WO2011138787A1

WO2011138787A1 - Identification of mrna-specific micrornas

Info

Publication number: WO2011138787A1
Application number: PCT/IL2011/000363
Authority: WO
Inventors: Stella Aronov
Original assignee: Ariel - University Research And Development Company, Ltd.
Priority date: 2010-05-05
Filing date: 2011-05-05
Publication date: 2011-11-10

Abstract

The present invention provides a method for identifying miRs which modulate a specific target mRNA. The present invention further provide transfected cells expressing tagged target mRNA and a labeled protein corresponding thereto.

Description

IDENTIFICATION OF mRNA-SPECIFIC MICRORNAS

FIELD OF THE INVENTION

The present invention provides a method for identifying microRNAs (miRs) which modulate a specific target mRNA. The present invention further provides host cells expressing tagged target mRNA and a labeled protein corresponding thereto.

BACKGROUND OF THE INVENTION

MicroRNAs (miRs) are short (20-25 nucleotides) endogenous non-coding RNAs that bind and repress or degrade translation of mRNA molecules, serving as essential transcriptional and post-transcriptional regulators. MicroRNAs originate from long miRNA precursors (Pri-miRs) which undergo two subsequent cleavages by the nuclear ribonuclease Drosha and cytoplasmic ribonuclease Dicer, thus producing mature molecules (Elbashir et al., Genes Dev. 2001 , 15; 15(2): 188-200).

MicroRNAs exhibit a wide range of physiological functions and the same miR may bind to different mRNAs, causing different effects and a single mRNA may be a target for multiple miRs. Although many studies have been directed to identify the mRNA targets of miRs and the role of miRs in various diseases, most of the mRNA targets of miRs remain unknown.

Currently, there are no accurate and simple methods for identifying the specific mRNA molecule(s) associated with or targeted by given miR(s). The most common approaches for predicting miR targets are based on in silico assays, using partial sequence alignment of complementary elements in the 3'-UTR of an miR and the corresponding sequences in the 3'-UTRs of the target gene. However, the target genes generated by these assays are substantially diverse, suggesting many false positive and false negative predictions. Additionally, the experimental approaches used to identify miR targets are not robust and rely upon a combination of different methods such as knocking out miR activity, temporary silencing of miR activity by short oligonucleotides (antagomir or antimir), over-expression of miR or a combination of all these techniques. These methods fail to distinguish definitively direct from indirect miR-target interactions and although they may partially identify mRNA targets of a certain miR, they cannot identify miRs directly bound to a specific mRNA.

U.S. Patent Application Publication No. 2010/0029501 discloses a method of identifying a target of a microRNA (miRNA or miR) by contacting the miRNA with a plurality of mRNAs, ex vivo, under artificial conditions that favor duplex formation between the miRNAs and the mRNAs.

Methods of identifying miRNA and its target RNA, based on obtaining miRNA/target RNA complexes in vivo and in vitro by non-specific hybridization, are disclosed in U.S. Patent Application Publication No. 2004/0175732. There remains an unmet need for methods enabling identification with high specificity of the miR(s) associated with specific mRNA.

SUMMARY OF THE INVENTION

The present invention provides a novel, efficient and highly accurate method for identifying the miRs which modulate a specific target mRNA. The present invention is based in part on the unexpected discovery that for a given mRNA, the particular miRs which modulate its expression and translation can be identified with high specificity using cells transfected with a sequence encoding the corresponding tagged mRNA or tagged fragments thereof. The methods of the invention enable for the first time identification of specific miR:niRNA pairs, formed intracellularly in real time, between the innate cellular miRs and a predetermined tagged mRNA or a fragment thereof expressed by a cell. The tagged mRNA or a tagged fragment thereof undergo translation, such that, the transfected cell not only expresses the tagged mRNA, but also produces the corresponding protein encoded by said mRNA.

As detailed below, to date, the majority of the methods directed to identifying miRs-mRNA pairs are based on in silico analyses and provide less than 50% accuracy.

In contrast, the methods of the invention are formed by a strict series of steps resulting in an accurate identification, with 100% specificity, of at least one miR associated with a given mRNA. Specifically, the methods of the invention comprise identifying miR:mRNA pairs, in intact cells that express tagged mRNA, of interest, wherein the tagged mRNAs are functional and translate to labeled proteins. Labeling both the mRNA and the protein corresponding thereto enables selecting cells by their ability to express functional mRNA. The methods of the invention provide a strong tool for identifying the miRs that regulate protein translation, mRNA degradation and other activities of cellular mRNA. The methods of the invention are also useful for designing therapeutic platforms for treating a disease by regulating mRNA and protein expression and translation associated with the disease.

According to one aspect the present invention provides a method of identifying at least one miR bound to a target mRNA, comprising:

(a) providing a plurality of cells co-transfected with a first nucleic acid sequence encoding a tagged mRNA and a labeled protein and a second nucleic acid sequence encoding RNA binding proteins fused to a marker;

(b) precipitating the tagged mRNA with the molecules bound thereto, thereby obtaining a precipitate of tagged mRNA:miR complexes comprising said tagged mRNA and at least one miR bound thereto; and

(c) identifying the at least one miR bound to said tagged mRNA. According to another embodiment, the second nucleic acid sequence encodes

RNA binding proteins fused to a fluorescent protein.

According to yet another embodiment, the method further comprises providing a plurality of cells co-transfected with a first nucleic acid sequence encoding a tagged mRNA and a labeled protein and a second nucleic acid sequence encoding RNA binding proteins fused to a marker, wherein the tagged mRNA comprises a nucleic acid sequence capable of binding the RNA binding proteins and wherein the plurality of cells produce the RNA binding proteins fused to a marker and the tagged mRNA fused to a labeled protein. According to yet another embodiment, the method further comprise selecting a precipitate comprising at least one miR bound to the tagged mRNA prior to identifying the miRs bound to said tagged mRNA.

According to yet another embodiment, the tagged mRNA further comprises any one or more of a target mRNA and an untranslated region. According to yet another embodiment, the method further comprises selecting a precipitate comprising one or more of: at least one miR bound to the target mRNA (mRNA:miR complexes); and at least one miR bound to the untranslated region (UTR:miR complexes).

According to yet another embodiment, the cells are stably transfected with the first nucleic acid. According to yet another embodiment, the cells are stably co- transfected with the first and second nucleic acids.

According to yet another embodiment, the second nucleic acid sequence encodes MS2-coat protein (CP) fused to a marker. According to yet another embodiment, the marker is green fluorescent protein (GFP). According to yet another embodiment the marker further comprises a streptavidin-binding protein (SBP).

According to yet another embodiment, the nucleic acid capable of binding the RNA binding proteins comprises MS2 mRNA binding sites capable of binding MS2- coat protein (CP).

According to yet another embodiment, the nucleic acid capable of binding the RNA binding proteins comprises at least 12 MS2 mRNA binding sites, wherein each binding site consists of a stem and loop structure capable of binding MS2-CP. According to yet another embodiment, precipitating (i.e. pulling down) is carried out by immunoprecipitation. According to yet another embodiment, the immunoprecipitation comprises a specific antibody targeted to the marker. According to yet another embodiment, the immunoprecipitation comprises streptavidin-conjugated beads which target the streptavidin-binding protein.

According to yet another embodiment, the method further comprises removing proteins bound to the precipitate mRNA:miR complexes prior to identifying the at least one miR.

According to yet another embodiment the method further comprises confirming the identity of the mRNA sequence bound to the at least one miR.

According to yet another embodiment, identifying is carried out by deep sequencing.

According to yet another embodiment, the method further comprises a validation step comprising transfecting a plurality of cells with said at least one miR and monitoring the activity of an mRNA corresponding to said tagged target mRNA thereby identifying the functional role of said at least one miR. According to yet another embodiment, the validation step comprises transfecting the plurality of cells with an antisense or sense nucleic acid sequence of said at least one miR.

According to yet another embodiment, the validation step further comprises monitoring the activity of at least one additional mRNA. It is to be understood that the mRNA used and explored by the methods of the invention, including the at least one additional mRNA, refers to endogenous mRNA.

According to yet another embodiment, the validation step comprises transfecting the plurality of cells with said at least one miR and evaluating the expression level of a protein translated by said target mRNA the mRNA corresponding to said at least one miR.

According to yet another embodiment the method further comprises modulating the expression of a target mRNA, comprising:

(a) identifying the at least one miR associated with a target mRNA by the methods of the present invention; and (b) introducing the at least one miR into at least one cell, thereby modulating the expression of the target mRNA. According to one embodiment, modulating the expression of the target mRNA is selected from the group consisting of: increasing expression of a protein translated by said mRNA, inhibiting expression of a protein translated by said mRNA and attenuating expression of a protein translated by said mRNA. Each possibility is a separate embodiment of the invention.

According to yet another embodiment the at least one miR modulates the expression of the target mRNA by any one or more of: translational inhibition, mRNA de-adenylation, mRNA degradation and mRNA sequestration. Each possibility is a separate embodiment of the invention. According to yet another embodiment the present invention provides a method for treating a disease associated with at least one gene product, comprising:

(a) identifying at least one miR associated with the at least one gene product by the methods of the invention; and

(b) administering a pharmaceutical composition comprising as the active ingredient, the at least one miR into a subject in need thereof, thereby modifying the activity of the at least one gene product.

According to one embodiment, the at least one gene product is selected from the group consisting of: mRNA comprising the gene product or an active fragment thereof, and mRNA which translates into the gene products or into an active fragment thereof.

According to another embodiment, modifying the activity of the at least one gene product is selected from inhibiting expression of the at least one gene product, inhibiting translation of the at least one gene product, attenuating the expression of the at least one gene product or attenuating the translation of the at least one gene product. Each possibility is a separate embodiment of the invention.

According to yet another embodiment, the disease is associated with overexpression of at least one gene product, wherein the disease is selected from the group consisting of: cancer, neuronal disorders, immune system disorders, autoimmune disorders, cardiovascular disorders, hematopoietic disorders, bone metabolism disorders, liver disorders, metabolic disorders and viral diseases. Each possibility is a separate embodiment of the invention.

According to yet another embodiment, the pharmaceutical composition further comprises pharmaceutically acceptable excipients, carriers, and diluents.

According to yet another embodiment the pharmaceutical composition is administered by a route selected from systemic administration and topical administration.

According to yet another embodiment the pharmaceutical composition is administered by systemic administration selected from the group consisting of: oral, parenteral, transdermal, rectal, injection, infusion, intravenous, intramuscular, and subcutaneous. Each possibility is a separate embodiment of the invention.

According to yet another aspect, the present invention provides a plurality of cells co-transfected with a first nucleic acid sequence encoding a tagged mRNA and a labeled protein and a second nucleic acid sequence encoding RNA binding proteins fused to a marker, wherein the tagged mRNA comprises a nucleic acid capable of binding the RNA binding proteins, and optionally, further comprises one or more nucleic acids selected from the group consisting of: a nucleic acid sequence comprising a target mRNA and an untranslated region. According to yet another embodiment, the second nucleic acid sequence encodes MS2-coat protein (CP) fused to a marker. According to yet another embodiment, the marker is a green fluorescent protein (GFP). According to yet another embodiment the marker further comprises a streptavidin-binding protein (SBP). According to yet another embodiment the nucleic acid capable of binding the

RNA binding proteins comprises MS2 mRNA binding sites capable of binding MS2- CP. According to yet another embodiment, the cells are eukaryotic cells other than yeast. According to yet another embodiment, the cells are mammalian cells. According to yet another embodiment, the cells are human cells. According to yet another embodiment, the cells are human cancer cells. According to yet another embodiment, the nucleic acid capable of binding the

RNA binding proteins comprises at least 12 MS2 mRNA binding sites, wherein each binding site consists of a stem and loop structure capable of binding MS2-CP.

According to yet another embodiment, the plurality of cells are stably transfected with the first nucleic acid. According to yet another embodiment, the cells are stably co-transfected with the first and second nucleic acids.

Further embodiments, features, advantages and the full scope of applicability of the present invention will become apparent from the detailed description and drawings given hereinafter. However, it should be understood that the detailed description, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a schematic representation of the pull down (precipitation) and miRNA identification assay.

FIG. 2 shows four β-actin constructs (FIG. 2A), expression of β-actin mRNA containing the GFP-MS2 fluorescent reporter, in the cytoplasm and nucleus of the H1299 cancer cells (FIG. 2B), expression of the labeled β-actin mRNA and protein in the lamillapodia (FIG. 2C) and expression of the labeled tau mRNA and protein in the axons and dendrites of neuronal P19 cells (FIG. 2D).

FIG. 3 shows transport of β-actin mRNA to the protrusions of HI 299 cells. FIG. 4 shows RT-PCR identification of β-actin mRNA from cells stably transfected by the tagged β-actin construct.

DETAILED DESCRIPTION OF THE INVENTION The present invention provides novel and accurate methods of identifying miRNA bound to a specific target mRNA. The present invention discloses methods involving a number of steps, carried out in a specific order, including labeling a specific target mRNA which subsequently forms a complex with at least one miR within living cells, in real time. The methods involve immunoprecipitation of the labeled target mRNAs and miR complex, followed by the accurate identification of said target mRNA and of at least one miR bound thereto.

The present invention is exemplified by the identification of miRs bound to β- actin in human cancer cells. As detailed below, HI 299 lung cancer cell were stably transfected with tagged nucleic acid constructs encoding tagged β-actin mRNA. Upon integration of the constructs in the β-actin gene, endogenous tagged β-actin mRNA was intracellularly transcribed and miR^-actin complexes were allowed to form under normal culture conditions. Immunoprecipitation (also termed herein 'pull down assay') of the miR^-actin complexes enables isolating the specific β-actin mRNA:miRs complexes and as a consequence isolating and identifying said miRs. Although the methods of the invention are exemplified for miRs that modulate the β-actin and tau genes, the method is applicable for identifying the miRs regulating any given mRNA.

The methods of the present invention further comprise a validation step of the identified miRs. This step is highly advantageous in that it precludes identification of non-specific miRs and increases the specificity of the claimed method. Specifically, gene target validation and protein target validation are performed for functional characterization of the identified miRs.

Thus, the methods of the invention disclose for the first time the accurate identification of miRs interacting directly with a specific target mRNA. Accordingly, the methods of the invention provide strong tools for investigating and monitoring mR A activities, including protein translation and protein function. Thus, the methods of the invention may be used for resolving mechanism involved in protein function. Furthermore, the methods and cells of the invention are useful for evaluating the effect of drugs and other therapeutic platforms on mRNA and protein functions. For example, the methods and cells of the invention may be used for designing screening assays aimed to assess the effect of a molecule of interest on protein translation and protein function. In addition, the methods and cells of the invention provide a highly useful tool for protein regulation. For example, the at least one miR identified by the methods of the invention may be found to be associated with the expression of a protein of interest.

The terms "microRNA", "miRNA" and "miR" are used interchangeably herein and refer to a microRNA molecule that is involved in RNA-based gene regulation. Specifically, microRNA refers to a small single-stranded genomically encoded RNA molecule, of about 20 to about 24 nucleotides, processed from a precursor, including, but not limited to, endogenous miRNAs and artificial miRNA (i.e. synthetic miRNA), which are capable of modulating the activity of an mRNA.

As used herein, the term "gene" has its meaning as understood in the art. In particular, the tenn gene refers to a nucleic acid (e.g., DNA or RNA) sequence that comprises coding sequences necessary for the production of RNA or a polypeptide. In general, a gene is taken to include gene regulatory sequences (e.g. promoters, enhancers, 3' and 5' untranslated regions, etc.) and/or intron sequences, in addition to coding sequences (open reading frames).

As used herein, the term "construct", when referring to nucleic acids, refers to an artificially assembled or isolated nucleic acid molecule which comprises the gene of interest or fragments thereof.

As used herein, the term "isolated" means (1) separated from at least some of the components with which it is usually associated in nature; (2) prepared or purified by a process that involves the hand of man; and/or (3) not occurring in nature. The terms "open reading frame" and "ORF" refer to the amino acid sequence encoded between translation initiation and termination codons of a coding sequence.

The term "mRNA" as used herein refers to endogenous RNA and includes, but is not limited to, pre-mRNA transcript(s), mature mRNA(s) ready for translation and transcripts of the gene or genes, or nucleic acids derived from the mRNA transcript(s). Furthermore, a nucleic acid derived from an mRNA transcript refers to a nucleic acid for the synthesis of which the mRNA transcript has served as a template. Thus, a cDNA reverse transcribed from an mRNA and a DNA amplified from the cDNA are all derived from the mRNA transcript and detection of such derived products is indicative of the presence and/or abundance of the original transcript in a sample.

The term "endogenous RNA" refers to any RNA which is encoded by any nucleic acid sequence present in the genome of the host cell, whether naturally- occurring or non-naturally occurring, i.e., introduced by recombinant means.

The terms "target mRNA", "specific mRNA" and "specific target mRNA" as used herein refer to a predetermined mRNA or one or more fragments thereof, selected a priori by the user as the mRNA of interest where the identification of the miRs associated therewith is desired.

The term "transfection" as used herein, refers to the transfer of foreign DNA into a host cell, resulting in genetic inheritance. Host cells containing the transfected nucleic acid fragments are referred to as "transgenic" cells. Transfection may be "stable", where the introduced DNA is incorporated into the genome of the cell, or "transient" where the introduced DNA is not incorporated into the genome of the cell. According to some embodiments, stable transfection is preferred.

As described herein, the present invention utilizes tagged nucleic acid constructs which are transfected into the DNA of the host cell, subsequently transcribed to the target mRNA, thereby yielding endogenously tagged mRNA, capable of binding RNA-binding proteins. Stable transfection ensures that the expression and trafficking of the target tagged mRNA are not altered and are performed by the endogenous transcription and translation systems of the cells, under physiological conditions. In contrast, transient transfection may end up with mRNA and protein expression that are beyond or below the physiological condition, which may cause toxic effects on the cells. Thus, for some mRNA and proteins, it may be preferred to apply in the methods of the invention stable transfection rather than transient transfection.

Furthermore, as disclosed herein, the protein product of said target mRNA is labeled thereby enabling, "in vivo " selection of cells expressing functional mRNA, i.e. mRNA that encodes the corresponding protein.

The terms "transfected cells", "transformants" and "transformed cells" are interchangeably used herein to describe the primary transformed cells and cell cultures derived from that primary cell regardless of the number of transfers. All progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Mutant progeny that have the same functionality as screened for in the originally transformed cell are included in the definition of transformants. The terms "nucleic acid", "nucleic acid sequence", "polynucleotide",

"polynucleotide sequence" and "oligonucleotide" are used interchangeably herein to refer to polymeric forms of nucleotides of any length, such as deoxyribonucleotides, ribonucleotides, or modified forms thereof in the form of an individual fragment or as a component of a larger construct, in a single strand or in a double strand or multi- strand form. The terms encompass sense and antisense sequences of DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. Further included are mRNA or cDNA that comprise intronic sequences. The backbone of the polynucleotide can comprise sugars and phosphate groups (as typically found in RNA or DNA), or modified or substituted sugar or phosphate groups. Alternatively, the backbone of the polynucleotide can comprise a polymer of synthetic subunits such as phosphoramidites and thus can be an oligodeoxynucleoside phosphoramidate or a mixed phosphoramidate-phosphodiester oligomer (see, e.g., Peyrottes et al. (1996) Nucl. Acids Res. 24: 1841-1848). A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl, other sugars, and linking groups such as fluororibose and thioate, and nucleotide branches. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component, capping, substitution of one or more of naturally occurring nucleotides with an analog, and introduction of means for attaching the polynucleotide to proteins, metal ions, labeling components, other polynucleotides, or a solid support. A polynucleotide may comprise a nucleotide sequence disclosed herein wherein thymidine (T) can also be uracil (U); this definition pertains to the differences between the chemical structures of DNA and RNA, in particular the observation that one of the four major bases in RNA is uracil (U) instead of thymidine (T).

As used herein, "treating" and "treatment", refers to amelioration or elimination of at least some of the symptoms associated with a disease associated with overexpression or downregulation of at least one gene product.

The present invention provides a method of identifying at least one miR bound to a target mRNA, comprising:

(a) providing a plurality of cells co-transfected with a first nucleic acid sequence encoding a tagged mRNA and a nucleic acid sequence encoding a labeled protein and a second nucleic acid sequence encoding RNA binding proteins fused to a marker; (b) precipitating the tagged mRNA with the molecules bound thereto, thereby obtaining a precipitate of tagged mRNA:miR complexes comprising the tagged mRNA or fragment(s) thereof and at least one miR bound thereto; and

(c) identifying the at least one miR. The term "tagged mRNA" as used herein describes an mRNA molecule comprising a nucleic acid sequence capable of binding RNA-binding proteins and may further comprise a nucleic acid sequence selected from the group consisting of: the target mRNA, the untranslated region (UTR) and the nucleic acid sequence encoding the labeled protein. The nucleic acid sequence capable of binding RNA-binding proteins forms a secondary structure which can bind to a specific domain of the RNA binding-protein. The length of the RNA-binding protein nucleic acid sequence is typically within the range of 10 to 30 nucleic acids, or about 15 to 25 nucleic acids.

Nucleic acid sequences capable of binding RNA-binding proteins include but are not limited to a streptavidin binding sequence (Streptotag), streptavidin binding sequence (SI), MS2 coat protein binding sequence, a sephadex binding sequence (D8), an N protein binding sequence (nut), a REV binding sequence, a TAT-binding sequence, a zipcode RNA sequence, the IRE target RNA sequence and an R17 coat protein binding sequence.

Other pairs of protein binding-RNA sequence/RNA binding-protein domain which can be used along with the aspects of the present invention include the hairpin II of the Ul small nuclear RNA and the RNA-binding domain of the U1 A spliceosomal protein (Oubridge et al., Nature 372:432-438 (1994); the IRP1 protein and the IRE target RNA sequence (a stem-loop structure found in the untranslated regions of mRNAs encoding certain proteins involved in iron utilization; Klausner et al., Cell 72: 19-28 (1993); the HIV REV and RRE (Zapp & Green, Nature 342:714- 716 (1989); the zipcode binding protein and the zipcode RNA element (Steward et al., in mRNA Metabolism and Posttranscriptional Gene Regulation, Wiley-Liss, New York, 127-146); and the box C/D motif and box C/D snoRNA family-specific binding protein (Samarsky et al., EMBO J. 17:3747-3757, 1998).

A method of identifying a localization of an RNA encoded by a gene-of- interest within a cell using RNA binding protein is disclosed in U.S Patent Application Publication No. 2010/0086917. The method comprises introducing into a cell an isolated polynucleotide encoding a reporter polypeptide and enabling homologous recombination of said isolated polynucleotide with the gene of interest and detecting within the cell a presence of said reporter polypeptide; thereby identifying the localization of the polypeptide encoded by the gene-of-interest within the cell.

According to a preferred embodiment the tag is a nucleic acid sequence comprising MS2 mRNA binding sites capable of binding MS2-coat protein (CP) fused with green fluorescent protein (GFP). The nucleic acid sequence may comprise a plurality of MS2 mRNA binding sites, wherein each binding site consists of a stem and loop structure capable of binding MS2-CP. Typically, each loop is 21 to 26 kb.

In a certain embodiment, the nucleic acid sequence comprises 12 or more MS2 mRNA binding sites. In other embodiment, the nucleic acid comprises 12, or 14, or 16, or 18 or 24 MS2 mRNA binding sites. It is to be understood that the number of MS2 mRNA binding site is optimally a number which provides excellent binding and strong labeling but causes minimal to zero toxicity.

Fluorescent proteins include, but are not limited to, a green fluorescent protein (GFP), yellow fluorescent protein (YFP), mCherry fluorescent protein or fragments thereof and red fluorescent protein (DsRed) or derivatives thereof.

The detectable marker may further comprise a streptavi din-binding protein (SBP) with high affinity to streptavidin-conjugated beads, for immunoprecipitation of the mRNA:miR complex.

The method of the invention further comprises:

(a) providing a plurality of cells co-transfected with a first nucleic acid sequence encoding a tagged mRNA and a labeled protein and a second nucleic acid sequence encoding RNA binding proteins fused to a marker, wherein the tagged mRNA comprises a nucleic acid sequence capable of binding the RNA binding proteins and wherein the plurality of cells produce the RNA binding proteins fused to a marker and the tagged mRNA fused to a labeled protein;

(b) precipitating said tagged mRNA with the molecules bound thereto in the plurality of cells, thereby obtaining a precipitate of tagged mRNA:miR complexes for each plurality of cells;

(c) selecting a precipitate comprising at least one miR bound to the tagged mRNA; and

(d) identifying the miRs bound to said tagged mRNA. According to yet another embodiment, the tagged mRNA further comprises any one or more of a target mRNA and an untranslated region. According to yet another embodiment, the method further comprises selecting a precipitate comprising one or more of: at least one miR bound to the target mRNA (mRNA:miR complexes); and at least one miR bound to the untranslated region (UTR:miR complexes).

According to some embodiments, the method comprises providing a plurality of cells co-transfected with a first nucleic acid sequence encoding a tagged mRNA and a labeled protein; and a second nucleic acid sequence encoding RNA binding proteins fused to a marker, wherein the tagged mRNA comprises (i) a target mRNA, (ii) a nucleic acid sequence capable of binding the RNA binding proteins and (iii) an untranslated region, and wherein the plurality of cells produce the RNA binding proteins fused to a marker and the tagged mRNA fused to a labeled protein.

According to other embodiments, the method comprises providing a plurality of cells co-transfected with a first nucleic acid sequence encoding a tagged mRNA and a labeled protein; and a second nucleic acid sequence encoding RNA binding proteins fused to a marker, wherein the tagged mRNA comprises (i) a target mRNA and (ii) a nucleic acid sequence capable of binding the RNA binding proteins, and wherein the plurality of cells produce the RNA binding proteins fused to a marker and the tagged mRNA fused to a labeled protein. According to yet other embodiments, the method comprises providing a plurality of cells co-transfected with a first nucleic acid sequence encoding a tagged mRNA and a labeled protein; and a second nucleic acid sequence encoding RNA binding proteins fused to a marker, wherein the tagged mRNA comprises (i) a nucleic acid sequence capable of binding the RNA binding proteins and (ii) an untranslated region, and wherein the plurality of cells produce the RNA binding proteins fused to a marker and the tagged mRNA fused to a labeled protein.

According to yet other embodiments, the method comprises providing a plurality of cells co-transfected with a first nucleic acid sequence encoding a tagged mRNA and a labeled protein; and a second nucleic acid sequence encoding RNA binding proteins fused to a marker, wherein the tagged mRNA comprises a nucleic acid sequence capable of binding the RNA binding proteins, and wherein the plurality of cells produce the RNA binding proteins fused to a marker and the tagged mRNA fused to a labeled protein.

According to yet other embodiments, the method comprises selecting a precipitate comprising one or more of: at least one miR bound to the target mRNA (mRNA:miR complexes); and at least one miR bound to the untranslated region (UTR:miR complexes).

Primarily, miRs recognize mRNAs through base-pairing to the 3' untranslated region or directly to the open reading frame of the mRNA. Hence, the plurality of cells obtained in (a) through (d) serve to identify the specific nucleic acid sequence the miRs bind to, namely the target mRNA or the untranslated region (UTR). Typically, the plurality of cells obtained in (a), (b) and (c) serve as positive control for identifying the specific nucleic acid sequence which the miR bind to and the cell population of (d) serves as a negative control as they do not contain any specific target mRNA or untranslated region. Thus, the cell population of (d) may serve as universal negative control for any target mRNA. Based on the identification of the mRNA:miR complexes in all the four cell populations a person of skill in the art can select the desired miR that he wishes to explore. For example, in order to identify only miR bound to the target mRNA, the person of skill in the art would select, by way of exclusion, only the miR that bind to target mRNA but not to the UTR, the nucleic acid sequence encoding the labeled protein or the nucleic acid sequence capable of binding the RNA binding proteins.

As detailed herein, although the target mRNA is known, it is required to confirm its identity during application of the methods of the invention. This confirmation validates that the mRNA to which the at least one miR bound to is the target mRNA.

Co-transfection of the plurality of cells in (a) through (d) with the first and second nucleic acid sequence, is carried out by use of plasmids comprising said nucleic acid sequences. The plasmids may further comprise a suitable promoter which may also be inducible. A non limiting example of a plasmid expression vector which may be used for the fusion of the first nucleic acid sequence is pcDNA3.1 . A non limiting example of a plasmid expression vector which may be used for the fusion of the second nucleic acid sequence is pcDNA4/TO, which may also comprise an inducible promoter, such as, a Tet-promoter. According another embodiment, the method further comprises cross-linking the tagged mRNA with the molecules bound thereto, prior to the precipitation of the tagged mRNA:miRs complexes. Typically, cross-linking is performed by formaldehyde or UV. For the formaldehyde cross-linking procedure, 1 % of formaldehyde may be added to the suspension of cells and subsequently washed with PBSX1. For the UV cross-linking procedure, the suspension of cells is irradiated at 254nm irradiation, targeting the RNA and the proteins bound thereto which subsequently induces the formation of a covalent bond between the RNA and the proteins. According to another embodiment the method further comprises reversing the cross-links after the precipitation step, and purifying the mRNA from the undesired molecules bound thereto or associated therewith prior to identifying the nucleic acid sequences of the mRNA and miRs bound thereto. The reversing procedure may comprise applying proteinase K, which digests the cross-linked polypeptides when incubated at the appropriate temperature, such as the temperature recommended by the manufacturer and text books, for example, around 42°C. The method further comprises incubation at high temperature, for example, 65°C, thereby removing the cross-links of the proteins and mRNA.

According to another embodiment, the method further comprises removing proteins bound to the precipitate mRNA:miR complex prior to identifying the nucleic acid sequences of the mRNA and said at least one miR bound thereto. Phenol/chloroform extraction is the one of the preferred approaches for removing the proteins from the nucleic acid samples and can be carried out in a manner that is very close to quantitative: Nucleic acids remain in the aqueous phase and proteins separate into the organic phase or lie at the phase interface.

Preferably, in the precipitation process, unwanted molecules bound to the tagged mRNA, such as, DNA, proteins, rRNA and small RNAs including tRNAs, are removed. In another embodiment the method further comprises reverse transcribing the precipitate mRNA:miR complex to cDNA products prior to identifying the at least one miR.

Identifying the nucleic acid sequences is carried out by any suitable technique known in the art, including, but not limited to, deep sequencing, cloning said at least one miR into a vector and sequencing the vector or fragments thereof and microRNA microarray assays.

Deep sequencing usually refers to a method of sequencing a plurality of nucleic acids in parallel (e.g., Bentley et al., Nature 2008, 456:53-59). Briefly, nucleic acids are attached to the surface of a reaction platform (e.g. flow cell), amplified in situ and used as templates for synthetic sequencing using a detectable label (e.g. fluorescent reversible terminator deoxyribonucleotide). It is considered a very accurate and efficient method for identifying nucleic acid sequences.

According to yet another embodiment the method further comprises a gene and protein target validation step which renders the methods of the invention highly specific. By applying the additional validation step, the modulating activity of the at least one miR on the target mRNA is verified and further specified. The validation step preferably comprises transfecting a cell with the at least one miR that was identified by the initial method steps, and monitoring the activity of an mRNA corresponding to the tagged mRNA, thereby identifying the functional modulatory role of said at least one miR on said mRNA.

The validation step may further comprise monitoring the activity of at least one additional mRNA other than the mRNA corresponding to said tagged mRNA.

Furthermore, the validation step may comprise transfecting a cell with said at least one miR and evaluating the expression level of a protein corresponding to the labeled protein, namely, the protein translated by the tagged target mRNA.

In another embodiment the present invention also provides a method for modulating the expression of a target mRNA, comprising: (a) identifying at least one miR associated with a target mRNA by the methods of the invention; and

(b) introducing the at least one miR into at least one cell, thereby modulating the expression of the target mRNA. Modulating the expression of the target mRNA includes, but is not limited to, any of the following activities: increasing expression of a protein translated by said mRNA, inhibiting expression of a protein translated by said mRNA and attenuating expression of a protein translated by said mRNA.

The mechanism by which the at least one miR may modulate an mRNA expression includes translational inhibition, mRNA de-adenylation, mRNA d gradation and mRNA sequestration.

In another aspect the present invention provides a method for treating a disease associated with modified expression of at least one gene product, the method comprising: (a) identifying at least one miR associated with the expression of at least one mRNA by the methods of the invention; and

(b) administering a pharmaceutical composition comprising as the active ingredient, the at least one miR into a subject in need thereof, thereby modifying the expression of the at least one mRNA. Typically, the at least one mRNA is selected from the group consisting of: mRNA comprising the gene product or an active fragment thereof, and mRNA which translates into the gene products or into an active fragment thereof. Each possibility is a separate embodiment of the invention.

Modifying the expression of at least one mRNA includes inhibiting or attenuating the expression of the at least one mRNA.

Any disease associated with overexpression of at least one gene product, may be treated according to the method the invention, including, but not limited to, any one or more of the following diseases: immune disorders, cardiovascular disorders, hematopoietic disorders, bone metabolism disorders, liver disorders, metabolic disorders and viral diseases among others.

The method of treating a disease associated with overexpression of at least one gene product can be applied to any target gene which considered as being associated with the disease, thereby specifically inhibiting, or at least attenuating, its expression. Non-limiting examples of genes which can be targeted by the at least one miR include but are not limited to an oncogene, a cytokine gene, a prion gene, a gene that translates to a protein which induces angiogenesis, an adhesion molecule, cellular motility (e.g. tau gene), signal transduction (e.g. β-actin gene) or a cell surface receptor, a gene involved in a metastasizing and a gene that regulates apoptosis and cell cycle.

Not limiting examples of neoplastic diseases and disorders associated with over expression of at least one gene product include but are not limited to: cancer, carcinoma, sarcoma, metastatic disorders, hematopoietic neoplastic disorders and leukemia.

The pharmaceutical composition of the present invention may be further useful in treating a variety of immune and autoimmune disorders associated with overexpression of at least one gene product including, but not limited to: diabetes mellitus, arthritis, rheumatoid arthritis, juvenile rheumatoid arthritis, osteoarthritis, psoriatic arthritis, multiple sclerosis, encephalomyelitis, myasthenia gravis, systemic lupus erythematosis, automimmune thyroiditis, dermatitis, atopic dermatitis, eczematous dermatitis, psoriasis, Sjogren's Syndrome, Crohn's disease, aphthous ulcer, iritis, conjunctivitis, keratoconjunctivitis, ulcerative colitis, asthma, allergic asthma, cutaneous lupus erythematosus, scleroderma, vaginitis, proctitis, drug eruptions, leprosy reversal reactions, erythema nodosum leprosum, autoimmune uveitis, allergic encephalomyelitis, acute necrotizing hemorrhagic encephalopathy, idiopathic bilateral progressive sensorineural hearing, loss, aplastic anemia, pure red cell anemia, idiopathic thrombocytopenia, polychondritis, Wegener's granulomatosis, chronic active hepatitis, Stevens-Johnson syndrome, idiopathic sprue, lichen planus, Graves' disease, sarcoidosis, primary biliary cirrhosis, uveitis posterior, interstitial lung fibrosis), graft- versus-host disease and allergies. The pharmaceutical composition of the present invention may also be useful in treating viral diseases associated with overexpression of at least one gene product, including, but not limited to, human papilloma virus, hepatitis C, hepatitis B, herpes simplex virus (HSV), HIV -AIDS, poliovirus and smallpox virus. The pharmaceutical composition which comprise, as the active ingredient, at least one miR identified by the method of the present invention may further comprise pharmaceutically acceptable one or more carriers, excipients and/or diluents.

The pharmaceutical composition may be administered once daily or in two or more sub-doses at appropriate intervals throughout the day, in dosages sufficient to inhibit, or attenuate, expression of the target gene.

The pharmaceutical composition may be administered by any route suitable for the administration of the at least one miR, which results with the desired therapeutic effect. Such route may be systemic or topical. Systemic administration includes oral or parenteral routes, including intravenous, intramuscular, intraperitoneal, subcutaneous, transdermal, airway (aerosol) and rectal administration.

The pharmaceutical composition may comprise microencapsulated formulations to protect the at least one miR from rapid elimination. Biodegradable polymers, such as, ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid may be used. Liposomal suspensions may also be used as pharmaceutically acceptable carriers and prepared by methods known in the art.

The pharmaceutical composition of the present invention may be formulated for intramuscular, intraperitoneal, subcutaneous and intravenous use, generally provided in sterile aqueous solutions or suspensions. Suitable aqueous vehicles include Ringer's solution and isotonic sodium chloride.

Oral administration generally provided in the form of tablets or capsules, powder, granules or as an aqueous solution or suspension. Tablets for oral use may include the active ingredients mixed with pharmaceutically acceptable excipients such as inert diluents, disintegrating agents, binding agents, lubricating agents, sweetening agents, flavoring agents, coloring agents and preservatives. Suitable inert diluents include sodium and calcium carbonate, sodium and calcium phosphate, and lactose. Capsules for oral use include hard gelatin capsules in which the active ingredient is mixed with a solid diluent, and soft gelatin capsules wherein the active ingredients is mixed with water or an oil such as peanut oil, liquid paraffin or olive oil.

The pharmaceutical composition of the present invention may be administered in combination with other known agents effective in treatment of diseases associated with overexpression of at least one gene.

The present invention further provides a plurality of cells stably transfected with a tagged nucleic acid sequence, wherein the plurality of cells express a tagged mRNA corresponding to the tagged nucleic acid sequence and produce a labeled protein encoded by said tagged mRNA and wherein the tagged mRNA comprises a nucleic acid sequence encoding a target mRNA and a tag.

According to yet another embodiment, the cells are eukaryotic cells other than yeast. According to yet another embodiment, the cells are mammalian cells. According to yet another embodiment, the cells are human cells. According to yet another embodiment, the cells are human cancer cells.

The following examples are presented to provide a more complete understanding of the invention. The specific techniques, conditions, materials, proportions and reported data set forth to illustrate the principles of the invention are exemplary and should not be construed as limiting the scope of the invention.

EXAMPLES

Example 1: Identification of miRs specific for β-actin and tau mRNAs An overview of the novel method disclosed in the present invention is illustrated in Figure 1 , exemplified for miRs bound to β-actin mRNA. Cells expressing endogenously functional β-actin mRNA, containing the MS2-RNA-binding protein sequence, are lysed. The β-actin mRNA containing the ribonucleoproteins (RNPs), including the MS2 RNA binding protein fused with green fluorescent protein (GFP) and the miRs bound thereto, are immunoprecipitated by binding to a column coated with antibody to GFP protein. The isolated RNPs are further eluted from the column and fractionated in order to purify fractions of β-actin mRNA and miRs bound thereto. Finally, these miRs are identified by deep sequencing or microarray analysis.

Constructs, cell system and MS2-pulldown assay

Constructs encompassing a fragment of the mCherry fluorescent sequence set forth in SEQ ID NO: 1 , for labeling the β-actin mRNA and the tau mRNA were designed. The sequence of the β-actin open reading frame is set forth in SEQ ID NO: 2. The tau-cod construct used in the present example is the human tau 23 coding region (1134 bp). The tau-cod-H construct included the 240 bp fragment H from tau 3_UTR (2529-2760; Aronov et al., J Mol Neurosci., 12(2):! 31-45, 1999).

Several GFP-tau constructs were prepared. The first included the complete region of tau 23, a juvenile form of tau, included repeats Rl, R3, and R4, and no insert in the N-terminus (Goedert EMBO J., 1989, 8(2):393-9). It was cloned by directed PCR using oligonucleotides primers 5'-GAAGATCTATGGCTGAGCCCCGCCAG-3' (SEQ ID NO: 8) that contains the site for Bgl II at the 5' end, and 5'- GAAGATCTATGGCTGAGCCCCGCC AG-3 ' (SEQ ID NO: 9) that contains the site for EcoRl at the 3' end. The product of the PCR reaction was subcloned in frame to the N-terminal EGFP in the Bgl II/EcoRl site of p-EGFP vector (Clontech®). 12 or 18 or 24 MS2 loops were inserted (subcloned) in to EcoRl/ BamHl site, at the 3' end of the GFP-tau construct. The cloning was verified by sequence analysis.

The GFP-tau-B construct included the B fragment that starts after MS2 loops, contains 1 154 bp (1637-2740) and terminates before the H region. It was derived by PCR and subcloned in to EcoRl, at the 3' end of the GFP-tau construct .

The GFP-tau-G construct include the Region G (624 bp) of tau 3'-UTR was cloned into the site EcoRl, at the 3' end of the GFP-tau construct . The GFP-tau-H construct included the H region includes 241 bp of tau 3'- UTR, which is required for sufficient localization. It was cloned into the EcoRl, at the 3' end of the Tau coding-GFP-MS2 construct.

The open reading frame of β-actin/tau was fused to SEQ ID NO: 1 in the N- terminus of the plasmid (pcDNA3.1) allowing visualization of β-actin/tau at the protein level. The constructs contained the ORF of β-actin/tau genes, either with or without its 3'UTR (Figure 2A). These constructs are used for identifying miRs that bind specifically to one of these regions. The β-actin 3' untranslated region (UTR) sequence is set forth in SEQ ID NO: 6. Twelve, eighteen or twenty four binding sites for the MS2 protein were inserted downstream of the termination codon of the β-actin/tau open reading frame and upstream to the 3'UTR end. The sequence of the twelve MS2 binding site is set forth in SEQ ID NO: 3, the sequence of the eighteen MS2 binding site is set forth in SEQ ID NO: 4 and the sequence of the twenty four MS2 binding sites is set forth in SEQ ID NO: 5.

The β-actin constructs were stably transfected to HI 299 cells and the tau constructs were stably transfected to neuronal P19 cells. The HI 299 and P19 cells were each further co-transfected with a plasmid containing MS2 coating protein fused to green fluorescent protein (GFP), which allowed detection of the β-actin/tau mRNA using fluorescence microscopy. The sequence of the plasmid is set forth in SEQ ID NO: 7.

The β-actin/tau mRNA is immuneprecipitated (pulled-down) by a specific antibody to GFP-MS2 RNA binding protein and extracted from the HI 299 and PI 9 cells. Every molecule of β-actin/tau mRNA is decorated by 12, 18 or 24 MS2-GFP protein molecules and a strong CMV promoter allowing expression of high number of mRNA copies per cell.

MicroRNA cloning to the vector and subsequent sequencing of the ligated miRs: Purification of the total RNA fraction is performed by using phenol-based isolation procedures that can recover RNA species in the 10-200-nucleotide range. The isolation of mature miRNA (19-23 nucleotides) from longer precursor molecules is carried out by running on an efficient polyacrylamide gel electrophoresis (PAGE).

The subsequent gel elution, was performed for isolation of small nucleic acids. The purified miRs are ligated with 3' donor and 5' acceptor oligonucleotide to RNA with T4 RNA ligase. The two-linkers ligated products were purified by polyacrylamide gel electrophoresis according to the indication of Colored Size Marker. The ligation of the linkers also prevents circularization of the fragments.

MiRs are amplified by RT-PCR and the PCR product is digested with restriction enzymes whose target site was incorporated into donor and acceptor oligonucleotides. Concatamerize PCR products are ligated with T4 DNA ligase in order to get insertion of several PCR fragments on the one long fragment. This product fills in the ends of the PCR products and ligation products (400-600 nt range) are isolated by gel purification. Resulting clones contain 4-6 inserts and provide longer templates for efficient sequencing analysis. These long PCR fragments are cloned into cloning vector and screening performed for vectors containing inserts by PCR. Positive vectors with insert are purified and sequenced. Alternatively the miRs are identified by deep sequencing technologies. The cells containing only the tagged plasmid are used as a negative control.

Functional characterization of the identified miRs: Functional characterization of the identified miRs is accomplished by either deletion/inhibition or over-expression of plasmids containing the identified miRs in the human cancer cells or neuronal cells. The level of endogenous and transfected β-actin/tau mRNA is measured 12 hours after treatment, and compared between treated and untreated cells by using real time PCR. As positive control cells treated with Dorsha or Dicer inhibitors are used. For negative control, the level of GAPDH mRNA is measured in the treated samples. The expression of the protein is measured by the Western blot analysis using specific anti- β-actin/anti-tau antibodies. Additionally miR mimetics or antagomirs are applied as they are known to be potent modulators of miRs expression in cancer. Finally the motility and invasiveness of the treated cells is assessed by using wound-healing and modified Boyden chamber assays. Example 2: Pair-wise poor overlaps (in silico) between identified miRs using different miRs databases

Bioinformatical searches predicting miRs target sites for a preselected mRNA sequence was performed using publicly available miR databases. The miR databases used and there publicly available url were:

1. miRBase- http://microrna.sanger.ac.uk/targets/v5/

2. miRanda- http://www.microrna.org/microrna/home.do

3. PicTar- http://pictar.mdc-berlin.de/

4. TargetScan- http://www.targetscan.org/

The β-actin mRNA sequence and the tau mRNA sequence were selected and several miRs were predicted to bind to said sequences using the above databases. The results of the search scan for β-actin are presented in Table 1 and for tau are presented in Table 2. Pair-wise overlaps between the different databases, predicting miRs bound to β-actin did not exceed 40% (Table 1) and for tau even lower overlaps were obtained (Table 2). Thus, bioinformatic approaches yield substantially diverse results with very low overlaps indicating the presence of many false positive and false negative results.

Table 1 : Pair-wise overlaps of predicted miRs bound to β-actin

Table 2: Pair- wise overlaps of predicted miRs bound to tau Database miRBase(l ) miRanda PicTar TargetScan

(Number of miRs) (27) (3) (237)

miRBase ( l ) 0 (0%) 0 (0%) 1 (36.17%) miRanda (27) 0 (0%) 1 (19.57%)

PicTar (3) 3 (100%)

TargetScan

(237)

Example 3: Construction of the 3-actin mRNA/protein and tau mRNA/protein labeling system

Four tagged β-actin constructs were designed (Fig. 2A):

1. mCherry as set forth in SEQ ID NO: 1 fused to MS2 binding loops as set forth in SEQ ID NO: 3;

2. mCherry as set forth in SEQ ID NO: 1 fused to MS2 binding loops as set forth in SEQ ID NO: 3 fused to 3'UTR as set forth in SEQ ID NO:

3. mCherry as set forth in SEQ ID NO: 1 fused to β-actin open reading frame (ORF) as set forth in SEQ ID NO: 2 fused to MS2 binding loops as set forth in SEQ ID NO : 3 ;

4. mCherry as set forth in SEQ ID NO: 1 fused to β-actin open reading frame (ORF) as set forth in SEQ ID NO: 2 fused to MS2 binding loops as set forth in SEQ ID NO: 3 fused to 3'UTR as set forth in SEQ ID NO: 6.

The MS2 binding loops bind MS2 protein fused to green fluorescent protein (GFP). The same four constructs were designed using the tau ORF. Cells were stably transfected with the constructs containing the MS2 binding sequences that integrated within the β-actin (Fig. 2C). These cells were selected by antibiotic G418. A plasmid expressing an RNA binding protein MS2 fused to GFP was stably co-transfected into the HI 299 lung cancer cells and neuronal P19 cells which were further selected by antibiotic-Zeomicin. The MS2-GFP protein was targeted directly to the nucleus by its nuclear localization signal (NLS), where it bound to the corresponding MS2 loops inserted in the β-actin/tau genes. The labeled β-Actin mRNA was exported to the cytoplasm inside granules which accumulated in the lamillapodia of HI 299 cells (Fig. 2C).

Fluorescently labeled β-actin mRNA and protein were visualized in the cytoplasm and nucleus of the H1299 cancer cells (Fig. 2B). P19 cells were transfected with lipofectine reagent followed by selection with G418 and FACS sorting. Observation of the stable GFP -tau cell lines was done by confocal microscopy with GFP-optimized filter set (Confocal Zeiss™, Germany).Visualization of tau mRNA and proteins revealed expression in the axon and dendrites of neuronal PI 9 cells (Fig. 2D), confirming that all the transfected cells expressed the GFP-MS2 product. Visualization and merging of β-actin expressed both at the mRNA and protein levels showed that mRNA and protein co-localized in lamillapodia inside granules of the H1299 cells (Fig. 2C). Visualization and merging of tau expressed both at the mRNA and protein levels showed that mRNA and protein co-localized in the axon and dendrites of the neuronal PI 9 cells. Pictures were taken with a Nikon™ fluorescence microscope and analyzed with Adobe Photoshop 8.0. Bar, 10 μηι (x4000 magnification).

The co-localization of the β-actin and tau mRNA, each with their corresponding protein, demonstrates full functionality of the used constructs and their eligibility for future immunoprecipitation studies.

Example 4: The effect of β-actin mRNA transport on its protein localization in cancer cell protrusions

The involvement of β-actin mRNA transport in localization of β-actin protein to the protrusions was performed by using time lapse microscopy analysis on the construct containing ORF and 3'UTR of β-actin. It was found that β-actin mRNA formed granules of size around lum. These granules were transported to the site of lamellipodia formation where the β-actin protein was actively expressed. Figure 3 shows transport of β-actin mRNA to the protrusions of the HI 299 cells. Migration of β-actin mRNA containing granules was identified at the site of lamellipodia formation (magnified and arrow pointed at the right part of the figure). The localization of β-actin mRNA was examined by time lapse microscopy analysis. Pictures were taken with a Nikon fluorescent microscope and analyzed with Adobe Photoshop 8.0. Bar, 20μηι (x 8000 magnification).

Thus, the high level of β-actin expression may be responsible for the extraordinary motility and invasiveness of the HI 299 cells.

Example 5: Immunoprecipitation of ribonucleoprotein (RNPs) complexes

Stable cells including the β-actin constructs were grown to high density (0.2- lxlO⁸ cells) and cross-linked to preserve mRNA/protein complexes. The cells were lysed and used for immunoprecipitation with specific beads treated with GFP antibody. After prolonged incubation the beads were washed and RNPs were eluted. The identity of β-actin mRNA was confirmed by applying RT-PCR with specific primers (Fig. 4).

As shown in Fig. 4, amplification of the immunoprecipitated RNPs with specific β-actin primers produced a band corresponding to the β-actin gene (lane 2). No product was obtained when primers for GAPDH (glyceraldehyde-3 -phosphate dehydrogenase) were used as a negative control (lane 1). Lane 3 is an additional negative control without DNA template. Molecular weight marker (MW lane) was used to identify the size of the RT-PCR product. Hence, only the product of β-actin mRNA was observed, indicating specificity of the assay.

Example 6; Ribonucleoprotein immunoprecipitation (RIP) An exemplary protocol of immunoprecipitation which was used in the methods of the invention is detailed bellow.

First, the preparation of whole cell RNP lysates from cultured cells was carried out. The preparation included growing cells in 10 x 150mm dishes until they were around 90% confluence.

Next, cross-linking of RNPs was performed. The formaldehyde cross linking method included adding to the cell suspension 1% formaldehyde, incubating for 1 Omin. and washing 3 times with 5ml of PBSX1.

The UV cross-linking method was carried out at 254 nm irradiation. Preferably, the depth of the suspension was approximately 1 mm. Irradiation is performed three times for 100^l00mJ/cm2 (approx. 15 cm distance from UV source) three times in Stratalinker™ (Stratagene™ model 2400) on ice. The cell suspension was mixed between each irradiation.

After irradiation immediately cells were collected and pelleted by centrifugation at 2500 rpm for 3 min at 4°C, the pellet was re-suspended in PBS and 1 ml of suspensions in microfuge tubes were subjected to Quick™ spin cells (10 sec max speed) at 4°C and supernatant was removed. At this point, pellets may be stored in liquid nitrogen.

Since cross-linking was performed on live cells, it enabled detecting unperturbed in vivo environment with relevant intermolecular interactions, salt and ion concentrations. Because the covalent bond formed by UV cross-linking is irreversible, the RNA may be partially digested to short RNA tags. A number of purification steps following the initial immunoprecipitation (IP) greatly enhanced the signal to noise ratio of RNA tags encoding the direct protein binding site. Next, cell lysis is carried out. Cell pellets were thawed (on ice) and to the pellet volume approximately 1.5 volumes of lysis buffer was added. Homogenous mixture was obtained and transferred to 2 ml centrifuge tubes, centrifuged at 14,000g for 10 minutes at 4°C . The supernatant was separated and centrifuged again to remove the lipid layer on top of the supernatant. Pellet was re-suspended in polysime lysis buffer, and combined with the supernatant obtained above.

Next, DNAses treatment (RNase-free DNase I) was applied by adding the following to 500 μΐ of the extract: MgCl₂ to 25 mM, CaCl₂ to 5 mM, 3μ1 of 40 U/μΙ RNasin and 6μ1 of 20 mg/ml RNase-free DNase I. After incubation (37°C for 15 min.) 20 μΐ of 0.5 M EDTA was added to stop the reaction (for a final concentration of 20 mM). Suspension was microcentrifuged (5 min at maximum speed) and the supernatant was retained and stored at -70°C . Next, protein concentration was determined the by Bradford. mRNP isolation was initiated by snap-freezing the extracts in liquid nitrogen and storing at -80°C until use.

Antibody coating of bead matrix was obtained using protein G Sepharose beads for monoclonal antibodies or protein Sepharose beads for rabbit serum or rabbit polyclonal antibodies. Protein G Sepharose beads (Amersham™) were stored in 20% EtOH . A portion (50 \iV) of drained beads (beads only) was used for each IP. After removal of EtOH (spinning at 10,000 rpm for 3 minutes, at 4°C) beads were resuspended in 8 volumes (400 μΕ) NT2 buffer containing 5% BSA, 0.02% sodium azide and heparin 0.02 mg/ml and washed three times as described above. The antibody was added according to the manufacturer's instructions. For example, for MOCK RIP, the beads were incubated only with NT2 buffer supplemented as described earlier.

Protein A Sepharose beads (Amersham®) were similarly prepared with NT2 buffer containing 5% BSA, 0.02% sodium azide and heparin 0.02 mg/ml and let to swell for around 12 hours on a rotating device at 4°C. Swollen beads were then stored at 4°C.

For each IP about 50 xL of drained beads (beads only) were used. Beads were resuspended in 8 volumes (400 μΕ) NT2 buffer containing 5% BSA, 0.02% sodium azide and heparin 0.02 mg/ml and then the immunoprecipitating antibody was added and suspension was incubated (around 12 hours) on a rotating device at 4°C. For MOCK RIP, the beads were incubated only with NT2 buffer supplemented as described earlier.

The immunoprecipitation of mRNPs: whole cell mRNP isolation was obtained according to the following procedure: a. Thaw the lysate on ice and centrifuge it in a microcentrifuge at 14,000g for 10 minutes at 4°C, then transfer the supernatant to a new tube on ice . b. Wash the beads three times at room temperature with NT2 buffer, spinning at 10,000 rpm for 3 minutes, then transfer the beads in 14 ml tubes and repeat the washing once more, and spin down the beads at 2,000 rpm for 2 minutes and 4°C and keep the beads on ice until use . c. Resuspend the antibody-coated beads in NT2 buffer supplemented with 50 U/mL RNase OUT™, 50 U/mL Superase-ΓΝ™, ImM dithiothreitol, and 30mM EDTA .The volume of resuspended beads in NT2 buffer correspond to ten times the volume of the RNP lysate being used because performing the immunoprecipitation reactions in larger volumes may decrease background problems. Perform the RIP in 14 ml tubes . d. Mix the resuspended antibody-coated beads several times by inversion, add the RNP lysate and tumble the immunoprecipitation reactions on a rotation device for 6 hours at 4°C. e. Collect a sample of the supernatant at the beginning of the incubation, then after 2h, 4 h and 6h to check the efficiency of the IP during the time (spin at 2000 rpm for 2 minutes at 4°C). f. After the incubation, spin the beads down as described at (e), remove the supernatant, add 1.0 ml ice-cold NT2 buffer and transfer the beads to a 1.5 ml tube, mix, then spin down the beads at 10,000 rpm for 3 minutes at 4°C. g. Repeat the washing step three more times and save samples from each washing step. h. Resuspend the washed beads in 500μί SDS-EDTA solution and incubate at 65 °C for 10 minutes mixing every two minutes by inverting the tubes . i. Spin down the beads by spinning at 10,000 rpm. 3 minutes at room temperature. j. Save the supernatant as 1st elution in a 2 ml tube and keep it at room temperature. k. Resuspend the beads again in 500μΙ, SDS-EDTA solution and incubate at 65°C for 10 minutes mixing every two minutes by inverting the tubes.

1. Spin down the beads by spinning at 10,000 rpm 3 minutes at room temperature. m. Save the supernatant as 2nd elution in a 2 ml tube and keep it at room temperature . n. Save samples from 1st and 2nd elution for SDS-PAGE before proceeding to RNA extraction, save samples from beads after elution, then store the beads at - 80°C.

Next, reverse cross-linking and RNA purification are applied. To this end, proteinase K is used as follows: add 6 μΐ of 5 M NaCl (for final concentration of -200

niM together with 20 μg proteinase K from 20 mg/ml stock; incubate at 42°C for 1 hr (optional), then at 65 °C for 1 hr. The incubation at 42°C allows for proteinase K digestion of cross-linked polypeptides, while the 65 °C incubation results in a reversal of the formaldehyde cross-links.

Then water was added (100 μΐ nuclease-free) to RNA (150 μΐ), then an equal volume (250 μΐ) of acid-equilibrated 5:1 phenol/chloroform, pH 4.7 was add. Phase lock gel, heavy, as recommended by the manufacturer was used for quick separation of the layers. The resulting aqueous layer was mixed with sodium acetate (3M), glycogen (pH 5.5, 20 μg), and ice-cold absolute ethanol (625 μΐ and incubated (at -80°C for 1 to 2 hr) to allow the RNA to precipitate.

After centrifugation (microcentrifuge 30 min at maximum speed, 4°C) supernatant was removed, precipitate washed (by adding 500 μΐ ice-cold 70% ethanol) and microcentrifuged (5 min at maximum speed, 4°C). Supernatant was removed and pellet was allowed to air dry.

Optionally, for storage, and to avoid RNA degradation the pellet may be dissolved in 200 μΐ TE buffer, pH 7.5, then 2.5 vol of absolute ethanol, and in the absence of salt. This mix can be stored for weeks at -80°C.

Claims

A method of identifying at least one miR bound to a target mRNA, comprising:

(b) precipitating the tagged mRNA with the molecules bound thereto, thereby obtaining a precipitate of tagged mRNA:rniR complexes comprising said tagged mRNA and at least one miR bound thereto; and

(c) identifying the at least one miR bound to said tagged mRNA.

The method of claim 1 , wherein the method further comprises providing a plurality of cells co-transfected with a first nucleic acid sequence encoding a tagged mRNA and a labeled protein and a second nucleic acid sequence encoding RNA binding proteins fused to a marker, wherein the tagged mRNA comprises a nucleic acid sequence capable of binding the RNA binding proteins and wherein the plurality of cells produce the RNA binding proteins fused to a marker and the tagged mRNA fused to a labeled protein.

The method of claim 1, wherein the method further comprises selecting a precipitate comprising at least one miR bound to the tagged mRNA prior to identifying the miRs bound to said tagged mRNA.

The method of claim 2, wherein the tagged mRNA further comprises any one or more of: a target mRNA and an untranslated region.

The method of claim 3, further comprising selecting a precipitate comprising one or more of: at least one miR bound to the target mRNA and at least one miR bound to the untranslated region.

The method of claim 1, wherein the second nucleic acid sequence encodes RNA binding proteins fused to a fluorescent protein.

7. The method of claim 1, wherein the second nucleic acid sequence encodes MS2-coat protein (CP) fused to a marker.

8. The method of claim 7, wherein the marker is a green fluorescent protein (GFP).

9. The method of claim 7, wherein the marker further comprises a streptavidin- binding protein (SBP).

10. The method of claim 2, wherein the nucleic acid sequence capable of binding the RNA binding proteins comprises MS2 mRNA binding sites capable of binding MS2-coat protein (CP).

11. The method of claim 2, wherein the nucleic acid sequence capable of binding the RNA binding proteins comprises at least 12 MS2 mRNA binding sites, wherein each binding site consists of a stem and loop structure capable of binding MS2-CP.

12. The method of claim 1, wherein precipitation in step (b) is carried out by immunoprecipitation.

13. The method of claim 12, wherein the immunoprecipitation comprises a specific antibody targeted to the marker.

14. The method of claim 12, wherein the immunoprecipitation comprises streptavidin-conjugated beads which target the streptavidin-binding protein.

15. The method of claim 1, wherein the method further comprises removing proteins bound to the precipitate mRNA:miR complexes prior to identifying the at least one miR.

16. The method of claim 1, wherein the method further comprises confirming the identity of the mRNA sequence bound to the at least one miR.

17. The method of claim 1 , wherein identifying in step (c) is carried out by deep sequencing.

18. The method of claim 1, wherein the method further comprises a validation step comprising transfecting a plurality of cells with said at least one miR and monitoring the activity of an mRNA corresponding to said tagged target mRNA thereby identifying the functional role of said at least one miR.

19. The method of claim 18, wherein the validation step comprises transfecting the plurality of cells with an antisense or sense nucleic acid sequence of said at least one miR.

20. The method of claim 19, wherein the validation step further comprises monitoring the activity of at least one additional mRNA.

21. The method of claim 18, wherein the validation step comprises transfecting the plurality of cells with said at least one miR and evaluating the expression level of a protein translated by said target mRNA the mRNA corresponding to said at least one miR.

22. The method of any one of claims 1 and 2, wherein the cells are stably transfected with one or more of the first nucleic acid sequence and the second nucleic acid sequence.

23. A method for modulating the expression of a target mRNA, comprising:

(a) identifying at least one miR associated with a target mRNA by the method of any one of claims 1 and 2; and

(b) introducing the at least one miR into at least one cell, thereby modulating the expression of the target mRNA.

24. The method of claim 23, wherein modulating the expression of the target mRNA is selected from the group consisting of: increasing expression of a protein translated by said mRNA, inhibiting expression of a protein translated by said mRNA and attenuating expression of a protein translated by said mRNA.

25. The method of claim 23, wherein the at least one miR modulates the expression of the target mRNA by translational inhibition, mRNA de-adenylation, mRNA degradation and mRNA sequestration.

26. A method for treating a disease associated with at least one gene product, comprising:

(a) identifying at least one miR associated with the at least one gene product by the method of any one of claims 1 and 2; and

27. The method of claim 26, wherein the at least one gene product is selected from the group consisting of: mRNA comprising the gene product or an active fragment thereof, and mRNA which translates into the gene products or into an active fragment thereof.

28. The method of claim 26, wherein modifying the activity of the at least one gene product is selected from inhibiting expression of the at least one gene product, inhibiting translation of the at least one gene product, attenuating the expression of the at least one gene product or attenuating the translation of the at least one gene product.

29. The method of claim 26, wherein the disease is associated with overexpression of at least one gene product, wherein the disease is selected from the group consisting of: cancer, neuronal disorders, immune system disorders, autoimmune disorders, cardiovascular disorders, hematopoietic disorders, bone metabolism disorders, liver disorders, metabolic disorders and viral diseases.

30. The method of claim 26, wherein the pharmaceutical composition further comprises pharmaceutically acceptable excipients, carriers, and diluents.

31. The method of claim 26, wherein the pharmaceutical composition is administered by a route selected from systemic administration and topical administration.

32. The method of claim 31, wherein the pharmaceutical composition is administered by systemic administration selected from the group consisting of: oral, parenteral, transdermal, rectal, injection, infusion, intravenous, intramuscular, and subcutaneous.

33. A plurality of cells co-transfected with a first nucleic acid sequence encoding a tagged mRNA and a labeled protein and a second nucleic acid sequence encoding RNA binding proteins fused to a marker, wherein the tagged mRNA comprises a nucleic acid capable of binding the RNA binding proteins, and optionally, further comprises one or more nucleic acids selected from the group consisting of: a nucleic acid sequence comprising a target mRNA and an untranslated region.

34. The plurality of cells of claim 33, wherein the second nucleic acid sequence encodes MS2-coat protein (CP) fused to a marker.

35. The plurality of cells of claim 33, wherein the marker is a green fluorescent protein (GFP).

36. The plurality of cells of claim 34, wherein the marker further comprises a streptavidin-binding protein (SBP).

37. The plurality of cells of claim 33, wherein the nucleic acid capable of binding the RNA binding proteins comprises MS2 mRNA binding sites capable of binding MS2-CP.

38. The plurality of cells of claim 33, wherein the cells are eukaryotic cells other than yeast.

39. The plurality of cells of claim 33, wherein the cells are mammalian cells.

40. The plurality of cells of claim 33, wherein the cells are human cells.

41. The plurality of cells of claim 33, wherein the cells are human cancer cells.

42. The plurality of cells of claim 33, wherein the nucleic acid capable of binding the RNA binding proteins comprises at least 12 MS2 mRNA binding sites, wherein each binding site consists of a stem and loop structure capable of binding MS2-CP.

The plurality of cells of claim 33, wherein the cells are stably transfected with one or more of the first nucleic acid sequence and the second nucleic acid sequence.