WO2011150453A1

WO2011150453A1 - Diagnostic, prognostic and therapeutic use of a long non-coding rna

Info

Publication number: WO2011150453A1
Application number: PCT/AU2011/000657
Authority: WO
Inventors: John Stanley Mattick; Marcel Eduard Dinger; Marjan Effat Askarian-Amiri
Original assignee: The University Of Queensland
Priority date: 2010-06-01
Filing date: 2011-06-01
Publication date: 2011-12-08

Abstract

In alternative embodiments, this invention relates to the use of a long non-coding anti-sense RNA for the diagnosis, prognosis and therapy of cancer, including breast cancer. The invention also relates to the design and production of therapeutic agents that modulate ZFAS1 expression and/or activity. The therapeutic agents may be used to modulate abnormal cell proliferation and/or alleviate symptoms associated with the development and/or progression of cancer.

Description

TITLE

DIAGNOSTIC, PROGNOSTIC AND THERAPEUTIC USE OF

A LONG NON-CODING RNA FIELD OF THE INVENTION

THIS INVENTION relates to diagnosis, prognosis and therapy of cancer. More particularly, the present invention relates to the use of a long non-coding RNA in the diagnosis, prognosis and therapy of cancer, including breast cancer. BACKGROUND OF THE INVENTION

Recent high throughput studies of gene expression have revealed more genomic transcription than previously anticipated, with the majority of the genome being transcribed as non-protein coding RNAs (ncRNAs) (Amaral et al., 2008; Carninci et al., 2005; Kapranov et al., 2007b). Large-scale studies of long ncRNAs have shown that many are dynamically regulated during differentiation and exhibit cell and tissue specific patterns (Dinger et al., 2008a; Mercer et al, 2008). These observations support the idea that ncRNAs have a functional role in the cell, with a select group likely operating within a regulatory and/or structural paradigm.

Despite the exponential increase in the number of ncRNAs identified in recent years (Taft et al., 2009), the function of only a small number of these has been assigned (Amaral and Mattick, 2008). Interestingly, several ncRNAs have been shown to be involved in various cellular processes including transcriptional regulation (Feng et al., 2006), splicing (Yan et al., 2005), translation (Wang et al., 2005) and structure and organization of cellular components (Sunwoo et al., 2009). Given the tissue- and cell-specific and dynamically regulated expression (Dinger et al., 2008a; Mercer et al., 2008; Ravasi et al., 2006) of long ncRNAs, there may be other, yet to be described, ncRNAs involved in regulating cell function.

The mammary gland is one of the few organs that undergo cycles of proliferation and regression throughout adult life. Development of the mammary gland starts in the embryo, progresses after birth, and is completed at maturity. The full development of the gland proceeds in distinct phases: embryonic, pubertal, pregnancy, lactation, and involution (Hennighausen and Robinson, 2001). Mammary gland functional differentiation occurs with distinct morphological and molecular changes of the epithelial cells and allows for the production and secretion of milk. The secretory alveolar cells represent the final cellular state of the differentiation processes within the mammary gland (Hennighausen and Robinson, 1998). These differentiation steps taking place during pregnancy and lactation are defined and characterized by the sequential activation of genes encoding the milk proteins WDNM1, β-casein, whey acidic protein (WAP) in mouse, and ct-lactalbumin (Robinson et al, 1995).

SUMMARY OF THE INVENTION

The present invention has arisen after the inventors discovered a long non- coding anti-sense RNA (ZFASl; previously referred to as ZNFX1AS) that is involved in mammary gland development and significantly down regulated in breast cancer. In contrast, in other cancers, particularly of the adrenal gland, colon, liver, testis, and thyroid, ZFASl is significantly up regulated.

It is therefore proposed that ZFASl may be used as a diagnostic and prognostic marker for breast cancer, adrenal gland cancer, colon cancer, liver cancer, testis cancer, and thyroid cancer. It is also proposed that therapeutic agents that modulate ZFASl expression and/or activity may be designed and used to modulate abnormal cell proliferation and/or alleviate symptoms associated with the development and/or progression of cancer.

In preferred embodiments, ZFASl is referred to as any one of SEQ ID NOs: 1-5 as shown in Figure 9.

In a first aspect, the invention therefore provides a method of diagnosis of a cancer, or a predisposition thereto, in a mammal, said method including the step of determining a level and/or an activity of a ZFASl nucleic acid in a biological sample obtained or obtainable from said mammal, which level and/or activity is indicative of said cancer, or said predisposition thereto, in said mammal.

In one embodiment, said level and/or activity of said ZFASl nucleic acid in said biological sample is at least partly reduced compared to a corresponding level and/or activity of the ZFASl nucleic acid in a biological sample obtained or obtainable from a mammal that does not have said cancer, or said predisposition thereto.

Preferably, said cancer is a breast cancer.

In one particular form, said cancer is a mammary ductal carcinoma.

In another embodiment, said level and/or said activity of said ZFASl nucleic acid in said biological sample is at least partly increased compared to a corresponding level and/or activity of the ZFASl nucleic acid in a biological sample obtained or obtainable from a mammal that does not have said cancer, or said predisposition thereto.

Preferably, said cancer is an adrenal gland cancer, a colon cancer, a liver cancer, a testis cancer, or a thyroid cancer.

Typically, although not exclusively, said ZFASl nucleic acid is selected from the group of ZFASl nucleic acids consisting of a 685 bp nucleic acid, a 677 bp nucleic acid, a 529 bp nucleic acid, a 615 bp nucleic acid, and a 500 bp nucleic acid, a fragment thereof, or a nucleic acid comprising a nucleotide sequence having at least 70% identity thereto.

In one particular embodiment, an at least partly reduced level and/or activity of a ZFASl small nucleolar RNA (snoRNA) nucleic acid, is indicative of breast cancer, or said predisposition thereto, in said mammal.

In another particular embodiment, an at least partly increased level and/or activity of a ZFASl small nucleolar RNA (snoRNA) nucleic acid, is indicative of an adrenal gland cancer, a colon cancer, a liver cancer, a testis cancer, or a thyroid cancer, or said predisposition thereto, in said mammal.

Typically, according to this particular embodiment, said ZFASl snoRNA nucleic acid is a C/D box-containing homologous snoRNA nucleic acid selected from the group consisting of SNORD12, SNORD12B, and SNORD12C.

Suitably, according to this particular embodiment, said ZFASl snoRNA nucleic acid is selected from the group of ZFASl snoRNA nucleic acids consisting of a 90 bp nucleic acid, a 78 bp nucleic acid, and a 103 bp nucleic acid, although without limitation thereto. Preferably, according to this particular embodiment, said ZFAS1 snoRNA nucleic acids are referred to as SEQ ID NOs: 6-8 as shown in Figure 9.

In a second aspect, the invention provides a method of diagnosis of a cancer, or a predisposition thereto, in a mammal, said method including the steps of determining a level of a ZFAS1 nucleic acid and determining a level of a ZNFXl protein or a nucleic acid encoding a ZNFXl protein in a biological sample obtained or obtainable from said mammal, which levels are indicative of said cancer, or said predisposition thereto, in said mammal.

In one embodiment, a ratio of said levels of a ZFAS1 nucleic acid and of a ZNFXl protein or a nucleic acid encoding a ZNFXl protein in said biological sample is indicative of said cancer, or said predisposition thereto, in said mammal.

In one particular embodiment, said ratio can distinguish between cancer types.

Preferably, said cancer is a cancer relating to female reproductive tissues.

In one particular form, said cancer is cancer of the breast, cervix, endometrium, ovary, and/or uterus.

In another particular embodiment, said ratio can distinguish between cancer sub-types.

In yet another particular embodiment, said ratio can distinguish between the different stages of a cancer.

Preferably, said cancer is a breast cancer.

In one particular form, said cancer is a mammary ductal carcinoma.

In a third aspect, the invention provides a kit for cancer diagnosis, said kit comprising one or more probes, primers, antibodies and/or other reagents for detecting: (i) a ZFAS1 nucleic acid, or a fragment thereof; (ii) a ZFAS1 snoRNA nucleic acid, or a fragment thereof; (iii) a ZFAS1 modulator, or a fragment thereof; (iv); a ZNFXl nucleic acid, or a fragment thereof; and/or (v) a ZNFXl protein, or a fragment thereof.

In a fourth aspect, the invention provides a method of designing, engineering, screening for, or otherwise producing a cancer therapeutic agent, said method including the step of identifying a candidate agent which at least partly modulates the expression and/or activity of a ZFAS1 nucleic acid. Preferably, the candidate agent at least partly reduces cell proliferation.

Suitably, the candidate agent at least partly reduces tumour cell proliferation.

In one particular embodiment, the candidate agent mimics, reproduces or otherwise replicates the activities of said ZFASl nucleic acid.

The candidate agent may enhance, increase or otherwise up-regulate the expression and/or activity of said ZFASl nucleic acid.

Alternatively, the candidate agent may minimise, decrease or otherwise reduce the expression and/or activity of said ZFASl nucleic acid.

Suitably, according to this particular embodiment, the candidate agent is a synthetic ZFASl nucleic acid, a fragment thereof, or a nucleic acid comprising a nucleotide sequence having at least 70% identity thereto; or a nucleic acid construct comprising a ZFASl, a fragment thereof , or a nucleic acid comprising a nucleotide sequence having at least 70% identity thereto.

Suitably, according to this particular embodiment, the candidate agent is a modulator that at least partly induces, activates or otherwise stimulates a ZFASl enhancer and/or promoter.

Suitably, according to this particular embodiment, the candidate agent is alternatively a modulator that at least partly reduces, inactivates or otherwise inhibits a ZFASl enhancer and/or promoter.

In another particular embodiment, the candidate agent at least partly modulates the expression and/or activity of one or more C/D box-containing homologous ZFASl snoRNA nucleic acids selected from the group consisting of SNORD12, SNORD12B, and SNORD12C.

In a fifth aspect, the invention provides a cancer therapeutic agent designed, engineered, screened for, or otherwise produced according to the method of the fourth aspect for use in the treatment of a mammal that has a cancer or a predisposition thereto.

Preferably, said cancer is a breast cancer, an adrenal gland cancer, a colon cancer, a liver cancer, a testis cancer, or a thyroid cancer .

More preferably, said cancer is a breast cancer.

In one particular form, said cancer is a mammary ductal carcinoma. In one particular embodiment, said cancer therapeutic agent is a synthetic ZFASl nucleic acid, a fragment thereof , or a nucleic acid comprising a nucleotide sequence having at least 70% identity thereto; or a nucleic acid construct comprising a ZFASl nucleic acid, a fragment thereof , or a nucleic acid comprising a nucleotide sequence having at least 70% identity thereto.

In another particular embodiment, the cancer therapeutic agent is a modulator that induces, stimulates, or otherwise activates a ZFASl promoter and/or enhancer.

In yet another particular embodiment, the cancer therapeutic agent is a modulator that reduces, inhibits, or otherwise inactivates a ZFASl promoter and/or enhancer.

In still another particular embodiment, the cancer therapeutic agent at least partly modulates the expression and/or activity of one or more C/D box-containing homologous ZFASl snoRNA nucleic acids selected from the group consisting of SNORD12, SNORD12B, and SNORD12C.

In a sixth aspect, the invention provides a pharmaceutical composition comprising the cancer therapeutic agent of the fifth aspect and a pharmaceutically acceptable carrier, diluent or excipient.

In a seventh aspect, the invention provides a method of prophylactic and/or therapeutic treatment of a cancer in a mammal, said method including the step of delivering the cancer therapeutic agent of the fifth aspect, or the pharmaceutical composition of the sixth aspect to said mammal to thereby treat said mammal.

Preferably, the cancer therapeutic agent at least partly reduces cell proliferation.

More preferably, the cancer therapeutic agent at least partly reduces tumour cell proliferation.

In an eighth aspect, the invention provides a method of determining whether a mammal with cancer is responsive to a cancer therapy, said method including the steps of (i) isolating a biological sample from the mammal before and after said cancer therapy; and (ii) measuring a level and/or activity of a ZFASl nucleic acid in said biological sample, to thereby determine whether said mammal is responsive to said cancer therapy. Preferably, said cancer is a breast cancer, an adrenal gland cancer, a colon cancer, a liver cancer, a testis cancer, or a thyroid cancer.

More preferably, said cancer is a breast cancer.

In one particular form, said cancer is a mammary ductal carcinoma.

In one embodiment, an at least partly increased, elevated or otherwise higher level and/or activity of a ZFASl nucleic acid indicates that said mammal is at least partly responsive to breast cancer therapy.

In one particular embodiment, an at least partly increased, elevated or otherwise higher level and/or activity of a ZFASl snoR A nucleic acid indicates that said mammal is at least partly responsive to breast cancer therapy.

In another particular embodiment, an at least partly increased, elevated or otherwise higher level and/or activity of a ZFASl modulator indicates that said mammal is at least partly responsive to breast cancer therapy.

Suitably, according to this particular embodiment, said modulator induces, activates, or otherwise stimulates a ZFASl promoter and/or enhancer.

In another embodiment, an at least partly decreased, lessened or otherwise lower level and/or activity of a ZFASl nucleic acid indicates that said mammal is at least partly responsive to adrenal gland, colon, liver, testis, or thyroid cancer therapy.

In one particular embodiment, an at partly decreased, lessened or otherwise lower level and/or activity of a ZFASl snoRNA nucleic acid indicates that said mammal is at least partly responsive to adrenal gland, colon, liver, testis, or thyroid cancer therapy.

In another particular embodiment, an at least partly decreased, lessened or otherwise lower level and/or activity of a ZFASl modulator indicates that said mammal is at least partly responsive to adrenal gland, colon, liver, testis, or thyroid cancer therapy.

Suitably, according to this particular embodiment, said modulator reduces, inactivates or otherwise inhibits a ZFASl promoter and/or enhancer.

In a ninth aspect, the invention provides a method of modulating cell proliferation in one or more cells, said method including the step of introducing: (i) a synthetic ZFASl nucleic acid, a fragment thereof, or a nucleic acid comprising a nucleotide sequence having at least 70% identity thereto; (ii) a nucleic acid construct comprising a ZFAS1 nucleic acid, a fragment thereof, or a nucleic acid comprising a nucleotide sequence having at least 70% identity thereto; or (iii) a ZFAS1 inhibitor, to said one or more cells, to thereby modulate said cell proliferation.

' Preferably, the introduction of said synthetic ZFAS1 nucleic acid or said fragment thereof, or said nucleic acid construct, at least partly reduces, suppresses or otherwise lowers cell proliferation.

In one particular embodiment, said fragment is a ZFAS1 snoRNA nucleic acid, or a nucleic acid comprising a nucleotide sequence having at least 70% identity thereto.

Preferably, said one or more cells are tumour cells.

Preferably, the introduction of said ZFAS1 inhibitor induces, stimulates, or otherwise increases cell proliferation.

In one particular embodiment, the ZFAS1 inhibitor at least partly silences, knocks-down, blocks, inhibits, reduces, suppresses or otherwise lowers the expression and/or activity of ZFAS1,

In another particular embodiment, said method is performed in vitro.

Suitably, according to this particular embodiment, the one or more cells are a cell culture.

In a tenth aspect, the invention provides a method of diagnosis of a cancer, or a predisposition thereto, in a mammal, said method including the step of determining a level of a ZNFXl protein or a nucleic acid encoding a ZNFXl protein in a biological sample obtained or obtainable from said mammal, which level is indicative of said cancer, or said predisposition thereto, in said mammal.

In one embodiment, said level of said ZNFXl protein or a nucleic acid encoding a ZNFXl protein in said biological sample is at least partly reduced compared to a corresponding level of the ZNFXl protein or a nucleic acid encoding a ZNFXl protein in a biological sample obtained or obtainable from a mammal that does not have said cancer, or said predisposition thereto.

Preferably, said cancer is a testis cancer. In an eleventh aspect, the invention provides a method of determining whether a mammal with cancer is responsive to a cancer therapy, said method including the steps of (i) isolating a biological sample from the mammal before and after said cancer therapy; and (ii) measuring a level of a ZNFX1 protein or a nucleic acid encoding a ZNFX1 protein in said biological sample, to thereby determine whether said mammal is responsive to said cancer therapy.

Preferably, said cancer is a testis cancer.

In one embodiment, an at least partly increased, elevated or otherwise higher level of a ZNFX1 protein or a nucleic acid encoding a ZNFX1 protein indicates that said mammal is at least partly responsive to testis cancer therapy.

Preferably, according to the aforementioned aspects the mammal is a human.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1. Relationship and expression of Znfxl and its associated ncR Zfasl. (A) Genomic context of Znficl and its associated ncRNA. The enlarged Zfasl indicates the location of three snoRNA derived from this gene. The high degree of conservation of these regions across mammalian species is indicated. (B) Relative expression of Znficl (left) and Zfasl (right) in mammary epithelial cells during different developmental stages of mammary gland development to Tubulin delta 1 (Tubdl). Expression levels of three biological replicates for each stage were measured in triplicate by qPCR. (C) Relative expression profile of Znficl and Zfasl to Tubdl in different tissues by qPCR. Technical replicates were performed in triplicate for each sample. (D) Decay curve of Znficl and Zfasl in N2A cells. Transcription was blocked by treatment with actinomycin D and expression levels of three biological replicates were detected by qPCR. Error bars in B, C and E are the standard error of the mean (SEM). (E) Northern blot analysis of Znficl and Zfasl on RNA derived from total, cytoplasmic and nuclear fractions of HC11 cells. Arrows indicate size of transcript for each gene.

Figure 2. ISH mammary gland sections from pregnant mice. Panels illustrate mammary gland sections hybridized with no probe (top; negative control), Zfasl antisense probe (middle), and Zfasl sense probe (bottom; negative control). Images in dotted boxed areas increase in magnification from left to right. The arrows show ductal and alveolar structure and the expression of Zfasl within these structures. Scale bars in each panel are indicated. Figure 3. Effect of Zfasl knockdown by RNA interference. (A) The expression level, normalized to Tubdl, iZnfxl and Zfasl genes in HCl 1 cells transfected with Zfasl siR A relative to the respective expression of each gene in HC1 1 cells transfected with scrambled siRNA measured by qPCR 1-5 days after siRNA transfection. Technical replicates were performed in triplicate for each time point, with error bars indicating SEM. (B) Proliferation rates based on level of BrdU incorporation measured 48 hours after cells were transfected with Zfasl versus scrambled siRNA. Six technical replicates were performed with error bars indicating SEM. (C) MTT assay measuring the metabolic rate of HCl 1 cells transfected with Zfasl versus scrambled siRNA. Six technical replicates were performed with error bars indicating SEM. (D) Effect of Zfasl knockdown compared to the scrambled siRNA control on dome formation in differentiated HCl 1 cells measured on day 8. (E) Quantitative PCR, relative to Tubdl, of b-casein (Csn2) levels in differentiated (day 8) cells relative to undifferentiated (day 2) in HCl 1 cells transfected with Zfasl or scrambled siRNA. The results in D and E represent data from three experiments, each with three technical replicates, with error bars indicating the SEM of the three experiments.

Figure 4. Expression of snoRNAs that are intronic to Zfasl. (A) Relative expression (from left to right) of Snordl2, Snordl2b and Snordl2c to Snord68 during different mammary gland developmental stages. Expression levels of three biological replicates for each stage were measured in triplicate by qPCR. (B) Expression levels (from left to right) of Snordl 2, Snordl2b and Snordl 2c during HCl 1 cell differentiation relative to Snord68. Expression levels of two biological replicates for each stage were measured in triplicate by qPCR. Error bars in both (A) and (B) are SEM of the biological replicates. (C) Decay curve of Snordl 2, Snordl 2b and Snordllc in N2A cells. Transcription was blocked by treatment with actinomycin D and expression levels were detected in triplicate by qPCR. Errors are the standard error of the mean (SEM). (D) Northern blot analysis of Snordl2, Snordl2b and Snordl2c (see Figure 1 A for genomic positions) expression in total, cytoplasmic and nuclear RNA derived from undifferentiated HC1 1 cells. (E) Expression levels of Snordl2, Snordl2b and Snordl2c, normalized to Snord68, in undifferentiated (day 2) HC11 cells transfected with Zfasl siRNA relative to expression levels of each normalized gene in HC11 cells transfected with scrambled siRNA. Technical replicates were performed in triplicate, with error bars indicating SEM. Figure 5. Expression analysis of human ZFASl. (A) Genomic context of human ZNFXI and ZFASl. The 5' ends of ZNFXI and ZFASl are oriented head to head on opposite strands. The zoomed in regions shows five different ZFASl isoforms that are represented by ESTs. The positions of the intronically-defived snoRNAs; SNORD12, SNORD12B and SNORD12C, are also shown with the degree of conservation across mammalian species indicated. (B) Comparative expression levels (tpm) of ZNFXI and ZFASl based on RNA deep sequencing of human breast tissue and mammary epithelium. (C) Relative abundance of alternate isoforms of ZFASl in various human tissues and cell lines based on exon-exon junction spanning deep sequence tags. The number on top of each bar represents the number of informative tags. (D) Relative expression level of ZNFXI and ZFASl to GAPDH in the five paired normal and invasive ductal carcinoma (IDC) samples detected by qPCR with technical replicates performed in triplicate. Error bars indicate SEM of the biological replicates.

Figure 6. Expression of ZNFXI and ZFASl in normal breast and IDC tissue. (A) Relative expression level of ZNFXI and ZFASl to GAPDH m the three normal and four invasive ductal carcinoma (iDC) samples, respectively, detected by qPCR with technical replicates performed in triplicate. The error bars represent the SEM of the biological replicates. (B). ZNFXI (LHS) and ZFASl (RHS) expression in IDC relative to normal epithelial cells in each of the five paired samples detected by qPCR with technical replicates performed in triplicate. Error bars indicate SEM of the technical replicates.

Figure 7. Expression of ZNFXl and ZFASl in a panel of human tumours.

Expression of ZFASl and ZNFXl was examined in duplicate using a 381 tissue qPCR array from OriGene Technologies (Rockville, MD, USA). The total RNA on the array was derived from both normal and cancer-affected tissue as summarised in Table 4. Expression of ZFASl and ZNFXl for all tissues examined is shown in (A). Tissues that indicated differential expression of ZFASl are shown in (B-G). Expression of two different isoforms of ZFASl was measured using probes that traversed either exons 2 and 3 {ZFASl ex 2/3) or exons 4 and 5 {ZFASl ex 4/5). Error bars indicate S.E.M. between replicate arrays.

Figure 8. Ratio of ZFASl to ZNFXl in a panel of human tumours. The ratios of ZFASl :ZNFX1 were calculated from the expression data shown in Figure 7, for all tissues examined (A) or breast tissue (B). Figure 9. (A) Human ZFASl, and (B) human SNORD12, SNORD12B and SNORD12C sequences. The five different ZFASl sequences are referred to as SEQ ID NOs: 1-5. The three ZFASl snoRNA sequences, SNORD12, SNORD12B and SNORD12C, are referred to as SEQ ID NOs: 6-8 respectively.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT

The present invention has identified a genuine need for novel diagnostic and therapeutic targets that will assist in the early diagnosis and treatment of cancer and improve the prognosis for a majority of patients.

Throughout this specification, unless the context requires otherwise, the words "comprise", "comprises" and "comprising" will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. In one broad aspect, the present invention arises, at least in part, from the discovery of a long non-coding anti-sense RNA (ZFAS1) that is significantly down regulated in breast cancer. In contrast, in other cancers, particularly of the adrenal gland, colon, liver, testis, and thyroid, ZFAS1 is significantly up regulated. Thus, ZFAS1 modulates cell proliferation in a number of different tissues, and changes in the level and/or activity of ZFAS1 may lead to abnormal cell proliferation during the development and progression of cancer. Ratios of ZFAS1 levels to levels of a ZNFX1 nucleic acid or a ZNFX1 protein are also informative of certain cancers, including cancers relating to female reproductive tissues, such as cancer of the breast, cervix, endometrium, ovary, and/or uterus.

Accordingly, the present invention aims to provide novel diagnostic, therapeutic and prognostic methods directed to cancer, such as breast cancer, adrenal gland cancer, colon cancer, liver cancer, testis cancer, and thyroid cancer, wherein the therapeutic methods seek to reduce abnormal cell proliferation through direct modulation of ZFAS1, and/or modulation of a ZFAS1 modulator.

As used herein, the term "cancer" includes any malignancy listed by the US National Cancer Institute, which listing may be found at http://www.cancer.gov.

Preferred examples of cancers include breast cancer, adrenal gland cancer, colon cancer, liver cancer, testis cancer, and thyroid cancer.

More preferably, for diagnosis, therapy and prognosis relating to ZFAS1 , the cancer is of the breast.

By "breast cancer" is meant a malignant tumour of the breast tissue. Similarly, "adrenal gland cancer" refers to a malignant tumour of the adrenal gland tissue; "colon cancer" refers to a malignant tumour of the colon tissue; "liver cancer" refers to a malignant tumour of the liver tissue; "testis cancer" refers to a malignant tumour of the testis tissue; and "thyroid cancer" refers to a malignant tumour of the thyroid tissue.

One particular form of breast cancer is "mammary ductal carcinoma". A mammary ductal carcinoma can be an "invasive ductal carcinoma (IDC)" which is characterized by infiltrating, malignant and abnormal proliferation of neoplastic cells, or a "ductal carcinoma in situ (DCIS)" which is characterized as a non invasive, possibly malignant neoplasm.

By "abnormal cell proliferation" is meant cell proliferation that deviates from a normal, proper, or expected course. For example, abnormal cell proliferation may include inappropriate cell proliferation of cells whose DNA and/or other cellular components have been damaged and/or are defective. Abnormal cell proliferation may also include cell proliferation whose characteristics are associated with an indication caused by, mediated by, or resulting in inappropriately high levels of cell division, inappropriately low levels of apoptosis, or both. Such indications may be characterised, for example, by single or multiple local abnormal proliferations of cells, groups of cells, or tissue(s) whether cancerous or non-cancerous, benign or malignant.

For the purposes of this invention, the term "ZFAS1 nucleic acid^'' may hereafter be used interchangeably with the term "ZFAS1".

In preferred embodiments, ZFAS1 is referred to as any one of SEQ ID NOs:

1-5 as shown in Figure 9.

The term "nucleic acid^'' as used herein designates single- or double-stranded mRNA, R A, ncRNA, cRNA, RNAi and DNA inclusive of cDNA and genomic DNA. Nucleic acids may comprise naturally-occurring nucleotides or synthetic, modified or derivatized bases (e.g., inosine, methyinosine, pseudouridine, methylcytosine etc). Nucleic acids may also comprise chemical moieties coupled thereto to them. Examples of chemical moieties include, but are not limited to, biotin, locked nucleic acids (LNAs), peptide nucleic acids (PNAs), cholesterol, 2'O-methyl, Morpholino, and fluorophores such as HEX, FAM, Fluorescein and FITC.

It will be readily appreciated that the terms "modulation", "modulator" or

"modulating" include within their scope any interaction which activates, augments, increases, induces, interferes with, inhibits, blocks, hinders or otherwise alters either ZFAS1 expression and/or activity and/or a ZFAS1 regulatory element (e.g., an enhancer or a promoter). In certain embodiments, the modulator is an agonist. In other embodiments, the modulator is an activator. In yet other embodiments, the modulator is an antagonist. In further embodiments, the modulator is an inhibitor. Non-limiting examples of modulators may be found in US Patent 7, 683, 036.

It will be appreciated that the modulators (e.g., oligomeric compounds and compositions) disclosed therein may be suitable for modulating non-coding RNA molecules such as ZFAS1.

The term "promoter", as used herein, means a synthetic or naturally-derived molecule which is capable of conferring, activating, or enhancing expression of a nucleic acid in a cell. A promoter may comprise one or more specific regulatory sequences to further enhance expression of a nucleic acid (e.g. , ZFAS1). A promoter may also comprise distal enhancer or repressor elements, which can be located as much as several thousands of base pairs away from the start site of transcription. A promoter may regulate the expression of a nucleic acid in response to an inducing agent (e.g., a modulator).

Suitable promoters may be selected according to the cell or organism in which the nucleic acid is to be expressed. Promoters may be selected to facilitate constitutive, conditional, tissue-specific, inducible or repressible expression as is well understood in the art. Examples of promoters are T7, SP6, SV40, PolIII, U6, HI and

7SK, although without limitation thereto.

In one aspect, the invention provides a method of diagnosis of a cancer, or a predisposition thereto, in a mammal, said method including the step of determining a level and/or an activity of a ZFAS1 nucleic acid, in a biological sample obtained or obtainable from said mammal, which level and/or activity is indicative of a cancer, or a predisposition thereto, in said mammal.

The term "biological sample^'", as used herein, refers to a sample obtained, or obtainable, from a mammal (e.g. , a patient). Suitably, said biological sample includes cells, tissues, organs or organ biopsies, proteins, nucleic acids or other isolated biological material as appropriate for the particular diagnostic method.

A biological sample may be cell or tissue material from neoplastic lesion taken by aspiration or punctuation, excision or by any other surgical method leading to biopsy or resected cellular material. Such biological sample may comprise cells obtained from a patient. The cells may be found in a cell "smear" collected, for example, by a nipple aspiration, ductal lavage, fine needle biopsy or from provoked or spontaneous nipple discharge. In another embodiment, the sample is a body fluid. Such fluids include, for example, blood fluids, lymph, ascitic fluids, or urine but not limited to these fluids.

For the purposes of this invention, by "isolated" is meant present in an environment removed from a natural state or otherwise subjected to human manipulation. Isolated material may be substantially or essentially free from components that normally accompany it in its natural state, or may be manipulated so as to be in an artificial state together with components that normally accompany it in its natural state. The term "isolated'^'' also encompasses terms such as "enriched

"synthetic'^'' and/or "recombinan .

In some instances, the level and/or activity of said ZFAS1 nucleic acid in said biological sample is at least partly reduced compared to a corresponding level and/or activity of a ZFAS1 nucleic acid in a biological sample obtained or obtainable from a mammal that does not have said cancer, or said predisposition thereto.

Preferably, said cancer is a breast cancer.

In one particular form, said cancer is a mammary ductal carcinoma.

In other instances, the level and/or activity of said ZFAS1 nucleic acid in said biological sample is at least partly increased compared to a corresponding level and/or activity of a ZFAS1 nucleic acid in a biological sample obtained or obtainable from a mammal that does not have said cancer, or said predisposition thereto.

In some aspects, the invention relates to diagnosis of cancers and/or to determining or predicting the sensitivity or responsiveness of cancers to therapy. In particular embodiments, diagnostic methods described herein may be used in conjunction with treatment methods described herein to determine the suitability of a patient for a particular drug therapy.

Diagnostic methods of the invention are at least partly predicated on the discovery that (i) the down-regulation, suppression, or reduction of a ZFAS1 nucleic acid in a biological sample obtained or obtainable from a mammal {e.g. , a human) is associated, linked, or otherwise correlated with the development and progression of certain cancers, particularly breast cancer, or a predisposition thereto, and (ii) the up- regulation, expression, or increase of a ZFAS1 nucleic acid in a biological sample obtained or obtainable from a mammal (e.g. , a human) is associated, linked, or otherwise correlated with the development and progression of other cancers, particularly adrenal gland cancer, colon cancer, liver cancer, testis cancer, and thyroid cancer, or a predisposition thereto.

Accordingly, methods of the invention may be useful in determining whether or not a mammal suffers from cancer and/or is genetically predisposed to cancer.

By "predisposed^{^} is meant having a higher probability, risk or susceptibility than normal for contracting or suffering from a cancer. Normal probability or risk may be assessed with reference to non-affected individuals, cohorts or populations of individuals as is well understood in the art.

Preferably, said ZFAS1 nucleic acid is located in an anti-sense orientation to a ZNFX1 nucleic acid of a genomic DNA sequence.

Typically, the ZFAS1 nucleic acid is selected from the group of ZFAS1 nucleic acids consisting of a 685 bp nucleic acid, a 677 bp nucleic acid, a 529 bp nucleic acid, a 615 bp nucleic acid, and a 500 bp nucleic acid, although without limitation thereto.

A skilled addressee will appreciate that these ZFAS1 nucleic acids may also be referred to herein as ZFAS1 "splice variants^''^'' and/or ZFAS1 "isoforms'^'' that have been produced through alternative splicing of the ZFAS1 gene. The present invention may also be suitable for one or more other ZFAS1 nucleic acids, isoforms, or splice variants.

In some embodiments, the level and/or activity of a particular ZFAS1 nucleic acid, isoform or splice variant (e.g. , the 685 bp ZFAS1 nucleic acid) may be indicative of a particular form of cancer. This may help a practitioner and/or a clinician distinguish between different types of cancers and provide a more accurate diagnosis and/or a more suitable treatment regime.

Typically, ZFAS1 does not encode a peptide or a protein encoded by a genome. Accordingly, said ZFAS1 nucleic acid is referred to herein as "non-coding" . In one particular embodiment, an absence or an at least partly reduced level and/or activity of a ZFASl snoRNA nucleic acid is indicative of said cancer {e.g., breast cancer), or said predisposition thereto, in said mammal. In another particular embodiment, a presence or an at least partly increased level and/or activity of a ZFASl snoRNA nucleic acid is indicative of said cancer {e.g. , adrenal gland cancer, colon cancer, liver cancer, testis cancer, or thyroid cancer), or said predisposition thereto, in said mammal. Suitably, said ZFASl snoRNA is located in a ZFASl intron.

Typically, according to this particular embodiment, said ZFASl snoRNA nucleic acid is a C/D box-containing homologous snoRNA selected from the group consisting of SNORD12, SNORD12B, and SNORD12C.

Suitably, according to this particular embodiment, said ZFASl snoRNA nucleic acid is selected from the group of ZFASl snoRNA nucleic acids consisting of a 90 bp nucleic acid, a 78 bp nucleic acid, and a 103 bp nucleic acid, although without limitation thereto.

Preferably, according to this particular embodiment, said ZFASl snoRNA nucleic acids are referred to as SEQ ID NOs: 6-8 as shown in Figure 9.

It will be appreciated that said snoRNA may be involved in regulatory activities selected from the group consisting of RNA methylation, ribosomal RNA (rRNA) modification and pre-mRNA splicing.

In additional embodiments of this aspect of the invention, diagnosis of a cancer, or a predisposition thereto, in a mammal, further includes the step of determining a level of a ZNFXl protein in a biological sample obtained or obtainable from said mammal, which level is indicative of a cancer, or a predisposition thereto, in said mammal.

This embodiment of the invention is at least partly predicated on the discovery that the ratio of the levels of a ZFASl nucleic acid and of a ZNFXl protein in a biological sample is indicative of a cancer, or a predisposition thereto, in a mammal. The ZFASl :ZNFX1 ratio can be used to distinguish between cancer types and particular cancer subtypes. Because different cancers show different ratios, this ratio can be used to detect the origin of cancer metastases. For example, in the case of cancer relapse following treatment, where the cancer occurs in a different tissue, its ZFAS1 :ZNFX1 ratio can be used to indicate whether or not the cancer represents a new malignancy or a metastase of the original cancer. This information can then be used to guide therapy of the cancer.

Preferably, said cancer is a cancer relating to female reproductive tissues. In one particular form, said cancer is cancer of the breast, cervix, endometrium, ovary, and/or uterus.

Typically, although not exclusively, said ZFAS1 nucleic acid is selected from the group of ZFAS1 nucleic acids consisting of a 685 bp nucleic acid, a 677 bp nucleic acid, a 529 bp nucleic acid, a 615 bp nucleic acid, and a 500 bp nucleic acid, a fragment thereof, or a nucleic acid comprising a nucleotide sequence having at least 70% identity thereto.

Although the murine Znfxl protein has not been rigourously studied, its predicted sequence contains an NFX-1 (nuclear transcription factor X-box binding) zinc finger domain. Despite the low homology between the NFX- 1 binding domain and the corresponding region in Znfxl, (26% identity; 36% similarity over a 327 amino acids region), the critical cysteine residues that characterize the domain (Song et al. , 1994) are highly conserved (36/40; 90%), suggesting that Znfxl may also bind DNA. Human ZNFX1 (or NFX 1 -type containing protein) is a zinc finger containing protein that is thought to bind DNA in the human nuclear transcriptional repressor NF-Xl . It comprises 1918 amino acids. While its function is currently unknown, it is postulated to be involved in DNA repair.

The invention also provides kits for cancer diagnosis. Suitably, the kits comprise one or more probes, primers, antibodies and/or other reagents that detect: (i) a ZFAS1 nucleic acid, or a fragment thereof; (ii) a ZFAS1 snoRNA nucleic acid, or a fragment thereof; (iii) a ZFAS1 modulator, or a fragment thereof; (iv); a ZNFX1 nucleic acid, or a fragment thereof; and/or (v) a ZNFX1 protein, or a fragment thereof.

In this context, by "fragment" is meant a region, portion, sub-sequence or segment of a ZFAS1, of a ZFAS1 snoRNA, and/or of a modulator, and or of a ZNFX1 nucleic acid/protein. In particular non-limiting embodiments, the fragment may comprise at least about 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or up to at least about 95% of (i) the ZFAS1 nucleic acid, (ii) the snoRNA nucleic acid, (iii) the modulator, or (iv) the ZNFX1 nucleic acid/protein.

Accordingly, the fragment may comprise about 20 contiguous nucleotides, about 60, about 100, about 140, about 180, about 220, about 260, about 300, about 340, about 380, about 420, about 460, about 500, about 560, and up to about 600 contiguous nucleotides of (i) the ZFAS1 nucleic acid, (ii) the ZFAS1 snoRNA nucleic acid, (iii) the modulator, or (iv) the ZNFX1 nucleic acid. A ZNFX1 protein fragment may comprise about 15 contiguous amino acids, about 16, about 18, about 20, about 25, about 30, about 40, about 50, and up to about 100 contiguous amino acids of the ZNFX1 protein.

Diagnostic methods may be protein-based or nucleic acid-based.

Nucleic acid-based detection is well known in the art and may utilize one or more techniques including nucleic acid sequence amplification, probe hybridization, mass spectrometry, nucleic acid arrays and nucleotide sequencing, although without limitation thereto.

In one embodiment, the invention contemplates nucleic acid sequence amplification and subsequent detection of one or more amplification products.

Nucleic acid amplification techniques are well known to the skilled addressee, and include polymerase chain reaction (PCR) and ligase chain reaction (LCR) as for example described in Chapter 15 of Ausubel et al. CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (John Wiley & Sons NY, 1995- 1999); quantitative PCR (qPCR); reverse transcription qPCR; strand displacement amplification (SDA) as for example described in US Patent 5,422,252; rolling circle replication (RCR) as for example described in Liu et al., 1996, J. Am. Chem. Soc. 118 1587 and International application WO 92/01813 and by Lizardi et al., in International Application WO 97/19193; nucleic acid sequence-based amplification (NASBA) as for example described by Sooknanan et al., 1994, Biotechniques 17 1077; Q-β replicase amplification as for example described by Tyagi et al., 1996, Proc. Natl. Acad. Sci. USA 93 5395 and helicase-dependent amplification as described in International Publication WO2004/02025.

The abovementioned are examples of nucleic acid sequence amplification techniques but are not presented as an exhaustive list of techniques. Persons skilled in the art will be well aware of a variety of other applicable techniques as well as variations and modifications to the techniques described herein.

For example, the invention contemplates use of particular techniques that facilitate quantification of nucleic acid sequence amplification products such as by "Competitive PCR", or techniques such as "Real-Time^'" PCR amplification.

As used herein, an "amplification product" is a nucleic acid generated by a nucleic acid sequence amplification technique as hereinbefore described.

Detection of amplification products may be achieved by detection of a probe hybridized to an amplification product, by direct visualization of amplification products by way of agarose gel electrophoresis, nucleotide sequencing of amplification products or by detection of fluorescently-labelled amplification products.

As used herein, a "probe" is a single- or double-stranded oligonucleotide or polynucleotide, one and/or the other strand of which is capable of hybridizing to another nucleic acid, to thereby form a "hybrid^{^} nucleic acid.

Probes and/or primers of the invention may be labelled, for example, with biotin or digoxigenin, with fluorochromes or donor fluorophores such as FITC, TRITC, Texas Red, TET, FAM6, HEX, ROX or Oregon Green, acceptor fluorophores such as LC-Red640, enzymes such as horseradish peroxidase (HRP) or alkaline phosphatase (AP) or with radionuclides such as I, P, P or S to assist detection of amplification products by techniques as are well known in the art.

As used herein, "hybridization", "hybridize" and "hybridizing" refers to formation of a hybrid nucleic acid through base-pairing between complementary or at least partially complementary nucleotide sequences under defined conditions, as is well known in the art. Normal base-pairing occurs through formation of hydrogen bonds between complementary A and T or U bases, and between G and C bases. It will also be appreciated that base-pairing may occur between various derivatives of purines (G and A) and pyrimidines (C, T and U). Purine derivatives include inosine, methylinosine and methyladenosines. Pyrimidine derivatives include sulfur- containing pyrimidines such as thiouridine and methylated pyrimidines such as methylcytosine. For a detailed discussion of the factors that generally affect nucleic acid hybridization, the skilled addressee is directed to Chapter 2 of CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, supra.

More specifically, the terms "anneaF and "annealing" are used in the context of primer hybridization to a nucleic acid template for a subsequent primer extension reaction, such as occurs during nucleic acid sequence amplification or nucleotide sequencing, as for example described in Chapter 15 of CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, supra.

In another embodiment, detection may be performed by melting curve analysis using probes incorporating fluorescent labels that hybridize to amplification products in a sequence amplification reaction. A particular example is the use of Fluorescent Resonance Energy Transfer (FRET) probes to hybridize with amplification products in "real time" as amplification products are produced with each cycle of amplification.

In yet another embodiment, the invention contemplates use of melting curve analysis whereby nucleic acid-intercalating dyes such as Ethidium Bromide (EtBr) or SYBR Green I bind amplification products and fluorescence emission by the intercalated complexes is detected.

Particularly for the purpose of clinical diagnosis, although without limitation thereto, the present invention provides a kit comprising one or more probes and/or primers that facilitate detection of a ZFASl nucleic acid, or a fragment thereof; a ZFASl snoRNA nucleic acid, or a fragment thereof; a ZFASl modulator that modulates a ZFASl promoter and/or enhancer, or a fragment of said modulator; a ZNFX1 nucleic acid, or a fragment thereof; and/or a ZNFX1 protein, or a fragment thereof. Said kit may further comprise other reagents such as a thermostable DNA polymerase, a thermostable RNA reverse transcriptase, positive and/or negative nucleic acid control samples, molecular weight markers, detection reagents such as for colorimetric detection or fluorescence detection of amplification products and/or reaction vessels such as microtiter plates.

It will also be appreciated that the method of the invention may be used alone or combined with other forms of molecular and/or clinical diagnosis to improve the accuracy of diagnosis.

In this regard, the invention contemplates nucleic acid array detection wherein one or more other nucleic acid markers associated with other cancers, or other diseases or conditions, may be provided on the array.

Nucleic acid array technology has become well known in the art and examples of methods applicable to array technology are provided in Chapter 22 of CURRENT PROTOCOLS IN MOLECULAR BIOLOGY Eds. Ausubel etal. (John Wiley & Sons NY USA 1995-2001).

In one embodiment, the method uses a "nucleic acid array^'" (ncRNA array).

By "nucleic acid array" is a meant a plurality of nucleic acids, preferably ranging in size from 10, 15, 20 or 50 bp to 250, 500, 700 or 900 kb, immobilized, affixed or otherwise mounted to a substrate or solid support. Typically, each of the plurality of nucleic acids has been placed at a defined location, either by spotting or direct synthesis. In array analysis, a nucleic acid-containing sample is labelled and allowed to hybridize with the plurality of nucleic acids on the array. Nucleic acids attached to arrays are referred to as "targets" whereas the labelled nucleic acids comprising the sample are called "probes". Based on the amount of probe hybridized to each target spot, information is gained about the specific nucleic acid composition of the sample. The major advantage of gene arrays is that they can provide information on thousands of targets in a single experiment and are most often used to monitor gene expression levels and "differential expression" .

"Differential expression" indicates whether the level of a particular non- coding RNA (e.g. , ZFAS1) in a sample is higher or lower than the level of that particular non-coding RNA in a normal or reference sample.

The physical area occupied by each sample on a nucleic acid array is usually 50-200 μηι in diameter thus nucleic acid samples representing entire genomes, ranging from 3,000-32,000 genes, may be packaged onto one solid support. Depending on the type of array, the arrayed nucleic acids may be composed of oligonucleotides, PCR products or cDNA vectors or purified inserts. The sequences may represent entire genomes and may include both known and unknown sequences or may be collections of sequences such as ncRNAs. Using array analysis, the expression profiles of samples from normal and cancerous tissues, and treated and untreated cells can be compared.

The invention also contemplates protein based methods, including measurement of relative levels of proteins that modulate the expression and/or activity of ZFAS1.

Thus, in a further aspect, the invention provides a method of diagnosis of a cancer, or a predisposition thereto, in a mammal, said method including the step of determining a level of a ZNFX1 protein in a biological sample obtained or obtainable from said mammal, which level is indicative of said cancer, or said predisposition thereto, in said mammal.

This embodiment of the invention is at least partly predicated on the discovery that the down-regulation, suppression, or reduction of a ZNFX1 protein in a biological sample obtained or obtainable from a mammal (e.g., a human) is associated, linked, or otherwise correlated with the development and progression of certain cancers, particularly testis cancer, or a predisposition thereto.

Thus, the invention also provides a method of determining whether a mammal with cancer is responsive to a cancer therapy, said method including the steps of (i) isolating a biological sample from the mammal before and after said cancer therapy; and (ii) measuring a level of a ZNFX1 protein in said biological sample, to thereby determine whether said mammal is responsive to said cancer therapy.

Protein-based techniques applicable to the invention are well known in the art and include Western blotting, ELISA, two dimensional protein profiling, protein arrays, immunoprecipitation, radioimmunoassays and radioligand binding, although without limitation thereto.

In this regard, antibodies may be particularly useful in immunoassays such as

ELISA, which are capable of high throughput analysis of multiple protein samples. Alternatively, antibodies may be used in a protein array format, which is particularly suited to larger scale expression analysis. The invention also contemplates recombinant methods of producing antibodies and antibody fragments. For example, antibodies to RNA molecules have been previously been produced by a method utilizing a synthetic phage display library approach to select RNA-binding antibody fragments.

In another aspect, the invention provides a method of designing, engineering, screening for, or otherwise producing a cancer therapeutic agent, said method including the step of identifying a candidate agent which at least partly modulates the expression and/or activity of a ZFASI nucleic acid.

In one particular embodiment, the candidate agent mimics, reproduces or otherwise replicates the activities of ZFASI.

Suitably, according to this particular embodiment, the candidate agent is a synthetic ZFASI nucleic acid, a fragment thereof, or a nucleic acid comprising a nucleotide sequence having at least 70% identity thereto; and/or a nucleic acid construct comprising a ZFASI nucleic acid, a fragment thereof, or a nucleic acid comprising a nucleotide sequence having at least 70% identity thereto.

In certain embodiments, the ZFASI sequence, or fragment thereof, has at least 70%) identity to any one of SEQ ID NOs: 1-5 as shown in Figure 9.

In one particular embodiment, said fragment is a ZFASI snoRNA nucleic acid.

Typically, according to this particular embodiment, said ZFASI snoRNA nucleic acid has at least 70%o identity to any one of SEQ ID NOs: 6-8 as shown in Figure 9.

It will be appreciated that this includes sequences having at least 72%>, 74%>,

76%, 78%, 80%, 82% , 84%, 86%, 88%, 90%, 92%, 94%, 96%, and up to at least 98%) identity to said ZFASI nucleic acid or said fragment thereof.

Generally, a nucleic acid construct may be any recombinant nucleic acid that facilitates delivery, expression, propagation or manipulation of a desired nucleic acid component of the construct (e.g. , ZFASI or a fragment thereof). By way of example only, a construct may be a plasmid, a cosmid, a modified virus or containing virus- derived elements, an artificial chromosome (e.g. , a YAC or BAC), a phagemid, or the like. A construct may be a DNA or RNA vector.

Particular virus-derived expression constructs suitable for human delivery include constructs comprising adenovirus-, adeno-associated virus-, lentivirus-, flavivirus- and/or vaccinia virus-derived elements.

The skilled addressee will appreciate that an exogenous nucleic acid (e.g., a synthetic ZFASl or a fragment thereof) may be introduced, delivered or otherwise transferred into a host cell using a variety of different methods. Such methods include a variety of well-known techniques including vector-mediated transfer (e.g., viral infection/transfection, or various other protein-based or lipid based gene delivery complexes), as well as techniques facilitating the delivery of "naked" nucleic acid sequences, such as electroporation, and "gene gun" delivery. It will also be appreciated that the introduced nucleic acid may be stably or transiently maintained in the host cell.

Preferably, according to this particular embodiment, the candidate agent reduces, lowers, or otherwise decreases cell proliferation.

More preferably, according to this particular embodiment, the candidate agent reduces tumour cell proliferation.

In another particular embodiment, the candidate agent enhances, increases or otherwise up-regulates the expression and/or activity of ZFASl.

Suitably, according to this particular embodiment, the candidate agent is a ZFASl enhancer and/or a promoter, or a modulator that induces, activates or otherwise stimulates a ZFASl enhancer and/or a promoter.

In yet another particular embodiment, the candidate agent at least partly modulates the expression and/or activity of a ZFASl snoRNA selected from the group consisting of SNORD12, SNORD12B, and SNORD12C.

Preferably, according to this particular embodiment, the candidate agent at least partly reduces cell proliferation.

More preferably, according to this particular embodiment, the candidate agent at least partly reduces tumour cell proliferation. In another aspect, the invention provides a cancer therapeutic agent designed, engineered, screened for, or otherwise produced according to the method of the aforementioned aspect for use in the treatment of a mammal that has a cancer or a predisposition thereto.

Preferably, said cancer is a breast cancer, an adrenal gland cancer, a colon cancer, a liver cancer, a testis cancer, or a thyroid cancer.

More preferably, said cancer is a breast cancer.

In one particular form, said cancer is a mammary ductal carcinoma.

In one particular embodiment, the cancer therapeutic agent is a synthetic ZFASl nucleic acid or a nucleic acid construct comprising ZFASl.

In still another particular embodiment, the cancer therapeutic agent at least partly modulates the expression and/or activity of a ZFASl snoRNA selected from the group consisting of SNORD1 '2, SNORD12B, and SNORD12C.

In still further aspects, the invention relates to compositions and/or methods of treating cancers, including but not limited to breast cancer, adrenal gland cancer, colon cancer, liver cancer, testis cancer, and thyroid cancer.

In another aspect, the invention provides a method of prophylactic and/or therapeutic treatment of a cancer in a mammal, said method including the step of delivering the cancer therapeutic agent, or the pharmaceutical composition of the aforementioned aspects to said mammal to thereby treat said mammal.

Preferably, said cancer therapeutic agent at least partly reduces cell proliferation.

More preferably, said cancer therapeutic agent at least partly reduces tumour cell proliferation. In certain embodiments, pharmaceutical compositions and treatment methods may utilize cancer therapeutic agents produced according to methods as hereinbefore described.

Thus, in particular embodiments, pharmaceutical compositions and treatment methods may utilize nucleic acid constructs for treatment of cancers.

Suitably, pharmaceutical compositions further comprise a pharmaceutically acceptable carrier, diluent or excipient.

By "pharmaceuticalfy-acceptable carrier, diluent or excipienf is meant a solid or liquid filler, diluent or encapsulating substance that may be safely used in systemic administration. Depending upon the particular route of administration, a variety of carriers, well known in the art may be used. These carriers may be selected from a group including sugars, starches, cellulose and its derivatives, malt, gelatine, talc, calcium sulfate, vegetable oils, synthetic oils, polyols, alginic acid, phosphate buffered solutions, emulsifiers, isotonic saline and salts such as mineral acid salts including hydrochlorides, bromides and sulfates, organic acids such as acetates, propionates and malonates and pyrogen-free water.

A useful reference describing pharmaceutically acceptable carriers, diluents and excipients is Remington's Pharmaceutical Sciences (Mack Publishing Co. N.J. USA, 1991).

Any safe route of administration may be employed for providing a patient with the composition of the invention. For example, oral, rectal, parenteral, sublingual, buccal, intravenous, intra-articular, intra-muscular, intra-dermal, subcutaneous, inhalational, intraocular, intraperitoneal, intracerebroventricular and transdermal administration may be employed.

Dosage forms include tablets, dispersions, suspensions, injections, solutions, syrups, troches, capsules, suppositories, aerosols, transdermal patches and the like. These dosage forms may also include injecting or implanting controlled releasing devices designed specifically for this purpose or other forms of implants modified to act additionally in this fashion. Controlled release of the therapeutic agent may be affected by coating the same, for example, with hydrophobic polymers including acrylic resins, waxes, higher aliphatic alcohols, polylactic and polyglycolic acids and certain cellulose derivatives such as hydroxypropylmethyl cellulose. In addition, the controlled release may be affected by using other polymer matrices, liposomes and/or microspheres.

Pharmaceutical compositions of the present invention suitable for oral or parenteral administration may be presented as discrete units such as capsules, sachets or tablets each containing a pre-determined amount of one or more therapeutic agents of the invention, as a powder or granules or as a solution or a suspension in an aqueous liquid, a non-aqueous liquid, an oil-in-water emulsion or a water-in-oil liquid emulsion. Such compositions may be prepared by any of the methods of pharmacy but all methods include the step of bringing into association one or more agents as described above with the carrier which constitutes one or more necessary ingredients. In general, the compositions are prepared by uniformly and intimately admixing the agents of the invention with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product into the desired presentation.

The above compositions may be administered in a manner compatible with the dosage formulation, and in such amount as is pharmaceutically-effective. The dose administered to a patient, in the context of the present invention, should be sufficient to effect a beneficial response in a patient over an appropriate period of time. The quantity of agent(s) to be administered may depend on the subject to be treated inclusive of the age, sex, weight and general health condition thereof, factors that will depend on the judgement of the practitioner.

Other aspects of the invention provides methods of determining whether a mammal with cancer is responsive to cancer therapy, said methods including the steps of (i) isolating a biological sample from the mammal before and after cancer therapy; and (ii) measuring a level of a ZFAS1 nucleic acid in said biological sample, to thereby determine whether said mammal is responsive to cancer therapy.

More preferably, said cancer is a breast cancer.

In one particular form, said cancer is a mammary ductal carcinoma. In one embodiment, an at least partly increased, elevated or otherwise higher level and/or activity of a ZFASl nucleic acid indicates that said mammal is at least partly responsive to breast cancer therapy.

In one particular embodiment, an at least partly increased, elevated or otherwise higher level and/or activity of a ZFASl snoRNA nucleic acid indicates that said mammal is at least partly responsive to breast cancer therapy.

In particular embodiments, the invention provides methods to determine or assess whether a mammal is more or less responsive to one or more anti-cancer agents.

In one embodiment, an increased level of ZFASl following cancer therapy is associated with a relatively increased or greater sensitivity or responsiveness to cancer therapy.

In another embodiment, an unaltered, unchanged, or reduced level of ZFASl following cancer therapy is associated with a relatively reduced or lower sensitivity or responsiveness to cancer therapy.

In light of the foregoing, it will be appreciated that typically, although not exclusively, a relatively decreased or lower level of expression of ZFASl is associated with a relative resistance or lower sensitivity to breast cancer therapy; a relatively increased or higher level of expression of ZFASl is associated with a relatively increased or higher sensitivity to breast cancer therapy. Furthermore, it will be appreciated that typically, although not exclusively, a relatively increased or higher level of expression of ZFASl is associated with a relative resistance or lower sensitivity to adrenal gland cancer, colon cancer, liver cancer, testis cancer, or thyroid cancer therapy; a relatively decreased or lower level of expression of ZFASl is associated with a relatively increased or higher sensitivity to adrenal gland cancer, colon cancer, liver cancer, testis cancer, and thyroid cancer therapy.

Accordingly, the invention provides diagnostic methods that may identify one or more of the following:

(i) a relative level of expression a ZFAS1 nucleic acid;

(ii) a relative level of expression of a ZFAS1 snoRNA nucleic acid; and/or

(iii) a relative level of expression of a ZFAS1 modulator.

In another aspect, the invention provides a method of modulating cell proliferation in one or more cells, said method including the step of introducing: (i) synthetic ZFAS1 nucleic acid, a fragment thereof, or a nucleic acid comprising a nucleotide sequence having at least 70% identity thereto (ii) a nucleic acid construct comprising ZFAS1, a fragment thereof, or a nucleic acid comprising a nucleotide sequence having at least 70% identity thereto; or (iii) a ZFAS1 inhibitor, to said one or more cells, to thereby modulate said cell proliferation.

Preferably, said one or more cells are tumour cells.

Preferably, the introduction of said synthetic ZFAS1 nucleic acid or said fragment thereof, or said nucleic acid construct, at least partly reduces, suppresses or otherwise lowers cell proliferation.

Preferably, said ZFAS1 inhibitor induces, elevates or otherwise increases cell proliferation.

In one particular embodiment, said ZFAS1 inhibitor at least partly silences, knocks-down, blocks, inhibits, reduces, suppresses or otherwise lowers the expression and/or activity ZFAS1.

Non-limiting examples of how the ZFAS1 inhibitor {e.g. , an siRNA or an RNAi construct) can be produced and used can be found in Wahlestedt, Drug Discovery Today (2006) and US Patent Application 20090258925. In some cases beyond treatment of certain cancers, it may be desirable to induce cell proliferation by reducing, inhibiting, or otherwise decreasing the level and/or activity of ZFAS1.

Increased cell proliferation may, for example, help induce growth of mammary tissue following a mastectomy or injury {e.g., during reconstructive surgery).

Furthermore, increased proliferation of mammary epithelial cells following pregnancy may prolong the lactating phase in humans and/or livestock, although without limitation thereto.

In another particular embodiment, said method is performed in vitro.

While methods, cancer therapeutic agents and compositions of the invention are preferably directed to human therapy, the invention also contemplates extension to veterinary treatments, such as for livestock, domestic pets and performance animals, although without limitation thereto.

So that the invention may be readily understood and put into practical effect, reference is made to the following non-limiting examples.

EXAMPLES

Example 1 - SNORD-host RNA Zfasl: a regulator of mammary development and marker for breast cancer

Materials and Methods

Animals and mammary epithelial cells isolation. All experiments were performed with Balb/c mice, which were maintained and handled according to Australian guidelines for animal safety. All experiments were approved by the Animal Research Ethics Committee of the University of Queensland. The mice were mated and then sacrificed at day 15 of pregnancy, day 7 of lactation and day 2 of involution. Nine mice from each stage were sacrificed and mammary glands were dissected. One thoracic gland from each mouse was fixed for in situ hybridization and remaining glands were pooled to create three pools for each developmental stage and processed for epithelial cell purification as described previously (Tan- Wong et al. 2008). For the adult mouse tissue expression analysis, brain, liver, lung, kidney, spleen, testis were dissected from a single male mouse, the whole mammary gland tissue was derived from a virgin female mouse, and whole embryos were harvested from a single mouse 10.5 days post-coitum.

RNA extraction. Total cellular RNA from mammary gland epithelial cells or cultured cells was purified using Trizol (Invitrogen) according to the manufacturer's instructions. To remove any contaminating genomic DNA, total RNA was treated with DNase I (Invitrogen) for 30 minutes at 37 °C prior to microarray analysis or RT- PCR. To assess the yield and quantity of RNA produced, samples were run on an Agilent 2100 Bioanalyzer using the RNA 6000 Pico Chip kit (Agilent) or absorption measurements were taken at 230, 260 and 280 nm. The ratio of optical density at 260 and 280 nm was > 1.8 in all cases.

Cytoplasmic and nuclear RNA was isolated from cultured HC11 cells. The harvested cells were first washed in PBS and the nuclear and cytoplasmic fractions then separated. The cell membrane was disrupted by incubation in buffer containing 10 mM HEPES, pH 7, 1.5 mM MgCl₂, 10 mM KC1, 0.5 n M DTT, 0.2 mM PSMF and 0.5% Nonidet-40 on ice for 5 minutes. After centrifugation, the cytoplasmic and nuclear fraction were contained within the supernatant and pellet, respectively. The nuclear fraction was washed twice in the incubation buffer, then once in a buffer containing 1% Triton -XI 00 and 0.5% deoxycholic acid. RNA from both the cytoplasmic and nuclear fraction was isolated using Trizol, as above.

Microarray design. The custom designed microarray chips were synthesised by NimbleGen and experiments performed according to the manufacturer's instructions. The noncoding transcripts targeted by the custom microarray were identified using the CRITIC A software, which uses a combination of statistical and comparative parameters, such as open reading frame (ORF) length, synonymous versus non-synonymous base substitution rates, and similarity to known proteins (Badger and Olsen, 1999; Frith et al., 2006). Although we cannot eliminate the possibility that small proteins or peptides are encoded by these transcripts (Dinger et al, 2008b), BLASTP searches of predicted ORFs indicated they did not contain any known protein motif and were not conserved in other species. Raw and normalized microarray data is available at the ArrayExpress Data Warehouse (EMBL-EBI; ArrayExpress Accession Number E-TABM-1 106). Microarray expression analysis. Total RNA from pregnant, lactating and involuting mice as well as undifferentiated and differentiated HCl l cells was amplified and labelled using the Superscript™ Indirect RNA Amplification System (Invitrogen) and Alexa Fluor 555 Decapack Set (Invitrogen) according to the manufacturer's instructions. Labelled RNA was hybridized using a micro fluidic hybridization chamber. Slides were scanned at a 5 μηι resolution using a DNA microarray scanner (Agilent Technology). Feature extraction was performed using NimbleScan software, with manual grid adjustment and auto spot finding and segmentation. Data were background-corrected and normalized between arrays. Subsequent data analysis was performed using NRED (Dinger et al., 2008a; Dinger et al., 2009). Differentially expressed genes (protein-coding or noncoding) were defined as having a minimum fold change of 8 or greater in at least one developmental transition.

Reverse transcription, PCR and qRT-PCR. RNA was oligo-dT reverse transcribed with Superscript III Reverse Transcriptase (Invitrogen) according to the manufacturer's instructions. Quantitative RT-PCR was performed as previously described (Saunus et al., 2007). For normalization of transcript expression levels, Tubulin delta and GAPDH were used as internal controls for mouse and human, respectively. For expression analysis, cDNA was PCR amplified for 35 cycles and products visualized after electrophoresis in a 1.5% agarose gel. For in situ hybridization (ISH) probe preparation, Zfasl cDNA probes were amplified from mouse mammary gland cDNA (see primers in Table 3) and PCR products were cloned into pGEM-T Easy Vectors (Promega). After sequence confirmation, the insert was PCR amplified with T7 and SP6 primers to generate DNA templates for in vitro transcription reactions. In situ hybridization. In situ hybridization (ISH) was performed using digoxigenin (DIG)-labelled complementary RNA probes. In vitro transcription was performed from each strand by using SP6 and T7 promoters, respectively, to produce sense (control) and antisense ISH probes. Section ISH was performed on 5 mm sections of paraformaldehyde-paraffin embedded 15-d pregnant mouse mammary glands. Sections were de-waxed, rehydrated, and incubated in 10 μg/nlL proteinase K for 30 minutes at 37 °C. After washing in PBS, sections were refixed with 4% paraformaldehyde for 10 minutes at room temperature, acetylated, and prehybridized with hybridization solution (50% formamide, x SSC, 5 x Denhardt's, 250 μg/mL yeast RNA, 500 μg/mL herring sperm DNA) for 2 hours at 55 °C. Hybridization (hybridization solution + 0.5 μg/mL probe) was performed overnight at 55 °C. Slides were washed in 4 SSC for 5 minutes at 45 °C, 2x SSC for 10 minutes at 37 °C, 2 ^χ SSC and 50% formamide for 30 minutes at 55 °C, 0. lx SSC buffer for 30 minutes at 55 °C, O.lx SSC for 10 minutes at room temperature, lx TBS for 10 minutes at room temperature, before incubating for 1 hour with blocking solution (3% heat- inactivated sheep serum and 0.3% Triton-XlOO in TBS buffer) in a humidified chamber. Anti-digoxigenin antibody (Roche Applied Science) at 1 :2000 dilution in blocking solution was added to the slides and incubated overnight at 4 °C. Unbound antibodies were removed by washing three times in TBS buffer. Slides were equilibrated in alkaline phosphatase (AP) buffer (100 mM Tris pH 9.5, lOOmM NaCl, 1 mM levamisole) for 10 minutes at room temperature, then incubated in colour solution (3.5 of 5-bromo-4-chloro-3-indolyl phosphate (Roche Applied Science), with 3.5 \i of nitro blue tetrazolium (Roche Applied Science) per ml of AP buffer) until sections showed sufficiently intense specific staining.

Northern blot analysis. Northern blot analysis was performed as previously described (Amaral et al. 2009). The Zfasl probe used for Northern blot analysis was the same antisense Zfasl PCR product that was used, for in situ hybridization. Both the Zfasl and Znfkl probe (see Table 3 for primer sequences) were random labeled (GE Healthcare) according to the manufacturer's instructions. The snoRNA probes were prepared by amplifying the respective genes using the primers listed in Table 3 and were randomly labeled as above.

Cell lines. Mouse HC11 cells were cultured and induced to differentiation in an eight-day assay as previously described (Naylor et al. 2005). T47D, BT474, MCF7 and N2A were cultured as described previously (Soule et al. 1973; Keydar et al. 1979; Lasfargues et al. 1979; Georgopoulou et al. 2006).

R A stability assay. N2A cells were grown to -50% confluence, before addition of 10 μg/mL actinomycin D to block RNA polymerase activity. RNA was extracted using RNeasy kits (Qiagen) from three biological replicates at 0, 0.5, 2, 4, 8 and 16 hours after treatment. For Znficl and Zfasl, qPCR using random hexamers was used to quantify expression relative to GAPDH. Snordl2, Snordl2b and Snordl2c levels were determined from RNA isolated from 0, 2, 4, 8 and 16 hours after treatment and quantified as described in Supplementary Methods. The control timepoint (t=0) expression level was set to 100% and treated samples shown as a percentage of the control. A one-phase exponential decay curve and half-life value was calculated using nonlinear regression with a least squares fit by Prism 5 (plateau = unconstrained, k>0). Where no decay was present a linear line was calculated using nonlinear regression with a least squares fit.

RNA interference. Four pairs of siRNAs (see Table 3) designed to knockdown Zfasl expression and one pair of scrambled siRNAs were purchased from Sigma. Equal quantities of HC 11 cells (5x 10⁵) were seeded per well in 12 well plates and the siRNA knockdown was performed as described previously (Naylor et al. 2005). Three replicates per time point were performed for both the Znfxl/Zfasl expression analysis (Figure 3A) and β-casein expression assay (Figure 3E) and quantitative PCR was performed as described above.

Proliferation assay. Quantification of cell proliferation based on the measurement of BrdU incorporation during DNA synthesis was performed on cells transfected with Zfasl versus those transfected with scrambled siRNA using the cell proliferation ELISA, BrdU colorimetric immunoassay kit (Roche). Twenty- four hours after siRNA transfection, cells were trypsinized and six replicates of 12 x 10 cells were seeded per well in a 96 well plate, with the no cells well used as a blank. The cell proliferation assay was performed according to the manufacturer's instructions with the cells assayed at 1, 2 and 3 hours after addition of BrdU. MTT assay. Twenty-four hours after HC1 1 transfection with Zfasl versus scrambled siRNA, cells were trypsinized and six replicates of 12 x 10 cells were seeded per well in 96 well plates, with a no cells well used as blank. Proliferation was measured by an MTT (tetrazolium blue) conversion test and tritiated thymidine uptake. Briefly, 20 μΐ MTT (5 mg/mL) was added to each well and the cells allowed to grow at 37 °C for 4 hours. After addition of 100 ih of solubilization solution (10% SDS in 0-01 M HC1) cells were incubated at 37 °C for a further 3 hours. Specific optical density of all wells was then measured at 540 nm.

Dome formation assay. Twenty-four hours after HC 11 transfection with wild type and knock-down siRNA, cells were seeded in 6 well plates. Assays for dome formation were performed as documented previously (Naylor et al, 2005). Briefly, cell differentiation was induced by the addition of o-prolactin and dexamethasone. The number of domes in each well was counted. Results presented here are from duplicate experiments with each individual assay performed in triplicate. Statistical analyses. Two-tailed t-tests were performed for qPCR, proliferation and dome formation assays. Standard error of the mean was calculated using Prism 5.0 (GraphPad Software, Inc.). Differential microarray expression analysis was performed by the LIMMA package using Bayesian statistics (B statistics; posterior log odds) and Benjamini-Hochberg multiple testing adjustment (see Supplementary Methods).

Results

Identification of long ncRNAs that are dynamically regulated in the mouse mammary gland

To identify IncRNAs (>200 nt) involved in mammary gland development, we interrogated custom-designed microarrays with RNA extracted from primary epithelial cells isolated from mouse mammary glands at three distinct stages; 15-days pregnant, 7-days lactating, and 2-days involuting. The microarray contained probes that uniquely profile 8,946 high-confidence long ncRNAs and 29,968 mRNAs (includes alternative isoforms) in mouse. Analysis of these data showed significant differential expression (B-statistic > 3; fold-change > 4) of 388 mRNAs and 97 IncRNAs in developing mammary glands (Table 1).

To validate our experimental model of the developing mammary gland, we first examined the differentially expressed coding mRNAs. The list of differentially expressed genes (Table 1 ) agreed with previously reported data on mouse mammary development (Master et al. 2002) and was generally consistent with expectations of the developmental transitions under investigation (Metcalfe et al. 1999), including dynamic regulation of mRNAs with roles in cell proliferation, milk production and apoptosis, such as Bcl2- and casein-family genes. Gene ontology (GO) analysis of differentially expressed mRNAs by Babelomics (Al-Shahrour et al. 2006) showed enrichment in genes associated with regulation of cell growth and size and response to hormone stimulus. Based on these observations, we anticipated that the differentially expressed IncRNAs should be similarly relevant to the biological processes underlying mammary development. Indeed, amongst the differentially expressed IncRNAs, we identified known IncRNAs, such as Dio3os, which has previously been associated with decreased proliferation and increased differentiation of precursor cells to mature adipocytes, analogous to the transition from pregnancy to lactation during mammary gland development (Hernandez et al. 2007).

Zfasl is a highly expressed, spliced IncRNA that is regulated during mammary gland development

To identify IncRNAs for subsequent experimental examination, we ranked the list of significantly differentially expressed IncRNAs by fold change and absolute expression level. Next, on the basis that many IncRNAs originate from complex transcriptional loci (Engstrom et al. 2006) in which they may have a functional relationship with the nearby protein-coding genes, we further refined our list of IncRNAs by examining their genomic context. Using our previously described classifications of IncRNA loci (Dinger etal. 2009), we identified 15 c/s-antisense, 3 nearby antisense, 37 intronic. and 42 in.tergenic transcripts (Table 1 ). Because we were interested in IncRNAs that may impact on human mammary development, we further refined our list of candidates by considering only those for which there was transcriptional evidence at the syntenic genomic position in human. In total, 19 of the 97 transcripts had human transcripts that arose from syntenic locations. Taken together, our criteria highlighted a previously uncharacterized IncRNA, which had been annotated in RefSeq as 1500012F01Rik (GenBank ID AK005231). Transcription of this spliced IncRNA initiates from the nearby antisense strand of the Znfi l (zinc finger NFX- 1 -type containing) promoter region (Figure 1 A), which led to our naming of it as Zfasl (zinc finger antisense). As Zfasl is not transcribed from an ultraconserved region (Bejerano et al. 2004) and is located close to a protein-coding gene, it does not belong to the existing IncRNA subclasses of T-UCRs (transcribed ultraconserved RNAs) (Calin et al. 2007) or lincRNAs (long intergenic noncoding RNAs) (Guttman et al. 2009). From our list of differentially expressed lncRNAs, Zfasl was the second most highly expressed (A- value - 10) and had the second largest fold-change (34-fold down-regulated from pregnant to lactating) (Table 1). In human, the ZNFX1 locus also features an equivalently positioned spliced noncoding transcript, which is annotated in RefSeq Genes as NCRNA00275, a feature not shared by the other highly differentially expressed transcripts. Another interesting feature of this transcript is that it hosts three snoRNA genes, Snordl2, Snordl2b and Snordl2c, within sequential introns (Figure 1A; Table 2). The combination of these characteristics led us to pursue Zfasl for further characterization in mammary development.

Although our ncRNA annotation program had indicated that Zfasl was noncoding, we noted that the sequence did contain a 79 amino acid open reading frame (ORF). Using BLASTP, we confirmed that this protein sequence was not conserved amongst mammals and did not contain any known protein motif. Moreover, the start and stop codons were not conserved in the human ortholog of Zfasl and there was no evidence of any consensus ribosomal binding sequences. Analysis by the CRITICA algorithm (Badger and Olsen 1999) also indicated that the codon usage frequency of this ORF was inconsistent with other mouse genes. Querying PRIDE, a database of peptide sequences deduced from proteomic analyses (Vizcaino et al. 2009), showed no peptides have been identified that correspond to the Zfasl ORF. Together, these observations led us to conclude that the transcript was unlikely to encode a protein. Zfasl expression is differentially regulated to Znfxl

As shown in Figure 1 A, Zfasl and Znfxl are closely positioned in a head-to- head orientation, and potentially share a bidirectional promoter. This raises the possibility that these genes may be co-ordinately regulated (Trinklein et al. 2004; Engstrom et al. 2006; Dinger et al. 2008a; Mercer et al. 2008). To investigate whether Zfasl and Znficl are co-regulated, we examined their expression profiles at different stages of mammary gland development by quantitative real time PCR (qPCR). Figure IB illustrates the expression of these two genes relative to Tubulin delta 1 (Tubdl), a result in agreement with the microarray data. Although Zfasl was significantly down-regulated (9-fold) between pregnancy and lactation, and significantly up-regulated between lactation and involution (4-fold), Znficl did not change appreciably during these transitions. This, together with the finding that the ratio of Zfasl to Znficl varies from 63: 1 (in pregnancy) to 6:1 (in lactation) in different developmental stages of the mammary gland, suggests that the transcripts are independently regulated.

EST evidence from GenBank showed that Znficl and Zfasl were expressed in many other tissues outside of the mammary gland, including kidney, brain, pancreatic bud, thymus, eye, heart and embryo. To obtain a more comprehensive profile of the relative expression levels of Znficl and Zfasl in mouse, we performed qPCR on a diverse range of tissues. Figure 1C shows the expression of Znfxl is significantly lower than Zfasl in each of the tissues examined (except testis). Although the expression profiles of Zfasl and Znfxl were positively correlated (Pearson coefficient, R = 0.77), the ratios of Zfasl to Znfxl varied considerably, ranging from 1 :2.6 in testis to 7.4:1 in mammary gland. The data shows that the highest level of expression of Zfasl occurs in the lung followed by mammary gland and, in contrast, is almost undetectable in testis. Interestingly, the lung and mammary gland both have biologically similar alveolar structures, raising the possibility that Zfasl may play a role in alveolar morphogenesis.

In addition to the various tissues, we also examined the relative expression of Zfasl and Znfxl in the murine mammary epithelial cell line HC 11 during an 8 day in vitro assay. After an initial proliferative phase in the presence of EGF (day 2), addition of lactogenic hormones to the HC11 cells at day 4 stimulates lactogenic differentiation in the formation of dome-like structures and the expression of mill- proteins by day 8. As well as again showing discordant expression between Zfasl and Znfi l, the results show that Zfasl is both highly expressed in HC1 1 cells and is down-regulated upon differentiation (Figure 1C). This is consistent with our observation of the differential expression of Zfasl in the mammary gland, and suggests that HC11 cells serve as a meaningful experimental model to explore Zfasl function.

Given the overlapping promoter regions of Znficl and Zfasl, the highly discordant expression of these transcripts is surprising. One explanation for this observation is that Zfasl is more stable than Znficl, resulting in higher steady-state levels. To examine this hypothesis, we treated N2A cells with the general transcription inhibitor actinomycin D and quantified the expression levels after 0.5, 2, 4, 8 and 16 hours (Figure ID). We calculated that Znficl had a mean half-life of 50 minutes (95% confidence interval; 41 to 65 minutes). In contrast, Zfasl levels did not decline significantly after 16 hours (relative to GAPDH), confirming that this transcript is indeed highly stable.

As a number of previously characterized IncRNAs have been shown to act in the nucleus (Wilusz et al. 2009), we performed Northern blot analysis on total, nuclear and cytoplasmic RNA derived from HC 1 1 cells using probes targeting Zfasl and Znficl (Figure IE). The Northern hybridization for Zfasl identified a single strong band of 0.5 kb, which is consistent with the length of the full-length cDNA clones of Zfasl. The Northern hybridizations revealed that Zfasl was expressed in both cytoplasmic and nuclear fractions, while Znficl was highly enriched in the nucleus.

Zfasl is expressed in the epithelial cells of the duct and alveoli of the mammary gland

To further analyze Zfasl expression, we performed section in situ hybridization (ISH) on mammary glands dissected from 15-day pregnant mice. DIG- labelled in vitro transcribed Zfasl RNA was used to detect expression in section paraffin embedded pregnant mammary gland. The staining revealed enrichment of Zfasl expression in the epithelial cells of the ducts and alveoli of the pregnant mammary gland (Figure 2) relative to the background. Together with the high expression of Zfasl observed in mammary gland and lung generally, this result is consistent with the notion that Zfasl is involved in alveolar development. Knockdown of Zfasl results in an increase in markers of cell proliferation

In light of the observation that Zfasl expression was increased in the mammary gland during pregnancy when the cells are most proliferative, we hypothesized that Zfasl has a role in cell proliferation. To investigate the effect of Zfasl on cell proliferation, we knocked down its expression in exponentially growing HC 1 1 cells using several small interfering RNAs (siRNAs) specific to Zfasl . Using qPCR to measure the relative expression levels of Zfasl, we observed a reduction in expression of Zfasl relative to a scrambled siRNA-transfected control, of at least 80%, which was maintained for up to 4 days in the Zfasl -specific siRNA-treated cells (Figure 3A). We also assayed Znfxl expression to see if attenuation of Zfasl expression had an effect on its protein-coding partner. As seen in Figure 3 A, a similar but slightly offset change in expression was apparent for Znfxl over the same period of analysis.

Cell proliferation rates were determined by quantifying incorporation of BrdU into DNA 48 hours after cells were transfected by siRNA (Figure 3B). We found that the Zfasl -knockdown cells displayed a higher rate of proliferation relative to the scrambled siRNA-transfected control. To further validate this effect, we also measured proliferation rates in Zfasl knockdown and control cells using an MTT (3- (4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, a tetrazol) assay (Mosmann 1983) to measure metabolic activity over a 4 hour period. Consistent with the BrdU incorporation assay, cells transfected with siRNAs targeting Zfasl showed increased proliferation (Figure 3C). Together, these results suggest that Zfasl plays a role in regulating cell proliferation.

Knockdown of Zfasl induces β-casein expression and epithelial dome formation

To explore the hypothesis that Zfasl has a regulatory role in alveolar development in the mammary gland, we examined the effect of knocking down Zfasl during a dome formation assay. Formation of domes in cell culture, which can be induced in HC 11 cells by addition of o-prolactin and dexamethasone, is considered to be a model for mammary epithelial cell differentiation (Zucchi et al. 2002). Relative to a scrambled siRNA control, HC1 1 cells that had been transfected with a Zfasl - targeted siRNA showed a marked increase in the number of domes formed following induction (Figure 3D). O-prolactin- and dexamethasone-induced HC1 1 differentiation is also characterized by increased expression of β-casein. To further characterize the role of Zfasl in this developmental model, we determined the response to Zfasl -knockdown in comparison to a scrambled siRNA-knockdown by measuring the expression level of Csn2 (β-casein) in differentiated (day 8) relative to undifferentiated (day 2) cells. We found that in Zfasl knockdown cells, the expression of Csn2 increased over 40-fold in differentiated cells relative to undifferentiated cells, whereas it increased just 2-fold in cells transfected with the control siRNA (Figure 3E). Together, these results suggest that Zfasl plays a role in regulating HC 1 1 differentiation. SnoRNAs derived from Zfasl are differentially expressed

Zfasl is predicted to host three C/D box-containing homologous snoRNA genes, Snordl2, Snordl2b, and Snordl2c, in consecutive introns (Figure 1A). Intronic snoRNAs have been identified in all eukaryotic genomes and are frequently distributed in noncoding genes in this manner, with one snoRNA per consecutive intron (Huang et al. 2005). C/D box snoRNAs primarily guide the site-specific methylation of other RNAs, mainly ribosomal RNAs. Snordl2 and Snordl2b (previously referred to as MBII-99 and MBII-99B) are predicted to modify Gm3868 and Gm3878, respectively, in 28S rRNA (Huttenhofer et al. 2001 ; Yang et al. 2006). Snordl2c (previously referred to as Snordl06 or U106) contains antisense elements that match the G1536 and U1602 segments in 18S rRNA. However, as there is no evidence for methylation at these sites, Snordl2c may function solely as an RNA chaperone or target chemical modifications in a non-ribosomal transcript, The predicted size for Snordl2, Snordl2b and Snordl2c are approximately 85, 87 and 93 nucleotides, respectively.

As the three Zfasl snoRNAs had not previously been examined in mouse

(Snordl2b and Snordl2c are unannotated in RefSeq and UCSC Known Genes), we designed primers to detect the expression of these SNORDs. Using cDNA prepared from mouse mammary epithelial cells, we were able to confirm the existence of all three snoRNAs. Next, we aimed to determine the relative expression levels of Snordl2, Snordl2b and Snordl2c in mammary epithelial tissue from pregnant, lactating and involuting mice. Using qPCR (TaqMan), each of the snoRNAs was found to be most highly expressed during pregnancy (Figure 4A), consistent with the higher expression of the host transcript Zfasl in pregnancy. However, in contrast to Zfasl, which shows increased expression in involuting relative to lactating mammary epithelial cells, the SNORDs are expressed at similar levels at these developmental stages. Surprisingly, given that the three snoRNAs are derived from the same host transcript, Snordl2b was expressed at up to 171 -fold and 72-fold greater levels than Snordl2c and Snordl2, respectively. To examine whether the expression trends of Snordl2, Snordl2b and Snordl2c were similar in differentiating HC11 cells, we used qPCR to examine their expression levels in 2, 4 and 8 day differentiated HC11 cells (Figure 4B). Although we found Snordl2b was more highly expressed than Snordl2 and Snordl2c, the difference in expression was much less dramatic (~8-fold and ~5- fold for Snordl2c and Snordl2, respectively). Similar to the expression trend of Zfasl, the snoRNAs were consistently most highly expressed in undifferentiated HC11 cells (day 2) and decreased significantly in differentiated (day 4 and 8) cells.

One explanation for the highly differential molar ratios of Snordl2, Snordl2b and Snordl2c is that they have different stabilities. Using the same approach as described above to determine the stability of Znfi l and Zfasl, we blocked transcription and determined the expression levels of the three SNORDs. We found that Snordl2 and Snordl2c levels decreased rapidly (with half-lives of 43 minutes and 37 minutes, respectively) following transcriptional inhibition, whereas Snordl2b levels did not change appreciably even after 16 hours (Figure 4C). Although these snoRNAs are similar in sequence, and are accordingly considered to belong to the same family, we hypothesized that they may fold into different structures. To examine this hypothesis, we used MFOLD to predict the secondary structures of the three snoRNAs. Interestingly, Snordl2b, which had exhibited much higher expression levels than Snordl2 and Snordl2c, folded into a distinct structure with an additional short hairpin in relation to Snordl2 and Snordl2c, which folded into the traditional secondary structure of C/D box snoRNAs.

As the Zfasl transcript was detected in both nuclear and cytoplasmic fractions of HC1 1 cells, we examined the cellular localization of the snoRNAs. We prepared total RNA from HC1 1 cells and subsequently fractionated the cells into nuclear and cytoplasmic portions. Consistent with the qPCR data, Northern blot analysis indicated a high level of expression for all three Zfas 1 -derived snoRNAs, but unlike Zfasl, SNORD expression was specific to the nuclear fraction of these cells (Figure 4D). The Northern analysis showed a single band of the predicted size for each snoRNA. The absence of smaller fragments in the Northern blot as well as examination of small RNA deep sequencing data (Taft et al. 2009) suggests that unlike previous reports of other snoRNAs (Ender et al. 2008; Taft et al. 2009), Snordl2, Snordl2b and Snordl2c are not processed into smaller RNAs.

Although the siRNA-mediated knockdown of Zfasl should not effect the expression of Snordl2, Snordl2b and Snordl2c, which we would expect to be spliced out of the Zfasl prior to siRNA-directed breakdown of the host transcript, we nevertheless wished to confirm that the phenotypic changes observed during Zfasl - knockdown were not a direct consequence of reduced SNORD expression. Using qPCR, we found that there only minor differences in the expression of Snordl2, Snordl 2b and Snordl2c in the Zfasl -knockdown compared to the scrambled siRNA control (Figure 4E). These small changes in expression, relative to the -80% knockdown of the host transcript, suggest that the phenotypic changes observed following Zfasl knockdown are a consequence of the host transcript and that the mature form of Zfasl functions intrinsically as an RNA. Human ZFASl transcript exists and undergoes regulated alternative splicing

The human ortholog of Zfasl, ZFASl, is located on chromosome 20. In terms of the relative position of its transcription start site to ZNFXl and the presence of intronic snoRNA genes (Figure 5A), the ZFASl locus is similar to that in mouse. ZFASl is alternatively spliced with cDNA evidence indicating the presence of at least five different isoforms. Although the snoRNA genes (SNORD12, SNORD12B and SNORD12C) are highly conserved between mouse and human (81.3%, 68.9% and 71 % respectively), a comparison of the exonic regions of the most prevalent isoforms of ZFASl (isoforms 1-4 in Figure 5A; C20orfl999 uc002xuj.2, uc002xul.3, uc002xum.3, uc002xuo.2) with its mouse ortholog (NM_001081005.1) shows an average of only 43% identity. However, comparison of the secondary structure predictions of the mature Zfasl and ZFASl transcripts revealed several highly structured regions of the transcripts were very similar despite lacking sequence identity.

To obtain an overview of ZNFXl and ZFASl expression, we performed qPCR across a panel of 20 human tissues and the breast cancer cell lines MCF7, BT474 and T47D. Similar to the mouse tissue data, the ratios of ZFASl to ZNFXl varied across tissues (from 2: 1 in testis to 12: 1 in mammary tissue). However, overall there was a positive correlation (Pearson's correlation; R = 0.797, n = 20) between the expression profiles of ZNFXl and ZFASl across the tissue samples. Analysis of publicly available transcriptomic deep sequencing data in normal human breast tissue and mammary epithelium (Wang et al. 2008) mirrored our expression analysis in mouse showing that ZFASl is very highly expressed in mammary tissue (in the top 2- 5% of all genes) (Figure 5B).

The deep sequencing data recapitulated the presence of at least three different isoforms of ZFASl. Furthermore we were able to detect ZFASl isoforms in RNA isolated from MCF7, BT474 and T47D by using PCR primers designed to common exons. To determine whether different isoforms were alternatively regulated in different tissue types, we examined the relative proportions of the isoforms in the RNA deep sequencing libraries. Although the longer isoforms were predominant in each tissue type (ranging from -55% to -85% of the three distinguishable groups), the relative proportions of the isoform groups differed between tissue types, suggesting regulation of the alternative splicing (Figure 5C).

Human ZFASl level are reduced in ductal carcinoma relative to normal breast tissue

Given the role of Zfasl in proliferation, we hypothesised that decreased ZFASl expression is a marker for breast cancer and, moreover, that ZFASl is a tumor suppressor gene in breast cancer. To investigate this hypothesis, we examined ZFASl expression in total RNA isolated from the epithelial cells isolated by micro-dissection from frozen sections of normal breast and invasive ductal carcinoma (IDC) tissue (five paired and seven unpaired samples). The result shows ZFAS1 expression is decreased (2.0-fold, p=0.0S, paired; 2.7-fold, p=0.09 unpaired) in ductal carcinoma relative to normal epithelial cells (Figure 5D; Figure 6). Taken together with the effects of Zfasl knockdown on mammary epithelial cell proliferation and differentiation, our results illustrate ZFAS1 as a novel human tumor suppressor gene in breast cancer and that its dysregulation is useful as a marker for breast cancer.

Discussion

Although the importance of IncRN As in cell function is now becoming firmly established (Mercer et al. 2009), only a relatively small number have been shown to be involved in cancer (Huarte and Rinn 2010). In light of the potential value of IncRNAs as biomarkers and therapeutic targets (Huarte and Rinn 2010), as well as to further our understanding of the molecular mechanisms underlying cancer formation and development, we sought to identify IncRNAs involved in breast cancer. Under the hypothesis that IncRNAs involved in mammary development may be dysregulated in breast cancer, we examined the expression of 8,946 IncRNAs at different stages of mouse mammary gland development, and found a total of 97 that showed significant dynamic changes. We ranked the candidates on the basis of overall expression level, fold change, and conservation in human. As a result we selected the IncRNA Zfasl, which is positioned on the antisense strand at the 5' end of the Znficl protein-coding gene and is host to three C/D box snoRNAs, for further functional examination.

Knockdown of Zfasl in mouse mammary epithelial cells resulted in a significant increase in proliferation and metabolic activity. Examination of the expression of the intronically hosted SNORDs following knockdown, showed that their expression was only minimally altered, suggesting that the processed Zfasl transcript is itself functional. The high level of proliferation and low level of Zfasl expression is analogous to our observations in human mammary tissues, where we observe a substantially decreased level of ZFAS1 in highly proliferative invasive ductal carcinoma cells compared to normal breast tissue. Collectively, these observations led us to propose ZFAS1 as a putative tumor suppressor gene.

The head to head arrangement between Zfasl and the oppositely transcribed protein-coding gene Znficl occurs frequently in mammalian genomes (Trinklein et al. 2004; Engstrom et al. 2006). Znfxl and Zfasl share a CpG island, the methylation of which would be expected to similarly affect the expression of these transcripts. Although in some cases such bidirectional genes show concordant expression profiles, consistent with the notion of shared regulatory elements, others, as described below for Znfxl and Zfasl, share more complex expression relationships (Dinger et al. 2008a; Mercer et al. 2008). In both mouse and human, the expression patterns of Znfxl and Zfasl were similar over a panel of tissues, with the exception of testis and mammary gland. In both species, relative to Znfxl, Zfasl was considerably down- regulated in testis and up-regulated in mammary gland. The uncoupling of Znfxl and Zfasl expression was also evident both in the developing mammary gland, where Znfxl remains relatively constant while Zfasl undergoes significant dynamic changes, and during differentiation of the mouse mammary epithelial cell line HC11 , where there was an inverse relationship in the expression of Zfasl and Znfxl. Furthermore, knockdown of Zfasl in HC11 cells results in a concomitant relative decrease in Znfxl expression levels. However, as the levels of Zfasl recovered following knockdown, there was an overcompensation of Znfxl, which increased to more than 2-fold that of normal cells. Together, these observations suggest that the expression of Znfxl and Zfasl is likely to be intertwined, and therefore may participate in the same regulatory network. However, because the expression of these genes can be uncoupled in some conditions, it is likely that there are at least some independent regulatory controls underlying their expression and/or stability. Furthermore, the specific up-regulation of Zfasl relative to Znfxl in mammary gland, suggests a specific role for Zfasl in this organ, particularly during development.

Although the Znfxl protein has not been previously studied, its predicted sequence contains an NFX-1 (nuclear transcription factor X-box binding) zinc finger domain. Despite the low homology between the NFX-1 binding domain and the corresponding region in Znfxl , (26% identity; 36% similarity over a 327 amino acids region), the critical cysteine residues that characterize the domain (Song et al. 1994) are highly conserved (36/40; 90%), suggesting that Znfxl may also bind DNA. Interestingly, the human ortholog of Znfxl, ZNFX1 (previously referred to as KIAA1404 or MAD-Cap5), is specifically up-regulated in response to chemotherapeutic treatment in MCF7 and ZR-75 - 1 human mammary gland cell lines (Troester et al. 2004) and is also up-regulated in the serum of patients following treatment for prostate cancer (Dunphy and McNeel 2005). One conclusion drawn from these studies was that ZNFX1 might be involved in DNA repair. If Zfasl indeed belongs to the same regulatory network as Znfxl, then Zfasl may also have some role in a DNA repair pathway.

Alignment of mouse Zfasl and human ZFASl reveals only moderate sequence conservation, with the notable exception of the snoRNA regions conserved in three consecutive introns. This evident conservation of Snordl2, Snordl2b and Snordl2c suggests the function of these transcripts is likely to be conserved across mammals. Interestingly, despite an apparent absence of alternative splice variants of Zfasl , the Zfasl -derived snoR As are not present in equal proportions. The highly differential ratios of the snoRNAs suggest the degradation and/or stability of the snoRNAs can vary considerably. Determination of the half-lives of the snoRNAs confirmed this hypothesis, showing that Snordl2b was considerably more stable than Snordl2 and Snordl2c. Structural predictions reflected this differential stability, showing that Snordl2b, the most highly expressed of the snoRNAs, has a structure consistent with increased stability. The differential stability/degradation of snoRNAs at the various stages of mammary development suggests that the target region for these snoRNAs is important during mammary gland development, and consequently that the dysregulation of their expression levels will have important consequences in breast cancer aetiology.

The moderate sequence homology of the evolutionarily conserved Zfasl and ZFASl led us to look beyond nucleotide alignment of these orthologs. A number of ncRNAs have characteristic structures that are functional, and hence are well conserved, over evolutionary timescales. Most of the "classical" ncRNAs, including rRNAs, tRNAs, small nuclear RNAs (snRNAs), snoRNAs, as well as the RNA components of RNAse P and the signal recognition particle, show this evolutionary conservation of structure and function (Washietl et al. 2005). Comparison of the predicted secondary structures of the human and mouse forms of Zfasl revealed several distinct regions that had almost identical structures, despite sharing minimal sequence identity over these areas. The remarkable stability of Zfasl (half-life of > 16 hours), as well as the presence of conserved structures within Zfasl, implies that the RNA has functions beyond its role as a host for generating snoRNAs. This notion is supported by the observed lack of effect on snoRNA transcript levels upon siRNA- mediated Zfasl knockdown. Thus, the phenotypic effects caused by the reduction of Zfasl indicate that, in this case, the snoRNA host transcript is itself functional. This may also be the case for many other noncoding host transcripts, as has been recently shown for the Gas5 SNORD host gene (Kino et al. 2010), as well as host transcripts for miRNA host genes, such as H19 (Gabory et al. 2010) and BIC (Eis et al. 2005).

In summary, we show that the mature spliced transcript of an RNA that harbors C/D-box snoRNAs can function independently of the snoRNAs. This RNA is highly regulated in the developing mouse mammary gland, acts as a repressor of proliferation and differentiation and is dysregulated in human breast cancer.

Example 2 - ZFAS1 and ZNFX1 expression levels vary by tumour type

Absolute expression levels of ZFAS1 and ZNFX1 vary with tumour type (Figure 7). These data show that expression of ZFAS 1 is reduced in cancerous tissue of breast origin, but increased in cancerous tissue of adrenal gland, colon, endometrium, liver, testis and thyroid origin. ZNFX1 is reduced in cancerous tissue of testis origin. The expression of ZFAS1 or ZNFX1 levels may be used to predict type or stage of cancer, or in the case of metastases, predict the tissue of origin of a cancer.

This includes, as an example, a cancer of breast origin, which show a reduced level of ZFAS 1 , and which may spread to a tissue such as liver, which do not normally show reduced levels of ZFAS 1 and therefore is indicative of breast cancer origin. In another example, the absolute level of ZNFX1 is reduced in cancer of testicular origin and which may spread to a tissue such as liver, which normally do not show reduced level of ZNFX1, and therefore is indicative of testicular origin. Expression of ZFAS 1 measured in this study using qPCR include an amplicon of 104 bp with primers within exon 2/3 (ZFAS 1 ex2/3) and will specifically amplify ZFAS 1 isoforms 1 , 2, 3 & 4 and an amplicon of 95 bp with primers within exon 4/5 (ZFASl ex4/5) and will specifically amplify ZFASl isoforms 1 and 2 only. Overall, the expression profile of ZFAS 1 isoforms 1 and 2 appears to correlate with the profile seen when amplifying ZFAS 1 isoforms 1 to 4. See Figure 5 A for more details regarding ZFASl isoforms 1 to 5.

Example 3 - Ratio of ZFASl to ZNFXl expression vary by tumour type

The ratio of ZFAS 1 to ZNFXl expression vary with tumour type (Figure 8). These data show that the ratio of ZFAS 1 to ZNFXl is negative in cancerous tissue of breast, cervix, endometrium, ovary, prostate, stomach and uterine origin, but positive in cancerous tissue of adrenal gland, colon, liver, lung, lymph node, testis and thyroid origin. The ZFASl :ZNFX1 ratios may further be used to predict type or stage of cancer, or in the case of metastases, predict the tissue of origin of a cancer.

This includes, as an example, a cancer of breast origin, which show a negative ratio of ZFAS 1 to ZNFZ 1 , and which may spread to a tissue such as liver, which do not normally show a negative ratio of ZFAS 1 to ZNFZ 1 and therefore is indicative of a breast cancer origin.

In another example, the ratio of ZFASl to ZNFXl is positive in cancer of testicular origin and which may spread to a tissue such as kidney, which normally do not show a positive ratio of ZFASl to ZNFXl, and therefore is indicative of a testicular origin.

In yet another example, a negative ratio of ZFASl to ZNFXl is indicative of a cancer, in the female, in tissue of reproductive, or hormone sensitive origin, including breast, cervix, endometrium, ovary and uterus.

Alternatively, the ratio of ZFASl to ZNFXl may be of prognostic value and indicative of the stage and progression of a cancer, of for example, breast origin.

Example 4 - Proteins that bind to ZFASl

A protein array containing -20,000 human proteins (in duplicate) was hybridized with Cy5 labeled ZFAS 1 RNA. Fluorescence was detected after washing. The candidates in Table 5 were found to bind to ZFASl. These candidate proteins include, for example, enzymes, oncogene products, DNA-binding proteins, ribosomal proteins, growth factors, growth factor receptors, proteins involved in signal transduction, GTPases, SH2 or SH3 domain-containing proteins, hormones, hormone receptors, cytokines, cytokine receptors, tumour suppressors, neuropeptides, neuropeptide receptors, cytoskeletal proteins, intracellular trafficking proteins, and ion channel proteins.

ZFAS1 can be used to measure or modulate the activity of these proteins. Measurement of protein levels or activity could be achieved by using ZFAS1 as a proxy. ZFAS 1 levels may be determined in tissue by measuring the RNA level of ZFAS1 using an approach such as reverse transcriptase qPCR or next generation sequencing of RNA. Modulation of protein function could be achieved by ectopic expression of ZFAS1 (or a sub-region thereof) via a delivery vehicle to the patient or by knockdown of ZFAS1 by some means such as ectopic expression of antisense oligos.

Throughout the specification the aim has been to describe the preferred embodiments of the invention without limiting the invention to any one embodiment or specific collection of features. It will therefore be appreciated by those of skill in the art that, in light of the instant disclosure, various modifications and changes can be made in the particular embodiments exemplified without departing from the scope of the present invention.

All computer programs, algorithms, patent and scientific literature referred to herein is incorporated herein by reference.

TABLES

Table 1. Summary of microarray expression results

Developmental Gene Fold -change > 8 B-score >1.5 p-value <0.05 stage classification

Pregnancy / Protein coding 754 290 (38.5%) 747 (99%) lactating ncRNA 125 55 (44%) 120 (96%)

Protein 506 170 (35.5%) 494 (97.6%) coding/ncRNA

Pregnancy / Protein coding 122 39 (32%) 44 (36%) involuting ncRNA 25 2 (8%) 4 (16%)

Protein 65 19 (29.2%) 21 (32.3%) coding/ncRNA

Lactating / Protein coding 89 23 (25.8%) 21 (23.5%) involuting ncRNA 3 0 0

Protein 63 16 (25.4%) 14 (22.2%) coding/ncRNA

Table 2. The list of small RNA derived from long ncRNA among the differentially expressed ncRNAs in mammary gland development.

Developmental Accession Target small RNA Target

stage number classification

Pregnancy / n5020_u4414 U40654_U27,

lactating n5021_u4415 U40654_U28,

n5022_u4416^" U40654_U29,

n5023_u4417 U40654JJ30,

n5024_u4418 U40654_U31,

n5025_u4419 U40654JJ22,

n5026_u4420 U40654_U25,

AK036616 n5027 u4421 U40654 U26 Non-coding

nl 493 ul413 AF357375 snoRNA,

AK002372 nl494 ul414 AF357376 snoRNA Non-coding

AK040602 nl471_ul391_AF357353_snoRNA Non-coding

nl457 ul377 AF357339 snoRNA,

nl 512 ul432 AF357394 snoRNA,

AK009175 nl519 ul439 AF357401 snoRNA Non-coding

nl441 ul361 AF357323 snoRNA,

nl475 ul395 AF357357 snoRNA,

nl490 ul410 AF357372 snoRNA,

AKO 10427 nl491 ul411 AF357373 snoRNA Non-coding

AK017164 mmu-mir-92-1 Non-coding

Pregnancy / n5020_u4414 U40654 U27,

involuting n5021_u4415 U40654 U28,

n5022_u4416 U40654 U29,

n5023_u4417 U40654 U30,

n5024_u4418 U40654 U31,

n5025_u4419 U40654 U22,

n5026_u4420 U40654 U25,

AK036616 n5027 u4421 U40654 U26 Non-coding

AK017164 mmu-mir-92-1 Non-coding

n2376_u2184 AJ278762_snr38,

n3492_u3121 AJ543400J 8,

n3493_u3122 AJ543401_R38, Non-coding/

AK007675 n3494 u3123 AJ543402 R38 Protein Coding

Non-coding/

BC042795 nl439 ul359 AF357321 snoRNA Protein Coding

Non-coding/

AK028938 nl482 ul402 AF357364 snoRNA Protein Coding

Lactating / AK004608 n5580_u4880_X54402_u 14, Non-coding/ involuting n5580_u4880_X54402_u 14, Protein Coding

n5581 u4881 X54403 ul4 Table 3. Primers used to amplify mouse Zfasl and human ZFAS1.

Primers used to amplify mouse Zfasl (accession number BC042795)

size of PCR primer Sequence Tm (°C) product (bp)

Primer used in qRT-PCR ZnfxNCIF GAGGTTGGAGGGAGAGAAGG 60.1

ZnfxNClR CTCAGGAGTTCACGCTCCAT 60.4 114

PCR product cloned for

ISH ZnfxNCFS CGGGATCCATGTCTCGTCCCTCCGG 77.4

ZnfxNCR3 CGGAATTATTTAAATATCATTAGTCAGA 57.6 420

Primers used to amplify mouse Znfxl (accession number NM OO 1033196)

Primer used in qRT-PCR ZnfxL-F AAGGCATCTACGGGTGTCAG 60.1

ZnfxL-R CTTGTTCCTCAGCTCCCTCA 60.5 101

Primers used to amplify mouse snoRNA

Primers used to amplify

Snordl2s Snord 12F AG AACTG ATG ATATC ATTTCTTTCCC 60

Snordl2R TGATGCATCAGACAAAACTGG 59.7 83

Snord 12BF ACAGGCATGTGTGATGACACA 61.1

Snord 12BR AGGCATGTCAGACATACTGGC 60.2 87

Snord 12CF AGAAGGTGTAAATGATGAACTCACTTT

Snord 12CR GCTGGTGTTTATCAGGACAAACT 94

Primers used to amplify mouse Casein beta (Csn2) (accession number NM_009972.1 )

Primer used in qRT-PCR bCasein FOR GGCAGAGGATGTGCTCCAGG 61.7

bCasein REV GGGACGGGATTGCAAGAGATG 62.5 102

Primers used to amplify human ZFASl (accession number NR 003605, and NR 003606)

Tm size of PCR product primer Sequence (°C) (bp)

hZnfxNcl-

Fl AAGCCACGTGCAGACATCTA 59.47

hZnfxNcl-

Primer used in qRT-PCR Rl CTACTTCCAACACCCGCATT 59.99 103

hZnfxNcl-

Fl AAGCCACGTGCAGACATCTA 59.47

primers to detect different hZnfxNcl- isoforms R2 TTTCTTTATGCAGGTAGGCAGTT 59.36 384, 324, 231 hZnfxNcl-

Fl AAGCCACGTGCAGACATCTA 59.47

primers to detect different hZnfxNc2- isoforms Rl TCATGAAAGCACAGGGTCTG 59.83 254, 191 , 104

Primers used to amplify mouse ZNFX1 (accession number NM 021035)

hZNFXl Fl ATCATGCTTTGGACCAGTTTCT 60

Primer used in qRT-PCR hZNFXlRl TAGGGTGAACTGCTTCAGGATT 60.13 107

Table 4. OriGene Cancer Survey Panel.

Tissue Sample Quantity

Normal Tumour Combined

Adrenal gland 5 10 15

Breast 2 23 25

Cervix 4 9 13

Colon 7 13 20

Endometrium 2 15 17

Esophagus 3 20 23

Kidney 5 18 23

Liver 3 17 20

Lung 3 20 23

Lymph node 3 34 37

Ovary 3 21 24

Pancreas 4 17 21

Prostate 5 21 26

Stomach 5 14 19

Testis 6 19 25

Thyroid 3 18 21

Urinary Bladder 2 22 24

Uterus 3 2 5

Total 68 313 381

Table 5. Proteins that show enriched binding to ZFASl.

Name F635 B635 F635/ Standard deviation

Median Median B635 above mean

APTX 2749 234 11.75 21.11

APTX 2670 241 1 1.08 19.77

C14orf153 2755 345 7.99 13.60

C14orf153 2648 341 7.77 13.16

TRUB1 2611 343 7.61 12.85

SSX2 2549 339 7.52 12.67

SSX2 2377 327 7.27 12.17

40788 2065 302 6.84 1 1.31

40788 1913 282 6.78 1 1.20

ND 2018 318 6.35 10.33

TRUB1 1914 320 5.98 9.60

RP1 1-529110.4 2084 353 5.90 9.44

COX6B1 1781 302 5.90 9.43

COX6B1 1689 288 5.86 9.36

ND 1814 310 5.85 9.34

RP1 1-529110.4 1919 341 5.63 8.89

TP53I13 2145 385 5.57 8.78

KCNAB2 1864 336 5.55 8.73

TIA1 2418 438 5.52 8.68

ALDH1 L1 3842 709 5.42 8.47

ALDH1 L1 3746 698 5.37 8.37

2249 421 5.34 8.32

ARMC2 21 15 407 5.20 8.03

ARMC2 2095 410 5.1 1 7.86

POLR3C 1195 235 5.09 7.81

ANXA2 1321 260 5.08 7.80

RFPL1 2208 439 5.03 7.70

IL7R 2356 471 5.00 7.64

TP53I13 2156 436 4.94 7.53

2149 435 4.94 7.52

FKBP5 1721 349 4.93 7.50

TCL1 B 1186 242 4.90 7.44

HNF4A 2194 450 4.88 7.39

POLR3C 1152 237 4.86 7.36

FKBP5 1631 343 4.76 7.15

TCL1 B 1145 241 4.75 7.14

ANXA2 1251 264 4.74 7.12

AQP8 1871 399 4.69 7.02

BRPF3 2050 439 4.67 6.98

2149 461 4.66 6.96

SNCA 1170 251 4.66 6.96

2113 465 4.54 6.73

SNCA 1141 252 4.53 6.70

ND 2009 453 4.43 6.51

IL7R 2199 509 4.32 6.28

DDX25 2022 469 4.31 6.26

ZMAT3 2211 514 4.30 6.24

DGCR14 2088 491 4.25 6.15

ARRDC4 2051 485 4.23 6.10

WDR66 2249 540 4.16 5.97

THPO 2194 534 4.11 5.86

EXOSC3 1621 395 4.10 5.85

BCAP29 1948 475 4.10 5.84

BCAS3 1841 450 4.09 5.82

LOC 136242 1791 442 4.05 5.75

ZNF263 1898 471 4.03 5.70

LGALS8 2135 532 4.01 5.67

1548 386 4.01 5.66

NPM1 1981 495 4.00 5.65

SLC11A2 2141 535 4.00 5.65

GPR110 1952 489 3.99 5.63

CARS 1285 322 3.99 5.62

HOXD10 2073 522 3.97 5.59

TAF15 2252 568 3.96 5.57

AACS 1838 465 3.95 5.55

CASC4 1641 416 3.94 5.53

FAM39DP 1739 443 3.93 5.49

SNCB 1011 258 3.92 5.48

SNCB 1007 257 3.92 5.48

1967 503 3.91 5.46

SYT6 1864 477 3.91 5.46

BRPF3 2086 536 3.89 5.43

CDKN2B 1182 304 3.89 5.42

SFRS2B 2043 526 3.88 5.41

CARS 1296 334 3.88 5.40

UNC13D 2114 547 3.86 5.37

CDKN2B 1167 302 3.86 5.37

PSMA6 1394 362 3.85 5.34

ZNF287 2075 539 3.85 5.34

ZNF287 1922 500 3.84 5.33

RCC1 2123 553 3.84 5.32

1931 509 3.79 5.23

N.D. 2153 568 3.79 5.22

ARRDC4 2003 529 3.79 5.22

RCC1 1988 526 3.78 5.20

1998 530 3.77 5.18

PRND 1928 514 3.75 5.15

CLK1 1585 423 3.75 5.14

TMEM64 1989 531 3.75 5.14

WDR21C 1965 527 3.73 5.10

MRPL52 1650 445 3.71 5.06

ND 1356 366 3.70 5.05

2120 574 3.69 5.03

LRRC15 1950 528 3.69 5.03

DDX53 1691 459 3.68 5.01

F635 indicates the foreground fluorescence intensity of Cy5-labelled ZFASl on the prtotein array and B635 indicates the background fluorescence intensity. F635/B635 is the ratio between foreground and background intensity. The Standard deviation above the mean indicates the number of standard deviations above the mean F635/E5635 across the entire array.

REFERENCES

Al-Shahrour F, Minguez P, Tarraga J, Montaner D, Alloza E, Vaquerizas JM, Conde L, Blaschke C, Vera J, Dopazo J. 2006. BABELOMICS: a systems biology perspective in the functional annotation of genome-scale experiments. Nucleic Acids Res 34: W472-476.

Amaral PP, Clark MB, Gascoigne DK, Dinger ME, Mattick JS. 2010. IncRNAdb: a reference database for long noncoding RNAs. Nucleic Acids Res 39.

Amaral PP, Mattick JS. 2008. Noncoding RNA in development. Mamm Genome 19: 454-492.

Amaral PP, Neyt C, Wilkins SJ, Askarian-Amiri ME, Sunkin SM, Perkins AC, Mattick JS. 2009. Complex architecture and regulated expression of the Sox2ot locus during vertebrate development. Rna 15: 2013-2027.

Babak T, Blencowe BJ, Hughes TR. 2005. A systematic search for new mammalian noncoding RNAs indicates little conserved intergenic transcription. BMC Genomics 6: 104.

Badger JH, Olsen GJ. 1999. CRITICA: coding region identification tool invoking comparative analysis. Mol Biol Evol 16: 512-524.

Bejerano G, Pheasant M, Makunin I, Stephen S, Kent WJ, Mattick JS, Haussler D. 2004. Ultraconserved elements in the human genome. Science 304: 1321-1325. Birney E Stamatoyannopoulos J A Dutta A Guigo R Gingeras TR Margulies EH Weng Z Snyder M Dermitzakis ET Thurman RE et al. 2007. Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project. Nature 447: 799-816.

Brosius J. 2005. Waste not, want not—transcript excess in multicellular eukaryotes. Trends Genet 21: 287-288.

Calin GA, Liu CG, Ferracin M, Hyslop T, Spizzo R, Sevignani C, Fabbri M, Cimmino A, Lee EJ, Wojcik SE et al. 2007. Ultraconserved regions encoding ncRNAs are altered in human leukemias and carcinomas. Cancer Cell 12: 215-229.

Carninci P Kasukawa T Katayama S Gough J Frith MC Maeda N Oyama R Ravasi T Lenhard 3 W c ! I s C ct al. 2005. The landscape of the mammalian genome. Science 309: 1559-1563.

Dieci G, Preti M, Montanini B. 2009. Eukaryotic snoRNAs: a paradigm for gene expression flexibility. Genomics 94: 83-88. Dinger ME, Amaral PP, Mercer TR, Mattick JS. 2009. Pervasive transcription of the eukaryotic genome: functional indices and conceptual implications. Brief Fund Genomic Proteomic 8: 407-423.

Dinger ME, Amaral PP, Mercer TR, Pang KC, Bruce SJ, Gardiner BB, Askarian- Amiri ME, Ru K, Solda G, Simons C et al. 2008a. Long noncoding RNAs in mouse embryonic stem cell pluripotency and differentiation. Genome Res 18: 1433-1445.

Dinger ME, Pang KC, Mercer TR, Mattick JS. 2008b. Differentiating protein-coding and noncoding RNA: challenges and ambiguities. PLoS Comput Biol 4: el000176.

Dong XY, Guo P, Boyd J, Sun X, Li Q, Zhou W, Dong JT. 2009. Implication of snoRNA U50 in human breast cancer. J Genet Genomics 36: 447-454.

Dunphy EJ, McNeel DG. 2005. Antigen-specific IgG elicited in subjects with prostate cancer treated with flt3 ligand. J Immunother 28: 268-275.

Eis PS, Tarn W, Sun L, Chadburn A, Li Z, Gomez MF, Lund E, Dahlberg JE. 2005. Accumulation of miR-155 and BIC RNA in human B cell lymphomas. Proc Natl Acad Sci USA 102: 3627-3632.

Ender C, Krek A, Friedlander MR, Beitzinger M, Weinmann L, Chen W, Pfeffer S, Rajewsky N, Meister G. 2008. A human snoRNA with microRNA-like functions. Mol Cell 32: 519-528.

Engstrom PG, Suzuki H, Ninomiya N, Akalin A, Sessa L, Lavorgna G, Brozzi A, Luzi L, Tan SL, Yang L et al. 2006. Complex loci in human and mouse genomes. PLoS Genet 2: e47.

Feng J, Bi C, Clark BS, Mady R, Shah P, Kohtz JD. 2006. The Evf-2 noncoding RNA is transcribed from the Dlx-5/6 ultraconserved region and functions as a Dlx-2 transcriptional coactivator. Genes Dev 20: 1470-1484.

Frith MC, Bailey TL, Kasukawa T, Mignone F, Kummerfeld SK, Madera M, Sunkara S, Furuno M, Bult CJ, Quackenbush J et al. 2006. Discrimination of non-protein- coding transcripts from protein-coding mRNA. RNA Biol 3: 40-48.

Gabory A, Jammes H, Dandolo L. 2010. The H19 locus: role of an imprinted non- coding RNA in growth and development. Bioessays 32: 473-480.

Georgopoulou N, Hurel C, Politis PK, Gaitanou M, Matsas R, Thomaidou D. 2006. BM88 is a dual function molecule inducing cell cycle exit and neuronal differentiation of neuroblastoma cells via cyclin Dl down-regulation and retinoblastoma protein hypophosphorylation. J Biol Chem 281: 33606-33620. Guttman M, Amit I, Garber M, French C, Lin MF, Feldser D, Huarte M, Zuk O, Carey BW, Cassady JP et al. 2009. Chromatin signature reveals over a thousand highly conserved large non-coding RNAs in mammals. Nature 458: 223-227.

Hennighausen L, Robinson GW. 1998. Think globally, act locally: the making of a mouse mammary gland. Genes Dev 12: 449-455.

Hennighausen L, Robinson GW. 2001. Signaling pathways in mammary gland development. Dev Cell 1: 467-475.

Hernandez A, Garcia B, Obregon MJ. 2007. Gene expression from the imprinted Dio3 locus is associated with cell proliferation of cultured brown adipocytes. Endocrinology 148: 3968-3976.

Huang ZP, Zhou H, He HL, Chen CL, Liang D, Qu LH. 2005. Genome-wide analyses of two families of snoRNA genes from Drosophila melanogaster, demonstrating the extensive utilization of introns for coding of snoRNAs. Rna 11: 1303-1316.

Huarte M, Rinn JL. 2010. Large non-coding RNAs: missing links in cancer? Hum Mol Genet 19: R152-161.

Huttenhofer A, Kiefmann M, Meier-Ewert S, O'Brien J, Lehrach H, Bachellerie JP, Brosius J. 2001. RNomics: an experimental approach that identifies 201 candidates for novel, small, non-messenger RNAs in mouse. Embo J 20: 2943-2953.

Kapranov P, Cawley SE, Drenkow J, Bekiranov S, Strausberg RL, Fodor SP, Gingeras TR. 2002. Large-scale transcriptional activity in chromosomes 21 and 22. Science 296: 916-919.

Kapranov P, Cheng J, Dike S, Nix DA, Duttagupta R, Willingham AT, Stadler PF, Hertel J, Hackermuller J, Hofacker IL et al. 2007a. RNA maps reveal new RNA classes and a possible function for pervasive transcription. Science 316: 1484-1488. Kapranov P, Willingham AT, Gingeras TR. 2007b. Genome-wide transcription and the implications for genomic organization. Nat Rev Genet 8: 413-423.

Keydar I, Chen L, Karby S, Weiss FR, Delarea J, Radu M, Chaitcik S, Brenner HJ. 1979. Establishment and characterization of a cell line of human breast carcinoma origin. Eur J Cancer 15: 659-670.

Kino T, Hurt DE, Ichijo T, Nader N, Chrousos GP. 2010. Noncoding RNA gas5 is a growth arrest- and starvation-associated repressor of the glucocorticoid receptor. Sci Signal 3: ra8.

Lasfargues EY, Coutinho WG, Dion AS. 1979. A human breast tumor cell line (BT- 474) that supports mouse mammary tumor virus replication. In Vitro 15: 723-729. Master SR, Hartman JL, D'Cruz CM, Moody SE, Keiper EA, Ha SI, Cox JD, Belka GK, Chodosh LA. 2002. Functional microarray analysis of mammary organogenesis reveals a developmental role in adaptive thermogenesis. Mol Endocrinol 16: 1 185- 1203.

Mazar J, Sinha S, Dinger ME, Mattick JS, Perera RJ. 2010. Protein-coding and non- coding gene expression analysis in differentiating human keratinocytes using a three- dimensional epidermal equivalent. Mol Genet Genomics 284: 1-9.

Mercer TR, Dinger ME, Mattick JS. 2009. Long noncoding RNAs: insights into function. Nat Rev Genet 10: 155-159.

Mercer TR, Dinger ME, Sunkin SM, Mehler MF, Mattick JS. 2008. Specific expression of long noncoding RNAs in the mouse brain. Proc Natl Acad Sci USA 105: 716-721.

Mercer TR, Qureshi IA, Gokhan S, Dinger ME, Li G, Mattick JS, Mehler MF. 2010. Long noncoding RNAs in neuronal-glial fate specification and oligodendrocyte lineage maturation. BMC Neurosci 11: 14.

Metcalfe AD, Gilmore A, Klinowska T, Oliver J, Valentijn AJ, Brown R, Ross A, MacGregor G, Hickman JA, Streuli CH. 1999. Developmental regulation of Bcl-2 family protein expression in the involuting mammary gland. J Cell Sci 112 ( Pt 11): 1771-1783.

Mosmann T. 1983. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods 65: 55-63.

Mourtada-Maarabouni M, Pickard MR, Hedge VL, Farzaneh F, Williams GT. 2009. GAS 5, a non-protein-coding RNA, controls apoptosis and is downregulated in breast cancer. Oncogene 28: 195-208.

Naylor MJ, Oakes SR, Gardiner-Garden M, Harris J, Blazek K, Ho TW, Li FC, Wynick D, Walker AM, Ormandy CJ. 2005. Transcriptional changes underlying the secretory activation phase of mammary gland development. Mol Endocrinol 19: 1868-1883.

Pang KC, Dinger ME, Mercer TR, Malquori L, Grimmond SM, Chen W, Mattick JS. 2009. Genome-wide identification of long noncoding RNAs in CD8+ T cells. J Immunol 182: 7738-7748.

Pelczar P, Filipowicz W. 1998. The host gene for intronic Ul 7 small nucleolar RNAs in mammals has no protein-coding potential and is a member of the 5 '-terminal oligopyrimidine gene family. Mol Cell Biol 18: 4509-4518. Ponjavic J, Ponting CP, Lunter G. 2007. Functionality or transcriptional noise? Evidence for selection within long noncoding RNAs. Genome Res 17: 556-565.

Ravasi T, Suzuki H, Pang KC, Katayama S, Furuno M, Okunishi R, Fukuda S, Ru K, Frith MC, Gongora MM et al. 2006. Experimental validation of the regulated expression of large numbers of non-coding RNAs from the mouse genome. Genome Res 16: 1 1-19.

Robinson GW, McKnight RA, Smith GH, Hennighausen L. 1995. Mammary epithelial cells undergo secretory differentiation in cycling virgins but require pregnancy for the establishment of terminal differentiation. Development 121: 2079- 2090.

Song Z, Krishna S, Thanos D, Strominger JL, Ono SJ. 1994. A novel cysteine-rich sequence-specific DNA-binding protein interacts with the conserved X-box motif of the human major histocompatibility complex class II genes via a repeated Cys-His domain and functions as a transcriptional repressor. J Exp Med 180: 1763-1774. Soule HD, Vazguez J, Long A, Albert S, Brennan M. 1973. A human cell line from a pleural effusion derived from a breast carcinoma. J Natl Cancer Inst 51: 1409-1416.

Struhl K. 2007. Transcriptional noise and the fidelity of initiation by RNA polymerase II. Nat Struct Mol Biol 14: 103-105.

Sunwoo H, Dinger ME, Wilusz JE, Amaral PP, Mattick JS, Spector DL. 2009. MEN varepsilon/beta nuclear-retained non-coding RNAs are up-regulated upon muscle differentiation and are essential components of paraspeckles. Genome Res 19: 347- 359.

Taft RJ, Glazov EA, Lassmann T, Hayashizaki Y, Carninci P, Mattick JS. 2009. Small RNAs derived from snoRNAs. RNA.

Tan- Wong SM, French JD, Proudfoot NJ, Brown MA. 2008. Dynamic interactions between the promoter and terminator regions of the mammalian BRCAl gene. Proc Natl Acad Sci USA 105: 5160-5165.

Trinklein ND, Aldred SF, Hartman SJ, Schroeder DI, Otillar RP, Myers RM. 2004. An abundance of bidirectional promoters in the human genome. Genome Res 14: 62- 66.

Troester MA, Hoadley KA, Sorlie T, Herbert BS, Borresen-Dale AL, Lonning PE, Shay JW, Kaufmann WK, Perou CM. 2004. Cell-type-specific responses to chemotherapeutics in breast cancer. Cancer Res 64: 4218-4226. Vizcaino JA, Cote R, Reisinger F, Foster JM, Mueller M, Rameseder J, Hermjakob H, Martens L. 2009. A guide to the Proteomics Identifications Database proteomics data repository. Proteomics 9: 4276-4283.

Wang H, Iacoangeli A, Lin D, Williams K, Denman RB, Hellen CU, Tiedge H. 2005. Dendritic BC 1 RNA in translational control mechanisms. J Cell Biol 171: 811 -821.

Wang Z, Zang C, Rosenfeld JA, Schones DE, Barski A, Cuddapah S, Cui K, Roh TY, Peng W, Zhang MQ et al. 2008. Combinatorial patterns of histone acetylations and methylations in the human genome. Nat Genet 40: 897-903.

Washietl S, Hofacker IL, Lukasser M, Huttenhofer A, Stadler PF. 2005. Mapping of conserved RNA secondary structures predicts thousands of functional noncoding RNAs in the human genome. Nat Biotechnol 23: 1383-1390.

Wilusz JE, Sunwoo H, Spector DL. 2009. Long noncoding RNAs: functional surprises from the RNA world. Genes Dev 23: 1494-1504.

Yan MD, Hong CC, Lai GM, Cheng AL, Lin YW, Chuang SE. 2005. Identification and characterization of a novel gene Saf transcribed from the opposite strand of Fas. Hum Mol Genet 14: 1465-1474.

Yang JH, Zhang XC, Huang ZP, Zhou H, Huang MB, Zhang S, Chen YQ, Qu LH. 2006. snoSeeker: an advanced computational package for screening of guide and orphan snoRNA genes in the human genome. Nucleic Acids Res 34: 51 12-5123. Zucchi I, Bini L, Albani D, Valaperta R, Liberatori S, Raggiaschi R, Montagna C, Susani L, Barbieri O, Pallini V et al. 2002. Dome formation in cell cultures as expression of an early stage of lactogenic differentiation of the mammary gland. Proc Natl Acad Sci USA 99: 8660-8665.

Claims

A method of diagnosis of a cancer, or a predisposition thereto, in a mammal, said method including the step of determining a level and/or an activity of a ZFAS1 nucleic acid in a biological sample obtained or obtainable from said mammal, which level and/or activity is indicative of said cancer, or said predisposition thereto, in said mammal.

The method of Claim 1 , wherein said level and/or said activity of said ZFAS1 nucleic acid in said biological sample is at least partly reduced compared to a corresponding level and/or activity of the ZFAS1 nucleic acid in a biological sample obtained or obtainable from a mammal that does not have said cancer, or said predisposition thereto.

The method of Claim 1 or Claim 2, wherein said cancer is a breast cancer. The method of Claim 3, wherein said cancer is a mammary ductal carcinoma. The method of Claim 1 , wherein said level and/or said activity of said ZFAS1 nucleic acid in said biological sample is at least partly increased compared to a corresponding level and/or activity of the ZFAS1 nucleic acid in a biological sample obtained or obtainable from a mammal that does not have said cancer, or said predisposition thereto.

The method of Claim 1 or Claim 5, wherein said cancer is an adrenal gland cancer, a colon cancer, a liver cancer, a testis cancer, or a thyroid cancer. The method of any one of Claims 1-6, wherein said ZFAS1 nucleic acid is selected from the group of ZFAS1 nucleic acids consisting of: a 685 bp nucleic acid; a 677 bp nucleic acid; a 529 bp nucleic acid, a 615 bp nucleic acid , and a 500 bp nucleic acid.

The method of any one of Claims 1-4 and 7, wherein an at least partly reduced level and/or activity of a ZFAS1 snoRNA nucleic acid, is indicative of said cancer, or said predisposition thereto, in said mammal.

The method of any one of Claims 1 and 5-7, wherein an at least partly increased level and/or activity of a ZFAS1 snoRNA nucleic acid, is indicative of said cancer, or said predisposition thereto, in said mammal. The method of Claim 8 or Claim 9, wherein said ZFAS1 snoRNA nucleic acid is a C/D box-containing homologous snoRNA selected from the group consisting of SNORD12, SNORD12B, and SNORD12C.

The method of any one of Claims 1-10, wherein said mammal is a human. A kit for cancer diagnosis, said kit comprising one or more probes, primers, antibodies and/or other reagents for detecting: (i) a ZFAS1 nucleic acid, or a fragment thereof; (ii) a ZFAS1 snoRNA, or a fragment thereof; and/or (iii) a ZFAS1 modulator, or a fragment thereof.

The kit of Claim 12, wherein said kit is suitable for use with the method of any one of Claims 1-11.

A method of designing, engineering, screening for, or otherwise producing a cancer therapeutic agent, said method including the step of identifying a candidate agent which at least partly modulates the expression and/or activity of a ZFAS1 nucleic acid.

The method of Claim 14, wherein the candidate agent mimics, reproduces or otherwise replicates the activities of said ZFAS1 nucleic acid.

The method of Claim 14 or Claim 15, wherein the candidate agent enhances, increases or otherwise induces the expression and/or activity of said ZFAS1 nucleic acid.

The method of Claim 14 or Claim 15, wherein the candidate agent minimises, decreases or otherwise reduces the expression and/or activity of said ZFAS1 nucleic acid.

The method of any one of Claims 14-17, wherein the candidate agent is a synthetic ZFAS1 nucleic acid, a fragment thereof, or a nucleic acid comprising a nucleotide sequence having at least 70% identity thereto; or a nucleic acid construct comprising a ZFAS1 nucleic acid, a fragment thereof, or a nucleic acid comprising a nucleotide sequence having at least 70% identity thereto.

The method of Claim 14, wherein the candidate agent is a modulator that induces, activates or otherwise stimulates a ZFAS1 enhancer and/or promoter. The method of Claim 14, wherein the candidate agent is a modulator that reduces, inactivates or otherwise inhibits a ZFASl enhancer and/or promoter. The method of Claim 14, wherein the candidate agent at least partly modulates the expression and/or activity of a ZFASl C/D box-containing homologous snoRNA selected from the group consisting of SNORD12, SNORD12B, and SNORD12C.

The method of any one of Claims 14-21, wherein the candidate agent at least partly reduces, lowers or otherwise decreases cell proliferation.

The method of Claim 22, wherein the candidate agent at least partly reduces tumour cell proliferation.

A cancer therapeutic agent designed, engineered, screened for, or otherwise produced according to the method of any one of Claims 14-23 for use in the treatment of a mammal that has a cancer or a predisposition thereto.

The cancer therapeutic agent of Claim 24, wherein said cancer is a breast cancer.

The cancer therapeutic agent of Claim 25, wherein said cancer is a mammary ductal carcinoma.

The cancer therapeutic agent of Claim 24, wherein said cancer is an adrenal gland cancer, a colon cancer, a liver cancer, a testis cancer, or a thyroid cancer.

The cancer therapeutic agent of any one of Claims 24-27, wherein said cancer therapeutic agent is a synthetic ZFASl nucleic acid, a fragment thereof, or a nucleic acid comprising a nucleotide sequence having at least 70% identity thereto; or a nucleic acid construct comprising a ZFASl nucleic acid, a fragment thereof, or a nucleic acid comprising a nucleotide sequence having at least 70% identity thereto.

The cancer therapeutic agent of any one of Claims 24-26, wherein the cancer therapeutic agent is a modulator that induces, stimulates, or otherwise activates a ZFASl promoter and/or enhancer. The cancer therapeutic agent of Claim 24 or Claim 27, wherein the cancer therapeutic agent is a modulator that reduces, inhibits, or otherwise inactivates a ZFAS1 promoter and/or enhancer.

The cancer therapeutic agent of any one of Claims 24-27, wherein the cancer therapeutic agent at least partly modulates the expression and/or activity of one or more C/D box-containing homologous ZFAS1 snoR A nucleic acids selected from the group consisting of SNORD12, SNORD12B, and SNORD12C.

The cancer therapeutic agent of any one of Claims 24-31, wherein the mammal is a human.

A pharmaceutical composition comprising the cancer therapeutic agent of any one of Claims 24-32, and a pharmaceutically acceptable carrier, diluent or excipient.

A method of prophylactic and/or therapeutic treatment of a cancer in a mammal, said method including the step of delivering the cancer therapeutic agent of any one of Claims 24-32, or the pharmaceutical composition of Claim 33, to said mammal to thereby treat said mammal.

A method of determining whether a mammal with cancer is responsive to cancer therapy, said method including the steps of (i) isolating a biological sample from the mammal before and after said cancer therapy; and (ii) measuring a level and/or activity of a ZFAS1 nucleic acid, or a fragment thereof, in said biological sample, to thereby determine whether said mammal is responsive to cancer therapy.

The method of Claim 35, wherein said cancer is a breast cancer.

The method of Claim 36, wherein said cancer is a mammary ductal carcinoma.

The method of any one of Claims 35-37, wherein an at least partly increased, elevated or otherwise higher level and/or activity of a ZFAS1 nucleic acid indicates that said mammal is at least partly responsive to cancer therapy. The method of any one of Claims 35-38, wherein an at least partly increased, elevated or otherwise higher level and/or activity of a ZFAS1 snoRNA nucleic acid indicates that said mammal is at least partly responsive to cancer therapy.

The method of any one of Claims 35-38, wherein an at least partly increased, elevated or otherwise higher level and/or activity of a ZFAS1 modulator indicates that said mammal is at least partly responsive to cancer therapy. The method of Claim 35, wherein said cancer is an adrenal gland cancer, a colon cancer, a liver cancer, a testis cancer, or a thyroid cancer.

The method of Claim 35 or Claim 41, wherein an at least partly decreased, lessened or otherwise lower level and/or activity of a ZFAS1 nucleic acid indicates that said mammal is at least partly responsive to cancer therapy. The method of Claim 35, Claim 41, or Claim 42, wherein an at least partly decreased, lessened or otherwise lower level and/or activity of a ZFAS1 snoRNA nucleic acid indicates that said mammal is at least partly responsive to cancer therapy.

The method of Claim 35, Claim 41, or Claim 42, wherein an at least partly decreased, lessened or otherwise lower level and/or activity of a ZFAS1 modulator indicates that said mammal is at least partly responsive to cancer therapy.

A method of modulating cell proliferation in one or more cells, said method including the step of introducing: (i) a synthetic ZFAS1 nucleic acid, a fragment thereof, or a nucleic acid comprising a nucleotide sequence having at least 70% identity thereto; (ii) a nucleic acid construct comprising a ZFAS1 nucleic acid, a fragment thereof, or a nucleic acid comprising a nucleotide sequence having at least 70% identity thereto; or (iii) a ZFAS1 inhibitor, to said one or more cells, to thereby modulate said cell proliferation.

The method of Claim 45, wherein said introduction of said synthetic nucleic acid or said fragment thereof, or said nucleic acid construct, at least partly reduces, suppresses or otherwise lowers cell proliferation.

The method of Claim 45 or Claim 46, wherein said one or more cells are tumour cells. The method of Claim 45, wherein said introduction of said ZFAS1 inhibitor induces, elevates or otherwise increases cell proliferation.

The method of Claim 45 or Claim 48, wherein said introduction of said ZFAS1 inhibitor at least partly silences, knocks-down, blocks, inhibits, reduces, suppresses or otherwise lowers the expression and/or activity of a ZFAS1 nucleic acid.

The method of any one of Claims 45-49, wherein said method is performed in vitro.

The method of Claim 50, wherein said one or more cells are a cell culture. A method of diagnosis of a cancer, or a predisposition thereto, in a mammal, said method including the steps of determining a level of a ZFAS1 nucleic acid and determining a level of a ZNFXl protein or a nucleic acid encoding a ZNFXl protein in a biological sample obtained or obtainable from said mammal, which levels are indicative of said cancer, or said predisposition thereto, in said mammal.

The method of Claim 52, wherein a ratio of said levels of a ZFAS1 nucleic acid and of a ZNFXl protein or a nucleic acid encoding a ZNFXl protein in said biological sample is indicative of said cancer, or said predisposition thereto, in said mammal.

The method of Claim 52 or Claim 53, wherein said cancer is a cancer relating to female reproductive tissues.

The method of Claim 54, wherein said cancer is cancer of the breast, cervix, endometrium, ovary, and/or uterus.

A method of diagnosis of a cancer, or a predisposition thereto, in a mammal, said method including the step of determining a level of a ZNFXl protein or a nucleic acid encoding a ZNFXl protein in a biological sample obtained or obtainable from said mammal, which level is indicative of said cancer, or said predisposition thereto, in said mammal.

The method of Claim 56, wherein said level of said ZNFXl protein or a nucleic acid encoding a ZNFXl protein in said biological sample is at least partly reduced compared to a corresponding level of the ZNFXl protein or a nucleic acid encoding a ZNFXl protein in a biological sample obtained or obtainable from a mammal that does not have said cancer, or said predisposition thereto.

The method of Claim 57, wherein said cancer is a testis cancer.