizing plasmid," "PTP," or "BHT-3021" are used interchangeably to refer to a plasmid expression vector containing the coding sequence for human proinsulin. The plasmid is a modified mammalian expression pVAXl vector comprising a reduced number of immunostimulatory CpG sequence elements. It provides the bacterial sequence elements required for cloning and propagation of the vector as well as the expression elements necessary for mammalian expression, including human cytomegalovirus (CMV) immediate-early promoter/enhancer; a synthetic intron for increased protein expression, bovine growth hormone (bGH) polyadenylation signal, kanamycin-resistance gene, and pUC origin of replication. A diagram of the main structural elements of BHT-3021 is provided in Fig. 1, and the DNA sequence of PTP is shown in Figs. 2A-B (SEQ ID NO: 1). In one embodiment, PTP comprises the following DNA sequence:

GCTGCTTCGCGATGTACGGGCCAGATATACGcgttgacattgattattgactagttattaatagtaatcaattac ggggtcattagttcatagcccat tatggagttccgcgttacataacttacggtaaatggcccgcctggctgacc gcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattg acgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgcc ccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctac ttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtgg atagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaa tcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtggga ggtctatataagcagagctctCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTATCGAAATTAATACGACTCA CTATAGGGAGACCCAAGCTGGCTAGCgtaagtatcaaggttacaagacaggtttaaggagaccaatagaaactgg gcttgtcgagacagagaagactcttgcgtttctgataggcacctattggtcttactgacatccactttgcctttc tctccacagGCTTAAGCTTatggcctttgtgaaccaacacctgtgcggctcacacctggtggaagctctctacct agtgtgcggggaacgaggcttcttctacacacccaagacccgccgggaggcagaggacctgcaggtggggcaggt ggagctgggcgggggccctggtgcaggcagcctgcagcccttggccctggaggggtccctgcagaagcgtggcat tgtggaacaatgctgtaccagcatctgctccctctaccagctggagaactactgcaactagCTCGAGTCTAGAGG GCCCGTTTAAACCCGCTGATCAGCCTCGActgtgccttctagttgccagccatctgttgtttgcccctcccccgt gccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtct gagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcag gcatgctggggatgcggtgggctctatggCTTCTACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCA GCTGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTtGCgGCCAAGGATCTGA TGGCGCAGGGGATCAAGCTCTGATCAAGAGACAGGATGAGGATGGTTTCGCatgattgaacaagatggattgcac gcaggttctccggcagcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgat gccgccgtgttcaggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaat gaactgcaagacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgtt gtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgct cctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattc gaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctg gacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcgaggat ctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggcaggttttctggattcatcgac tgtggccggctgggtgtggcggacaggtatcaggacatagcgttggctacccgtgatattgctgaagagcttggc ggcgaatgggctgacaggttcctcgtgctttacggtattgcggctcccgattcgcagcgcattgccttctatagg cttcttgacgagttcttctgaATTATTAACGCTTACAATTTCCTGATGCGGTATTTTCTCCTTACGCATCTGTGC GGTATTTCACACCGCATCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAAT ACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATAGCACGTGCTAAAACTTCA TTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTC GTTCCACTGAGCGTCAGACCccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctg ctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttcc gaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccactt caagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataa gtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttc gtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgc cacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgaggga gcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgattttt gtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttg ctggccttttgctcacatgTTCTT (SEQ ID NO: 1)

The "subject" or "patient" herein is a human subject or patient. [0033] "Treating," "treatment," or "therapy" of a disease or disorder shall mean slowing, stopping or reversing the disease's progression, as evidenced by decreasing, cessation or elimination of either clinical or diagnostic symptoms, by administration of a DNA vector, either alone or in combination with another compound as described herein. In one

embodiment, the treatment will result in any one or more of the following: preserving beta cell function (e.g. based on C-peptide level relative to untreated patient, for instance as determined at the end of a 1-year treatment period); improving glucose control (e.g. based on glycated hemoglobin, e.g. as determined by HbACl test, at about 6 months, and/or at about 12 months); and/or reducing insulin requirements relative to an untreated patient. [0034] "Insulin-dependent diabetes mellitus," "IDDM," "type I diabetes mellitus," and "TIDM," refer to diseases characterized by the autoimmune destruction of the β cells in the pancreatic islets of Langerhans.

[0035] The patient with "diagnosis of TIDM" herein is one in whom an attending clinician has identified one or more signs or symptoms of diabetes. In one embodiment, diagnosis of TIDM can be confirmed by the presence of at least one TIDM autoantibody.

[0036] When used herein, the expression "early diagnosis of TIDM" or "early diagnosed" TIDM refers to the patient in whom TIDM has either been recently or newly diagnosed, e.g. wherein the patient has been diagnosed with TIDM within about 3 months of initial treatment with the vector, and/or wherein the patient's TIDM is in early stages or is not advanced, e.g. wherein the patient is determined to have functioning beta cells, for instance as determined by a blood test such as C-peptide in which a detectable level of C-peptide (e.g. > 0.03 nMol/L either fasting or stimulated by a caloric load such as a mixed-meal tolerance test (MMTT) indicates the presence of functioning beta cells and a MMTT-stimulated C-peptide level >0.2 nMol/L indicates a clinically meaningful level of beta cell function. [0037] A "therapeutically effective amount" of a vector refers to an amount of the vector that is administered at a particular frequency over a certain period sufficient to treat or prevent the disease as, for example, by ameliorating or eliminating symptoms and/or the cause of the disease. Therapeutically effective amounts of vector are in the range of about 0.3 mg to about 6 mg. A most preferred therapeutic amount of vector is about 1 mg (for example 1 mg) per administration. [0038] The term "dosing frequency" or "frequency of dosing" refers to the time interval between administration of the DNA vector. The dosing frequency of the DNA vector can be daily, weekly, bi-weekly (i.e., once every other week or twice monthly), monthly, bi-monthly (i.e., once every other month), semi-annually (i.e., twice yearly) or annually. In a preferred embodiment, the dosing frequency in a treatment regimen is weekly.

[0039] The term "dosing duration" refers to the timeframe that the DNA vector is repeatedly administered to a patient. In one embodiment, the dosing duration is about 52 weeks. It will be understood herein that a dosing duration of "about 52 weeks" includes about 12 months, or about 1 year. II. Descriptions of the Embodiments

A. DNA vectors

[0040] The invention herein involves a DNA vector encoding an autoantigen associated with T1DM. In one embodiment, the autoantigen is selected from insulin, proinsulin, or preproinsulin. In one embodiment, the vector comprises a PTP vector. The PTP vector comprises a DNA expression plasmid backbone and DNA encoding human proinsulin. The vector PTP also comprises a CMV promoter-enhancer, which drives the expression of human proinsulin; bovine growth hormone termination and polyA sequences; a pUC origin of replication for vector propagation; and a Kanamycin resistance gene for vector selection.

[0041] The backbone of PTP is a modified pVAXl vector in which one or more CpG dinucleotides or immunostimulatory CpG sequence elements of the formula 5'-purine- pyrimidine-C-G-pyrimidine-pyrimidine-3' or 5'-purine-purine-C-G-pyrimidine-pyrimidine-3' is/are mutated by substituting the cytosine of the CpG dinucleotide with a non-cytosine nucleotide. The non-CpG dinucleotide forms the core of a hexameric motif referred to as an "Immune Modulatory Sequence" (IMS). The pVAXl vector is known in the art and is commercially available from Invitrogen (Carlsbad, CA). In one exemplary embodiment, the modified pVAXl vector has the following cytosine to non-cytosine substitutions within a CpG motif: cytosine to guanine at nucleotides 784, 1 161 , 1218, and 1966; cytosine to adenine at nucleotides 1264, 1337, 1829, 1874, 1940, and 1997; and cytosine to thymine at nucleotides 1 158 and 1987; with additional cytosine to guanine mutations at nucleotides 1831, 1876, 1942, and 1999. (The nucleotide number designations as set forth above are according to the numbering system for pVAXl provided by Invitrogen.). [0042] The invention contemplates PTP vectors with added, deleted, or substituted nucleotides that do not change the function of the PTP vector, e.g., for expressing pro insulin and inhibiting an autoimmune response. Accordingly, the invention contemplates a vector comprising a polynucleotide encoding human proinsulin that shares at least about 90%, 91%, 92%, 93%, 94%, 95%, 95%, 97%, 98% or 99% nucleic acid sequence identity to SEQ ID NO:l , as measured using an algorithm known in the art, e.g., BLAST or ALIGN, set with standard parameters. Sequence identity can be determined with respect to, e.g., the full- length of the BHT backbone, the full-length of the proinsulin autoantigen, or the full-length of the PTP vector. [0043] Techniques for construction of vectors and transfection of cells are well-known in the art, and the skilled artisan will be familiar with the standard resource materials that describe specific conditions and procedures. The vector PTP is prepared and isolated using commonly available techniques for isolation of nucleic acids. The vector is desirably purified free of bacterial endotoxin for delivery to humans as a therapeutic agent. [0044] Construction of the vectors of the invention employs standard ligation and restriction techniques that are well-known in the art (see generally, e.g., Ausubel et al, Current Protocols in Molecular Biology, John Wiley Interscience (1990-2008); Sambrook and Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (2001)). Isolated plasmids, DNA sequences, or synthesized oligonucleotides are cleaved, tailored, and relegated in the form desired. Sequences of DNA constructs can be confirmed using, e.g., standard methods for DNA sequence analysis {see, e.g., Sanger et al. Proc. Natl. Acad. Set , 74, 5463-5467 (1977)).

[0045] Nucleotide sequences selected for use in the vector can be derived from known sources, for example, by isolating the nucleic acid from cells containing a desired gene or nucleotide sequence using standard techniques. Similarly, the nucleotide sequences can be generated synthetically using standard modes of polynucleotide synthesis that are well known in the art. See, e.g., Edge et al, Nature 292:756 (1981); Nambair et al, Science 223: 1299 (1984); Jay et al., J. Biol. Chem. 259:6311 (1984). Generally, synthetic oligonucleotides can be prepared by either the phosphotriester method as described by Edge et al. (supra) and Duckworth et al. Nucleic Acids Res. 9:1691 (1981); or the phosphoramidite method as described by Beaucage et al. Tet. Letts. 22:1859 (1981) and Matteucci et al. J. Am. Chem. Soc. 103:3185 (1981). Synthetic oligonucleotides can also be prepared using commercially available automated oligonucleotide synthesizers. The nucleotide sequences can thus be designed with appropriate codons for a particular amino acid sequence. In general, one will select preferred codons for expression in the intended host. The complete sequence is assembled from overlapping oligonucleotides prepared by standard methods and assembled into a complete coding sequence. See, e.g., Edge et al. {supra); Nambair et al. {supra) and Jay et al. {supra).

[0046] Another method for obtaining nucleic acid sequences for use herein is by recombinant means. Thus, a desired nucleotide sequence can be excised from a plasmid carrying the nucleic acid using standard restriction enzymes and procedures. Site specific DNA cleavage is performed by treating with the suitable restriction enzymes and procedures. Site specific DNA cleavage is performed under conditions which are generally understood in the art, and the particulars of which are specified by manufacturers of commercially available restriction enzymes. If desired, size separation of the cleaved fragments may be performed by polyacrylamide gel or agarose gel electrophoreses using standard techniques. [0047] Yet another convenient method for isolating specific nucleic acid molecules is by the polymerase chain reaction (PCR) (Mullis et al, Methods Enzymol. 155:335-350 (1987)) or reverse transcription PCR (RT-PCR). Specific nucleic acid sequences can be isolated from RNA by RT-PCR. RNA is isolated from, for example, cells, tissues, or whole organisms by techniques known to one skilled in the art. Complementary DNA (cDNA) is then generated using poly-dT or random hexamer primers, deoxynucleotides, and a suitable reverse transcriptase enzyme. The desired polynucleotide can then be amplified from the generated cDNA by PCR. Alternatively, the polynucleotide of interest can be directly amplified from an appropriate cDNA library. Primers that hybridize with both the 5' and 3' ends of the polynucleotide sequence of interest are synthesized and used for the PCR. The primers may also contain specific restriction enzyme sites at the 5' end for easy digestion and ligation of amplified sequence into a similarly restriction digested plasmid vector.

[0048] The expression cassette of the modified vector will employ a promoter that is functional in host cells. In general, vectors containing promoters and control sequences that are derived from species compatible with the host cell are used with the particular host cell. Promoters suitable for use with prokaryotic hosts illustratively include the beta-lactamase and lactose promoter systems, alkaline phosphatase, the tryptophan (trp) promoter system and hybrid promoters such as tac promoter. However, other functional bacterial promoters are suitable. In addition to prokaryotes, eukaryotic microbes such as yeast cultures may also be used. Saccharomyces cerevisiae, or common baker's yeast is the most commonly used eukaryotic microorganism, although a number of other strains are commonly available.

Promoters controlling transcription from vectors in mammalian host cells may be obtained from various sources, for example, the genomes of viruses such as: polyoma, simian virus 40 (SV40), adenovirus, retroviruses, hepatitis B virus and cytomegalovirus (CMV), or from heterologous mammalian promoters, e.g. β-actin promoter. The early and late promoters of the SV 40 virus are conveniently obtained as an SV40 restriction fragment which also contains the SV40 viral origin of replication. The immediate early promoter of the human cytomegalovirus is conveniently obtained as a Hindlll restriction fragment. Of course, promoters from the host cell or related species also are useful herein.

[0049] For in vitro evaluation, host cells may be transformed with the modified vector and cultured in conventional nutrient media modified as is appropriate for inducing promoters, selecting transformants or amplifying genes. One suitable method for transfection of the host cells is the calcium phosphate co-precipitation method of Graham and van der Eb (1973) Virology 52, 456-457. Alternative methods for transfection are electroporation, the DEAE- dextran method, lipofection and biolistics (Kriegler Gene Transfer and Expression: A

Laboratory Manual, Stockton Press (1990)). Culture conditions, such as temperature, pH and the like, which are suitable for host cell expression are generally known in the art and will be apparent to the skilled artisan.

[0050] Modified vectors of this invention can be formulated as polynucleotide salts for use as pharmaceuticals. Polynucleotide salts can be prepared with non-toxic inorganic or organic bases. Inorganic base salts include sodium, potassium, zinc, calcium, aluminum, magnesium, etc. Organic non-toxic bases include salts of primary, secondary and tertiary amines, etc. Such self-DNA polynucleotide salts can be formulated in lyophilized form for reconstitution prior to delivery, such as sterile water or a salt solution. Alternatively, self-DNA

polynucleotide salts can be formulated in solutions, suspensions, or emulsions involving water- or oil-based vehicles for delivery. In one embodiment, the DNA is lyophilized in phosphate buffered saline with physiologic levels of calcium (0.9 mM) and then reconstituted with sterile water prior to administration. Alternatively the DNA is formulated in solutions containing higher quantities of Ca⁺⁺, between 1 mM and 2M. The DNA can also be formulated in the absence of specific ion species. B. Compositions

[0051] The composition comprising a DNA vector, such as PTP, for therapeutic use is preferably formulated in a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition comprises calcium at a concentration about equal to

physiological levels (e.g., about 0.9 mM). In some embodiments, the pharmaceutical composition further comprises a divalent cation at a concentration greater than physiological levels. In some embodiments, the divalent cation is calcium. In some embodiments, the vector is formulated with calcium at a concentration between about 0.9 mM (lx) to about 2 M; in some embodiments the calcium concentration is between about 2 mM to about 8.1 mM (9x); in some embodiments the calcium concentration is between about 2 mM to about 5.4 mM (6x). In some embodiments, the pharmaceutical composition is endotoxin-free.

[0052] In some embodiments, the vector is formulated with one or more divalent cations at a total concentration greater than physiological levels for injection into an animal for uptake by the host T cells of the animal. In some embodiments, one or more physiologically acceptable divalent cations can be used, e.g., Ca , Mg , Mn , Zn , Al , Cu , Ni , Ba , Sr²⁺, or others, and mixtures thereof. In some embodiments, magnesium, calcium or mixtures thereof, can be present extracellularly at approximately 1.5 mM and 1 mM, respectively. Mixtures of two or more divalent cations can be used in combinations amounting to total concentrations of about 0.9, 2, 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, 45, 65, 90, 130, 170, 220, 280, 320, 350, 500, 750, 1000, 1500 mM, etc., and up to about 2M.

[0053] In certain preferred embodiments, the counterion can include P0₄, CI, OH, C0₂, or mixtures thereof. In other embodiments, the formulations may cause DNA to form particulate or precipitates with size distributions where the mean sizes, or the 80% particles, are in excess of about 0.1 , 0.3, 0.5, 1, 3, 5, 8, 15, 20, 35, 50, 70 or 100 microns. Size of such particulates may be evaluated by centrifugation, flow cytometry analysis, propydium iodide or similar dye labeling, or dynamic light scattering.

[0054] A pharmaceutical composition comprising the vector can be incorporated into a variety of formulations for therapeutic administration. More particularly, a combination of the present invention can be formulated into pharmaceutical compositions, together or separately, by formulation with appropriate pharmaceutically acceptable carriers or diluents, and can be formulated into preparations in solid, semi-solid, liquid or gaseous forms, such as tablets, capsules, pills, powders, granules, dragees, gels, slurries, ointments, solutions, suppositories, injections, inhalants and aerosols. As such, administration of PTP can be ^■ achieved in various ways, including oral, buccal, parenteral, intravenous, intradermal, subcutaneous, intramuscular, transdermal, intrarectal, intravaginal, etc., administration. Moreover, the compound can be administered in a local rather than systemic manner, for example, in a depot or sustained release formulation. In a preferred embodiment, the vector is administered intramuscularly.

[0055] Formulations suitable for use in the present invention are found in Remington: The Science and Practice of Pharmacy, 21st Ed., University of the Sciences in Philadelphia (USIP), Lippincott Williams & Wilkins (2005), which is hereby incorporated herein by reference. The pharmaceutical compositions described herein can be manufactured in a manner that is known to those of skill in the art, i.e., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes. The following methods and excipients are merely exemplary and are in no way limiting.

[0056] In some embodiments, the vector or DNA vector can be formulated for

intramuscular, subcutaneous, or parenteral administration by injection, e.g., by bolus injection or continuous infusion. For injection, the vector can be formulated into preparations by dissolving, suspending or emulsifying them in an aqueous or nonaqueous solvent, such as vegetable or other similar oils, synthetic aliphatic acid glycerides, esters of higher aliphatic acids or propylene glycol; and if desired, with conventional additives such as solubilizers, isotonic agents, suspending agents, emulsifying agents, stabilizers and preservatives. In some embodiments, the vector can be formulated in aqueous solutions, for example, in

physiologically compatible buffers such as Hanks 's solution, Ringer's solution, or physiological saline buffer. Formulations for injection can be presented in unit dosage form, e.g., in ampules or in multi-dose containers, with an added preservative. The compositions can take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and can contain formulatory agents such as suspending, stabilizing and/or dispersing agents.

[0057] For oral administration, the vector can be readily formulated by combining the inhibitory agent with pharmaceutically acceptable carriers that are well known in the art. Such carriers enable the compounds to be formulated as tablets, pills, dragees, capsules, emulsions, lipophilic and hydrophilic suspensions, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a patient to be treated. Pharmaceutical preparations for oral use can be obtained by mixing the compounds with a solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). If desired, disintegrating agents can be added, such as a cross- linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. [0058] Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers can be added. All formulations for oral administration should be in dosages suitable for such administration.

C. Methods of Treatment

[0059] The present invention provides a method of treating T1DM in a patient comprising administering to the subject a DNA vector exemplified by PTP. The patient or subject treated herein is preferably a young patient (from about 5 years old to 18 years old) and/or has early diagnosis of T1DM (e.g. where initial diagnosis is within about 3 months of a first administration of the vector and/or wherein the patient has functioning beta cells).

[0060] The vector can be administered in a pharmaceutically acceptable carrier. In one embodiment, the vector is administered in a pharmaceutically acceptable carrier or excipient comprising calcium at a concentration about equal to physiological levels (e.g., about 0.9 mM). In another embodiment, the vector is administered in a pharmaceutically acceptable carrier or excipient comprising a divalent cation at a concentration greater than physiological levels. In some embodiments, the divalent cation is calcium. In some embodiments, the calcium is at a concentration greater than about 2 mM; in some embodiments, the calcium is at a concentration of about 5.4 mM. In some embodiments, the vector is endotoxin-free. In some embodiments, the vector is administered intramuscularly.

[0061] A wide variety of methods exist to deliver polynucleotide to subjects, as defined herein. For example, the polynucleotide encoding a self-polypeptide can be formulated with cationic polymers including cationic liposomes. Other liposomes also represent effective means to formulate and deliver self-polynucleotide. Alternatively, the DNA can be incorporated into a viral vector, viral particle, or bacterium for pharmacologic delivery. Viral vectors can be infection competent, attenuated (with mutations that reduce capacity to induce disease), or replication-deficient. Methods utilizing DNA to prevent the deposition, accumulation, or activity of pathogenic self proteins may be enhanced by use of viral vectors or other delivery systems that increase humoral responses against the encoded autoantigen. In other embodiments, the DNA can be conjugated to solid supports including gold particles, polysaccharide-based supports, or other particles or beads that can be injected, inhaled, or delivered by particle bombardment (ballistic delivery). Methods for delivering nucleic acid preparations are known in the art. See, for example, U.S. Patent Nos. 5,399,346, 5,580,859, and 5,589,466.

[0062] A number of viral based systems have been developed for transfer into mammalian cells. For example, retroviral systems have been described (U.S. Patent No. 5,219,740;

Miller et al, Biotechniques 7:980-990 (1989); Miller, Human Gene Therapy 1 :5-14, (1990); Scarpa et al, Virology 180:849-852 (1991); Burns et al, Proc. Natl Acad. Sci. USA

90:8033-8037 (1993); and, Boris-Lawrie and Temin, Cur. Opin. Genet. Develop. 3: 102-109 (1993). A number of adenovirus vectors have also been described, see e.g., (Haj-Ahmad et al., J. Virol. 57:267-274 (1986); Bett et al., J. Virol. 67:591 1-5921 (1993); Mittereder et al, Human Gene Therapy 5:717-729 (1994); Seth et al., J. Virol. 68:933-940 (1994); Barr et al, Gene Therapy 1 :51-58 (1994); Berkner, BioTechniques 6:616-629 (1988); and, Rich et al, Human Gene Therapy 4:461-476 (1993). Adeno-associated virus (AAV) vector systems have also been developed for nucleic acid delivery. AAV vectors can be readily constructed using techniques well known in the art. See, e.g. , U.S. Patent Nos. 5,173,414 and 5,139,941 ; International Publication Nos. WO 92/01070 and WO 93/03769; Lebkowski et al, Molec. Cell Biol. 8:3988-3996 (1988); Vincent et al , Vaccines 90 (Cold Spring Harbor Laboratory Press) (1990); Carter, Current Opinion in Biotechnology 3:533-539 (1992); Muzyczka, Current Topics in Microbiol. And Immunol. 158:97-129 (1992); Kotin, Human Gene Therapy 5:793-801 (1994); Shelling et al., Gene Therapy 1 : 165-169 (1994); and, Zhou et al. , J. Exp. Med. 179: 1867-1875 (1994).

[0063] The polynucleotide of this invention can also be delivered without a viral vector. For example, the molecule can be packaged in liposomes prior to delivery to the subject. Lipid encapsulation is generally accomplished using liposomes which are able to stably bind or entrap and retain nucleic acid. For a review of the use of liposomes as carriers for delivery of nucleic acids, see, e.g. , Hug et al , Biochim. Biophys. Acta. 1097: 1-17 (1991); Straubinger et al. , in Methods of Enzymology, 101 : 512-527 (1983).

[0064] Therapeutically effective amounts of vector are in the range of about 0.3 mg to about 6.0 mg. For example, a therapeutic amount of vector is in the range of about 1 mg to 3.0 mg, for example, in doses of about 1.0 mg, 1.5 mg, 2.0 mg, 2.5 mg, 3.0 mg per administration, and most preferably about 1.0 mg (including 1.0 mg) per administration.

[0065] With respect to frequency of administration or dosing, the vector can administered, e.g., approximately weekly, bi-weekly {i.e. , every other week or twice monthly) or monthly to achieve a therapeutic effect. Preferably, the plasmid is administered approximately weekly or every week (including weekly or every week administration).

[0066] With respect to the period of dosing or administration of the DNA vector, the DNA vector can be administered for a period of weeks, months, years, or the life of the patient. Preferably, the plasmid is administered for at least about 52 weeks (including 52 weeks), about 12 months, and/or about 1 year.

[0067] In one embodiment, the polynucleotide is delivered by intramuscular ("IM") injection. For IM administration, the vector is formulated in a pharmaceutically acceptable carrier in a concentration sufficient to dissolve the vector. For example, the vector can be prepared in a liquid, physiologically acceptable carrier in a concentration of about 1.5 mg/ml to about 3 mg/ml, for example, about 2 mg/ml. The vector is injected in a volume sufficient to deliver the vector without undesirable side effects, for example, a volume of about 2 ml or less is injected at a single site, for example, a volume of about 1.5 ml, 1 ml, 0.5 ml or less is injected at a single site. In some embodiments the full dose of the vector is delivered at, i.e., divided between, two or more sites. [0068] Treatment with the vector will have a clinical benefit in the patient according to any one or more of the following: preserving beta cell function in the patient (e.g. as evaluated by measuring C-peptide level in the patient); improving glucose control in the patient; reducing medically important events related to abnormally low glucose; reducing medically important events related to diabetic ketoacidosis; reducing complications of T1DM, including any one ore more of nephropathy, retinopathy, neuropathy, vascular disease, or cardiac disease; reducing insulin requirements in the patient; and/or preventing or eliminating the need for insulin therapy in the patient.

[0069] In other variations, the polynucleotide is delivered intranasally, orally,

subcutaneously, intradermally, intravenously, mucosally, impressed through the skin, or attached to gold particles delivered to or through the dermis {see, e.g., WO 97/46253).

Alternatively, nucleic acid can be delivered into skin cells by topical application with or without liposomes or charged lipids {see e.g. U.S. Patent No. 6,087,341). Yet another alternative is to deliver the nucleic acid as an inhaled agent. The polynucleotide can be formulated in phosphate buffered saline with physiologic levels of calcium (0.9 mM).

Alternatively, the polynucleotide is formulated in solutions containing higher quantities of Ca⁺⁺, e.g., between 1 mM and 2M. The polynucleotide may be formulated with other cations such as zinc, aluminum, and others. Alternatively, or in addition, the polynucleotide may be formulated either with a cationic polymer, cationic liposome-forming compounds, or in non- cationic liposomes. Examples of cationic liposomes for DNA delivery include liposomes generated using l ,2-bis(oleoyloxy)-3-(trimethylammionio) propane (DOTAP) and other such molecules.

[0070] Prior to delivery of the polynucleotide, the delivery site can be preconditioned by treatment with bupivicane, cardiotoxin or another agent that may enhance the subsequent delivery of the polynucleotide. Such preconditioning regimens are generally delivered 12 to 96 hours prior to delivery of therapeutic polynucleotide; more frequently 24 to 48 hours prior to delivery of the therapeutic polynucleotide. Alternatively, no preconditioning treatment is given prior to polynucleotide therapy.

[0071] The vector is optionally combined with one or more other agents used to treat T1DM, including, without limitation: insulin (including rapid acting insulin analogues, such as insulin lispro (Eli Lilly), insulin aspart (Novo Nordisk), and insulin glulisine (Sanofi- Aventis); long acting insulin analogues, such as insulin glargine (Sanofi-Aventis), and insulin detemir (Novo Nordisk); short acting human insulin, such as regular human insulin (Eli Lilly, and Novo Nordisk), neutral protamine hagedorn (NPH) insulin (Eli Lilly, and Novo Nordisk); fixed dose insulin, including human insulin combinations (Eli Lilly, and Novo Nordisk) and insulin analogue combinations (Eli Lilly, and Novo Nordisk)); adjuvants; cytokines, or vectors encoding cytokines; T-cell modulators such as anti-CD3 antibodies (e.g.

otelixizumab, TolerX, or Teplizumab, MacroGenics/Lilly); B-cell depleting agents such as anti-CD20 antibodies (e.g. rituximab or ofatumumab); anti-thymocyte globulin (ATG, Genzyme); GAD65-Alum (Diamyd); anti-IL-6 (Tocilizumab, Roche); anti-IL- 12/23 (Stelara, J&J); CTB-Ins plasmid; IL-10 plasmid, HSP60 (DiaPep277, Andromeda/Teva); CTLA4-Ig (Abatacept); etc. Such combination therapy encompasses combined administration (where two or more therapeutic agents are included in the same or separate formulations), and separate administration, in which case, administration of the vector can occur prior to, simultaneously, and/or following, administration of the additional therapeutic agent.

[0072] Furthermore, to avoid the possibility of eliciting unwanted anti-self cytokine responses when using cytokine codelivery, chemical immunomodulatory agents such as the active form of vitamin D3 can also be used. In this regard, 1 ,25-dihydroxy vitamin D3 has been shown to exert an adjuvant effect via intramuscular DNA immunization.

D. Articles of Manufacture

[0073] In another embodiment of the invention, an article of manufacture containing materials useful for the treatment of T1DM is provided. The article of manufacture comprises a container and a label or package insert on or associated with the container.

Suitable containers include, for example, bottles, vials, syringes, etc. The containers may be formed from a variety of materials such as glass or plastic. The container holds or contains the composition which is effective for treating T1DM and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). At least one active agent in the composition is the DNA vector.

[0074] The article of manufacture may further comprise a second container comprising a pharmaceutically-acceptable diluent buffer, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer's solution and dextrose solution. The article of

manufacture may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes. [0075] In a specific embodiment, the invention provides an article of manufacture comprising a container with a pharmaceutical composition comprising a DNA vector encoding an autoantigen associated with treating type I diabetes mellitus (T1DM) packaged together with a package insert with instructions to administer the composition to a patient aged about 5 years to 18 years with diagnosis of T1DM within about 3 months of initial treatment. Further instructions on the package insert about how often to administer the plasmid (e.g. weekly intramuscular administration), the dose per injection (e.g. 1.0 mg) and the duration of administration (e.g. 52-weeks, 12 months, or 1 year) are optionally provided on the package insert. E. Deposit of Biological Material

[0076] The following biological material has been deposited with the American Type Culture Collection, 10801 University Boulevard, Manassas, VA 20110-2209, USA (ATCC):

[0077] The following example is provided to further illustrate the invention but not to limit its scope. Other variants of the invention will be readily apparent to one of ordinary skill in the art and are encompassed by the appended claims.

EXAMPLE

[0078] Pro-insulin tolerizing plasmid (PTP) is an antigen-specific immunotherapy for type 1 diabetes mellitus (T1DM). The overall aims of PTP therapy are to decrease or prevent autoimmune destruction of beta islet cells in the pancreas, preserve beta cell insulin secretion, and/or retain blood glucose control.

[0079] PTP is a plasmid expression vector that expresses the full-length human proinsulin protein under the control of the cytomegalovirus immediate-early promoter/enhancer.

Without being bound by any on theory, the intended mechanism of action (MOA) is tolerization of insulin-specific T cells by expressing peptides derived from insulin in the major histocompatibility complex on antigen-presenting cells (APCs) in a non-stimulatory manner. Insulin is a key auto-antigen recognized by autoreactive T-cells that are involved in destruction of the pancreatic beta cells in T1DM. Expression of insulin-derived peptides on APCs through this non-stimulatory manner is expected to promote tolerance to beta cell auto- antigens.

[0080] PTP is formulated as a sterile, isotonic solution of purified PTP plasmid DNA that diluted to a nominal concentration of 2.0 mg DNA/mL in a phosphate-buffered saline (PBS) solution. The product is administered by intramuscular (IM) injection. The topoisomeric purity of the DNA is measured by high-performance liquid chromatography (HPLC), which determines the percent of plasmid in supercoiled form, linear form, open circular form, and others with a limit of quantification (LOQ) of 0.1 μg total pDNA. The typical topoisomeric purity of PTP is > 90% supercoiled form. The levels of contaminants (e.g., host cell protein, genomic DNA, endotoxin, and RNA) are generally below 1 %.

[0081] Patients most likely to benefit from therapy, specifically young patients recently diagnosed with T1DM are treated with PTP according to the current invention. Key eligibility criteria include age 5-18 years, recent diagnosis of autoimmune T1DM (within 3 months of initial study treatment) as confirmed by the presence of at least one T1DM autoantibody, and a clinically meaningful level of beta cell function at baseline (defined as a peak stimulated C-peptide level >0.2 nMol/L during a mixed-meal tolerance test (MMTT)). It is anticipated that young patients are more likely to benefit from PTP than older patients (19 years or older). Safety follow-up will continue for 1 year after active dosing is completed.

[0082] Patients will be treated with a 52-week course of weekly IM injections of PTP, at a dose of 1.0 mg per injection in order to achieve a durable treatment effect. The intended targets of PTP plasmid are injection site muscle cells and antigen-presenting cells.

[0083] The primary efficacy endpoint in this study will be preservation of beta cell function at 1 year in patients in the active cohort compared with patients in the placebo cohort, as measured by C-peptide MMTT. Secondary endpoints will be improvement in glucose control and reduction in insulin requirements among active patients.

[0084] The primary efficacy outcome measure in this study is stimulated C-peptide level at 1 year. C-peptide is a direct, quantitative measure of beta cell function, with higher levels indicating more endogenous insulin secretion. C-peptide is co-secreted with insulin in a 1 :1 ratio by beta cells, and its longer half-life (lower first-pass hepatic metabolism) makes it a more suitable measure of beta cell function than insulin itself (Palmer et al. "C-peptide is the appropriate outcome measure for type 1 diabetes clinical trials to preserve beta-cell function: report of an ADA workshop," 21-22 October 2001. Diabetes. 53:250-64 (2004)). In addition, C-peptide measurement is not confounded by exogenous insulin therapy. [0085] The most reliable and meaningful measurement of C-peptide is the amount that is secreted after ingestion of a standardized meal with mixed caloric sources, a mixed-meal tolerance test (MMTT) (Greenbaum et al. Diabetes Care 2008;31 :1966-71 (2008)). Serum C- peptide levels are obtained at defined time points before and after ingestion of the mixed meal and the total area under the C-peptide curve (AUC) is determined. A series of beta cell preservation trials have used MMTT C-peptide AUC as the primary endpoint; the U.S. Food and Drug Administration (FDA) has indicated in a draft guidance (U.S. Department of Health and Human Services 2008) that this endpoint may be appropriate in pivotal trials of beta cell preservation therapies.

[0086] C-peptide is assessed at baseline, throughout the 1-year treatment period and the 1 - year follow-up period according to the study flowchart (see Protocol Appendices A-l and A- 2). Additional assessments of disease progression will include HbA_]c and insulin

requirements.

[0087] In addition to the primary endpoint at 1 year, MMTT-stimulated C-peptide levels will be determined at baseline, 5 weeks, 3 months, 6 months, 9 months, 18 months, and 2 years.

[0088] Secondary endpoints in this study examine more direct potential clinical benefits of PTP therapy. Preservation of beta cell function in T1DM is predicted to improve glucose control and reduce insulin requirements. Glucose control will be measured primarily by HbAlc, the standard, quantitative clinical assay for this purpose. HbAlc levels will be obtained at the same times as the MMTT-stimulated C-peptide assays, described above. Self- monitored blood glucose levels and insulin requirements will be collected from patients' daily diaries one to two times per month during the active dosing phase of the trial and Months 15, 18, and 24.

Claims

WHAT IS CLAIMED IS:

1. A method of treating early diagnosed type I diabetes mellitus (T1DM) in a patient aged about 5 years to 18 years comprising administering to the patient a DNA vector encoding an autoantigen associated with T1DM.

2. The method of claim 1 wherein the autoantigen is human proinsulin.

3. The method of claim 2 wherein the human proinsulin comprises the amino acid sequence of SEQ ID NO: 3.

4. The method of any one of the preceding claims comprising administering multiple administrations of the vector to the patient.

5. The method of any one of the preceding claims wherein the vector is administered for about 52 weeks or longer.

6. The method of any one of the preceding claims wherein the vector is administered about every week.

7. The method of any one of the preceding claims wherein the vector is administered intramuscularly (IM).

8. The method of any one of the preceding claims wherein the vector is administered at a dose of about 1.Omg.

9. The method of any one of the preceding claims wherein the vector is administered at a concentration of about 2mg/mL.

10. The method of any one of the preceding claims comprising administering weekly intramuscular (IM) injections of the vector, at a dose of 1.0 mg per injection, for about 52 weeks.

1 1. The method of any one of the preceding claims wherein the patient has been diagnosed with T1DM within about 3 months of initial treatment with the vector.

12. The method of any one of the preceding claims wherein diagnosis of T1DM is confirmed by the presence of at least one T1DM autoantibody.

13. The method of any one of the preceding claims wherein the patient has detectable anti-insulin autoantibodies.

14. The method of any one of the preceding claims wherein the patient has functioning beta cells.

15. The method of claim 14 wherein the patient has a detectable level of C-peptide in blood or urine, during a mixed-meal tolerance test (MMTT) or other test for measuring C- peptide.

16. The method of any one of the preceding claims wherein the patient has a clinically meaningful level of beta cell function.

17. The method of claim 16 wherein the clinically meaningful level of beta cell function is defined as a peak stimulated C-peptide level > 0.2 nMol/L during a mixed-meal tolerance test (MMTT).

18. The method of any one of the preceding claims wherein the vector is proinsulin tolerizing plasmid (PTP).

19. The method of claim 18 wherein the PTP comprises the DNA sequence in SEQ ID NO:l .

20. The method of any one of the preceding claims which preserves beta cell function in the patient.

21. The method of 20 wherein beta cell preservation is evaluated by measuring C-peptide level in the patient.

22. The method of any one of the preceding claims which improves glucose control in the patient.

23. The method of any one of the preceding claims which reduces medically important events related to abnormally low glucose.

24. The method of claim 23 which reduces medically important events related to diabetic ketoacidosis.

25. The method of any one of the preceding claims which reduces complications of TIDM, including a complication selected from the group consisting of nephropathy, retinopathy, neuropathy, vascular disease, and cardiac disease.

26. The method of any one of the preceding claims which reduces insulin requirements in the patient.

27. The method of any one of the preceding claims which eliminates the need for insulin therapy in the patient.

28. A method of treating type I diabetes mellitus (TIDM) in a patient aged 5 years to 18 years with diagnosis of TIDM within 3 months of initial treatment comprising administering to the patient weekly intramuscular (IM) injections of plasmid tolerizing plasmid (PTP) at a dose of 1.0 mg per injection for about 52 weeks.

29. The method of claim 28 which preserves beta cell function, improves glucose control, or reduces insulin requirements in the patient.

30. An article of manufacture comprising a container with a pharmaceutical composition comprising a DNA vector encoding an autoantigen associated with type I diabetes mellitus

(TIDM) packaged together with a package insert providing instructions to administer the composition to a patient aged about 5 years to 18 years with early diagnosed TIDM.

31. The article of manufacture of claim 30 wherein the package insert further comprises instructions to administer the plasmid by weekly intramuscular (IM) injections of the plasmid, at a dose of 1.0 mg per injection, for at least 52 weeks.