WO2011138266A1 - Indolizine and imidazopyridine derivatives as orexin receptor antagonists - Google Patents

Abstract

The invention relates to compounds of formula (I) wherein A, R¹ to R⁸ have the meaning as cited in the description and the claims. Said compounds are useful as Orexin Receptor antagonists. The invention also relates to pharmaceutical compositions, the preparation of such compounds as well as the production and use as medicament.

Description

Indolizine and Imidazopyridine Derivatives as Orexin Receptor Antagonists

The present invention relates to Orexin Receptor antagonists, especially Orexin 2 Receptor antagonists, pharmaceutical compositions thereof, the preparation of such compounds as well as the production and use as medicament.

The orexins (orexin A or OX-A and orexin B or OX-B) are neuropeptides discovered in 1998 by two research groups; orexin A is a 33 amino acid peptide and orexin B is a 28 amino acid peptide which are derived from a common pre-propeptide (Sakurai et al, Cell, 1998, 92, 573- 585; De Lecea L. et al, PNAS, 1998, 95, 322-27). Orexins are produced in the lateral hypothalamus and bind to two eponymous G-protein-coupled receptors (0X1 and 0X2). The 0X1 receptor is selective for OX-A, whereas the 0X2 receptor binds both OX-A and OX-B.

It is believed that Orexin Receptors are associated with diseases and disorders including eating disorders, sleep disorders, cognitive dysfunctions in psychiatric and neurological disorders, drug dependence, obesity, and Type II Diabetes. Orexin Receptor antagonists are described in the art. However, most of these compounds are non-selective and used as dual, 0X1 and 0X2 receptor, antagonists.

For example, cinnamide compounds as antagonists are described in WO-A 00/47576. Phenylurea compounds are described in WO-A 00/47577. Tetrahydroisoquinoline derivatives are decribed in, e.g., WO-A 01/68609. Piperidines are described in WO-A 01/96302. N-Aroyl cyclic amine derivatives are described in, e.g., WO-A 02/089800. 7,8,9, 10-T etrahydro-6H- azepino-, 6,7,8,9-tetrahydro-pyrido- and 2,3-dihydro-2H-pyrrolo[2,l-b]-quinazolinone derivatives are described in WO-A 2004/004733. Azetidine compounds are described in WO- A 2008/020405. Benzofuran derivatives as Orexin Receptor antagonists are described in EP- A 2 161 266.

Indolizine derivatives useful in the medical field are described in e.g. WO-A 2007/031747 where l-phenylsulfonyl-2-methylindolizine-3 -acetic acid derivatives are claimed as CRTH2 receptor modulators. However there is a continuing need for new compounds useful as Orexin Receptor antagonists, especially those antagonists, which are selective 0X2 receptor antagonists.

Thus, an object of the present invention is to provide a new class of compounds as Orexin Receptor antagonists, especially selective 0X2 receptor antagonists, which may be effective in the treatment of Orexin Receptor related diseases.

Accordingly, the present invention provides compounds or a pharmaceutically acceptable salt thereof of formula (I)

wherein A is CH; N; or C(CH₃);

R is hydrogen; halogen; or Ci_₄ alkyl, wherein Ci_₄ alkyl is optionally substituted with more halogen, which are the same or different; R² is hydrogen; or halogen;

R³ is hydrogen; or Ci_₄ alkyl, wherein Ci_₄ alkyl is optionally substituted with one or more halogen, which are the same or different; R⁴, R⁵ are independently selected from the group consisting of hydrogen; halogen; and CN; R⁶ is hydrogen; Ci_₄ alkyl; or cyclopropyl, wherein Ci_₄ alkyl and cyclopropyl are optionally substituted with one or more halogen, which are the same or different;

R⁷ is hydrogen; or methyl;

R^s T¹;

Optionally R⁷ and R⁸ are joined together with the carbon atom to which they are attached to form a ring T²;

T¹ is cyclohexyl; or phenyl, wherein T¹ is optionally substituted with one or more R⁹, which are the same or different;

T² is a 7 to 1 1 membered carbobicycle, wherein T² is optionally substituted with one or more R¹⁰, which are the same or different;

R⁹, R¹⁰ are independently selected from the group consisting of halogen; CN; COOR^{1 1} ; OR^{1 1} ; C(0)Rⁿ; C(0)N(RⁿR^{l la}); S(0)₂N(RⁿR^{l la}); S(0)N(RⁿR^{l la}); S(0)₂Rⁿ; S(0)Rⁿ; N(Rⁿ)S(0)₂N(R^{l la}R^{l lb}); SR^{1 1}; N(RⁿR^{l la}); N0₂; OC(0)Rⁿ; N(Rⁿ)C(0)R^{l la}; N(Rⁿ)S(0)₂R^{l la}; N(Rⁿ)S(0)R^{l la}; N(Rⁿ)C(0)OR^{l la}; N(Rⁿ)C(0)N(R^{l la}R^{l lb}); OC(0)N(RⁿR^{l la}); oxo (=0), where the ring is at least partially saturated; and Ci_₆ alkyl, wherein Ci_₆ alkyl is optionally substituted with one or more halogen, which are the same or different; R^{1 1}, R^{l la}, R^{l lb} are independently selected from the group consisting of H; and Ci_₄ alkyl, wherein Ci_₄ alkyl is optionally substituted with one or more halogen, which are the same or different.

In case a variable or substituent defined herein can be selected from a group of different variants and such variable or substituent occurs more than once the respective variants can be the same or different.

Within the meaning of the present invention the terms are used as follows: "Alkyl" means a straight-chain or branched saturated hydrocarbon chain. Each hydrogen of an alkyl carbon may be replaced by a substituent as further specified herein.

"Ci_4 alkyl" means an alkyl chain having 1 - 4 carbon atoms, e.g. if present at the end of a molecule: methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, or e.g. - CH₂-, -CH₂-CH₂-, -CH(CH₃)-, -CH₂-CH₂-CH₂-, -CH(C₂H₅)-, -C(CH₃)₂-, when two moieties of a molecule are linked by the alkyl group. Each hydrogen of a Ci_₄ alkyl carbon may be replaced by a substituent as further specified herein.

"Ci_6 alkyl" means an alkyl chain having 1 - 6 carbon atoms, e.g. if present at the end of a molecule: Ci_₄ alkyl, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, n-hexyl, or e.g. -CH₂-, -CH₂-CH₂-, -CH(CH₃)-, -CH₂-CH₂-CH₂-, -CH(C₂H₅)-, - C(CH₃)₂-, when two moieties of a molecule are linked by the alkyl group. Each hydrogen of a Ci_6 alkyl carbon may be replaced by a substituent as further specified herein.

"Halogen" means fluoro, chloro, bromo or iodo. It is generally preferred that halogen is fluoro or chloro.

"C₃_7 cycloalkyl" or "C₃_₇ cycloalkyl ring" means a cyclic alkyl chain having 3 to 7 carbon atoms, e.g. cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl. Each hydrogen of a cycloalkyl carbon may be replaced by a substituent as further specified herein.

"7 to 11 membered carbobicyclyl" or "7 to 11 membered carbobicycle" means a carbocyclic system of two rings, like C₃_₇ cycloalkyl or phenyl rings, with 7 to 1 1 carbon ring atoms that may contain up to the maximum number of double bonds (aromatic or non-aromatic ring which is fully, partially or un-saturated). An example is indan.

Preferred compounds of formula (I) are those compounds in which one or more of the residues contained therein have the meanings given above, with all combinations of preferred substituent definitions being a subject of the present invention. With respect to all preferred compounds of the formula (I) the present invention also includes all tautomeric and stereoisomeric forms and mixtures thereof in all ratios, and their pharmaceutically acceptable salts as well as their isotopic derivatives. Preferably, A is CH; or C(CH₃), more preferred is C(CH₃). Alternatively preferred is A nitrogen (N). Preferably, R¹ is H; F; CI; CH₃; or CF₃. More preferably, R¹ is H; or F.

Preferably, R² is H; F; or CI. More preferably, R² is H; or F. Preferably, R³ is H; or CH₃. More preferably, R³ is H.

Preferably, R⁴ is H; or F and/or R⁵ is H; F; or CN. More preferably, R⁴, R⁵ are H.

Preferably, R⁶ is H; CH₃; CH₂CH₃; or cyclopropyl. More preferably, R⁶ is H; or CH₃. Even more preferably, R⁶ is CH₃.

Preferably, T¹ is phenyl, wherein T¹ is unsubstituted or substituted with 1, 2 or 3 R⁹, which are the same or different. Preferably, R⁹ is F; CI; CH₃; CF₃; CN; N(CH₃)₂; CH₃0; or CHF₂0. More preferably, R⁹ is H; F; or CI.

Preferably, T² is indanyl and wherein T² is unsubstituted or substituted with one or more (preferably 1, 2 or 3) R¹⁰, which are the same or different. Preferably, R¹⁰ is F; CI; CH₃; CF₃; CN; N(CH₃)₂; CH₃0; or CHF₂0.

In preferred embodiments of the present invention, the substituents A, R¹ to R⁸ of formula (I) independently have the abovementioned meaning. Hence, one or more of the substituents A, R¹ to R⁸ can have the preferred meanings given above. Compounds of the formula (I) in which some or all of the above-mentioned groups have the preferred meanings are also an object of the present invention.

Preferred compounds are selected from the group consisting of

1 -(Benzylsulfonyl)-2-methylindolizin-3-yl N-benzyl, N-methylacetamide;

1 -(Benzylsulfonyl)-2-methyl-indolizin-3-yl N-3-chlorobenzyl, N-methylacetamide;

1 -(Benzylsulfonyl)-2-methylindolizin-3-yl N-4-fluorobenzyl, N-methylacetamide;

l-(Benzylsulfonyl)imidazo[l,5-a]pyridin-3-yl N-(3-chlorobenzyl), N-methylacetamide;

l-(Benzylsulfonyl)imidazo[l,5-a]pyridin-3-yl N-(4-fluorobenzyl), N-methylacetamide;

1 -(3-Fluorobenzylsulfonyl)-2-methylindolizin-3-yl N-3-chlorobenzyl, N-methylacetamide; 1 -(3-Fluorobenzylsulfonyl)-2-methylindolizin-3-yl N-4-fluorobenzyl, N-methylacetamide; 1 -(4-Fluorobenzylsulfonyl)-2-methylindolizin-3-yl N-3-chlorobenzyl, N-methylacetamide; and

1 -(4-Fluorobenzylsulfonyl)-2-methylindolizin-3-yl N-4-fluorobenzyl, N-methylacetamide.

Where tautomerism, like e.g. keto-enol tautomerism, of compounds of formula (I) may occur, the individual forms, e.g. the keto and enol form, are comprised separately and together as mixtures in any ratio. Same applies for stereoisomers, e.g. enantiomers, cis/trans isomers, conformers and the like.

Isotopic labeled compounds of formula (I) are also within the scope of the present invention. Methods for isotope labeling are known in the art. Preferred isotopes are those of the elements H, C, N, O and S. If desired, the isomers can be separated by methods well known in the art, e.g. by liquid chromatography. Same applies for enantiomers by using e.g. chiral stationary phases. Additionally, enantiomers may be isolated by converting them into diastereomers, i.e. coupling with an enantiomerically pure auxiliary compound, subsequent separation of the resulting diastereomers and cleavage of the auxiliary residue. Alternatively, any enantiomer of a compound of formula (I) may be obtained from stereoselective synthesis using optically pure starting materials.

In case the compounds according to formula (I) contain one or more acidic or basic groups, the invention also comprises their corresponding pharmaceutically or toxicologically acceptable salts, in particular their pharmaceutically utilizable salts. Thus, the compounds of the formula (I) which contain acidic groups can be used according to the invention, for example, as alkali metal salts, alkaline earth metal salts or as ammonium salts. More precise examples of such salts include sodium salts, potassium salts, calcium salts, magnesium salts or salts with ammonia or organic amines such as, for example, ethylamine, ethanolamine, triethanolamine or amino acids. Compounds of the formula (I) which contain one or more basic groups, i.e. groups which can be protonated, can be present and can be used according to the invention in the form of their addition salts with inorganic or organic acids. Examples for suitable acids include hydrogen chloride, hydrogen bromide, phosphoric acid, sulfuric acid, nitric acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acids, oxalic acid, acetic acid, tartaric acid, lactic acid, salicylic acid, benzoic acid, formic acid, propionic acid, pivalic acid, diethylacetic acid, malonic acid, succinic acid, pimelic acid, fumaric acid, maleic acid, malic acid, sulfaminic acid, phenylpropionic acid, gluconic acid, ascorbic acid, isonicotinic acid, citric acid, adipic acid, and other acids known to the person skilled in the art. If the compounds of the formula (I) simultaneously contain acidic and basic groups in the molecule, the invention also includes, in addition to the salt forms mentioned, inner salts or betaines (zwitterions). The respective salts according to the formula (I) can be obtained by customary methods which are known to the person skilled in the art , for example by contacting these with an organic or inorganic acid or base in a solvent or dispersant, or by anion exchange or cation exchange with other salts. The present invention also includes all salts of the compounds of the formula (I) which, owing to low physiological compatibility, are not directly suitable for use in pharmaceuticals but which can be used, for example, as intermediates for chemical reactions or for the preparation of pharmaceutically acceptable salts.

The present invention provides compounds of general formula (I) as Orexin Receptor antagonists, preferably as selective 0X2 receptor antagonists.

As described before, the orexins (orexin A or OX-A and orexin B or OX-B) are neuropeptides discovered in 1998 by two research groups; orexin A is a 33 amino acid peptide and orexin B is a 28 amino acid peptide which are derived from a common pre-propeptide (Sakurai et al, Cell, 1998, 92, 573-585; De Lecea L. et al, PNAS, 1998, 95, 322-27). Orexins are produced in the lateral hypothalamus and bind to two eponymous G-protein-coupled receptors (0X1 and 0X2). The 0X1 receptor is selective for OX-A, whereas the 0X2 receptor binds both OX-A and OX-B.

The orexins stimulate food consumption in rats, suggesting a physiological role for these peptides as mediators of feeding behaviour (Sakurai T. et al, Cell, 1998, 92, 573-585; Ishii Y. et al, Behav.Brain.Res., 2005, vol. 157, 331-341; Thorpe A.J. et al, Brain Res., 2005, vol. 1050, 156-162).

The orexins regulate sleep-wake behaviour, indicating a potential therapeutic approach to narcolepsy, insomnia and other sleep disorders (Chemelli R.M. et al, Cell, 1999, 98, 437-451; Smith M.I. et al, Neurosci. Letters, 2003, 256-258; Midea M. et al, PNAS, 2004, vol. 101 (13), 4649-4654; Adamantidis A.R. et al, Nature, 2007, 420-425).

A post-mortem study of human narcolepsy patients failed to detect orexin peptides in the cortex and pons; there was an 80-100% reduction in the number of neurons containing detectable prepro-orexin mRNA or orexin-like immunoreactivity in the hypothalamus. Orexin A was undetectable in the cerebrospinal fluid of narcolepsy patients. The vast majority of patients with narcolepsy show decreased orexin A levels in the cerebrospinal fluid. A low cerebrospinal fluid concentration of orexin A is now one of the diagnostic criteria for narcolepsy-cataplexy (Sakurai T., Nature Reviews Neuroscience, 2007, 8, 171-181). Thus, blockade of Orexin receptors is expected to be of potential use in the treatment of insomnia.

Unexpectedly, it has been found that indolizine and imidazopyridine derivatives of formula (I) are antagonists of Orexin receptors, preferably selectively of the OX2 receptor. The present invention relates to the use of indolizine and imidazopyridine derivatives of formula (I) and pharmaceutically acceptable salts and solvates thereof in the treatment of disorders in which blockade of Orexin receptors is reasonably expected to be of therapeutic benefit e.g. eating disorders, sleep disorders, cognitive dysfunctions in psychiatric and neurological disorders, drug dependence, obesity and Type II Diabetes.

The compounds of formula (I) may be used for the preparation of a medicament, and are suitable, for the prevention or treatment of diseases selected from the group consisting of eating disorders, sleep disorders, cognitive dysfunctions in psychiatric and neurological disorders, drug dependence, obesity, or Type II Diabetes.

Compounds of formula (I) are particularly suitable for use in the treatment of diseases or disorders selected from the group consisting of eating disorders, sleep disorders, cognitive dysfunctions in psychiatric and neurological disorders, drug dependence, obesity, or Type II Diabetes.

Another aspect of the present invention is a method for the treatment or prophylaxis of diseases, which are related to the Orexin receptors such as eating disorders, sleep disorders, cognitive dysfunctions in psychiatric and neurological disorders, drug dependence, obesity, or Type II Diabetes comprising the administration to a patient a therapeutically effective amount of a compound of formula (I).

Accordingly, one aspect of the present invention is a compound or a pharmaceutically acceptable salt thereof of formula (I) for use as a medicament. Those compounds can be used in a pharmaceutical composition comprising at least one of said compound or a pharmaceutically acceptable salt thereof together with a pharmaceutically acceptable carrier, optionally in combination with one or more other bioactive compounds or pharmaceutical compositions. Other bioactive compounds may be further compounds of the present invention, i.e. a mixture of two or more of these compounds. Further bioactive compounds are further Orexin 2 Receptor antagonists and the like.

Yet another aspect of the present invention is the use of a compound or a pharmaceutically acceptable salt thereof of the present invention for the manufacture of a medicament for the treatment or prophylaxis of diseases and disorders associated with the Orexin 2 Receptor.

Yet another aspect of the present invention is a compound or a pharmaceutically acceptable salt thereof of the present invention for use in a method for the treatment or prophylaxis of diseases and disorders associated with the Orexin 2 Receptor.

Yet another aspect of the present invention is the use of a compound or a pharmaceutically acceptable salt thereof of the present invention for the manufacture of a medicament for the treatment or prophylaxis of eating disorders, sleep disorders, cognitive dysfunctions in psychiatric and neurological disorders, drug dependence, obesity, or Type II Diabetes. More specific diseases and disorders are mentioned above, which are also preferred for this aspect of the present invention.

Yet another aspect of the present invention is a compound or a pharmaceutically acceptable salt thereof of the present invention for use in a method for the treatment or prophylaxis of eating disorders, sleep disorders, cognitive dysfunctions in psychiatric and neurological disorders, drug dependence, obesity, or Type II Diabetes. More specific diseases and disorders are mentioned above, which are also preferred for this aspect of the present invention. Yet another aspect of the present invention is a method for treating, controlling, delaying or preventing in a mammalian patient in need of the treatment of one or more conditions selected from the group consisting of diseases and disorders associated with the Orexin 2 Receptor, wherein the method comprises the administration to said patient a therapeutically effective amount of a compound of the present invention or a pharmaceutically acceptable salt thereof.

Yet another aspect of the present invention is a method for treating, controlling, delaying or preventing in a mammalian patient in need of the treatment of one or more conditions selected from the group consisting of eating disorders, sleep disorders, cognitive dysfunctions in psychiatric and neurological disorders, drug dependence, obesity, and Type II Diabetes, wherein the method comprises the administration to said patient a therapeutically effective amount of a compound of the present invention or a pharmaceutically acceptable salt thereof. More specific diseases and disorders are mentioned above, which are also preferred for this aspect of the present invention.

"Pharmaceutical composition" means one or more active ingredients, and one or more inert ingredients that make up the carrier, as well as any product which results, directly or indirectly, from combination, complexation or aggregation of any two or more of the ingredients, or from dissociation of one or more of the ingredients, or from other types of reactions or interactions of one or more of the ingredients. Accordingly, the pharmaceutical compositions of the present invention encompass any composition made by admixing a compound of the present invention and a pharmaceutically acceptable carrier.

The active ingredients may be comprised in one or more different pharmaceutical compositions (combination of pharmaceutical compositions).

The term "pharmaceutically acceptable salts" refers to salts prepared from pharmaceutically acceptable non-toxic bases or acids, including inorganic bases or acids and organic bases or acids.

The compositions include compositions suitable for oral, rectal, topical, parenteral (including subcutaneous, intramuscular, and intravenous), ocular (ophthalmic), pulmonary (nasal or buccal inhalation), or nasal administration, although the most suitable route in any given case will depend on the nature and severity of the conditions being treated and on the nature of the active ingredient. They may be conveniently presented in unit dosage form and prepared by any of the methods well-known in the art of pharmacy.

In practical use, the compounds of formula (I) can be combined as the active ingredient in intimate admixture with a pharmaceutical carrier according to conventional pharmaceutical compounding techniques. The carrier may take a wide variety of forms depending on the form of preparation desired for administration, e.g., oral or parenteral (including intravenous). In preparing the compositions for oral dosage form, any of the usual pharmaceutical media may be employed, such as water, glycols, oils, alcohols, flavoring agents, preservatives, coloring agents and the like in the case of oral liquid preparations, such as, for example, suspensions, elixirs and solutions; or carriers such as starches, sugars, microcrystalline cellulose, diluents, granulating agents, lubricants, binders, disintegrating agents and the like in the case of oral solid preparations such as powders, hard and soft capsules and tablets, with the solid oral preparations being preferred over the liquid preparations.

Because of their ease of administration, tablets and capsules represent the most advantageous oral dosage unit form in which case solid pharmaceutical carriers are obviously employed. If desired, tablets may be coated by standard aqueous or nonaqueous techniques. Such compositions and preparations should contain at least 0.1 percent of active compound. The percentage of active compound in these compositions may, of course, be varied and may conveniently be between about 2 percent to about 60 percent of the weight of the unit. The amount of active compound in such therapeutically useful compositions is such that an effective dosage will be obtained. The active compounds can also be administered intranasally, for example, as liquid drops or spray.

The tablets, pills, capsules, and the like may also contain a binder such as gum tragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, lactose or saccharin. When a dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier such as a fatty oil.

Various other materials may be present as coatings or to modify the physical form of the dosage unit. For instance, tablets may be coated with shellac, sugar or both. A syrup or elixir may contain, in addition to the active ingredient, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye and a flavoring such as cherry or orange flavor. Compounds of formula (I) may also be administered parenterally. Solutions or suspensions of these active compounds can be prepared in water suitably mixed with a surfactant such as hydroxypropyl-cellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols and mixtures thereof in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form should be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils.

Any suitable route of administration may be employed for providing a mammal, especially a human, with an effective dose of a compound of the present invention. For example, oral, rectal, topical, parenteral, ocular, pulmonary, nasal, and the like may be employed. Dosage forms include tablets, troches, dispersions, suspensions, solutions, capsules, creams, ointments, aerosols, and the like. Preferably compounds of formula (I) are administered orally.

The effective dosage of active ingredient employed may vary depending on the particular compound employed, the mode of administration, the condition being treated and the severity of the condition being treated. Such dosage may be ascertained readily by a person skilled in the art.

Starting materials for the synthesis of preferred embodiments of the invention as well as compounds of the present invention may be purchased from commercially available sources such as Array, Sigma Aldrich, Acros, Fisher, Fluka, ABCR or can be synthesized using known methods by one skilled in the art.

In general, several methods are applicable to prepare compounds of the present invention. In some cases various strategies can be combined. Sequential or convergent routes may be used. Compounds of formula (I) where A is C-Me may be prepared according to Scheme 1 below. Reaction of benzyl mercaptan (II) and methylpyridine (III), where LG is a leaving group, in the presence of a suitable base, such as diazobicycloundecane, produces thioether (IV), which is oxidised to sulfone (V) using a reagent such as Oxone. Reaction with ketone (VI) where LG is a leaving group, which is optionally protected as the dialkyl ketal, in the presence of a base such as potassium carbonate produces indolizine (VII). Treatment with oxalate (VIII), where LG is a leaving group provides keto-acetate (IX), which is converted to acetate (XI) via reduction to produce hydroxyl-acetate (X) using e.g. sodium borohydride and subsequent reaction with triphenylphosphine in the presence of iodine. Hydrolysis of acetate (XI) using e.g. aqueous sodium hydroxide solution produces acid (XII), which is coupled with N-methyl benzylamine (XIII) using reagents such as EDC and HOBt to provide compound (I) where A is C-Me.

Scheme 1: Preparation of compounds of formula (I) where A is C-Me Compounds of formula (I) where A is N may be prepared according to Scheme 2 below. Malonyl amide (XVI) is formed by reaction of picolylamine (XIV) with activated ethyl malonate (XV), where LG is a leaving group in the presence of a suitable base e.g. triethylamine. Cyclisation to form imidazopyridine (XVII) is effected by treatment of malonyl amide (XVI) with a reagent such as phosphorus oxychloride. Reaction of imidazopyridine with e.g. N-iodosuccinimide produces iodide (XVIII), which combines with benzyl mercaptan (II) in the presence of suitable reagents, such as Xantphos, tridibenzylidene- dipalladium and Hunig's base in dioxane, to produce thioether (XIX). Reaction of thioether (XIX) with, for example, Oxone provides sulfone (XX), which can be hydrolysed with e.g. aqueous sodium hydroxide solution to give acid (XXI). Coupling of acid (XXI) with N- methyl benzylamine (XIII) using reagents such as EDC and HOBt provide compound (I) where A is N.

Scheme 2: Preparation of compounds of formula (I) where A is N Thus a further aspect of the present invention is a method for the preparation of a compound of formula (I) as defined in above comprising the step of reacting a compound of formula (la)

wherein A, R¹ to R⁵ have the meaning as indicated above with a compound of formula HN(R⁶)CH(R⁷R⁸), wherein R⁶ to R⁸ have the meaning as indicated above to yield a compound of formula (I).

Examples

Biological Assays Cell Lines

A CHO-Kl cell line stably expressing human Orexin-1 receptor (hOXIR, coding sequence of AF041243) was obtained from Euroscreen/PerkinElmer (CHO-hOXIR, ES-330-C).

A plasmid containing the human Orexin-2 receptor (hOX2R) cDNA was purchased from RZPD (RZPDo834A1045-pT-REx-DEST30). The human Orexin-2 receptor coding region was amplified in a gradient PCR reaction using hOX2Rfor (5' ccaggatccgc caccatgtccggcaccaaattggaggactcc) and hOX2Rrev (5' ccgcggccgcctaccagttttgaagtggtcctgc) primers containing restriction sites for the restriction enzymes BamHI and Notl. The PCR reaction was performed with the LightCycler system from Roche Applied Science. The amplified DNA fragment was digested with restriction enzymes BamHI and Notl (Fermentas) and subsequently cloned into the BamHI/NotI sites of the pFB-Neo vector (Stratagene) thereby generating plasmid pFB-Neo-hOX2R.

For a stably expressing CHO-hOX2R cell line viral transduction of CHO-K1 cells were performed by using the pFB-Neo-hOX2R plasmid and the pVPack vector system from Stratagene according to the manufacturer's manual. Cells expressing the hOX2 receptor were selected using G418 at a final concentration of 50(^g/ml and single cell clones were produced by limited dilution cloning. Cell Culture

CHO-hOXIR cells were grown in HAM F12 Nutrient Mixture (Sigma, N6658), 10%Fetal Bovine Serum (Sigma, F9665), 1% Penstrep (Sigma, p4333) and 400mg/ml G418 (Sigma, A1720). CHO-hOX2R cells were grown in DMEM F12 medium (Sigma, D8437) supplemented with 10%Fetal Bovine Serum (Sigma, F9665), 1% Penstrep (Sigma, p4333) and 500mg/ml G418 (Sigma, A1720). Cells were maintained under 5% C0₂ atmosphere at 37°C. Cells were passaged every 2-3 days.

Ca²⁺-flux Assay for EC50/IC50 Determination

CHO-hOXIR and CHO-hOX2R cells were seeded at a density of 7500 cells per well into black, 384 well Costar Cellbind plates and cultured overnight in the appropriate cell culture medium as described above without G418 selection. The next day the medium was removed and the cells were incubated for 1.5hrs at 37°C in fluo-4, AM dye solution [2μΜ fluo-4,AM (Molecular Probes; F- 14202, Lot#28Cl-12) in 5mM probenecid (Sigma, P-8761, Lot# 121K1662), 0.1% Bovine Serum Albumin (BSA, MERCK, 1.12018.0100), lxHBSS (Invitrogen, 14025-050), 20mM HEPES (Invitrogen,. 15630-056)]. For IC50 determination of compounds the dye supernatant was removed and cells were incubated for 20min at 37°C in probenecid buffer [5mM probenecid, 0.1% BSA, lxHBSS, 20mM HEPES, l%DMSO (Merck, 1.02931.1000)] containing compounds at concentrations ranging from 1.28nM to 20μΜ (7 dilution steps at 1 :5, last compound concentration is OnM). All compound concentrations were measured in triplicates. Subsequently, agonist solution (5nM Orexin-A, TOCRIS, 1455) in 5mM probenecid, 0.1% BSA, lxHBSS, 20mM HEPES was added during incubation of the plate at 37°C in the fluorescence plate reader (FlexStation, Molecular Devices). Fluorescence was measured for 0-60 seconds per well at an excitation of 485nm and emission of 538nm.

For EC50 determination of Orexin-A the cells were incubated as described above for 20min at 37°C in probenecid buffer (5mM probenecid, 0.1% BSA, lxHBSS, 20mM HEPES, 1%DMS0) without compound solution. Agonist injection occurred in the fluorescence plate reader (FlexStation, Molecular Devices) at different concentrations ranging from 0-lOOnM in 5mM probenecid, 0.1% BSA, lxHBSS, 20mM HEPES. Detection of fluorescence was as described above.

The activities of compounds of formula (I) are listed in Table 1 below:

OXl OX2

Example

IC₅o / nM IC₅o / nM

1 3784 1.0

2 500 0.4

3 2379 0.8

4 4125 226

5 >10 uM 194

6 599 1.4

7 4956 5.7

8 321 1.9

9 1255 2.7

Table 1: OXl and OX2 antagonism of compounds of formula (I) Compound Naming

All compounds are named either using ACD Labs 10.0 naming software (which conforms to IUPAC naming protocols) or by analogy to conventional nomenclature familiar to a skilled practitioner. Some compounds are isolated as TFA salts, which is not reflected by the chemical name. Within the meaning of the present invention the chemical name represents the compound in neutral form as well as its TFA salt or any other salt, especially pharmaceutically acceptable salt, if applicable.

Flash silica gel chromatography was carried out on silica gel 230-400 mesh or on pre-packed silica cartridges. List of Abbreviations

AcOH acetic acid

aq. aqueous

cat catalytic

DCE 1 ,2-dichloroethane

DCM dichloromethane

DBU 1 , 8-Diazabicyclo [5.4.0]undec-7-ene

DIPEA N,N-diisopropylethylamine

DMAP N,N-dimethylpyridin-4-amine

EDCI l-Ethyl-3-(3-dimethylaminopropyl)carbodiimide

eq equivalent

Et₂0 diethyl ether

EtOAc ethyl acetate

EtOH ethanol

FCC flash column chromatography

h hours

HOBt 1 -hydroxybenzotriazo le

LAH Lithium Aluminium Hydride

MeCN acetonitrile

MeOH methanol

min minutes

NMO N-methylmorpholine N-oxide

NMR nuclear magnetic resonance

PCC Pyridinium chlorochromate

TEA triethylamine

THF tetrahydrofuran

TLC thin layer chromatography

NMR Methods

NMR Spectroscopy was determined using a Bruker AVANCE 300 MHz NMR. Chemical shifts are reported in ppm ([delta]) using the residual solvent line as an internal standard. Splitting patterns are designated as s, singlet; d, doublet; t, triplet; q, quartet; m, multiplet; b, broad. The NMR spectra were recorded at ambient temperature. When more than one conformer was detected the chemical shifts for the most abundant one is reported. Analytical HPLC-MS

Column: Atlantis dC18 50mm x 3 mm; 3 μιη

Mobile phase A: 0.1% Formic acid in Water

Mobile phase B: 0.1% Formic acid in Acetonitrile

Flow rate: 0.8 ml/min.

Detection wavelength: Diode array Spectrum 1 max (with scan in the region 210-350nm)

Sampling rate: 5

Column temperature: 35°C

Injection volume: 5 μΐ

Eluent: 0 mins 95% solvent A + 5% solvent B, 0.2 mins 95% solvent A + 5% solvent B; 0.2mins to 3.2mins constant gradient from 95% solvent A + 5% solvent B to 5% solvent A and 95%) solvent B; 5mins 5% solvent A and 95% solvent B; 5mins to 5.2 mins constant gradient from 5% solvent A and 95% solvent B to 95% solvent A + 5% solvent B; 5.5mins 95% solvent A and 5% Solvent B.

MS detection using Waters LCT or LCT Premier, or ZQ or ZMD

UV detection using Waters 2996 photodiode array or Waters 2787 UV or Waters 2788 UV

Preparative HPLC-MS

Column: Waters SunFire Prep C18 OBD (5um 19 x 100mm)

Flow rate: 26ml/min

Solvent A: 0.1% TFA / water

Solvent B: 0.1% TFA / acetonitrile

Injection Volume: ΙΟΟΟμΙ

Column Temperature: room temperature

Detection: Mass directed

Eluent: 0 mins to 1 minute, 90% solvent A + 10% solvent B; 1 minute to 7.5 mins, constant gradient from 90% solvent A + 10% solvent B to 100% solvent B; 7.5 mins to 9 mins, 100% solvent B; 9 mins to 9.1 mins, constant gradient from 100% solvent B to 90% solvent A +

10% solvent B; 9.1 mins to 10 mins, 90% solvent A + 10% solvent B.

Waters Micromass Platform LCZ single quadrupole mass spectrometer

Waters 600 solvent delivery module

Waters 515 ancillary pumps

Waters 2487 UV detector

Gilson 215 autosampler and fraction collector Example 1 : 1 -(Benzylsulfonyl)-2-meth lindo lizin-3 -yl N-benzyl, N-methylacetamide

To a stirred solution of l-(benzylsulfonyl-2-methylindolizin-3-yl)acetic acid (Intermediate 7, 50 mg, 0.145 mmol) in DMF (3 mL) were added EDCI (34 mg, 0.17 mmol), HOBt (24 mg, 0.174 mmol) and DIPEA (0.054 mL, 0.29 mmol). The resulting solution was stirred for 5 min prior to the addition of N-methylbenzylamine (0.025 mL, 0.17 mmol) and stirred at ambient temperature overnight. The reaction was quenched with water (20 mL) and extracted with EtOAc (2 x 20 mL). The combined organic extracts were washed with water (2 x 5 mL), saturated brine (5 mL), dried over anhydrous sodium sulfate and concentrated in vacuo.

The above procedure was repeated using l-(benzylsulfonyl-2-methylindolizin-3-yl)acetic acid (Intermediate 7, 30 mg 0.087 mmol), EDCI (20 mg, 0.11 mmol), HOBt (14 mg, 0.11 mmol), DIPEA (0.032 mL, 0.17 mmol), N-methylbenzylamine (0.014 mL, 0.11 mmol) and DMF (1 mL). The 2 crude batches were combined and purified by FCC eluting with 50% EtOAc in hexane to afford the title compound (35 mg, 34%). HPLC-MS, MH+ requires m/z=447; Found m/z=447, Rt 3.78 min (100%). 1H NMR (300 MHz, CDC13), mixture of rotamers, δ 8.14-8.00 (2d, 1H), 7.79- 7.70 (2d, 1H), 7.39 - 6.98 (m, 8H), 6.96 -6.89 (m, 3H), 6.77- 6.69 (m, 1H), 4.60 - 4.58 (2s, 2H), 4.28-4.22 (2s, 2H), 3.90 - 3.87 (2s, 2H), 3.01- 2.93 (2s, 3H) and 2.02-1.91 (2s, 3H).

Example 2: l-(Benzylsulfonyl)-2-methyl-indo lizin-3 -yl N-3-chlorobenzyl, methylacetamide

The title compound was prepared according to the method described for Example 1 using 1- (benzylsulfonyl-2-methylindolizin-3-yl)acetic acid (prepared in an analogous manner to Intermediate 7, 70 mg, 0.20 mmol), EDCI (47 mg, 0.24 mmol), HOBt (33 mg, 0.24 mmol), DIPEA (0.075 mL, 0.40 mmol) and 3-chloro-N-methylbenzylamine (38 mg, 0.24 mmol) in DMF (3 mL). Yield: 45 mg, 46 %. HPLC-MS, MH+ requires m/z=481; Found m/z=481, Rt 3.93 min (100%). IH NMR (300 MHz, CDC1₃), mixture of rotamers, δ 8.10-7.99 (2d, IH), 7.79- 7.70 (2d, IH), 7.27 - 6.90 (m, 10H), 6.77- 6.73 (m, IH), 4.55 (s, 2H), 4.29-4.22 (2s, 2H), 3.90 - 3.84 (2s, 2H), 3.00- 2.94 (2s, 3H) and 2.00-1.90 (2s, 3H).

Example 3: l-(Benzylsulfonyl)-2-methylindolizin-3-yl N-4-fluorobenzyl, N- methylacetamide

The title compound was prepared according to the method described for Example 1 using 1- (benzylsulfonyl-2-methylindolizin-3-yl)acetic acid (prepared in an analogous manner to Intermediate 7, 70 mg, 0.20 mmol), EDCI (47 mg, 0.24 mmol), HOBt (33 mg, 0.24 mmol), DIPEA (0.075 mL, 0.40 mmol) and 4-fluoro-N-methylbenzylamine (33 μί, 0.24 mmol) in DMF (2 mL). Yield: 45 mg, 48%. HPLC-MS, MH+ requires m/z=465; Found m/z=465, Rt 3.80 min (100%). IH NMR (300 MHz, CDC13), mixture of rotamers, δ 8.08-7.06 (2d, IH), 8.01- 7.98 (2d, IH), 7.23 - 6.91 (m, 10H), 6.75- 6.71 (m, IH), 4.56-4.53 (2s, 2H), 4.28-4.23 (2s, 2H), 3.88 - 3.85 (2s, 2H), 2.98- 2.94 (2s, 3H), 2.00-1.89 (2s, 3H). Example 4: l-(Benzylsulfonyl)imidazo[l,5-a]pyridin-3-yl N-(3-chlorobenzyl), N- methylacetamide

To a stirred solution of [l-(benzylsulfonyl)imidazo[l,5-a]pyridin-3-yl]acetic acid (Intermediate 13, 100 mg, 0.30 mmol) in DMF (4 mL) were added HOBt (50 mg, 0.36 mmol) and EDCI (70 mg, 0.36 mmol). The resulting solution was stirred for 10 min prior to the addition of 3-chloro-N-methylbenzylamine (56 mg, 0.36 mmol) then stirred for 12 h. The solvent was removed under reduced pressure. The residue was diluted with EtOAc (10 mL), washed with saturated aqueous sodium hydrogencarbonate solution (10 mL), water (10 mL), brine (10 mL), dried over anhydrous sodium sulfate, and concentrated in vacuo. The residue was purified by FCC eluting with 0-5% MeOH in DCM to afford the title compound (20 mg, 14%). HPLC-MS, MH+ requires m/z=468; Found m/z=468, Rt 3.90 min (97%). 1H NMR (300 MHz, CDC13), mixture of rotamers, δ 8.25 (m, 1H), 7.55 (m, 1H), 7.30 - 7.00 (m, 9H), 6.94 (m, 1H), 6.87 (m, 1H), 4.80-4.60 (2s, 2H), 4.50-4.40 (2s, 2H), 4.28 - 4.25 (2s, 2H) and 3.15-2.98 (2s, 3H).

Example 5: l-(Benzylsulfonyl)imidazo[l,5-a]pyridin-3-yl N-(4-fluorobenzyl), N- methylacetamide

l-(Benzylsulfonyl)imidazo[l,5-a]pyridin-3-yl N-(4-fluorobenzyl), N-methylacetamide was prepared from [l-(benzylsulfonyl)imidazo[l,5-a]pyridin-3-yl]acetic acid (Intermediate 13, 100 mg, 0.30 mmol), HOBt (50 mg, 0.36 mmol), EDCI (70 mg, 0.36 mmol) and 3-fluoro-N- methylbenzylamine (50 mg, 0.36 mmol) in DMF (5 mL) according to the method described for Example 4. The residue was purified by FCC eluting with 0-5% MeOH in DCM to afford the title compound (55 mg, 39%). HPLC-MS, MH+ requires m/z=452; Found m/z=452, Rt 3.79 min (100%). 1H NMR (300 MHz, CDC13), mixture of rotamers, δ 8.26 (m, 1H), 7.50 (m, 1H), 7.30 - 6.88 (m, 10H), 6.77 (m, 1H), 4.78-4.53 (2s, 2H), 4.50-4.40 (2s, 2H), 4.25 (br s, 2H) and 3.15-2.98 (2s, 3H).

Example 6: l-(3-Fluorobenzylsulfonyl)-2-methylindolizin-3-yl N-3-chlorobenzyl, N- methylacetamide

To a stirred solution of [1 -(3 -fluorobenzylsulfonyl)-2-methylindolizin-3-yl] acetic acid (Intermediate 26, 70 mg, 0.194 mmol) in DMF (2 mL) were added EDCI (46 mg, 0.23 mmol), HOBt (32 mg, 0.23 mmol) and DIPEA (0.82 mL, 0.46 mmol). The resulting solution was stirred for 5 min prior to the addition of N-methylbenzyl amine (36 mg, 0.23 mmol) and stirred overnight. The reaction was quenched with water (50 mL) and extracted with EtOAc (2 x 30 mL). The combined organic extracts were washed with water (10 mL), saturated brine (10 mL), dried over anhydrous sodium sulfate and concentrated in vacuo. The residue was purified by FCC eluting with 40 % EtOAc / hexane to afford the title compound (45 mg, 47 %). HPLC-MS, MH+ requires m/z=499; Found m/z=499, Rt 3.92 min (100%). 1H NMR (300 MHz, CDC13), mixture of rotamers, δ 8.13-8.03 (2d, IH), 7.82- 7.73 (2d, IH), 7.28 - 6.89 (m, 7H), 6.80 -6.75 (m, 3H), 4.57 - 4.55 (2s, 2H), 4.28-4.20 (2s, 2H), 3.93 - 3.87 (2s, 2H), 3.00- 2.97 (2s, 3H) and 2.09-1.98 (2s, 3H).

Example 7: l-(3-Fluorobenzylsulfonyl)-2-methylindolizin-3-yl N-4-fluorobenzyl, N- methylacetamide

The title compound was prepared according to the method described for Example 6 using [1- (3 -fluorobenzylsulfonyl)-2-methylindolizin-3-yl] acetic acid (Intermediate 26, 70 mg, 0.194 mmol), EDCI (45 mg, 0.23 mmol), HOBt (32 mg, 0.23 mmol), DIPEA (0.82 mL, 0.40 mmol) and 4-fluoro-N-methylbenzyl amine (32 mg, 0.24 mmol) in DMF (2 mL). The crude product was purified by FCC eluting with 0.5 % MeOH in DCM. Yield: 45 mg, 48 %. HPLC-MS, MH+ requires m/z=483; Found m/z=483, Rt 3.79 min (100%). IH NMR (300 MHz, CDC13), mixture of rotamers, δ 8.11-8.03 (2d, IH), 7.80- 7.72 (2d, IH), 7.18 - 6.989 (m, 7H), 6.79- 6.73 (m, 3H), 4.56-4.53 (2s, 2H), 4.27-4.21 (2s, 2H), 3.91 - 3.88 (2s, 2H), 2.98- 2.96 (2s, 3H) and 2.09-1.97 (2s, 3H).

Example 8: l-(4-Fluorobenzylsulfonyl)-2-methylindolizin-3-yl N-3-chlorobenzyl, N- methylacetamide

The title compound was prepared according to the method described for Example 6 using [1- (3 -fluorobenzylsulfonyl)-2-methylindolizin-3-yl] acetic acid (Intermediate 27, 70 mg, 0.194 mmol), EDCI (44 mg, 0.23 mmol), HOBt (31 mg, 0.23 mmol), DIPEA (0.82 mL, 0.38 mmol) and 3-chloro-N-methylbenzyl amine (36 mg, 0.23 mmol) in DMF (2 mL). The crude product was purified by FCC eluting with 0.5 % methanol in DCM (50 mg, 52 %. HPLC-MS, MH+ requires m/z=499; Found m/z=499, Rt 3.77 min (100%). 1H NMR (300 MHz, CDC13), mixture of rotamers, δ 8.09-7.97 (2d, 1H), 7.80- 7.71 (2d, 1H), 7.29 - 6.74 (m, 10H), 4.59- 4.56 (2s, 2H), 4.25-4.18 (2s, 2H), 3.92 - 3.86 (2s, 2H), 3.02- 2.98 (2s, 3H) and 2.06-1.95 (2s, 3H).

Example 9: l-(4-Fluorobenzylsulfonyl)-2-methylindolizin-3-yl N-4-fluorobenzyl, N- methylacetamide

The title compound was prepared according to the method described for Example 6 using [1- (3 -fluorobenzylsulfonyl)-2-methylindolizin-3-yl] acetic acid (Intermediate 27, 50 mg, 0.138 mmol), EDCI (32 mg, 0.17 mmol), HOBt (23 mg, 0.17 mmol), DIPEA (0.052 mL, 0.28 mmol) and 4-fluoro-N-methylbenzyl amine (23 mg, 0.17 mmol) in DMF (4 mL). The crude product was purified by FCC eluting with 0.5 % methanol in DCM (30 mg, 45 %). HPLC- MS, MH+ requires m/z=483; Found m/z=483, Rt 3.65 min (98%). 1H NMR (300 MHz, CDC13), mixture ofrotamers, δ 8.07-7.98 (2d, 1H), 7.79- 7.71 (2d, 1H), 7.19 - 7.15 (m, 1H), 7.08-6.75 (m, 9H), 4.58-4.55 (2s, 2H), 4.25-4.20 (2s, 2H), 3.90 - 3.87 (2s, 2H), 3.00- 2.97 (2s, 3H), 2.04-1.92 (2s, 3H). Intermediate 1: 2-(Benzylthiomethyl)pyridine

To a suspension of 2-(chloromethyl)pyridine hydrochloride (0.5 g, 3.04 mmol) in toluene (15 mL) was added DBU (0.9 mL, 6.08 mmol) and the mixture was stirred for 15 min at room temperature. Benzyl mercaptan (0.37 g, 3.04 mmol) was added slowly and the reaction mixture was stirred overnight. The reaction mixture was diluted with ethyl acetate (30 mL), washed with water (20 mL), dried over anhydrous sodium sulfate and concentrated in vacuo. The residue was purified by FCC eluting with 10% ethyl acetate in hexane to afford the title compound (0.5 g, 76%). HPLC-MS, MH+ requires m/z=216; Found m/z=216, Rt 2.65 min (97%). 1H NMR (300 MHz, CDC13) δ 8.55 (d, 1H), 7.64 (t, 1H), 7.33 - 7.14 (m, 6H), 7.15- 7.13 (m, 1H), 3.75 (s, 2H) and 3.69 (s, 2H).

Intermediate 2: 2-(Benzylsulfon lmethyl)pyridine

2-(Benzylthiomethyl)pyridine (Intermediate 1, 0.4 g, 1.8 mmol) was dissolved in DCM (40 mL) and Oxone (3.40 g, 5.50 mmol) was added. The resulting reaction mixture was stirred for 5 h at room temperature. The reaction mixture was quenched with water (20 mL) and extracted with DCM (2 x 20 mL). The combined organic extracts were washed with brine (20 mL), dried over anhydrous sodium sulfate and concentrated in vacuo. The residue was purified by FCC eluting with 40% ethyl acetate in hexane to afford the title compound (0.28 g, 61%). HPLC-MS, MH+ requires m/z=248; Found m/z=248, Rt 2.84 min (100%). 1H NMR (300 MHz, CDC13) δ: 8.67 (m, 1H), 7.75 (dt, 1H), 7.58 - 7.55 (m, 2H), 7.48- 7.25 ( m, 5H), 4.32 (s, 2H), 4.31 (s, 2H).

Intermediate 3: l-(Benzylsulfonyl)-2-methylindolizine

A solution of l-bromo-2,2-dimethoxy propane (0.045 mL, 0.32 mmol), 2-butanone (2 mL) and cone. HC1 (0.013 mL) was stirred for 2 h at room temperature. To the solution were added potassium carbonate (50 mg, 0.32 mmol) and 2-(benzylsulfonylmethyl)pyridine (Intermediate 2, 40 mg, 0.16 mmol) and the reaction mixture was heated to 80 C stirred for 6 h. The mixture was cooled to room temperature and concentrated under reduced pressure. The residue was diluted with DCM (20 mL), washed with water (5 mL), dried over anhydrous sodium sulfate and concentrated in vacuo. The crude product was purified by FCC eluting with 15% EtOAc in hexane to afford the title compound (18 mg, 40%). HPLC-MS, MH+ requires m/z=286; Found m/z=286, Rt 3.61min (100%). 1H NMR (300 MHz, CDC13) δ: 7.87 (d, 1H), 7.63 (d, 1H), 7.40 - 6.87 (m, 7H), 6.65 (s, 1H), 4.29 (s, 2H) and 2.08 (s, 3H).

Intermediate 4: Ethyl 2-(l-benzylsulfon l-2-methylindolizin-3-yl)-2-oxoacetate

To a stirred solution of l-(benzylsulfonyl)-2-methylindolizine (prepared in an analogous manner to Intermediate 3, 40 mg, 0.14 mmol) in THF (2 mL) was added ethyl chlorooxoacetate (0.04 mL, 0.35 mmol) under argon and the reaction was stirred overnight at room temperature. The reaction mixture was quenched with saturated aqueous sodium hydrogencarbonate solution (10 mL) and extracted with DCM (2 x 20 mL). The combined organic layers were dried over anhydrous sodium sulfate and concentrated in vacuo. The residue was washed with hexane to give the title compound (33 mg, 61 %). HPLC-MS, MH+ requires m/z=386; Found: m/z=386, Rt 3.86 min (98%). 1H NMR (300 MHz, CDC13) δ 9.88 (d, 1H, J = 6.9 Hz), 7.96 (d, 1H, J = 9 Hz), 7.38- 7.00 (m, 7H), 4.42 (q, 2H), 4.33 (s, 2H), 2.24 (s, 3H) and 1.40 (t, 3H).

Intermediate 5: (RS) Ethyl 2-(l-benzylsulfonyl-2-methylindolizin-3-yl)-2-hydroxyacetate

To a stirred solution of ethyl 2-(l-benzylsulfonyl-2-methylindolizin-3-yl)-2-oxoacetate (Intermediate 4, 30 mg, 0.078 mmol) in MeOH (1 mL), DCM (0.22 mL) and water (0.04 mL) at -40 C was added sodium borohydride (12 mg, 0.31 mmol) and the resulting mixture was stirred for 10 min. A solution of 10% glacial AcOH (0.3 mL) was added and the pH was adjusted to 8 using saturated aqueous sodium hydrogencarbonate solution. The mixture was extracted with DCM (2 x 15 mL), the combined organic extracts were dried over anhydrous sodium sulfate and concentrated in vacuo. The residue was washed with hexane to afford the title compound (23 mg, 77 %). HPLC-MS, MH+ requires m/z=388; Found m/z=388, Rt 3.44 min (100%). 1H NMR (300 MHz, CDC13) δ 8.06 (d, 1H, J = 6.9 Hz), 7.73 (d, 1H, J = 9 Hz), 7.26 - 7.12 (m, 3H), 7.00 - 6.90 (m, 3H), 6.70 (t, 1H), 5.56 (s, 1H), 4.29-4.14 (m, 4H), 3.33 (br s, 1H), 2.15 (s, 3H) and 1.17 (t, 3H).

Intermediate 6: Ethyl (l-benzylsulfonyl-2-methylindolizin-3-yl)acetate

To a stirred solution of ethyl 2-(l-benzylsulfonyl-2-methylindolizin-3-yl)-2-hydroxyacetate (prepared in an analogous manner to Intermediate 5, 150 mg, 0.39 mmol) in toluene (12 mL) was added triphenylphosphine (203 mg, 0.78 mmol) and iodine (99 mg, 0.39 mmol). The resulting mixture was heated at 80 C and stirred for 1.5 h. The reaction mixture was cooled to room temperature, quenched with water (5 mL) and extracted with ethyl acetate (50 mL). The organic layer was washed with saturated aqueous sodium thiosulfate solution (20 mL), dried over anhydrous sodium sulfate and concentrated in vacuo. The residue was purified by FCC eluting with 25 % ethyl acetate in hexane to afford the title compound (110 mg, 78 %). HPLC-MS, MH+ requires m/z=372; Found m/z=372, Rt 3.72 min (97%). 1H NMR (300 MHz, CDC13) δ 7.91 (d, 1H, J = 6.9 Hz), 7.73 (d, 1H, J = 9 Hz), 7.26 - 7.11 (m, 3H), 6.97 - 6.89 (m, 3H), 6.75 (t, 1H), 4.28 (s, 2H), 4.16 (q, 2H), 3.81 (s, 2H), 2.09 (s, 3H) and 1.24 (t, 3H). Intermediate 7: (l-Benzylsulfonyl-2-methylindolizin-3-yl)acetic acid

To a stirred solution of ethyl (l-benzylsulfonyl-2-methylindolizin-3-yl)acetate (prepared in an analogous manner to Intermediate 6, 130 mg, 0.35 mmol) in MeOH/water (10 mL / 2 mL), was added aqueous sodium hydroxide solution (5M, 0.75 mL) and the reaction was stirred for 4 h at room temperature. The mixture was concentrated in vacuo and the residue was diluted with water (2 mL) and washed with DCM (15 mL). The aqueous layer was acidified with saturated aqueous citric acid (2 mL) and extracted with DCM (2 x 20 mL). The combined organic extracts were dried over anhydrous sodium sulfate and concentrated in vacuo to afford the title compound, which was used without further purification (85 mg, 71 %). HPLC-MS, MH+ requires m/z=344; Found m/z=344, Rt 3.17 min (100%). 1H NMR (300 MHz, CDC13 + 1 drop of DMSO-d6) δ 7.95 (d, 1H, J = 6.9 Hz), 7.73 (d, 1H, J = 9 Hz), 7.33 - 7.11 (m, 3H), 6.97 - 6.89 (m, 3H), 6.74 (t, 1H, J = 6.9 Hz), 4.27 (s, 2H), 3.79 (s, 2H) and 2.09 (s, 3H).

Intermediate 8: Ethyl 3-oxo-4-[(pyridin-2-ylmethyl)amino]butanoate

To a stirred solution of picolylamine (5.0 g, 46.23 mmol) and methylmalonyl chloride (5.80 mL, 46.23 mmol) in THF (200 mL) at 0 C was added TEA (9.5 mL, 69.35 mmol) and the reaction was stirred at room temperature for 2 h. The solvent was removed under reduced pressure. The residue was diluted with EtOAc (2 x 100 mL) and the organic layer was washed with saturated aqueous sodium hydrogencarbonate solution (3 x 20 mL), dried over anhydrous sodium sulfate, and concentrated in vacuo. The residue was purified by FCC eluting with 0-2% MeOH in DCM to afford the title compound (5.0 g, 48%). 1H NMR (300 MHz, CDC13) δ: 8.57-8.55 (d, 1H), 8.04 (s, 1H), 7.69-7.63 (m, 1H), 7.28-7.18 (m, 2H), 4.62- 4.60 (d, 2H), 4.26-4.18 (q, 2H), 3.40 (s, 2H) and 1.32-1.27 (t, 3H).

Intermediate 9: Ethyl imidazo[l,5-a]pyridin-3-ylacetate

A solution of ethyl 3-oxo-4-[(pyridin-2-ylmethyl)amino]butanoate (Intermediate 8, 5.0 g, 22.52 mmol) in phosphorus oxychloride (20 mL) was heated under reflux for 9 h. The mixture was cooled to room temperature and concentrated under reduced pressure. The residue was partitioned between saturated aqueous sodium hydrogencarbonate solution and EtOAc (3 x 50 mL). The combined organic layers were washed with water (3 x 20 mL), dried over anhydrous sodium sulfate, and concentrated in vacuo to afford the title compound (3.1 g, 67%). HPLC-MS, MH+ requires m/z=205; Found m/z=205, Rt 2.04 min (100%). 1H NMR (300 MHz, CDC13) δ 7.83-7.81 (d, 1H), 7.46-7.40 (t, 2H), 6.74-6.69 (m, 1H), 6.61-6.56 (m, 1H), 4.21-4.14 (q, 2H), 4.11 (s, 2H), and 1.27-1.22 (t, 3H).

Intermediate 10: Ethyl (l-iodoimidazo[l,5-a]pyridin-3-yl)acetate

To a stirred solution of ethyl imidazo[l,5-a]pyridin-3-ylacetate (Intermediate 9, 1.60 g, 7.82 mmol) in acetonitrile (200 mL) at 0 C was added N-iodosuccinimide (1.76 g, 7.82 mmol) portionwise and the mixture was stirred for 1 h. TEA (15 mL, 7.82 mmol) was added drop wise at 0 °C and the reaction was stirred for 15 min. The solvent was removed in vacuo. The residue was purified by FCC eluting with 0-15% EtOAc in hexane to afford the title compound (1.7 g, 66%). HPLC-MS, MH+ requires m/z=331; Found m/z=331, Rt 3.38 min (92%). 1H NMR (300 MHz, CDC13) δ 7.84-7.81 (d, 1H), 7.33-7.30 (d 1H), 6.83-6.78 (t, 1H), 6.66-6.62 (t, 1H), 4.21-4.08 (m, 2H), 4.11 (s, 2H) and 1.28-1.25 (t, 3H). Intermediate 11: Ethyl [l-(benzylthio)imidazo[l,5-a]pyridin-3-yl]acetate

A solution of ethyl (l-iodoimidazo[l,5-a]pyridin-3-yl)acetate (Intermediate 10, 1.0 g, 3.03 mmol), benzyl mercaptan (376 mg, 3.03 mmol), DIPEA (1 mL, 6.05 mmol) and Xantphos (88 mg, 0.152 mmol) in dry dioxane (15 mL) was degassed with argon for 15 min. Pd₂(dba)₃ (70 mg, 0.076 mmol) was added and the reaction mixture was heated under reflux (110 °C) for 6 h. The mixture was cooled to room temperature and the solvent was removed in vacuo. The residue was purified by FCC eluting with 0-15% EtOAc in hexane to afford the title compound (760 mg, 77%). HPLC-MS, MH+ requires m/z=327; Found m/z=327, Rt 3.63 min (77%). 1H NMR (300 MHz, CDC13) δ 7.78-7.76 (d, IH), 7.14-7.03 (m, 6H), 6.65-6.54 (m, 2H), 4.22-4.15 (q, 2H), 4.13 (s, 2H), 3.97 (s, 2H) and 1.27-1.23 (t, 3H).

Intermediate 12: Ethyl [l-(benzylsulfonyl)imidazo[l,5-a]pyridin-3-yl]acetate

To a stirred solution of ethyl [l-(benzylthio)imidazo[l,5-a]pyridin-3-yl]acetate (Intermediate 11, 300 mg, 0.92 mmol) in DCM (15 mL) was added Oxone (1.13 g, 3.68 mmol) and the reaction mixture was stirred for 12 h at ambient temperature. The reaction mixture was diluted with DCM (20 mL) and washed with water (25 mL). The aqueous layer was extracted with EtO Ac (40 mL), the combined organic layers were dried over anhydrous sodium sulfate and concentrated in vacuo. The crude product was purified by FCC eluting with 0-20%> EtOAc in hexane to afford the title compound as a brown solid (230 mg, 70%). HPLC-MS, MH+ requires m/z=359; Found m/z=359, Rt 3.31 min (100%). IH NMR (300 MHz, CDC13) δ 7.90-7.87 (d, IH), 7.52-7.49 (d, IH), 7.19-7.05 (m, 5H), 6.93-6.88 (t, IH), 6.79-6.74 (t, IH), 4.48 (s, 2H), 4.26-4.19 (m, 4H) and 1.30-1.25 (t, 3H).

Intermediate 13: [l-(Benzylsulfonyl)imidazo[l,5-a]pyridin-3-yl]acetic acid

Ethyl [l-(benzylsulfonyl)imidazo[l,5-a]pyridin-3-yl]acetate (prepared in an analogous manner to Intermediate 12, 250 mg, 0.70 mmol) was dissolved in THF:water (7:3 mL) and lithium hydroxide (58 mg, 1.39 mmol) was added. The mixture was stirred for 2 h, the solvent was removed in vacuo and the residue was diluted with water (20 mL). The aqueous layer was washed with DCM (2 x 20 mL), acidified to pH 4 with aqueous potassium hydrogen sulfate and extracted with EtOAc (3 x 50 mL). The combined organic extracts were washed with water (20 mL), brine (20 mL) then dried over anhydrous sodium sulfate, filtered and concentrated in vacuo to afford the title compound, which was used without further purification (201 mg, 87%). HPLC-MS, MH+ requires m/z=331; Found m/z=331, Rt 2.81 min (100%). 1H NMR (300 MHz, CDC1₃) δ 8.38-8.35 (d, 1H), 7.40-7.37 (d, 1H), 7.20-7.01 (m, 6H), 6.91-6.87 (t, 1H), 4.53 (s, 2H) and 4.20 (s, 2H).

Intermediate 14: 2-(3-Fluorobenzylthiomethyl)pyridine

To the suspension of 2-(chloromethyl)pyridine hydrochloride (2.0 g, 12.1 mmol) in toluene (35 mL) was added DBU (3.68 mL, 24.2 mmol) and the mixture was stirred for 15 min at room temperature. 3-Fluoro benzyl mercaptan (1.5 mL, 12.1 mmol) was added slowly and the reaction mixture was stirred overnight. The reaction was diluted with ethyl acetate (150 mL), washed with water (50 mL), dried over anhydrous sodium sulfate and concentrated in vacuo. The residue was purified by FCC eluting with 10%> ethyl acetate in hexane to afford the title compound (2.2 g, 77 %). HPLC-MS, MH+ requires m/z=234; Found m/z=234, Rt 3.14 min (94%). 1H NMR (300 MHz, CDC13) δ 8.55 (d, 1H), 7.64 (t, 1H), 7.31 - 7.21 (t, 2H), 7.16 (t, 1H), 7.09 - 7.03 (m, 2H), 6.93 (m, 1H), 3.75 (s, 2H) and 3.68 (s, 2H).

Intermediate 15: 2-(4-Fluorobenzylthiomethyl)pyridine

The title compound was prepared according to the procedure used for the synthesis of Intermediate 14 using 2-(chloromethyl)pyridine hydrochloride (3.0 g, 18.2 mmol), DBU (5.6 mL, 37 mmol) and 4-fluoro benzyl mercaptan (2.26 mL, 18.2 mmol) in toluene (50 mL). Yield: 3.0 g, 71%. HPLC-MS, MH+ requires m/z=234; Found m/z=234, Rt 2.96 min (98%). 1H NMR (300 MHz, CDC13) δ 8.55-8.53 (m, 1H), 7.66-7.60 (m, 1H), 7.31 - 7.25 (m, 3H), 7.18-7.14 (m, 1H), 7.00-6.93 (m, 2H), 3.74 (s, 2H) and 3.66 (s, 2H).

Intermediate 16: 2-(3-Fluorobenzylsulfonylmethyl)pyridine

To a stirred solution of 2-(3-fluorobenzylthiomethyl)-pyridine (Intermediate 14, 2.2 g, 9.4 mmol) in DCM (150 mL) was added Oxone (17.40 g, 28.0 mmol). The mixture was stirred for 48 h at room temperature. The reaction mixture was diluted with DCM (150 mL) and washed with water (100 mL). The organic layer was dried over anhydrous sodium sulfate and concentrated in vacuo. The residue was purified by FCC eluting with 40%> ethyl acetate in hexane to afford the title compound (1.9 g, 76 %). HPLC-MS, MH+ requires m/z=266; Found m/z=266. Rt 3.31 min (100%). 1H NMR (300 MHz, CDC13) δ 8.68 (d, 1H, J = 4.8 Hz), 7.76 (t, 1H, J = 7.8 Hz), 7.46 (d, 1H, J = 7.8 Hz), 7.39- 7.26 (m, 4H), 7.11 - 7.08 (m, 1H) and 4.32 (s, 4H). Intermediate 17: 2-(4-Fluorobenzylsulfonylmethyl)pyridine

The title compound was prepared according to the procedure described for the synthesis of Intermediate 16 using 2-(4-fluorobenzylthiomethyl)pyridine (Intermediate 15, 3.0 g, 12.8 mmol) and Oxone (23.72 g, 38.5 mmol) in DCM (150 mL). Yield: 2.4 g, 70 %. HPLC-MS, MH+ requires m/z=266, Found m/z=266, Rt 3.03 min (100%). 1H NMR (300 MHz, CDC13) δ 8.68-8.66 (m, 1H), 7.79-7.74 (m, 1H), 7.59-7.54 (m, 2H), 7.47 (d, 1H), 7.36-7.32 (m, 1H), 7.12 - 7.06 (m, 2H), 4.30 (s, 2H) and 4.29 (s, 2H).

Intermediate 18: l-(3-Fluorobenzylsulfonyl)-2-methylindolizine

A solution of l-bromo-2,2-dimethoxy propane (2.07 g, 11.32 mmol), 2-butanone (40 mL) and hydrochloric acid (Cone, 0.5 mL) was stirred for 2 h at room temperature. To the mixture were added potassium carbonate (1.56 g, 11.3 mmol) and 2-(3- fluorobenzylsulfonylmethyl)pyridine (Intermediate 16, 1.5 g, 5.7 mmol) and the reaction mixture was heated to 80 C and stirred overnight. The mixture was cooled to room temperature, the solvent evaporated under reduced pressure and the residue diluted with DCM (150 mL). The organic layer was washed with water (50 mL), dried over anhydrous sodium sulfate and concentrated in vacuo. The crude product was purified by FCC eluting with 15% EtOAc in hexane to afford the title compound (0.21 g, 12%). HPLC-MS, MH+ requires m/z=304; Found m/z=304, Rt 3.83 min (100%). 1H NMR (300 MHz, CDC13) δ 7.88 (d, 1H, J = 6.9 Hz), 7.64 (d, 1H, J = 9.3 Hz), 7.14 - 7.10 (m, 1H), 7.05 (s, 1H), 6.93 - 6.80 (m, 3H), 6.71- 6.65 (m, 2H), 4.27 (s, 2H) and 2.14 (s, 3H).

Intermediate 19: l-(4-Fluorobenzylsulfonyl)-2-methylindolizine

The title compound was prepared according to the procedure described for the synthesis of Intermediate 18 using l-bromo-2,2-dimethoxy propane (2.9 g, 15.8 mmol), 2-butanone (60 mL), hydrochloric acid (Cone, 1 mL), potassium carbonate (2.1 g, 15.8 mmol) and 2-(4- fluorobenzylsulfonylmethyl)pyridine (Intermediate 17, 2.1 g, 7.90 mmol). Yield: 0.3 g, 12 %. HPLC-MS, MH+ requires m/z=304; Found m/z=304, Rt 3.58 min (100%). 1H NMR (300 MHz, CDC13) δ 7.88 (d, 1H, J = 6.9 Hz), 7.62 (d, 1H, J = 9.3 Hz), 7.04 (s, 1H), 7.00 - 6.82 (m, 5H), 6.70 - 6.65 (m, 1H), 4.14 (s, 2H) and 2.04 (s, 3H). Intermediate 20: Methyl 2-[l-(3-fluorobenzylsulfonyl)-2-methylindolizin-3-yl]-2-oxoacetate

To a stirred solution of l-(3-fluorobenzylsulfonyl)-2-methylindolizine (prepared in an analogous manner to Intermediate 18, 250 mg, 0.825 mmol) in THF (20 mL) was added methyl oxalyl chloride (0.22 mL, 2.06 mmol) under argon. The mixture was stirred overnight at room temperature, then quenched with saturated aqueous sodium hydrogencarbonate solution (15 mL) and extracted with DCM (2 x 50 mL). The combined organic layers were dried over anhydrous sodium sulfate and concentrated in vacuo. The residue was purified by washing with pentane (210 mg, 66 %). HPLC-MS, MH+ requires m/z=390; Found m/z=390, Rt 3.70 min (100%). 1H NMR (300 MHz, CDC1₃) δ: 9.87 (d, 1H, J = 6.9 Hz), 7.96 (d, 1H, J = 9 Hz), 7.39, (t, 1H, J = 8.1 Hz), 7.17 - 7.08 (m, 2H), 7.01- 6.95 (m, 1H), 6.86 (d, 1H, J = 7.4 Hz), 6.74 (d, 1H, J = 7.5 Hz), 4.31 (s, 2H), 3.96 (s, 3H) and 2.30 (s, 3H). Intermediate 21: Methyl 2-[l-(4-fluorobenzylsulfonyl)-2-methylindolizin-3-yl]-2-oxoacetate

The title compound was prepared according to the procedure described for the synthesis of Intermediate 20 using l-(4-fluorobenzylsulfonyl)-2-methylindolizine (Intermediate 19, 219 mg, 0.7 mmol), methyl oxalyl chloride (0.18 mL, 1.7 mmol) in THF (20 mL). Yield: 0.17 g, 63 %. HPLC-MS, MH+ requires m/z=390; Found m/z=390, Rt 3.80 min (96%). 1H NMR (300 MHz, CDC13) δ 9.86 (d, 1H, J = 6.9 Hz), 7.93 (d, 1H, J = 9 Hz), 7.37, (t, 1H, J = 7.8 Hz), 7.09 (t, 1H, J = 6.9 Hz), 7.01 - 6.96 (m, 2H), 6.91 - 6.83 (m, 2H), 4.27 (s, 2H), 3.94 (s, 3H) and 2.11 (s, 3H).

Methyl 2- [ 1 -(3 -fluorobenzylsulfonyl)-2-methylindo lizin-3 -yl] -2-

To a stirred solution of methyl 2-[l-(3-fluorobenzylsulfonyl)-2-methylindolizin-3-yl]-2- oxoacetate (prepared in an analogous manner to Intermediate 20, 380 mg, 0.98 mmol) in a mixture of methanol (20 mL), DCM (4.4 mL) and water (0.8 mL) at -40 C was added sodium boro hydride (150 mg, 3.9 mmol) and the resulting mixture was stirred for 15 min. Aqueous acetic acid (10%, 3 mL) was added and the pH was adjusted to 8 using saturated aqueous sodium hydrogencarbonate solution. The mixture was extracted with DCM (2 x 50 mL), the combined organic extracts were dried over anhydrous sodium sulfate and concentrated in vacuo. The residue was purified by FCC eluting with 35% EtOAc in hexane to afford the title compound (310 mg, 81 %). HPLC-MS, MH+ requires m/z=392; Found m/z = 392, Rt 3.33 min (100%). IH NMR (300 MHz, CDC13) δ 8.09 (d, IH, J = 6.9 Hz), 7.75 (d, IH, J = 9.3 Hz), 7.18 - 7.1 1 (m, IH), 6.99 -6.75 (m, 3H), 6.75 -6.70 (m, IH), 6.60 (d, IH), 5.60 (s, IH), 4.26 (s, 2H), 3.76 (s, 3H) and 3.35 (br s, IH), 2.18 (s, 3H).

Methyl 2- [ 1 -(4-fluorobenzylsulfonyl)-2-methylindo lizin-3 -yl] -2-

The title compound was prepared according to the procedure described for the synthesis of Intermediate 22 using methyl 2-[l-(4-fluorobenzylsulfonyl)-2-methylindolizin-3-yl]-2- oxoacetate (prepared in an analogous manner to Intermediate 21, 200 mg, 0.51 mmol) and sodium borohydride (93 mg, 2.5 mmol) in a mixture of methanol (9 mL), DCM (2 mL) and water (0.4 mL). Yield: 0.14 g, 70 %. HPLC-MS, MH+ requires m/z=392; Found m/z=392, Rt 3.28 min (100%). IH NMR (300 MHz, CDC13) δ 8.09 (d, IH), 7.74 (d, IH), 6.96 - 6.82 (m, 5H), 6.73 (t, IH), 5.59 (s, IH), 4.25 (s, 2H), 3.32 (s, IH), 3.76 (s, 3H), 3.50 (br s, IH) and 2.16 (s, 3H).

Intermediate 24: Methyl 2-[l -(3 -fluorobenz lsulfonyl)-2-methylindo lizin-3 -yl] acetate

To a stirred solution of methyl 2-[l-(3-fluorobenzylsulfonyl)-2-methylindolizin-3-yl]-2- hydroxyacetate (prepared in an analogous manner to Intermediate 22, 350 mg, 0.89 mmol) in toluene (25 mL) were added triphenylphosphine (470 mg, 1.79 mmol) and iodine (227 mg, 0.89 mmol). The resulting mixture was heated at 80 C for 1 h, cooled to room temperature, diluted with EtOAc (50 mL) and washed with saturated sodium thiosulfate solution (20 mL). The organic layer was dried over anhydrous sodium sulfate and concentrated in vacuo. The resulting residue was purified by FCC eluting with 40 % EtOAc in hexane to afford the title compound (220 mg, 66 %). HPLC-MS, MH+ requires m/z=376; Found m/z=376, Rt 3.67 min (90%). 1H NMR (300 MHz, CDC13) δ 7.92 (d, 1H, J = 6.9 Hz), 7.79-7.75 (m, 1H), 7.16 - 7.09 (m, 1H), 6.97 - 6.89 (m, 2H), 6.82 - 6.77 (m, 2H), 6.63 (d, 1), 4.26 (s, 2H), 3.84 (s, 2H), 3.70 (s, 3H) and 2.15 (s, 3H).

Intermediate 25: Methyl 2- [l-(4-fluorobenzylsulfonyl)-2-methylindolizin-3-yl] acetate

The title compound was prepared according to the procedure described for the synthesis of Intermediate 24 using methyl 2-[l-(4-fluorobenzylsulfonyl)-2-methylindolizin-3-yl]-2- hydroxyacetate (prepared in an analogous manner to Intermediate 23, 160 mg, 0.4 mmol), triphenylphosphine (210 mg, 0.8 mmol) and iodine (100 mg, 0.4 mmol) in toluene (20 mL). Yield: 90 mg, 59 %. HPLC-MS, MH+ requires m/z=376; Found m/z=376, Rt 3.65 min (96%). 1H NMR (300 MHz, CDC13) δ 7.90 (d, 1H, J = 6.9 Hz), 7.75 (d, 1H, J = 9 Hz), 6.99 - 6.91 (m, 3H), 6.86 - 6.77 (m, 3H), 4.25 (s, 2H), 3.84 (s, 2H), 3.71 (s, 3H) and 2.12 (s, 3H).

Intermediate 26: [1 -(3 -Fluorobenzylsulfonyl)-2-methylindolizin-3-yl] acetic acid

To a stirred solution of methyl 2-[l-(3-fluorobenzylsulfonyl)-2-methylindolizin-3-yl]acetate (Intermediate 24, 210 mg, 0.54 mmol) in a 5 : 1 mixture of methanol: water (15 mL:3 mL) was added aqueous sodium hydroxide solution (5M, 2 mL) and the reaction was stirred at room temperature for 2 h. The methanol was removed in vacuo, the residue was diluted with water (20 mL) and washed with DCM (20 mL). The aqueous layer was acidified using a saturated aqueous citric acid solution (2 mL) and extracted with DCM (2 x 25 mL). The combined acidic organic extracts were dried over anhydrous sodium sulfate and concentrated in vacuo. The white solid residue was washed with pentane to afford the title compound, which was used without further purification (150 mg, 77 %). HPLC-MS, MH+ requires m/z=362; Found m/z=362, Rt 3.29 min (98%). 1H NMR (300 MHz, CDC13) δ 8.02 (d, 1H, J = 6.9 Hz), 7.71 (d, 1H, J = 9 Hz), 7.16 - 7.09 (m, 1H), 7.00 - 6.89 (m, 2H), 6.82- 6.72 (m, 3H), 4.27 (s, 2H), 3.83 (s, 2H) and 2.17 (s, 3H).

Intermediate 27: [l-(4-Fluorobenzylsulfonyl)-2-methylindolizin-3-yl] acetic acid

The title compound was prepared according to the procedure described for the synthesis of Intermediate 26 using methyl 2- [l-(4-fluorobenzylsulfonyl)-2-methylindolizin-3-yl] acetate (prepared in an analogous manner to Intermediate 25, 150 mg, 0.4 mmol), aqueous sodium hydroxide solution (5M, 2 mL) and methanol: water (15 mL:3 mL). Yield: 120 mg, 83 %. HPLC-MS, MH+ requires m/z=362; Found m/z=362, Rt 3.05 min (100%). 1H NMR (300 MHz, CDCls) δ 7.97 (d, 1H, J = 6.9 Hz), 7.71 (d, 1H, J = 9 Hz), 7.99 - 7.76 (m, 6H), 4.23 (s, 2H), 3.81 (s, 2H) and 2.12 (s, 3H).

Claims

Patent claims

A compound or a pharmaceutically acceptable salt thereof of formula (I)

wherein

A is CH; N; or C(CH₃);

R¹ is hydrogen; halogen; or Ci_₄ alkyl, wherein Ci_₄ alkyl is optionally substituted with one or more halogen, which are the same or different;

R² is hydrogen; or halogen;

R³ is hydrogen; or Ci_₄ alkyl, wherein Ci_₄ alkyl is optionally substituted with one or more halogen, which are the same or different;

R⁴, R⁵ are independently selected from the group consisting of hydrogen; halogen; and CN;

R⁶ is hydrogen; Ci_₄ alkyl; or cyclopropyl, wherein Ci_₄ alkyl and cyclopropyl are optionally substituted with one or more halogen, which are the same or different;

R⁷ is hydrogen; or methyl; R^ is T¹;

Optionally R⁷ and R⁸ are joined together with the carbon atom to which they are attached to form a ring T²;

T¹ is cyclohexyl; or phenyl, wherein T¹ is optionally substituted with one or more R⁹, which are the same or different;

T² is a 7 to 1 1 membered carbobicycle, wherein T² is optionally substituted with one or more R¹⁰, which are the same or different;

R⁹, R¹⁰ are independently selected from the group consisting of halogen; CN; COOR^{1 1}; OR^{1 1}; C(0)Rⁿ; C(0)N(RⁿR^{l la}); S(0)₂N(RⁿR^{l la}); S(0)N(RⁿR^{l la}); S(0)₂Rⁿ; S(0)Rⁿ; N(Rⁿ)S(0)₂N(R^{l la}R^{l lb}); SR^{1 1}; N(RⁿR^{l la}); N0₂; OC(0)Rⁿ ; N(Rⁿ)C(0)R^{l la}; N(Rⁿ)S(0)₂R^{l la}; N(Rⁿ)S(0)R^{l la}; N(Rⁿ)C(0)OR^{l la}; N(Rⁿ)C(0)N(R^{l la}R^{l lb}); OC(0)N(RⁿR^{l la}); oxo (=0), where the ring is at least partially saturated; and Ci_₆ alkyl, wherein Ci_₆ alkyl is optionally substituted with one or more halogen, which are the same or different;

R^{1 1}, R^{l la}, R^{l lb} are independently selected from the group consisting of H; and Ci_₄ alkyl, wherein Ci_₄ alkyl is optionally substituted with one or more halogen, which are the same or different.

A compound of claim 1 , wherein A is CH; or C(CH₃). A compound of claim 1 , wherein A is N.

A compound of any of claims 1 to 3, wherein R¹ is H; F; CI; CH₃; or CF₃. A compound of any of claims 1 to 4, wherein R² is H; F; or CI.

A compound of any of claims 1 to 5, wherein R³ is H; or CH₃.

7. A compound of any of claims 1 to 6, wherein R⁴ is H; or F and/or R⁵ is H; F; or CN.

8. A compound of any of claims 1 to 7, wherein R⁶ is H; CH₃; CH₂CH₃; or cyclopropyl.

9. A compound of any of claims 1 to 8, wherein T¹ is phenyl and wherein T¹ is unsubstituted or substituted with 1 , 2 or 3 R⁹, which are the same or different.

10. A compound of any of claims 1 to 9, wherein R⁹ is F; CI; CH₃; CF₃; CN; N(CH₃)₂;

CH₃0; or CHF₂0.

11. A compound of any of claims 1 to 8, wherein T² is indanyl and wherein T² is unsubstituted or substituted with one or more R¹⁰, which are the same or different.

A compound of claim 1 selected from the group consisting of

1 -(Benzylsulfonyl)-2-methylindolizin-3-yl N-benzyl, N-methylacetamide;

1 -(Benzylsulfonyl)-2-methyl-indolizin-3-yl N-3-chlorobenzyl, N-methylacetamide;

1 -(Benzylsulfonyl)-2-methylindolizin-3-yl N-4-fluorobenzyl, N-methylacetamide;

1 -(Benzylsulfonyl)imidazo [ 1 ,5 -a]pyridin-3 -yl N-(3-chlorobenzyl), N- methylacetamide;

1 -(Benzylsulfonyl)imidazo [ 1 ,5 -a]pyridin-3 -yl N-(4-fluorobenzyl), N- methylacetamide;

1 -(3 -Fluorobenzylsulfonyl)-2-methylindo lizin-3 -yl N-3-chlorobenzyl, N- methylacetamide;

1 -(3 -Fluorobenzylsulfonyl)-2-methylindo lizin-3 -yl N-4-fluorobenzyl, N- methylacetamide;

1 -(4-Fluorobenzylsulfonyl)-2-methylindo lizin-3 -yl N-3-chlorobenzyl, N- methylacetamide; and

1 -(4-Fluorobenzylsulfonyl)-2-methylindo lizin-3 -yl N-4-fluorobenzyl, N- methylacetamide.

13. A compound according to any of claims 1 to 12 for use as a medicament

A pharmaceutical composition comprising at least one compound or a pharmaceutically acceptable salt thereof according to any of claims 1 to 12 together with a pharmaceutically acceptable carrier, optionally in combination with one or more other bioactive compounds or pharmaceutical compositions.

15. A compound or a pharmaceutically acceptable salt thereof according to any of claims 1 to 12 for use in a method of treating or preventing diseases and disorders associated with the Orexin Receptors.

A method for treating, controlling, delaying or preventing in a mammalian patient in need of the treatment of one or more conditions selected from the group consisting of diseases and disorders associated with the Orexin 2 Receptor, wherein the method comprises the administration to said patient a therapeutically effective amount of a compound of any of claims 1 to 12 or a pharmaceutically acceptable salt thereof.

A method for the preparation of a compound of formula (I) according to any of claims 1 to 12 comprising the step of reacting a compound of formula (la)

wherein A, R¹ to R⁵ have the meaning as indicated in any of claims 1 to 12 with a compound of formula HN(R⁶)CH(R⁷R⁸), wherein R⁶ to R⁸ have the meaning as indicated in any of claims 1 to 12 to yield a compound of formula (I).