WO2012007462A1 - Mittel und verfahren zur diagnostik, prognose und therapiekontrolle von tumorerkrankungen - Google Patents
Mittel und verfahren zur diagnostik, prognose und therapiekontrolle von tumorerkrankungen Download PDFInfo
- Publication number
- WO2012007462A1 WO2012007462A1 PCT/EP2011/061854 EP2011061854W WO2012007462A1 WO 2012007462 A1 WO2012007462 A1 WO 2012007462A1 EP 2011061854 W EP2011061854 W EP 2011061854W WO 2012007462 A1 WO2012007462 A1 WO 2012007462A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- methylation
- phospholipase
- dna
- receptor
- tumor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Definitions
- the invention relates to the field of medicine, especially the diagnosis, prognosis and therapy control of tumor diseases.
- tumor markers are determined in body fluids such as blood samples, urine, sputum or tissue samples. These are components of tumor cells that are increased or decreased and whose changes in body fluids such as blood can be detected. However, with few exceptions, these tumor markers do not allow general screening for tumors because their diagnostic specificities and sensitivities are too low. Although these tumor markers can often indicate early malignant changes to imaging techniques, they do not permit detection of malignant changes at a time when the occurrence of metastases is in any event precluded.
- genes can be epigenically regulated by DNA methylation. In tumors, the DNA is generally hypomethylated. However, individual genes are hypermethylated [60, 61, 62]. Methods for detecting DNA methylation in tumors are also known [60]. Also DE 100 56 802 AI describes such a method for toxicological diagnosis.
- PHA 2 phospholipase A 2
- pancreatic or non-pancreatic or synovial PLA 2 assigned to groups 1 and 11 [1, 2].
- Further differentiation of sPLA 2 s was required when the structure of the bee venom PLA 2 was elucidated. In contrast to groups 1 and 11, bee and wasp sPLA 2 s have only 10 cysteine residues, which is why these enzymes belong to group III [4].
- PLA 2 s have been discovered in recent years, which also have a catalytic histidine residue. Since these enzymes differ structurally distinctly from those of groups 1-111, these enzymes are assigned to groups V, X and XII [5]. Additional PLA 2 s were identified, which are similar to the previously known PLA 2 group 11 except for the arrangement of the 7th disulfide group and a C-terminal amino acid sequence extension. Accordingly, a classification of these enzymes has been proposed which provides for further subgroups such as sPLA 2 -llA, sPLA 2 -llD, sPLA 2 -llE and sPLA 2 -III [6, 7]. The non-pancreatic or synovial PLA 2 now corresponds to the sPLA 2 -UA, the secretory PLA 2 type IIA.
- a publication in the circle of the inventors discusses an epigenetic regulation of secreted phospholipases A2 of type IIA (SPLA 2 -IIA) and of type V (sPLA 2 -V) by DNA hypermethylation in Jurkat cells [61].
- the sPLA2 -llA is next to the pancreatic sPLA2 -LB and cPLA2 -lVA the most studied enzyme of PLA2 superfamily [1, 2, 6-8].
- sPLA 2 -llA is constitutively expressed in a variety of different cell types and stored in secretory granules. These include platelets [9], neutrophils, macrophages and mast cells [10-12].
- organs and tissues such as the prostate [13], placenta [14], spleen, liver, intestinal mucosa, tonsils, salivary and lacrimal glands, cartilage, and bone marrow, sPLA 2 -llA enzyme activities are also found [13, 15].
- the enzyme can also be detected in body fluids such as seminal plasma [16, 17] and tear fluids [18].
- body fluids such as seminal plasma [16, 17] and tear fluids [18].
- sPLA 2 -llA body fluids
- the function of sPLA 2 -llA in seminal plasma and the prostate is associated with active prostaglandin biosynthesis [19].
- fusogenic properties of lysophospholipids are described, which are released in the sPLA 2 -UA-catalyzed reaction. This may facilitate sperm penetration through the egg-plasma membrane [20].
- Anti-bacterial properties of sPLA 2 -llA may also be important.
- a sPLA 2 -llA was detected in the paneth cells of the digestive tract.
- the sPLA 2 -UA of the Paneth cells should also play a role in the digestion of dietary phospholipids [21]. Finally, high levels of sPLA 2 -IAA can be detected in the placenta [22]. However, the function of the enzyme in this tissue is still largely unexplained. The involvement of the enzyme in eicosanoid biosynthesis through the release of arachidonic acid is discussed [23].
- sPLA 2 -IAA In addition to effects associated with the release of arachidonic acid, up-regulation of sPLA 2 -IAA may also lead to effects that are independent of enzyme activity. Thus, inactive sPLA 2 -IAA mutants that were unable to release arachidonic acid from cytokine-stimulated connective tissue mast cells retained their ability to increase COX-2 expression in these cells. This suggests that COX-2-inducing activities of sPLA 2 -IIA are mediated regardless of their enzyme activity [24]. In mesangial cells and smooth vascular muscle cells, the autocrine and paracrine transcriptional regulation of the PLA2G2A gene was also independent of the activity of the enzyme [25, 26].
- sPLA 2 -HA activates signal transduction pathways such as the protein kinase C, MEK / ERK1 / 2, p38 MAPK, and P13K / Akt-dependent cascades, [27-31] as well as activating the synthesis and release of cytokines from human monocytes, lung macrophages and eosinophils, for which enzyme activity was not required, at least in part [32-35].
- signal transduction pathways such as the protein kinase C, MEK / ERK1 / 2, p38 MAPK, and P13K / Akt-dependent cascades, [27-31] as well as activating the synthesis and release of cytokines from human monocytes, lung macrophages and eosinophils, for which enzyme activity was not required, at least in part [32-35].
- pancreatic sPLA 2 -lB and bee venom sPLA 2 - 111 The formation of sPLA
- sPLA 2 -Rl receptors or binding sites that are responsible for the effects caused by sPLA 2 -Rl and independent of their enzyme activities.
- a corresponding sPLA 2 receptor has been detected in a number of cells, including smooth muscle cells, fibroblasts, polymorphonuclear neutrophils (PMNs), Swiss 3T3 cells, and astrocytes (31, 37-42).
- PMNs polymorphonuclear neutrophils
- astrocytes 31, 37-42).
- the possible significance of this receptor for cell physiology and pathophysiology is demonstrated, for example, by the fact that corresponding effects on the migration and proliferation of smooth vascular muscle cells, on the adhesion of PMN and on the activity of p38 MAPK have been described. This in turn changed elastase release, inhibition of acetylcholine release, proliferation of Swiss 3T3 cells, and, above all, tumor invasion (31, 43-47).
- sPLA 2 receptor sPLA 2 -Rl
- the sPLA 2 -Rl is a type 1 transmembrane glycoprotein receptor and is also known as a multifunctional M-type receptor. It has a molecular weight of 180 kDa, first time specifically detects secretory sPLA 2 s in rabbits in skeletal muscle cells [50, 51].
- sPLA 2 -Rl The biological function of sPLA 2 -Rl is still unclear. It is known that sPLA 2 -R1-deficient mice are partially resistant to LP S -induced lethality and that these mice have reduced TNF- ⁇ and IL-1 ⁇ serum levels after LPS administration. From this, a pro-inflammatory significance of the receptor was derived [55]. Furthermore, the receptor is endocytosed similar to the LDL receptor and leads to the lysosomal degradation of bound sPLA 2 s, so that the receptor may also play a role in the regulation of sPLA 2 activities in inflammation [56, 57].
- sPLA 2 -Rl-expressing human fibroblasts which became cell-growth-inhibited and senescent after 2 weeks of culture
- short-hairpin RNA (shRNA) -transfected cells whose translation of the PLA2R1 gene was blocked, were unrestricted Growth on.
- sPLA 2 -Rl-dependent effects are mediated via p53-dependent metabolic pathways and that the generation of reactive oxygen species is important [48].
- the invention is intended to detect malignant changes at an early stage, ie. H. at the cellular level. Furthermore, with the aid of the invention, methods are to be developed which enable an immediate efficiency control of therapies and facilitate the search for new active substances for the therapy of tumor diseases.
- the object of the invention is in particular to specify new means and methods for the diagnosis, prognosis and therapy control of tumor diseases.
- the invention is based on the inventively discovered and previously unknown epigenetic decommissioning of the phospholipase A2 receptor gene (PLA2R1 gene) in leukemia cells (Fig. 1) and in patients with leukemias and solid tumors.
- PLA2R1 gene This epigenetic decommissioning of the PLA2R1 gene is associated with DNA methylation in GC-rich sections (CpG islands) within the PL ⁇ 2R7-encoding exons (especially exon 1) and / or regulatory regions, particularly before (in 5 " Upstream) of the exon 1.
- the coding exons and the regulatory regions are referred to below as the PLA2R1 gene (or PLA2R1 DNA), using as reference the PLA2R1 sequence according to SEQ ID No. 1 which contains the nucleotides -2000 (Position 1 in SEQ ID No. 1) to + 2199 (Position 4199 in SEQ ID No. 1) counted from the start of exon 1 (position 2001 in SEQ ID No. 1), but the term PLA2R1 gene preferably also comprises homologous sequences which have a sequence identity of 90%, preferably 95%, particularly preferably 98% to SEQ ID No. 1.
- CpG sites The individual GC pairs that can be methylated in the PLA2R1 gene are referred to below as CpG sites.
- the degree of PL ⁇ 2R7 gene methylation detected correlates with the malignancy of the tumor.
- PLA2R1 gene methylation as a biomarker can thus be used not only for diagnosis but also for prognosis of the course of tumor diseases.
- the region -662 bp to +783 bp (1339 to 2783 in SEQ ID No. 1) from the beginning of exon 1 of the PLA2R1 gene contains a total of 91 CpG sites.
- the degree of methylation of one or more of these total 91 CpG sites is preferably determined in the range from -662 bp to +783 bp of the exon 1 and distal promoter region of the PLA2R1 gene (1339 to 2783 in SEQ ID No. 1).
- the exon 1 of the PLA2R1 gene is 315 bp long (positions 2001 to 2315 in SEQ ID No. 1).
- the translation start is at position 207 (2207 in SEQ ID NO: 1).
- the PLA2R1 gene contains a CpG island (referred to herein as island 1): -356 bp to -241 bp (1645 to 1760 in SEQ ID No.1) from the beginning of exon 1 and three additional S'-CpG islands in the nucleotide regions +37 bp to +458 bp (island 2: 2038 to 2458 in SEQ ID No.
- CpG sites methylated in tumors are highlighted in bold in Figure 3 and numbered 1 to 108 (subscript).
- the section of exon 1 (beginning and end) is marked with an asterisk (*) and the CpG islands are underlined.
- the CpG sites 1 to 108 correspond to the following sequence positions in SEQ ID no. 1 :
- CpG island 1 -356 bp to -241 bp, 1645 to 1760 in SEQ ID No. 1 from the beginning of exon 1
- CpG island 2 +37 bp to +458 bp, 2038 to 2458 in SEQ ID No. 1
- CpG island 3 +51 1 bp to +667 bp, 2511 to 2667 in SEQ ID No. 1
- CpG island 4 +836 bp to +990 bp, 2836 to 2990 in SEQ ID No. 1) in lymphoma (U937) and leukemia cell lines (Jurkat) are fully methylated.
- CpG island 1 -356 bp to -241 bp (1645 to 1760 in SEQ ID No. 1) from the beginning of exon 1, CpG island 2: +37 bp to +458 bp (2038 to 2458 in SEQ ID No. 1) and CpG island 3: +511 bp to +667 bp (2511 to 2667 in SEQ ID No. 1) in the PLA2R1 gene are almost completely unmethylated.
- the CpG sites in CpG island 4 +836 bp to +990 bp (2836 to 2990 in SEQ ID No. 1) were also completely methylated in samples of healthy volunteers.
- CpG sites in the PLA2R1 gene unmethylated in normal subjects are increasingly methylated (in particular in CpG island 1: -356 bp to -241 bp (1645 to 1760 in SEQ ID No. 1) but also in CpG island 2: +37 bp to +458 bp (2038 to 2458 in SEQ ID No. 1) and CpG island 3: +511 bp to +667 bp (2511 to 2667 in SEQ ID No. 1) are CpG sites methylated and differ significantly from the samples of healthy subjects.
- Preferred CpG sites methylated in tumors but not in samples of healthy subjects include CpG sites at positions 1 and 4-87 (positions in SEQ ID No. 1 are shown in Table 1).
- the CpG sites at positions 2, 3, 88-108 are methylated in both tumors and samples from healthy volunteers.
- the number and positions of CpG sites methylated in each tumor are different.
- positions 6-11 position in SEQ ID Nos. 1: 1587-1588, 1590-1591, 1651-1652, 1651-1652, 1660-1661 and 1662-1663
- positions 31-36 positions in FIGS SEQ ID No. 1: 2073-2074, 2087-2088, 2089-2090, 2101-2102, 2107-2108 and 2113-2114
- positions 1 are methylated in tumors but not in samples of healthy volunteers.
- a downstream 3 'direction CpG island (CpG island 4: +836 bp to +990 bp (2836 to 2990 in SEQ ID No. 1) in the PLA2R1 gene was in samples from high-risk patients with MDS and patients with acute leukemias and U937 leukemia cells, but also fully methylated in DNA samples from normal subjects.
- the invention thus relates to the use of methylated and unmethylated sequences of the PLA2R1 gene, in particular the above-mentioned CpG islands and CpG sites (positions 1 and 4-87), as biomarkers for the diagnosis, prognosis and control of the course of therapy of tumor diseases.
- Body fluids such as blood, urine, sputum or tissue samples
- B. Sequencing use of methylation-specific oligonucleotides, methylation-specific Restriktasen or by determination of DNA melting curves, qualitatively and / or quantitatively determined.
- the bisulfite treatment causes a change in the sequence of all non-methylated cytosine bases (cytosine is converted to uracil), while 5-methyl-cytosine bases remain unchanged. This sequence change is only possible with non-methylated DNA, since the methylated DNA is protected.
- sequences are formed which differ from the original sequence in the region of unmethylated CpG sites.
- the modified DNA is then preferably amplified by PCR.
- the primer sets used in the PCR are designed so that they differentiate methylated DNA from non-methylated DNA and bind only to modified non-methylated DNA (uracil instead of cytosine) or only to unmodified methylated DNA. Furthermore, they bind at various points in the critical region, which leads to the formation of dissimilar PCR products that can be detected separately.
- These methods can be direct sequencing (eg, pyrosequencing with mass spectrometry) of genomic DNA after bisulfite modification, but also MethyLight (eg, according to Eads et al 2000 Nucleic Acids Res. 28 (8): e32), MS-SnuPE (methylation-sensitive signle nucleotide primer extension), MSP (methylation-specific PCR), MCA (methylated CpG island amplification), COBRA (combined bisulfite restriction analysis), real-time PCR with HMR (high melting resolution) and their combinations include ,
- PLA2R1 DNA methylation is carried out qualitatively and / or quantitatively, even without prior bisulfite modification with the aid of methylation-sensitive restrictases.
- L J 42R7 DNA methylation is preferably carried out in biological body fluids such as whole blood (blood cells), serum, plasma, urine, cerebrospinal fluid, sputum or tissue samples, in particular tumor biopsies and / or histological preparations. From these tissue samples, genomic DNA is isolated by known methods.
- biological body fluids such as whole blood (blood cells), serum, plasma, urine, cerebrospinal fluid, sputum or tissue samples, in particular tumor biopsies and / or histological preparations. From these tissue samples, genomic DNA is isolated by known methods.
- the detection of L J 42R7 DNA methylation is carried out in a sample of cells which express little or no PLA 2 -R1 (hereafter PLA 2 -R1 -negative cells).
- PLA 2 -R1 -negative cells This variant is suitable in particular for the detection of minimal residual disease ("MRD") .
- the accumulation of the PLA 2 -R1 -negative cells is preferably carried out by separation of sPLA 2 -Rl positive and negative cells by binding to antibodies against PLA 2 -R1. These antibodies are preferably immobilized on matrix materials (eg magnetic beads or support materials for column chromatography, inter alia). Alternatively, the separation of sPLA 2 -Rl positive and negative cells by naturallusszytometrie or immunoprecipitation by means of antibodies against sPLA 2 -Rl.
- sPLA2-Rl expression at the protein level (eg by antibodies to sPLA 2 -R1) and / or mRNA level.
- the detection of PLA 2 -R1 expression is carried out, for example, by congestive blotting or other immunochemical methods.
- these methods are used for the determination of sPLA 2 -Rl -negative cells, in particular for
- the invention also relates to corresponding laboratory kits for the diagnosis, prognosis and therapy of tumor diseases.
- the lab kit preferably contains at least:
- a reductive center as Cyto s reduced in uracil, bisulfite and / or methylation-sensitive DNA restrictases
- PCR primer deoxyribonucleoside triphosphate mix
- PCR buffer DNA polymerase
- Control DNA in particular unmethylated PLA2R1 DNA (negative control) and / or fully methylated PLA2R1 DNA (positive control), and optionally a DNA ladder,
- Antibodies to sPLA 2 -Rl (possibly immobilized on matrix materials),
- the PCR primers are designed to amplify the PLA2R1 gene or portions thereof, particularly single or multiple of the above mentioned CpG islands and CpG sites.
- the PCR primers are designed to selectively amplify the PLA2R1 gene or certain regions of the phospholipase A2 receptor-1 gene, especially single or multiple of the above mentioned CpG islands and CpG sites.
- the primer sets used in the PCR are preferably additionally designed so that they distinguish methylated DNA from non-methylated DNA and bind only to modified non-methylated DNA (uracil instead of cytosine) or only to unmodified methylated DNA. Furthermore, they bind at various points in the critical region, which leads to the formation of dissimilar PCR products that can be detected separately.
- the primers for > L ⁇ 42R7 DNA detection of the methylation are preferably selected from the sequences according to SEQ ID no. 6 to 26.
- the invention advantageously allows the sensitive and specific detection of malignant changes already at the cellular level, to which individual a few altered cells are required. This makes an early diagnosis of tumor diseases possible.
- the invention thus enables an improved diagnosis and therapy of tumor diseases with the aim of significantly reducing the mortality and morbidity rates of patients suffering from tumors.
- DNA samples from patients with tumor diseases in particular leukemia patients, high-risk patients with MDS and patients with AML and patients with prostate tumors, can be distinguished clearly from DNA samples which originate from normal subjects without diseases, on the basis of the PLR 2R7 DNA methylations.
- the invention allows the control of anti-tumor therapy, especially when methyltransferase inhibitors or other substrates that reduce the methylation of PLA2R1 are used.
- the invention is not limited to the differentiation of blood cancer cells and normal blood cells, but can also in the differentiation of malignant cells of solid tumors such.
- prostate cancer since even in solid tumors, especially prostate tumor cells in comparison to normal epithelial cells increased methylation of the PLA2R1 gene was observed.
- the invention is preferably used, in particular for diagnosis, prognosis and therapy control, for tumor diseases selected from lymphomas, leukemias, neoplasms, myelomas and prostate tumors, in particular acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), Hodgkin's lymphomas, myelodysplastic syndromes ( MDS), myeloproliferative neoplasia, chronic myeloid leukemia (CML), multiple myeloma (MM, plasmocytoma), B and T cell lymphoma (NHL), chronic lymphocytic leukemia, polycythemia vera, primary Myelofibrosis, aggressive B and T cell lymphomas, indolent (mature) B and T cell lymphomas, B-CLL, prolymphocytic leukemia (B-PLL, T-PLL), T-cell large granular lymphocyte leukemias (T-LGL), adult T-cell leuk
- the invention is further suitable for use in the development and search of drugs for the prevention and therapy of tumor diseases.
- a screening method preferably tumor cells or tumor cell lines in which PLA2R1 DNA is methylated, incubated with substances to be tested.
- the L J 42R7 DNA methylation in the tumor cells or tumor cell lines as described above is detected and the L J 42R7 DNA methylation compared with and without the action of the substances to be tested , The comparison is carried out either based on an accompanying control (tumor cells or tumor cell lines without test substance) or comparative data from previous measurements.
- Substances that reduce L J 42R7 DNA methylation are likely to be useful in preventing and treating tumors.
- the substances thus determined can advantageously be further tested in an animal model for their anti-tumor effect and tolerability.
- Fig. 1 Determination of PLA 2 -Rl mRNA transcripts by RT-PCR in U937 leukemia cells.
- L size standard; 1, 6: blank; 2, 7: IFN- ⁇ ; 3: IL-1 ⁇ ; 5: 1L-6; 5: TNF-a; 6: blank value; 7: IFN- ⁇ ; 8: IL-1 ⁇ ; 9: 1L-6; 10: TNF-a.
- Fig. 2 Examination of the PLA2R1 promoter and exon 1 (nucleotide range -2000 bp to the beginning of exon 1 and +2200 bp after initiation of exon 1) for the presence of CpG sites using MethPrimer software; CpG islands in the nucleotide ranges -356 bp to -241 bp, +37 bp to +458 bp, +511 bp to +667 bp, and +836 bp to +990 bp.
- Fig. 3 Sequence detail of the PLA2R1 gene (nucleotide range -2000 bp from the beginning of exon 1 and +2199 bp after the beginning of exon 1. CpG sites in the nucleotide ranges -356 bp to -241 bp, +37 bp to +458 bp , +511 bp to +667 bp and +836 bp to +990 bp) are highlighted in bold and underlined.
- GenBanks Genome eference Consortium Human Build 37 GRCh37
- Alternate assembly (Celera), AC 000045.1 and NW 921585.1 or Alternate assembly (HuRef), AC 000134.1 and NW 001838860.1.
- Fig. 4 Use of methylation-specific Restrktasen Hinfl and Hgal for methylation detection of CpG sites in the positions 9 and 20 of Frêts 1 in the PLA2R1 gene in Jurkat and U937 leukemia cells and leukocytes of a normal subjects [NP-1] in (A) resp of a patient [Pat. 21] with AML and normal subjects [NP2 and NP3] in (B).
- FIG. 5 Use of methylation-specific restrictingases Acil, BstUI, BsrBI and BceAI for methylation detection of CpG sites in fragment 1 of the PLA2R1 gene of leukocytes of a normal subject (A), U937 leukemia cells (B) and of a patient with AML (C).
- Fig. 6 Restriction of genomic DNA by methylation-sensitive restrictase Hgal and subsequent amplification to determine the degree of methylation of a CpG site in fragment 1 (position 9) of the PLA2R1 gene without sodium bisulfite modification in U937 leukemia cells (lanes 2 and 3), blood leukocytes Patients with AML, MI (patient 21, lanes 4 and 5) and a normal subject (NPL, lanes 6 and 7). Lanes 1 and 8: 100 bp ladders, Lanes 2, 4 and 6 were spiked with Hgal and lanes 3, 5, and 7 with buffer. Lane 9: Blank without template.
- FIG. 7 Restriction of genomic DNA by means of methylation-sensitive restrictase Hgal and subsequent amplification to determine the degree of methylation of a CpG site in fragment 1 (position 9) of the PLA2R1 gene without sodium bisulfite modification.
- A Normal subjects 1-4 (lanes 2-9), patient 1 with MDS (lanes 10, 11).
- B Patient 2 with MDS (lanes 2, 3), patient 5 with MDS (lanes 4 and 5), patient 7 with MDS (lanes 6 and 7), patient 8 with MDS (lanes 8 and 9) and U937- Leukemia cells (lanes 10 and 11). Lanes 2, 4, 6, 8 and 10 were added with Hgal and lanes 3, 5, 7, 9 and 11 with buffer. Lane 1: 100 bp ladder, lane 12: without template.
- FIG. 8 Overview of the methylations of CpG sites 1 to 21 in the examined fragment 1 of the PLA2R1 gene in U937 and Jurkat leukemia cells, 6 normal subjects (NP 1-4, NP 29 and 30) and patients with MDS (Pat 7 and 8) and AML (patents 19, 21-24, 53 and 54).
- Figure 9 Summary of methylation of CpG sites 22 to 61 in the fragment 2A of the PLA2R1 gene examined in U937 leukemia cells, normal subjects 1-4 (NP 1-4) and patients 21, 22, 53 and 54 with AML (Pat 21, Pat 22, Pat 53 and Pat 54).
- Figure 10 Summary of methylation of CpG sites 62 to 91 in the fragment 2B of the PLA2R1 gene examined in U937 leukemia cells, normal subjects 1-4 (NP 1-4) and patients 21, 22, 53 and 54 with AML (Pat 21, Pat 22, Pat 53 and Pat 54).
- Fig. 11 Summary of methylation of CpG sites 92 to 108 in the fragment 3 of the PLA2R1 gene examined in U937 leukemia cells, normal subjects 1-4 (NP 1-4) and patients 21, 22, 53 and 54 with AML (Pat 21, Pat 22, Pat 53 and Pat 54).
- Fig. 12 Overview of the methylation of CpG sites 1 to 21 in island 1 (fragment 1) of the PLA2R1 gene in normal epithelial prostate cells (PrEC), and three prostate tumor cell lines (PC-3, DU-145 and LNCaP).
- Fig. 13 Principle of differentiation between blood, urine or other types of specimens from patients with tumors and healthy volunteers.
- a white box indicates a methylation degree of 0% to 25%, a dashed box of a degree of methylation of 30% to 70%, and a black box of a methylation degree of 75% to 100%.
- Fig. 15 Representation of the average methylation of CpG sites 6-14 of the PLA2R1 gene from 18 leukemia patients.
- one patient with AML-M4 had a methylation of 7% and one patient with AML-MO of 3%.
- In the control group one subject had 21% PLA2R1 methylation.
- Fig. 17 HRM analyzes of bisulfite-treated genomic DNA from leukemia patients (P22, P23, P40 and P43 with AML-Ml and P37 with ALL), healthy subjects (N11-N20), Jurkat and U937 cells. Calibration was performed with 0%, 20%, 30%, 40%, 60% and 100% methylated control DNA.
- Fig. 18 Melt analyzes of bisulfite-treated and amplified genomic DNA samples from blood leukocytes from leukemia patients (P22 and P23 with AML-Ml) compared to unmethylated (0%) and fully methylated (100%) controls DNA.
- P22 the larger portion of the blood leukocytes contain unmethylated DNA sequences of the PLA2R1 gene, whereas in P22 the larger portion contains hypermethylated DNA sequences.
- Fig. 19 HRM analysis of bisulfite-modified genomic DNA from 2 patients (PI and P7) with myelodysplastic syndrome (MDS) before and after treatment with 5-azacytidine (Vidaza). In the two patients, referred to as responders, the degree of methylation of the PLA2R1 gene decreased.
- Fig. 20 HRM analysis of bisulfite-modified genomic DNA of a patient (P3) with myelodysplastic syndrome (MDS) before and after treatment with 5-azacytidine (Vidaza).
- MDS myelodysplastic syndrome
- 5-azacytidine Vidaza
- the degree of methylation of the PLA2R1 gene increased significantly during treatment.
- the X-axis is the melting temperature in ° C and the Y-axis is the normalized minus.
- RNA samples After isolation of cellular RNA from human monocytic leukemia cells (U937 cells, ATCC CRL-1593.2) using TR1AZOL (Sigma-Aldrich, Deisenhofen, Germany) and reverse transcription using GeneAmp RNA PCR kits (PerkinElmer LAS GmbH, Jügesheim, Germany) the cDNA of sPLA 2 -Rl using appropriate primers (Table 1) amplified and determined semi-quantitatively. As a control, the determination of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) - specific mRNA was used. The oligonucleotides were used in a final concentration of 0.8 ⁇ .
- GPDH glyceraldehyde-3-phosphate dehydrogenase
- PCR amplification was performed as follows: 40 cycles at 94 ° C for 30 seconds, 68 ° C for 30 seconds, and 72 ° C for 1 minute.
- the buffers and reagents used were from the GeneAmp Kit (PerkinElmer LAS GmbH).
- the amplified products were analyzed by agarose gel electrophoresis. 1) basal expression, 2) expression as a function of incubation with proinflammatory cytokines (IL-1 ⁇ , 1L-6, TNF- ⁇ and IFN- ⁇ ) and 3) expression after concomitant inhibition of DNA methylation 5-aza-2 , -deoxycytidine (5-azadc) of interest ( Figure 1).
- the 5 'upstream direction contains the PLA2R1 gene an S'-CpG island: -356 bp to -241 bp from the beginning of exon 1 and three further S'-CpG islands in the nucleotide regions +37 bp to +458 bp, +511 bp to +667 bp and +836 bp to +990 bp. DNA methylation studies of 5'-CpG sites in the PLA2R1 gene by sequencing
- Fragment 1 (-662 bp to -86 bp):
- Fragment 2 (-105 bp to +783 bp):
- the oligonucleotides were used in a final concentration of 0.8 ⁇ .
- the conditions for the PCR were as follows: 20 cycles at 95 ° C for 45 seconds, 44 ° C for 60 seconds, and 72 ° C for 45 seconds using the extrinsic primers and 35 cycles at 95 ° C for 30 seconds, 45 ° C for 45 seconds and 72 ° C for 30 seconds using the intrinsic primer.
- the buffers and reagents were from GeneAmp Kit (PerkinElmer LAS GmbH).
- the PCR products were finally purified by QIAquick PCR purification kit (Qiagen GmbH, Hilden, Germany).
- PCR products were incubated after modification of genomic DNA by sodium bisulfite treatment with restrictionases.
- fragment 1 which comprises the S'-CpG island 1 of the PLA2RI gene
- methylation-sensitive restrictionases such as Hinfl and Hgal
- Figure 4 the methylation of the 5 "-CpG sites in positions 9 and 20 in fragment 1 could be determined ( Figure 4) .
- the methylation-sensitive restriction sites Acil, BstUI, BsrBI and BceAI were also used to determine the methylation of further S'- CpG sites in the PLA2RI gene were determined ( Figure 5), which confirmed the results obtained by sequencing.
- DNA samples were treated directly with methylation-sensitive restrictases and then assayed by PCR amplification and analysis in agarose gel.
- genomic DNA of U937 leukemia cells and leukocytes from normal subjects or patients with MDS or AML were incubated with the methylation-sensitive restrictase Hgal and then amplified by nested PCR.
- the following oligonucleotides were used for this:
- a downstream 3 'direction S'-CpG island in the PLA2R1 gene was in samples from high-risk patients with MDS and patients with acute leukemias and U937 leukemia cells, as well as in DNA samples from normal subjects completely methylated (Fig. 11).
- Prostate tumor cell lines (PC-3, DU-145, and LNCaP cells) also showed markedly increased PL ⁇ 2R7 DNA methylation compared to normal prostate epithelial cells (PrEC) ( Figure 12).
- the invention is therefore also applicable to solid tumors.
- the following table summarizes the results of the high resolution melting curve (HRM) analysis of leukemia patients and healthy volunteers.
- HRM high resolution melting curve
- Senegas-Balas F Balas D, Verger R, DeCaro A, Figarella C, Ferrato F, Lechene P, Bertrand C, Ribet A. Immunohistochemical localization of intestinal phospholipase A2 in rat Paneth cells. Histochemistry. 1984; 81: 581-584.
- MethyLight a high-throughput assay to measure DNA methylation. Nucleic Acids Res. 2000 Apr 15; 28 (8): E32.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Die Erfindung betrifft das Gebiet der Medizin, speziell die Diagnostik, Prognose und Therapiekontrolle von Tumorerkrankungen. Die Erfindung beruht auf der durch die Erfinder zufällig entdeckten und bisher unbekannten epigenetischen Stilllegung des für den Phospholipase A2 Rezeptor-1 codierenden Gens in Leukämiezellen (Abb. 1) und bei Patienten mit Leukämien und soliden Tumoren. Basierend auf dieser Erkenntnis gibt die Erfindung Verfahren und ein Kit an, mit welchem der Methylierungsgrad des Phospholipase A2 Rezeptor-1-Gens in einer isolierten Patientenprobe bestimmt wird.
Description
Mittel und Verfahren zur Diagnostik, Prognose und Therapiekontrolle von Tumorerkrankungen
Die Erfindung betrifft das Gebiet der Medizin, speziell die Diagnostik, Prognose und-Therapiekontrolle von Tumorerkrankungen.
Gegenwärtige Verfahren zum Nachweis von Tumoren wie klinisch-chemische Untersuchungen in Körperflüssigkeiten und Gewebeproben oder bildgebende Verfahren führen trotz aller Fortschritte in den letzten Jahren zu einem zu späten Nachweis von malignen Veränderungen. So ist die Hauptursache der hohen Mortalitätsrate von Tumorpatienten nicht das Auftreten von Primärtumoren, sondern von Metastasen. Um das Auftreten von Metastasen zu verhindern, ist ein so früh wie möglicher Nachweis von malignen Veränderungen erforderlich. Ferner bedarf es neben sensitiver auch hochspezifischer Verfahren, um maligne Zellen von normalen Zellen richtig unterscheiden zu können. Sowohl falschpositive als auch falsch-negative Befunde haben fatale Konsequenzen für die Betroffenen. Ebenso sind Methoden erforderlich, die eine richtige Prognose von Tumorpatienten gestatten und eine entsprechend auf den Patienten individuell abgestimmte Therapie erlauben.
Bisher werden in Körperflüssigkeiten wie Blutproben, Urin, Sputum oder Gewebeproben sogenannte Tumormarker bestimmt. Hierbei handelt es sich um Bestandteile von Tumorzellen, die verstärkt oder vermindert gebildet werden und deren Veränderungen in Körperflüssigkeiten wie Blut nachgewiesen werden können. Bis auf wenige Ausnahmen erlauben diese Tumormarker jedoch kein generelles Screening auf Tumorerkrankungen, da ihre diagnostischen Spezifitäten und Sensitivitäten zu gering sind. Wenngleich diese Tumormarker gegenüber bildgebenden Verfahren oft frühzeitiger maligne Veränderungen anzeigen können, gestatten sie bisher keinen Nachweis von malignen Veränderungen zu einem Zeitpunkt, bei dem das Auftreten von Metastasen in jeden Fall auszuschließen ist.
Die Nachteile bisheriger Verfahren zum Nachweis von Tumorerkrankungen beruhen in ihren niedrigen diagnostischen Sensitivitäten und Spezifitäten und ihr zu spätes Anzeigen von malignen zellulären Veränderungen.
Es ist bekannt, dass Gene durch DNA-Methylierung epigentisch reguliert werden können. In Tumoren ist die DNA generell hypomethyliert. Einzelne Gene sind jedoch hypermethyliert [60, 61 , 62]. Methoden zum Nachweis der DNA-Methylierung in Tumoren sind ebenfalls bekannt [60]. Auch DE 100 56 802 AI beschreibt eine solche Methode zur toxologischen Diagnostik.
Vor mehr als 20 Jahren wurde erstmals eine Phospholipase A2 (PLA2) aus Thrombozyten der Ratte und aus Synovialflüssigkeiten von Patienten mit rheumatoider Arthritis isoliert, die sich strukturell von der bis dahin bekannten PLA2 aus dem Pankreas unterschied [1-3]. Aus diesem Grund wurden in der
Folgezeit beide Enzyme als pankreatische bzw. nicht-pankreatische oder synoviale PLA2 bezeichnet und den Gruppen 1 und 11 zugeordnet [1, 2]. Eine weitere Differenzierung der sPLA2s wurde erforderlich, als die Struktur der im Bienengift vorkommenden PLA2 aufgeklärt war. Im Gegensatz zu den Gruppen 1 und 11 besitzen Bienen- und Wespen-sPLA2s nur 10 Cysteinreste, weshalb diese Enzyme der Gruppe III zugeordnet werden [4].
Nicht zuletzt durch die Untersuchungen des menschlichen Genoms wurden in den letzten Jahren zahlreiche neue PLA2s entdeckt, die ebenfalls einen katalytischen Histidinrest besitzen. Da sich diese Enzyme strukturell deutlich von denen der Gruppen 1-111 unterscheiden, werden diese Enzyme den Gruppen V, X und Xll zugeordnet [5]. Weitere PLA2s wurden identifiziert, die bis auf die Anordnung der 7. Disulfidgruppe und einer C-terminalen Aminosäure-sequenz-verlängerung den bisher bekannten PLA2 der Gruppe 11 ähnlich sind. Dementsprechend wurde eine Klassifizierung dieser Enzyme vorgeschlagen, die weitere Untergruppen vorsieht wie sPLA2-llA, sPLA2-llD, sPLA2-llE und sPLA2-llF [6, 7]. Die nicht-pankreatische bzw. synoviale PLA2 entspricht nunmehr der sPLA2-UA, der sekretorischen PLA2 vom Typ IIA.
In einer Publikation aus dem Kreise der Erfinder wird eine epigenetische Regulierung von sezernierten Phospholipasen A2 vom Typ IIA (SPLA2-IIA) und vom Typ V (sPLA2-V) durch DNA-Hypermethylierung in Jurkatzellen diskutiert [61].
Die sPLA2-llA ist neben der pankreatischen sPLA2-lB und der cPLA2-lVA das am häufigsten untersuchte Enzym der PLA2-Superfamilie [1, 2, 6-8]. Bei Säugern einschließlich des Menschen wird die sPLA2-llA in einer Reihe unterschiedlicher Zelltypen konstitutiv exprimiert und in sekretorischen Granula gespeichert. Dazu zählen Thrombozyten [9], Neutrophilen, Makrophagen und Mastzellen [10-12]. In Organen und Geweben wie Prostata [13], Plazenta [14], Milz, Leber, Darmmukosa, Tonsillen, Speichel- und Tränendrüsen, Knorpel und Knochenmark finden sich ebenfalls sPLA2-llA-Enzymaktivitäten [13, 15 ] . Das Enzym lässt sich auch in Körperflüssigkeiten wie Seminalplasma [16, 17] und Tränenflüssigkeiten [18] nachweisen. In der Prostata sind besonders die glandulären Epithelzellen reich an sPLA2-llA. Die Funktion der sPLA2-llA im Seminalplasma und der Prostata wird mit einer aktiven Prostaglandinbiosynthese in Verbindung gebracht [19]. Außerdem sind fusogene Eigenschaften von Lysophospholipiden beschrieben, die bei der sPLA2-UA-katalysierten Reaktion freigesetzt werden. Dadurch wird möglicherweise die Penetration der Spermien durch die Eiplasmamembran erleichtert [20]. Auch anti-bakterielle Eigenschaften der sPLA2-llA können von Bedeutung sein. Weiterhin wurde eine sPLA2-llA in den Paneth-Zellen des Verdauungstraktes nachgewiesen. Neben der Körperabwehr soll die sPLA2-UA der Paneth-Zellen auch eine Rolle bei der Verdauung von Nahrungsphospholipiden spielen
[21 ]. Schließlich lassen sich auch hohe sPLA2-IIA-Konzentrationen in der Plazenta feststellen [22]. Die Funktion des Enzyms in diesem Gewebe ist jedoch noch weitgehend ungeklärt. Es wird eine Beteiligung des Enzyms an der Eicosanoidbiosynthese durch Freisetzung von Arachidonsäure diskutiert [23].
Neben Effekten, die mit der Freisetzung von Arachidonsäure assoziiert sind, kann eine Hochregulation der sPLA2-IIA auch zu Effekten führen, die unabhängig von der Enzymaktivität sind. So behielten inaktive sPLA2-IIA-Mutanten, die unfähig waren, Arachidonsäure von Zytokin-stimulierten Bindegewebsmastzellen freizusetzen, ihre Fähigkeit, die COX-2 -Expression in diesen Zellen zu erhöhen. Das lässt darauf schließen, dass COX-2-induzierende Aktivitäten der sPLA2-IIA unabhängig von ihrer Enzymaktivität vermittelt werden [24]. In mesangialen Zellen und glatten vaskulären Muskelzellen war die autokrine und parakrine transkriptioneile Regulation des PLA2G2A-Gens ebenfalls unabhängig von der Aktivität des Enzyms [25, 26]. Außerdem führt die sPLA2-HA zu einer Aktivierung von Signaltransduktionswegen wie den Proteinkinase C-, MEK/ERK1/2-, p38 MAPK- und P13 -K/Aktabhängigen Kaskaden [27-31 ] wie auch zur Aktivierung der Synthese und Freisetzung von Zytokinen aus humanen Monozyten, Lungenmakrophagen und eosinophilen Zellen, wofür auch hier die Enzymaktivität, zumindest teilweise, nicht erforderlich war [32-35]. Schließlich konnte gezeigt werden, dass in Mastzellen sogenannte survival Signals durch die pankreatische sPLA2-lB und Bienengift sPLA2- 111 induziert werden. Dabei scheint weniger die Bildung von sPLA2-katalysierten Mediatoren als vielmehr ein sPLA2-vermittelte Mechanismus von Bedeutung zu sein [36].
Aus diesen Gründen werden Rezeptoren bzw. Bindungsstellen diskutiert, die für die durch sPLA2-Rl hervorgerufenen und von ihren Enzymaktivitäten unabhängigen Effekte verantwortlich sind. Ein entsprechender sPLA2-Rezeptor wurde in einer Reihe von Zellen wie glatte Muskelzellen, Fibroblasten, polymorphkernige neutrophile Zellen (PMN), Swiss 3T3-Zellen und Astrozyten nachgewiesen (31 , 37- 42). Die mögliche Bedeutung dieses Rezeptors für die Zellphysiologie und -pathophysiologie zeigt sich z.B darin, dass entsprechende Einflüsse auf die Migration und Proliferation glatter vaskulärer Muskelzellen, auf die Adhäsion von PMN und auf die Aktivität von p38 MAPK beschrieben wurden. Dadurch wurden wiederum die Elastasefreisetzung, Hemmung von Acetylcholinfreisetzungen, die Proliferation von Swiss 3T3-Zellen und vor allem die Tumorinvasion verändert (31, 43-47).
In einer von Augert et al. [48] publizerten Arbeit wurde mittels eines Loss-of-function-Screemng einer shRNA-Bibliothek des Netherlands Cancer Institutes [49] der sPLA2-Rezeptor (sPLA2-Rl) als eine von vier Komponenten beschrieben, die im Prozess der Seneszenz, der Zellalterung, eine zentrale Rolle spielt [48]. Der sPLA2-Rl stellt einen transmembranen Glykoproteinrezeptor vom Typ 1 dar und ist auch als multifunktionaler M-Typ-Rezeptor bekannt. Er hat ein Molekulargewicht von 180 kDa, wurde erstmals
bei Kaninchen in Skelettmuskelzellen entdeckt und bindet spezifisch sekretorische sPLA2s [50, 51 ]. Er ist dem Mannose- ezeptor, DEC-205 Rezeptor und dem Endo-1890-Rezeptor strukturell ähnlich und besteht aus einer transmembranen Domäne, einem kurzen cytoplasmatischen Teil und einer großen extrazelluläten Region. Letztere wird durch eine N -terminale Cystein-reichen Domäne, einer Fibronektin-ähnlichen Typ 11-Domäne und einem Tandemrepeat bestehend aus acht Lektin-ähnlichen Kohlenhydraterkennungsdomänen zusammengesetzt [52-54].
Die biologische Funktion des sPLA2-Rl ist noch ungeklärt. Bekannt ist, dass sPLA2-Rl-defiziente Mäuse teilweise rersistant gegenüber einer LP S -induzierten Letalität sind und dass diese Mäusen nach LPS- Gabe verminderte TNF-α- und IL-lß-Serumspiegel aufweisen. Daraus wurde eine pro-inflammatorische Bedeutung des Rezeptors abgeleitet [55]. Ferner wird der Rezeptor ähnlich dem LDL-Rezeptor endozytiert und führt zur lysosomalen Degradation von gebundenen sPLA2s, so dass der Rezeptor möglicherweise auch bei der Regulation von sPLA2-Aktivitäten bei Entzündungen eine Rolle spielt [56, 57].
Im Vergleich mit sPLA2-Rl-exprimierenden humanen Fibroblasten, die nach 2-wöchiger Kultivierung im Zellwachstum blockiert und verstärkt seneszent wurden, wiesen mit short-hairpin RNA (shRNA)- transfizierte Zellen, deren Translation des PLA2R1 -Gens blockiert war, ein ungehindertes Wachstum auf. Dies zeigte sich auch anhand einer erhöhten ß-Galaktosidase-Aktivität als Zeichen der Seneszenz [58], die in sPLA2-Rl -exprimierenden Zellen nachweisbar war, nicht aber in Zellen ohne sPLA2-Rl- Expression. Schließlich konnte nachgewiesen werden, dass die sPLA2-Rl -abhängigen Effekte über p53- abhängige Stoffwechselwege vermittelt werden und die Generation von reaktiven Sauerstoffspecies dabei von Bedeutung ist [48].
Mit Hilfe der Erfindung sollen die oben genannten Nachteile bisheriger Verfahren beseitigt werden. Neben einer verbesserten diagnostischen Sensitivität und Spezifität soll durch die Erfindung ein Nachweis von malignen Veränderungen bereits frühzeitig, d. h. auf Zellebene, ermöglicht werden. Ferner sollen mit Hilfe der Erfindung Verfahren entwickelt werden, die eine unmittelbare Effizienzkontrolle von Therapien ermöglichen und die Suche nach neuen Wirkstoffen für die Therapie von Tumorerkrankungen erleichtern.
Aufgabe der Erfindung ist es insbesondere, neue Mittel und Methoden zur Diagnostik, Prognose und Therapiekontrolle von Tumorerkrankungen anzugeben.
Die Erfindung beruht auf der durch die Erfinder zufällig entdeckten und bisher unbekannten epigenetischen Stilllegung des Phospholipase A2 Rezeptor- 1 -Gens (PLA2R1 -Gens) in Leukämiezellen (Abb. 1) und bei Patienten mit Leukämien und soliden Tumoren.
Diese epigenetische Stilllegung des PLA2R1-Gens ist mit einer DNA-Methylierung in GC-reichen Abschnitten (CpG-lnseln) innerhalb der für PL^2R7-codierenden Exons (insbesondere Exon 1) und/oder regulatorischer Bereiche, insbesondere vor (in 5" -Richtung stromaufwärts) des Exons 1 assoziert. Die codierenden Exons und die regulatorischer Bereiche werden nachfolgend als PLA2R1-Gen (oder PLA2R1-DNA) bezeichnet. Als Referenz wird dazu die PLA2R1 -Sequenz gemäß SEQ 1D No. 1 herangezogen, welche die Nukleotide -2000 (Position 1 in SEQ 1D No. 1) bis + 2199 (Position 4199 in SEQ 1D No. 1) gerechnet vom Start des Exons 1 (Position 2001 in SEQ 1D No. 1) umfasst, wobei der Begriff PLA2R1 -Gen jedoch vorzugsweise auch homologe Sequenzen umfasst, die eine Sequenzidentität von 90 %, bevorzugt 95 %, besonders bevorzugt 98 % zu SEQ 1D No. 1 aufweisen.
Die einzelnen GC Paare, die im PLA2R1 -Gen methyliert werden können, werden nachfolgend CpG- Stellen genannt.
Der Grad der nachgewiesenen PL^2R7-Gen-Methylierung korreliert mit der Bösartigkeit des Tumors. Umso höher die nachgewiesene PLA2R1 -Gen-Methylierung, umso niedriger ist die Lebenserwartung des Patienten.
Die Bestimmung der PLA2R1 -Gen-Methylierung als Biomarker lässt sich somit nicht nur zur Diagnostik, sondern auch zur Prognose des Verlaufs von Tumorerkrankungen einsetzen.
Folgende CpG-lnseln im PLA2R1-Gen sind in den Tumoren insbesondere methyliert:
Der Bereich -662 bp bis +783 bp (1339 bis 2783 in SEQ 1D No. 1) vom Beginn des Exons 1 des PLA2R1-Gen enthält insgesamt 91 CpG-Stellen. Bevorzugt wird in der Erfindung der Methylierungsgrad einzelner oder mehrerer dieser insgesamt 91 CpG-Stellen in der im Bereich -662 bp bis +783 bp des Exons 1 und distalen Promotorbereiches des PLA2R1-Gen (1339 bis 2783 in SEQ 1D No. 1) bestimmt.
Das Exon 1 des PLA2R1-Gens ist 315 bp lang (Postionen 2001 bis 2315 in SEQ 1D No. 1). Der Translationstart ist an Position 207 (2207 in SEQ 1D No. 1). In 5"-Richtung stromaufwärts des Exonl enthält das PLA2R1-Gen eine CpG-lnsel (hier als Insel 1 bezeichnet): -356 bp bis -241 bp (1645 bis 1760 in SEQ 1D No. 1) vom Beginn des Exons 1 und drei weitere S'-CpG-lnseln in den Nukleotidbereichen +37 bp bis +458 bp (Insel 2: 2038 bis 2458 in SEQ 1D No. 1), +511 bp bis +667 bp
(Insel 3: 2511 bis 2667 in SEQ ID No. 1) und +836 bp bis +990 bp (Insel 4: 2836 bis 2990 in SEQ ID No. 1).
CpG-Stellen, welche in Tumoren methyliert sind, sind in Abb. 3 durch Fettdruck hervorgehoben und mit 1 bis 108 (tiefgestellt) nummeriert. Der Abschnitt des Exon 1 (Beginn und Ende) ist mit einem Stern (*) markiert und die CpG-lnseln sind unterstrichen. Die CpG-Stellen 1 bis 108 entsprechen folgenden Sequenzpositionen in SEQ ID No. 1 :
Tabelle 1 :
Untersuchungen der Erfinder haben gezeigt, dass die CpG-Stellen in vier CpG-lnseln (CpG-lnsel 1 : -356 bp bis -241 bp, 1645 bis 1760 in SEQ ID No. 1 vom Beginn des Exons 1 ; CpG-lnsel 2: +37 bp bis +458 bp, 2038 bis 2458 in SEQ ID No. 1 ; CpG-lnsel 3: +51 1 bp bis +667 bp, 2511 bis 2667 in SEQ ID No. 1 und CpG-lnsel 4: +836 bp bis +990 bp, 2836 bis 2990 in SEQ ID No. 1) in Lymphoma- (U937)- und Leukämiezelllinien (Jurkat) vollständig methyliert vorliegen. Im Gegensatz dazu sind in DNA-Proben,
die von Normalprobanden isoliert wurden, die CpG-Stellen in drei CpG-lnseln (CpG-lnsel 1 : -356 bp bis -241 bp (1645 bis 1760 in SEQ ID No. 1) vom Beginn des Exons 1, CpG-lnsel 2: +37 bp bis +458 bp (2038 bis 2458 in SEQ ID No. 1) und CpG-lnsel 3: +511 bp bis +667 bp (2511 bis 2667 in SEQ ID No. 1) im PLA2R1-Gen nahezu vollständig unmethyliert. Die CpG-Stellen in CpG-lnsel 4: +836 bp bis +990 bp (2836 bis 2990 in SEQ ID No. 1) hingegen waren auch in Proben gesunder Probanden vollständig methyliert.
In DNA-Proben aus Tumorproben (insbesondere weißen Blutzellen von Hoch-Risiko-Patienten mit MDS und Patienten mit akuten Leukämien) sind die bei Normalprobanden unmethyliert vorliegenden CpG- Stellen im PLA2R1-Gen verstärkt methyliert (insbesondere in der CpG-lnsel 1 : -356 bp bis -241 bp (1645 bis 1760 in SEQ ID No. 1). Aber auch in der CpG-lnsel 2: +37 bp bis +458 bp (2038 bis 2458 in SEQ ID No. 1) und CpG-lnsel 3: +511 bp bis +667 bp (2511 bis 2667 in SEQ ID No. 1) sind CpG-Stellen methyliert und unterscheiden sich deutlich von den Proben gesunder Probanden.
Bevorzugte CpG-Stellen, welche in Tumoren, nicht aber in Proben gesunder Probanden methyliert sind, umfassen CpG-Stellen in Positionen 1 und 4-87 (Positionen in SEQ ID No. 1 sind in Tab. 1 dargestellt). Die CpG-Stellen in Positionen 2, 3, 88-108 sind sowohl in Tumoren als auch in Proben gesunder Probanden methyliert. Die Anzahl und Positionen der CpG-Stellen, die in den einzelnen Tumoren methyliert vorliegen, sind unterschiedlich. Häufig sind besonders die Positionen 6-11 (Position in SEQ ID No. 1 : 1587-1588, 1590-1591, 1651-1652, 1651-1652, 1660-1661 und 1662-1663) und die Positionen 31-36 (Positionen in SEQ ID No. 1 : 2073-2074, 2087-2088, 2089-2090, 2101-2102, 2107-2108 und 2113-2114) in Tumoren, nicht aber in Proben gesunder Probanden methyliert.
Eine stromabwärts in 3"-Richtung liegende CpG-lnsel (CpG-lnsel 4: +836 bp bis +990 bp (2836 bis 2990 in SEQ ID No. 1) im PLA2R1 -Gen war in Proben von Hoch-Risiko-Patienten mit MDS und Patienten mit akuten Leukämien und U937-Leukämiezellen, aber auch in DNA-Proben von Normalprobanden vollständig methyliert.
Die Erfindung betrifft somit die Verwendung methylierter und unmethylierter Sequenzen des PLA2R1- Gens, insbesondere die oben genannten CpG-lnseln und CpG-Stellen (Positionen 1 und 4-87), als Biomarker zur Diagnostik, Prognose und zur Kontrolle des Therapieverlaufs von Tumorerkrankungen.
Zur Detektion der DNA-Methylierung eignen sich unterscheidliche Verfahren:
In einer Variante werden dazu Unterschiede hinsichtlich der Methylierung im PLA2R1-Gen nach CpG- spezifischer Modifikation, bevorzugt durch Bisulfit-Modifizierung genomischer DNA, die aus
Körperflüssigkeiten wie z. B. Blut, Urin, Sputum oder aus Gewebeproben isoliert wurde, durch unterschiedliche Verfahren, wie z. B . Sequenzierung, Verwendung methylierungsspezifischer Oligonukleotide, methylierungsspezifischer Restriktasen oder durch Bestimmung von DNA- Schmelzkurven, qualitativ und/oder quantitativ bestimmt. Durch die Bisulfit-Behandlung tritt eine Sequenzänderung aller nicht-methylierter Cytosinbasen ein (Cytosin wird in Uracil umgewandelt), während 5-Methyl-Cytosin-Basen unverändert bleiben. Diese Sequenzänderung ist nur bei nicht methylierter DNA möglich, da die methylierte DNA geschützt ist. Aufgrund dieser chemischen Veränderung entstehen Sequenzen, die sich von der ursprünglichen Sequenz im Bereich der unmethylierten CpG-Stellen unterscheiden. Die modifizierte DNA wird dann bevorzugt mittels PCR amplifiziert. Die bei der PCR verwendeten Primer-Sets sind so kreiert, dass sie methylierte DNA von nicht-methlyierter DNA unterscheiden und nur an modifizierte nicht-methylierte DNA (Uracil statt Cytosin) bzw. nur an nicht-modifizierte methylierte DNA binden. Weiters binden sie an verschiedenen Stellen in der kritischen Region, was zur Entstehung ungleich langer PCR-Produkte führt, die getrennt voneinander detektierbar sind.
Diese Verfahren können die direkte Sequenzierung (z. B. Pyrosequenzierung mit Massenspektronomie) genomischer DNA nach Bisulfit-Modifizierung, aber auch MethyLight (z. B. nach Eads et al 2000 Nucleic Acids Res. 28(8): e32 ) , MS-SnuPE (methylation-sensitive signle nucleotide primer extension), MSP (methylation-specific PCR), MCA (methylated CpG island amplification), COBRA (combined bisulfite restriction analysis), Real-Time-PCR mit HMR (high melting resolution) und deren Kombinationen einschließen.
Alternativ erfolgt die Detektion der PLA2R1 -DNA-Methylierung auch ohne vorherige Bisulfit- Modifizierung mit Hilfe methylierungssensitiver Restriktasen qualitativ und/oder quantitativ z. B. durch quantitative Real-Time-PCR.
Die Detektion der LJ42R7-DNA-Methylierung erfolgt bevorzugt in biologischen Körperflüssigkeiten wie Vollblut (Blutzellen), Serum, Plasma, Urin, Liquor, Sputum oder Gewebeproben insbesondere Tumorbiopsien und/oder histologischen Präparaten. Aus diesen Gewebeproben wird genomische DNA mit bekannten Methoden isoliert.
In einer bevorzugten Variante erfolgt die Detektion der LJ42R7-DNA-Methylierung in einer Probe von Zellen, die kein oder nur wenig PLA2-R1 exprimieren (nachfolgend PLA2-R1 -negative Zellen). Diese Variante eignet sich insbesondere zum Nachweis von Minimalresterkrankung („minimal residual disease (MRD)"). Die Anreicherung der PLA2-R1 -negativen Zellen erfolgt bevorzugt durch Separation von
sPLA2-Rl -positiven und -negativen Zellen durch Bindung an Antikörpern gegen PLA2-R1. Diese Antikörper sind vorzugsweise an Matrixmaterialien (z. B. magnetische Beads oder Trägermaterialien für Säulenchromatografie u. a.) immobilisiert. Alternativ erfolgt die Separation von sPLA2-Rl -positiven und -negativen Zellen durch Durchilusszytometrie oder Immunpräzipitation mittels Antikörpern gegen sPLA2-Rl .
Zusätzlich zu der qualitativen oder quantitativen Bestimmung der PLA2R1 -DNA-Methylierung erfolgt bevorzugt eine Detektion der sPLA2-Rl -Expression auf Protein-Ebene (z. B. durch Antikörper gegen sPLA2-Rl) und/oder mRNA-Ebene. Die Detektion der PLA2-R1 -Expression erfolgt beispielsweise durch Durchilusszytometrie, Western-Blotting oder andere immunchemische Verfahren. Bevorzugt werden diese Verfahren zur Bestimmung von sPLA2-Rl -negativen Zellen verwendet, insbesondere zum
Nachweis der Minimalresterkrankung („minimal residual disease" (MRD).
Gegenstand der Erfindung sind auch entsprechende Laborkits zur Diagnostik, Prognose und Therapie von Tumorerkrankungen.
Zur Detektion der PLA2R1 -DNA-Methylierung enthält das Laborkit bevorzugt mindestens:
Ein Re dukti onsmitte l, we lc he s Cyto s in in Uraci l re duziert, Bisulfit und/oder methylierungssensitive DNA-Restriktasen,
sowie ggf. einen oder mehrere der folgenden Bestandteile:
PCR-Primer, Desoxyribonukleosidtriphosphat-Mix, PCR-Puffer und DNA-Polymerase,
Kontroll-DNA, insbesondere unmethylierte PLA2R1 -DNA (Negativkontrolle) und/oder vollständig methylierte PLA2R1 -DNA (Positivkontrolle), sowie optional eine DNA-Leiter,
Antikörper gegen sPLA2-Rl (ggf. an Matrixmaterialien immobilisiert),
- Puffer,
Gebrauchsanleitung und Software zur Auswertung.
Die PCR-Primer sind so gestaltet, dass sie das PLA2R1 -Gen oder Teile davon, insbesondere einzelne oder mehrere der oben genannten CpG-lnseln und CpG-Stellen, amplifizieren. Bevorzugt sind die PCR- Primer so gestaltet, dass sie selektiv das PLA2R1-Gen oder bestimmte Regionen des Phospholipase A2 Rezeptor- 1 -Gens, insbesondere einzelne oder mehrere der oben genannten CpG-lnseln und CpG-Stellen, amplifizieren.
Die bei der PCR verwendeten Primer-Sets sind bevorzugt zusätzlich so kreiert, dass sie methylierte DNA von nicht-methlyierter DNA unterscheiden und nur an modifizierte nicht-methylierte DNA (Uracil statt Cytosin) bzw. nur an nicht-modifizierte methylierte DNA binden. Weiters binden sie an verschiedenen Stellen in der kritischen Region, was zur Entstehung ungleich langer PCR-Produkte führt, die getrennt voneinander detektierbar sind.
Die Primer zur >L^42R7-DNA-Detektierung der Methylierung sind bevorzugt ausgewählt aus den Sequenzen gemäß SEQ 1D No. 6 bis 26.
Die Erfindung gestattet vorteilhaft den sensitiven und spezifischen Nachweis von malignen Veränderungen bereits auf Zellebene, wozu einzelne wenige veränderte Zellen erforderlich sind. Dadurch wird eine frühzeitige Diagnostik von Tumorerkrankungen möglich. Durch die Erfindung wird somit eine verbesserte Diagnostik und Therapie von Tumorerkrankungen ermöglicht mit dem Ziel, die Mortalitäts- und Morbititätsraten von tumorerkrankten Patienten deutlich zu verringern.
Vorteilhaft können anhand der PL^2R7-DNA-Methylierungen DNA-Proben von Patienten mit Tumorerkrankungen, insbesondere Leukämiepatienten, Hochrisikopatienten mit MDS und Patienten mit AML sowie Patienten mit Prostatatumoren, eindeutig von DNA-Proben unterschieden werden, die von Normalprobanden ohne Erkrankungen stammen.
Darauf aufbauend ermöglicht die Erfindung die Kontrolle der Antitumortherapie, insbesondere wenn Methyltransferase-Hemmstoffe oder andere Subsatnzen, welche die Methylierung des PLA2R1 reduzieren, eingesetzt werden.
Die Erfindung ist dabei nicht auf die Differenzierung von Blutkrebszellen und normalen Blutzellen beschränkt, sondern kann auch bei der Differenzierung von malignen Zellen solider Tumoren, wie z. B. bei Prostatakarzinomen, eingesetzt werden, da auch in soliden Tumoren, insbesondere Prostatatumorzellen im Vergleich zu normalen epithelialen Zellen eine verstärkte Methylierung des PLA2R1 -Gen beobachtet wurde.
Die Erfindung wird bevorzugt, insbesondere zur Diagnose, Prognose und Therpaiekontrolle, auf Tumorerkrankungen ausgewählt aus Lymphomen, Leukämien, Neoplasien, Myelomen und Prostatatumoren angewandt, insbesondere akute lymphatische Leukämie (ALL), akute myeloische Leukämie (AML), Hodgkin-Lymphome, myelodysplastische Syndrome (MDS), myeloproliferative Neoplasien, chronische myeloische Leukämien (CML), Multiple Myelome (MM, Plasmozytome), B- und T-Zell-Lymphome (NHL), Chronische Lymphozyten-Leukämien, Polycythaemia vera, primäre
Myelofibrosen, Aggressive B- und T-Zell-Lymphome, Indolente (reife) B- und T-Zell-Lymphome, B- CLL, Prolymphozytenleukämie (B-PLL, T-PLL), T-Zell "Large Granulär Lymphocyte"-Leukämien (T- LGL), adulte T-Zell-Leukämien (ATL), Lymphome der Haut, kutane T-Zell-Lymphome, Mycosis fungoides, Sezary-Syndrome, Lymphome des ZNS, Lymphome des Gl-Traktes, Magenlymphome, intestinale Lymphome und Prostatatumorerkrankungen, aber auch auf Pankreas-, Hoden-, Mundhöhlen- und Rachentumoren, Speiseröhren-, Kehlkopf-, Schilddrüsen-, Magen-, Darm-, Lungen-, Nieren- und ableitende Harnwegs- und Harnblasentumoren, Mamma-, Eierstock-, Gebärmutterhals- und Gebährmutterkörpertumoren, malignes Melanom, Gallenblasentumoren, Astrozytome, Glioblastome und Neuroblastome.
Die Erfindung eignet sich weiter zum Einsatz bei der Entwicklung und Suche von Wirkstoffen zur Prävention und Therapie von Tumorerkrankungen.
Dazu werden in einem Screeningverfahren bevorzugt Tumorzellen oder Tumorzelllinien, in denen PLA2R1 -DNA methyliert vorliegt, mit zu testenden Substanzen inkubiert.
Anschließend (z. B. nach 2-6 Tagen) wird die LJ42R7-DNA-Methylierung in den Tumorzellen oder Tumorzelllinien, wie oben beschrieben detektiert, und die LJ42R7-DNA-Methylierung mit und ohne Einwirkung der zu testenden Substanzen verglichen. Der Vergleich erfolgt entweder basierend auf einer mitgeführten Kontrolle (Tumorzellen oder Tumorzelllinien ohne Testsubstanz) oder Vergleichsdaten aus vorherigen Messungen.
Substanzen, welche die LJ42R7-DNA-Methylierung vermindern, eignen sich voraussichtlich zur Prävention und Therapie von Tumorerkrankungen. Die so ermittelteten Substanzen können vorteilhaft weiter in einem Tiermodell auf ihre Antitumorwirkung und Verträglichkeit getestet werden.
Die Erfindung wird durch die nachfolgenden Abbildungen und Ausführungsbeispiele näher erläutert, ohne auf diese beschränkt zu sein:
Abb. 1: Bestimmung von PLA2-Rl-mRNA-Transkripten mittels RT-PCR in U937-Leukämiezellen. L: Größenstandard; 1, 6: Leerwert; 2, 7: lFN-γ; 3: IL-lß; 5: 1L-6; 5: TNF-a; 6: Leerwert; 7: lFN-γ; 8: IL-lß; 9: 1L-6; 10: TNF-a.
Abb. 2: Untersuchung des PLA2R1 -Promotors und Exon 1 (Nukleotidbereich -2000 bp bis zum Beginn des Exons 1 und +2200 bp nach Beginn des Exons 1) hinsichtlich des Vorkommens von CpG-Stellen
mittels MethPrimer-Software; CpG-lnseln in den Nukleotidbereichen -356 bp bis -241 bp, +37 bp bis +458 bp, +511 bp bis +667 bp und +836 bp bis +990 bp.
Abb. 3: Sequenzausschnitt des PLA2R1 -Gens (Nukleotidbereich -2000 bp vom Beginn des Exons 1 und +2199 bp nach Beginn des Exons 1. CpG-Stellen in den Nukleotidbereichen -356 bp bis -241 bp, +37 bp bis +458 bp, +511 bp bis +667 bp und +836 bp bis +990 bp) sind durch Fettdruck und Unterstreichung hervorghoben.
Quellen: GenBanks Genome eference Consortium Human Build 37 (GRCh37), NC_000002.11 und NT 005403.17; Alternate assembly (Celera), AC 000045.1 und NW 921585.1 bzw. Alternate assembly (HuRef), AC 000134.1 und NW 001838860.1.
Chromosom: 2; Lokalisation: 2q23-q24; GenelD: 22925; primäre Quelle: HGNC: 9042. Sequenz unter: http://w .ncbi.nlm.nih.gov/sites/entrez?Db=gene&term=%28pla2ri rgener/o29%20AND%20%28Hom o%20sapiensrorgnl%29%20AND%20aliverprorjl%20NOT%20newentryrgenel&log$=genesensor5&log
(National Center for Biotechnology Information NCB1, U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA) und SEQ 1D No. 1.
Abb. 4: Verwendung methylierungsspezifischer Restriktasen Hinfl und Hgal zum Methylierungsnachweis von CpG-Stellen in den Positionen 9 und 20 des Framentes 1 im PLA2R1-Gen bei Jurkat- und U937-Leukämiezellen und Leukozyten eines Normalprobanden [NP-1] in (A) bzw. eines Patienten [Pat. 21] mit AML und Normalprobanden [NP2 und NP3] in (B).
Abb. 5: Verwendung methylierungsspezifischer Restriktasen Acil, BstUI, BsrBI und BceAI zum Methylierungsnachweis von CpG-Stellen im Fragment 1 des PLA2R1 -Gens von Leukozyten eines Normalprobanden (A), U937-Leukämiezellen (B) und eines Patienten mit AML (C).
Abb. 6: Restriktion genomischer DNA mittels methylierungssensitiver Restriktase Hgal und anschließender Amplifikation zur Bestimmung des Methylierungsgrades einer CpG-Stelle im Fragment 1 (Position 9) des PLA2R1-Gens ohne Natriumbisulfit-Modifizierung in U937-Leukämiezellen (Bahnen 2 und 3), Blutleukozyten eines Patienten mit AML, Ml (Patient 21, Bahnen 4 und 5) und eines Normalprobanden (NPl, Bahnen 6 und 7). Bahnen 1 und 8: 100 bp-Ladder, Bahnen 2, 4 und 6 wurden mit Hgal und Bahnen 3, 5, und 7 mit Puffer versetzt. Bahn 9: Leerwert ohne Template.
Abb. 7: Restriktion genomischer DNA mittels methylierungssensitiver Restriktase Hgal und anschließender Amplifikation zur Bestimmung des Methylierungsgrades einer CpG-Stelle im Fragment 1 (Position 9) des PLA2R1 -Gens ohne Natriumbisulfit-Modifizierung. (A) Normalprobanden 1-4 (Bahnen 2-9), Patient 1 mit MDS (Bahnen 10, 11). (B) Patient 2 mit MDS (Bahnen 2, 3), Patient 5 mit MDS (Bahnen 4 und 5), Patient 7 mit MDS (Bahnen 6 und 7), Patient 8 mit MDS (Bahnen 8 und 9) und U937-
Leukämiezellen (Bahnen 10 und 11). Bahnen 2, 4, 6, 8 und 10 wurden mit Hgal und Bahnen 3, 5, 7, 9 und 11 mit Puffer versetzt. Bahn 1 : 100 bp-Ladder, Bahn 12: ohne Template.
Abb. 8: Übersicht über die Methylierungen der CpG-Stellen 1 bis 21 im untersuchten Fragment 1 des PLA2R1-Gens bei U937- und Jurkat-Leukämiezellen, 6 Normalprobanden (NP 1-4, NP 29 und 30) und Patienten mit MDS (Pat. 7 und 8) und AML (Pat. 19, 21-24, 53 und 54).
Abb. 9: Übersicht über die Methylierungen der CpG-Stellen 22 bis 61 in dem untersuchten Fragment 2A des PLA2R1-Gens bei U937-Leukämiezellen, Normalprobanden 1-4 (NP 1-4) und Patienten 21, 22, 53 und 54 mit AML (Pat. 21, Pat. 22, Pat. 53 und Pat.54).
Abb. 10: Übersicht über die Methylierungen der CpG-Stellen 62 bis 91 in dem untersuchten Fragment 2B des PLA2R1-Gens bei U937-Leukämiezellen, Normalprobanden 1-4 (NP 1-4) und Patienten 21, 22, 53 und 54 mit AML (Pat. 21, Pat. 22, Pat. 53 und Pat.54).
Abb. 11: Übersicht über die Methylierungen der CpG-Stellen 92 bis 108 in dem untersuchten Fragment 3 des PLA2R1-Gens bei U937-Leukämiezellen, Normalprobanden 1-4 (NP 1-4) und Patienten 21, 22, 53 und 54 mit AML (Pat. 21, Pat. 22, Pat. 53 und Pat.54).
Abb. 12: Übersicht über die Methylierung von CpG-Stellen 1 bis 21 in der Insel 1 (Fragment 1) des PLA2R1-Gens bei normalen epithelialen Prostatazellen (PrEC), und drei Prostatatumorzelllinien (PC-3, DU-145 und LNCaP).
Abb. 13: Prinzip der Differenzierung zwischen Blut, Urin oder anderen Probenarten von Patienten mit Tumorerkrankungen und von gesunden Probanden.
In den Abb. 8 bis 13 steht ein weißes Kästchen jeweils für einen Methylierungsgrad von 0 % bis 25 %, ein gestricheltes Kästchen für einen Methylierungsgrad von 30 % bis 70 % und ein schwarzes Kästchen für einen Methylierungsgrad von 75 % bis 100 %.
Abb. 14: Durchschnittliche Methylierungsgrade (Mittelwert und Standardabweichung) der CpG-Stellen 1-108 des PLA2 1 -Promoters von genomischer DNA aus Blutzellen von gesunden Probanden (N=10) und Leukämiepatienten (N=18). Ferner sind die Methylierungen der CpG-Stellen 1-108 des PLA2R1- Promoters in der Myelomzelllinie RPM1-8866, der lymphatischen Leukämiezelllinie Jurkat und der myeloischen Leukämiezelllinie U937 dargestellt. Der Bereich der in der HRM analysierten Nukleinsäuren ist durch einen schwarzen Balken gekennzeichnet.
Abb. 15: Darstellung der durchschnittlichen Methylierungen der CpG-Stellen 6-14 des PLA2R1-Gens von 18 Leukämiepatienten.
Abb. 16: Durchschnittliche Methylierungsgrade des PLA2 1-Gens von Leukämiepatienten (N=31) und normalen Probanden (N=51) durch HRM-Analyse. In der Gruppe der Leukämiepatienten wiesen ein Patient mit AML-M4 eine Methylierung von 7% und ein Patient mit AML-MO von 3% auf. In der Kontrollgruppe wies eine Probandin eine PLA2R1 -Methylierung von 21% auf. Die Unterschiede zwischen Leukämiepatienten und normalen Probanden waren im Mann-Whitney U-Test signifikant unterschiedlich (p=<0,001).
Abb. 17: HRM-Analysen von Bisulfit-behandelter genomischer DNA von Leukämiepatienten (P22, P23, P40 und P43 mit jeweils AML-Ml und P37 mit ALL), gesunden Probanden (N11-N20), Jurkat- und U937-Zellen. Eine Kalibrierung wurde mit 0%, 20%, 30%, 40%, 60% und 100% methylierter Kontroll- DNA durchgeführt.
Abb. 18: Schmelzkurven (Melt)-Analysen von Bisulfit-behandelten und amplifizierten genomischen DNA-Proben aus Blutleukozyten von Leukämiepatienten (P22 und P23 mit jeweils AML-Ml) im Vergleich zu unmethylierten (0%) und vollständig methylierten (100%) Kontroll-DNA. Bei P22 enthalten der größere Anteil der Blutleukozyten unmethylierte DNA-Sequenzen des PLA2R1-Gens, während bei P22 der größere Anteil hypermethylierte DNA-Sequenzen aufweist.
Abb. 19: HRM-Analysen von Bisulfit-modifizierter genomischer DNA von 2 Patienten (PI und P7) mit myelodysplastischem Syndrom (MDS) vor und nach Behandlung mit 5-Azacytidin (Vidaza). Bei den beiden Patienten, die als„Responder" bezeichnet wurden, sank der Methylierungsgrad des PLA2R1 - Gens.
Abb. 20: HRM-Analysen von Bisulfit-modifizierter genomischer DNA eines Patienten (P3) mit myelodysplastischem Syndrom (MDS) vor und nach Behandlung mit 5-Azacytidin (Vidaza). Bei diesem Patient, der als „Non-Responder" bezeichnet wurde, stieg der Methylierungsgrad des PLA2R1-Gens während der Behandlung signifikant an.
In den Abbildungen 17 bis 20 ist auf der X-Achse die Schmelztemperatur in °C und auf der Y-Achse das normalisierte Minus (normalized minus).
Untersuchungen zur Expression von sPLA?-Rl durch RT-PCR
Nach Isolierung zellulärer RNA aus humanen monozytären Leukämiezellen (U937-Zellen, ATCC CRL- 1593.2) mittels TR1AZOL (Sigma-Aldrich, Deisenhofen, Germany) und reverser Transkription mit Hilfe von GeneAmp RNA-PCR Kits (PerkinElmer LAS GmbH, Jügesheim, Germany) wurden die cDNA von sPLA2-Rl unter Verwendung entsprechender Primer (Tab. 1) amplifiziert und semi-quantitativ bestimmt. Als Kontrolle diente die Bestimmung der Glyceraldehyd-3-Phosphat-Dehydrogenase (GAPDH)- spezifischen mRNA. Die Oligonukleotide wurden in einer Endkonzentration von 0.8 μΜ eingesetzt. Die PCR-Amplifikation wurde wie folgt durchgeführt: 40 Zyklen bei 94 °C für 30 Sekunden, 68 °C für 30 Sekunden und 72 °C für 1 Minute. Die eingesetzten Puffer und Reagenzien stammten vom GeneAmp Kit (PerkinElmer LAS GmbH). Die amplifizierten Produkte wurden in der Agarose- Gelelektrophorese analysiert. Dabei waren 1) die basale Expression, 2) die Expressionen in Abhängigkeit von der Inkubation mit proinflammatorischen Cytokinen (IL-lß, 1L-6, TNF-α und lFN-γ) und 3) die Expressionen nach gleichzeitiger Hemmung der DNA-Methylierung mit 5-Aza-2,-desoxycytidin (5-Aza- dC) von Interesse (Abb. 1).
Tabelle 2: Sequenzen der verwendeten Oligonukleotide zum Nachweis von sPLA2-Rl-mRNA
Nachweis von 5'-CpG-Stellen im PLA2R1 -Gen
Mit Hilfe von MethPrimer-Software konnten im PLA2R1 -Gen im Nukleotidbereich -2000 bp vom Exon 1 und +2199 bp nach Beginn des Exons 1 vier S'-CpG-lnseln identifiziert werden (Abb. 2; Chromosom 2, Lokalisation: 2q23-q24; GenelD: 22925; primäre Quelle: HGNC: 9042; Sequenz ENSG00000153246 ENSEMBL-Datenbank (http://www.ensembl.org/). Das Exon 1 selbst ist 315 bp lang. In 5"-Richtung stromaufwärts enthält das PLA2R1-Gen eine S'-CpG-lnsel: -356 bp bis -241 bp vom Beginn des Exons 1 und drei weitere S'-CpG-lnseln in den Nukleotidbereichen +37 bp bis +458 bp, +511 bp bis +667 bp und +836 bp bis +990 bp.
Untersuchungen zur DNA-Methylierung von 5'-CpG-Stellen im PLA2R1-Gen durch Sequenzierung
Nach Isolierung genomischer DNA aus U937- und humanen lymphozytären Jurkat-Leukämie-Zelllinien, normalen epithelialen Prostatazellen und Prostatatumorzelllinien (PC-3, DU-145 und LNCaP) sowie aus Leukozyten von Normalprobanden und Patienten mit Myelodysplastischem Syndrom (MDS) und akuter myeloischer Leukämie (AML) mit Hilfe des QIAamp DNA Blood Mini Kit (Qiagen, Hilden, DE) wurde die DNA nach Frommer et al. [59] mittels EpiTect Bisulfit Kit (Qiagen) modifiziert und anschließend gereinigt.
Um die 5"-aufwärts gelegene Promotorregion des PLA2R1-Gens im Nukleotidbereich -662 bp bis zum Exon 1 und stromabwärts bis +1275 bp das PLA2R1-Gen zu sequenzieren, wurden 4 Fragmente in einer nested PCR amplifiziert. Dazu kamen folgende Oligonukleotid-Primerpaare zum Einsatz:
Fragment 1 (-662 bp bis -86 bp):
extrinsische Primer:
5 " - TTTGTTGGTTATTTGAAGGAGGA- 3 " ( SEQ ID No
5 " -ACCATCTACCCATCCCAAAA- 3 " ( SEQ ID No
und intrinsische Primer:
5 " - TATATTTTAGTTAGGGTTGTTTTAT - 3 " ( SEQ ID No
5 " - TTCCTACCTTTAAAATAAAAACAAA- 3 " ( SEQ ID No
Fragment 2 (-105 bp bis +783 bp):
extrinsische Primer:
5 " - CTGGTTATTTGAAGGAGGACAGT - 3 " ( SEQ ID No
5 " - CCATCTGCCCATCCCAGAAATT- 3 " ( SEQ ID No intrinsische Primer:
5 " - CATTCTAGCCAGGGCTGTCCT
5 ~~ - AATTCCTGCCTTTGGGGTGGG
Anstelle des gesamten Fragmentes 2 wurden z. T. auch Teilfragmente amplifizert, wozu folgende Primer- Paare verwendet wurden:
extrinsische Primer:
5 " - TTTGTTTTTATTTTAAAGGTAGGAA- 3 " ( SEQ ID No . 14 ) und
5 " - ACCCTATCTCAAAAAACAAACAA- 3 " ( SEQ ID No . 15 )
Fragment 2A:
intrinsische Primer:
5 ~~ - TTTTTGGGATGGGTAGATGG- 3
5 " - CATACTCAAAACTACTAACACA
Fragment 2B:
intrinsische Primer:
5 - _ TTTGGAGTGGTAGGGTGAGT - 3
5 ~~ - ACCTAACTTAAAAATCACTCCTA
Fragment 3 (+824 bp bis +1275 bp):
semi-nested-PCR: extrinsische Primer:
5 " - TAGGAGCGATTTTTAAGTTAGGT - 3 " ( SEQ ID No
5 " - CTCTCCTCCCTCTCTTTACA- 3 " ( SEQ ID No
intrinsische Primer:
5 " - TAGGAGCGATTTTTAAGTTAGGT - 3 " ( SEQ ID No
5 " - CAACCTTCTAAATCTCATATATAA- 3 " ( SEQ ID No
Die Oligonukleotide wurden in einer Endkonzentration von 0,8 μΜ eingesetzt. Die Bedingungen für die PCR waren folgende: 20 Zyklen bei 95 °C für 45 Sekunden, 44 °C für 60 Sekunden und 72 °C für 45 Sekunden unter Verwendung der extrinsischen Primer und 35 Zyklen bei 95 °C für 30 Sekunden, 45 °C für 45 Sekunden und 72 °C für 30 Sekunden unter Verwendung der intrinsischen Primer. Die Puffer und Reagentien stammten vom GeneAmp Kit (PerkinElmer LAS GmbH). Die PCR-Produkte wurden schließlich mittels QIAquick PCR-Reinigungskit (Qiagen GmbH, Hilden, Germany) gereinigt.
Nach Markierung der PCR-Produkte mittels BigDye Terminator Sequencing Standard Version 3.1 (Qiagen) wurden die DNA-Sequenzen der PCR-Produkte am ABl 3730 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) analysiert.
Untersuchungen zur DNA-Methylierung von 5'-CpG-Stellen im PLA2R1-Gen durch methylierungsspezifische Restriktasen
Alternativ zur direkten Sequenzierung wurden PCR-Produkte nach Modifizierung genomischer DNA durch Natriumbisulfit-Behandlung mit Restriktasen inkubiert.
Als Beispiel wurde das Fragment 1, das die S'-CpG-lnsel 1 des PLA2RI-Gens umfasst, mit methylierungssensitiven Restriktasen wie Hinfl und Hgal inkubiert und anschließend in der Agarosegelelektrophorese analysiert. Mit Hilfe dieser Methode konnten die Methylierungen der 5"-CpG- Stellen in Positionen 9 und 20 im Fragment 1 bestimmt werden (Abb. 4). Ferner wurden die methylierungssensitiven Restriktasen Acil, BstUI, BsrBI und BceAI zur Bestimmung der Methylierung weiterer S'-CpG-Stellen im PLA2RI-Gen bestimmt (Abb. 5). Durch diese Untersuchungen konnten die Ergebnisse, die durch Sequenzierung erhalten wurden, bestätigt werden.
Untersuchungen zur DNA-Methylierung von 5'-CpG-Stellen im PLA2RI-Gen ohne Natriumbisulfit- Behandlung genomischer DNA
Um eine Natriumbisulfit-Modifizierung genomischer DNA zu umgehen, wurden DNA-Proben direkt mit methylierungssensitiven Restriktasen behandelt und anschließend durch PCR-Amplifikation und Analyse im Agarosegel untersucht.
Als Beispiel wurden genomische DNA von U937-Leukämiezellen und Leukozyten von Normalprobanden bzw. Patienten mit MDS bzw. AML mit der methylierungssensitiven Restriktase Hgal inkubiert und anschließend durch nested PCR amplifiiert. Folgende Oligonukleotide wurden dafür eingesetzt:
extrinsische Primer:
5 " - CTGGTTATTTGAAGGAGGACAGT - 3 " ( SEQ ID No . 23 ) und
5 " - CCATCTGCCCATCCCAGAAATT- 3 " ( SEQ ID No . 24 ) und
intrinsische Primer:
5 " - CATTCTAGCCAGGGCTGTCCT - 3 " ( SEQ ID No . 25 ) und
5 " - AATTCCTGCCTTTGGGGTGGG- 3 " ( SEQ ID No . 26 ) .
Mittels dieser Untersuchungen konnte die Methylierung der S'-CpG-Stelle Nr. 9 im Fragment 1 bestimmt (Abb. 6 und 7) und die Daten, die durch Sequenzierung erhalten wurden, bestätigt werden.
Die Ergbnisse werden wie folgt zusammengefasst:
(1) Überraschend wurde in U937-Zellen eine epigenetische Stilllegung (epigenetic silencing) des PLA2RI -Gens festgestellt (Abb. 1).
(2) Anschließende Untersuchungen zeigten, dass vier S' -CpG-lnseln in unmittelbarer Nähe des Exons 1 im PLA2RI-Gen existieren (Abb. 2). Diese vier S' -CpG-lnseln liegen in U937-Leukämiezellen vollständig methyliert vor (Abb. 8-11).
(3) Im Gegensatz dazu waren in DNA-Proben, die aus weißen Blutzellen von Normalprobanden isoliert wurden, drei S'-CpG-lnseln im PLA2R1-Gen nahezu vollständig unmethyliert (Abb. 8-11).
(4) Untersuchungen von DNA-Proben aus weißen Blutzellen von Hoch-Risiko-Patienten mit MDS und Patienten mit akuten Leukämien zeigten, dass die bei Normalprob anden unmethyliert vorliegenden 5"- CpG-lnseln im PLA2R1-Gen verstärkt methyliert waren und sich deutlich von den Proben gesunder Probanden unterschieden (Abb. 8-11).
(5) Eine stromabwärts in 3"-Richtung liegende S'-CpG-lnsel im PLA2R1-Gen war in Proben von Hoch- Risiko-Patienten mit MDS und Patienten mit akuten Leukämien und U937-Leukämiezellen, aber auch in DNA-Proben von Normalprobanden vollständig methyliert (Abb. 11).
(6) Beispiele für diese Verfahren basierend auf der Verwendung methylierungsspezifischer Restriktasen nach Natriumbisulfit-Modifizierung genomischer DNA-Proben zur Bestimmung des Methylierungsgrades von S'-CpG-Stellen im PLA2R1-Gen sind in Abb. 4 und 5 dargestellt.
(7) Ein Beispiel für diese Verfahren zur Bestimmung der Methylierung von S'-CpG-Stellen im PLA2R1- Gen, die keine Natriumbisulfit-Modifizierung genomischer DNA erfordern und damit besonders für die Untersuchung geringer DNA-Probemengen, z. B. aus Paraffinschnitten, geeignet sind und den Einsatz methylierungssensitiver Restriktasen vorsehen, ist in Abb. 6 und 7 dargestellt.
(8) Auch in Prostatatumorzelllinien (PC-3-, DU-145- und LNCaP-Zellen) wurde im Vergleich zu normalen epithelialen Prostatazellen (PrEC) eine deutliche erhöhte PL^2R7-DNA-Methylierung festgestellt (Abb. 12). Die Erfindung ist damit auch auf solide Tumore anwendbar.
Untersuchung des Methylierungsgrads in Leukämiepatienten und gesunden Probanden
Die nachfolgende Tabelle zeigt eine Zusammenfassung der Ergebnisse der hoch auflösenden Schmelzkurven- Analyse (high resolution melting curve analysis; HRM) von Leukämiepatienten und gesunden Probanden. In der Gruppe der Leukämiepatienten wiesen 2 Patienten eine Methylierung des PLA2R1-Gens unterhalb von 10% (7% bei einem Patienten mit AML-M4 und 3% bei einem Patienten mit AML-MO) und in der Kontrollgruppe eine Probandin eine PLA2R1 -Methylierung von 21% auf. Die Unterschiede hinsichtlich der Methylierungen des PLA2R1-Gens zwischen beiden untersuchten Gruppen waren im Mann-Whitney U-Test signifikant unterschiedlich (p=<0,001).
Tabelle 3:
*Ausnahme: 2 Patienten mit PLA2R1 -Methylierungen von 7% bzw. 3%
In der Patentbeschreibung wird folgende Nichtpatentliteratur zitiert:
Literaturverzeichnis
[I] Kramer RM, Hession C, Johansen B, Hayes G, McGray P, Chow EP, Tizard R, Pepinsky RB.
Structure and properties of a human non-pancreatic phospholipase A2. J Biol Chem. 1989; 264: 5768-5775.
[2] Seilhamer JJ, Pruzanski W, Vadas P, Plant S, Miller JA, Kloss J, Johnson LK. Cloning and recombinant expression of phospholipase A2 present in rheumatoid arthritic synovial fluid. J Biol Chem. 1989; 264: 5335-5338.
[3] Valentin E, Ghomashchi F, Gelb MH, Lazdunski M, Lambeau G. On the diversity of secreted phospholipases A2. Cloning, tissue distribution, and functional expression of two novel mouse group 11 enzymes. J Biol Chem. 1999; 274: 31195-31202.
[4] Davidson FF, Dennis EA. Evolutionary relationships and implications for the regulation of phospholipase A2 from snake venom to human secreted forms. J Mol Evol. 1990; 31 : 228-238.
[5] Kudo 1, Murakami M. Phospholipase A2 enzymes. Prostaglandins Other Lipid Mediat. 2002; 68- 69: 3-58.
[6] Dennis EA. The growing phospholipase A2 superfamily of signal transduction enzymes. Trends Biochem Sci. 1997; 22: 1-2.
[7] Murakami M, Shimbara S, Kambe T, Kuwata H, Winstead MV, Tischfield JA, Kudo 1. The functions of five distinct mammalian phospholipase A2s in regulating arachidonic acid release. Type IIa and type V secretory phospholipase A2s are functionally redundant and act in concert with cytosolic phospholipase A2. J Biol Chem. 1998; 273: 14411-14423.
[8 ] Chang HW, Kudo 1, Tomita M, Inoue K. Purification and charactenzation of extracellular phospholipase A2 from peritoneal cavity of caseinate-treated rat. J Biochem (Tokyo). 1987; 102: 147-154.
[9] Mounier C, Vargaftig BB, Franken PA, Verheij HM, Bon C, Touqui L. Platelet secretory phospholipase A2 fails to induce rabbit platelet activation and to release arachidonic acid in contrast with venom phospholipases A2. Biochim Biophys Acta. 1994; 1214: 88-96.
[ 10] Inada M, Tojo H, Kawata S, Tarui S, Okamoto M. Preferential distribution of group-ll-like phospholipase A2 in mononuclear phagocytic cells in rat spieen and liver. Eur J Biochem. 1991 ; 197: 323-329.
[I I ] Horigome K, Hayakawa M, Inoue K, Nojima S. Purification and characterization of phospholipase
A2 released from rat platelets. J Biochem (Tokyo). 1987; 101 : 625-631.
[12] Murakami M, Kudo 1, Suwa Y, Inoue K. Release of 14-kDa group-11 phospholipase A2 from activated mast cells and its possible involvement in the regulation of the degranulation process. Eur J Biochem. 1992; 209: 257-265.
[13] Nevalainen T, Haapanen T. Distribution of pancreatic (group 1) and synovial-type (group 11) phospholipase A2 in human tissue. Inflammation 1993; 17: 453-464.
[14] Andersen S, Sjursen W, Laegreid A, Austgulen R, Johansen B. Immunohistologic detection of non-pancreatic phospholipase A2 (type 11) in human placenta and its possible involvement in normal parturition at term. Prostaglandins Leukot Essent Fatty Acids. 1994; 51 : 19-26.
[15] Murakami M, Nakatani Y, Atsumi G, Inoue K, Kudo 1. Regulatory functions of phospholipase A2.
Crit Rev Immunol. 1997; 17: 225-283.
[16] Takayama , Hara S, Kudo I, Inoue K. Detection of 14-kDa group 11 phospholipase A2 in human seminal plasma. Biochem Biophys Res Commun. 1991 ; 178: 1505-1511.
[17] Nevalainen TJ, Meri K-M, Niemi M. Synovial type (group 11) phospholipase A2 in human seminal plasma. Andrologia 1993; 25: 355-330.
[18] Nevalainen TJ, Aho HJ, Peuravuori H. Secretion of group 2 phospholipase A2 by lacrimal gland.
Invest. Ophthalmol. Visc Sei 1994; 32: 417-421.
[ 19] Kunze H, Bohn E. Phospholipase A2 and Prostaglandins in human seminal plasma. Adv.
Prostaglandin Thromboxane Res. 1978; 3: 159-165.
[20] Riffo M, Parraga M. Lysophosphatidylcholine treatment allows interspecies fertilization of hamster oocytes with zona pellucida by human spermatozoa. J Exp Zool. 1995; 271 : 151-154.
[21 ] Senegas-Balas F, Balas D, Verger R, DeCaro A, Figarella C, Ferrato F, Lechene P, Bertrand C, Ribet A. Immunohistochemical localization of intestinal phospholipase A2 in rat Paneth cells. Histochemistry. 1984; 81 : 581-584.
[22] Farrugia W, Aitken MA, van Dünne F, Wong MH, Brennecke SP, Scott KF, Rice GE. Type 11 phospholipase A2 in human gestational tissues: subcellular distribution of placental immuno- and catalytic activity. Biochim Biophys Acta. 1993; 1166: 77-83.
[23] Lappas M, Rice GE. Phospholipase A2 isozymes in pregnancy and parturition. Prostaglandins Leukot Essent Fatty Acids. 2004; 70: 87-100.
[24] Tada, K., Murakami, M., Kambe, T., and Kudo, I. Induction of cyclooxygenase-2 by secretory phospholipases A2 in nerve growth factor-stimulated rat serosal mast cells is facilitated by interaction with fibroblasts and mediated by a mechanism independent of their enzymatic funetions. J Immunol 161 :5008. 1998.
[25] Beck, S., Lambeau, G., Scholz-Pedretti, K., et al. Potentiation of tumor necrosis factor-a-induced secreted phospholipase A2 (sPLA2)-UA expression in mesangial cells by an autoerine loop involving sPLA2 and peroxisome proliferator-activated receptor-α activation. J Biol Chem 278:29799. 2003.
[26 ] Jaulmes, A. , Janvier, B . , Andreani, M. , and Raymondjean, M.Autocrine and paracrine transcriptional regulation of type IIA secretory phospholipase A2 gene in vascular smooth muscle cells. Arterioscler Thromb Vase Biol 25: 1161. 2005.
[27] Han, W.K., Sapirstein, A., Hung, C.C., Alessandrini, A., and Bonventre, J.V. Cross-talk between cytosolic phospholipase A2a (cPLA2a) and secretory phospholipase A2 (sPLA2) in hydrogen peroxide-induced arachidonic acid release in murine mesangial cells. sPLA2 regulates cPLA2a activity that is responsible for arachidonic acid release. J Biol Chem 278: 24153. 2003
[28] Hernandez, M., Burillo, S.L., Crespo, M.S., and Nieto, M.L. Secretory phospholipase A2 activates the cascade of mitogen-activated protein kinases and cytosolic phospholipase A2 in the human astrocytoma cell line 1321N1. J Biol Chem 273:606. 1998.
[29] Huwiler, A., Staudt, G., Kramer, R.M, Pfeilschifter, J. Cross-talk between secretory phospholipase A2 and cytosolic phospholipase A2 in rat renal mesangial cells. Biochim Biophys Acta 1348:257. 1997.
[30] Park, D.W., Kim, J.R., Kim, S.Y., et al. Akt as a mediator of secretory phospholipase A2 reeeptor- involved inducible nitric oxide synthase expression. J Immunol 170:2093. 2003.
[31 ] Silliman, C.C., Moore, E.E., Zallen, G., et al. Presence of the M-type sPLA2 reeeptor on neutrophils and its role in elastase release and adhesion. Am J Physiol Cell Physiol 283 :C1 102. 2002.
[32] Tnggiani, M., Granata, F., Oriente, A., et cd. Secretory phospholipases A2 induce beta- glucuronidase release and 1L-6 production from human lung macrophages. J Immunol 164:4908. 2000.
[33] Triggiani, M., Granata, F., Oriente, A., et al. Secretory phospholipases A2 induce cytokine release from blood and synovial fluid monocytes. Eur J Immunol 32:67. 2002.
[34] Triggiani, M., Granata, F., Balestrieri, B., et al. Secretory phospholipases A2 activate selective functions in human eosinophils. J Immunol 170:3279. 2003.
[35] Granata, F., Balestrieri, B., Petraroli, A., Giannattasio, G., Marone, G., and Triggiani, M. Secretory phospholipases A2 as multivalent mediators of inflammatory and allergic disorders. Int Arch Allergy Immunol 131 :153. 2003.
[36] Fonteh, A.N., Marion, C ., Barham, B.J., et al. Enhancement of mast cell survival: a novel function of some secretory phospholipase A2 isotypes. J Immunol 167:4161. 2001.
[37] Valentin, E., and Lambeau, G. Increasing molecular diversity of secreted phospholipases A2 and their receptors and binding proteins. Biochim Biophys Acta 1488:59. 2000.
[38] Nicolas, J.P., Lambeau, G., and Lazdunski, M. Identification of the binding domain for secretory phospholipases A2 on their M-type 180-kDa membrane receptor. J Biol Chem 270:28869. 1995.
[39] Nicolas, J.P., Lin, Y., Lambeau, G., Ghomashchi, F., Lazdunski, M., and Gelb, M.H. Localization of structural elements of bee venom phospholipase A2 involved in N-type receptor binding and neurotoxicity. J Biol Chem 272: 7173. 1997.
[40] Ancian, P., Lambeau, G., and Lazdunski, M. Multifunctional activity ofthe extracellular domain of the M-type (180 kDa) membrane receptor for secretory phospholipases A2. Biochemistry 34: 13146. 1995.
[41 ] Ancian, P., Lambeau, G., Mattei, M.G., and Lazdunski, M. The human 180-kDa receptor for secretory phospholipases A2. Molecular cloning, identification of a secreted soluble form, expression, and chromosomal localization. J Biol Chem 270: 8963. 1995.
[42] Hanasaki, . Mammalian phospholipase A2: phospholipase A2 receptor. Biol Pharm Bull 27: 1165. 2004.
[43] Arita, H., Hanasaki, ., Nakano, T., Oka, S., Teraoka, H., and Matsumoto, K. Novel proliferative effect of phospholipase A2 in Swiss 3T3 cells via specific binding site. J Biol Chem 266: 19139. 1991.
[44] Fossier, P., Lambeau, G., Lazdunski, M., and Baux, G. Inhibition of ACh release at an Aplysia Synapse by neurotoxic phospholipases A2: specific receptors and mechanisms of action. J Physiol 489:29. 1995.
[45] anemasa, T., Hanasaki, . , and Arita, H. Migration of vascular smooth muscle cells by phospholipase A2 via specific binding sites. Biochim Biophys Acta 1 125:210. 1992.
[46] undu, G.C., and Mukherjee, A.B. Evidence that porcine pancreatic phospholipase A2 via its high affinity receptor stimulates extracellular matrix invasion by normal and Cancer cells. J Biol Chem 272:2346. 1997.
[47] Hanasaki, ., and Arita, H. Phospholipase A2 receptor: a regulator of biological functions of secretory phospholipase A2. Prostaglandins Other Lipid Mediat 68-69:71. 2002.
[48] Augert A, Payre C, de Launoit Y, Gil J, Lambeau G, Bernard. The M-type receptor PLA2-R regulates senescence through the p53 pathway. EMBO Rep. EMBO Rep. 2009; 10: 271-7.
[49] Berns K, Hijmans EM, Mullenders J, Brummelkamp TR, Velds A, Heimerikx M, erkhoven RM, Madiredjo M, Nijkamp W, Weigelt B, Agami R, Ge W, Cavet G, Linsley PS, Beijersbergen RL,
Bernards R. A large-scale RNAi screen in human cells identifies new components of the p53 pathway. Nature 2004; 428: 431-437
[50] Lambeau G, Schmid-Alliana A, Lazdunski M, Barhanin J. Identification and purification of a very high affinity binding protein for toxic phospholipases A2 in skeletal muscle. J Biol Chem. 1990 Jun 5;265(16):9526-32.
[51 ] Lambeau G, Gelb MH. Biochemistry and physiology of mammalian secreted phospholipases A2.
Annu Rev Biochem. 2008; 77: 495-520.
[52] Drickamer , Fadden AJ. Genomic analysis of C-type lectins. Biochem Soc Symp. 2002;(69):59- 72.
[53] East L, Isacke CM. The mannose receptor family. Biochim Biophys Acta. 2002 Sep 19; 1572(2- 3):364-86
[54] Taylor PR, Gordon S, Martinez-Pomares L. The mannose receptor: linking homeostasis and immunity through sugar recognition. Trends Immunol. 2005 Feb;26(2): 104-10.
[55] Hanasaki , Yokota Y, Ishizaki J, Itoh T, Arita H. Resistance to endotoxic shock in phospholipase A2 receptor-deficient mice. J Biol Chem. 1997 Dec 26;272(52):32792-7
[56] Hanasaki , Arita H. Phospholipase A2 receptor: a regulator of biological functions of secretory phospholipase A2. Prostaglandins Other Lipid Mediat. 2002 Aug;68-69:71-82.
[57] Lambeau G, Lazdunski M. Receptors for a growing family of secreted phospholipases A2. Trends Pharmacol Sei. 1999 Apr;20(4): 162-70.
[58] Dimri GP, Lee X, Basile G, Acosta M, Scott G, Roskelley C, Medrano EE, Linskens M, Rubelj 1, Pereira-Smith O, et al.A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sei U S A. 1995; 92: 9363-7.
[59] Frommer M, McDonald LE, Miliar DS, Collis CM, Watt F, Grigg GW, Molloy PL, Paul CL. A genomic sequencing protoeol that yields a positive display of 5-methylcytosine residues in individual DNA Strands. Proc Natl Acad Sei U S A. 1992 Mar 1 ;89(5): 1827-31.
[60] Eads CA, Danenberg KD, Kawakami K, Saltz LB, Blake C, Shibata D, Danenberg PV, Laird PW.
MethyLight: a high-throughput assay to measure DNA methylation. Nucleic Acids Res. 2000 Apr 15;28(8):E32.
[61 ] Menschikowski M, Hagelgans A, Kostka H, Eisenhofer G, Siegert G. Involvement of epigenetic mechanisms in the regulation of secreted phospholipase A2 expressions in Jurkat leukemia cells. Neoplasia. 2008 Nov;10(l 1):1195-203.
[62] Kulis M, Esteller M. DNA methylation and Cancer. Adv Genet. 2010;70:27-56.
Claims
1. Verfahren zur Diagnose, Prognose und Therapiekontrolle von Tumorerkrankungen, dadurch gekennzeichnet, dass der Methylierungsgrad des Phospholipase A2 Rezeptor- 1-Gens in einer isolierten Patientenprobe bestimmt wird.
Verfahren nach Anspruch 1, dadurch gekennzeichnet, dass der bestimmte Methylierungsgrad mit dem Referenz-Methylierungsgrad des Phospholipase A2 Rezeptor- 1 -Gens in einer Referenzprobe eines gesunden Probanden oder entsprechenden Referenzdaten verglichen wird.
Verfahren nach Anspruch 2, dadurch gekennzeichnet, dass ein gegenüber dem Referenz-Methylierungsgrad erhöhter Methylierungsgrad mit dem Vorliegen einer Tumorerkrankung korreliert.
Verfahren nach einem der Ansprüche 1 bis 3, wobei die Tumorerkrankung ausgewählt ist aus Lymphomen, Leukämien oder soliden Tumoren.
Verfahren nach einem der Ansprüche 1 bis 4, dadurch gekennzeichnet, dass der Nachweis des Methylierungsgrades des Phospholipase A2 Rezeptor- 1 -Gens in einer Probe erfolgt, in der zuvor Zellen angereichert wurden, die kein oder nur wenig PLA2- Rl exprimieren.
Verfahren nach Anspruch 5 zum Nachweis einer Minimalresterkrankung („minimal residual disease" - MRD).
Verwendung von methylierten Sequenzen des Phospholipase A2 Rezeptor- 1 -Gens als Tumormarker, insbesondere für die Diagnostik, Prognose und Therapiekontrolle von Tumorerkrankungen.
8. Verwendung nach Anspruch 7 zum Nachweis einer Minimalresterkrankung (minimal residual disease - MRD).
9. Kit für die Diagnostik, Prognose und Therapiekontrolle von Tumorerkrankungen enthaltend:
- Bisulfit und/oder methylierungssensitive Restriktasen,
sowie ggf. einen oder mehrere der folgenden Bestandteile:
- PCR-Primer, Desoxyribonukleosidtriphosphat-Mix, PCR-Puffer und DNA- Polymerase,
- Kontroll-DNA, insbesondere unmethylierte Phospholipase A2 Rezeptor- 1 -DNA und methylierte Phospholipase A2 Rezeptor- 1 -DNA, DNA-Leiter,
- Antikörper gegen PLA2-R1 (ggf. an Matrixmaterialien immobilisiert),
- Puffer,
- Gebrauchsanleitung und Software zur Auswertung.
10. Screeningverfahren zur Ermittlung von Wirkstoffen zur Prävention und Therapie von Tumorerkrankungen, mit den Schritten:
a. ) Inkubation von Tumorzellen oder Tumorzelllinien, in denen Phospholipase A2
Rezeptor- 1 -DNA methyliert vorliegt, mit einer Testsubstanz, und anschließende b. ) Detektion der Phospholipase A2 Rezeptor- 1-DNA-Methylierung in den
Tumorzellen oder Tumorzelllinien.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE201010031354 DE102010031354B3 (de) | 2010-07-14 | 2010-07-14 | Mittel und Verfahren zur Diagnostik, Prognose und Therapiekontrolle von Tumorerkrankungen |
| DE102010031354.8 | 2010-07-14 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2012007462A1 true WO2012007462A1 (de) | 2012-01-19 |
Family
ID=44628906
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2011/061854 Ceased WO2012007462A1 (de) | 2010-07-14 | 2011-07-12 | Mittel und verfahren zur diagnostik, prognose und therapiekontrolle von tumorerkrankungen |
Country Status (2)
| Country | Link |
|---|---|
| DE (1) | DE102010031354B3 (de) |
| WO (1) | WO2012007462A1 (de) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017114754A1 (de) | 2015-12-30 | 2017-07-06 | Technische Universität Dresden | Verfahren und mittel zur diagnostik von tumoren |
| DE102017214449A1 (de) | 2017-08-18 | 2019-02-21 | Technische Universität Dresden | Verfahren und Mittel zur Diagnostik von Tumoren durch Nachweis und Quantifizierung heterogen methylierter Epiallele |
| DE102021127535B3 (de) | 2021-10-22 | 2023-03-09 | Technische Universität Dresden, Körperschaft des öffentlichen Rechts | Verfahren und Kit zur Diagnostik von Tumoren |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE10056802A1 (de) | 2000-11-14 | 2002-05-29 | Epigenomics Ag | Verfahren zur Detektion von Methylierungszuständen zur toxikologischen Diagnostik |
-
2010
- 2010-07-14 DE DE201010031354 patent/DE102010031354B3/de not_active Expired - Fee Related
-
2011
- 2011-07-12 WO PCT/EP2011/061854 patent/WO2012007462A1/de not_active Ceased
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE10056802A1 (de) | 2000-11-14 | 2002-05-29 | Epigenomics Ag | Verfahren zur Detektion von Methylierungszuständen zur toxikologischen Diagnostik |
Non-Patent Citations (71)
| Title |
|---|
| AGRAWAL SHUCHI ET AL: "DNA methylation of tumor suppressor genes in clinical remission predicts the relapse risk in acute myeloid leukemia", CANCER RESEARCH, vol. 67, no. 3, February 2007 (2007-02-01), pages 1370 - 1377, XP002663179, ISSN: 0008-5472 * |
| ANCIAN, P., LAMBEAU, G., LAZDUNSKI, M.: "Multifunctional activity of the extracellular domain of the M-type (180 kDa) membrane receptor for secretory phospholipases A2", BIOCHEMISTRY, vol. 34, 1995, pages 13146 |
| ANCIAN, P., LAMBEAU, G., MATTEI, M.G., LAZDUNSKI, M.: "The human 180-kDa receptor for secretory phospholipases A2. Molecular cloning, identification of a secreted soluble form, expression, and chromosomal localization", J BIOL CHEM, vol. 270, 1995, pages 8963 |
| ANDERSEN S, SJURSEN W, LAEGREID A, AUSTGULEN R, JOHANSEN B: "Immunohistologic detection of non-pancreatic phospholipase A2 (type II) in human placenta and its possible involvement in normal parturition at term", PROSTAGLANDINS LEUKOT ESSENT FATTY ACIDS, vol. 51, 1994, pages 19 - 26, XP026324119, DOI: doi:10.1016/0952-3278(94)90173-2 |
| ARITA, H., HANASAKI, K., NAKANO, T., OKA, S., TERAOKA, H., MATSUMOTO, K.: "Novel proliferative effect of phospholipase A2 in Swiss 3T3 cells via specific binding site", J BIOL CHEM, vol. 266, 1991, pages 19139 |
| AUGERT A, PAYRE C, DE LAUNOIT Y, GIL J, LAMBEAU G, BERNARD: "The M-type receptor PLA2-R regulates senescence through the p53 pathway", EMBO REP. EMBO REP., vol. 10, 2009, pages 271 - 7 |
| BECK, S., LAMBEAU, G., SCHOLZ-PEDRETTI, K. ET AL.: "Potentiation oftumornecrosis factor-a-induced secreted phospholipase A2 (sPLA2)-IIA expression in mesangial cells by an autocrine loop involving sPLA2 and peroxisome proliferator-activated receptor-a activation", J BIOL CHEM, vol. 278, 2003, pages 29799 |
| BERNS K, HIJMANS EM, MULLENDERS J, BRUMMELKAMP TR, VELDS A, HEIMERIKX M, KERKHOVEN RM, MADIREDJO M, NIJKAMP W, WEIGELT B: "A large-scale RNAi screen in human cells identifies new components of the p53 pathway", NATURE, vol. 428, 2004, pages 431 - 437, XP002676276, DOI: doi:10.1038/nature02371 |
| CHANG HW, KUDO I, TOMITA M, INOUE K: "Purification and characterization of extracellular phospholipase A2 from peritoneal cavity of caseinate-treated rat", J BIOCHEM (TOKYO, vol. 102, 1987, pages 147 - 154 |
| DAVIDSON FF, DENNIS EA: "Evolutionary relationships and implications for the regulation of phospholipase A2 from snake venom to human secreted forms", J MOL EVOL., vol. 31, 1990, pages 228 - 238, XP009025453, DOI: doi:10.1007/BF02109500 |
| DENNIS EA: "The growing phospholipase A2 superfamily of signal transduction enzymes", TRENDS BIOCHEM SCI., vol. 22, 1997, pages 1 - 2, XP004016851, DOI: doi:10.1016/S0968-0004(96)20031-3 |
| DIMRI GP, LEE X, BASILE G, ACOSTA M, SCOTT G, ROSKELLEY C, MEDRANO EE, LINSKENS M, RUBELJ I, PEREIRA-SMITH O ET AL.: "A biomarker that identifies senescent human cells in culture and in aging skin in vivo", PROC NATL ACAD SEI USA, vol. 92, 1995, pages 9363 - 7, XP009065201, DOI: doi:10.1073/pnas.92.20.9363 |
| DRICKAMER K, FADDEN AJ: "Genomic analysis of C-type lectins", BIOCHEM SOC SYMP., 2002, pages 59 - 72 |
| DUNWELL THOMAS ET AL: "A Genome-wide screen identifies frequently methylated genes in haematological and epithelial cancers", MOLECULAR CANCER, BIOMED CENTRAL, LONDON, GB, vol. 9, no. 1, 25 February 2010 (2010-02-25), pages 44, XP021067996, ISSN: 1476-4598 * |
| EADS CA, DANENBERG KD, KAWAKAMI K, SALTZ LB, BLAKE C, SHIBATA D, DANENBERG PV, LAIRD PW: "MethyLight: a high-throughput assay to measure DNA methylation", NUCLEIC ACIDS RES., vol. 28, no. 8, 15 April 2000 (2000-04-15), pages E32, XP002341618, DOI: doi:10.1093/nar/28.8.e32 |
| EADS ET AL., NUCLEIC ACIDS RES., vol. 28, no. 8, 2000, pages E32 |
| EAST L, ISACKE CM: "The mannose receptor family", BIOCHIM BIOPHYS ACTA, vol. 1572, no. 2-3, 19 September 2002 (2002-09-19), pages 364 - 86, XP004380527, DOI: doi:10.1016/S0304-4165(02)00319-7 |
| FARRUGIA W, AITKEN MA, VAN DUNNE F, WONG MH, BRENNECKE SP, SCOTT KF, RICE GE: "Type II phospholipase A2 in human gestational tissues: subcellular distribution ofplacental immuno- and catalytic activity", BIOCHIM BIOPHYS ACTA, vol. 1166, 1993, pages 77 - 83 |
| FONTEH, A.N., MARION, C.R., BARHAM, B.J. ET AL.: "Enhancement of mast cell survival: a novel function of some secretory phospholipase A2 isotypes", J IMMUNOL, vol. 167, 2001, pages 4161 |
| FOSSIER, P., LAMBEAU, G., LAZDUNSKI, M., BAUX, G.: "Inhibition of ACh release at an Aplysia synapse by neurotoxic phospholipases A2: specific receptors and mechanisms of action", J PHYSIOL, vol. 489, 1995, pages 29 |
| FROMMER M, MCDONALD LE, MILLAR DS, COLLIS CM, WATT F, GRIGG GW, MOLLOY PL, PAUL CL: "A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands", PROC NATL ACAD SEI USA, vol. 89, no. 5, 1 March 1992 (1992-03-01), pages 1827 - 31, XP002941272, DOI: doi:10.1073/pnas.89.5.1827 |
| GEBHARD CLAUDIA ET AL: "Genome-wide profiling of CpG methylation identifies novel targets of aberrant hypermethylation in myeloid leukemia", CANCER RESEARCH, vol. 66, no. 12, June 2006 (2006-06-01), pages 6118 - 6128, XP002663139, ISSN: 0008-5472 * |
| GRANATA, F., BALESTRIERI, B., PETRAROLI, A., GIANNATTASIO, G., MARONE, G., TRIGGIANI, M.: "Secretory phospholipases A2 as multivalent mediators of inflammatory and allergic disorders", INT ARCH ALLERGY IMMUNOL, vol. 131, 2003, pages 153 |
| HAN, W.K., SAPIRSTEIN, A., HUNG, C.C., ALESSANDRINI, A., BONVENTRE, J.V.: "Cross-talk between cytosolic phospholipase A2a (cPLA2a) and secretory phospholipase A2 (sPLA2) in hydrogen peroxide-induced arachidonic acid release in murine mesangial cells. sPLA2 regulates cPLA2a activity that is responsible for arachidonic acid release", J BIOL CHEM, vol. 278, 2003, pages 24153 |
| HANASAKI K, ARITA H: "Phospholipase A2 receptor: a regulator of biological functions of secretory phospholipase A2", PROSTAGLANDINS OTHER LIPID MEDIAT., vol. 68-69, August 2002 (2002-08-01), pages 71 - 82, XP004380615, DOI: doi:10.1016/S0090-6980(02)00022-9 |
| HANASAKI K, YOKOTA Y, ISHIZAKI J, ITOH T, ARITA H: "Resistance to endotoxic shock in phospholipase A2 receptor-deficient mice", J BIOL CHEM., vol. 272, no. 52, 26 December 1997 (1997-12-26), pages 32792 - 7 |
| HANASAKI, K., ARITA, H.: "Phospholipase A2 receptor: a regulator of biological functions of secretory phospholipase A2", PROSTAGLANDINS OTHER LIPID MEDIAT, vol. 68-69, 2002, pages 71, XP004380615, DOI: doi:10.1016/S0090-6980(02)00022-9 |
| HANASAKI, K.: "Mammalian phospholipase A2: phospholipase A2 receptor", BIOL PHARM BULL, vol. 27, 2004, pages 1165 |
| HEMANDEZ, M., BURILLO, S.L., CRESPO, M.S., NIETO, M.L.: "Secretory phospholipase A2 activates the cascade of mitogen-activated protein kinases and cytosolic phospholipase A2 in the human astrocytoma cell line 1321N1", J BIOL CHEM, vol. 273, 1998, pages 606 |
| HORIGOME K, HAYAKAWA M, INOUE K, NOJIMA S: "Purification and characterization of phospholipase A2 released from rat platelets", J BIOCHEM (TOKYO, vol. 101, 1987, pages 625 - 631 |
| HUWILER, A., STAUDT, G., KRAMER, R.M, PFEILSCHIFTER, J.: "Cross-talk between secretory phospholipase A2 and cytosolic phospholipase A2 in rat renal mesangial cells", BIOCHIM BIOPHYS ACTA, vol. 1348, 1997, pages 257, XP027208848 |
| INADA M, TOJO H, KAWATA S, TARUI S, OKAMOTO M: "Preferential distribution of group-II-like phospholipase A2 in mononuclear phagocytic cells in rat spleen and liver", EUR J BIOCHEM., vol. 197, 1991, pages 323 - 329 |
| JAULMES, A., JANVIER, B., ANDREANI, M., RAYMONDJEAN, M.: "Autocrine and paracrine transcriptional regulation of type IIA secretory phospholipase A2 gene in vascular smooth muscle cells", ARTERIOSCLER THROMB VASC BIOL, vol. 25, 2005, pages 1161 |
| KANEMASA, T., HANASAKI, K., ARITA, H.: "Migration of vascular smooth muscle cells by phospholipase A2 via specific binding sites", BIOCHIM BIOPHYS ACTA, vol. 1125, 1992, pages 210, XP023366504, DOI: doi:10.1016/0005-2760(92)90047-Y |
| KRAMER RM, HESSION C, JOHANSEN B, HAYES G, MCGRAY P, CHOW EP, TIZARD R, PEPINSKY RB: "Structure and properties of a human non-pancreatic phospholipase A2", J BIOL CHEM., vol. 264, 1989, pages 5768 - 5775 |
| KUANG S-Q ET AL: "Genome-wide identification of aberrantly methylated promoter associated CpG islands in acute lymphocytic leukemia", LEUKEMIA (BASINGSTOKE), vol. 22, no. 8, August 2008 (2008-08-01), pages 1529 - 1538, XP002663178, ISSN: 0887-6924 * |
| KUDO I, MURAKAMI M: "Phospholipase A2 enzymes", PROSTAGLANDINS OTHER LIPID MEDIAT., vol. 68-69, 2002, pages 3 - 58 |
| KULIS M, ESTELLER M: "DNA methylation and cancer", ADV GENET., vol. 70, 2010, pages 27 - 56 |
| KUNDU, G.C., MUKHERJEE, A.B.: "Evidence that porcine pancreatic phospholipase A2 via its high affinity receptor stimulates extracellular matrix invasion by normal and cancer cells", J BIOL CHEM, vol. 272, 1997, pages 2346 |
| KUNZE H, BOHN E: "Phospholipase A2 and prostaglandins in human seminal plasma", ADV. PROSTAGLANDIN THROMBOXANE RES., vol. 3, 1978, pages 159 - 165 |
| LAMBEAU G, GELB MH: "Biochemistry and physiology ofmammalian secreted phospholipases A2", ANNU REV BIOCHEM., vol. 77, 2008, pages 495 - 520 |
| LAMBEAU G, LAZDUNSKI M: "Receptors for a growing family of secreted phospholipases A2", TRENDS PHARMACOL SEI., vol. 20, no. 4, April 1999 (1999-04-01), pages 162 - 70, XP004172557, DOI: doi:10.1016/S0165-6147(99)01300-0 |
| LAMBEAU G, SCHMID-ALLIANA A, LAZDUNSKI M, BARHANIN J: "Identification and purification of a very high affinity binding protein for toxic phospholipases A2 in skeletal muscle", J BIOL CHEM., vol. 265, no. 16, 5 June 1990 (1990-06-05), pages 9526 - 32 |
| LAPPAS M, RICE GE: "Phospholipase A2 isozymes in pregnancy and parturition", PROSTAGLANDINS LEUKOT ESSENT FATTY ACIDS, vol. 70, 2004, pages 87 - 100 |
| MENSCHIKOWSKI M ET AL: "HYPERMETHYLATION OF PHOSPHOLIPASE A2-RECEPTOR GENE AS A MOLECULAR BIOMARKER OF LEUKEMIA", CLINICAL CHEMISTRY AND LABORATORY MEDICINE, WALTER DE GRUYTER & CO, BERLIN, NEW YORK, vol. 49, no. Suppl. 1, 19 May 2011 (2011-05-19), pages S257, XP009153655, ISSN: 1434-6621 * |
| MENSCHIKOWSKI M, HAGELGANS A, KOSTKA H, EISENHOFER G, SIEGERT G: "Involvement ofepigenetic mechanisms in the regulation of secreted phospholipase A2 expressions in Jurkat leukemia cells", NEOPLASIA, vol. 10, no. 11, November 2008 (2008-11-01), pages 1195 - 203 |
| MENSCHIKOWSKI MARIO ET AL: "Involvement of epigenetic mechanisms in the regulation of secreted phospholipase A2 expressions in Jurkat leukemia cells.", NEOPLASIA (NEW YORK, N.Y.) NOV 2008 LNKD- PUBMED:18953428, vol. 10, no. 11, November 2008 (2008-11-01), pages 1195 - 1203, XP002663136, ISSN: 1476-5586 * |
| MOUNIER C, VARGAFTIG BB, FRANKEN PA, VERHEIJ HM, BON C, TOUQUI L: "Platelet secretory phospholipase A2 fails to induce rabbit platelet activation and to release arachidonic acid in contrast with venom phospholipases A2", BIOCHIM BIOPHYS ACTA, vol. 1214, 1994, pages 88 - 96, XP023366552, DOI: doi:10.1016/0005-2760(94)90013-2 |
| MURAKAMI M, KUDO I, SUWA Y, INOUE K: "Release of 14-kDa group-11 phospholipase A2 from activated mast cells and its possible involvement in the regulation of the degranulation process", EUR J BIOCHEM., vol. 209, 1992, pages 257 - 265 |
| MURAKAMI M, NAKATANI Y, ATSUMI G, INOUE K, KUDO I: "Regulatory functions of phospholipase A2", CRIT REV IMMUNOL., vol. 17, 1997, pages 225 - 283 |
| MURAKAMI M, SHIMBARA S, KAMBE T, KUWATA H, WINSTEAD MV, TISCHFIELD JA, KUDO I: "The functions of five distinct mammalian phospholipase A2s in regulating arachidonic acid release. Type IIa and type V secretory phospholipase A2s are functionally redundant and act in concert with cytosolic phospholipase A2", J BIOL CHEM., vol. 273, 1998, pages 14411 - 14423 |
| NEVALAINEN T, HAAPANEN T: "Distribution ofpancreatic (group I) and synovial-type (group II) phospholipase A2 in human tissue", INFLAMMATION, vol. 17, 1993, pages 453 - 464 |
| NEVALAINEN TJ, AHO HJ, PEURAVUORI H: "Secretion of group 2 phospholipase A2 by lacrimal gland", INVEST. OPHTHALMOL. VISC SEI, vol. 32, 1994, pages 417 - 421 |
| NEVALAINEN TJ, MERI K-M, NIEMI M: "Synovial type (group II) phospholipase A2 in human seminal plasma", ANDROLOGIA, vol. 25, 1993, pages 355 - 330 |
| NICOLAS, J.P., LAMBEAU, G., LAZDUNSKI, M.: "Identification of the binding domain for secretory phospholipases A2 on their M-type 180-kDa membrane receptor", J BIOL CHEM, vol. 270, 1995, pages 28869 |
| NICOLAS, J.P., LIN, Y., LAMBEAU, G., GHOMASHCHI, F., LAZDUNSKI, M., GELB, M.H.: "Localization of structural elements of bee venom phospholipase A2 involved in N-type receptor binding and neurotoxicity", J BIOL CHEM, vol. 272, 1997, pages 7173 |
| PARK, D.W., KIM, J.R., KIM, S.Y. ET AL.: "Akt as a mediator of secretory phospholipase A2 receptorinvolved inducible nitric oxide synthase expression", J IMMUNOL, vol. 170, 2003, pages 2093 |
| PERKEL: "DNA Methylation and Cancer", 14 April 2010 (2010-04-14), XP002663137, Retrieved from the Internet <URL:HTTP://WWW.BIOCOMPARE.COM/ARTICLES/EDITORIALARTICLE/1139/DNA-METHYLATION-AND-CANCER.HTML> [retrieved on 20111107] * |
| RIFFO M, PARRAGA M: "Lysophosphatidylcholine treatment allows interspecies fertilization of hamster oocytes with zona pellucida by human spermatozoa", J EXP ZOOL., vol. 271, 1995, pages 151 - 154 |
| SCHAFER ERIC ET AL: "Promoter hypermethylation in MLL-r infant acute lymphoblastic leukemia: biology and therapeutic targeting", BLOOD, AMERICAN SOCIETY OF HEMATOLOGY, US, vol. 115, no. 23, 10 June 2010 (2010-06-10), pages 4798 - 1809, XP008137233, ISSN: 0006-4971, [retrieved on 20100309], DOI: 10.1182/BLOOD-2009-09-243634 * |
| SEILHAMER JJ, PRUZANSKI W, VADAS P, PLANT S, MILLER JA, KLOSS J, JOHNSON LK: "Cloning and recombinant expression of phospholipase A2 present in rheumatoid arthritic synovial fluid", J BIOL CHEM., vol. 264, 1989, pages 5335 - 5338 |
| SENEGAS-BALAS F, BALAS D, VERGER R, DECARO A, FIGARELLA C, FERRATO F, LECHENE P, BERTRAND C, RIBET A: "Immunohistochemical localization of intestinal phospholipase A2 in rat Paneth cells", HISTOCHEMISTRY, vol. 81, 1984, pages 581 - 584 |
| SILLIMAN, C.C., MOORE, E.E., ZALLEN, G. ET AL.: "Presence of the M-type sPLA2 receptor on neutrophils and its role in elastase release and adhesion", AM J PHYSIOL CELL PHYSIOL, vol. 283, 2002, pages C1102 |
| TADA, K., MURAKAMI, M., KAMBE, T., KUDO, I: "Induction of cyclooxygenase-2 by secretory phospholipases A2 in nerve growth factor-stimulated rat serosal mast cells is facilitated by interaction with fibroblasts and mediated by a mechanism independent of their enzymatic functions", J IMMUNOL, vol. 161, 1998, pages 5008 |
| TAKAYAMA K, HARA S, KUDO I, INOUE K: "Detection of 14-kDa group II phospholipase A2 in human seminal plasma", BIOCHEM BIOPHYS RES COMMUN, vol. 178, 1991, pages 1505 - 1511, XP024770516, DOI: doi:10.1016/0006-291X(91)91064-J |
| TAYLOR PR, GORDON S, MARTINEZ-POMARES L: "The mannose receptor: linking homeostasis and immunity through sugar recognition", TRENDS IMMUNOL., vol. 26, no. 2, February 2005 (2005-02-01), pages 104 - 10, XP004724116, DOI: doi:10.1016/j.it.2004.12.001 |
| TRIGGIANI, M., GRANATA, F., BALESTRIERI, B. ET AL.: "Secretory phospholipases A2 activate selective functions in human eosinophils", J IMMUNOL, vol. 170, 2003, pages 3279, XP003014819 |
| TRIGGIANI, M., GRANATA, F., ORIENTE, A ET AL.: "Secretory phospholipases A2 induce cytokine release from blood and synovial fluid monocytes", EUR J IMMUNOL, vol. 32, 2002, pages 67 |
| TRIGGIANI, M., GRANATA, F., ORIENTE, A. ET AL.: "Secretory phospholipases A2 induce betaglucuronidase release and IL-6 production from human lung macrophages", J IMMUNOL, vol. 164, 2000, pages 4908 |
| VALENTIN E, GHOMASHCHI F, GELB MH, LAZDUNSKI M, LAMBEAU G: "On the diversity of secreted phospholipases A2. Cloning, tissue distribution, and functional expression of two novel mouse group II enzymes", J BIOL CHEM., vol. 274, 1999, pages 31195 - 31202, XP002197141, DOI: doi:10.1074/jbc.274.44.31195 |
| VALENTIN, E., LAMBEAU, G.: "Increasing molecular diversity of secreted phospholipases A2 and their receptors and binding proteins", BIOCHIM BIOPHYS ACTA, vol. 1488, 2000, pages 59, XP004277424, DOI: doi:10.1016/S1388-1981(00)00110-4 |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017114754A1 (de) | 2015-12-30 | 2017-07-06 | Technische Universität Dresden | Verfahren und mittel zur diagnostik von tumoren |
| US10689693B2 (en) | 2015-12-30 | 2020-06-23 | Technische Universität Dresden | Method and means for diagnosing tumors |
| DE102017214449A1 (de) | 2017-08-18 | 2019-02-21 | Technische Universität Dresden | Verfahren und Mittel zur Diagnostik von Tumoren durch Nachweis und Quantifizierung heterogen methylierter Epiallele |
| DE102017214449B4 (de) | 2017-08-18 | 2019-03-07 | Technische Universität Dresden | Verfahren und Mittel zur Diagnostik von Tumoren durch Nachweis und Quantifizierung heterogen methylierter Epiallele |
| DE102021127535B3 (de) | 2021-10-22 | 2023-03-09 | Technische Universität Dresden, Körperschaft des öffentlichen Rechts | Verfahren und Kit zur Diagnostik von Tumoren |
| WO2023067149A1 (en) | 2021-10-22 | 2023-04-27 | Technische Universität Dresden | Method and kit for diagnosing tumours |
Also Published As
| Publication number | Publication date |
|---|---|
| DE102010031354B3 (de) | 2012-02-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ziedalski et al. | Prospective analysis of cystic fibrosis transmembrane regulator mutations in adults with bronchiectasis or pulmonary nontuberculous mycobacterial infection | |
| US10718025B2 (en) | Methods for predicting age and identifying agents that induce or inhibit premature aging | |
| Dammann et al. | Increased DNA methylation of neuropsychiatric genes occurs in borderline personality disorder | |
| KR102464372B1 (ko) | Rnaset2를 통한 염증성 장 질환의 진단 방법 | |
| Landowski et al. | Novel deletion of RPL15 identified by array-comparative genomic hybridization in Diamond–Blackfan anemia | |
| US7939287B2 (en) | Methods of identifying a subject having or at risk of having or developing coronary artery disease | |
| Benezeder et al. | IL-36–driven pustulosis: Transcriptomic signatures match between generalized pustular psoriasis (GPP) and acute generalized exanthematous pustulosis (AGEP) | |
| Tanaka et al. | Relationship between DNA methylation in the 5′ CpG Island of the SLC47A1 (multidrug and toxin extrusion protein MATE1) gene and interindividual variability in MATE1 expression in the human liver | |
| Luo et al. | ARMC5 controls the degradation of most Pol II subunits, and ARMC5 mutation increases neural tube defect risks in mice and humans | |
| Kobayashi et al. | DNA methylation changes between relapse and remission of minimal change nephrotic syndrome | |
| JP2010535501A (ja) | チオプリン薬抵抗性およびチオプリン薬不耐性のリスクがある個体を同定する方法 | |
| Hong et al. | Mapping the immune-genetic architecture of aging: a single-cell causal framework for biomarker discovery and therapeutic targeting | |
| Živković et al. | The glutathione S-transferase T1 deletion is associated with susceptibility to multiple sclerosis | |
| DE102010031354B3 (de) | Mittel und Verfahren zur Diagnostik, Prognose und Therapiekontrolle von Tumorerkrankungen | |
| Chen et al. | AluYb8 insertion in the MUTYH gene is related to increased 8-OHdG in genomic DNA and could be a risk factor for type 2 diabetes in a Chinese population | |
| AU2011221239B2 (en) | Markers for obesity and methods of use thereof | |
| Xu et al. | Brain iron deposition and whole-exome sequencing of non-Wilson's disease hypoceruloplasminemia in a family | |
| US20140343145A1 (en) | RBP1 as a Molecular Biomarker for Predicting Survival and Response to Treatment in Glioma | |
| Genet et al. | Mutation detection in 65 families with a possible diagnosis of ornithine carbamoyltransferase deficiency including 14 novel mutations | |
| Beke et al. | Study of patterns of inheritance of premature ovarian failure syndrome carrying maternal and paternal premutations | |
| Gao et al. | Copy number deletion of PLA2G4A affects the susceptibility and clinical phenotypes of schizophrenia | |
| Verbenko et al. | FILAGGRIN LOSS-OF-FUNCTION MUTATIONS 2282DEL4, R501X, R2447X AND S3247X IN ATOPIC DERMATITIS | |
| US11753682B2 (en) | Noninvasive molecular controls | |
| Carević Milićević et al. | Sugars and their substitutes increase pathogenicity of Pseudomonas aeruginosa | |
| Sengul et al. | Association of the neuropeptide Y LEU7PRO rs16139 and NEUREXIN 3 rs760288 polymorphisms with alcohol dependence |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11735626 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 11735626 Country of ref document: EP Kind code of ref document: A1 |


