WO2012013932A1 - Improved race - Google Patents
Improved race Download PDFInfo
- Publication number
- WO2012013932A1 WO2012013932A1 PCT/GB2011/001131 GB2011001131W WO2012013932A1 WO 2012013932 A1 WO2012013932 A1 WO 2012013932A1 GB 2011001131 W GB2011001131 W GB 2011001131W WO 2012013932 A1 WO2012013932 A1 WO 2012013932A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cdna
- adapter
- molecule
- sequence
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1096—Processes for the isolation, preparation or purification of DNA or RNA cDNA Synthesis; Subtracted cDNA library construction, e.g. RT, RT-PCR
Definitions
- the present invention relates to a method of generating a cDNA molecule or pool of cDNA molecules which comprise adapter sequences 5' and 3' of the sequence corresponding to the 5' or 3' ends of the original mRNA molecule. There is further provided a method of amplifying a desired 5' or 3' end of said modified cDNA or pool of cDNA molecules whilst minimising the generation of false positives and/or non-specific amplification. There is also provided a kit for carrying out the method of the present invention.
- Cloning of novel cDNAs typically results in sequences that only partially represent the mRNA species, with the 3' ends usually well represented and the 5' end of the sequence often incomplete. This tendency can be due to RNA degradation, or is a result of the cDNA synthesis reaction not reaching completion. When working with novel organisms, where the genome has not been sequenced, obtaining the 5' end of the cDNA, although in theory quite simple, can often prove to be technically challenging.
- the unknown 5' sequence from the ends of cDNA molecules can be cloned using a PCR technique know as rapid amplification of cDNA ends (RACE) (2).
- RACE rapid amplification of cDNA ends
- homopolymer tailing of the cDNA is used to append a linker sequence to the cDNA terminus.
- Extension of unknown regions of the cDNA is then achieved through PCR using a gene specific primer and a primer that can bind and prime DNA synthesis from the linker sequence.
- New RACE an anchor primer is ligated to the 5' end of the mRNA molecule prior to reverse transcription, which subsequently synthesised cDNA molecules incorporate into their sequence (3). Therefore only full length cDNA molecules are amplified by PCR using the anchor primer and gene specific primer.
- Cap-switch RACE Cap finder
- MMLV Murine moloney leukaemia virus
- dUTP is incorporated into all amplicons by substituting dUTP for dTTP in PCR reactions.
- Treatment of PCR products with UDG prior to thermal cycling cleaves DNA at uracil bases thereby inhibiting amplification of carryover contamination from previous PCR reactions (10). This function can be exploited to remove unwanted DNA sequences from reaction mixtures.
- the use of dUTP and UDG to increase the specificity of 3' RACE reactions has been reported (11 , see also US5334515), however, no methods using dUTP/UDG for 5' RACE are currently available.
- the present invention is based on the development of a modified version of the RACE protocol which enables the amplification reaction to be simplified by degrading non- target modified cDNA sequences using uracil DNA glycosylase (UDG).
- UDG uracil DNA glycosylase
- a double stranded cDNA is synthesised to incorporate dUTP, and this then serves as template for subsequent amplification of cDNA ends of any target gene.
- PCR primer sites (where dUTP replaces dTTP) are incorporated at the 3' and 5' ends of each cDNA molecule. These primer sites are incorporated at the 3' and 5' ends by way of adapter sequences.
- the modified double stranded cDNA, incorporating dUTP now serves as a universal pool for PCR amplification of cDNA ends for any gene of interest.
- a method for generating a modified cDNA molecule comprising sequence corresponding to the 5' and 3' ends of an mRNA molecule comprising the steps of: a) annealing a first adapter oligonucleotide to an mRNA molecule, said first adapter comprising a 3' portion which is substantially complimentary to the 3' poly A tail of the mRNA molecule and a 5' portion which comprises one or more uracil residues; b) extending from said first adapter, utilizing dNTPs which include dUTP, so as to generate a first modified cDNA strand, which comprises one or more, typically a plurality of uracil residues in its sequence; c) incorporating a second adapter, which is different to the first adapter, at the 3' end of the first cDNA strand, wherein the second adapter comprises at least a 3' portion which is not specific to the mRNA molecule and which comprises one or more uracil
- the method may be conducted on a pool of mRNA molecules, thereby generating a single pool of cDNA molecules, each cDNA molecule from the pool comprising the same 5' and 3' adapter sequences respectively
- modified cDNA molecule relates to a cDNA molecule which comprises one or more, typically many uracil molecules throughout its sequence.
- the modified cDNA molecules of the present invention comprise uracils in place of many thymidine residues.
- typically at least 1 in 1 , to 1 in 20, such as 1 in 1 to 1 , in 4, especially 1 in 1.05 to 1 in 2 thymidine residues are replaced by a uracil residue.
- the first adapter oligonucleotide typically comprises a 3' portion which comprises a stretch of T residues, so as to be able to complimentary base pair with the poly A tail of the mRNA molecule.
- the stretch will be 10-40 Ts in length, such as 15-30 Ts in length.
- the 3' end of the first adapter may be a T or may incorporate other residues to ensure proper annealing and extension from the first adapter. Indeed a pool of first adapters may be provided which include possible variations at the 3' end so as to ensure proper annealing and extension from the adapter.
- the 5' end of the first adapter sequence is designed to be not complimentary to eukaryotic sequences based on blast homology searches and generally not to be specific to the mRNA sequence.
- any nucleotide sequence as described herein will comprise a complimentary portion which is at least 95%, such as 97-99% identical with the sequence to which it is to bind.
- the extension from the first adapter is carried out using dNTPs which comprise dUTP, but as mentioned above, conveniently dTTP may also be present, albeit in much lower (e.g. ⁇ 10%) amounts than dUTP, in the dNTP mix.
- the extension reaction may be catalysed using a variety of reverse transcriptases, such as avian myeloblastosis virus (A V) or Moloney murine leukaemia virus (M-MLV).
- the reverse transcriptase is M-MLV reverse transciptase.
- M- MLV reverse transcriptase adds 2-4 cytosine residues to the 3' ends of cDNA molecules and by using the cap switching techniques previously described (5, 6), it is possible to incorporate a second adapter (containing uracil) at the 3' end of the first cDNA strand.
- RNA ligase method previously described (3), however to make this compatible with the technique described herein, dUTP should replace dTTP in the dNTP mix used for first strand cDNA synthesis.
- RNA of the RNA/cDNA hybrid may be removed by way of RNAse H treatment to degrade RNA of the RNA/cDNA hybrid and the cDNA purified from degraded RNA and unincorporated adapter molecules by way of affinity purification (e.g. silica-based purification) using a suitable column purification method, such as by using QIA quick (Qiagen Inc., Chatsworth, CA, USA).
- affinity purification e.g. silica-based purification
- suitable column purification method such as by using QIA quick (Qiagen Inc., Chatsworth, CA, USA).
- the second cDNA strand may be easily generated by copying the first cDNA strand using a first primer (where uracil replaces thymidine) which is able to specifically bind to the second adapter sequence at 3' end of the first cDNA strand, using a suitable DNA polymerase, such as Taq polymerase and a dNTP mix comprising dUTP.
- a first primer where uracil replaces thymidine
- a suitable DNA polymerase such as Taq polymerase and a dNTP mix comprising dUTP.
- the resulting double stranded cDNA can be purified by way of affinity purification (e.g. silica-based purification) using a suitable column purification method, such as by using QIA quick (Qiagen Inc., Chatsworth, CA, USA) and then used as a template for the specific amplification of the ends of target genes.
- affinity purification e.g. silica-based purification
- suitable column purification method such as by using QIA quick (Qiagen Inc., Chatsworth, CA, USA) and then used as a template for the specific amplification of the ends of target genes.
- the modified resulting double stranded cDNA molecule(s) can be amplified further by using said first primer and a second primer which is able to specifically bind to the sequence at the 3' end of the second strand cDNA strand and which second primer comprises one or more uracil residues, and the dNTP mix contains dUTP, so as to generate an amplified cDNA molecule(s), which comprises a plurality of uracil residues within the first and second strands of the amplified cDNA molecule.
- Further rounds of amplification may be carried out, such as 20-25 cycles of PCR, so as to increase the cDNA copies.
- an asymmetric amplification reaction using a single gene specific primer and standard dNTPs (without dUTP) is performed.
- the reaction mixture is then treated with UDG to simplify the PCR reaction mixture by degrading non-target cDNAs.
- the present invention provides a method of amplifying a 5' or 3' end of an mRNA molecule for enabling identification of sequence at a respective 5' or 3' end of the mRNA molecule, the method comprising: a) providing the double stranded cDNA molecule or pool of cDNA molecules according to the first aspect, or amplified copies thereof; b) asymmetrically amplifying the 5' or 3' end of said cDNA molecule or one of said cDNA molecules in the pool using a gene specific primer which is substantially complementary to an internal portion of the cDNA sequence, using dNTPs which do not include dUTP, so as to generate an amplified gene specific single stranded DNA molecule; c) adding UDG so as to degrade sequences which comprise uracil thereby leaving only an amplified gene
- Step d) is preferable in order to increase specificity and yield of the amplified 5' or 3' end to be detected
- the gene specific primers are generally comprised only of DNA bases (i.e. A, C, G and T) and may be designed to hybridise specifically to a desired mRNA sequence.
- the gene specific primers may be designed and synthesised based on a known mRNA sequence, or may be based on a consensus sequence ascertained from previously sequenced gene sequences from other organisms.
- the skilled addressee is very familiar with asymmetric amplification or PCR and a number of cycles (e.g. 10-40) may be performed to linearly amplify the sequence of interest and hence the 5' or 3' end of the cDNA. It is to be appreciated that the gene specific primer can be chosen to anneal to either particular strand of the modified cDNA molecule and hence generate amplified copies of the 5' or 3' end of a particular mRNA, as desired.
- UDG is added so as to degrade the modified cDNA molecule(s) present once the asymmetric amplification step has been completed.
- the amplified single stranded DNA molecule which includes a complimentary DNA copy representative of the desired 5' or 3' end of the mRNA molecule remains as a viable target for a second exponential PCR amplification.
- Exponential PCR amplification of the desired amplified single stranded DNA molecule is achieved using a second nested gene specific primer and a primer which is able to specifically bind to the sequence at the 5' or 3' end of the amplified single stranded DNA molecule. Further rounds of amplification may be carried out as necessary.
- the 5' end of the mRNA molecule is amplified.
- the appropriately amplified 5' or 3' end sequence can easily be ascertained by conventional cloning and gene sequencing techniques known to the skilled addressee, utilizing a suitable primer.
- kits for use in generating the modified cDNA molecule(s) and/or the amplified DNA molecule which includes the amplified 5' or 3' end may comprise first and second adapter molecules, a dNTP mix which includes dUTP and first and second primer molecules for amplifying the modified cDNA molecule.
- a kit for generating an amplified DNA molecule which comprises a sequence corresponding to a 5' or 3' end of a mRNA molecule may comprise UDG and a primer for use in amplifying the 5' or 3' end.
- kits may also comprise other suitable reagents such as buffers, salts solutions and the like, as well as instructions for carrying out the methods as described hereinabove.
- FIG. 1 shows a diagrammatic representation of a double stranded template (T-RACE cDNA) synthesis protocol according to the present invention.
- First strand cDNA synthesis using a dNTP mix which includes dUTP is primed using an oligo-dT adapter- A primer.
- oligo(dC) is added to the end of the cDNA by the M-MLV reverse transcriptase.
- Adapter A and B both contain dUTP instead of dTTP.
- Adapter A and B serve as priming sites for PCR amplification using primers A and B, which also have dTTP replaced by dUTP.
- T-RACE ready cDNA contains dUTP residues throughout and dUTP containing adapters at the 3' and 5' ends.
- Figure 2 shows a diagrammatic representation of the 5' specific amplification of cDNA ends using T-RACE.
- T-RACE ready cDNA serves as template for an asymmetric PCR reaction using a single gene specific primer (GSP1 ) and standard dNTPs (without dUTP). This reaction produces single stranded target cDNAs which include the adapter sequence comprised of standard dNTPs.
- FIG. 1 shows (A) Specific amplification of 5' cDNA ends from Atlantic salmon (Ss) and Zebrafish (Dr) fast muscle. Lane 1 STAC3 (Ss), Lane 2 IGF-I (Ss) Lane 3 CMYA5 (Dr), Lane 4 MAFbx (Ss), Lane 5 STAC3 (Ss). DNA size marker of 5000, 2000, 850, 400 and 200 bp is shown in Lane M.
- Figure 4 shows for background purposes non-specific amplification of products without UDG treatment.
- the T-RACE ready protocol is depicted in figure 1 and the primers used listed in table 1.
- RNAse inhibitor RNase OUT, Invitrogen, Carlsbad, CA, USA), 200 U Superscript II (Invitrogen, Carlsbad, CA, USA) and
- RNA/cDNA hybrid was achieved by addition of 1 pi RNAse H (Invitrogen, Carlsbad, CA, USA) and incubation at 37 °C for 15 minutes.
- the reaction was purified through a QIAquick PCR purification column and eluted in 30 ⁇ elution buffer as per manufacturer's guidelines (Qiagen Inc., Chatsworth, CA, USA).
- Second strand synthesis was achieved by PCR using the priming sites incorporated at the 3' (Adapter B) and 5' (Adapter A) ends of the first strand cDNA.
- 2 ⁇ of the purified first strand cDNA was used as template, and amplified in the following reaction (50 ⁇ ): 2.5 mM MgCI2, 1.0 mM dUTP, 0.5 m dATP, 0.5 mM dCTP, 0.5 mM dGTP, 0.1 mM dTTP, 0.5 ⁇ primer A, 0.5 ⁇ primer B (table 1 ).
- the reaction mixture was mixed and heated to 95 °C before addition of 5 units of Taq DNA polymerase (Bioline, London, UK).
- the reaction mixture was then incubated at 95 °C for a further 2 minutes, followed by 20 cycles of 95 °C denaturing for 30 s, annealing at 60 °C for 30 s, and extension at 72 °C 12 minutes.
- the reaction was then chilled on ice and purified through a QIAquick PCR purification column (Qiagen Inc., Chatsworth, CA, USA) and eluted in 10Oul elution buffer as per manufacturer's guidelines.
- the purified double stranded cDNA, incorporating dUTP and 5' and 3' adapter sequences serves as template for the following PCR reactions.
- Asymmetric PCR was performed using a gene specific primer (GSP1 ) and standard dNTPs (dATP, dTTP, dGTP, dCTP) in the following hot start 20 ⁇ reaction: 0.5 ⁇ GSP1 , 2 ⁇ T-RACE ready cDNA, 16 mM (NH 4 ) 2 S0 4 , 67 mM Tris-HCI, 3 mM MgCI 2 , 0.25 mM dNTPs.
- the reaction mixture was heated to 95 °C for 2.5 min before addition of 1 unit of Taq DNA polymerase (Bioline, London, UK), and then cycled 20 times with the following conditions: 95 °C 30 s, 60 °C 30 s, 72 °C 2 min.
- the reaction was chilled on ice, purified through a MinElute PCR purification column (Qiagen Inc., Chatsworth, CA, USA) and eluted in 11 ⁇ water.
- the length of time for the 72 °C extension step of the PCR should be varied according to expected amplicon length.
- the entire asymmetric reaction is used in the following steps using a nested gene specific primer (GSP2), and the primers used for PCR do not contain dUTP.
- GSP2 nested gene specific primer
- cDNAs incorporating dUTP were removed by UDG treatment to leave only those cDNAs synthesised with standard dNTPs during the asymmetric PCR.
- the following 17.8 ⁇ reaction was performed: 10 ⁇ asymmetric PCR product, 2 ⁇ (2 units) Uracil DNA glycosylase, 2 ⁇ 10 x PCR buffer (160 mM (NH 4 ) 2 S0 4l 670 mM Tris-HCI), 1.2 ⁇ 50 mM MgCI 2 , 1 ⁇ nested GSP2, 1 ⁇ of 10 ⁇ T-RACE primer (table 1), 0.6 ⁇ water, and incubated at 37 °C for 30 minutes. Depending on whether 3' or 5' cDNA ends are targeted, the 3' or 5' T-RACE primer is used for amplification.
- T-RACE PCR Targeted amplification of cDNA ends
- the UDG treated cDNA mixture was heated to 95 °C before addition of 2 ⁇ 2.5 mM standard dNTPs and 0.2 ⁇ (1unit) of Taq DNA polymerase (Bioline, London, UK).
- the reaction was denatured at 95 °C for 5 min followed by 35 cycles of 95 °C 30 s, 60 °C 30s, 72 °C 2 min, followed by a final extension of 7 min at 72 °C.
- the length of time for the 72 °C extension step of the PCR should be varied according to expected amplicon length.
- PCR products were separated on a 1.2% (m/v) agarose gel, and the bands excised and purified using a QIAquick gel extraction kit (Qiagen Inc., Chatsworth, CA, USA).
- the PCR products were cloned into a T/A pCR4-TOPO vector (Invitrogen, Carlsbad, CA, USA) and transformation of chemically competent TOP10 Escherichia coli cells (Invitrogen, Carlsbad, CA, USA). Individual colonies were grown and plasmids purified using a QIAprep Spin Miniprep Kit (Qiagen Inc., Chatsworth, CA, USA).
- This asymmetric PCR using only a gene specific primer produces a cDNA fragment which includes the 5' adapter sequence, and is comprised of standard dNTPs (Fig. 2).
- Degradation of dUTP containing cDNA molecules by Uracil DNA glycosylase (UDG) treatment leaves only the molecules comprised of standard dNTPs primed by the gene specific primer (Fig. 2).
- UDG Uracil DNA glycosylase
- CMYA5 zebrafish myospryn
- IGF-I insulin-like growth factor-l
- Standard RACE methods often result in non specific amplification giving false positive results (6, 7, 8).
- cDNA is synthesised using oligo dT
- the subsequent incorporation of the adapter sequence for 5' RACE through terminal transferase tailing or cap finder methods
- mispriming events during PCR will often lead to exponential amplification, and smears, rather than distinct bands are often obtained.
- the use of a nested PCR reaction should increase the specificity of the RACE reaction, however non-specific products are frequently obtained.
- the T-RACE method described herein degrades all of the non-target cDNA molecules, except for those that were primed by the gene specific primer and synthesised using standard dNTPs, thereby significantly simplifying the templates present in the PCR reaction.
- the gene specific primer is used in an asymmetric PCR, where higher annealing temperatures are permitted, rather than during cDNA synthesis, the specificity of the reaction is increased.
- a nested primer in the second PCR reaction specific amplification of the desired molecule is achieved.
- Taq polymerase is less efficient at incorporating dUTP than dTTP (10) which could impact on the double stranded cDNA synthesis. It was observed that a ratio of dUTP:dTTP of 8:1 , improved the efficiency of the T-RACE reaction, but still resulted in sufficient degradation of non- target cDNAs to give specific amplification. We also observed an improvement in the specificity of the PCR reactions by adding the MnCI 2 and adapter-A after cDNA synthesis has completed. Presumably this modification decreases the chances of adapter-A priming cDNA synthesis during the first strand cDNA reaction which could lead to spurious amplification products in subsequent reactions.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Crystallography & Structural Chemistry (AREA)
- Plant Pathology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Computational Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a method of generating a cDNA molecule or pool of cDNA molecules which comprise adapter sequences 5' and 3' of the sequence corresponding to the 5' or 3' ends of the original mRNA molecule. There is further provided a method of amplifying a desired 5' or 3' end of said modified cDNA or pool of cDNA molecules whilst minimising the generation of false positives and/or non-specific amplification. There is also provided a kit for carrying out the method of the present invention.
Description
Improved RACE
Field of the Invention The present invention relates to a method of generating a cDNA molecule or pool of cDNA molecules which comprise adapter sequences 5' and 3' of the sequence corresponding to the 5' or 3' ends of the original mRNA molecule. There is further provided a method of amplifying a desired 5' or 3' end of said modified cDNA or pool of cDNA molecules whilst minimising the generation of false positives and/or non-specific amplification. There is also provided a kit for carrying out the method of the present invention.
INTRODUCTION
The genomes of an increasing number of organisms have been sequenced, however the exact structure of many transcripts remain unresolved, particularly their 5' untranslated regions (UTRs). Many open reading frames are predicted and need to be supported by experimental data to obtain an accurate annotation of the genome. For example, Salehi-Ashtiani et al (1 ) performed large scale rapid amplification of cDNA ends (RACE) on C. elegans, identifying UTRs, new exons and redefined previously annotated exons. The lack of experimental data supporting gene structure is in part due to the methodologies employed in cloning gene sequences. Cloning of novel cDNAs typically results in sequences that only partially represent the mRNA species, with the 3' ends usually well represented and the 5' end of the sequence often incomplete. This tendency can be due to RNA degradation, or is a result of the cDNA synthesis reaction not reaching completion. When working with novel organisms,
where the genome has not been sequenced, obtaining the 5' end of the cDNA, although in theory quite simple, can often prove to be technically challenging.
The unknown 5' sequence from the ends of cDNA molecules can be cloned using a PCR technique know as rapid amplification of cDNA ends (RACE) (2). In Classic RACE, homopolymer tailing of the cDNA is used to append a linker sequence to the cDNA terminus. Extension of unknown regions of the cDNA is then achieved through PCR using a gene specific primer and a primer that can bind and prime DNA synthesis from the linker sequence.
Different versions of RACE have been developed, making significant improvements to the original methodology, including New RACE (3), and Cap finder RACE (5, 6). In New RACE, an anchor primer is ligated to the 5' end of the mRNA molecule prior to reverse transcription, which subsequently synthesised cDNA molecules incorporate into their sequence (3). Therefore only full length cDNA molecules are amplified by PCR using the anchor primer and gene specific primer. The Cap-switch RACE (Cap finder) protocol exploits the Murine moloney leukaemia virus (MMLV) reverse transcriptase ability to add an extra 2-4 cytosine residues to the 3' ends of cDNA molecules after reaching the cap structure at the 5' end of the mRNA template. When a primer with multiple guanine residues at its 3' end is present in the reaction mix, annealing of the poly G to poly C sequences occurs, allowing for copying of the annealed primer sequence to the cDNA, adding an adapter sequence to the end of the cDNA (5, 6). These methods, have been developed into commercially available RACE kits including Clontech (Cap switching Smart RACE), Invitrogen (5'RACE system) and Ambion (First Choice RLM-RACE kit).
Many of the commercially available kits offer protocols that allow the amplification of 5' cDNA ends of many genes from a single cDNA synthesis reaction. Despite claims of specific amplification of the desired 5' region of a target gene, a common problem that occurs in RACE reactions is obtaining non-specific amplification products (6, 7, 8). The use of a second nested PCR reaction has been shown to increase the specificity of the reaction, however, non-specific amplification and false positive products are still often obtained. When cDNA synthesis is primed using an oligo-dT primer, all mRNA species are reverse transcribed, and the 3' primer site will subsequently be incorporated into the 3' end of all newly transcribed cDNAs. When cDNA templates such as these are used for PCR, non-specific amplification is likely due to the incorporation of the primer sequence in every cDNA molecule in the universal pool of full length cDNAs.
Prevention of PCR carryover contamination by incorporation of dUTP during PCR and uracil-DNA glycosylase treatment is a widely used technique (9) (covered by patents US5035996, US 5683896 and US5945313). dUTP is incorporated into all amplicons by substituting dUTP for dTTP in PCR reactions. Treatment of PCR products with UDG prior to thermal cycling cleaves DNA at uracil bases thereby inhibiting amplification of carryover contamination from previous PCR reactions (10). This function can be exploited to remove unwanted DNA sequences from reaction mixtures. For example, the use of dUTP and UDG to increase the specificity of 3' RACE reactions has been reported (11 , see also US5334515), however, no methods using dUTP/UDG for 5' RACE are currently available.
It is amongst the objects of the present invention to obviate and/or mitigate one or more of the aforementioned disadvantages.
Summary of the Invention
The present invention is based on the development of a modified version of the RACE protocol which enables the amplification reaction to be simplified by degrading non- target modified cDNA sequences using uracil DNA glycosylase (UDG). Essentially, a double stranded cDNA is synthesised to incorporate dUTP, and this then serves as template for subsequent amplification of cDNA ends of any target gene. During synthesis of the modified double stranded cDNA, PCR primer sites (where dUTP replaces dTTP) are incorporated at the 3' and 5' ends of each cDNA molecule. These primer sites are incorporated at the 3' and 5' ends by way of adapter sequences. The modified double stranded cDNA, incorporating dUTP, now serves as a universal pool for PCR amplification of cDNA ends for any gene of interest.
Thus, in a first aspect there is provided a method for generating a modified cDNA molecule comprising sequence corresponding to the 5' and 3' ends of an mRNA molecule comprising the steps of: a) annealing a first adapter oligonucleotide to an mRNA molecule, said first adapter comprising a 3' portion which is substantially complimentary to the 3' poly A tail of the mRNA molecule and a 5' portion which comprises one or more uracil residues; b) extending from said first adapter, utilizing dNTPs which include dUTP, so as to generate a first modified cDNA strand, which comprises one or more, typically a plurality of uracil residues in its sequence;
c) incorporating a second adapter, which is different to the first adapter, at the 3' end of the first cDNA strand, wherein the second adapter comprises at least a 3' portion which is not specific to the mRNA molecule and which comprises one or more uracil residues in the sequence; d) copying said first modified cDNA strand by extending from a first primer which comprises one or more uracils and comprises at least a 3' portion which is substantially complementary to a portion of the second adapter sequence, using dNTPs which include dUTP, thereby generating a modified double stranded cDNA molecule, which includes one or more, typically a plurality of uracil residues in the first and second strands and adapter sequences 5' and 3' of sequence corresponding to the 5'and 3' ends of the mRNA molecule.
Conveniently the method may be conducted on a pool of mRNA molecules, thereby generating a single pool of cDNA molecules, each cDNA molecule from the pool comprising the same 5' and 3' adapter sequences respectively
It is to be understood that the term "modified cDNA molecule" relates to a cDNA molecule which comprises one or more, typically many uracil molecules throughout its sequence. Thus, the modified cDNA molecules of the present invention comprise uracils in place of many thymidine residues. However, not all thymidine residues need to be replaced by a uracil and indeed the present inventors have observed that it can be desirable not to replace all thymidine residues with a uracil. Thus, typically at least 1 in 1 , to 1 in 20, such as 1 in 1 to 1 , in 4, especially 1 in 1.05 to 1 in 2 thymidine residues are replaced by a uracil residue.
The first adapter oligonucleotide typically comprises a 3' portion which comprises a stretch of T residues, so as to be able to complimentary base pair with the poly A tail of the mRNA molecule. Typically the stretch will be 10-40 Ts in length, such as 15-30 Ts in length. The 3' end of the first adapter may be a T or may incorporate other residues to ensure proper annealing and extension from the first adapter. Indeed a pool of first adapters may be provided which include possible variations at the 3' end so as to ensure proper annealing and extension from the adapter. The 5' end of the first adapter sequence is designed to be not complimentary to eukaryotic sequences based on blast homology searches and generally not to be specific to the mRNA sequence.
The term "substantially complimentary" as used throughout the description, is to be understood to mean that complimentary is such that specific binding at high stringency, (see for example ref 3) for what is generally understood as high stringency, but the skilled addressee is well aware that relevant sequences need not be 100% complimentary. Thus, a small degree of variation may be permitted. Typically any nucleotide sequence as described herein will comprise a complimentary portion which is at least 95%, such as 97-99% identical with the sequence to which it is to bind.
After denaturation, typically by heat, of the RNA, the poly dT sequence of the first adapter base pairs to the polyA sequence of the mRNA.
The extension from the first adapter is carried out using dNTPs which comprise dUTP, but as mentioned above, conveniently dTTP may also be present, albeit in much lower (e.g. <10%) amounts than dUTP, in the dNTP mix. The extension reaction may be catalysed using a variety of reverse transcriptases, such as avian myeloblastosis virus (A V) or Moloney murine leukaemia virus (M-MLV). However, in one embodiment, the reverse transcriptase is M-MLV reverse transciptase. As mentioned previously M-
MLV reverse transcriptase adds 2-4 cytosine residues to the 3' ends of cDNA molecules and by using the cap switching techniques previously described (5, 6), it is possible to incorporate a second adapter (containing uracil) at the 3' end of the first cDNA strand.
Other reverse transcriptases may be employed and the second adapter incorporated at 3' end of the first modified cDNA strand using enzymes such as terminal transferase (2). An alternative approach to incorporate a uracil containing adapter in the 3' end of the newly synthesised first strand cDNA is to use the RNA ligase method previously described (3), however to make this compatible with the technique described herein, dUTP should replace dTTP in the dNTP mix used for first strand cDNA synthesis.
Before copying the first cDNA strand, RNA of the RNA/cDNA hybrid may be removed by way of RNAse H treatment to degrade RNA of the RNA/cDNA hybrid and the cDNA purified from degraded RNA and unincorporated adapter molecules by way of affinity purification (e.g. silica-based purification) using a suitable column purification method, such as by using QIA quick (Qiagen Inc., Chatsworth, CA, USA).
The second cDNA strand may be easily generated by copying the first cDNA strand using a first primer (where uracil replaces thymidine) which is able to specifically bind to the second adapter sequence at 3' end of the first cDNA strand, using a suitable DNA polymerase, such as Taq polymerase and a dNTP mix comprising dUTP.
The resulting double stranded cDNA can be purified by way of affinity purification (e.g. silica-based purification) using a suitable column purification method, such as by using QIA quick (Qiagen Inc., Chatsworth, CA, USA) and then used as a template for the specific amplification of the ends of target genes. However, the modified resulting
double stranded cDNA molecule(s) can be amplified further by using said first primer and a second primer which is able to specifically bind to the sequence at the 3' end of the second strand cDNA strand and which second primer comprises one or more uracil residues, and the dNTP mix contains dUTP, so as to generate an amplified cDNA molecule(s), which comprises a plurality of uracil residues within the first and second strands of the amplified cDNA molecule.
Further rounds of amplification may be carried out, such as 20-25 cycles of PCR, so as to increase the cDNA copies. To specifically amplify the ends of target genes, an asymmetric amplification reaction using a single gene specific primer and standard dNTPs (without dUTP) is performed. The reaction mixture is then treated with UDG to simplify the PCR reaction mixture by degrading non-target cDNAs. A subsequent amplification reaction using a nested gene specific primer in combination with a primer which is complimentary to an adapter sequence which has been incorporated into the 5' or 3' end of the cDNA, during cDNA synthesis, results in specific amplification of an end of the cDNA. This technique provides a novel and reliable method to specifically amplify the 5' and/or 3' ends of cDNAs from a single pool of cDNA. Thus, in a further aspect, the present invention provides a method of amplifying a 5' or 3' end of an mRNA molecule for enabling identification of sequence at a respective 5' or 3' end of the mRNA molecule, the method comprising: a) providing the double stranded cDNA molecule or pool of cDNA molecules according to the first aspect, or amplified copies thereof;
b) asymmetrically amplifying the 5' or 3' end of said cDNA molecule or one of said cDNA molecules in the pool using a gene specific primer which is substantially complementary to an internal portion of the cDNA sequence, using dNTPs which do not include dUTP, so as to generate an amplified gene specific single stranded DNA molecule; c) adding UDG so as to degrade sequences which comprise uracil thereby leaving only an amplified gene specific single stranded DNA molecule; d) optionally generating an amplified double stranded DNA gene specific product comprising a sequence corresponding to the 5' or 3' end of a specific mRNA molecule using a gene nested specific primer and a primer which comprises a 3' portion which is substantially complementary to the 5' or 3' end of the amplified gene specific single stranded DNA molecule.
Step d) is preferable in order to increase specificity and yield of the amplified 5' or 3' end to be detected
The gene specific primers are generally comprised only of DNA bases (i.e. A, C, G and T) and may be designed to hybridise specifically to a desired mRNA sequence. The gene specific primers may be designed and synthesised based on a known mRNA sequence, or may be based on a consensus sequence ascertained from previously sequenced gene sequences from other organisms.
The skilled addressee is very familiar with asymmetric amplification or PCR and a number of cycles (e.g. 10-40) may be performed to linearly amplify the sequence of
interest and hence the 5' or 3' end of the cDNA. It is to be appreciated that the gene specific primer can be chosen to anneal to either particular strand of the modified cDNA molecule and hence generate amplified copies of the 5' or 3' end of a particular mRNA, as desired.
UDG is added so as to degrade the modified cDNA molecule(s) present once the asymmetric amplification step has been completed. Thus only the amplified single stranded DNA molecule which includes a complimentary DNA copy representative of the desired 5' or 3' end of the mRNA molecule remains as a viable target for a second exponential PCR amplification.
Exponential PCR amplification of the desired amplified single stranded DNA molecule is achieved using a second nested gene specific primer and a primer which is able to specifically bind to the sequence at the 5' or 3' end of the amplified single stranded DNA molecule. Further rounds of amplification may be carried out as necessary.
Preferably the 5' end of the mRNA molecule is amplified.
Once an amplified gene specific product comprising a sequence corresponding to the 5' or 3' end of an mRNA molecule has been generated, the appropriately amplified 5' or 3' end sequence can easily be ascertained by conventional cloning and gene sequencing techniques known to the skilled addressee, utilizing a suitable primer.
As well as the methods described hereinabove, the present invention also provides a kit for use in generating the modified cDNA molecule(s) and/or the amplified DNA molecule which includes the amplified 5' or 3' end. A kit for generating suitable modified cDNA molecules may comprise first and second adapter molecules, a dNTP
mix which includes dUTP and first and second primer molecules for amplifying the modified cDNA molecule. A kit for generating an amplified DNA molecule which comprises a sequence corresponding to a 5' or 3' end of a mRNA molecule may comprise UDG and a primer for use in amplifying the 5' or 3' end. Such kits may also comprise other suitable reagents such as buffers, salts solutions and the like, as well as instructions for carrying out the methods as described hereinabove.
Detailed Description The present invention will now be further described with reference to the figures which show:
Figure 1 shows a diagrammatic representation of a double stranded template (T-RACE cDNA) synthesis protocol according to the present invention. First strand cDNA synthesis using a dNTP mix which includes dUTP is primed using an oligo-dT adapter- A primer. After reaching the 5' end of the mRNA (dashed line), oligo(dC) is added to the end of the cDNA by the M-MLV reverse transcriptase. Base pairing between the oligo(dC) and the oligo(dG) of adapter-B occurs, and through the process of template switching, the reverse compliment of adapter-B (adapter B') is incorporated into the 3' end of the newly synthesised cDNA as previously described (5, 6). Adapter A and B both contain dUTP instead of dTTP. Adapter A and B serve as priming sites for PCR amplification using primers A and B, which also have dTTP replaced by dUTP. PCR is performed using a dNTP mix which contains dUTP, so the resulting double stranded cDNA (T-RACE ready cDNA) contains dUTP residues throughout and dUTP containing adapters at the 3' and 5' ends.
Figure 2 shows a diagrammatic representation of the 5' specific amplification of cDNA ends using T-RACE. T-RACE ready cDNA serves as template for an asymmetric PCR reaction using a single gene specific primer (GSP1 ) and standard dNTPs (without dUTP). This reaction produces single stranded target cDNAs which include the adapter sequence comprised of standard dNTPs. UDG treatment degrades all non- target cDNAs and adapters containing dUTP. Subsequent PCR using a nested gene specific primer 2 (GSP2) with the 5' T-RACE primer results in the specific amplification of target cDNA ends. Figure 3 shows (A) Specific amplification of 5' cDNA ends from Atlantic salmon (Ss) and Zebrafish (Dr) fast muscle. Lane 1 STAC3 (Ss), Lane 2 IGF-I (Ss) Lane 3 CMYA5 (Dr), Lane 4 MAFbx (Ss), Lane 5 STAC3 (Ss). DNA size marker of 5000, 2000, 850, 400 and 200 bp is shown in Lane M. In all cases, a single amplicon was produced, except for STAC3 (Lane 1) where two alternative splice variants were obtained. 5' T- RACE successfully amplified IGF-I (Lane 2) which is expressed at low levels in Atlantic salmon muscle, and a long transcript, CMYA5 (Lane 3), which is over 6kb in length. To demonstrate that long amplicons can be amplified using the T-RACE method, we amplified -1.9 kb from STAC3 (Lane 5). (B) To demonstrate that the single pool of cDNA can be used for both 5' and 3' amplification of cDNA ends, we amplified the 3' ends of Zebrafish CMYA5 (Lane 1 ) and Atlantic salmon MAFbx (Lane 2) and STAC3 (Lane 3). DNA size marker of 5000, 2000, 850, 400 and 200 bp is shown in Lane M.
Figure 4 shows for background purposes non-specific amplification of products without UDG treatment. To demonstrate the increased specificity obtained by UDG treatment, we performed the same reactions to those in figure 1A but without UDG treatment prior to thermal cycling.
MATERIALS AND METHODS
RNA extraction
Total RNA was extracted from 100mg of Atlantic salmon (Salmo salar L) or zebrafish (Danio rerio) fast skeletal muscle tissue using Lysing matrix D (Qbiogene, Irvine, CA) with 1 ml Tri Reagent (Sigma, Gillingham, Dorset, UK) and homogenised using a Fast Prep instrument (Qbiogene, Irvine, CA). Total RNA was quantified based on absorbance at 260nm. Genomic DNA contamination was removed by treatment with Turbo DNA-free (Ambion, Austin, Texas, USA), and the integrity of purified RNA confirmed by agarose gel electrophoresis.
T-RACE ready cDNA synthesis
The T-RACE ready protocol is depicted in figure 1 and the primers used listed in table 1.
First strand cDNA synthesis incorporating dUTP and 5' and 3' adapter sequences
First strand cDNA synthesis was performed using a modified dNTP mixture which contained dUTP and a MMLV reverse transcriptase. cDNA synthesis was primed with Adapter A (table 1 ) using ^g total RNA. The RNA, Adapter A and dNTPs were incubated at 65 °C for 5 minutes to denature the RNA and then chilled on ice before addition of the remaining components in the following reaction mixture (20 μΙ): 2.5 uM Adapter A, 50 mM Tris-HCI pH 8.3, 75 mM KCI, 3 m MgCI2, 10 mM DTT, 1.0 mM dUTP, 0.5 mM dATP, 0.5 m dCTP, 0.5 mM dGTP, 0.1 mM dTTP, 40 U RNAse inhibitor (RNase OUT, Invitrogen, Carlsbad, CA, USA), 200 U Superscript II (Invitrogen, Carlsbad, CA, USA) and incubated for 1 h at 42 °C. After incubation, 0.4 μΙ of 100 mM MnCI2, and 1 μΙ of Adapter B (10 μΜ) was added to the reaction which was further
incubated for 15 min at 42°C. The reaction was then heat inactivated at 70 °C for 10 minutes. Degradation of the RNA in the RNA/cDNA hybrid was achieved by addition of 1 pi RNAse H (Invitrogen, Carlsbad, CA, USA) and incubation at 37 °C for 15 minutes. The reaction was purified through a QIAquick PCR purification column and eluted in 30 μΙ elution buffer as per manufacturer's guidelines (Qiagen Inc., Chatsworth, CA, USA).
Second strand synthesis incorporating dUTP by PCR
Second strand synthesis was achieved by PCR using the priming sites incorporated at the 3' (Adapter B) and 5' (Adapter A) ends of the first strand cDNA. 2 μΙ of the purified first strand cDNA was used as template, and amplified in the following reaction (50 μΙ): 2.5 mM MgCI2, 1.0 mM dUTP, 0.5 m dATP, 0.5 mM dCTP, 0.5 mM dGTP, 0.1 mM dTTP, 0.5 μΜ primer A, 0.5 μΜ primer B (table 1 ). The reaction mixture was mixed and heated to 95 °C before addition of 5 units of Taq DNA polymerase (Bioline, London, UK). The reaction mixture was then incubated at 95 °C for a further 2 minutes, followed by 20 cycles of 95 °C denaturing for 30 s, annealing at 60 °C for 30 s, and extension at 72 °C 12 minutes. The reaction was then chilled on ice and purified through a QIAquick PCR purification column (Qiagen Inc., Chatsworth, CA, USA) and eluted in 10Oul elution buffer as per manufacturer's guidelines. The purified double stranded cDNA, incorporating dUTP and 5' and 3' adapter sequences (T-RACE ready cDNA) serves as template for the following PCR reactions.
T-RACE PCR
The PCR reactions for the targeted amplification of cDNA ends are shown in figure 2, and the primers used listed in table 1.
Asymmetric PCR using standard dNTPs
Asymmetric PCR was performed using a gene specific primer (GSP1 ) and standard dNTPs (dATP, dTTP, dGTP, dCTP) in the following hot start 20 μΙ reaction: 0.5 μΜ GSP1 , 2μΙ T-RACE ready cDNA, 16 mM (NH4)2S04, 67 mM Tris-HCI, 3 mM MgCI2, 0.25 mM dNTPs. The reaction mixture was heated to 95 °C for 2.5 min before addition of 1 unit of Taq DNA polymerase (Bioline, London, UK), and then cycled 20 times with the following conditions: 95 °C 30 s, 60 °C 30 s, 72 °C 2 min. The reaction was chilled on ice, purified through a MinElute PCR purification column (Qiagen Inc., Chatsworth, CA, USA) and eluted in 11 μΙ water. The length of time for the 72 °C extension step of the PCR should be varied according to expected amplicon length.
Uracil DNA glycosylase degradation of non target dUTP containing cDNAs
The entire asymmetric reaction is used in the following steps using a nested gene specific primer (GSP2), and the primers used for PCR do not contain dUTP. cDNAs incorporating dUTP were removed by UDG treatment to leave only those cDNAs synthesised with standard dNTPs during the asymmetric PCR. The following 17.8 μΙ reaction was performed: 10 μΙ asymmetric PCR product, 2 μΙ (2 units) Uracil DNA glycosylase, 2 μΙ 10 x PCR buffer (160 mM (NH4)2S04l 670 mM Tris-HCI), 1.2 μΙ 50 mM MgCI2, 1 μΙ nested GSP2, 1μΙ of 10 μΜ T-RACE primer (table 1), 0.6 μΙ water, and incubated at 37 °C for 30 minutes. Depending on whether 3' or 5' cDNA ends are targeted, the 3' or 5' T-RACE primer is used for amplification.
Targeted amplification of cDNA ends (T-RACE PCR)
The UDG treated cDNA mixture was heated to 95 °C before addition of 2 μΙ 2.5 mM standard dNTPs and 0.2 μΙ (1unit) of Taq DNA polymerase (Bioline, London, UK). The reaction was denatured at 95 °C for 5 min followed by 35 cycles of 95 °C 30 s, 60 °C 30s, 72 °C 2 min, followed by a final extension of 7 min at 72 °C. The length of time for
the 72 °C extension step of the PCR should be varied according to expected amplicon length.
Cloning
PCR products were separated on a 1.2% (m/v) agarose gel, and the bands excised and purified using a QIAquick gel extraction kit (Qiagen Inc., Chatsworth, CA, USA). The PCR products were cloned into a T/A pCR4-TOPO vector (Invitrogen, Carlsbad, CA, USA) and transformation of chemically competent TOP10 Escherichia coli cells (Invitrogen, Carlsbad, CA, USA). Individual colonies were grown and plasmids purified using a QIAprep Spin Miniprep Kit (Qiagen Inc., Chatsworth, CA, USA). Sequencing was performed using T3 and T7 sequencing primers with Big Dye terminator v3.1 sequencing chemistry (Applied Biosystems, Foster City, CA, USA) at the University of Dundee Sequencing Facility. Table 1. Primer and adapter sequences used for first and second strand cDNA synthesis and specific amplification of cDNA ends.
Primer Sequence (5' - 3') Application
Adapter A AUAUCUCGAGUUCGCGCCGGAUCC(T)25VN cDNA synthesis and adapter-A incorporation
Adapter B AUAUGCACUGCCGCGUCUGAGGGGGGGG Cap finder adapter-B incorporation
Primer A AUAUCUCGAGUUCGCGCCGGAU 2nd strand cDNA synthesis
Primer B AUAUGCACUGCCGCGUCUGA 2nd strand cDNA synthesis
5' T-RACE ATATGCACTGCCGCGTCTGA 5' Specific Amplification of primer cDNA ends
3' T-RACE ATATCTCGAGTTCGCGCCGGAT 3' Specific amplification of primer cDNA ends
RESULTS AND DISCUSSION We report the development of a novel method for acquiring the ends especially the 5' ends of cDNA molecules using a modification of previously published methods. Using this approach, we have identified the 5' ends of cDNA molecules expressed in muscle of zebrafish and Atlantic salmon (Fig. 3A). The improved method involves the production of double stranded cDNA incorporating dUTP, and the addition of 5' and 3' adapters which also contain dUTP (Fig. 1 ). By producing the second strand of cDNA, a priming site for a gene specific primer for 5' RACE is introduced, allowing for an asymmetric PCR reaction to be performed using standard dNTP mix. This asymmetric PCR using only a gene specific primer produces a cDNA fragment which includes the 5' adapter sequence, and is comprised of standard dNTPs (Fig. 2). Degradation of dUTP containing cDNA molecules by Uracil DNA glycosylase (UDG) treatment leaves only the molecules comprised of standard dNTPs primed by the gene specific primer (Fig. 2). This now serves as the template for PCR amplification using a nested gene specific primer and a 5' T-RACE primer, thus specifically amplifying the 5'end of the desired cDNA sequence.
To demonstrate the effectiveness of our approach, we amplified the 5' ends of several genes of differing lengths whose mRNAs are present in varying abundance (Fig. 3A). For example, we amplified the 5' ends of zebrafish myospryn (CMYA5), a gene over 6kb in length, Atlantic salmon MAFbx, and insulin-like growth factor-l (IGF-I) which is expressed at low levels in muscle (Fig 3A). We also demonstrated that long amplicons
can be generated using this method by amplifying the ~1.9 kb 5' end of STAC3 (Fig. 3A). Using GSPs and the 5' T-RACE primer, in all cases we were able to obtain a single amplicon (except for STAC3 where we identified two alternatively spliced transcripts) of the correct size (Fig. 3A), the identity of which was confirmed by sequencing. We also used the same cDNA pool to amplify the 3' ends for a number of genes (Fig. 3B), demonstrating that a single cDNA pool can be used for both 5' and 3' amplification of cDNA ends.
The current method has several advantages over existing methodologies. Standard RACE methods often result in non specific amplification giving false positive results (6, 7, 8). When cDNA is synthesised using oligo dT, the subsequent incorporation of the adapter sequence for 5' RACE (through terminal transferase tailing or cap finder methods) occurs in every cDNA molecule. Due to this, mispriming events during PCR will often lead to exponential amplification, and smears, rather than distinct bands are often obtained. The use of a nested PCR reaction should increase the specificity of the RACE reaction, however non-specific products are frequently obtained. The T-RACE method described herein degrades all of the non-target cDNA molecules, except for those that were primed by the gene specific primer and synthesised using standard dNTPs, thereby significantly simplifying the templates present in the PCR reaction. As the gene specific primer is used in an asymmetric PCR, where higher annealing temperatures are permitted, rather than during cDNA synthesis, the specificity of the reaction is increased. By using a nested primer in the second PCR reaction, specific amplification of the desired molecule is achieved. During the development of this method, we made several changes to our original protocol which improved the efficiency of the reactions. Taq polymerase is less efficient at incorporating dUTP than dTTP (10) which could impact on the double
stranded cDNA synthesis. It was observed that a ratio of dUTP:dTTP of 8:1 , improved the efficiency of the T-RACE reaction, but still resulted in sufficient degradation of non- target cDNAs to give specific amplification. We also observed an improvement in the specificity of the PCR reactions by adding the MnCI2 and adapter-A after cDNA synthesis has completed. Presumably this modification decreases the chances of adapter-A priming cDNA synthesis during the first strand cDNA reaction which could lead to spurious amplification products in subsequent reactions. Performing all reactions as a hot-start (adding Taq DNA polymerase after reactions have reached 95°C) improved specificity and this could also be achieved using a commercially available hot-start enzyme. Originally our method did not use a PCR (exponential) amplification step during double stranded cDNA synthesis, and we were unable to amplify rare transcripts such as IGF-I from this template. This is likely to be due to the fact that the asymmetric PCR performed using standard dNTPs, which is critical to the success of this method, does not result in exponential amplification of products. However, performing 20 cycles of PCR for the second strand synthesis improved the outcomes for amplifying rare transcripts, most likely by greatly increasing the number of targets available for the asymmetric PCR. The use of Uracil DNA glycosylase and dUTP has been widely used to control PCR product carryover contamination (9, 10), and its effectiveness in simplifying 5'RACE reactions is clearly demonstrated here (Fig. 3A and 4). Nested PCR reactions, which were not treated with UDG prior to thermal cycling resulted in smears and non specific amplification products (Fig. 3), whereas treatment with UDG resulted in specific amplification (Fig. 3A).
The method described herein offers several advantages over other protocols that are currently in use. Using UDG treated PCR products as template results in specific amplification, which in most cases results in a single amplicon of the correct size. We
have now used this technique to amplify the 5' ends of several cDNAs, each one from the same T-RACE ready cDNA pool using total RNA as starting material.
REFERENCES
1. Salehi-Ashtiani, K., Lin, C.W., Hao, T., Shen, Y., Szeto, D., Yang, X.P., Ghamsari, L., Lee, H., Fan, C.Y., Murray, R.R. et al. (2009) Large-scale RACE approach for proactive experimental definition of C. elegans ORFeome. Genome Res., 19, 2334- 2342.
2. Frohman, M.A., Dush, M.K. and Martin, G.R. (1988) Rapid Production of Full-Length Cdnas from Rare Transcripts - Amplification Using a Single Gene-Specific Oligonucleotide Primer. Proc. Natl. Acad. Sci. U.S.A., 85, 8998-9002.
3. Fromont-Racine, M., Bertrand, E., Pictet, R. and Grange, T. (1993) A Highly Sensitive Method for Mapping the 5' Termini of mRNAs. Nucleic Acids Res., 21 , 1683- 1684.
4. Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) In Molecular cloning: a laboratory manual, 2d ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, pp. 1.74-1.84, 7.37-7.52.
5. Schmidt, W.M. and Mueller, M.W. (1999) CapSelect: a highly sensitive method for 5' CAP-dependent enrichment of full-length cDNA in PCR-mediated analysis of mRNAs.
Nucleic Acids Res., 27, e31.
6. Schramm, G., Bruchhaus, I. and Roeder, T. (2000) A simple and reliable 5 -RACE approach. Nucleic Acids Res., 28, e96
7. Schaefer, B.C. (1995) Revolutions in Rapid Amplification of Cdna Ends - New Strategies for Polymerase Chain-Reaction Cloning of Full-Length Cdna Ends. Anal Biochem., 227, 255-273.
8. Lipovich, L, Lynch, E.D., Lee, M.K. and King, M.C. (2001 ) A novel sodium bicarbonate cotransporter-like gene in an ancient duplicated region: SLC4A9 at 5q31 . Genome Biol., 2:research0011.1-001 1.13..
9. Kwok, S. and Higuchi, R. (1989) Avoiding False Positives with Per. Nature., 339, 237-238.
10. Longo, M.C, Berninger, M.S. and Hartley, J.L (1990) Use of Uracil DNA Glycosylase to Control Carry-over Contamination in Polymerase Chain-Reactions. Gene., 93, 125-128.
11. Buchman, G.W., Schuster, D.M. and Rashtchian, A. (1993) Selective Rna Amplification - a Novel Method Using Dump-Containing Primers and Uracil DNA
Glycosylase. PCR Methods ADDI.. 3, 28-31.
Claims
1. a method for generating a modified cDNA molecule comprising sequence corresponding to the 5' and 3' ends of an mRNA molecule comprising the steps of: e) annealing a first adapter oligonucleotide to an mRNA molecule, said first adapter comprising a 3' portion which is substantially complimentary to the 3' poly A tail of the mRNA molecule and a 5' portion which comprises one or more uracil residues; f) extending from said first adapter, utilizing dNTPs which include dUTP, so as to generate a first modified cDNA strand, which comprises one or more, typically a plurality of uracil residues in its sequence; g) incorporating a second adapter, which is different to the first adapter, at the 3' end of the first cDNA strand, wherein the second adapter comprises at least a 3' portion which is not specific to the mRNA molecule and which comprises one or more uracil residues in the sequence; h) copying said first modified cDNA strand by extending from a first primer which comprises one or more uracils and comprises at least a 3' portion which is substantially complementary to a portion of the second adapter sequence, using dNTPs which include dUTP, thereby generating a modified double stranded cDNA molecule, which includes one or more, typically a plurality of uracil residues in the first and second strands and adapter sequences 5' and 3' of sequence corresponding to the 5'and 3' ends of the mRNA molecule.
2. The method according to claim 1 wherein the method may be conducted on a pool of mRNA molecules, thereby generating a single pool of cDNA molecules, each cDNA molecule from the pool comprising the same 5' and 3' adapter sequences respectively.
3. The method according to either of claims 1 or 2 wherein at least 1 in 1 , to 1 in 20, such as 1 in 1 to 1 , in 4, especially 1 in 1.05 to 1 in 2 thymidine residues of the cDNA are replaced by a uracil residue.
4. The method according to any preceding claim wherein the first adapter oligonucleotide comprises a 3' portion which comprises a stretch of T residues, so as to be able to complimentary base pair with the poly A tail of the mRNA molecule.
5. The method according to any preceding claim wherein the extension reaction is catalysed by a reverse transcriptase, such as avian myeloblastosis virus (AMV) or
Moloney murine leukaemia virus (M-MLV).
6. The method according to claim 5 wherein the reverse transcriptase is MMLV and the second adapter is added using a cap switching technique.
7. The method according to claim 5 wherein the second adapter is added using terminal transferase or RNA ligase.
8. The method according to any preceding claim wherein the second cDNA strand is generated by copying the first cDNA strand using a first primer (where uracil replaces thymidine) which is able to specifically bind to the second adapter sequence at 3' end of the first cDNA strand, using a suitable DNA polymerase, such as Taq polymerase and a dNTP mix comprising dUTP.
9. A method of amplifying a 5' or 3' end of an mRNA molecule for enabling identification of sequence at a respective 5' or 3' end of the mRNA molecule, the method comprising: e) providing the double stranded cDNA molecule or pool of cDNA molecules according to any preceding claim, or amplified copies thereof; f) asymmetrically amplifying the 5' or 3' end of said cDNA molecule or one of said cDNA molecules in the pool using a gene specific primer which is substantially complementary to an internal portion of the cDNA sequence, using dNTPs which do not include dUTP, so as to generate an amplified gene specific single stranded DNA molecule; g) adding UDG so as to degrade sequences which comprise uracil thereby leaving only an amplified gene specific single stranded DNA molecule; h) optionally generating an amplified double stranded DNA gene specific product comprising a sequence corresponding to the 5' or 3' end of a specific mRNA molecule using a gene nested specific primer and a primer which comprises a 3' portion which is substantially complementary to the 5' or 3' end of the amplified gene specific single stranded DNA molecule.
10. The method according to claim 9 wherein [step?] (d) is included.
11. The method according to claims 9 or 10 wherein exponential amplification of the desired amplified single stranded DNA molecule is achieved using a second nested
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GB1012748.8 | 2010-07-29 | ||
| GBGB1012748.8A GB201012748D0 (en) | 2010-07-29 | 2010-07-29 | Improved RACE |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2012013932A1 true WO2012013932A1 (en) | 2012-02-02 |
Family
ID=42799293
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB2011/001131 Ceased WO2012013932A1 (en) | 2010-07-29 | 2011-07-28 | Improved race |
Country Status (2)
| Country | Link |
|---|---|
| GB (1) | GB201012748D0 (en) |
| WO (1) | WO2012013932A1 (en) |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013191775A2 (en) | 2012-06-18 | 2013-12-27 | Nugen Technologies, Inc. | Compositions and methods for negative selection of non-desired nucleic acid sequences |
| CN106636074A (en) * | 2017-02-23 | 2017-05-10 | 厦门大学 | 3'RACE (rapid amplification of cDNA ends) method for acquiring complete 3' end sequence as 3' end having repetitive sequence |
| US9650628B2 (en) | 2012-01-26 | 2017-05-16 | Nugen Technologies, Inc. | Compositions and methods for targeted nucleic acid sequence enrichment and high efficiency library regeneration |
| US9745614B2 (en) | 2014-02-28 | 2017-08-29 | Nugen Technologies, Inc. | Reduced representation bisulfite sequencing with diversity adaptors |
| US9822408B2 (en) | 2013-03-15 | 2017-11-21 | Nugen Technologies, Inc. | Sequential sequencing |
| WO2018006567A1 (en) * | 2016-07-08 | 2018-01-11 | 北京全式金生物技术有限公司 | High-efficiency method for linking dna connector |
| US10102337B2 (en) | 2014-08-06 | 2018-10-16 | Nugen Technologies, Inc. | Digital measurements from targeted sequencing |
| US10570448B2 (en) | 2013-11-13 | 2020-02-25 | Tecan Genomics | Compositions and methods for identification of a duplicate sequencing read |
| US11028430B2 (en) | 2012-07-09 | 2021-06-08 | Nugen Technologies, Inc. | Methods for creating directional bisulfite-converted nucleic acid libraries for next generation sequencing |
| US11099202B2 (en) | 2017-10-20 | 2021-08-24 | Tecan Genomics, Inc. | Reagent delivery system |
| US12059674B2 (en) | 2020-02-03 | 2024-08-13 | Tecan Genomics, Inc. | Reagent storage system |
| US12492430B2 (en) | 2017-04-11 | 2025-12-09 | Tecan Genomics, Inc. | Library quantitation and qualification |
| US12600963B2 (en) | 2020-01-20 | 2026-04-14 | Tecan Genomics, Inc. | Depletion of abundant uninformative sequences |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5035996A (en) | 1989-06-01 | 1991-07-30 | Life Technologies, Inc. | Process for controlling contamination of nucleic acid amplification reactions |
| WO1992018521A1 (en) * | 1991-04-10 | 1992-10-29 | Life Technologies, Inc. | Method for amplifying and altering an rna sequence |
| US5683896A (en) | 1989-06-01 | 1997-11-04 | Life Technologies, Inc. | Process for controlling contamination of nucleic acid amplification reactions |
-
2010
- 2010-07-29 GB GBGB1012748.8A patent/GB201012748D0/en not_active Ceased
-
2011
- 2011-07-28 WO PCT/GB2011/001131 patent/WO2012013932A1/en not_active Ceased
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5035996A (en) | 1989-06-01 | 1991-07-30 | Life Technologies, Inc. | Process for controlling contamination of nucleic acid amplification reactions |
| US5683896A (en) | 1989-06-01 | 1997-11-04 | Life Technologies, Inc. | Process for controlling contamination of nucleic acid amplification reactions |
| US5945313A (en) | 1989-06-01 | 1999-08-31 | Life Technologies, Inc. | Process for controlling contamination of nucleic acid amplification reactions |
| WO1992018521A1 (en) * | 1991-04-10 | 1992-10-29 | Life Technologies, Inc. | Method for amplifying and altering an rna sequence |
| US5334515A (en) | 1991-04-10 | 1994-08-02 | Life Technologies, Inc. | Method for altering a nucleotide sequence |
Non-Patent Citations (16)
| Title |
|---|
| BOWER NEIL I ET AL: "Targeted rapid amplification of cDNA ends (T-RACE)--an improved RACE reaction through degradation of non-target sequences.", NUCLEIC ACIDS RESEARCH, vol. 38, no. 21, E194, November 2010 (2010-11-01), pages 1 - 7, XP002661009, ISSN: 1362-4962, DOI: 10.1093/nar/gkq816 * |
| BUCHMAN G W ET AL: "Selective RNA amplification: a novel method using dUMP-containing primers and uracil DNA glycosylase.", PCR METHODS AND APPLICATIONS, vol. 3, no. 1, August 1993 (1993-08-01), pages 28 - 31, XP002661010, ISSN: 1054-9803 * |
| BUCHMAN, G.W., SCHUSTER, D.M., RASHTCHIAN, A.: "Selective Rna Amplification - a Novel Method Using Dump-Containing Primers and Uracil DNA Glycosylase", PCR METHODS APPL., vol. 3, 1993, pages 28 - 31, XP002661010 |
| FROHMAN, M.A., DUSH, M.K., MARTIN, G.R.: "Rapid Production of Full-Length Cdnas from Rare Transcripts - Amplification Using a Single Gene-Specific Oligonucleotide Primer", PROC. NATL. ACAD. SCI. U.S.A., vol. 85, 1988, pages 8998 - 9002, XP000604678, DOI: doi:10.1073/pnas.85.23.8998 |
| FROMONT-RACINE, M., BERTRAND, E., PICTET, R., GRANGE, T.: "A Highly Sensitive Method for Mapping the 5' Termini of mRNAs", NUCLEIC ACIDS RES., vol. 21, 1993, pages 1683 - 1684 |
| KWOK, S., HIGUCHI, R.: "Avoiding False Positives with Pcr", NATURE, vol. 339, 1989, pages 237 - 238, XP001172940, DOI: doi:10.1038/339237a0 |
| LIPOVICH, L., LYNCH, E.D., LEE, M.K., KING, M.C.: "A novel sodium bicarbonate cotransporter-like gene in an ancient duplicated region: SLC4A9 at 5q31", GENOME BIOL., 2001 |
| LONGO M C ET AL: "Use of uracil DNA glycosylase to control carry-over contamination in polymerase chain reactions", GENE, vol. 93, no. 1, 1 September 1990 (1990-09-01), ELSEVIER, AMSTERDAM, NL, pages 125 - 128, XP023545615, ISSN: 0378-1119, [retrieved on 19900901], DOI: 10.1016/0378-1119(90)90145-H * |
| LONGO, M.C., BERNINGER, M.S., HARTLEY, J.L.: "Use of Uracil DNA Glycosylase to Control Carry-over Contamination in Polymerase Chain-Reactions", GENE, vol. 93, 1990, pages 125 - 128, XP023545615, DOI: doi:10.1016/0378-1119(90)90145-H |
| SALEHI-ASHTIANI, K., LIN, C.W., HAO, T., SHEN, Y., SZETO, D., YANG, X.P., GHAMSARI, L., LEE, H., FAN, C.Y., MURRAY, R.R. ET AL.: "Large-scale RACE approach for proactive experimental definition of C. elegans ORFeome", GENOME RES., vol. 19, 2009, pages 2334 - 2342 |
| SAMBROOK, J, FRITSCH, E.F., MANIATIS, T.: "Molecular cloning: a laboratory manual", 1989, COLD SPRING HARBOR LABORATORY, pages: 1.74 - 1.84,7.3 |
| SCHAEFER, B.C.: "Revolutions in Rapid Amplification of Cdna Ends - New Strategies for Polymerase Chain-Reaction Cloning of Full-Length Cdna Ends", ANAL BIOCHEM., vol. 227, 1995, pages 255 - 273, XP009012046, DOI: doi:10.1006/abio.1995.1279 |
| SCHMIDT W M ET AL: "CapSelect: a highly sensitive method for 5' CAP-dependent enrichment of full-length cDNA in PCR-mediated analysis of mRNAs.", NUCLEIC ACIDS RESEARCH, vol. 27, no. 21, E31, 1 November 1999 (1999-11-01), pages I - IV, XP002661269, ISSN: 1362-4962 * |
| SCHMIDT, W.M., MUELLER, M.W.: "CapSelect: a highly sensitive method for 5' CAP-dependent enrichment of full-length cDNA in PCR-mediated analysis of mRNAs", NUCLEIC ACIDS RES., vol. 27, 1999, pages E31, XP002661269, DOI: doi:10.1093/nar/27.21.e31 |
| SCHRAMM G ET AL: "A simple and reliable 5'-RACE approach.", NUCLEIC ACIDS RESEARCH, vol. 28, no. 22, E96, 15 November 2000 (2000-11-15), pages 1 - 4, XP002661255, ISSN: 1362-4962 * |
| SCHRAMM, G., BRUCHHAUS, I., ROEDER, T.: "A simple and reliable 5'-RACE approach", NUCLEIC ACIDS RES., vol. 28, 2000, pages E96 |
Cited By (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9650628B2 (en) | 2012-01-26 | 2017-05-16 | Nugen Technologies, Inc. | Compositions and methods for targeted nucleic acid sequence enrichment and high efficiency library regeneration |
| US10876108B2 (en) | 2012-01-26 | 2020-12-29 | Nugen Technologies, Inc. | Compositions and methods for targeted nucleic acid sequence enrichment and high efficiency library generation |
| US10036012B2 (en) | 2012-01-26 | 2018-07-31 | Nugen Technologies, Inc. | Compositions and methods for targeted nucleic acid sequence enrichment and high efficiency library generation |
| EP2861787A4 (en) * | 2012-06-18 | 2016-03-02 | Nugen Technologies Inc | COMPOSITIONS AND METHODS FOR THE NEGATIVE SELECTION OF UNDESIRABLE NUCLEIC ACID SEQUENCES |
| US9957549B2 (en) | 2012-06-18 | 2018-05-01 | Nugen Technologies, Inc. | Compositions and methods for negative selection of non-desired nucleic acid sequences |
| WO2013191775A2 (en) | 2012-06-18 | 2013-12-27 | Nugen Technologies, Inc. | Compositions and methods for negative selection of non-desired nucleic acid sequences |
| US11697843B2 (en) | 2012-07-09 | 2023-07-11 | Tecan Genomics, Inc. | Methods for creating directional bisulfite-converted nucleic acid libraries for next generation sequencing |
| US11028430B2 (en) | 2012-07-09 | 2021-06-08 | Nugen Technologies, Inc. | Methods for creating directional bisulfite-converted nucleic acid libraries for next generation sequencing |
| US10619206B2 (en) | 2013-03-15 | 2020-04-14 | Tecan Genomics | Sequential sequencing |
| US9822408B2 (en) | 2013-03-15 | 2017-11-21 | Nugen Technologies, Inc. | Sequential sequencing |
| US10760123B2 (en) | 2013-03-15 | 2020-09-01 | Nugen Technologies, Inc. | Sequential sequencing |
| US10570448B2 (en) | 2013-11-13 | 2020-02-25 | Tecan Genomics | Compositions and methods for identification of a duplicate sequencing read |
| US11098357B2 (en) | 2013-11-13 | 2021-08-24 | Tecan Genomics, Inc. | Compositions and methods for identification of a duplicate sequencing read |
| US11725241B2 (en) | 2013-11-13 | 2023-08-15 | Tecan Genomics, Inc. | Compositions and methods for identification of a duplicate sequencing read |
| US9745614B2 (en) | 2014-02-28 | 2017-08-29 | Nugen Technologies, Inc. | Reduced representation bisulfite sequencing with diversity adaptors |
| US10102337B2 (en) | 2014-08-06 | 2018-10-16 | Nugen Technologies, Inc. | Digital measurements from targeted sequencing |
| WO2018006567A1 (en) * | 2016-07-08 | 2018-01-11 | 北京全式金生物技术有限公司 | High-efficiency method for linking dna connector |
| CN106636074A (en) * | 2017-02-23 | 2017-05-10 | 厦门大学 | 3'RACE (rapid amplification of cDNA ends) method for acquiring complete 3' end sequence as 3' end having repetitive sequence |
| US12492430B2 (en) | 2017-04-11 | 2025-12-09 | Tecan Genomics, Inc. | Library quantitation and qualification |
| US11099202B2 (en) | 2017-10-20 | 2021-08-24 | Tecan Genomics, Inc. | Reagent delivery system |
| US12600963B2 (en) | 2020-01-20 | 2026-04-14 | Tecan Genomics, Inc. | Depletion of abundant uninformative sequences |
| US12059674B2 (en) | 2020-02-03 | 2024-08-13 | Tecan Genomics, Inc. | Reagent storage system |
Also Published As
| Publication number | Publication date |
|---|---|
| GB201012748D0 (en) | 2010-09-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2012013932A1 (en) | Improved race | |
| Chenchik et al. | Full-length cDNA cloning and determination of mRNA 5′ and 3′ ends by amplification of adaptor-ligated cDNA | |
| Stewart et al. | Characterization of mature mitochondrial transcripts in Drosophila, and the implications for the tRNA punctuation model in arthropods | |
| US9663770B2 (en) | Reverse transcriptases for use in high temperature nucleic acid synthesis | |
| US9012183B2 (en) | Use of template switching for DNA synthesis | |
| US5830712A (en) | Selective template deletion method | |
| CN106062209B (en) | Synthetic long-read DNA sequencing | |
| Yeku et al. | Rapid amplification of cDNA ends (RACE) | |
| CN112689673A (en) | Transposome-enabled DNA/RNA sequencing (TED RNA-SEQ) | |
| WO2007035742A2 (en) | Cdna library preparation | |
| US20060240451A1 (en) | Compositions and methods employing 5' phosphate-dependent nucleic acid exonucleases | |
| CN113215219A (en) | Methods of depleting target molecules from an initial collection of nucleic acids, and compositions and kits for practicing same | |
| JP6583796B2 (en) | Nucleic acid amplification method | |
| US10619199B2 (en) | Nucleic acid amplification and library preparation | |
| JP2023541511A (en) | Reverse transcriptase variants with increased activity and thermostability | |
| JP4284063B2 (en) | Nucleotide sequencing method | |
| CN114364813B (en) | Method for multiplex isothermal amplification of nucleic acid sequences | |
| US20160122818A1 (en) | Gene expression analysis | |
| KR20240051994A (en) | Systems, compositions, and methods comprising retrotransposons and functional fragments thereof | |
| Bower et al. | Targeted rapid amplification of cDNA ends (T-RACE)—an improved RACE reaction through degradation of non-target sequences | |
| US20240368586A1 (en) | Guide rna sequencing confirmation | |
| WO2002059353A2 (en) | Two-step amplification using a program primer followed by specific primers | |
| Fehr et al. | Rapid cloning of cDNA ends polymerase chain reaction of G-protein-coupled receptor kinase 6: an improved method to determine 5′-and 3′-cDNA ends | |
| Chutia et al. | Recent developments in RACE-PCR for the full-length cDNA identification | |
| JP5532925B2 (en) | Method for synthesizing single-stranded or double-stranded DNA and kit for synthesis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11743571 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 11743571 Country of ref document: EP Kind code of ref document: A1 |