WO2011149353A1

WO2011149353A1 - Yeast strains engineered to produce ethanol from acetic acid and glycerol

Info

Publication number: WO2011149353A1
Application number: PCT/NL2011/050375
Authority: WO
Inventors: Johannes Adrianus Maria De Bont; Aloysius Wilhelmus Rudolphus Hubertus Teunissen
Original assignee: C5 Yeast Company B.V.
Priority date: 2010-05-27
Filing date: 2011-05-27
Publication date: 2011-12-01

Abstract

The present invention relates to processes for producing ethanol from lignocellulosic hydrolysates comprising hexoses, pentoses and acetic acid, whereby genetically modified yeast cells are use that comprise an exogenous gene encoding anacetaldehyde dehydrogenase. The process is further characterised in that glycerol is present in or fed into the culture medium, whereby the modified yeast cell ferments the hexoses, pentoses, acetic acid and glycerol to ethanol. The invention further relates to yeast cells for use in such processes. The yeast cells advantageously comprise genetic modifications that improve glycerol utilization such as modifications that increase one or more of glycerol dehydrogenase activity, dihydroxyacetone kinase activity and transport of glycerol into the cell. The yeast cell further preferably comprises a functional exogenous xylose isomerase gene and/or functional exogenous genes which confer to the cell the ability to convert L-arabinose into D-xylulose 5-phosphate and they may comprise a genetic modification that increase acetyl-CoA synthetase activity.

Description

Yeast strains engineered to produce ethanol from acetic acid and glycerol

Field of the invention

The present invention relates to metabolic engineering in microorganisms such as yeast. In particular the invention relates to yeast strains that have been engineered to produce ethanol from acetic acid and glycerol. In addition to acetic acid and glycerol, the yeast strain may also consume hexoses and pentoses for the production of ethanol. The invention further relates to the processes wherein the engineered strains of the invention produce ethanol from acetic acid and glycerol.

Background of the invention

Second generation bioethanol is produced from e.g. lignocellulosic fractions of plant biomass that is hydrolysed to free monomeric sugars, such as hexoses and pentoses, for fermentation to ethanol. Lignocellulosic hydro lysates contain high amounts of acetic acid, which is a potent inhibitor of the fermentative capacities of microorganisms used for ethanol production such as yeasts.

Sonderegger et al. (2004, Appl. Environ. Microbiol. 70: 2892-2897) disclose heterologous expression of phosphotransacetylase and acetaldehyde dehydrogenase in xylose-fermenting Saccharomyces cerevisiae strain. In combination with the native phosphoketolase, Sonderegger et al. thereby created a functional phosphoketolase pathway that is capable of net reoxidation of NADH generated by the heterologous expression of a xylose reductase and xylitol dehydrogenase that are used for xylose utilization in the strain.

Guadalupe et al. (2009, Appl. Environ. Microbiol. doi: 10.1128/AEM.01772-09) disclose a Saccharomyces cerevisiae strain wherein production of the by-product glycerol is eliminated by disruption of the endogenous NAD-dependent glycerol 3- phosphate dehydrogenase genes {GPDl and GPDl). Expression of the E. coli mhpF gene, encoding the acetylating NAD-dependent acetaldehyde dehydrogenase restored the ability of the GPD-disrupted strain to grow anaerobically by supplementation with of the medium with acetic acid.

Yu et al. (2010, Bioresour. Technol. 101(11):4157-61. Epub 2010 Feb 9) disclose Saccharomyces cerevisiae strains metabolically engineered for improved ethanol production from glycerol by simultaneous overexpression of glycerol dehydrogenase (GCY), dihydroxyacetone kinase (DAK) and the glycerol uptake protein (GUP1).

It is an object of the present invention to provide for yeasts that are capable of producing ethanol from acetic acid and glycerol (and hexoses and pentoses), as well as processes wherein these strains are used for the production of ethanol and/or other fermentation products.

Description of the invention

Definitions

Sequence identity is herein defined as a relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. In the art, "identity" also means the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the match between strings of such sequences. "Similarity" between two amino acid sequences is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide. "Identity" and "similarity" can be readily calculated by known methods. The terms "sequence identity" or "sequence similarity" means that two (poly)peptide or two nucleotide sequences, when optimally aligned, preferably over the entire length (of at least the shortest sequence in the comparison) and maximizing the number of matches and minimizes the number of gaps such as by the programs ClustalW (1.83), GAP or BESTFIT using default parameters, share at least a certain percentage of sequence identity as defined elsewhere herein. GAP uses the Needleman and Wunsch global alignment algorithm to align two sequences over their entire length, maximizing the number of matches and minimizes the number of gaps. Generally, the GAP default parameters are used, with a gap creation penalty = 50 (nucleotides) / 8 (proteins) and gap extension penalty = 3 (nucleotides) / 2 (proteins). For nucleotides the default scoring matrix used is nwsgapdna and for proteins the default scoring matrix is Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919). A preferred multiple alignment program for aligning protein sequences of the invention is ClustalW (1.83) using a blosum matrix and default settings (Gap opening penalty: 10; Gap extension penalty: 0.05). It is clear than when RNA sequences are said to be essentially similar or have a certain degree of sequence identity with DNA sequences, thymine (T) in the DNA sequence is considered equal to uracil (U) in the RNA sequence. Sequence alignments and scores for percentage sequence identity may be determined using computer programs, such as the GCG Wisconsin Package, Version 10.3, available from Accelrys Inc., 9685 Scranton Road, San Diego, CA 92121-3752 USA or the open-source software Emboss for Windows (current version 2.7.1- 07). Alternatively percent similarity or identity may be determined by searching against databases such as FASTA, BLAST, etc.

Preferred methods to determine identity are designed to give the largest match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Preferred computer program methods to determine identity and similarity between two sequences include e.g. the GCG program package (Devereux, J., et al, Nucleic Acids Research 12 (1):387 (1984)), BestFit, BLASTP, BLASTN, and FASTA (Altschul, S. F. et al, J. Mol. Biol. 215:403-410 (1990). The BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S., et al, NCBI NLM NIH Bethesda, MD 20894; Altschul, S., et al, J. Mol. Biol. 215:403-410 (1990). The well-known Smith Waterman algorithm may also be used to determine identity.

Preferred parameters for polypeptide sequence comparison include the following: Algorithm: Needleman and Wunsch, J. Mol. Biol. 48:443-453 (1970); Comparison matrix: BLOSSUM62 from Hentikoff and Hentikoff, Proc. Natl. Acad. Sci. USA. 89: 10915-10919 (1992); Gap Penalty: 12; and Gap Length Penalty: 4. A program useful with these parameters is publicly available as the "Ogap" program from Genetics Computer Group, located in Madison, WI. The aforementioned parameters are the default parameters for amino acid comparisons (along with no penalty for end gaps).

Preferred parameters for nucleic acid comparison include the following:

Algorithm: Needleman and Wunsch, J. Mol. Biol. 48:443-453 (1970); Comparison matrix: matches=+10, mismatch=0; Gap Penalty: 50; Gap Length Penalty: 3. Available as the Gap program from Genetics Computer Group, located in Madison, Wis. Given above are the default parameters for nucleic acid comparisons.

Optionally, in determining the degree of amino acid similarity, the skilled person may also take into account so-called "conservative" amino acid substitutions, as will be clear to the skilled person. Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide- containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulphur-containing side chains is cysteine and methionine. Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine- valine, and asparagine-glutamine. Substitutional variants of the amino acid sequence disclosed herein are those in which at least one residue in the disclosed sequences has been removed and a different residue inserted in its place. Preferably, the amino acid change is conservative. Preferred conservative substitutions for each of the naturally occurring amino acids are as follows: Ala to ser; Arg to lys; Asn to gin or his; Asp to glu; Cys to ser or ala; Gin to asn; Glu to asp; Gly to pro; His to asn or gin; He to leu or val; Leu to ile or val; Lys to arg; gin or glu; Met to leu or ile; Phe to met, leu or tyr; Ser to thr; Thr to ser; Trp to tyr; Tyr to trp or phe; and, Val to ile or leu.

Nucleotide sequences of the invention may also be defined by their capability to hybridise with parts of specific nucleotide sequences disclosed herein, respectively, under moderate, or preferably under stringent hybridisation conditions. Stringent hybridisation conditions are herein defined as conditions that allow a nucleic acid sequence of at least about 25, preferably about 50 nucleotides, 75 or 100 and most preferably of about 200 or more nucleotides, to hybridise at a temperature of about 65 °C in a solution comprising about 1 M salt, preferably 6 x SSC or any other solution having a comparable ionic strength, and washing at 65 °C in a solution comprising about 0.1 M salt, or less, preferably 0.2 x SSC or any other solution having a comparable ionic strength. Preferably, the hybridisation is performed overnight, i.e. at least for 10 hours and preferably washing is performed for at least one hour with at least two changes of the washing solution. These conditions will usually allow the specific hybridisation of sequences having about 90% or more sequence identity.

Moderate conditions are herein defined as conditions that allow a nucleic acid sequences of at least 50 nucleotides, preferably of about 200 or more nucleotides, to hybridise at a temperature of about 45 °C in a solution comprising about 1 M salt, preferably 6 x SSC or any other solution having a comparable ionic strength, and washing at room temperature in a solution comprising about 1 M salt, preferably 6 x SSC or any other solution having a comparable ionic strength. Preferably, the hybridisation is performed overnight, i.e. at least for 10 hours, and preferably washing is performed for at least one hour with at least two changes of the washing solution. These conditions will usually allow the specific hybridisation of sequences having up to 50% sequence identity. The person skilled in the art will be able to modify these hybridisation conditions in order to specifically identify sequences varying in identity between 50% and 90%.

A "nucleic acid construct" or "nucleic acid vector" is herein understood to mean a man-made nucleic acid molecule resulting from the use of recombinant DNA technology. The term "nucleic acid construct" therefore does not include naturally occurring nucleic acid molecules although a nucleic acid construct may comprise (parts of) naturally occurring nucleic acid molecules. The terms "expression vector" or expression construct" refer to nucleotide sequences that are capable of affecting expression of a gene in host cells or host organisms compatible with such sequences. These expression vectors typically include at least suitable transcription regulatory sequences and optionally, 3' transcription termination signals. Additional factors necessary or helpful in effecting expression may also be present, such as expression enhancer elements. The expression vector will be introduced into a suitable host cell and be able to effect expression of the coding sequence in an in vitro cell culture of the host cell. The expression vector will be suitable for replication in the host cell or organism of the invention.

As used herein, the term "promoter" or "transcription regulatory sequence" refers to a nucleic acid fragment that functions to control the transcription of one or more coding sequences, and is located upstream with respect to the direction of transcription of the transcription initiation site of the coding sequence, and is structurally identified by the presence of a binding site for DNA-dependent RNA polymerase, transcription initiation sites and any other DNA sequences, including, but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to one of skill in the art to act directly or indirectly to regulate the amount of transcription from the promoter. A "constitutive" promoter is a promoter that is active in most tissues under most physiological and developmental conditions. An "inducible" promoter is a promoter that is physiologically or developmentally regulated, e.g. by the application of a chemical inducer.

The term "selectable marker" is a term familiar to one of ordinary skill in the art and is used herein to describe any genetic entity which, when expressed, can be used to select for a cell or cells containing the selectable marker. The term "reporter" may be used interchangeably with marker, although it is mainly used to refer to visible markers, such as green fluorescent protein (GFP). Selectable markers may be dominant or recessive or bidirectional.

As used herein, the term "operably linked" refers to a linkage of polynucleotide elements in a functional relationship. A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For instance, a transcription regulatory sequence is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked means that the DNA sequences being linked are typically contiguous and, where necessary to join two protein encoding regions, contiguous and in reading frame.

The terms "protein" or "polypeptide" are used interchangeably and refer to molecules consisting of a chain of amino acids, without reference to a specific mode of action, size, 3-dimensional structure or origin.

"Fungi" (singular fungus) are herein understood as heterotrophic eukaryotic microorganism that digest their food externally, absorbing nutrient molecules into their cells. Fungi are a separate kingdom of eukaryotic organisms and include yeasts, molds, and mushrooms. The terms fungi, fungus and fungal as used herein thus expressly includes yeasts as well as filamentous fungi.

The term "gene" means a DNA fragment comprising a region (transcribed region), which is transcribed into an RNA molecule (e.g. an mRNA) in a cell, operably linked to suitable regulatory regions (e.g. a promoter). A gene will usually comprise several operably linked fragments, such as a promoter, a 5' leader sequence, a coding region and a 3'nontranslated sequence (3 'end) comprising a polyadenylation site. "Expression of a gene" refers to the process wherein a DNA region which is operably linked to appropriate regulatory regions, particularly a promoter, is transcribed into an RNA, which is biologically active, i.e. which is capable of being translated into a biologically active protein or peptide. The term "homologous" when used to indicate the relation between a given (recombinant) nucleic acid or polypeptide molecule and a given host organism or host cell, is understood to mean that in nature the nucleic acid or polypeptide molecule is produced by a host cell or organisms of the same species, preferably of the same variety or strain. If homologous to a host cell, a nucleic acid sequence encoding a polypeptide will typically (but not necessarily) be operably linked to another (heterologous) promoter sequence and, if applicable, another (heterologous) secretory signal sequence and/or terminator sequence than in its natural environment. It is understood that the regulatory sequences, signal sequences, terminator sequences, etc. may also be homologous to the host cell. In this context, the use of only "homologous" sequence elements allows the construction of "self-cloned" genetically modified organisms (GMO's) (self-cloning is defined herein as in European Directive 98/81/EC Annex II). When used to indicate the relatedness of two nucleic acid sequences the term "homologous" means that one single-stranded nucleic acid sequence may hybridize to a complementary single-stranded nucleic acid sequence. The degree of hybridization may depend on a number of factors including the amount of identity between the sequences and the hybridization conditions such as temperature and salt concentration as discussed later.

The terms "heterologous" and "exogenous" when used with respect to a nucleic acid (DNA or RNA) or protein refers to a nucleic acid or protein that does not occur naturally as part of the organism, cell, genome or DNA or RNA sequence in which it is present, or that is found in a cell or location or locations in the genome or DNA or RNA sequence that differ from that in which it is found in nature. Heterologous and exogenous nucleic acids or proteins are not endogenous to the cell into which it is introduced, but have been obtained from another cell or synthetically or recombinantly produced. Generally, though not necessarily, such nucleic acids encode proteins, i.e. exogenous proteins, that are not normally produced by the cell in which the DNA is transcribed or expressed. Similarly exogenous RNA encodes for proteins not normally expressed in the cell in which the exogenous RNA is present. Heterologous/exogenous nucleic acids and proteins may also be referred to as foreign nucleic acids or proteins. Any nucleic acid or protein that one of skill in the art would recognize as foreign to the cell in which it is expressed is herein encompassed by the term heterologous or exogenous nucleic acid or protein. The terms heterologous and exogenous also apply to non-natural combinations of nucleic acid or amino acid sequences, i.e. combinations where at least two of the combined sequences are foreign with respect to each other.

The "specific activity" of an enzyme is herein understood to mean the amount of activity of a particular enzyme per amount of total host cell protein, usually expressed in units of enzyme activity per mg total host cell protein. In the context of the present invention, the specific activity of a particular enzyme may be increased or decreased as compared to the specific activity of that enzyme in an (otherwise identical) wild type host cell.

"Anaerobic conditions" or an anaerobic fermentation process is herein defined as conditions or a fermentation process run in the absence of oxygen or in which substantially no oxygen is consumed, preferably less than 5, 2.5 or 1 mmol/L/h, more preferably 0 mmol/L/h is consumed (i.e. oxygen consumption is not detectable), and wherein organic molecules serve as both electron donor and electron acceptors. Detailed description of the invention

Expression of an exogenous acetaldehyde dehydrogenase in yeast allows the yeast to convert acetic acid, which may be present in high amounts in lignocellulosic hydrolysates, to ethanol. The NADH dependent reduction of acetic acid to ethanol has been proposed as a replacement for glycerol formation as a redox sink in anaerobic glucose-grown cultures of S. cerevisiae, thus providing a stoichiometric basis for elimination of glycerol production (as byproduct) during industrial ethanol production and consequently a higher ethanol yield (Guadalupe et al. supra). However, the stoichiometry of these reactions is such that the reduction of one molecule of acetic acid to ethanol would require two glycerol molecules not being produced. The present inventors have found however, that in practice the amount of acetic acid that typically is present in industrial lignocellulosic hydrolysates is such that the amount of NADH required for it to be reduced to ethanol exceeds the amount of NADH that would become available from preventing glycerol production in yeasts grown under anaerobic conditions. The present inventors have now surprisingly found that much higher amounts of acetic acid can be reduced to ethanol by simultaneous consumption of glycerol by the yeast, rather than by preventing its production.

Large amounts of glycerol are generated as a by-product in biodiesel production from transesterification reactions using vegetable oils or animal fats and an alcohol. The availability of crude glycerol is therefore predicted to increase over the next years as a result of the growth in biodiesel production worldwide. Consequently large amounts of glycerol will be available at low cost. The present invention provides means and methods for valorising glycerol, obtained e.g. as by-product from biodiesel production, by converting it to ethanol that may be used as biofuel. At the same time the present invention addresses the problem of high amounts of acetic acid that are present in lignocellulosic hydrolysates and which inhibit the fermentative capacities of yeasts producing ethanol from these hydrolysates. A further advantage of the present invention is that by leaving the high-osmolarity glycerol response pathway intact in the yeast cells of the invention (as opposed to strains wherein (all) glycerolphosphate dehydrogenase genes are inactivated as described by Guadalupe et al. supra), more robust yeast strains are obtained that are better capable of handling osmotic stress that may occur under industrial fermentations conditions.

In a first aspect the invention relates to a fungal host cell comprising an exogenous gene coding for a enzyme with the ability to reduce acetylCoA into acetaldehyde, which gene confers to the cell the ability to convert acetic acid into ethanol. An enzyme with the ability to reduce acetylCoA into acetaldehyde is herein understood as an enzyme which catalyze the reaction (ACDH; EC 1.2.1.10): acetaldehyde + NAD⁺ + Coenzyme A→ acetyl-Coenzyme A + NADH + H⁺.

Thus, the enzyme catalyzes the conversion of acetylCoA into acetaldehyde (and vice versa) and is also referred to as an (acetylating NAD-dependent) acetaldehyde dehydrogenase or an acetyl-CoA reductase. The enzyme may be a bifunctional enzyme which further catalyzes the conversion of acetaldehyde into ethanol (and vice versa; see below). For convenience we shall refer herein to an enzyme having at least the ability to reduce acetylCoA into either acetaldehyde or ethanol as an "acetaldehyde dehydrogenase". It is further understood herein the fungal host cell has endogenous acetyl-CoA synthetase and alcohol dehydrogenase activities which allow the cell, being provided with acetaldehyde dehydrogenase activity, to complete the conversion of acetic acid into ethanol.

The exogenous gene may encode for a mono functional enzyme having only acetaldehyde dehydrogenase activity (i.e. an enzyme only having the ability to reduce acetylCoA into acetaldehyde) such as e.g. the acetaldehyde dehydrogenase encoded by the E.coli mhpF gene. A suitable exogenous gene coding for an enzyme with acetaldehyde dehydrogenase activity comprises a nucleotide sequence coding for an amino acid sequence with at least 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 98, 99% amino acid sequence identity with SEQ ID NO: 1. Suitable examples of prokaryotes comprising mono functional enzymes with acetaldehyde dehydrogenase activity are provided in Table 1. The amino acid sequences of these mono functional enzymes are available in public databases and can be used by the skilled person to design codon- optimised nucleotide sequences coding for the corresponding mono functional enzyme (see e.g. SEQ ID NO: 2).

Table 1 : Enzymes with acetaldehyde dehydrogenase activity related to E.coli mhpF

Organism Amino acid

identity (%)

Escherichia coli str. K12 substr. MG1655 100%

Shigella sonnei 100%

Escherichia coli IAI39 99%

Citrobacter youngae ATCC 29220 93%

Citrobacter sp. 30_2 92%

Klebsiella pneumoniae 342) 87%

Klebsiella variicola 87%

Pseudomonas putida 81%

Ralstonia eutropha JMP134 82%

Burkholderia sp. HI 60 81%

Azotobacter vinelandii DJ 79%

Ralstonia metallidurans CH34 70%

Xanthobacter autotrophics Py2 67%

Burkholderia cenocepacia J2315 68%

Frankia sp. EANlpec 67%

Polaromonas sp. JS666 68%

Burkholderia phytofirmans PsJN 70%

Rhodococcus opacus B4 64% Preferably, the host cell comprises an exogenous gene coding for a bifunctional enzyme with acetaldehyde dehydrogenase and alcohol dehydrogenase activity, which gene confers to the cell the ability to covert acetic acid into ethanol. The advantage of using a bifunctional enzyme with acetaldehyde dehydrogenase and alcohol dehydrogenase activities as opposed to separate enzymes for each of the acetaldehyde dehydrogenase and alcohol dehydrogenase activities, is that it allows for direct channelling of the intermediate between enzymes that catalyze consecutive reactions in a pathway offers the possibility of an efficient, exclusive, and protected means of metabolite delivery. Substrate channelling thus decreases transit time of intermediates, prevents loss of intermediates by diffusion, protects labile intermediates from solvent, and forestalls entrance of intermediates into competing metabolic pathways. The bifunctional enzyme therefore allows for a more efficient conversion of acetic acid into ethanol as compared to the separate acetaldehyde dehydrogenase and alcohol dehydrogenase enzymes. A further advantage of using the bifunctional enzyme is that it may also be used in host cells having little or no alcohol dehydrogenase activity under the condition used, such as e.g. anaerobic conditions and/or conditions of catabolite repression.

Bifunctional enzymes with acetaldehyde dehydrogenase and alcohol dehydrogenase activity are known in the art prokaryotes and protozoans, including e.g. the bifunctional enzymes encoded by the Escherichia coli adhE and Entamoeba histolytica ADH2 genes (see e.g. Bruchaus and Tannich, 1994, J. Biochem. 303: 743- 748; Burdette and Zeikus, 1994, J. Biochem. 302: 163-170; Koo et al, 2005, Biotechnol. Lett. 27: 505-510; Yong et al, 1996, Proc Natl Acad Sci USA, 93: 6464- 6469). Bifunctional enzymes with acetaldehyde dehydrogenase and alcohol dehydrogenase activity are larger proteins consisting of around 900 amino acids and they are bifunctional in that they exhibit both acetaldehyde dehydrogenase (ACDH; EC 1.2.1.10) and alcohol dehydrogenase activity (ADH; EC 1.1.1.1). The E. coli adhE and Entamoeba histolytica ADH2 show 45% amino acid identity. Therefore, in one embodiment of the invention, a suitable exogenous gene coding for a bifunctional enzyme with acetaldehyde dehydrogenase and alcohol dehydrogenase activity comprises a nucleotide sequence coding for an amino acid sequence with at least 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 98, 99% amino acid sequence identity with at least one of SEQ ID NO: 3 and 5. Suitable examples of prokaryotes comprising bifunctional enzymes with acetaldehyde dehydrogenase and alcohol dehydrogenase activity are provided in Tables 2 and 3. The amino acid sequences of these bifunctional enzymes are available in public databases and can be used by the skilled person to design codon- optimised nucleotide sequences coding for the corresponding bifunctional enzyme (see e.g. SEQ ID NO: 4 or 6).

Table 2: Bifunctional enzymes with acetaldehyde dehydrogenase and alcohol dehydrogenase activity related to E.coli adhE

Table 3: Bifunctional enzymes with acetaldehyde dehydrogenase and alcohol dehydrogenase activity related to Entamoeba histolytica ADH2

Organism Amino acid

identity (%)

Entamoeba histolytica HM-1 TMSS 99%

Entamoeba dispar SAW760 98%

Mollicutes bacterium D7 65%

Fusobacterium mortiferum ATCC 9817 64%

Actinobacillus succinogenes 130Z 63% Pasteurella multocida Pm70 62%

Mannheimia succiniciproducens MBEL55E 61%

Streptococcus sp. 2_1_36FAA] 61%

The exogenous gene coding for the bifunctional enzyme having acetaldehyde dehydrogenase and alcohol dehydrogenase activities, for an enzyme having acetaldehyde dehydrogenase activity, preferably is an expression construct comprising a nucleotide sequence coding for the enzyme operably linked to suitable expression regulatory regions/sequences to ensure expression of the enzyme upon transformation of the expression construct into the host cell of the invention. Thus, the gene or expression construct will at least comprise a promoter that is functional in the host cell operably linked to the coding sequence. The gene or construct may further comprise a 5' leader sequence upstream of the coding region and a 3'-nontranslated sequence (3 'end) comprising a polyadenylation site and a transcription termination site downstream of the coding sequence.

In one aspect the invention relates to methods for preparing or constructing the yeast cells of the invention. For this purpose standard genetic and molecular biology techniques are used that are generally known in the art and have e.g. been described by Sambrook and Russell (2001, "Molecular cloning: a laboratory manual" (3rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press) and Ausubel et al. (1987, eds., "Current protocols in molecular biology", Green Publishing and Wiley Interscience, New York). Furthermore, the construction of mutated host yeast strains is carried out by genetic crosses, sporulation of the resulting diploids, tetrad dissection of the haploid spores containing the desired auxotrophic markers, and colony purification of such haploid host yeasts in the appropriate selection medium. All of these methods are standard yeast genetic methods known to those in the art. See, for example, Sherman et al, Methods Yeast Genetics, Cold Spring Harbor Laboratory, NY (1978) and Guthrie et al. (Eds.) Guide To Yeast Genetics and Molecular Biology Vol. 194, Academic Press, San Diego (1991).

Suitable promoters for expression of the nucleotide sequence coding for the enzyme having acetaldehyde dehydrogenase and optionally alcohol dehydrogenase activity (as well as other enzymes of the invention; see below) include promoters that are preferably insensitive to catabolite (glucose) repression, that are active under anaerobic conditions and/or that preferably do not require xylose or arabinose for induction. Promoters having these characteristics are widely available and known to the skilled person. Suitable examples of such promoters include e.g. promoters from glycolytic genes such as the phosphofructokinase (PPK), triose phosphate isomerase (ΤΡΓ), glyceraldehyde-3 -phosphate dehydrogenase (GPD, TDH3 or GAPDH), pyruvate kinase (PYK), phosphoglycerate kinase (PGK), glucose-6-phosphate isomerase promoter (PGIl) promoters from yeasts. More details about such promoters from yeast may be found in (WO 93/03159). Other useful promoters are ribosomal protein encoding gene promoters (TEFI), the lactase gene promoter (LAC4), alcohol dehydrogenase promoters (ADH1, ADH4, and the like), the enolase promoter (ENO) and the hexose(glucose) transporter promoter (HXT7). Alternatively, the nucleotide sequence encoding the enzyme having acetaldehyde dehydrogenase and optionally alcohol dehydrogenase activity is overexpressed under anaerobic conditions by using an anoxic promoter such as e.g. the S. cerevisiae ANB1 promoter (SEQ ID NO: 19). Other promoters, both constitutive and inducible, and enhancers or upstream activating sequences will be known to those of skill in the art. Preferably the promoter that is operably linked to nucleotide sequence as defined above is homologous to the host cell. Suitable terminator sequences are e.g. obtainable from the cytochrome cl (CYC1) gene or an alcohol dehydrogenase gene (e.g. ADH1).

To increase the likelihood that the enzyme having acetaldehyde dehydrogenase and optionally alcohol dehydrogenase activities is expressed at sufficient levels and in active form in the transformed host cells of the invention, the nucleotide sequence encoding these enzymes, as well as other enzymes of the invention (see below), are preferably adapted to optimise their codon usage to that of the host cell in question. The adaptiveness of a nucleotide sequence encoding an enzyme to the codon usage of a host cell may be expressed as codon adaptation index (CAI). The codon adaptation index is herein defined as a measurement of the relative adaptiveness of the codon usage of a gene towards the codon usage of highly expressed genes in a particular host cell or organism. The relative adaptiveness (w) of each codon is the ratio of the usage of each codon, to that of the most abundant codon for the same amino acid. The CAI index is defined as the geometric mean of these relative adaptiveness values. Non- synonymous codons and termination codons (dependent on genetic code) are excluded. CAI values range from 0 to 1, with higher values indicating a higher proportion of the most abundant codons (see Sharp and Li , 1987, Nucleic Acids Research 15: 1281-1295; also see: Jansen et al, 2003, Nucleic Acids Res. 3J_(8):2242-51). An adapted nucleotide sequence preferably has a CAI of at least 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8 or 0.9. Most preferred are the sequences which have been codon optimised for expression in the fungal host cell in question such as e.g. S. cerevisiae cells.

The nucleotide sequence encodes an enzyme having acetaldehyde dehydrogenase and optionally alcohol dehydrogenase activities that is preferably expressed in active form in the transformed host cell. Thus, expression of the nucleotide sequence in the host cell produces an acetaldehyde dehydrogenase with a specific activity of at least 0.005, 0.010, 0.020, 0.050 or 0.10 μιηοΐ min ¹ (mg protein)^"1, determined as acetyl-CoA dependent rate of NADH reduction in cell extracts of the transformed host cell at 30 °C as described in the Examples herein.

The host cell to be transformed with a nucleic acid construct comprising a nucleotide sequence encoding an enzyme with acetaldehyde dehydrogenase and optionally alcohol dehydrogenase preferably is a yeast host cell. Preferably the host cell is a cultured cell. The host cell of the invention, preferably is a host capable of active or passive pentose (xylose and preferably also arabinose) transport into the cell. The host cell preferably contains active glycolysis. The host cell may further preferably contains an endogenous pentose phosphate pathway and may contain endogenous xylulose kinase activity so that xylulose isomerised from xylose may be metabolised to pyruvate. The host further preferably contains enzymes for conversion of a pentose (preferably through pyruvate) to a desired fermentation product such as ethanol, lactic acid, 3 -hydroxy-propionic acid, acrylic acid, 1,3-propane-diol, butanols (1-butanol, 2- butanol, isobutanol) and isoprenoid-derived products. A particularly preferred host cell is a yeast cell that is naturally capable of alcoholic fermentation, preferably, anaerobic alcoholic fermentation. The yeast host cell further preferably has a high tolerance to ethanol, a high tolerance to low pH (i.e. capable of growth at a pH lower than 5, 4, or 3) and towards organic acids like lactic acid, acetic acid or formic acid and sugar degradation products such as furfural and hydroxy-methylfurfural, and a high tolerance to elevated temperatures. Any of these characteristics or activities of the host cell may be naturally present in the host cell or may be introduced or modified by genetic modification, preferably by self cloning or by the methods of the invention described below. A suitable cell is a cultured cell, a cell that may be cultured in fermentation process e.g. in submerged or solid state fermentation. Particularly suitable cells are eukaryotic microorganism like e.g. fungi, however, most suitable for use in the present inventions are yeasts.

Yeasts are herein defined as eukaryotic microorganisms and include all species of the subdivision Eumycotina (Yeasts: characteristics and identification, J.A. Barnett, R.W. Payne, D. Yarrow, 2000, 3rd ed., Cambridge University Press, Cambridge UK; and, The yeasts, a taxonomic study, CP. Kurtzman and J.W. Fell (eds) 1998, 4^th ed., Elsevier Science Publ. B.V., Amsterdam, The Netherlands) that predominantly grow in unicellular form. Yeasts may either grow by budding of a unicellular thallus or may grow by fission of the organism. Preferred yeasts cells for use in the present invention belong to the genera Saccharomyces, Kluyveromyces, Candida, Pichia, Schizosaccharomyces, Hansenula, Kloeckera, Schwanniomyces, and Yarrowia. Preferably the yeast is capable of anaerobic fermentation, more preferably anaerobic alcoholic fermentation. Over the years suggestions have been made for the introduction of various organisms for the production of bio-ethanol from crop sugars. In practice, however, all major bio-ethanol production processes have continued to use the yeasts of the genus Saccharomyces as ethanol producer. This is due to the many attractive features of Saccharomyces species for industrial processes, i.e., a high acid-, ethanol- and osmo-tolerance, capability of anaerobic growth, and of course its high alcoholic fermentative capacity. Preferred yeast species as host cells include S. cerevisiae, S. exiguus, S. bayanus, K. lactis, K. marxianus and Schizosaccharomyces pombe.

In a further embodiment, the host cell of the invention further comprises a genetic modification that increases at least one of: i) the specific activity of glycerol dehydrogenase; ii) the specific activity of dihydroxyacetone kinase; and, iii) transport of glycerol into the cell.

Preferably, the genetic modification that increases the specific activity of at least one of glycerol dehydrogenase and dihydroxyacetone kinase is overexpression of a nucleotide sequence encoding at least one of a glycerol dehydrogenase and dihydroxyacetone kinase. However, alternatively, the specific activity of the glycerol dehydrogenase and/or dihydroxyacetone kinase may be increased by expressing an enzyme having increased activity as compared to the endogenous wild type enzyme of the host cell, in addition to, or as a replacement for the wild type enzyme. A glycerol dehydrogenase is herein understood as an enzyme that catalyzes the chemical reaction (EC 1.1.1.6): glycerol + NAD⁺ <→ glycerone + NADH + H⁺

Other names in common use include glycerin dehydrogenase, NAD -linked glycerol dehydrogenase and glycerol:NAD+ 2-oxidoreductase. Preferably the genetic modification causes overexpression of a glycerol dehydrogenase, e.g. by overexpression of a nucleotide sequence encoding a glycerol dehydrogenase. The nucleotide sequence encoding the glycerol dehydrogenase may be endogenous to the cell or may be a glycerol dehydrogenase that is heterologous to the cell. Nucleotide sequences that may be used for overexpression of glycerol dehydrogenase in the cells of the invention are e.g. the glycerol dehydrogenase gene from S. cerevisiae (GCY1) as e.g. described by Oechsner et al. (1988, FEBS Lett. 238: 123-128) or Voss et al. (1997, Yeast 13: 655-672). Preferably, the nucleotide sequence encoding the glycerol dehydrogenase comprises a nucleotide sequence coding for an amino acid sequence with at least 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 98, 99% amino acid sequence identity with SEQ ID NO: 7. In a preferred embodiment a codon-optimised (see above) nucleotide sequence encoding the glycerol dehydrogenase is overexpressed, such as e.g. a codon optimised nucleotide sequence encoding the glycerol dehydrogenase of SEQ ID NO: 7.

For overexpression of the nucleotide sequence encoding the glycerol dehydrogenase, the nucleotide sequence (to be overexpressed) is placed in an expression construct wherein it is operably linked to suitable expression regulatory regions/sequences to ensure overexpression of the glycerol dehydrogenase enzyme upon transformation of the expression construct into the host cell of the invention (see above). Suitable promoters for (over)expression of the nucleotide sequence coding for the enzyme having glycerol dehydrogenase activity include promoters that are preferably insensitive to catabolite (glucose) repression, that are active under anaerobic conditions and/or that preferably do not require xylose or arabinose for induction. Examples of such promoters are given above. In the cells of the invention, a glycerol dehydrogenase to be overexpressed is preferably overexpressed by at least a factor 1.1, 1.2, 1.5, 2, 5, 10 or 20 as compared to a strain which is genetically identical except for the genetic modification causing the overexpression. Preferably, the glycerol dehydrogenase is overexpressed under anaerobic conditions by at least a factor 1.1, 1.2, 1.5, 2, 5, 10 or 20 as compared to a strain which is genetically identical except for the genetic modification causing the overexpression. It is to be understood that these levels of overexpression may apply to the steady state level of the enzyme's activity (specific activity in the cell), the steady state level of the enzyme's protein as well as to the steady state level of the transcript coding for the enzyme in the cell. Overexpression of the nucleotide sequence in the host cell produces a specific glycerol dehydrogenase activity of at least 0.2, 0.5, 1.0, 2.0, or 5.0 U min^"1 (mg protein)^"1, determined in cell extracts of the transformed host cells at 30 °C as described in the Examples herein.

A dihydroxyacetone kinase is herein understood as an enzyme that catalyzes the chemical reaction ((EC 2.7.1.29):

ATP + glycerone → ADP + glycerone phosphate

Other names in common use include glycerone kinase, ATP:glycerone phosphotransferase and (phosphorylating) acetol kinase. It is understood that glycerone and dihydroxyacetone are the same molecule. Preferably the genetic modification causes overexpression of a dihydroxyacetone kinase, e.g. by overexpression of a nucleotide sequence encoding a dihydroxyacetone kinase. The nucleotide sequence encoding the dihydroxyacetone kinase may be endogenous to the cell or may be a dihydroxyacetone kinase that is heterologous to the cell. Nucleotide sequences that may be used for overexpression of dihydroxyacetone kinase in the cells of the invention are e.g. the dihydroxyacetone kinase genes from S. cerevisiae (DAK1) and (DAK2) as e.g. described by Molin et al. (2003, J. Biol. Chem. 278: 1415-1423). Preferably, the nucleotide sequence encoding the dihydroxyacetone kinase comprises an amino acid sequence with at least 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 98, 99% amino acid sequence identity with at least one of SEQ ID NO's: 8 and 9. In a preferred embodiment a codon-optimised (see above) nucleotide sequence encoding the dihydroxyacetone kinase is overexpressed, such as e.g. a codon optimised nucleotide sequence encoding the dihydroxyacetone kinase of SEQ ID NO: 8 or a codon optimised nucleotide sequence encoding the dihydroxyacetone kinase of SEQ ID NO: 9. A preferred nucleotide sequence for overexpression of a dihydroxyacetone kinase is a nucleotide sequence encoding a dihydroxyacetone kinase comprises an amino acid sequence with at least 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 98, 99% amino acid sequence identity with at least one of SEQ ID NO's: 8 (S. cerevisiae (DAK1).

For overexpression of the nucleotide sequence encoding the dihydroxyacetone kinase, the nucleotide sequence (to be overexpressed) is placed in an expression construct wherein it is operably linked to suitable expression regulatory regions/sequences to ensure overexpression of the dihydroxyacetone kinase enzyme upon transformation of the expression construct into the host cell of the invention (see above). Suitable promoters for (over)expression of the nucleotide sequence coding for the enzyme having dihydroxyacetone kinase activity include promoters that are preferably insensitive to catabolite (glucose) repression, that are active under anaerobic conditions and/or that preferably do not require xylose or arabinose for induction. Examples of such promoters are given above. In the cells of the invention, a dihydroxyacetone kinase to be overexpressed is preferably overexpressed by at least a factor 1.1, 1.2, 1.5, 2, 5, 10 or 20 as compared to a strain which is genetically identical except for the genetic modification causing the overexpression. Preferably, the dihydroxyacetone kinase is overexpressed under anaerobic conditions by at least a factor 1.1, 1.2, 1.5, 2, 5, 10 or 20 as compared to a strain which is genetically identical except for the genetic modification causing the overexpression. It is to be understood that these levels of overexpression may apply to the steady state level of the enzyme's activity (specific activity in the cell), the steady state level of the enzyme's protein as well as to the steady state level of the transcript coding for the enzyme in the cell. Overexpression of the nucleotide sequence in the host cell produces a specific dihydroxyacetone kinase activity of at least 0.002, 0.005, 0.01, 0.02 or 0.05 U min^"1 (mg protein)^"1, determined in cell extracts of the transformed host cells at 30 °C as described in the Examples herein.

Preferably, the genetic modification that increases transport of glycerol into the cell preferably is a genetic modification that causes overexpression of a nucleotide sequence encoding at least one of a glycerol uptake protein and a glycerol channel.

A glycerol uptake protein is herein understood as a multimembrane-spanning protein that belongs to the included in the membrane bound O-acyltransferases (MBOAT) superfamily including e.g. the S. cerevisiae glycerol uptake proteins encoded by the GUP1 and GUP2 genes. Preferably the genetic modification causes overexpression of a glycerol uptake protein, e.g. by overexpression of a nucleotide sequence encoding a glycerol uptake protein. The nucleotide sequence encoding the glycerol uptake protein may be endogenous to the cell or may be a glycerol uptake protein that is heterologous to the cell. Nucleotide sequences that may be used for overexpression of glycerol uptake protein in the cells of the invention are e.g. the glycerol uptake protein genes from S. cerevisiae {GUPl) and (GUP2) and orthologues thereof as e.g. described by Neves et al. (2004, FEMS Yeast Res. 5:51-62). Preferably, the nucleotide sequence encoding the glycerol uptake protein comprises a nucleotide sequence coding for an amino acid sequence with at least 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 98, 99% amino acid sequence identity with at least one of SEQ ID NO's: 10 (Guplp) and 11 (Gup2p). In a preferred embodiment a codon-optimised (see above) nucleotide sequence encoding the glycerol uptake protein is overexpressed, such as e.g. a codon optimised nucleotide sequence encoding the glycerol uptake protein SEQ ID NO: 10 or a codon optimised nucleotide sequence encoding the glycerol uptake protein of SEQ ID NO: 11. Although the exact nature of the influence of GUPl on glycerol transport is not yet clear, Yu et al. (2010, supra) have shown that overexpression of GUPl in S.cerevisiae improves ethanol production on glycerol grown cells. A preferred nucleotide sequence for overexpression of a glycerol uptake protein is therefore a nucleotide sequence encoding a glycerol uptake protein that is capable of rescuing salt stress-associated phenotype of a S. cerevisiae guplA mutant by complementation as described by Neves et al. (2004, supra). Such complementing orthologues of S. cerevisiae GUPl include nucleotide sequences encoding amino acid sequences having at least 60, 68, 72, 75, 80, 85, 90, 95, 98, 99% identity with the amino acid sequence of SEQ ID NO: 10 and may be obtained from yeast species belonging to the genera of Saccharomyces, Zygosaccharomyces, Kluyveromyces, Candida, Pichia, Hansenula, Kloeckera, Schwanniomyces, and Yarrowia.

A glycerol channel is herein understood as a member of the MIP family of channel proteins reviewed by Reizer et al. (1993, CRC Crit. Rev. Biochem. Mol. Biol, 28: 235-257), which channel proteins comprise a 250 -280 amino acid transmembrane domain consisting of six membrane-spanning domains and have at least 30, 35, 40, 45, 50, 60, 70, 80, 90, 95, 98 or 99 % amino acid identity, or at least 55, 60, 65, 70, 80, 90, 95, 98 or 99% amino acid similarity with the amino acid sequence between amino acids 250 and 530 of SEQ ID NO: 12, the S. cerevisiae FPS1 aquaglyceroporin. Nucleotide sequences that may be used for overexpression of a glycerol channel in the cells of the invention include nucleotide sequences encoding the yeast aquaglyceroporin FPS 1 gene from e.g. S. cerevisiae (Van Aelst et al, 1991, EMBO J. 10:2095-2104) and orthologues thereof from other yeasts including Kluyveromyces lactis, Kluyveromyces marxianus and Zygosaccharomyces rouxii as e.g. described by Neves et al. (2004, supra). However, the use of bacterial or plant glycerol channels is not excluded as e.g. Luyten et al. (1995, EMBO J. 14: 1360-1371) have shown that the E.coli glycerol facilitator, having only 30% sequence identity with the amino acid sequence between amino acids 250 and 530 of the S. cerevisiae FPS1 aquaglyceroporin, can complement glycerol uptake in a S. cerevisiae fpslA mutant. The nucleotide sequence encoding the glycerol channel may be endogenous to the cell or may be a glycerol channel that is heterologous to the cell. In a preferred embodiment a codon-optimised (see above) nucleotide sequence encoding the glycerol channel is overexpressed, such as e.g. a codon optimised nucleotide sequence encoding the aquaglyceroporin of SEQ ID NO: 12.

For overexpression of the nucleotide sequence encoding the glycerol uptake protein and/or the glycerol channel protein, the nucleotide sequence (to be overexpressed) is placed in an expression construct wherein it is operably linked to suitable expression regulatory regions/sequences to ensure overexpression of the glycerol uptake protein and/or the glycerol channel protein upon transformation of the expression construct into the host cell of the invention (see above). Suitable promoters for (over)expression of the nucleotide sequence coding for the glycerol uptake protein and/or the glycerol channel protein include promoters that are preferably insensitive to catabolite (glucose) repression, that are active under anaerobic conditions and/or that preferably do not require xylose or arabinose for induction. Examples of such promoters are given above. In the cells of the invention, a glycerol uptake protein and/or a glycerol channel protein to be overexpressed are preferably overexpressed by at least a factor 1.1, 1.2, 1.5, 2, 5, 10 or 20 as compared to a strain which is genetically identical except for the genetic modification causing the overexpression. Preferably, the glycerol uptake protein and/or the glycerol channel protein are overexpressed under anaerobic conditions by at least a factor 1.1, 1.2, 1.5, 2, 5, 10 or 20 as compared to a strain which is genetically identical except for the genetic modification causing the overexpression. It is to be understood that these levels of overexpression may apply to the steady state level of the enzyme's activity (specific activity in the cell), the steady state level of the enzyme's protein as well as to the steady state level of the transcript coding for the enzyme in the cell.

In a preferred embodiment of the host cell of the invention, the expression of the glycerol channel protein as defined above is reduced or inactivated. A genetic modification reducing or inactivating the expression of the glycerol channel protein may be useful to reduce or prevent transport of glycerol out of the cell. Preferably, the reduction or inactivation of the expression of the glycerol channel protein is combined with overexpression of the nucleotide sequence encoding the glycerol uptake protein as defined above.

In a further embodiment, the host cell of the invention further comprises a genetic modification that increases the specific acetyl-CoA synthetase activity in the cell, preferably under anaerobic conditions as this activity is rate-limiting under these conditions. Acetyl-CoA synthetase or acetate-CoA ligase (EC 6.2.1.1) is herein understood as an enzyme that catalyzes the formation of a new chemical bond between acetate and coenzyme A (CoA). Preferably the genetic modification causes overexpression of a acetyl-CoA synthetase, e.g. by overexpression of a nucleotide sequence encoding a acetyl-CoA synthetase. The nucleotide sequence encoding the acetyl-CoA synthetase may be endogenous to the cell or may be a acetyl-CoA synthetase that is heterologous to the cell. Nucleotide sequences that may be used for overexpression of acetyl-CoA synthetase in the cells of the invention are e.g. the acetyl- CoA synthetase genes from S. cerevisiae (ACS1 and ACS2) as e.g. described by de Jong-Gubbels et al. (1998, FEMS Microbiol Lett. 165: 15-20). Preferably, the nucleotide sequence encoding the acetyl-CoA synthetase comprises an amino acid sequence with at least 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 98, 99% amino acid sequence identity with at least one of SEQ ID NO's: 13 and 14.

In one embodiment, the nucleotide sequence that is overexpressed encodes an acetyl-CoA synthetase with a high affinity for acetate. Use of an acetyl-CoA synthetase with a high affinity for acetate is preferred for conditions under which there is a relatively low concentration of acetic acid in the culture medium, e.g. no more than 2 g acetic acid/L culture medium. An acetyl-CoA synthetase with a high affinity for acetate is herein defined as an acetyl-CoA synthetase with a higher affinity for acetate than the acetyl-CoA synthetase encoded by the S. cerevisiae ACS2. Preferably, an acetyl-CoA synthetase with a high affinity for acetate has a Km for acetate of no more than 10, 5, 2, 1, 0.5, 0.2 or 0.1 mM, such e.g. the acetyl-CoA synthetase encoded by the S. cerevisiae ACS1 gene. More preferably a codon-optimised (see above) nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 13 is overexpressed.

In another embodiment, the nucleotide sequence that is overexpressed encodes an acetyl-CoA synthetase with a high maximum rate (v_max). Use of an acetyl-CoA synthetase with a high maximum rate is preferred for condition under which there is a relatively high concentration of acetic acid in the culture medium, e.g. at least 2, 3, 4 or 5 g acetic acid/L culture medium. An acetyl-CoA synthetase with a high maximum rate is herein defined as an acetyl-CoA synthetase with a higher maximum rate than the acetyl-CoA synthetase encoded by the S. cerevisiae ACS1. Preferably, the acetyl-CoA synthetase with a high maximum rate is the acetyl-CoA synthetase encoded by the S. cerevisiae ACS2 gene. More preferably a codon-optimised (see above) nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 14 is overexpressed.

For overexpression of the nucleotide sequence encoding the acetyl-CoA synthetase (to be overexpressed) is placed in an expression construct wherein it is operably linked to suitable expression regulatory regions/sequences to ensure overexpression of the acetyl-CoA synthetase enzyme upon transformation of the expression construct into the host cell of the invention (see above). Suitable promoters for (over)expression of the nucleotide sequence coding for the enzyme having acetyl- CoA synthetase activity include promoters that are preferably insensitive to catabolite (glucose) repression, that are active under anaerobic conditions and/or that preferably do not require xylose or arabinose for induction. Examples of such promoters are given above. In the cells of the invention, an acetyl-CoA synthetase to be overexpressed is overexpressed by at least a factor 1.1, 1.2, 1.5, 2, 5, 10 or 20 as compared to a strain which is genetically identical except for the genetic modification causing the overexpression. Preferably, the acetyl-CoA synthetase is overexpressed under anaerobic conditions by at least a factor 2, 5, 10, 20, 50, or 100 as compared to a strain which is genetically identical except for the genetic modification causing the overexpression. It is to be understood that these levels of overexpression may apply to the steady state level of the enzyme's activity (specific activity), the steady state level of the enzyme's protein as well as to the steady state level of the transcript coding for the enzyme. In a further embodiment, the host cell of the invention further comprises a genetic modification that reduces specific NAD⁺-dependent glycerol 3-phosphate dehydrogenase activity in the cell. Glycerol 3-phosphate dehydrogenase or glycerolphosphate dehydrogenase (EC 1.1.1.8) katalyses the reduction of dihydroxyacetone phosphate to sn-glycerol 3-phosphate while oxidising NADH to NAD⁺. In the cells of the invention, the specific glycerolphosphate dehydrogenase activity is preferably reduced by at least a factor 0.8, 0.5, 0.3, 0.1, 0.05 or 0.01 as compared to a strain which is genetically identical except for the genetic modification causing the overexpression, preferably under anaerobic conditions.

Preferably, glycerolphosphate dehydrogenase activity is reduced in the host cell by one or more genetic modifications that reduce the expression of or inactivates a gene encoding an glycerolphosphate dehydrogenase. Preferably, the genetic modifications reduce or inactivate the expression of each endogenous copy of the gene encoding a specific glycerolphosphate dehydrogenase in the cell's genome. A given cell may comprise multiple copies of the gene encoding a specific glycerolphosphate dehydrogenase with one and the same amino acid sequence as a result of di-, poly- or aneu-ploidy. In such instances preferably the expression of each copy of the specific gene that encodes the glycerolphosphate dehydrogenase is reduced or inactivated. Alternatively, a cell may contain several different (iso)enzymes with glycerolphosphate dehydrogenase activity that differ in amino acid sequence and that are each encoded by a different gene. In such instances, in some embodiments of the invention it is preferred that only certain types of the isoenzymes are reduced or inactivated while other types remain unaffected (see below). Preferably, the gene is inactivated by deletion of at least part of the gene or by disruption of the gene, whereby in this context the term gene also includes any non-coding sequence up- or down-stream of the coding sequence, the (partial) deletion or inactivation of which results in a reduction of expression of glycerolphosphate dehydrogenase activity in the host cell.

A preferred gene encoding a glycerolphosphate dehydrogenase whose activity is to be reduced or inactivated in the cell of the invention is the S. cerevisiae GPD2 gene as described by Eriksson et al. (1995, Mol. Microbiol. 17: 95-107), encoding the amino acid sequence of SEQ ID NO: 15 and orthologues thereof in other species. Therefore a gene encoding a glycerolphosphate dehydrogenase whose activity is to be reduced or inactivated in the cell of the invention preferably is a gene encoding a glycerolphosphate dehydrogenase having an amino acid sequence with at least 70, 75, 80, 85, 90, 95, 98 or 99% sequence identity to SEQ ID NO: 15.

In a preferred embodiment of the invention, the host cell of the invention comprises a functional high-osmolarity glycerol response pathway. Preferably therefore, only the activity of the gene(s) encoding a glycerolphosphate dehydrogenase having an amino acid sequence with at least 70% sequence identity to SEQ ID NO: 15 are reduced or inactivated, while at least one endogenous gene encoding a glycerolphosphate dehydrogenase having an amino acid sequence with at least 70, 75, 80, 85, 90, 95, 98 or 99% sequence identity to SEQ ID NO: 16 is functional. SEQ ID NO: 16 depicts the amino acid sequence encoded by the S. cerevisiae GPDl gene as described by Albertyn et al. (1994, Mol. Cell. Biol. 14: 4135-4144), which has 69% amino acid identity with the S. cerevisiae GPD2 glycerolphosphate dehydrogenase. The S. cerevisiae GPDl gene is the stress-induced glycerolphosphate dehydrogenase of S. cerevisiae, which is important for growth under osmotic stress as may occur under industrial fermentations conditions. Its expression is inter alia regulated by the high- osmolarity glycerol response pathway. It is therefore advantageous that a host cell of the invention has at least one functional copy of a endogenous gene encoding a glycerolphosphate dehydrogenase having an amino acid sequence with at least 70, 75, 80, 85, 90, 95, 98 or 99% sequence identity to SEQ ID NO: 16.

In a further embodiment, the activity of all the genes in the host cell encoding a glycerolphosphate dehydrogenase is reduced or inactivated. In such cells preferably all copies of endogenous genes encoding a glycerolphosphate dehydrogenase having an amino acid sequence with at least 70, 75, 80, 85, 90, 95, 98 or 99% sequence identity to SEQ ID NO: 15 or 16 are inactivated or at least reduced in expression.

In a further preferred embodiment, the host cell of the invention has at least one of: a) the ability of isomerising xylose to xylulose; and, b) the ability to convert L- arabinose into D-xylulose 5-phosphate. For a) the cell preferably has a functional exogenous xylose isomerase gene, which gene confers to the cell the ability to isomerise xylose into xylulose. For b) the cell preferably has functional exogenous genes coding for a L-arabinose isomerase, a L-ribulokinase and a L-ribulose-5- phosphate 4-epimerase, which genes together confers to the cell the ability to isomerise convert L-arabinose into D-xylulose 5-phosphate. Fungal host cells having the ability of isomerising xylose to xylulose as e.g. described in WO 03/0624430 and in WO 06/009434. The ability of isomerising xylose to xylulose is preferably conferred to the cell by transformation with a nucleic acid construct comprising a nucleotide sequence encoding a xylose isomerase. Preferably the cell thus acquires the ability to directly isomerise xylose into xylulose. More preferably the cell thus acquires the ability to grow aerobically and/or anaerobically on xylose as sole energy and/or carbon source though direct isomerisation of xylose into xylulose (and further metabolism of xylulose). It is herein understood that the direct isomerisation of xylose into xylulose occurs in a single reaction catalysed by a xylose isomerase, as opposed to the two step conversion of xylose into xylulose via a xylitol intermediate as catalysed by xylose reductase and xylitol dehydrogenase, respectively.

Several xylose isomerases (and their amino acid and coding nucleotide sequences) that may be successfully used to confer to the cell of the invention the ability to directly isomerise xylose into xylulose have been described in the art. These include the xylose isomerases of Piromyces sp. and of other anaerobic fungi that belongs to the families Neocallimastix, Caecomyces, Piromyces or Ruminomyces (WO 03/0624430), Cyllamyces aberensis (US 20060234364), Orpinomyces (Madhavan et al, 2008, DOI 10.1007/s00253-008- 1794-6), the xylose isomerase of the bacterial genus Bacteroides, including e.g. B. thetaiotaomicron (WO 06/009434), B.fragilis, and B. uniformis (WO 09/109633), the xylose isomerase of the anaerobic bacterium Clostridium phytofermentans (Brat et al, 2009, Appl. Environ. Microbiol. 75: 2304- 2311), and the xylose isomerases of Clostridium difficile, Ciona intestinales and Fusobacterium mortiferum.

Fungal host cells having the ability to convert L-arabinose into D-xylulose 5- phosphate as e.g. described in Wisselink et al. (2007, AEM Accepts, published online ahead of print on 1 June 2007; Appl. Environ. Microbiol. doi: 10.1128/AEM.00177-07) and in EP 1 499 708. The ability of to converting L-arabinose into D-xylulose 5- phosphate is preferably conferred to the cell by transformation with a nucleic acid construct(s) comprising nucleotide sequences encoding a) an arabinose isomerase; b) a ribulokinase, preferably a L-ribulokinase a xylose isomerase; and c) a ribulose-5-P-4- epimerase, preferably a L-ribulose-5-P-4-epimerase. Preferably, in the cells of the invention, the ability to convert L-arabinose into D-xylulose 5 -phosphate is the ability to convert L-arabinose into D-xylulose 5 -phosphate through the subsequent reactions of 1) isomerisation of arabinose into ribulose; 2) phosphorylation of ribulose to ribulose 5- phosphate; and, 3) epimerisation of ribulose 5-phosphate into D-xylulose 5-phosphate. Suitable nucleotide sequences encoding arabinose isomerases, a ribulokinases and ribulose-5-P-4-epimerases may be obtained from Bacillus subtilis, Escherichia coli (see e.g. EP 1 499 708), Lactobacilli, e.g. Lactobacillus plantarum (see e.g. Wisselink et al. supra), or species of Clavibacter, Arthrobacter and Gramella, of which preferably Clavibacter michiganensis, Arthrobacter aurescens and Gramella forsetii (see WO2009/011591).

The transformed host cell of the invention further preferably comprises xylulose kinase activity so that xylulose isomerised from xylose may be metabolised to pyruvate. Preferably, the cell contains endogenous xylulose kinase activity. More preferably, a cell of the invention comprises a genetic modification that increases the specific xylulose kinase activity. Preferably the genetic modification causes overexpression of a xylulose kinase, e.g. by overexpression of a nucleotide sequence encoding a xylulose kinase. The gene encoding the xylulose kinase may be endogenous to the cell or may be a xylulose kinase that is heterologous to the cell. A nucleotide sequence that may be used for overexpression of xylulose kinase in the cells of the invention is e.g. the xylulose kinase gene from S. cerevisiae (XKS1) as described by Deng and Ho (1990, Appl. Biochem. Biotechnol. 24-25: 193-199). Another preferred xylulose kinase is a xylose kinase that is related to the xylulose kinase from Piromyces (xylB; see WO 03/0624430). This Piromyces xylulose kinase is actually more related to prokaryotic kinase than to all of the known eukaryotic kinases such as the yeast kinase. The eukaryotic xylulose kinases have been indicated as non-specific sugar kinases, which have a broad substrate range that includes xylulose. In contrast, the prokaryotic xylulose kinases, to which the Piromyces kinase is most closely related, have been indicated to be more specific kinases for xylulose, i.e. having a narrower substrate range. In the cells of the invention, a xylulose kinase to be overexpressed is overexpressed by at least a factor 1.1, 1.2, 1.5, 2, 5, 10 or 20 as compared to a strain which is genetically identical except for the genetic modification causing the overexpression. It is to be understood that these levels of overexpression may apply to the steady state level of the enzyme's activity, the steady state level of the enzyme's protein as well as to the steady state level of the transcript coding for the enzyme. A cell of the invention further preferably comprises a genetic modification that increases the flux of the pentose phosphate pathway as described in WO 06/009434. In particular, the genetic modification causes an increased flux of the non-oxidative part pentose phosphate pathway. A genetic modification that causes an increased flux of the non-oxidative part of the pentose phosphate pathway is herein understood to mean a modification that increases the flux by at least a factor 1.1, 1.2, 1.5, 2, 5, 10 or 20 as compared to the flux in a strain which is genetically identical except for the genetic modification causing the increased flux. The flux of the non-oxidative part of the pentose phosphate pathway may be measured as described in WO 06/009434.

Genetic modifications that increase the flux of the pentose phosphate pathway may be introduced in the cells of the invention in various ways. These including e.g. achieving higher steady state activity levels of xylulose kinase and/or one or more of the enzymes of the non-oxidative part pentose phosphate pathway and/or a reduced steady state level of unspecific aldose reductase activity. These changes in steady state activity levels may be effected by selection of mutants (spontaneous or induced by chemicals or radiation) and/or by recombinant DNA technology e.g. by overexpression or inactivation, respectively, of genes encoding the enzymes or factors regulating these genes.

In a preferred cell of the invention, the genetic modification comprises overexpression of at least one enzyme of the (non-oxidative part) pentose phosphate pathway. Preferably the enzyme is selected from the group consisting of the enzymes encoding for ribulose-5 -phosphate isomerase, ribulose-5 -phosphate 3-epimerase, transketolase and transaldolase. Various combinations of enzymes of the (non- oxidative part) pentose phosphate pathway may be overexpressed. E.g. the enzymes that are overexpressed may be at least the enzymes ribulose-5-phosphate isomerase and ribulose-5 -phosphate 3-epimerase; or at least the enzymes ribulose-5 -phosphate isomerase and transketolase; or at least the enzymes ribulose-5 -phosphate isomerase and transaldolase; or at least the enzymes ribulose-5-phosphate 3-epimerase and transketolase; or at least the enzymes ribulose-5 -phosphate 3-epimerase and transaldolase; or at least the enzymes transketolase and transaldolase; or at least the enzymes ribulose-5 -phosphate 3-epimerase, transketolase and transaldolase; or at least the enzymes ribulose-5 -phosphate isomerase, transketolase and transaldolase; or at least the enzymes ribulose-5 -phosphate isomerase, ribulose-5 -phosphate 3-epimerase, and transaldolase; or at least the enzymes ribulose-5 -phosphate isomerase, ribulose-5 - phosphate 3-epimerase, and transketolase. In one embodiment of the invention each of the enzymes ribulose-5 -phosphate isomerase, ribulose-5 -phosphate 3-epimerase, transketolase and transaldolase are overexpressed in the cell of the invention. Preferred is a cell in which the genetic modification comprises at least overexpression of the enzyme transaldolase. More preferred is a cell in which the genetic modification comprises at least overexpression of both the enzymes transketolase and transaldolase as such a host cell is already capable of anaerobic growth on xylose. In fact, under some conditions we have found that cells overexpressing only the transketolase and the transaldolase already have the same anaerobic growth rate on xylose as do cells that overexpress all four of the enzymes, i.e. the ribulose-5 -phosphate isomerase, ribulose- 5-phosphate 3-epimerase, transketolase and transaldolase. Moreover, cells of the invention overexpressing both of the enzymes ribulose-5 -phosphate isomerase and ribulose-5 -phosphate 3-epimerase are preferred over cells overexpressing only the isomerase or only the 3-epimerase as overexpression of only one of these enzymes may produce metabolic imbalances.

There are various means available in the art for overexpression of enzymes in the cells of the invention. In particular, an enzyme may be overexpressed by increasing the copynumber of the gene coding for the enzyme in the cell, e.g. by integrating additional copies of the gene in the cell's genome, by expressing the gene from an episomal multicopy expression vector or by introducing a episomal expression vector that comprises multiple copies of the gene. The coding sequence used for overexpression of the enzymes preferably is homologous to the host cell of the invention. However, coding sequences that are heterologous to the host cell of the invention may likewise be applied.

Alternatively overexpression of enzymes in the cells of the invention may be achieved by using a promoter that is not native to the sequence coding for the enzyme to be overexpressed, i.e. a promoter that is heterologous to the coding sequence to which it is operably linked. Although the promoter preferably is heterologous to the coding sequence to which it is operably linked, it is also preferred that the promoter is homologous, i.e. endogenous to the cell of the invention. Preferably the heterologous promoter is capable of producing a higher steady state level of the transcript comprising the coding sequence (or is capable of producing more transcript molecules, i.e. mRNA molecules, per unit of time) than is the promoter that is native to the coding sequence, preferably under conditions where xylose or xylose and glucose are available as carbon sources, more preferably as major carbon sources (i.e. more than 50% of the available carbon source consists of xylose or xylose and glucose), most preferably as sole carbon sources.

A further preferred cell of the invention comprises a genetic modification that reduces unspecific aldose reductase activity in the cell. Preferably, unspecific aldose reductase activity is reduced in the host cell by one or more genetic modifications that reduce the expression of or inactivates a gene encoding an unspecific aldose reductase. Preferably, the genetic modifications reduce or inactivate the expression of each endogenous copy of a gene encoding an unspecific aldose reductase that is capable of reducing an aldopentose, including, xylose, xylulose and arabinose, in the cell's genome. A given cell may comprise multiple copies of genes encoding unspecific aldose reductases as a result of di-, poly- or aneu-ploidy, and/or a cell may contain several different (iso)enzymes with aldose reductase activity that differ in amino acid sequence and that are each encoded by a different gene. Also in such instances preferably the expression of each gene that encodes an unspecific aldose reductase is reduced or inactivated. Preferably, the gene is inactivated by deletion of at least part of the gene or by disruption of the gene, whereby in this context the term gene also includes any non-coding sequence up- or down-stream of the coding sequence, the (partial) deletion or inactivation of which results in a reduction of expression of unspecific aldose reductase activity in the host cell. A nucleotide sequence encoding an aldose reductase whose activity is to be reduced in the cell of the invention and amino acid sequences of such aldose reductases are described in WO 06/009434 and include e.g. the (unspecific) aldose reductase genes of S. cerevisiae GRE3 gene (Traff et al, 2001, Appl. Environm. Microbiol. 67: 5668-5674) and orthologues thereof in other species.

A further preferred transformed host cell according to the invention may comprises further genetic modifications that result in one or more of the characteristics selected from the group consisting of (a) increased transport of xylose and/or arabinose into the cell; (b) decreased sensitivity to catabolite repression; (c) increased tolerance to ethanol, osmolarity or organic acids; and, (d) reduced production of by-products. Byproducts are understood to mean carbon-containing molecules other than the desired fermentation product and include e.g. xylitol, arabinitol, glycerol and/or acetic acid. Any genetic modification described herein may be introduced by classical mutagenesis and screening and/or selection for the desired mutant, or simply by screening and/or selection for the spontaneous mutants with the desired characteristics. Alternatively, the genetic modifications may consist of overexpression of endogenous genes and/or the inactivation of endogenous genes. Genes the overexpression of which is desired for increased transport of arabinose and/or xylose into the cell are preferably chosen form genes encoding a hexose or pentose transporter. In S. cerevisiae and other yeasts these genes include HXT1, HXT2, HXT4, HXT5, HXT7 and GAL2, of which HXT7, HXT5 and GAL2 are most preferred (see Sedlack and Ho, Yeast 2004; 21 : 671-684). Another preferred transporter for expression in yeast is the glucose transporter encoded by the P. stipitis SUT1 gene (Katahira et al, 2008, Enzyme Microb. Technol. 43: 115-119). Similarly orthologues of these transporter genes in other species may be overexpressed. Other genes that may be overexpressed in the cells of the invention include genes coding for glycolytic enzymes and/or ethanologenic enzymes such as alcohol dehydrogenases. Preferred endogenous genes for inactivation include hexose kinase genes e.g. the S. cerevisiae HXK2 gene (see Diderich et al, 2001, Appl. Environ. Microbiol. 67: 1587-1593); the S. cerevisiae MIG1 or MIG2 genes; genes coding for enzymes involved in glycerol metabolism such as the S. cerevisiae glycerol-phosphate dehydrogenase 1 and/or 2 genes; or (hybridising) orthologues of these genes in other species. Other preferred further modifications of host cells for xylose fermentation are described in van Maris et al. (2006, Antonie van Leeuwenhoek 90:391-418), WO2006/009434, WO2005/023998, WO2005/111214, and WO2005/091733. Any of the genetic modifications of the cells of the invention as described herein are, in as far as possible, preferably introduced or modified by self cloning genetic modification.

A preferred host cell according to the invention has the ability to grow on at least one of xylose and arabinose as carbon/energy source, preferably as sole carbon/energy source, and preferably under anaerobic conditions, i.e. conditions as defined herein below for anaerobic fermentation process. Preferably, when grown on xylose as carbon/energy source the host cell produces essentially no xylitol, e.g. the xylitol produced is below the detection limit or e.g. less than 5, 2, 1, 0.5, or 0.3% of the carbon consumed on a molar basis. Preferably, when grown on arabinose as carbon/energy source, the cell produces essentially no arabinitol, e.g. the arabinitol produced is below the detection limit or e.g. less than 5, 2, 1, 0.5, or 0.3 % of the carbon consumed on a molar basis.

A preferred host cell of the invention has the ability to grow on a combination of: a) at least one of a hexose and a pentose; b) acetic acid; and c) glycerol at a rate of at least 0.01, 0.02, 0.05, 0.1, 0.2, 0,25 or 0,3 h^"1 under aerobic conditions, or, more preferably, at a rate of at least 0.005, 0.01, 0.02, 0.05, 0.08, 0.1, 0.12, 0.15 or 0.2 h^"1 under anaerobic conditions. Therefore, preferably the host cell has the ability to grow on at least one of xylose and arabinose as sole carbon/energy source at a rate of at least 0.01, 0.02, 0.05, 0.1, 0.2, 0,25 or 0,3 h^"1 under aerobic conditions, or, more preferably, at a rate of at least 0.005, 0.01, 0.02, 0.05, 0.08, 0.1, 0.12, 0.15 or 0.2 h^"1 under anaerobic conditions. More preferably, the host cell has the ability to grow on a mixture of a hexose (e.g. glucose) and at least one of xylose and arabinose (in a 1 : 1 weight ratio) as sole carbon/energy source at a rate of at least 0.01, 0.02, 0.05, 0.1 , 0.2, 0,25 or 0,3 h^"1 under aerobic conditions, or, more preferably, at a rate of at least 0.005, 0.01, 0.02, 0.05, 0.08, 0.1, 0.12, 0.15 or 0.2 h^"1 under anaerobic conditions.

In a one aspect, the invention relates to the use of a yeast cell according to the invention for the preparation of a fermentation product selected from the group consisting of ethanol, lactic acid, 3 -hydroxy-propionic acid, acrylic acid, 1,3-propane- diol, butanols and isoprenoid-derived products.

In another aspect the invention relates to a process for producing a fermentation product selected from the group consisting of ethanol, lactic acid, 3 -hydroxy-propionic acid, acrylic acid, 1,3-propane-diol, butanols (1-butanol, 2-butanol, isobutanol) and isoprenoid-derived products. The process preferably comprises the step of: a) fermenting a medium with a yeast cell, whereby the medium contains or is fed with: a) a source of at least one of a hexose and a pentose; b) a source of acetic acid; and, c) a source of glycerol and whereby the yeast cell ferments acetic acid, glycerol and at least one of the hexose and pentose to ethanol. The yeast cell preferably is a (host) cell as herein defined above. The process preferably comprise a further step wherein the fermentation product is recovered. The process may be a batch process, a fed-batch process or a continuous process as are well known in the art. In the process of the invention, the source of glycerol may be a any carbon source that has a more reduced state than glucose. A carbon source having a more reduced state than glucose is understood as a carbon source of which the average reduction state per C-mol (of the compounds therein) is higher than the reduction state per C-mol of glucose. Examples of carbon sources having a more reduced state than glucose include e.g. alkanols such as propanol and butanol; polyols such as 1 ,3-propane-diol, butandiol, glycerol, mannitol and xylitol.

In a preferred process the source of hexose comprises or consists of glucose.

Preferably the source pentose comprises or consists of at least one of xylose and arabinose. Preferably, the medium fermented by the cells of the invention comprises or is fed with (fractions of) hydrolysed biomass comprising at least one at least one of a hexose and a pentose such as glucose, xylose and/or arabinose. The (fractions of) hydrolysed biomass comprising the hexoses and pentose will usually also comprise acetic acid (or a salt thereof). An example of hydrolysed biomass to be fermented in the processes of the invention is e.g. hydrolysed lignocellulosic biomass. Lignocellulosic biomass is herein understood as plant biomass that is composed of cellulose, hemicellulose, and lignin. The carbohydrate polymers (cellulose and hemicelluloses) are tightly bound to the lignin. Examples of lignocellulosic biomass to be hydrolysed for use in the present invention include agricultural residues (including corn stover and sugarcane bagasse), wood residues (including sawmill and paper mill discards and (municipal) paper waste. Methods for hydrolysis of biomass such as lignocelluloses are known in the art per se and include e.g. acids, such as sulphuric acid and enzymes such as cellulases and hemicellulases.

In the process of the invention, the sources of xylose, glucose and arabinose may be xylose, glucose and arabinose as such (i.e. as monomeric sugars) or they may be in the form of any carbohydrate oligo- or polymer comprising xylose, glucose and/or arabinose units, such as e.g. lignocellulose, arabinans, xylans, cellulose, starch and the like. For release of xylose, glucose and/or arabinose units from such carbohydrates, appropriate carbohydrases (such as arabinases, xylanases, glucanases, amylases, cellulases, glucanases and the like) may be added to the fermentation medium or may be produced by the modified host cell. In the latter case the modified host cell may be genetically engineered to produce and excrete such carbohydrases. An additional advantage of using oligo- or polymeric sources of glucose is that it enables to maintain a low(er) concentration of free glucose during the fermentation, e.g. by using rate- limiting amounts of the carbohydrases preferably during the fermentation. This, in turn, will prevent repression of systems required for metabolism and transport of non- glucose sugars such as xylose and arabinose. In a preferred process the modified host cell ferments both the glucose and at least one of xylose and arabinose, preferably simultaneously in which case preferably a modified host cell is used which is insensitive to glucose repression to prevent diauxic growth. In addition to a source of at least one of xylose and arabinose (and glucose) as carbon source, the fermentation medium will further comprise the appropriate ingredient required for growth of the modified host cell. Compositions of fermentation media for growth of eukaryotic microorganisms such as yeasts are well known in the art.

In the process of the invention, the medium further preferably comprises and/or is fed a source of glycerol. Glycerol for use in the process of the present invention may advantageously be glycerol that is generated as a by-product in biodiesel production from transesterification reactions using vegetable oils or animal fats and an alcohol.

The fermentation process may be an aerobic or an anaerobic fermentation process. An anaerobic fermentation process is herein defined as a fermentation process run in the absence of oxygen or in which substantially no oxygen is consumed, preferably less than 5, 2.5 or 1 mmol/L/h, more preferably 0 mmol/L/h is consumed (i.e. oxygen consumption is not detectable), and wherein organic molecules serve as both electron donor and electron acceptors. In the absence of oxygen, NADH produced in glycolysis and bio mass formation, cannot be oxidised by oxidative phosphorylation. To solve this problem many microorganisms use pyruvate or one of its derivatives as an electron and hydrogen acceptor thereby regenerating NAD⁺. Thus, in a preferred anaerobic fermentation process pyruvate is used as an electron (and hydrogen acceptor) and is reduced to fermentation products such as ethanol, as well as non-ethanol fermentation products such as lactic acid, 3 -hydroxy-propionic acid, acrylic acid, 1,3- propane-diol, butanols (1-butanol, 2-butanol, isobutanol) isoprenoid-derived products. Anaerobic processes of the invention are preferred over aerobic processes because anaerobic processes do not require investments and energy for aeration and in addition, anaerobic processes produce higher product yields than aerobic processes.

Alternatively, the fermentation process of the invention may be run under aerobic oxygen- limited conditions. Preferably, in an aerobic process under oxygen-limited conditions, the rate of oxygen consumption is at least 5.5, more preferably at least 6 and even more preferably at least 7 mmol/L/h. In a preferred aerobic oxygen-limited fermentation process of the invention, the yeast cell of the invention consumes less than 30, 20, 18, 15, 12, 10, 8 or 5% of the amount of oxygen on a C-molar basis related to the carbon source consumed during the conversion of the carbon source into the fermentation product. The conversion coefficient of oxygen consumed over substrate utilised on a C-molar basis (Cos) is herein understood to mean mol 0₂ used per C-mol carbon source consumed. Thus, a process of the invention can be carried out under strict anaerobic conditions (i.e. Cos = 0.0), or the process of the invention can be carried out under aerobic, preferably oxygen-limited conditions wherein the Cos is preferably less than 0.3, 0.2, 0.18, 0.15, 0.12, 0.1, 0.08, or 0.05.

The fermentation process is preferably run at a temperature that is optimal for the modified cells of the invention. Thus, for most yeasts cells, the fermentation process is performed at a temperature which is less than 42°C, preferably less than 38°C. For yeast cells, the fermentation process is preferably performed at a temperature which is lower than 35, 33, 30 or 28°C and at a temperature which is higher than 20, 22, or 25°C.

A preferred fermentation process according to the invention is a process for the production of ethanol, whereby the process comprises the step of fermenting a medium with a yeast cell, whereby the medium contains or is fed with: a) a source of at least one of a hexose and a pentose; b) a source of acetic acid; and, c) a source of glycerol, whereby the yeast cell ferments acetic acid, glycerol and at least one of the hexose and pentose to ethanol, and optionally, b) recovery of the ethanol. The fermentation medium may further be performed as described above. In the process the volumetric ethanol productivity is preferably at least 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 5.0 or 10.0 g ethanol per litre per hour. The ethanol yield on xylose and/or glucose and/or arabinose and/or acetate and/or glycerol in the process preferably is at least 50, 60, 70, 80, 90, 95 or 98%. The ethanol yield is herein defined as a percentage of the theoretical maximum yield, which, for xylose, glucose and arabinose is 0.51 g. ethanol per g. xylose, glucose or arabinose. For glycerol the theoretical maximum yield is 0.50 g. ethanol per g. glycerol and for acetic acid the theoretical maximum yield is 0.77 g. ethanol per g. acetic acid.

In this document and in its claims, the verb "to comprise" and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article "a" or "an" thus usually means "at least one".

All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety.

The following examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way.

Examples

1. Enzyme activity assays

Cell extracts for activity assays were prepared from exponentially growing aerobic or anaerobic batch cultures and analysed for protein content as described by Abbot et al, (2009, Appl. Environ. Microbiol. 75 : 2320-2325).

NAD⁺-dependent acetaldehyde dehydrogenase (EC 1.2.1.10) activity was measured at 30 °C by monitoring the oxidation of NADH at 340 nm. The reaction mixture (total volume 1 ml) contained 50 mM potassium phosphate buffer (pH 7.5), 0.15 mM NADH and cell extract. The reaction was started by addition of 0.5 mM acetyl-Coenzyme A.

For glycerol 3 -phosphate dehydrogenase (EC 1.1.1.8) activity determination, cell extracts were prepared as described above except that the phosphate buffer was replaced by triethanolamine buffer (10 mM, pH 5). Glycero 1-3 -phosphate dehydrogenase activities were assayed in cell extracts at 30 °C as described previously (Blomberg and Adler, 1989, J. Bacteriol. 171 : 1087-1092.9). Reaction rates were proportional to the amounts of cell extract added.

Acetyl-CoA synthase (EC 6.2.1.1) activity was measured as described by Frenkel and Kitchens (1977, J. Biol. Chem. 252: 504-507) which is a modification of the method of Webster (Webster, 1969, Methods Enzymol. 13: 375-381). NADH formation measured is spectrophotometrically when the acetyl-CoA produced is coupled with citrate synthase and malate dehydrogenase reactions. The assay system contained 100 mM Tris-Cl(pH 7.6), 10 mM MgCl₂, 6 mM ATP, 5 mM malate, 1 mM NAD⁺, 0.1 mM NADH, 2.5 mM dithiothreitol or 2-mercaptoethanol, 0.2 mM coenzyme A, 25 μg citrate synthase (80 units/mg), 20 μg malate dehydrogenase (1000 units/mg), and 10 mM acetate and the reaction was measured rate was measured at 340 nm and calculated from the extinction coefficient of NADH (6.22 x 10⁶ cmVmol).

The activity of glycerol dehydrogenase and dihydroxyacetone kinase are measured at 30 °C in cell extracts, essentially as previously described (Gonzalez et al, 2008, Metab. Eng. 10, 234-245). Enzyme activities of glycerol dehydrogenase and dihydroxyacetone kinase are reported as μιηοΐεβ of substrate/min/mg of cell protein.

2. Strain construction

All modifications start with the xylose and arabinose fermenting strain RN1008 his^". RN1008 his^", also referred to herein as RN1041 , is a CEN.PK-based arabinose and xylose fermenting strain) with the genotype:

Mat a, ura3-52, leu2-112, his3::loxP, gre3::loxP, loxP-Ptpi::TALl, loxP-Ptpi::RKIl, loxP-Ptpi-TKLl, loxP-Ptpi-RPEl, delta:: -LEU2, delta:: PadhlXKSlTcycl-URA3- Ptpi-xylA-Tcyc 1 , delta : : LEU2- AAAaraABD .

Mat a = mating type a

ura3-52, leu2-l 12, his3::loxP mutations in the genes ura3, leu2 and his3, the ura3 is complemented by the xylA-XKS overexpression construct, leu2 is complemented by the AraABD overexpression construct. his3 could be used for selection of additional plasmids, RN1041 needs histidine in the medium for growth.

gre3::loxP = deletion of the gre3 gene encoding xylose reductase, loxP site is left after marker removal.

loxP-Ptpi = overexpression of het pentose phosphate pathway, loxP site upstream of constitutive promoter is left after marker removal

delta:: = integration of the construct after recombination on the long terminal repeats of the Tyl reterotransposon.

AAAaraABD = codon optimized arthrobacter aurescens araA, araB and araD genes (see WO2009/011591)

First the deletion of gpd2 in RN1041 is constructed (to produce strain RN1068, not in the list). In this strain subsequently gpdl is deleted (to produce strain RN1069, not in the list Table 4). In these strains plasmids were introduced containing either the overexpression of one or both ACS genes (R 1070 and R 1071, not in the Table 4) and one of the heterologous genes E. coli adhE, E. histolytica ADH2 or E. coli mpfiF (RN1072 - RN1077, not in the Table 4). In strain RN1156 only the gpdl gene is deleted.

Deletion constructs gpdl and gpd2

gpdl ::hphMX

Upstream sequence PCR amplified from genomic DNA 5'KpnI site and 3 'an Xbal site. Downstream sequence PCR amplified with 5 'a BsiWI site and 3 'a Kpnl site. hphMX cloned from plasmid from the Nedalco collection cut with BsiWI and Xbal. Ligation and cloning in topo blunt vector. Cut with Kpnl to obtain deletion fragment for disrupting the genomic copy (SEQ ID NO: 17). Selection on hygromycin resistance correct integration was PCR verified.

gpd2::natMX

Upstream sequence PCR amplified from genomic DNA 5'BglII site and 3 'an Aflll site (from gpd2 sequence). Downstream sequence PCR amplified with 5 'a Xhol site and 3 'a Bglll site. natMX cloned from plasmid from the Nedalco collection cut with Aflll and Xhol. Ligation and cloning in topo blunt vector. Cut with Bglll to obtain deletion fragment for disrupting the genomic copy (SEQ ID NO: 18). Selection on nourseotricin resistance. Correct integration was PCR verified.

Cloning method for overexpression of the Saccharomyces cerevisiae ACSl and ACS2 genes

PCR ACSl with 5 'a Hindlll site and 3' an Aflll site. Clone the Tefl promoter Sail - Hindlll and the adhl terminator Aflll-BsiWI. Ligate to one functional unit and clone in topo vector.

PCR ACS2 with 5 'a Pstl site and 3 'a Sail site. Clone with the Pgkl promoter Spel - Pstl and the pgil terminator XhoI-BsiWI. Ligate to one functional unit and clone in topo vector. Cut ACSl and ACS2 overexpression construct with Sail and BsiWI and Spel and BsiWI respectively. Cut KanMX construct with BspEI and Xbal. Cut vector (pRS306 + 2mu ori) with BspEI and Xhol and ligate these four fragments to the plasmid pRN500 (SEQ ID NO: 20). Transformation of yeast, selection on G418 resistance. Overexpression was qPCR verified.

Expression of E. coli adhE, E. histolytica ADH2 or E. coli mpfiF

The pgkl promoter (Spel-Pstl) and the adhl terminator sequence (Aflll-Notl) were added to the codon optimized synthetic fragments and cloned into pRS303 with 2μ ori cut with Spel and Notl and the overexpression construct was cloned in this vector. Overexpression was qPRC verified. Codon optimized sequences for E. coli mpfiF (SEQ ID NO: 2), E. coli adhE (SEQ ID NO: 4) and E. histolytica ADH2 (SEQ ID NO: 6) are as indicated in the sequence listing.

GCY1 overexpression

PCR is performed on genomic DNA of S. cerevisiae with primers introducing a Pstl site 5 'of the ATG and an Aflll site 3 'of the TAA to produce the fragment of SEQ ID NO: 21. A DNA fragment comprising the S. cerevisiae Actinl promoter is ligated upstream of the GCY1 ORF and DNA fragment comprising the S. cerevisiae ADH1 terminator fragment is ligated downstream of the GCY1 ORF. DA 1 overexpression

PCR is performed on genomic DNA of S. cerevisiae with primers introducing a Xbal site 5 Of the ATG and a Sail site 3 Of the TAA to produce the fragment of SEQ ID NO: 22. A DNA fragment comprising the S. cerevisiae TPI1 promoter is ligated upstream of the DAK1 ORF and DNA fragment comprising the S. cerevisiae PGI1 terminator fragment is ligated downstream of the DAK1 ORF.

GUP1 overexpression

PCR is performed on genomic DNA of S. cerevisiae with primers introducing a Hindlll site 5 Of the ATG and a BamHI site 3 Of the TAA to produce the fragment of SEQ ID NO: 23. A DNA fragment comprising the S. cerevisiae TDH3 promoter is ligated upstream of the GUP1 ORF and DNA fragment comprising the S. cerevisiae CYC1 terminator fragment is ligated downstream of the GUP1 ORF.

FPS1 overexpression

PCR is performed on genomic DNA of S. cerevisiae with primers introducing a Nsil site 5'of the ATG and a BamHI site 3 Of the TAA to produce the fragment of SEQ ID NO: 24. A DNA fragment comprising the S. cerevisiae ADHl (medium) promoter is ligated upstream of the FSP1 ORF and DNA fragment comprising the S. cerevisiae CYC1 terminator fragment is ligated downstream of the FSP1 ORF.

Construction of pRN605 and yeast strains comprising pRN605

The expression constructs of GCY1, DAK1 and GUPlare combined into a pRS315- based centromeric plasmid having the hygromycine resistance gene as selectable marker to produce pRN605 (SEQ ID NO: 25). Plasmid pRN605 is used to transform the yeast strain RN1041 together with the plasmid pRN500 (pRS306, 2mu, ACSl, ACS2 and KanMX) and with plasmids expressing one of the heterologous genes adhE, adh2 or mphF and generating the strains RN 1079-2, RN 1080-2 and RN 1081-2 respectively.

Construction of pRN606 and yeast strains comprising pRN606

The expression constructs of GCY1 and GUPlare combined into a pRS315-based centromeric plasmid having the hygromycine resistance gene as selectable marker to produce pRN606 (SEQ ID NO: 26). This plasmid is used for the construction of yeast strain RN1082.

Construction of pRN607 and yeast strains comprising pRN607 The expression constructs of DAK1 and GUP 1 are combined into a pRS315-based centromeric plasmid having the hygromycine resistance gene as selectable marker to produce pRN607 (SEQ ID NO: 27). This plasmid is used for the construction of yeast strain RN 1083.

Construction of pRN608 and yeast strains comprising pRN608

The expression constructs of GCY1 and DAK1 are combined into a pRS315-based centromeric plasmid having the hygromycine resistance gene as selectable marker to produce pRN608 (SEQ ID NO: 28). This plasmid is used for the construction of yeast strain RN1084.

Construction of pRN609 and yeast strains comprising pRN609

Plasmid pRN609 is made by cloning the FPS l PCR fragment into pRN500 cut with EcoRI and Sail. This plasmid is used for the construction of yeast strain RN 1085.Construction of pRN819 and yeast strains comprising pRN819

The expression constructs of GCY1 , DAK1 and GUP1 are combined into a pRN615 (SEQ ID NO: 32) based plasmid having the phleomycine resistance gene as selectable marker to produce pRN819 (SEQ ID NO: 30). Plasmid pRN819 is used to transform the yeast strain RN1041 together with the plasmid pRN500 (pRS306, 2mu, ACS1 , ACS2 and KanMX) and with plasmids expressing one of the heterologous genes adhE, adh2 or mphF and generating the strains RN1079, RN1080 and RN1081 respectively. Construction of pRN595 and yeast strains comprising pRN595

pRN347 is constructed by cloning the 2μ origin of replication (that was PCR-amplified from pYES2) in pRS303 (with HIS3 gene for complementation). pRN595 is constructed by doing the adhE expression construct (see above) in pRN347. RN1041 is tranformed with the plasmids as indicated to produce strains RN1 150, RN1 151 and RN1 152:

RN1 150 = RN1041 + pRN819 + pRN595

RN1 151 = RN1041 + pRN347

RN1 152 = RN1041 + pRN595 + pRN500

Construction of FPS l deletion construct pRN895

For the deletion of FPS l a construct consisting of upstream, selectable marker and downstream sequences is made. This construct is cloned in plasmid pRN895 and can be cut out with Acc65l and BgUl prior to yeast transformation. loxP hphMX loxP is chosen as selectable marker encoding hygromycin resistance. Sequence fragments upstream and downstream of the FPS1 open reading frame are amplified with the following primers:

Upstream fragment (445bp)

fpsuf: AAGGTACCACGGCAAGATTGCCCG (SEQ ID NO: 34)

fpsur: TTTCTAGATTCCGGATAGTCGTCATCATTTCCCCC (SEQ ID NO:

35) downstream fragment (339bp)

fpsdf: CTCGAGTATTGGTGCGTTAATGGGGG (SEQ ID NO: 36)

fpsdr: CCAGATCTACCAAACGTTCTTTTGCCGC (SEQ ID NO: 37)

The upstream fragment is cut with Acc65l and Xbal and the downstream fragment is cut with Xhol and BgHl. The LoxP hphMX loxP fragment is cut from plasmid pRN888

(SEQ ID NO: 33) with Nhel and Xhol. These fragments are ligated and the correct fragment is amplified with the fpsuf and fpsdr primers. The fragment of 2607bp is cloned in pCRII blunt to make pRN895 (SEQ ID NO: 31). To obtain the fragment used for the yeast transformation pRN895 is cut with Acc65l and BgUl (2607bp). Correct integration is PCR verified.

Construction of further strains

RN1087 is obtained by transforming RN1068 with plasmids pRN819, pRN595 and pRN500.

RNl 153 is obtained by transforming RN1069 with plasmids pRN819, pRN595 and pRN500.

RNl 154 is obtained by transforming RNl 156 with plasmid pRN500.

RNl 155 is obtained by transforming RNl 079 with the fpsl deletion construct from pRN895.

RNl 156 is obtained by transforming RNl 150 with the gpdl deletion construct, RNl 157 is obtained by transforming RN1068 with plasmids pRN819 and pRN595. RNl 158 is obtained by transforming RNl 069 with plasmids pRN819 and pRN595 Table 4: Overview of strain constructed

ACS1 ACS2 GPD1 GPD2 adhE ade2 mphF DAK1 GCY1 GUP1 FPS1 / fpsIA

Strain kanMX kanMX hphMX natMX HIS3 HIS3 HIS3 zeoM zeoM zeoM Up: marker X X X KanM

X

del: hphMX

RN1041 wt wt wt wt absen absen absen wt wt wt wt t t t

RN1079 up up wt wt expr absen absen up up up wt t t

RN1080 up up wt wt absen expr absen up up up wt t t

RN1081 up up wt wt absen absen expr up up up wt t t

RN1082 up up wt wt expr absen absen wt up up wt t t

RN1083 up up wt wt expr absen absen up wt up wt t t

RN1084 up up wt wt expr absen absen up up wt wt t t

RN1085 up up wt wt expr absen absen up up wt up t t

RN1086 up up wt wt expr absen absen up up up up t t

RN1087 up up wt del expr absen absen up up up wt t t

RN1 150 wt wt wt wt expr absen absen up up up wt

t t

RN1 151* wt wt wt wt absen absen absen wt wt wt Wt t t t

RN1 152 up up wt wt expr absen absen wt wt wt Wt t t

RN1 153 up up del del expr absen absen up up up Wt t t

RN1 154 up up del wt expr absen absen up up up Wt t t

RN1 155 up up wt wt expr absen absen up up up del t t

RN1 156 wt wt del wt expr absen absen up up up Wt t t

RN1 157 wt wt wt del expr absen absen up up up Wt t t

RN1 158 wt wt del del expr absen absen up up up wt t t 3. Anoxic fermentations in sterile yeast extract peptone medium with constructed strains in the presence and absence of glycerol and or acetic acid

The proof of principle of concomitant reduction of acetic acid and oxidation of glycerol was obtained by using a medium containing 1% yeast extract and 1% peptone. Experiments were run in chemostat culture (1 liter working volume) at D = 0.05 h^"1 and the pH was kept at 5.5 by automatic addition of either KOH or H₂SO₄. Glucose (50 g/1) and xylose (50 g/1) were added as carbon and energy source to the yeast extract peptone medium. For these experiments demonstrating the proof of principle, no arabinose was included. Where relevant, acetic acid was added to the yeast extract peptone medium at 4 g/1 and glycerol at 10 g/1. The temperature was kept at 32 °C.

Precultures of strains are prepared by inoculating a frozen glycerol stock culture of the yeast in an YP (Yeast extract at 1% w/v and Peptone at 1% w/v) medium with addition of each of the sugars glucose and xylose (each at 1% w/v) at 32 °C and pH 5.5. After 24 h incubation under oxic conditions in shake flasks, 50 ml of this culture is used to inoculate the chemostat cultures.

At steady state of the fermentations (5 volume changes), a sample was taken for analysis of sugar (glucose and xylose) consumption, consumption of acetic acid, and metabolite (ethanol and glycerol). Ethanol, glycerol and acetic acid concentrations are monitored by HPLC analysis. To determine the sugar consumption, glucose and xylose are determined by HPAEC (Dionex) analysis.

Strain R 1151 is not able to reach a steady state situation in the medium containing 4 g/1 acetic acid either in the presence or absence of glycerol. If no acetic acid is added to the medium, the organism at steady state consumed all glucose and xylose (less than 1 g/1 remaining). No glycerol was consumed, but instead it was produced.

Strains RN1079, RN1080 and RN1081 are similarly tested on media with acetic acid and either with or without glycerol added. These strains perform distinctly different from strain RN1151. In the glycerol-containing medium the sugars glucose and xylose are consumed almost to completion (less than 1 g/1 remaining). Acetic acid levels decreases to 0.5 g/1 and the concentrations of glycerol at the end of the fermentation is 3 g/1 in all three instances. The amounts of ethanol produced for strains RN1079, RN1080 and RN1081 ranged between 43 and 47 g/1 in various experiments. In the medium not containing glycerol, but containing 4 g/1 acetic acid, no stable steady state was obtained. The strains cannot grow under these conditions. From these results we conclude that expression of either of the genes adhE, ade2 or mpfiF, and each in combination with upregulation of DAK1, GCY1 and GUP1, has a profound effect on the performance of the strains. In the presence of glycerol, they are able to consume glycerol and acetic acid,

Strains RN1087, R 1153 and R 1154 are similar to strain RN1079 except for the fact that GPD1 and/or GPD2 genes have been deleted. In the medium containing 4 g/1 acetic acid, the sugars glucose and xylose are consumed almost to completion (less than 1 g/1 remaining) if glycerol is added to the medium as is the case for strain R 1079. If no glycerol is added, no steady state is obtained.

4. Anoxic fermentations with the constructed strains in acetic acid comprising lignocellulosic hydrolysates in the presence or absence of glycerol

The corn fiber hydrolysate contains: glucose (38 g/1), xylose (28 g/1), arabinose (12 g/1) and acetic acid (4 g/1). It had been prepared by treating corn fibers at 160 C and at pH 3.0 during 20 minutes, followed by enzymatic hydrolysis by cellulases and hemicellulases. Acetic acid was added to this hydrolysate resulting in a total concentration of acetic acid in the hydrolysate of 10 g/1. The pH of this hydrolysate enriched in acetic acid was restored to pH = 4.5 by KOH addition. Yeast extract was added to this hydrolysate to reach a final concentration of 5 g/1. In all subsequent experiments, this enriched hydrolysate was employed. The pH during fermentations was kept at 6.5 by automatic addition of either KOH or H₂SO₄.

Precultures of strains are prepared by inoculating a frozen glycerol stock culture of the yeast in an YP (Yeast extract at 1% w/v and Peptone at 1% w/v) medium with addition of each of the sugars glucose, xylose and arabinose (each at 1% w/v) at 32 °C and pH 5.5. After 24 h incubation under oxic conditions in shake flasks, 50 ml of this culture is used to inoculate the fermenter cultures. Fermentations are performed in a fed-batch fermentation setup. Hydrolysate (either with or without glycerol added at 50 g/1) is pumped into the fermentor. If no glycerol was added, then 40 ml of water was added. During the first 6 hours, the flow rate for hydrolysate is set at a rate of 5 ml per hour. During the next 6 hours, the flow rate is set at 10 ml per hour. Subsequently, for another 43 hours, the flow rate is set at 20 ml per hour. The total volume at the end of the fermentation reaches 1000 ml. These anoxic fed-batch fermentations are performed at about pH = 4.5 with gentle stirring at 100 rpm. The temperature during the fermentations is set at 32 °C. To minimize infection, the hydro lysates are heated for 10 min at 105 °C prior to fermentations and the antibiotic kanamycine with at final concentration of 50 μg/ml is added.

At the end of the fermentations after 55 h, a sample was taken for analysis of sugar (glucose, xylose and arabinose) consumption, consumption of acetic acid, and metabolite (ethanol and glycerol). Ethanol, glycerol and acetic acid concentrations over time are monitored by HPLC analysis. To determine the sugar consumption, glucose, xylose, and arabinose are determined by HPAEC (Dionex) analysis.

Strain RN1151 (= R 1041 complemented with HIS3) is tested on hydrolysate either with or without glycerol added. In both instances, the concentration of glucose at the end of the fermentation run (55 h) is 35 g/1 whereas xylose and arabinose remain at their initial concentrations of 28 and 12 g/1, respectively. The amounts of ethanol produced are 2 g/1 and acetic acid is present at 9.5 g/1. No glycerol consumption is detected in the glycerol-containing hydrolysate. The fermentation of the sugars halts during the course of the fed-batch operation because of increasing levels of acetic acid. Initially, no acetic acid is present in the fermentor, but while pumping the hydrolysate that contained toxic levels of acetic acid, the concentration quickly reaches toxic levels.

Strains RN1079, RN1080 and RN1081 are similarly tested on hydrolysate either with or without glycerol added. These strains perform distinctly different from strain RN1151. In the glycerol-containing hydrolysate, the sugars glucose, xylose and arabinose are consumed to completion. Acetic acid levels decreases to 2 g/1 and the concentrations of glycerol at the end of the fermentation is 29.5 g/1 in all three instances. The amounts of ethanol produced for strains RN1079, RN1080 and RN1081 are 51.8, 52.1 and 51.6 g/1, respectively. In the hydrolysate that did not contain glycerol, considerably less sugar is consumed. Xylose and arabinose levels are unchanged at 28 and 12 g/1, respectively. Glucose is consumed but to a limited extent only. At the end of the fermentation, the remaining concentration is 32 g/1 in all three instances with ethanol reaching a concentration of 3 g/1. The concentration of acetic acid drops to 9.1 g/1 at the end of the fermentation whereas some glycerol is produced (less than 0.5 g/1). From these results we conclude that expression of either of the genes adhE, ade2 or mpfiF, and each in combination with upregulation of DAK1 , GCY1 and GUPl, has a profound effect on the performance of the strains. In the presence of glycerol, they are able to consume glycerol and acetic acid, and produce additional ethanol (as compared to strain R 1151). In the absence of glycerol, the strains consume some acetic acid. But during the fermentation, the acetic acid level rises to toxic levels.

Strains RN1082, RN1083 and RN1084 are similarly tested on hydrolysate either with or without glycerol added. As for strains RN1082 and RN1083, results for metabolite concentrations (either in the presence or absence of glycerol in the hydrolysate) are that xylose and arabinose levels are unchanged at 28 and 12 g/1, respectively Apparently, no substantial glycerol consumption takes place in these strains. Strain RN1084 gives better results than either strains RN1082 or RN1083 if glycerol is present in the medium. The glucose concentration at the end of the fermentation is 28 g/1 with xylose and arabinose levels unchanged at 28 and 12 g/1, respectively. Ethanol reaches 5 g/1, acetic acid is at 8.6 g/1 and glycerol at 48 g/1. Apparently, strain RN1084 is able to metabolize glycerol at a low rate in the absence of the transporter GUP1. In the absence of glycerol in the hydrolysate, strain RN1084 performs as expected. That is, almost no sugar is consumed and little ethanol is produced as is the case for strains RN1079, RN1080 and RN1081 when cultivated in the absence of glycerol. From these results we conclude that not over-expressing GUP1 has a negative effect on the glycerol uptake capabilities whereas not over- expressing either DAK1 or GCY1 prevents the yeast from glycerol metabolism at a rate that allows sufficient acetic acid consumption.

Strain R 1085 is constructed and tested in order to determine if FPS1 would be a more suitable glycerol transporter than GUP1 for the current purposes. However, as compared to strain R 1080, the strain is less effective in hydro lysates that contained glycerol. In the glycerol-containing hydrolysate, R 1084 consumes glucose resulting in a glucose concentration of 22 g/1 at the end of the fermentation, whereas no consumption of xylose or arabinose occurs. Acetic acid levels decrease to 7.5 g/1 and the concentrations of glycerol at the end of the fermentation is 26.5 g/1. The amounts of ethanol produced for strain R 1085 in the presence of glycerol is 6.7 g/1. The glycerol concentration is 46 g/1. In the absence of glycerol in the hydrolysate, strain R 1084 performs as expected. That is, almost no sugar is consumed and little ethanol was produced as is the case for strains R 1079, R 1080, R 1081, R 1082, R 1083 and RN1084. These results indicate that the passive diffusion of glycerol by FPS1 is less effective than via active glycerol uptake via GUP1.

In strain RN1086 both glycerol transporters are expressed. However, this organism performs considerably less than strain RN1085 in glycerol-containing hydro ly sate fermentations.

Strains RN1087, R 1153 and R 1154 are similar to strain RN1079 except for the fact that GPD1 and/or GPD2 genes have been deleted. In the glycerol-containing hydrolysate, the sugars glucose, xylose and arabinose are consumed to completion as was the case for strain RN1079. Acetic acid levels similarly decrease to approximately 2 g/1 and the concentrations of glycerol at the end of the fermentation is 28 g/1 in these three instances. The amounts of ethanol produced for strains RN1087, R 1153 and RN1154 are 52.7, 53.1 and 52.3 g/1, respectively. In the hydrolysate that not containing glycerol, considerably less sugar is consumed. Xylose and arabinose levels are unchanged at 28 and 12 g/1, respectively. Glucose is consumed but to a limited extent only. At the end of the fermentation, the remaining concentration in the non-glycerol hydrolysate for glucose is 31 g/1 in all three instances with ethanol reaching a concentration of 3 g/1. The concentration of acetic acid drops to 9.1 g/1 at the end of the fermentation whereas some glycerol is produced (less than 0.5 g/1). From these results we conclude that deleting GPD1 and/or GPD2 genes along with the other modifications in the R 1087, R 1153 and R 1154 result in strains that can perform the desired reactions.

Strain R 1155 has the same genotype as strain R 1079 except for the fact that FPS1 has been deleted. This organism gives results that are comparable to the results for strain R 1079 in glycerol-containing media in that the three sugars are consumed, and that glycerol is consumed as well as acetic acid to the levels as indicated for strain R 1079. However, erratic growth was observed in hydrolysate not containing glycerol.

Strains R 1150, R 1156, R 1157 and R 1158 lack overexpression of either ACSl and/or ACS2. These organisms were tested in the fed-batch mode as their counterpart strain R 1079, R 1154, R 1087 and R 1153, respectively. The counterpart organisms have ACSl and ACS2 overexpressed. The four strains lacking overexpressed ACS-genes perform similar to their counterpart strains in that after 55 hours of fermentation no sugars remain, ethanol is produced to similar levels and glycerol and acetic acid are consumed similar to the R 1079 situation. Strains RNl 151 and RNl 152 are strains to serve as control organisms. Neither of the strains perform reduction of acetic acid to an appreciable level nor do they metabolize glycerol at an appreciable rate.

Claims

1. A process for producing ethanol, whereby the process comprises the step of fermenting a medium with a yeast cell, whereby the medium contains or is fed with: a) a source of at least one of a hexose and a pentose;

b) a source of acetic acid; and,

c) a source of glycerol,

whereby the yeast cell ferments acetic acid, glycerol and at least one of the hexose and pentose to ethanol, and optionally, recovery of the ethanol,

and whereby the yeast cell comprises an exogenous gene coding for an enzyme with acetaldehyde dehydrogenase activity, which gene confers to the cell the ability to convert acetic acid into ethanol, and whereby, preferably, the exogenous gene coding for the enzyme with acetaldehyde dehydrogenase activity comprises a nucleotide sequence coding for an amino acid sequence with at least one of:

i) at least 64% amino acid sequence identity with SEQ ID NO: 1,

ii) at least 76% amino acid sequence identity with SEQ ID NO: 3 and, iii) at least 61% amino acid sequence identity with SEQ ID NO: 5.

2. A process according to claim 1, wherein the yeast cell comprises a genetic modification that increases at least one of

i) the specific activity of glycerol dehydrogenase;

ii) the specific activity of dihydroxyacetone kinase; and,

iii) transport of glycerol into the cell.

3. A process according to claim 2, wherein the genetic modification that increases the specific activity of at least one of glycerol dehydrogenase and dihydroxyacetone kinase is overexpression of a nucleotide sequence encoding at least one of a glycerol dehydrogenase and a dihydroxyacetone kinase, wherein, preferably, the nucleotide sequence encoding the glycerol dehydrogenase comprises a nucleotide sequence coding for an amino acid sequence with at least 50% amino acid sequence identity with SEQ ID NO: 7, and wherein, preferably, the nucleotide sequence encoding the dihydroxyacetone kinase comprises a nucleotide sequence coding for an amino acid sequence with at least 50% amino acid sequence identity with at least one of SEQ ID NO: 8 and 9.,.

4. A process according to any one of claims 2 - 3, wherein the genetic modification that increases transport of glycerol into the cell is overexpression of a nucleotide sequence encoding at least one of a glycerol uptake protein and a glycerol channel, wherein, preferably, the nucleotide sequence encoding the glycerol uptake protein comprises a nucleotide sequence coding for an amino acid sequence with at least 50% amino acid sequence identity with at least one of SEQ ID NO: 10 and 11, and wherein, preferably, the nucleotide sequence encoding the glycerol channel comprises a nucleotide sequence coding for an amino acid sequence with at least 30%> amino acid sequence identity with the amino acid sequence between amino acids 250 and 530 of SEQ ID NO: 12.

5. A process according to any one of the claims 2 - 4, wherein the yeast cell comprises a functional high-osmolarity glycerol response pathway, wherein, preferably, the cell has at least one functional copy of a endogenous gene encoding a glycerolphosphate dehydrogenase having an amino acid sequence with at least 70%> sequence identity to SEQ ID NO: 16.

6. A process according to any one of the claims 2 - 5, wherein the cell further comprises a genetic modification that increases the specific acetyl-CoA synthetase activity, and wherein, preferably, the genetic modification is overexpression of a nucleotide sequence encoding an acetyl-CoA synthetase.

7. A process according to claim 6, wherein the nucleotide sequence encodes an acetyl-CoA synthetase with a higher maximum rate than the acetyl-CoA synthetase encoded by the S. cerevisiae ACS1 gene, or wherein the nucleotide sequence encodes an acetyl-CoA synthetase with a higher affinity for acetate than the acetyl-CoA synthetase encoded by the S. cerevisiae ACS2 gene.

8. A process according to claim 6 or 7, wherein the genetic modification increases the specific acetyl-CoA synthetase activity under anaerobic conditions.

9. A process according to any one of claims 2 - 8, wherein the yeast cell comprises at least of:

i) a functional exogenous xylose isomerase gene, which gene confers to the cell the ability to isomerise xylose into xylulose; and,

ii) functional exogenous genes coding for a L-arabinose isomerase, a L- ribulokinase and a L-ribulose-5 -phosphate 4-epimerase, which genes together confers to the cell the ability to convert L-arabinose into D-xylulose 5 -phosphate, and wherein, preferably, the yeast cell comprises at least one further genetic modification that result in a characteristic selected from the group consisting of:

a) increased xylulose kinase specific activity;

b) increased flux of the pentose phosphate pathway

c) reduced unspecific aldose reductase specific activity

d) increased transport of at least one of xylose and arabinose into the host cell; e) decreased sensitivity to catabolite repression;

f) increased tolerance to ethanol, osmolarity or organic acids; and,

g) reduced production of by-products.

10. A process according to any one of the preceding claims, wherein the yeast cell is of a genus selected from the group consisting of Saccharomyces, Kluyveromyces,

Candida, Pichia, Schizosaccharomyces, Hansenula, Kloeckera, Schwanniomyces, and Yarrowia.

11. A process according to claim 10, wherein the yeast cell belongs to a species selected from the group consisting of S. cerevisiae, S. exiguus, S. bayanus, K. lactis, K marxianus and Schizosaccharomyces pombe.

12. A process according to any one of the preceding claims, wherein the medium contains or is fed with a lignocellulosic hydrolysate.

13. A process according to any one of the preceding claims, wherein the yeast cell ferments under anaerobic conditions.

14. A yeast cell comprising:

a) an exogenous gene coding for an enzyme with acetaldehyde dehydrogenase activity, which gene confers to the cell the ability to convert acetic acid into ethanol; and,

b) a genetic modification that increases at least one of:

i) the specific activity of glycerol dehydrogenase;

ii) the specific activity of dihydroxyacetone kinase; and,

iii) transport of glycerol into the cell.

15 A yeast cell according to claim 14, wherein the yeast cell further is as defined any one of claims 2 - 11.