WO2012006244A1 - Method for producing phloroglucinol and dihydrophloroglucinol - Google Patents

Abstract

The invention provides cells and related methods for the biosynthetic production of phloroglucinol and its derivatives. The phloroglucinol can accumulate in the medium at increased concentrations without substantially inducing end product inhibition. For example, the phloroglucinol product can accumulate to a concentration above about 5 g/L in the medium without substantially inducing product inhibition. The invention includes recombinant cells that have resistance to phloroglucinol toxicity and that are transformed to biologically synthesize phloroglucinol. The invention also includes methods for selecting and transforming such cells. Furthermore, the invention includes recombinant cells having a phloroglucinol reductase that mitigates end product inhibition by the phloroglucinol and facilitates the accumulation of phloroglucinol and its derivatives.

Description

METHOD FOR PRODUCING PHLOROGLUCINOL AND DIHYDROPHLOROGLUCINOL

RELATED APPLICATIONS

[0001] This application claims priority to and the benefit of U.S. Provisional Application Number 61/361,799, filed July 6, 2010, the entire contents of which are hereby incorporated by reference.

FIELD OF THE INVENTION

[0002] The invention relates generally to the biological synthesis of phloroglucinol, as well as its derivatives and precursors. The invention relates, more particularly, to cells and related methods for the biosynthetic production of phloroglucinol from a renewable carbon source and where the phloroglucinol product can accumulate in the medium at increased concentrations without substantially inducing end product inhibition.

BACKGROUND

[0003] Phloroglucinol (1,3,5-trihydroxybenzene) and its derivatives are widely used in commerce. Phloroglucinol and its derivatives (e.g., trimethylphloroglucinol) are used as pharmaceutical agents (e.g., as antispasmodics). Phloroglucinol is used as a starting material or intermediate in pharmaceutical, microbicide, and other organic syntheses. Phloroglucinol is also used as a stain for microscopy samples that contain lignin (e.g., wood samples) and in the manufacture of dyes (e.g., leather, textile, and hair dyes). Phloroglucinol is used in the manufacture of adhesives, as an epoxy resin curing agent, and in the preparation of explosives (e.g., the thermally- and shock-stable high explosive, l,3,4-triamino-2,4,6- trinitrobenzene or TATB). Phloroglucinol also functions as an antioxidant, stabilizer, and corrosion resistance agent, and is utilized as a coupling agent for photosensitive duplicating paper, as a substitute for silver iodide in rain-making, as a bone sample decalcifying agent, and as a floral preservative. Phloroglucinol can also be converted to resorcinol by catalytic hydrogenation.

[0004] Resorcinol (1,3-dihydroxybenzene) is a particularly useful derivative of phloroglucinol, although resorcinol is not currently produced by that route. Like

phloroglucinol, resorcinol is used in the manufacture of dyes and adhesives, and as an epoxy resin curing agent. It is also used as a starting material and intermediate in pharmaceutical and other organic syntheses. Resorcinol and its derivatives are used, either alone or with other active ingredients such as sulfur, in cosmetics and in topical skin medicaments for treatment of conditions including acne, dandruff, eczema, and psoriasis (e.g., functioning, in part, as an antiseptic and antipruritic). Resorcinol is also used as a cross-linking agent for neoprene, as a tack-enhancing agent in rubber compositions, in bonding agents for organic polymers (e.g., melamine and rubber) and in the fabrication of fibrous and other composite materials. Resorcinol can be used in the manufacture of resins and resin adhesives (e.g., both as a monomer and as a UV absorbing agent), in the manufacture of explosives (e.g., energetic compounds such as styphnic acid, 2,4,6-trinitrobenzene-l,3-diol), and heavy metal styphnates, as well as in the synthesis of diazo dyes, plasticizers, hexyl resorcinol, and p- aminosalicylic acid.

[0005] Common resorcinol-based resins include resorcinol-aldehyde and resorcinol- phenol-aldehyde resins. These resorcinol-based resins are used, for example, as resin adhesives, composite material matrices, and as starting materials for rayon and nylon production. Examples of composite materials include resorcinol-formaldehyde carbon (or other organic) particle hydrogels, aerogels, and xerogels (e.g., which can be used as matrix materials for metallic and organometallic catalysts). Resorcinol-formaldehyde resins and particulate composites are also used in dentistry as a root canal filling material.

[0006] Resorcinol-aldehyde resin adhesives can be especially useful in applications requiring high bond strength (e.g., wooden trusses, joists, barrels, and boats, and aircraft). Modified resorcinol-aldehyde resin adhesives can also used as biological wound sealant compositions both on topical wounds and on internal wounds or surgical cuts (e.g., vascular incisions). Such medical uses are common in military field medicine (e.g., to minimize environmental exposure, reduce bleeding and fluid loss, and facilitate healing). Modified resin adhesives include gelatin-resorcinol-formaldehyde and gelatin-resorcinol- glutaraldehyde compositions. In such adhesives, the aldehyde can be maintained separately from the resorcinol-gelatin composition and mixed to form the sealant when needed.

[0007] Currently, both phloroglucinol and resorcinol are commercially produced by chemical organic synthesis using caustics and high temperatures, beginning with petroleum- derived starting materials and creating environmentally problematic waste and depleting fossil fuel and petroleum reserves.

SUMMARY

[0008] The invention provides cells and related methods for the biosynthetic production of phloroglucinol and its derivatives. The phloroglucinol product can accumulate in the medium at increased concentrations without substantially inducing end product inhibition. The phloroglucinol and its derivatives (e.g., dihyrophloroglucinol, any molecule or compound synthesized using the phloroglucinol) can be renewable (e.g., "green" or plant, as opposed to fossil-fuel or petroleum, based).

[0009] The invention includes recombinant cells that have resistance to phloroglucinol toxicity and that are transformed to produce phloroglucinol. For example, the phloroglucinol product can accumulate to a concentration above about 5 g/L in the medium without substantially inducing end product inhibition. The invention also include recombinant cells having a phloroglucinol reductase that helps convert phloroglucinol to dihydrophloroglucinol, thus mitigating end product inhibition by the phloroglucinol and facilitating the accumulation of phloroglucinol. Furthermore, the invention includes the vectors and other biological materials for producing such recombinant cells.

[0010] Likewise, the invention includes methods for selecting cells that have resistance to phloroglucinol toxicity, as well as methods for transforming such cells to produce

phloroglucinol and its derivatives. The invention also includes methods of using the recombinant cells to produce phloroglucinol and its derivatives.

[0011] Mitigating phloroglucinol toxicity in a fermentation culture can increase product yield (e.g., by allowing higher concentrations to accumulate in the fermentation broth) and facilitate the synthesis (e.g., by avoiding the cost and inconvenience of an extractive fermentation). The synthesis can be from a renewable carbon source (e.g., malonyl-CoA, glucose, and the like). The phloroglucinol and its derivatives can be used in subsequent reactions.

[0012] In one aspect, the invention features a method for producing anabolic

phloroglucinol. The method includes contacting a PhlD⁺ recombinant cell and malonyl-CoA in a medium, to produce an anabolic phloroglucinol product. The anabolic phloroglucinol product accumulates to a concentration above about 5 g/L in the medium without

substantially inducing product inhibition.

[0013] In another aspect, the invention features a recombinant cell having a recombinant phloroglucinol synthase gene that can produce a phloroglucinol synthase capable of converting malonyl-CoA to an anabolic phloroglucinol product. The recombinant cell can produce the anabolic phloroglucinol product at a concentration above about 5 g/L in the medium without substantially inducing product inhibition.

[0014] In still another aspect, the invention features a method for producing a

recombinant cell. The method includes selecting a cell resistant to phloroglucinol toxicity. The method also includes transforming the cell with a phloroglucinol synthase gene that can produce a phloroglucinol synthase capable of converting malonyl-CoA to an anabolic phloroglucinol product. The recombinant cell can produce the anabolic phloroglucinol product at a concentration above about 5 g/L in the medium without substantially inducing product inhibition.

[0015] In yet another aspect, the invention features a method for producing anabolic phloroglucinol. The method includes expressing a recombinant phloroglucinol synthase gene and a recombinant phloroglucinol reductase gene, to produce a phloroglucinol synthase and a phloroglucinol reductase. The method also includes contacting the phloroglucinol synthase and malonyl-CoA, to produce anabolic phloroglucinol. Furthermore, the method includes contacting the phloroglucinol reductase and the anabolic phloroglucinol, to produce dihydrophloroglucinol. The production of dihydrophloroglucinol mitigates product inhibition by the anabolic phloroglucinol and facilitates the accumulation of anabolic phloroglucinol and dihydrophloroglucinol to a concentration above about 5 g/L.

[0016] In another aspect, the invention features a recombinant cell having a recombinant phloroglucinol synthase gene that can produce a phloroglucinol synthase capable of converting malonyl-CoA to phloroglucinol. The recombinant cell also has a recombinant phloroglucinol reductase gene that can produce a phloroglucinol reductase capable of converting phloroglucinol to dihydrophloroglucinol. The conversion of phloroglucinol to dihydrophloroglucinol mitigates product inhibition by the phloroglucinol and facilitates the accumulation of phloroglucinol and dihydrophloroglucinol to a concentration above about 5 g/L.

[0017] In still another aspect, the invention features a method for producing a recombinant cell. The method includes transforming a cell with a recombinant

phloroglucinol synthase gene that can produce a phloroglucinol synthase capable of converting malonyl-CoA to phloroglucinol. The method also includes transforming the cell with a recombinant phloroglucinol reductase gene that can produce a phloroglucinol reductase capable of converting phloroglucinol to dihydrophloroglucinol. The conversion of phloroglucinol to dihydrophloroglucinol mitigates product inhibition by the phloroglucinol and facilitates the accumulation of phloroglucinol and dihydrophloroglucinol to a concentration above about 5 g/L.

[0018] In yet another aspect, the invention features an isolated or recombinant nucleic acid vector including a recombinant phloroglucinol synthase gene that can produce a phloroglucinol synthase capable of converting malonyl-CoA to phloroglucinol. The vector also includes a recombinant phloroglucinol reductase gene that can produce a phloroglucinol reductase capable of converting phloroglucinol to dihydrophloroglucinol.

[0019] In other embodiments, any of the aspects above, or any composition of matter or method described herein, can include one or more of the following features.

[0020] In various embodiments, the phloroglucinol product accumulates to a

concentration above about 10 g/L. In one embodiment, the phloroglucinol product can accumulate to a concentration above about 15 g/L. In one embodiment, the phloroglucinol product can accumulate to a concentration above about 20 g/L. In one embodiment, the phloroglucinol product can accumulate to a concentration above about 25 g/L. In one embodiment, the phloroglucinol product can accumulate to a concentration saturating the medium. In one embodiment, the phloroglucinol product can accumulate to a concentration above about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27 g/L.

[0021] In some embodiments, the cell does not substantially degrade the anabolic phloroglucinol product.

[0022] In certain embodiments, the cell is at least one of PhlA^", PhlB^", and PhlC^". The cell can be PhlA^", PhlB^", and PhlC^". The cell can include a malonyl-CoA synthesis enzyme.

[0023] In various embodiments, the method includes contacting the anabolic

phloroglucinol, hydrogen, and a rhodium catalyst, to produce resorcinol. In one embodiment, the method includes producing a medicament, cosmetic, dye, polymer resin, rubber, adhesive, sealant, coating, composite material, laminated material, or bonded material from the anabolic phloroglucinol or resorcinol derived from the anabolic phloroglucinol. In one embodiment, the method includes chemically modifying the anabolic phloroglucinol or resorcinol derived from the anabolic phloroglucinol, to produce a propellant or explosive.

[0024] In some embodiments, the cell includes a recombinant phloroglucinol synthase gene that can produce a phloroglucinol synthase capable of converting malonyl-CoA to an anabolic phloroglucinol product and the recombinant cell can produce the anabolic phloroglucinol product at a concentration above about 5 g/L in the medium without substantially inducing product inhibition.

[0025] In certain embodiments, the cell is a Candida, Debaryomyces , Kluyveromyces, or Saccharomyces cell. In one embodiment, the cell is a Candida krusei, Debaryomyces polymorphus, Kluyveromyces iactis, or Saccharomyces cerevisiae cell.

[0026] In various embodiments, the phloroglucinol reductase gene is derived from Eubacterium oxidoreducens. [0027] In some embodiments, the phloroglucinol reductase gene corresponds to: the nucleic acid sequence of phloroglucinol reductase from Eubacterium oxidoreducens is shown as SEQ ID NO. 3; the amino acid sequence of phloroglucinol reductase from Eubacterium oxidoreducens is shown as SEQ ID NO. 4; and sequences that are homologous to SEQ ID NO. 3 and SEQ ID NO. 4 and that correspond to a functioning phloroglucinol reductase.

[0028] Other aspects and advantages of the invention can become apparent from the following drawings and description, all of which illustrate principles of the invention, by way of example only.

BRIEF DESCRIPTION OF DRAWINGS

[0029] The advantages of the invention described above, together with further advantages, may be better understood by referring to the following description taken in conjunction with the accompanying drawings. The drawings are not necessarily to scale, emphasis instead generally being placed upon illustrating the principles of the invention.

[0030] FIG. 1 presents Scheme 1, which illustrates literature-reported routes: (a) for acetylphloroglucinol biosynthesis without phloroglucinol as an intermediate, see M. G. Bangera & L. S. Thomashow, J Bact. 181(10):3155-63 (1999); and (c) for triacetic acid lactone biosynthesis, see S. Eckermann et al., Nature 396:387 (1998), J. M. Jez et al., Chem. Bio. 7:919 (2000); W. Zha et al., J. Am. Chem. Soc. 126:4534 (2004). Also shown are the routes (b) and (b') for acetylphloroglucinol biosynthesis with phloroglucinol as an intermediate. The correct biosynthetic pathway was later elucidated in J. Achkar et al., J. Am. Chem. Soc. 127:5332 (2005).

[0031] FIG. 2 presents Scheme 2, which illustrates: the common commercial chemical synthetic route (a, b, c) for phloroglucinol synthesis; a multi-step route (d, e, f, g) previously proposed for synthesis of phloroglucinol from glucose; a first, common commercial chemical synthetic route (i, j) for resorcinol synthesis; and a second, common commercial chemical synthetic route (k, 1) for resorcinol synthesis. Also illustrated with circled arrows are: (1) the fully biosynthetic route (indicated by a circled asterisk) for production of phloroglucinol; and (2) the chemical hydrogenation (h) of phloroglucinol to resorcinol. Specific reactions or reaction steps shown are: (a) Na₂Cr0₇, H₂S0₄; (b) Fe, HC1; (c) H₂S0₄, 108° C; (d) see W. Zha et al., J. Am. Chem. Soc. 126:4534 (2004); (e) Dowex 50 H⁺, MeOH; (f) Na, MeOH, 185° C; (g) 12 N HC1; (h) i) H₂, Rh on A1₂0₃, ii) 0.5 M H₂S0₄, reflux; (i) S0₃, H₂S0₄; (j) NaOH, 350° C; (k) HZSM-12 zeolite, propene; and (1) i) 0₂, ii) H₂0₂, iii) H⁺. [0032] FIG. 3 presents putative reaction pathways, by which malonyl-CoA is

biosynthetically converted to phloroglucinol by a phloroglucinol synthase, either via enzyme- activated 3,5-diketopimelate (3,5-diketoheptanedioate) or via enzyme-activated 3,5- diketohexanoate (3 ,5-diketocaproate).

[0033] FIG. 4 illustrates a variety of exemplary pathways for utilization of different carbon sources in a process for anabolic phloroglucinol synthesis. Dashed arrows show possible alternative carbon source utilization routes; square brackets enclose intermediates that can be absent in some pathways.

[0034] FIG. 5 illustrates a cell capable of producing dihydrophloroglucinol.

[0035] FIG. 6 illustrates the progression of a fermentation culture producing

dihydrophloroglucinol.

[0036] FIG. 7 illustrates the 'H-NMR spectrum of a fermentation culture producing dihydrophloroglucinol.

[0037] FIG. 8 illustrates an example environmental isolate selection experiment.

[0038] FIG. 9 illustrates an example phloroglucinol degradation experiment.

[0039] Fig. 10A-B show the Pseudomonas fluorescens strain Pf-5 phlD nucleic acid SEQ

ID NO 1

[0040] Fig. 1 1A-B show the Pseudomonas fluorescens strain Pf-5 PhlD amino acid SEQ

ID NO 2.

[0041] Fig. 12A and B shows phloroglucinol reductase nucleotide sequence SEQ ID NO. 3 and the amino acid sequence SEQ ID NO: 4 from Eubacterium oxidoreducens .

DETAILED DESCRIPTION

[0042] The invention provides cells and related methods for the biosynthetic production of phloroglucinol and its derivatives. The phloroglucinol product can accumulate in the medium at increased concentrations without substantially inducing end product inhibition. The phloroglucinol and its derivatives (e.g., dihyrophloroglucinol, any molecule or compound synthesized using the phloroglucinol) can be renewable (e.g., "green" or plant, as opposed to fossil-fuel or petroleum, based).

[0043] The invention includes recombinant cells that have resistance to phloroglucinol toxicity and that are transformed to produce phloroglucinol. For example, the phloroglucinol product can accumulate to a concentration above about 5 g/L in the medium without substantially inducing end product inhibition. The invention also include recombinant cells having a phloroglucinol reductase that helps convert phloroglucinol to dihydrophloroglucinol, thus mitigating end product inhibition by the phloroglucinol and facilitating the accumulation of phloroglucinol. Furthermore, the invention includes the vectors and other biological materials for producing such recombinant cells.

[0044] Likewise, the invention includes methods for selecting cells that have resistance to phloroglucinol toxicity, as well as methods for transforming such cells to produce phloroglucinol and its derivatives. The invention also includes methods of using the recombinant cells to produce phloroglucinol and its derivatives.

[0045] Mitigating phloroglucinol toxicity in a fermentation culture can increase product yield (e.g., by allowing higher concentrations to accumulate in the fermentation broth) and facilitate the synthesis (e.g., by avoiding the cost and inconvenience of an extractive fermentation). The synthesis can be from a renewable carbon source (e.g., malonyl-CoA, glucose, and the like). The phloroglucinol and its derivatives can be used in subsequent reactions.

Sequence Homology

[0046] In various embodiments, the invention includes an isolated or recombinant nucleic acid sequence that is at least 80% homologous to SEQ ID NO. 3 and that encodes a functioning phloroglucinol reductase. For example, the sequence can be at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 92, 94, 95, 96, 97, 98, 99, or 100% homologous to SEQ ID NO. 3. In some embodiments, the sequence can be less than 80% homologous to SEQ ID NO. 3, provided that it encodes a functioning phloroglucinol reductase.

[0047] In various embodiments, the invention includes an isolated or recombinant amino acid sequence that is at least 50% homologous to SEQ ID NO. 4 and that encodes a functioning phloroglucinol reductase. For example, the sequence can be at least 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 92, 94, 95, 96, 97, 98, 99, or 100 % homologous to SEQ ID NO. 4. In some embodiments, the sequence can be less than 50% homologous to SEQ ID NO. 3, provided that it encodes a functioning phloroglucinol reductase.

[0048] Sequence homology can refer to the degree of identity between two sequences of amino acid residues, or between two sequences of nucleobases. Homology can be determined by visual comparison of two sequences, or by use of bioinformatic algorithms that align sequences for comparison or that determine percent homology among compared sequences. Automated algorithms are available, for example, in the GAP, BESTFIT, FASTA, and TFASTA computer software modules of the Wisconsin Genetics Software Package (available from Genetics Computer Group, Madison, Wis., USA). The alignment algorithms automated in these modules include the Needleman & Wunsch, the Pearson & Lipman, and the Smith & Waterman sequence alignment algorithms. Other useful algorithms for sequence alignment and homology determination are automated in software including: FASTP, BLAST, BLAST2, PSIBLAST, and CLUSTAL V. See, e.g., N. P. Brown et al., Bioinformatics: Applications Note, 1998, 14:380-81; the U.S. National Center for

Biotechnology Information at http://www.ncbi.nlm.nih.gov/Tools/index.html; and U.S. Pat. No. 6,790,639, Brown et al., issued Sep. 14, 2004, which provides software parameter settings useful for homology determination.

[0049] The sequence homology exhibited by nucleobase polymers, such as nucleic acids and nucleic acid analogs, can be determined by hybridization assays between a first sequence and the complement of a second sequence. Any of the well known hybridization assays can be used for this purpose, and examples of these include those described in U.S. Pat. No. 6,767,744, Koffas et al., issued Jul. 27, 2004, and U.S. Pat. No. 6,783,758, Wands et al., issued Aug. 31, 2004.

Conservative Substitutions

[0050] In addition, conservative amino acid substitutions can be found in a polypeptide according to the invention. The term conservative amino acid substitution can indicate any amino acid substitution for a given amino acid residue, where the substitute residue is so chemically similar to that of the given residue that no substantial decrease in polypeptide function (e.g., enzymatic activity) results. Conservative amino acid substitutions are well known (see, e.g., U.S. Pat. No. 6,790,639, Brown et al., issued Sep. 14, 2004; U.S. Pat. No. 6,774,107, Strittmatter et al., issued Aug. 10, 2004; U.S. Pat. No. 6, 194,167, Browse et al., issued Feb. 27, 2001 ; or U.S. Pat. No. 5,350,576, Payne et al, issued Sep. 27, 1994). In one embodiment, a conservative amino acid substitution can be any one that occurs within one of the following six groups:

1. Small aliphatic, substantially non-polar residues: Ala, Gly, Pro, Ser, and Thr;

2. Large aliphatic, non-polar residues: He, Leu, Met and Val;

3. Polar, negatively charged residues and their amides: Asp and Glu;

4. Amides of polar, negatively charged residues: Asn, His and Gin;

5. Polar, positively charged residues: Arg, His and Lys; and

6. Large aromatic residues: Trp, Phe and Tyr. [0051] In one embodiment, a conservative amino acid substitution can be any one of the following, which are listed as Native Residue (Conservative Substitutions) pairs: Ala (Ser); Arg (Lys); Asn (Gin; His); Asp (Glu); Gin (Asn); Glu (Asp); Gly (Pro); His (Asn; Gin); He (Leu; Val); Leu (He; Val); Lys (Arg; Gin; Glu); Met (Leu; He); Phe (Met; Leu; Tyr); Ser (Thr); Thr (Ser); Trp (Tyr); Tyr (Trp; Phe); and Val (He; Leu).

[0052] Just as a polypeptide can contain conservative amino acid substitution(s), a polynucleotide can contain conservative codon substitution(s). A codon substitution is considered conservative if, when expressed, it produces a conservative amino acid substitution. Degenerate codon substitution, which results in no amino acid substitution, are also possible. For example, a polynucleotide encoding a selected polypeptide can be mutated by degenerate codon substitution in order to approximate the codon usage frequency exhibited by an expression host cell, or to otherwise improve the expression.

Biosynthetic pathway of Phloroglucinol

[0053] As illustrated in FIG. 3, the mechanism by which phloroglucinol synthase catalyzes phloroglucinol synthesis proceeds according to the following series of steps, or via an alternative mechanism in which the first malonyl-CoA providing the group that is transferred to form the illustrated thioester (— SR) linkage, provides a malonyl, rather than an acetyl group:

1. Acetyl Activation— The first step involves activation of an acetyl group. This occurs by decarboxylation of malonyl-CoA to transfer an acetyl group to the enzyme, thus forming an enzyme-activated acetyl thioester (R in FIG. 3 represents the enzyme or a moiety attached thereto); in an alternative embodiment, the first step involves activation of an entire malonyl group to form an enzyme-activated malonyl thioester;

2. Chain Extension— The next phase involves two successive malonyl-CoA decarboxylations to transfer further acetyl groups to form an enzyme-activated 3- ketobutanoate thioester and then an enzyme-activated 3,5-diketohexanoate thioester; in an alternate embodiment, successive transfers form enzyme-activated: 3-ketoglutarate thioester and 3,5-diketopimelate thioester; and

3. Cyclization— The final step involves cyclization of the 3,5-diketohexanoate thioester intermediate to form phloroglucinol; in an alternative embodiment, a

decarboxylation of 3,5-diketopimelate takes place to permit cyclization to phloroglucinol. All three steps are catalyzed by phloroglucinol synthase. Biosynthesis of Phloroglucinol and Dihydrophloroglucinol

[0054] As discussed above, a biological system according to the invention can, in various embodiments, include at least one phloroglucinol synthase enzyme.

[0055] A biological system according to the invention can, in various embodiments, include at least one phloroglucinol reductase enzyme. Examples of such enzymes include all of the functioning phloroglucinol reductases corresponding to the nucleic acid sequence of phloroglucinol reductase from Eubacterium oxidoreducens is shown as SEQ ID NO. 3. Examples of such enzymes also include all of the functioning phloroglucinol reducatase corresponding to the amino acid sequence of phloroglucinol reductase from Eubacterium oxidoreducens is shown as SEQ ID NO. 4. These examples include sequences that are homologous to SEQ ID NO. 3 and SEQ ID NO. 4 and that correspond to a functioning phloroglucinol reductase.

[0056] In various embodiments (e.g., where the biological system is capable of producing phloroglucinol from a simple carbon source), the biological system can also include at least one phloroglucinol synthase. The phloroglucinol synthase can be obtained from a

Pseudomonad, for example, a member of the genus Pseudomonas such as a member of the species P. fluorescens (e.g., P. fluorescens Pf-5). The amino acid sequence of the P.

fluorescens Pf-5 phloroglucinol synthase is shown in SEQ ID NO. 2, and its native coding sequence is shown in SEQ ID NO. 1.

[0057] In one embodiment, an enzyme system can also include at least one enzyme capable, either solely or jointly with other enzyme(s), of catalyzing the formation of malonyl- CoA. Malonyl-CoA can be biosynthetically produced (e.g., from acetyl-CoA by a malonyl- CoA synthesis enzyme). Example include the malonyl-CoA synthetase (MatB) from

Rhizobium leguminosarum (see GenBank Accession AAC83455 [gi:3982573]), which converts malonate to malonyl-CoA; the malonyl-CoA decarboxylase (MatA) from Rhizobium leguminosarum (see GenBank Accession AAC83456 [gi:3982574]), which converts malonic semialdehyde to malonyl-CoA; and the transcarboxylase activity of acetyl-CoA carboxylase (EC 6.4.1.2), which carboxylates acetyl-CoA to form malonyl-CoA. The malonic acid, malonic semialdehyde, or acetyl-CoA starting material can be biosynthetic. For example, the acetyl-CoA can be biosynthetically derived from a biological source such as glucose, photosynthetic 3-phosphoglycerate, and the like.

[0058] A biological system according to the invention can be in vitro or in vivo. Where a malonyl-CoA synthesis enzyme is not provided, malonyl-CoA can be supplied to the medium in contact with the cells and/or enzymes. In one embodiment, a phloroglucinol synthase- encoding nucleic acid can be transformed into a cell of an organism capable of synthesizing malonyl CoA. Examples of organisms synthesizing malonyl CoA include plants, algae, animals, and humans. In vitro systems include batch enzyme suspensions, (adsorbed or covalently) immobilized enzyme bioreactors, and the like. In vivo systems include immobilized cell bioreactors, continuous fermentations, batch fermentations, and the like. Fermentation can indicate cultured cell growth under any effective conditions and is not limited to anaerobic conditions or anaerobic metabolism. A source of malonyl-CoA can be provided to the phloroglucinol synthase, whether or not that source is added (e.g., exogenous) malonyl-CoA or in situ biosynthesized (e.g., endogenous).

[0059] Recombinant cells according to the invention can express at least one

phloroglucinol synthase and, optionally, at least one malonyl-CoA synthesis enzyme.

However, the cells expressing a phloroglucinol synthase should not express an entire phlABCD operon or all three oiphlA, phlB, and phlC genes involved in the microbial acetylphloroglucinol pathway, e.g., phlABCDEF. In one embodiment, the recombinant cell can be a walled cell. Examples of walled cells include plant (including avascular plants such as moss), yeast, fungal, bacterial, and Archaea cells, as well as some protists (e.g., algae). In one embodiment, the recombinant cell can be a microbe (e.g., a bacterial cell, proteobacterial cell, and the like). The recombinant cell can lack the ability to express functional enzymes from phlABC, phlE, and phlF genes. The cell can be a phlABC, phlE, and phlF cell.

Recombinant host cells can contain at least one nucleic acid encoding a phloroglucinol synthase. The nucleic acid can be in the form of a vector, such as a plasmid or transposon.

[0060] In one embodiment, a cell that is both phlD⁺ as well as phlA⁺, phlB⁺, and/or phlC⁺, can be made phlA^~, phlB^', and/or phlC by any gene inactivation or knockout techniques generally known in the art (e.g., any gene excision or mutation technique that results in the cell's inability to make the functioning expression product encoded by the wild- type or pre-knocked-out gene). In one embodiment, all of the phlA, phlB, and phlC genes in the cell are inactivated or knocked out. The resulting cell can retain its phlD⁺ phenotype. Optionally, phlE and/or phlF genes present in the cell can also be knocked out. In one embodiment, a phlABCD⁺ cell can be made into a phlABC cell. In one embodiment, a cell that is both phlD^~ and phlA^', phlB^', and/or phlC can be made phlD⁺ by inserting an expressible PhlD-encoding nucleic acid into the cell (e.g., into the genomic DNA and/or as part of an extrachromosomal unit such as a plasmid). In one embodiment, a phlABCD^' cell can be made into a phlD⁺ cell. [0061] In some embodiments, a native or recombinant cell that is PhlD can be supplemented with one or more additional phlD genes (e.g., by transformation with nucleic acid comprising one or more expressible open reading frames encoding a phloroglucinol synthase). The PhlD cell can be a PhlA^", PhlB^", and/or PhlC^" cell (e.g., a phlA^', phlB^~, and/or phlC, or a phlABC cell), or it may be a PhlA⁺, PhlB⁺, and/or PhlC⁺ cell, such as a phlA⁺, phlB⁺, and/or phlC⁺ cell (e.g., a phlABCD⁺ cell). The resulting recombinant cell, which is capable of expressing the additional phlD gene(s), can exhibit enhanced phloroglucinol synthesis capability.

[0062] Similar to recombinant cells, isolated or recombinant enzyme systems according to the invention can include at least one phloroglucinol synthase and, optionally, at least one malonyl-CoA synthesis enzyme or enzyme set. In one embodiment, an enzyme systems including at least one phloroglucinol synthase does not also include all three of PhlA, PhlB, and PhlC enzymes. An enzyme systems including at least one phloroglucinol synthase can include none of PhlA, PhlB, and PhlC enzymes.

[0063] It is generally known that stepwise acetylation of phloroglucinol performed by PhlABC leads to monoacetylphloroglucinol (MAPG) and 2,4-DAPG, respectively. The level of produced DAPG is regulated mainly by degradation through the specific hydrolase PhlG, which converts DAPG into MAPG, and by the regulatory proteins PhlF and PhlH. PhlF represses the expression of the phlABCD operon by binding to two conserved sites in the phlA leader region. DAPG itself is able to dissociate the repressor PhlF from the phlA promotor, hence acting as an autoinducer of it own biosynthesis. PhlH, the second pathway- associated transcriptional regulator, is hypothesized to antagonize the repressive effect of PhlF. In addition, PhlE regulates the efflux of DAPG.

[0064] U.S. Publication No. 2007/0178571, now U.S. Patent No. 7,943,362, which is incorporated by reference, includes additional examples and background regarding phloroglucinol biosynthesis.

[0065] It should be understood that according to generally accepted gene/protein nomenclature guidelines, gene symbols are italicized, whereas protein designations are not italicized and the first letter is in upper case. "+" and "-" signs indicate the presence and absence, respectively, of a functional gene or protein. For example, "phlD" represents the phloroglucinol synthase gene, "PhlD" represents the phloroglucinol synthase protein, "p z/D⁺" indicates that the gene is present and functional, and "phlD^~" indicates that the gene is inactive or knocked out. Whole-Cell Fermentation Modes

[0066] Whole cell fermentations of recombinant cells can be performed in any culture mode, for example, in a batch, fed-batch, or continuous (or semi-continuous, e.g., reseeding) mode. However, phloroglucinol can exert toxicity against the cultured cells after it reaches as threshold concentration in a process called end-product inhibition. In some embodiments, phloroglucinol-containing spent medium can be processed to extract phloroglucinol (e.g., an extractive fermentation). Another approach to addressing phlorloglucinol toxicity to select cells for the fermentation culture that is resistant to phlorloglucinol toxicity. Unlike phloroglucinol, dihydrophloroglucinol exerts relatively little or no toxicity against the fermentation culture cells. Therefore, extractive fermentation (and the associated cost and inconvenience) is generally not necessary where fermentation culture cells are selected to for resistance to phloroglucinol toxicity (e.g., end product inhibition) or where

dihydrophloroglucinol (as opposed to phloroglucinol) is the accumulative product.

Whole-Cell Fermentation Conditions

[0067] Cultures of whole cells producing phloroglucinol (and its derivatives) can utilize conditions that are supportive of both cell growth and anabolic phloroglucinol production. In some methods, a phloroglucinol synthase can be expressed throughout the cell culture period (e.g., constitutively). In other methods, phloroglucinol synthase can be expressed only/predominantly near the end of the exponential growth phase (EGP). Where a later expression is desired, a phloroglucinol synthase coding sequence that is under the control of a regulated promoter generally can be activated or derepressed when about 70 to 100%, about 70 to 90%, or about 70 to 80% of EGP has elapsed. Examples of promoters useful for this purpose include the tac, T5, and T7 promoters (e.g., Pn). Induction can be made using lactose or a gratuitous inducer such as IPTG (isopropyl-beta-D-thiogalactopyranoside).

[0068] In some embodiments, a recombinant microbial cell, such as a recombinant yeast or bacterial host cell can be used as a whole cell biocatalyst. Host cells having resistance to phloroglucinol toxicity include a Candida (e.g., Candida krusei), Debaryomyces (e.g., Debaryomyces polymorphus), Kiuyveromyces (e.g., Kiuyveromyces lactis), and

Saccharomyces (e.g., Saccharomyces cerevisiae) cells. Additional host cells having resistance to phloroglucinol toxicity can be identified by the methods of the invention.

Bacterial host cells can include Proteobacteria (e.g., the gamma proteobacteria, such as enterobacteria and pseudomonads), Escherichia (e.g., E. coli), and Pseudomonas (e.g., P. fluorescens). Host cells can lack, or be treated to decrease or eliminate, protease activity that can degrade a phloroglucinol reductase, phloroglucinol synthase, and/or malonyl-CoA synthesis enzymes. In bacteria, Lon and OmpT are two such proteases that can be absent or otherwise decrease or eliminated (e.g., by mutation). E. coli strains BL21 and W3110 are examples of phlABCD⁺ cells for insertion of phlD gene(s). P. fluorescens strain Pf-5 is an example of a phlABCD⁺ cell for inactivation of phlA, phlB, and/or phlC, with or without insertion of further phlD gene(s), or for inactivation of phlABCD, with insertion of further phlD gene(s), or for supplementation with additional phlD gene(s). E. coli strain BL21 can be obtained as: BL21 STAR (DE3) ONE SHOT (Invitrogen Corp., Carlsbad, Calif, USA) or ULTRA BL21 (DE3) (Edge BioSystems, Gaithersburg, Md., USA). E. coli strain W3110 can be obtained as ATCC No. 27325 (American Type Culture Collection, Manassas, Va., USA). P. fluorescens strain Pf-5 can be obtained as ATCC No. BAA-477.

[0069] In the case of E. coli, fermentation temperatures can be from about 20 to about 37° C, about 25 to about 37° C, or about 30 to about 37° C. In anabolic phloroglucinol synthesis, a combination of a higher temperature during EGP or during the pre-induction portion of EGP, and a lower temperature during at least part of the remaining culture period (e.g., throughout all or part of the post-induction or all or part of the maintenance phase) can facilitate phloroglucinol production. Thus, recombinant E. coli cells can be grown at about 35-37° C, about 36-37° C, or about 36° C during EGP or during pre -induced EGP, and at about 30-34° C, about 30-33° C, about 33° C, or about 30° C during maintenance phase or during post-induction.

[0070] In some embodiments, the switch to a lower temperature can occur well into the maintenance phase (e.g., up to about 15 hours after EGP ends). Thus, in the case of a cell culture in which EGR ends at about 15 hours from the start of culturing (e.g., E. coli), the switch from a higher to a lower temperature for a two-temperature fermentation profile can occur at about 1 1 or about 12 hours (e.g., at approximately the same time as a 70% or 80% EGR induction point), or at about 15 hours, or even up to about 30 hours from the start of culturing. In the case of P. fluorescens, temperatures can be from about 20° C to about 30° C, with the higher temperatures being from about 27° C to about 30° C and the lower temperatures being from about 24 to about 27° C.

Carbon Sources

[0071] The biological systems and methods for producing phloroglucinol according to the invention can utilize a wide variety of carbon sources including carbohydrates (C6), celluloses (C5), and glycerides. For example, a carbon source can include one or more of glucose, xylose, arabinose, glycerol, a starch, a cellulose, a hemicellulose, and a plant oil.

[0072] In various embodiments, a carbon source can be a simple carbon source. Simple carbon sources can contain from 0% to about 5%, 0% to about 2%, 0% to about 1%, 0% to about 0.5%, or about 0% by weight secondary metabolites and larger or complex organics. In other example, simple carbon sources can be free or substantially free of secondary metabolites and larger/complex organics. In some embodiments, a simple carbon source can include primary metabolite -type compound(s). Examples of primary metabolite-type compounds include saccharides (e.g., mono- and/or di-saccharides) and polyols (e.g., glycerol). Useful monosaccharides include glucose, xylose, and arabinose. In one embodiment, glucose, xylose, and/or arabinose can be used as the carbon source (e.g., as the carbon source throughout both the exponential growth phase and the maintenance phase of the cell culture). In one embodiment a combination of a monosaccharides (e.g., glucose, xylose, and/or arabinose) and glycerol can be used (e.g., at a 1 : 1 or 2: 1 weight ratio). Such a combination can be used during the maintenance phase, with monosaccharides (without glycerol) being used during the exponential growth phase.

[0073] FIG. 4 illustrates a number of representative routes for anabolic synthesis of phloroglucinol from carbon sources (e.g., malonyl-CoA or a malonyl-CoA precursor).

Suitable carbon sources can include biomolecules that can be catabolized by the biological system as well as simpler organic molecules that can be fixed by the biological system (see FIG. 4 and U.S. Publication No. 2007/0178571).

Renewable Phloroglucinol

[0074] The biosynthesized phloroglucinol (and its derivatives) includes carbon from the atmospheric carbon dioxide incorporated by plants (e.g., from a carbon source such as glucose, malonyl-CoA, or malonyl-CoA precursor). Therefore, the biosynthesized phloroglucinol includes renewable carbon rather than fossil fuel-based or petroleum-based carbon. Accordingly, the biosynthetic phloroglucinol and associated products will have a less of an environmental impact than similar compositions produced by conventional methods because they do not deplete fossil fuel or petroleum reserves and because they do not increase the amount of carbon in the carbon cycle (e.g., increase greenhouse gases). Additionally, the biosynthetic phloroglucinol and associated products will have a less of an environmental impact because the biosynthesis does not require the toxic chemicals required by

conventional synthetic methods. [0075] The biosynthetic phloroglucinol can be distinguished from similar compounds produced from a fossil fuel or petrochemical carbon source by dual carbon-isotopic finger printing. This method can distinguish chemically-identical materials, and apportions carbon in the copolymer by source (and possibly year) of growth of the biospheric (plant) component using the information contained in the ¹⁴C and ¹³C isotope ratios. The radiocarbon dating isotope (¹⁴C), with its nuclear half life of 5730 years, allows one to apportion specimen carbon between fossil (dead) and biospheric (alive) feedstocks (See Currie, L. A. "Source Apportionment of Atmospheric Particles," Characterization of Environmental Particles, J. Buffle and H. P. van Leeuwen, Eds., 1 of Vol. I of the IUPAC Environmental Analytical Chemistry Series (Lewis Publishers, Inc) (1992) 3-74). The basic assumption in radiocarbon dating is that the constancy of ¹⁴C concentration in the atmosphere leads to the constancy of ¹⁴C in living organisms.

[0076] When dealing with an isolated sample, the age of a sample can be deduced approximately by the relationship t = (-5730/0.693)ln(A/A_o) where t = age, 5730 years is the half-life of radiocarbon, and A and A₀ are the specific ¹⁴C activity of the sample and of the modern standard, respectively (Hsieh, Y., Soil ScL Soc. Am J., 56, 460, (1992)). However, because of atmospheric nuclear testing since 1950 and the burning of fossil fuel since 1850, ¹⁴C has acquired a second, geochemical time characteristic. Its concentration in atmospheric CO₂, and hence in the living biosphere, approximately doubled at the peak of nuclear testing, in the mid-1960s. It has since been gradually returning to the steady-state cosmogenic (atmospheric) baseline isotope rate (¹⁴C/¹²C) of ca. 1.2 x 10^~12, with an approximate relaxation half-life of 7-10 years. (This latter half-life must not be taken literally; rather, one must use the detailed atmospheric nuclear input/decay function to trace the variation of atmospheric and biospheric ¹⁴C since the onset of the nuclear age.) It is this latter biospheric ¹⁴C time characteristic that holds out the promise of annual dating of recent biospheric carbon. ¹⁴C can be measured by accelerator mass spectrometry (AMS), with results given in units of fraction of modern carbon (ΪΜ). ΪΜ is defined by National Institute of Standards and Technology (NIST) Standard Reference Materials (SRMs) 4990B and 4990C, known as oxalic acids standards HOxI and HOxII, respectively. The fundamental definition relates to 0.95 times the ¹⁴C/¹²C isotope ratio HOxI (referenced to AD 1950). This is roughly equivalent to decay-corrected pre-lndustrial Revolution wood. For the current living biosphere (plant material), f_M « 1.1. [0077] The stable carbon isotope ratio ( CI C) provides a complementary route to source discrimination and apportionment. The ¹³C/¹²C ratio in a given biosourced material is a consequence of the ¹³C/¹²C ratio in atmospheric carbon dioxide at the time the carbon dioxide is fixed and also reflects the precise metabolic pathway. Regional variations also occur. Petroleum, C3 plants (the broadleaf), C₄ plants (the grasses), and marine carbonates all show significant differences in ¹³C/¹²C and the corresponding δ ¹³C values. Furthermore, lipid matter of C3 and C₄ plants analyze differently than materials derived from the carbohydrate components of the same plants as a consequence of the metabolic pathway. Within the precision of measurement, ¹³C shows large variations due to isotopic fractionation effects, the most significant of which for the instant invention is the photosynthetic mechanism. The major cause of differences in the carbon isotope ratio in plants is closely associated with differences in the pathway of photosynthetic carbon metabolism in the plants, particularly the reaction occurring during the primary carboxylation (e.g., the initial fixation of atmospheric CO2). Two large classes of vegetation are those that incorporate the C₃ (or Calvin-Benson) photosynthetic cycle and those that incorporate the C₄ (or Hatch-Slack) photosynthetic cycle. C₃ plants, such as hardwoods and conifers, are dominant in the temperate climate zones. In C₃ plants, the primary CO2 fixation or carboxylation reaction involves the enzyme ribulose- l,5-diphosphate carboxylase and the first stable product is a 3- carbon compound. C₄ plants, on the other hand, include such plants as tropical grasses, corn and sugar cane. In C₄ plants, an additional carboxylation reaction involving another enzyme, phosphoenol-pyruvate carboxylase, is the primary carboxylation reaction. The first stable carbon compound is a 4-carbon acid, which is subsequently decarboxylated. The C0₂ thus released is refixed by the C₃ cycle.

[0078] Both C₄ and C₃ plants exhibit a range of ¹³C/¹²C isotopic ratios, but typical values are ca. - 10 to - 14 per mil (C₄) and -21 to -26 per mil (C₃) (Weber et al., J. Aqric. Food Chem., 45, 2942 (1997)). Coal and petroleum fall generally in this latter range. The ¹³C

measurement scale was originally defined by a zero set by PeeDee belemnite (PDB) limestone, where values are given in parts per thousand deviations from this material. The 5¹³C values are in parts per thousand (per mil), abbreviated %₀, and are calculated as follows: 5¹³C≡ (¹³C/¹²C)sample - (¹³C/¹²C)standard / (¹³C/¹²C)standard x 1000%_o

Since the PDB reference material (RM) has been exhausted, a series of alternative RMs have been developed in cooperation with the IAEA, USGS, NIST, and other selected international isotope laboratories. Notations for the per mil deviations from PDB is 5¹³C. Measurements are made on CO₂ by high precision stable ratio mass spectrometry (IRMS) on molecular ions of masses 44, 45 and 46.

[0079] Therefore, the biosynthesized phloroglucinol and compositions including biosynthesized phloroglucinol can be distinguished from their fossil-fuel and petrochemical derived counterparts on the basis of ¹⁴C (ΪΜ) and dual carbon-isotopic fingerprinting, indicating new compositions of matter (e.g., U.S. Patent Nos. 7, 169,588, 7,531,593, and 6,428,767). The ability to distinguish these products is beneficial in tracking these materials in commerce. For example, products comprising both new and old carbon isotope profiles may be distinguished from products made only of old materials. Hence, the biosynthetic phloroglucinol and derivative materials can be followed in commerce on the basis of their unique profile.

EXAMPLES

Example 1 - Expression of PhlD in E. coli and Resulting Phloroglucinol Synthesis

[0080] Plasmid pJA3.131A (Kan^R, lacI^Q, P_T7-phlD, serA) is transfected into

chromosomally serA ^. coli strains BL21(DE3), W3110(DE3), and JWF1(DE3) [i.e., RB791serA^~(DE3)], and into strain KL3(DE3) [i.e., AB2834(serA::aroB)]. E. coli strains RB791 and AB2834 are available from the E. coli Genetic Stock Center, New Haven, Conn., USA. All DE3 strains are obtained by integration of λϋΕ3 prophage into the cell chromosomes. Cells are cultured in fed-batch conditions under mineral salts and limited glucose. Although all transformed strains express substantial levels of phloroglucinol, the BL21 and W3110 strains produce superior titers of 3.0 and 3.1 g/L phloroglucinol, respectively. Relative to the amounts of glucose supplied to the cultures, these strains produce a superior phloroglucinol yields of 4.4 and 3.1 moles phloroglucinol per 100 moles of glucose (% mol/mol).

[0081] These tests also compare phloroglucinol expression levels in BL21 strains similarly transformed with a plasmid in which phlD is under the control of Ptac or Ρχ5. Ρτ7 is found to provide superior results (data not shown). In these tests, phloroglucinol

accumulation for all strains stops increasing during the stationary (or maintenance) phase. Peak phloroglucinol concentration is achieved about 6 hours and about 12 hours after initiation of induction (i.e., the first IPTG addition) for BL21 and W31 10, respectively. End- product inhibition is observed. Further tests demonstrate that phloroglucinol is responsible for the inhibition when the concentration is at or above about 2 g/L (data not shown). Example 2 - Extractive Phloroglucinol Fermentation

[0082] An anion-exchange resin column-based extractive fermentation is employed to remove phloroglucinol during fermentation, which reduces/eliminates phloroglucinol cytotoxicity and phloroglucinol synthesis repression. A stirred tank reactor is equipped with tubing leading through an anion exchange column and returning to the tank. The tubing is equipped with a peristaltic pump in order to circulate the medium through the column. Bio- Rad Econo columns (25x200 mm) packed with 80 mL (bed volume) AG 1-X8 resin are rinsed with 15 bed volumes of KH₂PO₄ (0.8 M) to convert the tertiary ammonium salts to their phosphate form before the in situ extraction. A total of 3 to 5 columns are used for each fermentation. Each column is used for about 6-12 h before being replaced with another column, to keep the culture medium phloroglucinol concentration below about 1.5 g/L. All columns are operated in a fluidized-bed mode with a circulation flow rate of about 8-12 mL/min.

[0083] To recover the phloroglucinol adsorbed on the AG 1-X8 resin, the column is washed in a fluidized-bed mode with 10 bed volumes of distilled, deionized water to remove residual cells. The washing also recovers about 15% of the phloroglucinol from the resin. Then, the column is rinsed in a fixed-bed mode with 15 bed volumes of acidic ethanol (10% v/v acetic acid, 75% v/v ethanol, and 15% v/v H₂0), to recover remaining phloroglucinol from the resin. After phloroglucinol recovery, the column is regenerated by further rinses of 15 bed volumes of KH₂PO₄ (0.8 M), 2 bed volumes of ethanol (70%), and 5 bed volumes of sterilized distilled, deionized water.

[0084] To purify the recovered phloroglucinol, cells in the resulting water solution are removed by centrifugation. The solution is then concentrated to about 1/10 of the original volume, to produce a concentrated aqueous solution. Separately, the acidic ethanol solution is concentrated to dryness, to produce a residue that is redissolved with the concentrated aqueous solution. The resulting aqueous phase is then extracted three times with an equal volume of ethyl acetate. The organic phases are combined, dried over MgS0₄, mixed with silicone gel, concentrated to dryness, and loaded onto a flash column. Phloroglucinol is separated form other brown impurities by rinsing with 1 : 1 hexane:acetate. The

phloroglucinol fraction is identified by TLC and then concentrated to dryness and dried under high vacuum, to produce phloroglucinol as pale crystals. Example 3 - Optimization of Phloroglucinol Fermentation

[0085] A variety of dual temperature fermentation profiles are used in extractive and non- extractive fermentations of the transformed W3110 strain described above. Glucose is steadily fed by ρ(¾ cascade control and the exhausted CO₂ level is maintained at a steady level until the end of the fermentation. In both extractive and non-extractive of

fermentations, lowering the temperature during fermentation (e.g., from an initial 36° C) increase the titer and yield of phloroglucinol (with extractive the fermentation results being greater than the non-extractive fermentation results). Temperature shifts to 30° C are performed in separate fermentations at 12 h (e.g., the time of the first induction by IPTG), 15 h (e.g., the beginning of the maintenance phase), or 30 h. Superior results are obtained when the temperature shift occurs at 15 h and the extractive fermentation is permitted to proceed for a total of 60 h. Under these conditions, the W3110serA^"(DE3)/pJA3.131A synthesizes 15 g/L phloroglucinol in a yield of 11% (mol/mol). In comparison with the non-extractive fermentation, the extractive fermentation is found to provide undiminished phloroglucinol production throughout the fermentation, a steady PhlD specific activity, maintained cell viability, and longer maximum fermentation times.

[0086] An identical fermentation profile, with the same extractive fermentation conditions, is also used to test phloroglucinol production by the BL21serA^"(DE3)/pJA3.131A strain described above. Equivalent results to those of the W3110 fermentation are obtained. Another dual temperature profile, where in which the initial 36° C temperature is shifted at 15 h to 33° C, is found to increase recovery of phloroglucinol from BL21 yet further, giving a 17.3 g/L titer and a 12.3% (mol/mol) yield. In addition, expression of recombinant phlD in yeast (e.g., S. cerevisiae) is successful, although yields are from 0.5 to about 1.5 mg/L under test conditions (data not shown).

Example 4 - Cloning and Expression of Phloroglucinol Reductase

[0087] DNA encoding phloroglucinol reductase (pgr) was amplified from Eubacterium oxidoreducens G41 genomic DNA using

GGGAATTCCATATGATGGTGCCGTGTAACAAAGAG (SEQ ID NO: 5) and

CTGCAGTGCTCGAGTTTATCTCTCCTATCATTTTG (SEQ ID NO:6) as the primer pair. Plasmid pJJ10.043 was constructed by inserting the phloroglucinol reductase gene under a T7 promoter into Ndel and Xhol sites of pET22b vector.

[0088] E. coli BL21 (DE3) was transformed with plasmid pJJ10.043 and colonies were selected on LB/Amp plates. A single colony of the transformed cells was selected and used to inoculate a shakeflask of liquid LB/Amp medium which incubated at 37 °C overnight. The next day, a fresh LB/Amp liquid medium was inoculated from the overnight culture (1:200 dilution) and this new shakeflask was incubated at 37 °C. At the OD₆oo of 0.6, the culture was induced with 0.5 mM IPTG and heterologous expression of phloroglucinol reductase was performed for 4h at room temperature. A cell-free lysate of BL21(DE3)/pJJl 0.043 exhibited 100 μmol/min/mg specific activity of phloroglucinol reductase.

Example 5 - Preparation of a Dihydrophloroglucinol Producing Cell

[0089] Plasmid pKIT9.041 was digested with Ndel and Xhol restriction endonucleases and the remaining linearlized vector pACYCDuet-l-phlD*-serA was purified by agarose gel electrophoresis. Phloroglucinol reductase that was amplified from Eubacterium

oxidoreducens G41 genomic DNA and was cloned under a T7 promoter into Ndel and Xhol sites of pACYCDuet-l-phlD*-serA vector, which afforded the new pPhlD*-PGR plasmid. The E. coli host PG1 was transformed with the pPhlD*-PGR plasmid using standard electroporation protocol and colonies were selected on M9/Glucose plates.

Example 6 - Batch Fermentation of Dihydrophloroglucinol

[0090] E. coli PGl/pPhlD*-PGR was cultivated in a 2L fermentor under fed-batch, glucose-limited fermentor-controlled conditions at pH 7.0, dissolved oxygen level at 10% and initial temperature at 36 °C. Dissolved oxygen concentration was initially controlled by increasing the agitation from 50 to 1000 rpm. When the agitation reached the maximum level, DO was then controlled by increasing airflow from 0.06 to 1.0 slpm. At the end of the DO control cascade the initial glucose was depleted and culture was switched to glucose- limited conditions, where the dissolved oxygen level was controlled by adjusting glucose addition using the PID controller. The culture continued to grow under glucose-limited conditions until the cell density was between 40 and 50 OD₆oo- A temperature shift from 36 °C to 33 °C was then performed over a period of 30 minutes, after which

dihydrophloroglucinol synthesis was initiated at 33 °C by the addition of 3mL of 0.1 M IPTG.

Example 7 - Selecting a cell resistant to phloroglucinol toxicity

[0091] FIG. 8 illustrates an example environmental isolate experiment for selecting a cell resistant to phloroglucinol toxicity. [0092] Activated sludge was obtained from the East Lansing, MI sewage water treatment facility. A 100 μϊ_^ sample of activated sludge was inoculated into 10 mL of Medium A with 10 g/L of phloroglucinol ("PG") and Medium B with 10 g/L of PG and agitated for 3 days at 30 °C. Medium A and Medium B compositions are shown in Table 1. Actively growing culture was used as a seed culture (100 μΚ) to inoculate 10 mL of: Medium A with 10 g/L of PG; Medium A with 20 g/L of PG; Medium B with 10 g/L of PG; and Medium B with 20 g/L of PG, to produce a second generation culture that was agitated at 30 °C for 24 h. 100 of second generation culture was inoculated into 10 mL of original medium, to produce a third generation culture that was agitated at 30 °C for 24 h. Next, 100 μϊ_^ of third generation culture was inoculated in 10 mL of original medium, to produce a fourth generation culture that was agitated at 30 °C for 24 h. Next, fourth generation culture samples were streaked on solid medium plates with: Medium A with 10 g/L of PG; Medium A with 20 g/L of PG; Medium B with 10 g/L of PG; and Medium B with 20 g/L of PG, as shown in FIG. 8. The solid medium plates were incubated for 24-48 h at 30 °C, to produce fifth generation colonies. The fifth generation colonies were then restreaked on solid medium plates (each having the same composition as in the previous generation step) and incubated for 24-48 h at 30 °C, to produce sixth generation colonies.

[0093] Several colonies from sixth generation were replicated on a double set of solid medium plates (each having the same composition as in the previous generation step). The identity of the cells in each of these colonies was determined by an independent laboratory test (by Accugenix, Inc. of Newark, DE USA). The tests identified several different strains of Debaryomyces polymorphus and Candida krusei. Yeast identification was based on the sequencing of the D2 expansion segment of the large subunit rRNA gene. Other testing identified additional strains of Candida krusei, Kiuyveromyces lactis, and S. cervisiae that grow well at PG concentrations of at least about 20 g/L (data not shown).

[0094] The identified strains grow rapidly an vigorously in the presence of 10 g/L and 20 g/L of PG in liquid Medium A and Medium B (e.g., reaching OD600 > 1.0 in 18 h when agitated at 30 °C). Such growth is about the same as the growth without PG (e.g., the same strains reach OD600 > 1.0 in 18 h when agitated at 30 °C in Medium A and Medium B without PG). The same strains are also able to grow in the presence of 10 g/L of PG on solid Medium A and Medium B in 24 h at 30 °C to afford normal size round colonies (e.g., 2-4 mm in diameter). When the PG concentration in solid medium plates was increased to 20 g/L, the same strains required 48 h incubation at 30 °C in order to reach the same size colonies on Medium A and Medium B. Phloroglucinol solubility in water is 27 g/L at 35 °C in pH 7 aqueous solution buffered with inorganic phosphate (e.g., 43 mM). Therefore, these experiments demonstrate that identified strains are resistant to PG concentrations that are about equal to the phloroglucinol solubility limit.

Table 1. Minimal salt medium compositions.

[0095] FIG. 9 illustrates an experiment, which demonstrates that the strains' PG resistance is not due to PG biodegradation. FIG. 9A illustrates the experimental results in Medium A and FIG. 9B illustrates the experimental results in Medium B. The strain shown in FIG. 9 include JJ2a (Candida krusei), JJ2b (Candida krusei), JJ2c (Candida krusei), JJ2d (Candida krusei), JJla (Debaryomyces poiymorphus), and JJlb (Debaryomyces polymorphus).

[0096] The identified strains were inoculated from the solid medium into liquid Medium A and Medium B and agitated at 30 °C for 18 h. Actively growing cultures were used as a seed cultures to inoculate a 100 μΐ, into 10 mL of liquid Medium A and Medium B containing 10 g/L and 20 g/L of PG. Control experiments (cell-free incubation of Medium A and Medium B containing 10 g/L and 20 g/L of PG) were run in parallel. Samples were taken after 16, 24 and 44 h of agitation at 30 °C and analyzed by GC. The remaining phloroglucinol concentrations in the medium are shown in FIG. 9. PG concentration exhibited a slight downwards trend with strain JJlb cultivated in the presence of 10 g/L and 20 g/L of PG in Medium A over 44 h time period. However this trend was not observed when JJlb was cultivated in the presence of 10 g/L and 20 g/L of PG in Medium B over 44 h time period. All other strains exhibited no substantial PG biodegradation during the experiment (FIG. 9). Therefore, the PG resistance of the selected cells is not due to PG biodegradation.

[0097] The citation of references does not constitute an admission that any references are prior art or have any particular relevance to the patentability of the invention. All references cited in the Description section of this specification are hereby incorporated by reference in their entirety.

[0098] While the invention has been particularly shown and described with reference to specific embodiments, it should be understood by those skilled in the art that various changes in form and detail may be made without departing from the spirit and scope of the invention as defined by the appended claims.

Claims

CLAIMS What is claimed is:

1. A method for producing anabolic phloroglucinol comprising:

contacting a PhlD+ recombinant cell and malonyl-CoA in a medium, to produce an anabolic phloroglucinol product,

wherein the anabolic phloroglucinol product accumulates to a concentration above about 5 g/L in the medium without substantially inducing product inhibition.

2. The method of claim 1, wherein the phloroglucinol product accumulates to a concentration above about 10 g/L.

3. The method of claim 1, wherein the phloroglucinol product accumulates to a concentration above about 15 g/L.

4. The method of claim 1 , wherein the phloroglucinol product accumulates to a concentration above about 20 g/L.

5. The method of claim 1, wherein the phloroglucinol product accumulates to a concentration above about 25 g/L.

6. The method of claim 1 , wherein the phloroglucinol product accumulates to a concentration saturating the medium.

7. The method of claim 1, wherein the cell does not substantially degrade the anabolic phloroglucinol product.

8. The method of claim 1, wherein the cell is at least one of PhlA^", PhlB^", and PhlC^".

9. The method of claim 1, wherein the cell is PhlA^", PhlB^", and PhlC^".

10. The method of claim 1, wherein the cell comprises a malonyl-CoA synthesis enzyme.

1 1. The method of claim 1 , further comprising: contacting the anabolic phloroglucinol, hydrogen, and a rhodium catalyst, to produce resorcinol.

12. The method of claim 1, further comprising:

producing a medicament, cosmetic, dye, polymer resin, rubber, adhesive, sealant, coating, composite material, laminated material, or bonded material from the anabolic phloroglucinol or resorcinol derived from the anabolic phloroglucinol.

13. The method of claim 1, further comprising:

chemically modifying the anabolic phloroglucinol or resorcinol derived from the anabolic phloroglucinol, to produce a propellant or explosive.

14. A recombinant cell comprising:

a recombinant phloroglucinol synthase gene that can produce a phloroglucinol synthase capable of converting malonyl-CoA to an anabolic phloroglucinol product,

wherein the recombinant cell can produce the anabolic phloroglucinol product at a concentration above about 5 g/L in the medium without substantially inducing product inhibition.

15. The recombinant cell of claim 14, wherein the phloroglucinol product accumulate to a concentration above about 10 g/L.

16. The recombinant cell of claim 14, wherein the phloroglucinol product accumulate to a concentration above about 15 g/L.

17. The recombinant cell of claim 14, wherein the phloroglucinol product accumulate to a concentration above about 20 g/L.

18. The recombinant cell of claim 14, wherein the phloroglucinol product accumulate to a concentration above about 25 g/L.

19. The recombinant cell of claim 14, wherein the phloroglucinol product accumulates to a concentration saturating the medium.

20. The recombinant cell of claim 14, wherein the cell does not substantially degrade the anabolic phloroglucinol product.

21. The recombinant cell of claim 14, wherein the cell is at least one of PhlA^", PhlB^", and PMC^".

22. The recombinant cell of claim 14, wherein the cell is PhlA^", PhlB^", and PhlC^".

23. The recombinant cell of claim 14, wherein the cell comprises a malonyl-CoA synthesis enzyme.

24. The recombinant cell of claim 14, wherein the cell is a Candida, Debaryomyces, Kluyveromyces, or Saccharomyces cell.

25. The recombinant cell of claim 14, wherein the cell is a Candida krusei,

Debaryomyces poiymorphus, Kluyveromyces iactis, or Saccharomyces cerevisiae cell.

26. A method for producing a recombinant cell comprising:

selecting a cell resistant to phloroglucinol toxicity; and

transforming the cell with a phloroglucinol synthase gene that can produce a phloroglucinol synthase capable of converting malonyl-CoA to an anabolic phloroglucinol product,

wherein the recombinant cell can produce the anabolic phloroglucinol product at a concentration above about 5 g/L in the medium without substantially inducing product inhibition.

27. A method for producing anabolic phloroglucinol comprising:

expressing a recombinant phloroglucinol synthase gene and a recombinant phloroglucinol reductase gene, to produce a phloroglucinol synthase and a phloroglucinol reductase;

contacting the phloroglucinol synthase and malonyl-CoA, to produce anabolic phloroglucinol; and

contacting the phloroglucinol reductase and the anabolic phloroglucinol, to produce dihydrophloroglucinol; wherein the production of dihydrophloroglucinol mitigates product inhibition by the anabolic phloroglucinol and facilitates the accumulation of anabolic phloroglucinol and dihydrophloroglucinol to a concentration above about 5 g/L.

28. The method of claim 27, wherein the phloroglucinol reductase gene is derived from Eubacterium oxidoreducens .

29. A recombinant cell comprising:

a recombinant phloroglucinol synthase gene that can produce a phloroglucinol synthase capable of converting malonyl-CoA to phloroglucinol; and

a recombinant phloroglucinol reductase gene that can produce a phloroglucinol reductase capable of converting phloroglucinol to dihydrophloroglucinol,

wherein the conversion of phloroglucinol to dihydrophloroglucinol mitigates product inhibition by the phloroglucinol and facilitates the accumulation of phloroglucinol and dihydrophloroglucinol to a concentration above about 5 g/L.

30. The recombinant cell of claim 29, wherein the phloroglucinol reductase gene is derived from Eubacterium oxidoreducens.

31. A method for producing a recombinant cell comprising:

transforming a cell with a recombinant phloroglucinol synthase gene that can produce a phloroglucinol synthase capable of converting malonyl-CoA to phloroglucinol; and

transforming the cell with a recombinant phloroglucinol reductase gene that can produce a phloroglucinol reductase capable of converting phloroglucinol to

dihydrophloroglucinol,

wherein the conversion of phloroglucinol to dihydrophloroglucinol mitigates product inhibition by the phloroglucinol and facilitates the accumulation of phloroglucinol and dihydrophloroglucinol to a concentration above about 5 g/L.

32. An isolated or recombinant nucleic acid vector comprising:

a recombinant phloroglucinol synthase gene that can produce a phloroglucinol synthase capable of converting malonyl-CoA to phloroglucinol; and

a recombinant phloroglucinol reductase gene that can produce a phloroglucinol

reductasecapable of converting phloroglucinol to dihydrophloroglucinol.