WO2011136743A1

WO2011136743A1 - Methods and/or primers for the detection of influenza a

Info

Publication number: WO2011136743A1
Application number: PCT/SG2011/000164
Authority: WO
Inventors: Charlie Lee Wah Heng; Ken Sung Wing Kin; Yang Sun Chan; Christopher Wong Wing Cheong; Martin Lloyd Hibberd
Original assignee: Agency for Science Technology and Research Singapore
Current assignee: Agency for Science Technology and Research Singapore
Priority date: 2010-04-26
Filing date: 2011-04-26
Publication date: 2011-11-03
Anticipated expiration: 2012-10-26

Abstract

There is provided a method of detecting the presence of pandemic H1 N1 (2009) Influenza A virus in a sample, the method comprising detecting the presence of an amplicon, a fragment and/or a derivative thereof, wherein the amplicon, fragment and/or derivative thereof (a) is amplified by a pair of primers. There are also provided primer(s) and/or probe as well as kit for the detection of the presence of Influenza A of subtype pandemic H1 N1 (2009) in a sample and/or in a subject.

Description

METHODS AND/OR PRIMERS FOR THE DETECTION OF INFLUENZA A

FIELD OF THE INVENTION The present invention relates to methods and reagents for detecting Influenza A virus. In particular, the invention relates to the detection of influenza A virus, subtype Pandemic H1 N1 (2009).

BACKGROUND TO THE INVENTION

Influenza A is an infectious disease of animals caused by type A strains of the influenza virus that normally infect animals, including birds, pigs and humans. There are many subtypes of the influenza A virus. These subtypes are based on haemagglutinin (HA) segment 4, which has 14 varieties and neuraminidase (NA) segment 6, which has 9 varieties. It is these two segments of the virus that cause virulence.

For example, influenza A subtype, H1 N1 , is known to mutate quickly, and has been shown to be highly pathogenic and can cause severe diseases in man. H1 1 has been viewed as a model for rapid genetic evolution and pandemic change. Generally, evolution is explained to be the selection of frequent copy errors generated by a polymerase complex that lacks a copy function. These errors are then selected for an evolutionary advantage, such as evasion of the immune response of the host, which allows the influenza to expand and fix the selected mutation. Also, influenza viruses employ recombination for rapid evolution via homologous recombination. Therefore, mutation in influenza occurs frequently and these variants may include properties such as anti-viral drug resistance, ability to escape from immune recognition and the like.

A subgroup of the H1 N1 virus is Influenza A (H1 N1 ) 2009 which was first detected in Singapore in May 2009 and has been shown to be highly virulent, particularly in man. WO/2009/144667, WO/05/116270 and the Recommended laboratory tests to identify avian influenza A virus in specimens from human (2005, World health organization, Geneva) provide different PCR primers for detecting influenza A in general. However, many of these primers may not be very sensitive and/or specific to the pandemic H1 N1(2009) and their mutated forms.

Molecular biology techniques like PCR and RT-PCR may be used for the detection of the virus. However, since H1 1 is prone to mutations, the sensitivity and specificity of the primers used is fundamental.

SUMMARY OF THE INVENTION With the rapid emergence of new strains of Influenza A viruses with mutations in the genome leading to properties that allow better survival of the virus in the body, early detection and treatment is essential to eradicate the virus at the early stages. Molecular biology techniques like PCR and RT-PCR may be used for the detection of the virus. The severity of disease due to Influenza A of subtype pandemic H1 N1 (2009) is in general similar to that of seasonal H1 N1 , with only a small proportion of infections producing severe disease. However, the concern is that there may be huge numbers of influenza due to the immunologically naive younger global population and that with this large denominator the small proportion of severe cases may actually represent a considerable cohort. Therefore, a specific and/or sensitive detection method for influenza A virus, in particular, influenza A virus of subtype pandemic H1 N1(2009) is essential.

The present invention addresses the problems above, and in particular provides highly sensitive and specific oligonucleotides, fragment(s) and/or derivative(s) thereof useful in a method of detecting Influenza A virus in patient specimens. In particular, the invention relates to the detection of influenza A virus, subtype pandemic H1 N1(2009). The primers of the present invention may be more sensitive, specific and may be able to obtain high yield of amplicon by single gene amplification. The increased sensitivity of the primers means that the risk of a false negative result may be reduced and the primers may be able to detect virus even in patients with low virus titres. The primers of the present invention thus may provide rapid and cost-effective diagnostic and prognostic reagents for determining infection by influenza A viruses, in particular subtype H1 N1 (2009) viruses and/or disease conditions associated therewith-. These primers may provide an informative influenza assay that can be performed in the field, i.e., at the point of care ("POC"). According to a first aspect, the present invention provides at least one isolated oligonucleotide comprising, consisting essentially of, or consisting of at least one nucleotide sequence selected from the group consisting of: SEQ ID NO:1 to SEQ ID NO:9, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof. The oligonucleotide may be capable of binding to and/or being amplified from influenza A virus. The influenza A virus may be of subtype pandemic H1 N1 (2009).

According to another aspect, the present invention provides at least one pair of oligonucleotides comprising, consisting essentially of, or consisting of at least one forward primer and at least one reverse primer, wherein the forward primer comprises, consists essentially of or consists of a nucleotide sequence selected from the group consisting of: SEQ ID NO:1 , SEQ ID NO:4 and SEQ ID NO:7, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof and the reverse primer comprises, consists essentially of or consists of at least one nucleotide sequence selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:5 and SEQ ID NO:8, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof.

According to a further aspect, the present invention provides a set of oligonucleotides comprising, consisting essentially of or consisting of a pair of oligonucleotides according to any aspect of the present invention and at least one probe, the probe comprising, consisting essentially of or consisting of at least one nucleotide sequence selected from the group consisting of: SEQ ID NO:3, SEQ ID NO:6 and SEQ ID NO:9, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof. According to yet another aspect, the present invention provides a set of oligonucleotides comprising, consisting essentially of or consisting of:

(a) a forward primer comprising, consisting essentially of or consisting of SEQ ID NO:1 , fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof, a reverse primer comprising, consisting essentially of or consisting of SEQ ID NO:2, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof and a probe comprising, consisting essentially of or consisting of SEQ ID NO:3, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof;

(b) a forward primer comprising, consisting essentially of or consisting of SEQ ID NO:4, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof, a reverse primer comprising, consisting essentially of or consisting of

SEQ ID NO:5, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof and a probe comprising, consisting essentially of or consisting of SEQ ID NO:6, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof; and/or

(c) a forward primer comprising, consisting essentially of or consisting of SEQ ID NO:7, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof, a reverse primer comprising, consisting essentially of or consisting of SEQ ID NO:8, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof and a probe comprising, consisting essentially of or consisting of SEQ ID NO:9, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof.

According to one aspect, the present invention provides an amplicon amplified from Influenza A using at least one pair of oligonucleotides according to any aspect of the present invention.

According to one aspect, the present invention provides at least one method of detecting the presence of Influenza A virus in a biological sample, the method comprising the steps of:

(a) providing at least one biological sample;

(b) contacting at least one oligonucleotide, pair of oligonucleotides or set of oligonucleotides according to any aspect of the present invention, with at least one nucleic acid in the biological sample, and/or with at least one nucleic acid extracted, purified and/or amplified from the biological sample; and

(c) detecting any binding resulting from the contacting in step (b) whereby the influenza A virus is present when binding is detected.

The influenza A virus may be of subtype pandemic H1N1(2009).

According to one aspect, the present invention provides at least one method of amplifying nucleic acid of influenza A virus of subtype H1 N1(2009), wherein said method comprises carrying out a polymerase chain reaction using at least one forward primer according to any aspect of the present invention and at least one reverse primer according to any aspect of the present invention.

According to another aspect, the present invention provides a kit for the detection of influenza A virus of subtype H1 N1(2009), the kit comprising at least one oligonucleotide, a pair of oligonucleotides or a set of oligonucleotides according to any aspect of the present invention and/or a sequencing primer according to any aspect of the present invention. All primers and probes may be mixed to construct multiplex one- step fluorescence probe-based real-time PCR in one-tube with high specificity and high sensitivity.

The oligonucleotides of the present invention may be capable of binding to and/or being amplified from Influenza A virus. The Influenza A virus may be of subtype H1 N1. In particular, the primers may be specific to segment 4 of the Influenza A virus of subtype Pandemic H1 N1 (2009). Examples of the genomes of Influenza A virus of subtype Pandemic H1 N1 (2009) includes but is not limited to the list online in www.ncbi.nlm.nih.gov/genomes/FLU/SwineFlu.html.

The primers of the present application may target any genome of Influenza A virus of subtype Pandemic H1 N1 (2009).

As will be apparent from the following description, preferred embodiments of the present invention allow an optimal use of the oligonucleotides to take advantage of the specificity and selectivity of these primers. This and other related advantages will be apparent to skilled persons from the description below.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

Bibliographic references mentioned in the present specification are for convenience listed in the form of a list of references and added at the end of the examples. The whole content of such bibliographic references is herein incorporated by reference. Definitions

The term "biological sample" is herein defined as a sample of any tissue and/or fluid from at least one animal and/or plant. Biological samples may be animal, including human, fluid, solid (e.g., stool) or tissue, as well as liquid and solid food and feed products and ingredients such as dairy items, vegetables, meat and meat by-products, and waste. Biological samples may be obtained from all of the various families of domestic animals, as well as feral or wild animals, including, but not limited to, such animals as ungulates, bear, fish, lagamorphs, rodents, etc. Environmental samples include environmental material such as surface matter, soil, water, air and industrial samples, as well as samples obtained from food and dairy processing instruments, apparatus, equipment, utensils, disposable and non-disposable items. These examples are not to be construed as limiting the sample types applicable to the methods disclosed herein. In particular, a biological sample may be of any tissue and/or fluid from at least a human being.

The term "complementary" is used herein in reference to polynucleotides (i.e., a sequence of nucleotides such as an oligonucleotide or a target nucleic acid) related by the base-pairing rules. For example, for the sequence "5'-A-G-T-3'," is complementary to the sequence "3'-T-C-A-5\" The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods that depend upon binding between nucleic acids. In particular, the "complementary sequence" refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5' end of one sequence is paired with the 3' end of the other, is in "anti-parallel association." Certain bases not commonly found in natural nucleic acids may be included in the nucleic acids disclosed herein and include, for example, inosine and 7-deazaguanine. Complementarity need not be perfect; stable duplexes may contain mismatched base pairs or unmatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the oligonucleotide, base composition and sequence of the oligonucleotide, ionic strength and incidence of mismatched base pairs. Where a first oligonucleotide is complementary to a region of a target nucleic acid and a second oligonucleotide has complementary to the same region (or a portion of this region) a "region of overlap" exists along the target nucleic acid. The degree of overlap may vary depending upon the extent of the complementarity. The term "comprising" is herein defined as "including principally, but not necessarily solely". Furthermore, the term "comprising" will be automatically read by the person skilled in the art as including "consisting of. The variations of the word "comprising", such as "comprise" and "comprises", have correspondingly varied meanings. The term "derivative," is herein defined as the chemical modification of the oligonucleotides of the present invention, or of a polynucleotide sequence complementary to the oligonucleotides. Chemical modifications of a polynucleotide sequence can include, for example, replacement of hydrogen by an alkyl, acyl, or amino group.

The term "fragment" is herein defined as an incomplete or isolated portion of the full sequence of an oligonucleotide which comprises the active/binding site(s) that confers the sequence with the characteristics and function of the oligonucleotide. In particular, it may be shorter by at least one nucleotide or amino acid. More in particular, the fragment comprises the binding site(s) that enable the oligonucleotide to bind to influenza A virus, particularly Influenza A virus of subtype Pandemic H1 N1 (2009). A fragment of the oligonucleotides of the present invention may be about 20 nucleotides in length. In particular, the length of the fragment may be at least about 10 nucleotides in length. For example, the fragment of the forward primer may comprise at least 10, 12, 15, 18, 19, 20 or 22 consecutive nucleotides of SEQ ID NO:1 , and/or the reverse primer may comprise at least 10, 13, 15, 18, 19, 20, 21 or 22, consecutive nucleotides of SEQ ID NO:2, More in particular, the fragment of the primer may be at least 15 nucleotides in length.

The term "internal control (IC) molecule" is herein defined as the in vitro transcribed oligonucleotide molecule which is co-amplified by the same primer set for influenza virus used in the method of the present invention. In particular, the IC may be mixed in the reaction mixture to monitor the performance of PC to avoid false negative results. The probe to detect this IC molecule may be specific to the interior part of this molecule. This interior part may be artificially designed and may not occur in nature.

The term "influenza virus" as used in the context of the invention includes all subtypes of influenza viruses that fall under the categories of "avian influenza viruses" and "human influenza viruses". The influenza viruses may be influenza A, B or C viruses. In particular, the influenza A virus may include but are not limited to H1 1 , H3N2, H5N1 , H5N2, H5N8, H5N9, H7N2, H7N3, H7N4, H7N7, H9N2, Pandemic H1 N1 (2009) and the like.

The term "mutation" is herein defined as a change in the nucleic acid sequence of a length of nucleotides. A person skilled in the art will appreciate that small mutations, particularly point mutations of substitution, deletion and/or insertion has little impact on the stretch of nucleotides, particularly when the nucleic acids are used as probes. Accordingly, the oligonucleotide(s) according to the present invention encompasses mutation(s) of substitution(s), deletion(s) and/or insertion(s) of at least one nucleotide. Further, the oligonucleotide(s) and derivative(s) thereof according to the present invention may also function as probe(s) and hence, any oligonucleotide(s) referred to herein also encompasses their mutations and derivatives. For example, if mutations occur at a few base positions at any primer hybridization site of the target gene, particularly to the 5'-terminal, the sequence of primers may not affect the sensitivity and the specificity of the primers. The term "nucleic acid in the biological sample" refers to any sample that contains nucleic acids (RNA or DNA). In particular, sources of nucleic acids are biological samples including, but not limited to blood, saliva, cerebral spinal fluid, pleural fluid, milk, lymph, sputum and semen.

The oligonucleotides according to the present invention may be useful as primers and/or probes and may be used in methods for specificall detecting influenza A, particularly, pandemic H1 N1 (2009), in a sample containing either one or more strains of influenza and/or other unrelated viruses/microscopic organisms. These nucleotide sequences of the primers and probes of the present invention are designed to hybridize specifically to regions of the influenza A genomes that are unique to the genome of subtype pandemic H1 1 (2009), that are also conserved across many viruses within each strain. The primers according to any aspect of the present invention may also be used to distinguish the genotype of influenza A of subtype pandemic H1 N1 (2009) from other subtypes of influenza A.

The oligonucleotide sequence may be between 13 and 35 linked nucleotides in length and may comprise at least 70% sequence identity to any of the sequences selected from the group consisting of SEQ ID NO:1 to SEQ ID NO:9. A skilled person will appreciate that a given primer need not hybridize with 100% complementarity in order to effectively prime the synthesis of a complementary nucleic acid strand in an amplification reaction. A primer may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event, (e.g., for example, a loop structure or a hairpin structure). In particular, the sequence of the oligonucleotide may have 80%, 85%, 90%, 95% or 98% sequence identity to any one of the sequences selected from the group consisting of SEQ ID NO:1 to SEQ ID NO:9. An extent of variation of 70% to 100%, or any range therewithin, of the sequence identity is possible relative to the specific primer sequences disclosed. Determination of sequence identity is described in the following example: a primer 20 nucleotides in length which is identical to another 20 nucleotides in length primer having two non- identical residues has 18 of 20 identical residues (18/20 = 0.9 or 90% sequence identity). In another example, a primer 15 nucleotides in length having all residues identical to a 15 nucleotides segment of primer 20 nucleobases in length would have 15/20 = 0.75 or 75% sequence identity with the 20 nucleotides primer.

Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for UNIX, Genetics Computer Group, University Research Park, Madison Wl), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981 , 2, 482-489). A skilled person is able to calculate percent sequence identity or percent sequence homology and able to determine, without undue experimentation, the effects of variation of primer sequence identity on the function of the primer in its role in priming synthesis of a complementary strand of nucleic acid for production of an amplification product.

A set of oligonucleotides may comprise a pair of oligonucleotides according to any aspect of the present invention and at least one probe. The probe may be labeled with a fluorescent dye at 5' and 3' ends thereof. Examples of the 5'-labeled fluorescent dye may include, but are not limited to, 6-carboxyfluorescein (FAM), hexachloro-6- carboxyfluorescein (HEX), tetrachloro-o-carboxyfluorescein, and Cyanine-5 (Cy5). Examples of the 3'-labeled fluorescent dye may include, but are not limited to, 5- carboxytetramethylrhodamine (TAMRA) and black hole quencher- 1 ,2,3 (BHQ-1 ,2,3);

The oligonucleotides of the present invention may be used in various nucleic acid amplification techniques known in the art, such as, for example, Polymerase Chain Reaction (PCR), Nucleic Acid Sequence Based Amplification (NASBA), Transcription- Mediated Amplification (TMA), Rolling Circle Amplification (RCA), Strand Displacement Amplification (SDA), thermophilic SDA (tSDA) or Ligation-Mediated Amplification (LMA). The oligonucleotides of the present invention may also be used in a variety of methods known to one of ordinary skill in the art for direct detection of influenza A without amplification through direct hybridization with viral nucleic acids, or to detect DNA or RNA copies of viral nucleic acids, or their complements. The oligonucleotide according to any aspect of the present invention may be used in a method for the detection of influenza from either a clinical or a culture sample, wherein the clinical samples may include but are not limited to, nasopharyngeal, nasal and throat swabs as well as nasopharyngeal aspirates and washes. The clinical sample may undergo preliminary processing prior to testing to allow more efficient detection of the viral nucleic acid. For example, the sample may be collected and may be added to transport medium to stabilize the virus. Nasopharyngeal, nasal and throat swabs may be added to a transport medium. Nasopharyngeal aspirates and washes may or may not be stabilized by addition of transport medium. Once received at the testing laboratory, the virus may be inactivated and lysed to liberate the viral RNA. The nucleic acid may optionally then be extracted to remove potential inhibitors or other interfering agents of later assay steps. To perform the methods of the invention, viral nucleic acids may be mixed with components essential for specific detection of influenza A, in particular the detection of influenza A of subtype pandemic H1 N1 (2009).

The method of detecting the presence of influenza A virus in a biological sample and/or the method of amplifying the nucleic acid of influenza A virus of subtype pandemic H1 N1 (2009) may further comprise a step of analysing the amplified sequence. In particular, the step of analysis may include sequencing. More in particular, the sequencing step may be a method of pyrosequencing using a sequencing primer. Use of Pyrosequencing directly on clinical material enabled the measurement of the dynamics of these mixed genotypes without the polluting or diluting effect of viral culture. The present invention provides at least one kit for the detection of influenza A of subtype pandemic H1 N1 (2009), the kit comprising at least one oligonucleotide, pair of oligonucleotides or set of oligonucleotides according to any aspect of the present invention. The kit may be used by clinicians to detect human and avian influenza viruses in patients that are afflicted with influenza symptoms. Such kit will include one or more primer and probe sets for the detection of influenza A, of subtype pandemic H1 N1 (2009). EXAMPLES

Standard molecular biology techniques known in the art and not specifically described were generally followed as described in Sambrook and Russel, Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (2001 ).

EXAMPLE 1

RNA was extracted from six patients according to hospital lab Standard Operating Procedure. The Roche Kit, Influenza A/H1 N1 Detection Set (Version: November 2009) Cat. No. 05 640 393 001, was used as per manufacturer's protocol on the samples and the results provided in Table 2 below.

The six patient samples were subject to primers of SET A in Table 1 below using the same experimental conditions as per the kit. The results are provided in Table 2.

Set Name Sequence SEQ ID NO:

A H1 N1 , Forward Primer, 5" 1

Forward_FJ771_PE CGAAGCAACTGGAAATCTAGTGG

TA 3'

A H1 1 , Reverse Primer, 5'CGTGGACTGGTGTATCTGAAAT 2

Rev_FJ771_PE G 3'

A H1 N1 , Probe, 5' [6FAM] 3

Probe_FJ771_PE CATTCGCAATGGAAAGAAATGCTG

GATC [TAM] 3'

B H1 N1 , Forward Primer, 5' TTTAATATGGCTAGTTAAAAAAG 4

FJ981613:491_F 3'

B H1 N1 , Reverse Primer, 5' ATCTGCATTCTGATAGAGACTTT 5

FJ981613:616_R 3'

B H1 N1 , Probe, 5' 6

FJ981613:570_Probe CTCGTGCTATGGGGCATTCACCA

3'

C H1 N1 , Forward Primer, 5' TTAATATGGCTAGTTAAAAAAG 7

FJ981613:491_F 3'

C H1 N1 , Reverse Primer, 5' ATCTGCATTCTGATAGAGACTT 8

FJ981613:491_F 3' c H1 N1 , Probe, 5'-/56- 9

FJ981613:491_F FAM/CTCGTGCTATGGGGCATTCA

CC/36-TAMSp/-3'

SW H1 Forward 5' 10

GTGCTATAAACACCAGCCTYCCA

3'

SW H1 Reverse 5' 1 1

CGGGATATTCCTTAATCCTGTRGC

3'

SW H1 Probe 5' 12

CAG A AT AT AC A'T'CC RGTC AC AAT

TGGARAA 3'

Table 1 ^Drimers used in the present invention

Table 2 Results comparing primer set A with the Roche primers

Duplicate runs for each primer set for six different recent patient samples, following passage in MDCK cell line was carried out. The primers of SET A were consistently more sensitive than the primers from the Roche kit, by at least 6 CT values. The results are provided in Table 2.

Table 3 Results comparing primer set B with the WHO primers (SW H1 )

As can be seen in Table 3, out of 11 samples, only one sample (sample 124) gave a CT value for SW H1 , the rest could not be detected. This proves that the primer set B is more sensitive in detecting Influenza A of subtype H1 N1 (2009) than the WHO primer by at least 12 CT values. REFERENCES

1 WO/2009/144667,

2. ^' WO/05/116270

3. Recommended laboratory tests to identify avian influenza A virus in specimens from human (2005, World health organization, Geneva).

4. Sambrook and Russel, Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (2001 )

Claims

An isolated oligonucleotide comprising at least one nucleotide sequence selected from the group consisting of: SEQ ID NO:1 to SEQ ID NO:9, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof.

The isolated oligonucleotide according to claim 1 , wherein the oligonucleotide is capable of binding to and/or being amplified from Influenza A virus of subtype pandemic H1 N1 (2009).

A pair of oligonucleotides comprising at least one forward primer and at least one reverse primer, wherein the forward primer comprises a nucleotide sequence selected from the group consisting of: SEQ ID NO:1 , SEQ ID NO:4 and SEQ ID NO:7, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof and the reverse primer comprises at least one nucleotide sequence selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:5 and SEQ ID NO:8, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof.

A pair of oligonucleotides comprising at least one forward primer and at least one reverse primer, wherein the forward primer consists of at least one nucleotide sequence selected from the group consisting of: SEQ ID NO:1 , SEQ ID NO:4 and SEQ ID NO:7, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof and the reverse primer consists of at least one nucleotide sequence selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:5 and SEQ ID NO:8, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof.

The pair of oligonucleotides according to either claim 3 or 4, capable of binding to and/or being amplified from Influenza A virus of subtype pandemic H1 1 (2009).

A set of oligonucleotides comprising a pair of oligonucleotides according to either claim 3 to 4 and at least one probe comprising the nucleotide sequence selected from the group consisting of: SEQ ID NO:3, SEQ ID NO:6 and SEQ ID NO:9, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof.

7. A set of oligonucleotides comprising a pair of oligonucleotides and at least one probe, wherein the pair of oligonucleotides comprises at least one forward primer comprising SEQ ID NO:1 , fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof and at least one reverse primer comprising SEQ ID NO:2, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof and wherein the probe comprises SEQ ID NO:3, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof.

8. A set of oligonucleotides comprising a pair of oligonucleotides and at least one probe, wherein the pair of oligonucleotides comprises at least one forward primer comprising SEQ ID NO:4, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof and at least one reverse primer comprising

SEQ ID NO:5, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof and wherein the probe comprises SEQ ID NO:6, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof. 9. A set of oligonucleotides comprising a pair of oligonucleotides and at least one probe, wherein the pair of oligonucleotides comprises at least one forward primer comprising SEQ ID NO:7, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof and at least one reverse primer comprising SEQ ID NO:8, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof and wherein the probe comprises SEQ ID NO:9, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof.

10. A set of oligonucleotides comprising at least one forward primer consisting of SEQ ID NO:1 , fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof, at least one reverse primer consisting of SEQ ID NO:2, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof and at least one probe consisting of SEQ ID NO:3, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof.

1 1. A set of oligonucleotides comprising at least one forward primer consisting of SEQ ID NO:4, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof, at least one reverse primer consisting of SEQ ID NO:5, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof and at least one probe consisting of SEQ ID NO:6, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof.

12. A set of oligonucleotides comprising at least one forward primer consisting of SEQ ID NO:7, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof, at least one reverse primer consisting of SEQ ID NO:8, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof and at least one probe consisting of SEQ ID NO:9, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof.

13. An amplicon amplified from Influenza A virus of subtype pandemic H1 N1 (2009) using at least one forward primer and at least one reverse primer, wherein the forward primer comprises a nucleotide sequence selected from the group consisting of: SEQ ID NO:1 , SEQ ID NO:4 and SEQ ID NO:7, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof and the reverse primer comprises at least one nucleotide sequence selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:5 and SEQ ID NO:8, fragment(s), derivative(s), mutation(s), and complementary sequence(s) thereof.

14. A method of detecting the presence of Influenza A virus of subtype pandemic H1 1 (2009) in a biological sample, the method comprising the steps of:

(a) providing at least one biological sample;

(b) contacting at least one oligonucleotide according to either claim 1 or 2, with at least one nucleic acid in the biological sample, and/or with at least one nucleic acid extracted, purified and/or amplified from the biological sample; and

(c) detecting any binding resulting from the contacting in step (b) whereby the Influenza A virus of subtype pandemic H1 1 (2009) is present when binding is detected.

12. A method of detecting the presence of Influenza A virus of subtype pandemic H1 1 (2009) in a biological sample, the method comprising the steps of:

(a) providing at least one biological sample;

(b) contacting a set of oligonucleotides according to any one of claims 6 to 12, with at least one nucleic acid in the biological sample, and/or with at least one nucleic acid extracted, purified and/or amplified from the biological sample; and

(c) detecting any binding resulting from the contacting in step (b) whereby the pandemic H1 N1 (2009) is present when binding is detected.

13. A method of amplifying Influenza A virus of subtype pandemic H1 N1 (2009) nucleic acid, wherein said method comprises carrying out a polymerase chain reaction using a pair of oligonucleotides according to any one of claims 3 to 5.

14. A kit for the detection of Influenza A virus of subtype pandemic H1 N1 (2009), the kit comprising at least one oligonucleotide according to either one of claims 1 or 2.

15. A kit for the detection of Influenza A virus of subtype pandemic H1 N1 (2009), the kit comprising at least one pair of oligonucleotides according to any one of claims 3 to 5.

16. A kit for the detection of Influenza A virus of subtype pandemic H1 N1 (2009), the kit comprising at least one set of oligonucleotides according to any one of claims 6 to 12.