WO2011133112A1 - Cell penetrating peptide derived from the premembrane protein of flavivirus - Google Patents

Cell penetrating peptide derived from the premembrane protein of flavivirus Download PDF

Info

Publication number
WO2011133112A1
WO2011133112A1 PCT/SG2011/000155 SG2011000155W WO2011133112A1 WO 2011133112 A1 WO2011133112 A1 WO 2011133112A1 SG 2011000155 W SG2011000155 W SG 2011000155W WO 2011133112 A1 WO2011133112 A1 WO 2011133112A1
Authority
WO
WIPO (PCT)
Prior art keywords
peptide
amino acid
cell
agent
pcpp
Prior art date
Application number
PCT/SG2011/000155
Other languages
French (fr)
Inventor
Mary Mah Lee Ng
Terence Tze Tong Tan
Original Assignee
National University Of Singapore
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National University Of Singapore filed Critical National University Of Singapore
Publication of WO2011133112A1 publication Critical patent/WO2011133112A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/10—Antimycotics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00—Antiparasitic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/10—Fusion polypeptide containing a localisation/targetting motif containing a tag for extracellular membrane crossing, e.g. TAT or VP22
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/24011—Flaviviridae
    • C12N2770/24111—Flavivirus, e.g. yellow fever virus, dengue, JEV
    • C12N2770/24122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/24011—Flaviviridae
    • C12N2770/24111—Flavivirus, e.g. yellow fever virus, dengue, JEV
    • C12N2770/24133—Use of viral protein as therapeutic agent other than vaccine, e.g. apoptosis inducing or anti-inflammatory
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/24011—Flaviviridae
    • C12N2770/24111—Flavivirus, e.g. yellow fever virus, dengue, JEV
    • C12N2770/24141—Use of virus, viral particle or viral elements as a vector
    • C12N2770/24142—Use of virus, viral particle or viral elements as a vector virus or viral particle as vehicle, e.g. encapsulating small organic molecule
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates generally to a novel cell penetrating peptide, and methods comprising use of the novel peptide for delivering an agent into a cell, as a bioimaging agent, or as an antimicrobial agent.
  • the cell plasma membrane is a semi-permeable phospholipid bilayer structure that regulates the entry and egress of biomolecules and chemicals into the cell.
  • protein channels and carriers facilitate the trafficking of certain molecules through the hydrophobic cell membrane, such processes are highly selective and the plasma membrane constitutes an impermeable barrier against the entry of many exogenous or therapeutic molecules.
  • invasive techniques such as electrical pulsing and microinjection have been used to force the molecules through the cell plasma membrane (Fonseca et al, 2009).
  • problems associated with the use of such invasive methods including cellular toxicity.
  • CPPs cell penetrating peptides
  • CPPs have been derived from the sequences of homeodomains of transcription factors and cell receptors as well as signal sequences (US 2008/0234183). Examples of naturally derived CPPs include penetratin from Antennapedia protein (DeRossi et al, 1994) and TAT from HIV (Vives et al, 1997). CPPs derived from Herpes Simplex virus (Elliot et al, 1998) and Pestivirus (Langedijk et al, 2002) have also been described.
  • the second group consists of peptides that are artificially synthesized or modified. This includes peptides like polyarginine (Mitchell et al, 2000, Futaki et al, 2001).
  • caveolae/lipid raft-mediated endocytosis can occur concomitantly, depending on the nature of CPP and the concentration used (Duchardt, et al, 2007).
  • CPPs have been used as delivery vehicles for transporting a wide variety of molecules including RNA, siRNA, DNA, antibodies, drugs and proteins into the cell (Fonseca et al, 2009, Heitz et al, 2009) and have been studied for potential therapeutic and bioimaging purposes (Kersemans et al, 2008, Fonseca et al, 2009).
  • Radiolabelled or fluorescent probes conjugated to CPPs have been found to efficiently enter cells to facilitate molecular imaging. For example, Gallazzi et al.
  • (2003) used a fluorescent-labelled CPP-nucleic acid construct against bcl-2 for observation of over-expression of bcl-2 oncogene in tumors. Furthermore, CPPs have also been demonstrated to be useful in animal models (Heckl et al, 2003). Bioimaging of apoptosis in vivo was performed successfully in live animals using a capase-activatable form of a far-red fluorescent CPP (Maxwell et al, 2009).
  • CPPs Another interesting trait of CPPs is the intrinsic antimicrobial nature found in some of these peptides. Monomeric penetratin was found to be bactericidal without causing cytotoxicity towards mammalian cells (Zhu and Shin, 2009). Another CPP, PAF26, has also been shown to exhibit fungicidal activity against Penicillium fungus (Munoz et al, 2006). In addition, the antiviral effects of polyarginine on gpl60 processing of HIV (Hallenberger et al, 1992) and of SUMO-1 heptapeptide protein transduction domain through antagonistic binding of HIV Rev protein (Roisin et al, 2003) have also been reported.
  • novel cell penetrating peptide derived from the amino acid sequence of a Flavivirus premembrane protein.
  • the novel cell penetrating peptide described herein may be used to deliver an agent, including for example a biological molecule or therapeutic compound, into a cell and may be used as a bioimaging agent for visualizing cellular trafficking pathways.
  • the novel cell penetrating peptide of the present invention exhibits antimicrobial activity and may be used for the treatment of a microbial infection or disease or disorder characterized or caused by a microbial infection.
  • Xi, X 2 , X 3, X 5j Xt X Xs X Xio Xu Xn and X 13j are each any amino acid;
  • X4 is cysteine or is absent
  • X 7 is any amino acid or is absent.
  • X] is an amino acid with a nonpolar side chain
  • X 2 is arginine, glutamine, asparagine, threonine, methionine or glutamic acid;
  • X 3 is an amino acid with a positively-charged polar side chain or an amino acid with an uncharged polar side chain;
  • 4 is cysteine or is absent;
  • X 5 is histidine, an amino acid with an uncharged polar side chain or an amino acid with a nonpolar side chain;
  • X 6 is an amino acid with an uncharged polar side chain or an amino acid with a positively charged side chain;
  • X 7 is histidine, an amino acid with a non-polar side chain or an amino acid with an uncharged polar side chain, or is absent;
  • X 8 is arginine, glycine or glutamine;
  • X9 is an amino acid with an electrically charged polar side chain;
  • X 10 is serine or glycine or an amino acid with a positively-charged polar side chain;
  • X u
  • the cell penetrating peptide consists of seventeen amino acids, up to eighteen amino acids, up to nineteen amino acids, up to twenty amino acids, up to twenty-one amino acids, up to twenty-two amino acids, up to twenty-three amino acids, up to twenty-four amino acids, up to twenty- five amino acids, up to twenty- six amino acids, up to twenty-seven amino acids, up to twenty-eight amino acids, up to twenty nine amino acids, up to thirty amino acids, up to thirty-one amino acids, up to thirty-two amino acids, up to thirty-seven amino acids, up to forty-two amino acids, up to forty-seven amino acids, up to fifty-seven amino acids, up to sixty-seven amino acids, up to seventy-seven amino acids, up to eighty-seven amino acids, up to ninety-seven amino acids, up to one hundred and seven amino acids, up to one hundred and seventeen amino acids, up to two hundred and seventeen amino acids, up to two hundred and sixty-seven amino acids,
  • the cell penetrating peptide consists essentially of or consists of an amino acid sequence of amino acids 76 to 92 of a Flavivirus premembrane protein.
  • the Flavivirus may be West Nile Virus, Japanese Encephalitis Virus, Murray Valley Encephalitis Virus, Dengue Virus, Tick Borne Encephalitis Virus or Langat Virus.
  • the Flavivirus is West Nile Virus, Japanese Encephalitis Virus or Murray Valley Encephalitis Virus.
  • the Flavivirus is West Nile Virus.
  • the cell penetrating peptide consists essentially of or consists of a sequence set forth in any one of SEQ ID NOS: 2 to 13. In different embodiments, the cell penetrating peptide consists essentially of or consists of a sequence set forth in any one of SEQ ID NOS: 2 to 7. In particular, embodiments, the cell penetrating peptide consists essentially of or consists of a sequence set forth in any one of SEQ ID NOS: 2 to 5.
  • the cell penetrating peptide consists essentially of or consists of a sequence that shares at least 40% sequence identity with a sequence set forth in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13.
  • the cell penetrating peptide consists essentially of or consists of an amino acid sequence comprising the amino acid sequence CG added to beginning of the amino acid sequence X 1 X 2 YGX 3 X4X5X 6 X 7 X 8 X 9 X 1 oX 11 RXi2 i3R [SEQ ID NO: 1] and the amino acid sequence GC added to the end of the amino acid sequence X1X2YGX3X4X5X6X7X8X9X10X11R 12X13 ' [SEQ ID NO: 1].
  • the cell penetrating peptide consists essentially of or consists of a sequence set forth in SEQ ID NO: 14 or SEQ ID NO: 15.
  • a cell penetrating peptide consisting essentially of or consisting of a fragment of the cell penetrating peptide described herein, the fragment consisting of at least eight amino acids.
  • the cell penetrating peptide consists essentially of or consists of the sequence set forth in SEQ ID NO: 16.
  • a peptide/agent complex formed by complexing a peptide comprising an amino acid sequence of the cell penetrating peptide described herein with an agent.
  • a method for delivering an agent into a cell comprising contacting the cell with the peptide/agent complex described herein so that the peptide/agent complex penetrates the cell.
  • the agent may be, for example, an siRNA, a microRNA, an shRNA, a protein or a small molecule.
  • a method for visualizing a cellular trafficking pathway comprising coupling a peptide comprising an amino acid sequence of the cell penetrating peptide described herein with a visually detectable label to form a labelled peptide; contacting a cell with the labelled peptide; detecting the labelled peptide.
  • a method for delivering an antimicrobial agent to a cell comprising contacting a peptide comprising an amino acid sequence of the cell penetrating peptide described herein with the cell.
  • the method comprises administering an effective amount of the peptide for the treatment of a microbial infection or a disease or disorder caused or characterized by a microbial infection.
  • the antimicrobial agent is an antiviral agent.
  • the cell of the methods described herein may be in vitro or in vivo.
  • a peptide comprising an amino acid sequence of the cell penetrating peptide described herein for delivering an agent into a cell.
  • a peptide comprising an amino acid sequence of the cell penetrating peptide described herein in the manufacture of a medicament for delivering an agent into a cell.
  • a peptide comprising an amino acid sequence of the cell penetrating peptide described herein for delivering an agent into a cell.
  • the agent may be, for example, an siRNA, a microRNA, an shRNA, a protein or a small molecule.
  • the cell may be in vitro or in vivo.
  • a peptide comprising an amino acid sequence of the cell penetrating peptide described herein as a bioimaging agent for visualizing a cellular trafficking pathway.
  • a peptide comprising an amino acid sequence of the cell penetrating peptide described herein for use as a bioimaging agent for visualizing a cellular trafficking pathway.
  • a peptide comprising an amino acid sequence of the cell penetrating peptide described herein as an antimicrobial agent.
  • a peptide comprising an amino acid sequence of the cell penetrating peptide described herein in the manufacture of a medicament for use as an antimicrobial agent.
  • a peptide comprising an amino acid sequence of the cell penetrating peptide described herein for use as an antimicrobial agent.
  • the uses or peptide described herein are in an amount effective for the treatment of a microbial infection or a disease or disorder caused or characterized by a microbial infection.
  • the antimicrobial agent is an antiviral agent.
  • FIG. 1 Multiple sequence analysis of protein sequences of Flavivirus premembrane protein (prM). ClustalW sequence analysis of a West Nile Virus (WNV) Sarafend (Sarafend) amino acid sequence [Accession no: AY688948] [SEQ ID NO: 17]. prM protein is aligned against amino acid sequences from other Flaviviruses: WNV Wengler (Wengler) [Accession no: NC_001563] [SEQ ID NO: 18], WNV New York (New York) [Accession no: DQ211652] [SEQ ID NO: 19], Kunjin virus (Kunjin)
  • FIG. 1 Nucleotide and amino acid sequence of a novel cell penetrating peptide (PCPP).
  • PCPP novel cell penetrating peptide
  • A Complete nucleotide sequence of WNV (Sarafend) prM gene [SEQ ID NO : 29] and the nucleotide sequence of PCPP is underlined and in bold.
  • B Amino acid sequence of WNV (Sarafend) prM protein [SEQ ID NO: 30] with the amino acid sequence of PCPP underlined and in bold.
  • C Amino acid sequence of PCPP derived from WNV (Sarafend) [SEQ ID NO: 31] and its predicted molecular weight.
  • D Design and amino acid sequence of fluorescein thiocyanate (FITC)-labelled PCPP [SEQ ID NO: 32] and its predicted molecular weight.
  • FITC fluorescein thiocyanate
  • BHK cells The baby hamster kidney (BHK) cells at 0 min upon addition of FITC- PCPP.
  • BHK Entry of FITC-PCPP into BHK cells was detected at 30 mins after addition of FITC-PCPP.
  • the entry mechanism of PCPP seemingly adopts a vesicular pattern as indicated by white arrows.
  • Figure 4 Single cell bioimaging of entry of PCPP in live BHK cells.
  • the BHK cells expressed Red Fluorescence Protein at their plasma membranes (light grey areas in black and white image). The addition of FITC-PCPP into cells causing a green hue (bright areas in black and white image) in solution at 0 min.
  • B The appearance of initiation points for PCPP entry on the surface membrane at 20 mins as indicated by white arrows.
  • C Rapid entry of PCPP into the plasma membrane of cells at 30 mins resulting in change of red (light grey areas in black and white image) to yellow colouration (bright areas in black and white image), signifying colocalization of plasma membrane and PCPP.
  • FRAP FRAP experiment on PCPP.
  • FRAP was performed on BHK cells pretreated with FITC-PCPP and photobleached with laser before image acquisition. Image data is analyzed by NIS Elements software to generate the FRAP Table.
  • the FRAP Table indicates that partial fluorescence recovery occurred approximately 2 mins after photobleaching.
  • FIG. 8 Cellular cytotoxicity evaluation of PCPP using flow cytometry.
  • BHK cells were incubated with 100 ⁇ of control alanine rich peptide [Petri] or R9 or PCPP overnight and subjected to PI exclusion sorting using flow cytometry.
  • Cytotoxic level of chlorpromazine 100 ⁇ g/mL was used as a positive indicator for PI staining (PI Ctrl) [>90% PI positive cells].
  • PI fluorescence of 50,000 cells was acquired and no cytotoxic effect was observed for PCPP or any of the peptides (R9 and Petri) tested ( ⁇ 1% PI positive cells).
  • siRNA can be delivered successfully into BHK cells using PCPP.
  • PCPP-treated cells exhibit a punctuated vesicular distribution of siRNA as compared to Lipofectamine 2000, which displays aggregates at cytoplasmic and perinuclear regions.
  • FIG. 13 Gene knock-down of human GADPH using PCPP as delivery agent. Different PCPP concentration (Lane 1 - untreated cells, Lane 2 - 25 ⁇ , Lane 3 - 50 ⁇ , Lane 4 - 75 ⁇ , Lane 5 - 100 ⁇ and Lane 6 - Dharmafect 1 -treated cells) were used to deliver 100 nM of human GADPH siRNA in HeLa cells. The cell lysates were harvested at 72 hr post-transfection and subjected to Western
  • FIG. 14 Delivery of proteins using PCPP.
  • BHK cells were treated with Streptavidin-conjugated AlexaFluor-488-fluoronanogold using (A) Optimem medium or (B) 50 ⁇ of PCPP.
  • BHK cells were treated with AlexaFluor-488 conjugated anti-rabbit goat antibody using Optimem medium (C) or (D) 50 ⁇ of PCPP.
  • the live cells were imaged at 4 hrs post-treatment. Experiments showed that protein molecules can be delivered successfully into BHK cells using PCPP.
  • PCPP control alanine rich peptide
  • FIG. 16 PCPP exerted its antiviral effect on Flavivirus entry through direct binding to Flavivirus virions.
  • Black arrows represent FITC- PCPP that bind to virion(s) while black arrowheads indicate the unbound virions.
  • Figure 17 Effect of PCPP on WNV NS3 protease activity.
  • the antiviral effect of PCPP on Flavivirus replication was assessed by measuring NS3 protease activity using in vitro fluorogenic assay. The assay was performed using serial dilutions of Petri, R9 and PCPP. The assay indicates that at 5 ⁇ , R9 and PCPP reduced approximately 50 % of the WNV NS3 protease activity. Mean ⁇ SD was obtained from three independent experiments. Asterisk indicates p-value ⁇ 0.05 calculated by Student t- test.
  • PCPP for co-localization of Flavivirus NS3 protease and PCPP, the BHK cells were infected with WNV and DEN2 at MOI of 1 and treated with 5 ⁇ of FITC-PCPP (green fluorescence) at 18 hr and 24 hr post-infection, respectively. The samples were fixed and stained for NS3 protease (red fluorescence) using anti-NS3 rabbit antibody and anti- rabbit AlexaFluor-594 goat antibody. The cell nuclei were stained with DAPI (blue fluorescence). The images indicate that PCPP co-localized with NS3 protease in
  • Figure 19 Reduction of Flavivirus infectivity after treatment using PCPP at post-infection.
  • BH cells were infected with DEN2 (Figure 19A) and WNV ( Figure 19B) at MOI of 1 and 25, 50 or 100 ⁇ of PCPP were added at 4 hr post-infection.
  • the samples were fixed at 18 hr (for WNV) or 24 hr (for DEN2), respectively and stained for E protein using anti-E 4G2 monoclonal antibody. In each case, the fluorescence of 25,000 events was analysed.
  • Black line represents mock-infected cells
  • green line represents the untreated infected cells
  • blue line represents infected cells treated with 25 ⁇
  • pink line represents infected cells treated with 50 ⁇
  • red line represents infected cells treated with 100 ⁇ . Addition of PCPP after infection reduces virus infectivity in a dose-dependent manner.
  • FIG. 20 Antibacterial activity of PCPP. Disk Diffusion Testing of antibiotic-resistant Escherichia coli Stbl4. The nutrient agar plate was coated with a lawn of E.coli bacteria before placement of antibiotic disks, vancomycin (1), ampicillin (2) and erythromycin (3). Droplets equivalent to 50 ⁇ of R9 (Positive control) (4) and PCPP (5 and 6). The plate was incubated overnight at 37 °C. As shown above, the clear halos (5-6) indicated that the PCPP prevented the growth of E.coli and henceforth, possesses antibacterial property.
  • novel cell penetrating peptide derived from an amino acid sequence of a Flavivirus premembrane protein.
  • This novel cell penetrating peptide can be used to deliver agents, such as biological molecules and therapeutic compounds, into a cell and can be used as a bioimaging agent to visualize cellular trafficking pathways.
  • agents such as biological molecules and therapeutic compounds
  • the novel cell penetrating peptide described herein can be used as an antimicrobial agent, for example an antiviral, antibacterial, antifungal or antiparasitic agent.
  • the present inventors have identified the first CPP derived from a
  • Flaviviridae virus Flaviviridae is a family of viruses comprising three genera:
  • Flavivirus Hepacirivirus and Pestivirus.
  • the Flavivirus genus includes numerous viruses that cause or are associated with human disease including West Nile Virus, Japanese Encephalitis Virus, Tick Borne Encephalitis Virus, Yellow Fever Virus and Dengue Virus (EP 2 085 098).
  • premembrane protein is a cell penetrating peptide.
  • the Flavivirus premembrane protein is a structural protein involved in viral particle assembly.
  • the amino acid sequence of the novel cell penetrating peptide described herein is derived from the furin recognition site of a Flavivirus prM protein which is cleaved by the host furin enzyme during the virus maturation process. Defective cleavage of the prM protein is associated with reduced virus infectivity (Stadler et al., 1997, Elshuber et al., 2003).
  • PCPP premembrane cell penetrating peptide
  • PCPP does not share similar amino acid sequences with other known viral CPPs, it, like many CPPs, is rich in arginines and is positively charged (Kersemans et al., 2008, Fonseca et al., 2009). However, although positive residues have been shown to play an important role in mediating entry of CPPs into cells, it has been observed that non-positive residues may also play a key part in modulating the function of CPPs (Alves et al., 2008, Su et al, 2009). Without being limited to any particular theory, it appears the cell penetrating ability of the PCPP may be modulated, at least in part, by its non-positive residues.
  • amino acid sequence from amino acid 76 to amino acid 92 of the premembrane protein is highly conserved among West Nile Virus, Japanese Encephalitis Virus and Murray Valley Encephalitis Virus, and is conserved to a lesser extent, between these viruses and Dengue Virus, Tick Borne Encephalitis Virus and Langat Virus.
  • the premembrane protein of the Sarafend strain of the West Nile Virus (as described in NCBI accession no. AY688948) has the following amino acid sequence from amino acid 76 to amino acid 92:
  • the premembrane protein of the Wengler strain of the West Nile Virus (as described in NCBI accession no. NC 001563) has the following amino acid sequence from amino acid 76 to amino acid 92:
  • the premembrane protein of the Kunjin strain of the West Nile Virus (as described in NCBI accession no. D00246) has the following amino acid sequence from amino acid 76 to amino acid 92:
  • NCBI accession no. NC_001437) has the following amino acid sequence from amino acid 76 to amino acid 92:
  • VQYGRCTRTRHSKRSRR [SEQ ID NO: 6]
  • the premembrane protein of Murray Valley Encephalitis virus (as described in NCBI accession no. AF161266) has the following amino acid sequence from amino acid 76 to amino acid 92:
  • VNYGRCTRARHSKRSRR [SEQ ID NO: 7]
  • the premembrane protein of Dengue 1 Virus (as described in NCBI accession no. AD097104) has the following amino acid sequence from amino acid 76 to amino acid 92:
  • VTYGTCSQTGEHRRDKR [SEQ ID NO: 8]
  • the premembrane protein of Dengue 2 Virus (as described in NCBI accession no. NC_001474) has the following amino acid sequence from amino acid 76 to amino acid 92:
  • VTYGTCTTTGEHRREKR [SEQ ID NO: 9]
  • the premembrane protein of Dengue 3 Virus (as described in NCBI accession no. NC_001475) has the following amino acid sequence from amino acid 76 to amino acid 92:
  • VTYGTCNQAGEHRRDKR [SEQ ID NO: 10]
  • the premembrane protein of Dengue 4 Virus (as described in NCBI accession no. NC_002640) has the following amino acid sequence from amino acid 76 to amino acid 92:
  • the premembrane protein of Langat Virus (as described in NCBI accession no. NC_003690) has the following amino acid sequence from amino acid 76 to amino acid 92:
  • the premembrane protein of Tick-borne Encephalitis Virus (as described in NCBI accession no. NC_001672) has the following amino acid sequence from amino acid 76 to amino acid 92:
  • the premembrane cell penetrating peptide, PCPP described herein includes any peptide consisting essentially of or consisting of an amino acid sequence of amino acids 76 to 92 of a Flavivirus premembrane protein. It will be understood by persons skilled in the art that the PCPP presently described may encompass any homologue, derivative, variant, or fragment of the PCPP that is a cell penetrating peptide.
  • a "cell penetrating peptide” refers to a peptide with the ability to traverse the cell plasma membrane and enter into the interior of the cell from the exterior. Such peptides can traverse the cell plasma membrane without the use of techniques, such as electroporation or microinjection, or delivery agents, such as liposomes, to enter into the cell.
  • amino acid sequence includes one or more amino acids in addition to the amino acids of the described sequence, including at one or both ends of the described sequence, but that the additional amino acids do not materially affect the ability of the peptide to penetrate the cell.
  • the peptide consisting essentially of an amino acid sequence of amino acids 76 to 92 of a Flavivirus premembrane protein may alternatively have up to one, up to two, up to three, up to four, up to five, up to six, up to seven, up to eight, up to nine, up to ten , up to eleven, up to twelve, up to thirteen, up to fourteen, up to fifteen, up to twenty, up to twenty five, up to thirty, up to forty, up to fifty, up to sixty, up to seventy, up to eighty, up to ninety, up to one hundred, up to two hundred, up to two hundred and fifty, up to five hundred or more amino acids at one or both ends of the described sequence, provided that such a peptide still possesses the ability to penetrate a cell.
  • the peptide may alternatively consist of seventeen, up to eighteen, up to nineteen, up to twenty, up to twenty-one, up to twenty- two, up to twenty-three, up to twenty-four, up to twenty- five, up to twenty-six, up to twenty-seven, up to twenty-eight, up to twenty nine, up to thirty, up to thirty-one, up to thirty-two, up to thirty-seven, up to forty-two, up to forty-seven, up to fifty-seven, up to sixty-seven, up to seventy-seven, up to eighty-seven, up to ninety-seven, up to one hundred and seven, up to one hundred and seventeen, up to two hundred and seventeen, up to two hundred and sixty-seven, up to five hundred and seventeen or more amino acids.
  • a peptide consisting essentially of an amino acid sequence of amino acids 76 to 92 of a Flavivirus premembrane protein may be a fusion proteiri comprising the PCPP.
  • the fusion protein may comprise the PCPP and a peptide tag, including for example, tags for peptide purification such as a histidine tag, a tandem affinity purification tag or an epitope tag.
  • tags for peptide purification such as a histidine tag, a tandem affinity purification tag or an epitope tag.
  • that fusion protein may comprise the PCPP and a fluorescent protein or bioluminescent protein.
  • the presently described peptide consisting essentially of an amino acid sequence of amino acids 76 to 92 of a Flavivirus premembrane protein excludes native full length Flavivirus premembrane protein.
  • a nucleotide sequence or peptide sequence is a "homologue" of, or is
  • nucleotide sequences or peptide sequences are considered to have substantial identity if, when optimally aligned (with gaps permitted), they share at least about 40% sequence identity, or if the sequences share defined functional motifs.
  • optimally aligned sequences may be considered to be substantially identical (i.e.
  • identity refers to sequence similarity between two peptides or two polynucleotide molecules. Identity can be determined by comparing each position in the aligned sequences. A degree of identity between amino acid sequences is a function of the number of identical or matching amino acids at positions shared by the sequences, i.e. over a specified region. Optimal alignment of sequences for comparisons of identity may be conducted using a variety of algorithms, as are known in the art, including the ClustalW program, available at clustalw.genome.ad.jp, the local homology algorithm of Smith and Waterman, 1981, Adv. Appl. Math 2: 482, the homology alignment algorithm of Needleman and Wunsch, 1970, J. Mol.
  • a variant or derivative of the PCPP refers to a PCPP that has been altered or mutated at one or more amino acids, including point, insertion or deletion mutation, but still retains the ability to penetrate a cell, as well as non-peptides and peptide mimetics which possess the ability to mimic the biological activity of the PCPP.
  • a variant or derivative therefore includes deletions, insertions and additions, including tagged polypeptides and fusion proteins; substitutions, for example conservative substitutions, site-directed mutants and allelic variants; and modifications, including peptoids having one or more non-amino acyl groups (q.v., sugar, lipid, etc.) covalently linked to the peptide and post-translational modifications.
  • conservative substitutions for example conservative substitutions, site-directed mutants and allelic variants
  • modifications including peptoids having one or more non-amino acyl groups (q.v., sugar, lipid, etc.) covalently linked to the peptide and post-translational modifications.
  • the term “conserved amino acid substitutions” or “conservative substitutions” refers to the substitution of one amino acid for another at a given location in the peptide, where the substitution can be made without substantial loss of the relevant function.
  • substitutions are made with conservative amino acid residues, i.e., residues having similar physical, biological or chemical properties.
  • substitutions of like amino acid residues can be made on the basis of relative similarity of side-chain substituents, for example, their size, charge, hydrophobicity, hydrophilicity, and the like, and such substitutions may be assayed for their effect on the function of the peptide by routine testing.
  • Conservative changes can also include the substitution of a chemically derivatised moiety for a non-derivatised residue, for example, by reaction of a functional side group of an amino acid.
  • PCPP encompasses such variants and derivatives as described herein.
  • Non-limiting representative PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence wherein:
  • Xi represents any amino acid and is preferably an amino acid with a nonpolar side chain, such as valine or leucine;
  • X 2 represents any amino acid and is preferably arginine, glutamine, asparagine, threonine, methionine, glutamic acid; -
  • X 3 represents any amino acid and is preferably an amino acid with a positively- charged polar side chain, such as arginine, or an amino acid with an uncharged polar side chain, such as threonine;
  • Xt represents cysteine or is absent
  • X 5 represents any amino acid and is preferably histidine, an amino acid with an uncharged polar side chain, such as threonine or asparagine, or an amino acid with a nonpolar side chain such as glycine;
  • X 6 represents any amino acid and is preferably an amino acid with an uncharged polar side chain, such as threonine and glutamine, or an amino acid with a positively charged side chain, such as lysine or arginine;
  • X 7 represents any amino acid and is preferably bistidine, an amino acid with a non-polar side chain, such as alanine, or an amino acid with an uncharged polar side chain, such as serine or threonine, or is absent;
  • X 8 represents any amino acid and is preferably arginine, glycine or glutamine;
  • X9 represents any amino acid and is preferably an amino acid with an electrically charged polar side chain, such as histidine or glutamic acid;
  • X 10 represents any amino acid and is preferably serine, glycine or an amino acid with a positively-charged polar side chain, such as arginine or histidine;
  • X 11 represents any represents any amino acid and is preferably an amino acid with a positively-charged polar side chain, such as arginine or lysine, or an amino acid with an uncharged polar side chain, such as serine;
  • X 12 represents any amino acid and is preferably histidine, an amino acid with an uncharged polar side chain, such as serine or threonine, or an amino acid with a negatively-charged polar side chain, such as aspartic acid or glutamic acid;
  • Xi 3 represents any amino acid and is preferably an amino acid with a positively- charged polar side chain, such as arginine or lysine.
  • PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence
  • Xi represents any amino acid and is preferably an amino acid with a nonpolar side chain, such as valine or leucine.
  • PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence
  • X 1X2YGX3X4X5X6X7X8X9X10X11RX12X13R [SEQ ID NO: 1] wherein X 2 represents any amino acid and is preferably arginine, glutamine, asparagine, threonine, methionine, glutamic acid.
  • PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence
  • PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence X1X2YGX3X4X5X6X7X8X9X10X11RX12X13R [SEQ ID NO: 1] wherein X represents cysteine or is absent.
  • PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence XiX 2 YGX 3 X 4 X 5 X 6 X 7 X 8 X9XioXi 1 RX 1 2Xi3R [SEQ ID NO: 1] wherein X 5 represents any amino acid and is preferably histidine, an amino acid with an uncharged polar side chain, such as threonine or asparagine, or an amino acid with a nonpolar side chain such as glycine.
  • PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence
  • X 6 represents any amino acid and is preferably an amino acid with an uncharged polar side chain, such as threonine and glutamine, or an amino acid with a positively charged side chain, such as lysine or arginine.
  • PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence
  • X 7 represents any amino acid and is preferably histidine, an amino acid with a non-polar side chain, such as alanine, or an amino acid with an uncharged polar side chain, such as serine or threonine, or is absent.
  • PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence
  • PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence XiX 2 YGX 3 X 4 X 5 X 6 X7X 8 X9XioXiiRXi2Xi3 [SEQ ID NO: 1] wherein X 9 represents any amino acid and is preferably an amino acid with an electrically charged polar side chain, such as histidine or glutamic acid.
  • X 10 represents any amino acid and is preferably serine, glycine or an amino acid with a positively-charged polar side chain, such as arginine or histidine.
  • PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence X1X2YGX3X4X5X6X7X8X9X10X1 iRXi 2 Xi 3 R [SEQ ID NO: 1 ] wherein X n represents any amino acid and is preferably an amino acid with a positively-charged polar side chain, such as arginine or lysine, or an amino acid with an uncharged polar side chain, such as serine.
  • PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence
  • XiX 2 YGX 3 X4X 5 X 6 X7X8X9XioXiiRXi2Xi3 [SEQ ID NO: 1] wherein X i2 represents any amino acid and is preferably histidine, an amino acid with an uncharged polar side chain, such as serine or threonine, or an amino acid with a negatively- charged polar side chain, such as aspartic acid or glutamic acid.
  • PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence
  • X 13 represents any amino acid and is preferably an amino acid with a positively-charged polar side chain, such as arginine or lysine.
  • the representative variant described above reflects consensus sequences based on sequence alignments between amino acids 76 to 92 of the premembrane protein of Flaviviruses such as West Nile Virus, Japanese Encephalitis Virus, Murray Valley Encephalitis Virus, Dengue Virus, Tick Borne Encephalitis Virus and Langat Virus.
  • the PCPP consists essentially of or consists of an amino acid sequence wherein the third amino acid in the amino acid sequence is tyrosine, the fourth amino acid in the amino acid sequence is glycine, the sixth amino acid in the amino acid sequence is cysteine, the thirteenth or the fourteenth amino acid in the amino acid sequence is arginine and the sixteenth or the seventeenth amino acid in the amino acid sequence is arginine.
  • the peptide described herein may consist essentially of or consist of the amino acid sequence of amino acids 76 to 92 of the premembrane pro tein of Flaviviruses such as West Nile Virus, Japanese Encephalitis Virus, Murray Valley Encephalitis Virus, Dengue Virus, Tick Borne Encephalitis Virus or Langat Virus.
  • the peptide described herein consists essentially of or consists of one of the following amino acid sequences:
  • VQYGRCTRTRHSKRSRR [SEQ ID NO: 6]; VNYGRCTRARH SKRSRR [SEQ ID NO: 7]; VT YGTC S QTGEHRRDKR [SEQ ID NO: 8]; VTYGTCTTTGEHRREKR [SEQ ID NO: 9]; VTYGTCNQAGEHRRDKR [SEQ ID NO: 10]; VMYGTCTQSGERRREKR [SEQ ID NO: 11]; LEYGRCGRREGSRSRRS [SEQ ID NO: 12]; and LEYGRCGRQEGSRTRRS [SEQ ID NO: 13].
  • the peptide described herein may consist essentially of or consist of the amino acid sequence of amino acids 76 to 92 of the premembrane protein of West Nile Virus, Japanese Encephalitis Virus or Murray Valley Encephalitis Virus.
  • the peptide described herein consists essentially of or consists of the amino acid sequence set forth in of any one of SEQ ID NOS: 2 to 7.
  • the PCPP described herein consists essentially of or consists of an amino acid sequence of amino acids 76 to 92 from a premembrane protein of West Nile Virus including, for example, the Sarafend strain of West Nile Virus, the Wengler strain of West Nile Virus, the New York strain of West Nile Virus or the Kunjin strain of West Nile Virus.
  • the peptide described herein is derived from the Sarafend strain of West Nile Virus.
  • the PCPP described herein consists essentially of or consists of the amino acid sequence set forth in SEQ ID NO : 2 to 5.
  • the PCPP described herein consists of or consists essentially of a variant or derivative of an amino acid sequence of amino acids 76 to 92 of a Flavivirus premembrane protein.
  • the PCPP described herein consists of or consists essentially of a variant or derivative of an amino acid sequence of amino acids 76 to 92 of a premembrane protein of a West Nile Virus including, for example, the Sarafend strain of West Nile Virus, the Wengler strain of West Nile Virus, the New York strain of West Nile Virus or the Kunjin strain of West Nile Virus.
  • the PCPP consists essentially of or consists of an amino acid sequence of amino acids 76 to 91 of Langat Virus or Tick Borne Encephalitis Virus.
  • a variant or derivative of the PCPP may comprise substitution of up to one, up to two, up to three, up to four, up to five, up to six, up to seven, up to eight, up to nine or more of the amino acids in the PCPP amino acid sequence.
  • a variant or derivative of the PCPP may comprise deletions of up to one, up to two, up to three, up to four, up to five, up to six, up to seven, up to eight, up to nine or more of the amino acids in the PCPP amino acid sequence.
  • a variant or derivative of the PCPP may comprise addition of up to one, up to two, up to three or more amino acids to the PCPP amino acid sequence.
  • a variant or derivative of the PCPP may be a peptide consisting of eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, or twenty amino acids.
  • PCPP variants and derivatives consist essentially of or consist of an amino acid sequence wherein one or more amino acid substitutions, one or more amino acid deletions or one or more amino acid additions, or any combination thereof, has been made to the amino acid sequence [SEQ ID NO: 1] as defined herein.
  • PCPP variants and derivatives consist essentially of or consist of an amino acid sequence wherein one or more substitutions and one or more deletions has been made to the amino acid sequence
  • PCPP variants and derivatives consist essentially of or consist of an amino acid sequence wherein one or more substitutions and one or more additions has been made to the amino acid sequence
  • PCPP variants and derivatives consist essentially of or consist of an amino acid sequence wherein one or more additions and one or more deletions has been made to the amino acid sequence
  • PCPP variants and derivatives consist essentially of or consist of an amino acid sequence wherein on or more substitutions, one or more additions and one or more deletions has been made to the amino acid sequence X 1 X 2 YGX 3 X 4 X 5 X 6 X 7 X8X9XioXi iRX ]2 Xi 3 R [SEQ ID NO: 1 ] as defined herein.
  • PCPP variants and derivatives may comprise a combination of any of the substitutions, deletions or additions described herein.
  • the PCPP consists essentially of or consists of an amino acid sequence comprising the amino acid sequence CG added to beginning of the amino acid sequence X ⁇ YGXsXiXsXeXvXs ⁇ ioXi.RXi ⁇ XnR [SEQ ID NO: 1] and the amino acid sequence GC added to the end of the amino acid sequence
  • the PCPP consists essentially of or consists of the amino acid sequence CGVRYGRTKTRHSRRSRRGC [SEQ ID NO: 14].
  • the PCPP consists essentially of or consists of the amino acid sequence CGVRYGRHKHRHSRRHRRGC [SEQ ID NO: 15].
  • the PCPP presently described also includes fragments thereof, either alone or contained in a fusion or chimeric protein, which retain the ability to penetrate a cell.
  • the fragment may be a truncation of the PCPP that retains the ability to penetrate a cell.
  • the fragment may be formed by truncating the amino acid sequence of the PCPP at the N-terminus or the C-terminus such that the one or more amino acid from the N-terminus or the C-terminus of the PCPP amino acid sequence is absent in the amino acid sequence of the fragment.
  • the fragment may consist of an amino acid sequence of amino acids 77 to 92, 78 to 92, 79 to 92, 80 to 92, 81 to 92, 82 to 92, 83 to 92, 84 to 92 or 85 to 92 of a Flavivirus premembrane protein.
  • the fragment may consist of an amino acid sequence of amino acids 76 to 91, 76 to 90, 76 to 89, 76 to 88, 76 to 87, 76 to 86, 76 to 85, 76 to 84 or 76 to 83 of a Flavivirus premembrane protein.
  • the fragment may be comprised of an amino acid sequence of part of the PCPP peptide in which one or more amino acids from both the N-terminus and the C- terminus of the PCPP amino acid sequence are absent.
  • the fragment may be a peptide consisting of sixteen, fifteen, fourteen, thirteen, twelve, eleven, ten, nine or eight amino acids.
  • the fragment may consist of an amino acid sequence wherein the first seven amino acids have been deleted from the amino acid sequence X1X2YGX3X4X5X6X7X8X9X10X11RX12X13 [SEQ ID NO: 1] as described herein.
  • the fragment may consist of an amino acid sequence wherein the first seven amino acids have been deleted from an amino acid sequence of amino acids 76 to 92 of a Flavivirus premembrane protein, including the premembrane protein of Flaviviruses such as West Nile Virus, Japanese Encephalitis Virus, Murray Valley Encephalitis Virus, Dengue Virus, Tick Borne Encephalitis Virus or Langat Virus.
  • the fragment may consist of an amino acid wherein the first seven amino acids have been deleted from an amino acid sequence of amino acids 76 to 92 of the premembrane protein of West Nile virus.
  • the PCPP consists essentially of or consists of the amino acid sequence KTRHSRRSRR [SEQ ID NO: 16].
  • the fragment has an amino acid sequence of amino acids 78 to 92 of a Flavivirus premembrane protein.
  • Variants, derivatives and fragments can be prepared, for example, by substituting, deleting or adding one or more amino acid residues in the amino acid sequence of PCPP, and screening for biological activity.
  • a skilled person will understand how to make such derivatives, variants or fragments, using standard molecular biology techniques and methods, described for example in Sambrook et al. ((2001) Molecular Cloning: a Laboratory Manual, 3 rd ed., Cold Spring Harbour
  • PCPP presently described may be synthesized synthetically using known peptide synthesis techniques, including chemical synthesis methods such as liquid- or solid-phase synthesis methods, including Fmoc and Boc synthesis methods.
  • the PCPP may be expressed in and purified from a cell.
  • a nucleic acid sequence encoding the PCPP may be synthesized using known techniques, including for example polymerase chain reaction (PCR), and inserted into an expression vector.
  • PCR polymerase chain reaction
  • a suitable host cell is then transfected or transformed with the expression vector and cultured to produce the PCPP, which can then be isolated and purified from the cell, using known methods including but not limited to ion exchange chromatography, affinity chromatography, high pressure liquid chromatography, reversed phase high pressure liquid chromatography, gel electrophoresis and immunoprecipitation.
  • Appropriate expression vectors are commercially available or may be synthesized using known synthesis methods. As would be understood by a skilled person, selection of a host cell will depend upon the expression vector used and a suitable host cell may include, for example, a prokaryote cell, an insect cell or a mammalian cell, including a human cell. Suitable expression vectors, host cells, methods of cell culture and methods of isolating and purifying the PCPP would be readily apparent to a skilled person.
  • the peptide is synthesized in and purified from a cell in a host animal that is transfected with a nucleic acid molecule encoding the PCPP and that expresses PCPP.
  • Methods of transfecting a cell in a host animal include, for example, use of a gene gun.
  • the PCPP is synthesized by in vitro translation methods.
  • the in vitro translation method can be conducted using a DNA template or RNA template encoding the PCPP.
  • Suitable cell-free expression systems include, for example, extracts from rabbit reticulocytes, wheat germ and
  • the PCPP presently described may also be synthesized using a combination of synthesis methods, including the methods outlined above. As would be understood by a skilled person, two or more peptides, each encoding part of the PCPP amino acid sequence, can be synthesized using different synthesis methods and combined in an appropriate manner, using methods known in the art, to form the PCPP presently described.
  • the PCPP described herein may be modified to improve or alter its stability and activity.
  • the PCPP may be modified to increase resistance to peptidases, provide selective ligation of the PCPP to particular cell receptors or to target the PCPP to particular organelles within the cell.
  • Modifications of the PCPP include for example, esterfication, glycosylation, acylation, amidation, phosphorylation,
  • the PCPP may also be modified by addition of amino acid sequences or conjugates, including for example antibodies, protein binding domains, D-form amino acids, unnatural or unusual amino acids and amino acids mimetics, and fusion peptides that target the PCPP to penetrate particular cell types or localize to particular organelles within the cell.
  • Modifications may be made at the N-terminus of the peptide, the C-terminus of the peptide or at any amino acid in the peptide and are described, for example in WO 2009/100934, US 2008/0234183 and EP 2 085 098.
  • the PCPP may also be modified by coupling to a detectable label, for example a fluorophore, including for example fluorescein isothiocyanate (FITC), to allow for detection of PCPP.
  • a detectable label for example a fluorophore, including for example fluorescein isothiocyanate (FITC)
  • FITC fluorescein isothiocyanate
  • a "detectable label” refers to any tag or label that can be detected by any means, directly or indirectly, for example by using visualizing methods, autoradiography methods, colour development methods or by affinity binding. It will be appreciated that the detectable label selected should not interfere with the ability of the PCPP to penetrate the cell.
  • the tag or label may comprise a fluorescent group, a chemiluminescent group, a radioactive group, a ligand (for example biotin), a photolabile fluorescent group, FRET substrates, a paramagnetic group, or a heavy metal complex or moiety.
  • the PCPP is coupled to a detectable label to allow monitoring of PCPP movement into and within the cell, including through bioimaging. As would be understood by a skilled person, a single PCPP may have more then one type of modification.
  • the PCPP may be modified by addition of a conjugate or amino acid sequence that targets binding of the PCPP to a particular organelle within the cell and may also be coupled with a detectable label such as a fluorophore, in order to allow organelle specific bioimaging.
  • a conjugate or amino acid sequence that targets binding of the PCPP to a particular organelle within the cell and may also be coupled with a detectable label such as a fluorophore, in order to allow organelle specific bioimaging.
  • nucleic acid molecule encoding an amino acid sequence of the presently described PCPP.
  • nucleic acid molecule encoding an amino acid sequence of the presently described PCPP.
  • nucleic acid molecule can comprise any sequence of nucleotides which can be transcribed to form an RNA molecule with a nucleotide sequence that can be translated to provide an amino acid sequence of the presently described PCPP.
  • the nucleic acid molecule may comprise the nucleotide sequence of the West Nile virus prM encoding amino acids 76 to 92 of the West Nile virus prM protein, (as described in GENBank Accession no. AY688948) , as follows:
  • the presently described PCPP may be used to transport other molecules or compounds into a cell, including molecules and compounds that do not efficiently traverse or poorly traverse the cell plasma membrane on their own.
  • a peptide/agent complex formed by complexing a peptide comprising an amino acid sequence of the PCPP described herein with an agent and use of such a peptide-agent complex in a method for delivering the agent into a cell, the method comprising contacting the cell with the peptide/agent complex.
  • the peptide of the peptide/agent complex includes any peptide
  • the peptide of the peptide/agent complex includes the presently described PCPP or any homologue, variant, derivative or fragment thereof and a peptide comprising an amino acid sequence of the presently described PCPP or any homologue, variant, derivative or fragment thereof.
  • the agent may be any agent that is desired to be delivered into a cell.
  • the agent may be any agent having a biological, diagnostic, therapeutic or preventative effect or which effects a desired biological or therapeutic result, that is to be delivered into a cell.
  • the agent may comprise, for example, a nucleic acid molecule including DNA, RNA and DNA/RNA hybrids, an siRNA, a microRNA, an shRNA, a protein, a peptide, a polypeptide, a small molecule, a pharmaceutical compound, a drug, an antibiotic, an antibody, a radioactive isotope, a protease-activable molecule or compound, a photoactivable molecule or compound, a hormone or a cellular factor.
  • the agent is an siRNA molecule.
  • the agent is a protein.
  • the agent is a nucleic acid that is to be delivered into a cell.
  • the nucleic acid molecule may be, for example, a DNA molecule, an RNA molecule, or a DNA/RNA hybrid molecule.
  • the RNA molecule may be an siRNA molecule, a microRNA molecule or an shRNA molecule.
  • an siRNA molecule is a double-stranded RNA molecule, typically 20-25 base pairs in length, that targets a specific gene and interferes with expression of that gene.
  • the agent is a nucleic acid, including an siRNA, microRNA, or shRNA molecule
  • the cell is a cell of hematopoietic origin, including a monocyte or a dendritic cell.
  • the agent is an anti-cancer drug.
  • Cancer as used herein encompasses a class of diseases in which cells exhibit abnormal cell growth and the potential to invade nearby tissues. In some forms of cancer, the abnormal cells may also spread to other locations in the body.
  • cancer include for example, breast cancer, colorectal cancer, brain cancer, prostate cancer, cervical cancer, ovarian cancer, bone cancer, skin cancer, lung cancer, pancreatic cancer, bladder cancer, gallbladder cancer, kidney cancer, esophageal cancer, Hodgkin lymphoma, non-Hodgkin lymphoma, laryngeal cancer, leukemia, multiple myeloma, oral cancer, pleural mesothelioma, small intestine cancer, testicular cancer, uterine cancer, thyroid cancer and stomach cancer.
  • anti-cancer drugs may be used for the treatment of different types of cancer.
  • the term drug is used to refer to any compound that can be administered to have a biological and/or pharmaceutical effect.
  • An anti-cancer drug may be a small molecule, a pharmaceutical compound, a biological compound for example a protein, including an antibody such as a monoclonal antibody.
  • an "anti-cancer drug” thus refers to any drug that has an anti-cancer effect on a cell, including an anti-tumour effect, such as a cytotoxic, apoptotic, anti-mitotic anti- angiogenesis or inhibition of metastasis effect.
  • the anti-cancer effect is intended to include inhibition or reduction of tumour cell growth, inhibition or reduction of carcinogenesis, killing of tumour cells, or inhibition or reduction of carcinogenic or tumourogenic properties of a cell, including a tumour cell.
  • Anti-cancer drugs are known in the art and, in different embodiments, the anti-cancer drug may be, for example, herceptin, TNP470, trastuzumab, bevacizumab, rituximab, erlotinib,daunorubicin, doxorubicin, etoposide, vinblastine, vincristine, pacitaxel, methotrexate, 5-fluorouracil, gemcitabine, arabinosylcytosine, altretamine, asparaginase, bleomycin, capecitabine, carboplatin, carmustine, BCNU, cladribine, cisplatin, cyclophosphamide, cytarabine, dacarbazine, d
  • a peptide comprising an amino acid sequence of the PCPP described herein may be complexed with an anti-cancer drug for delivery of the anti-cancer drug to a cell.
  • the peptide/agent complex comprising an amino acid sequence of the PCPP described herein complexed with an anti-cancer drug is delivered to a cell for the treatment of cancer.
  • references herein to a "peptide/agent complex” or references herein that the peptide and agent "are complexed" or form a "complex” refer to an interaction or association between the peptide and agent that is sufficiently stable to allow for the agent to associate with the peptide in order to be delivered into a cell.
  • the agent to be delivered into the cell is capable of interacting with the peptide to form a complex.
  • the agent may have a region or portion available to interact with the amino acid sequence of the peptide to form a complex.
  • the agent may form a complex with the peptide via a hydrophobic, electrostatic, hydrogen bonding, Van der Waals or covalent interaction between the agent and the amino acids of the peptide.
  • the hydrophobic, electrostatic, hydrogen bonding, Van der Waals or covalent interaction may be between various functional groups available on the agent and complementary functional groups available on the peptide.
  • the agent is a nucleic acid molecule
  • the negatively charged phosphates on the nucleic acid molecule backbone may interact with positive charges of the peptide, including the positive charges of the amino acids of the PCPP amino acid sequence present in the peptide, to form a peptide/nucleic acid complex.
  • the agent is a protein
  • the protein may contain a region on the surface of the protein that is negatively charged due to the spatial arrangement of negatively charged amino acids at the surface of the protein.
  • the protein may be designed as a fusion protein having a stretch of amino acids containing negatively charged amino acids, for example at the C-terminus of a biologically active protein or protein domain.
  • the protein may be modified with a negatively charged group or tag attached to the protein.
  • the agent is a pharmaceutically active small molecule
  • the small molecule may have negatively charged functional groups or may also be modified with a negatively charged group or tag attached to the small molecule. It will be appreciated that any modification, including by insertion or fusion of additional amino acids or by attachment of .a negatively charged tag, should be done so as to avoid or minimize interference with any biological function of the protein or biological activity of the small molecule.
  • the agent may be complexed to the peptide through the formation of a fusion molecule comprising the peptide coupled to the agent by a chemical bond, including for example, a peptide bond or a bond formed by chemical linkage.
  • the agent may be directly coupled to the peptide or the agent may be indirectly coupled to the peptide via an intervening molecule that is coupled to both the agent and the peptide.
  • an "intervening molecule” is a molecule that physically separates the agent and the peptide.
  • the intervening molecule may be provided to physically separate the peptide and agent in order to prevent or minimize interference with the biological effects and activities of the peptide, including the cell penetrating ability, and the biological effects and activities of the agent.
  • the intervening molecule may be, for example, a peptide, an amino acid, small molecule or a chemical compound.
  • the method of forming the fusion molecule will depend on the agent to be coupled to the peptide.
  • the agent is a small molecule, a pharmaceutical or a drug
  • the fusion molecule may be formed by chemical synthesis.
  • the agent is a peptide
  • the fusion molecule may be in the form of a fusion peptide comprising the peptide of the present method and the agent peptide may be expressed from a nucleic acid molecule encoding the fusion peptide.
  • any fusion molecule should be synthesized or designed so as to avoid or minimize interference with the cell penetrating ability of the peptide of the present method and interference with any biological function or activity of the agent.
  • More than one agent at a time may be complexed with the peptide in the peptide/agent complex.
  • the peptide may be complexed with more than one agent that are of the same or different type of agent.
  • each agent may be complexed to the peptide directly.
  • one or more agents may be complexed to the peptide via another agent or an intervening molecule.
  • different agents may be complexed to the peptide by the same or different manner.
  • the peptide/agent complex can be used to deliver more than one agent at time into a cell.
  • Using a combination of agents complexed with the peptide may allow, for example, for specific targeting and/or a synergistic therapeutic effect in the cell.
  • references herein to "deliver into” “delivering into”, “delivery into”, or “delivered into” a cell mean that the agent crosses the cell plasma membrane and enters into the interior of the cell from the exterior of the cell. In some embodiments, the agent becomes localised within the cell, including in the cytosol or within an organelle of the cell.
  • a skilled person can readily determine whether the agent has been delivered into the cell using known methods and techniques, including various detection methods, immunoassays and fluorescence labelling techniques. A skilled person can also readily determine whether the agent retains any biological, pharmaceutical or therapeutic function provided there exists a direct or indirect assay for that particular function within the cell.
  • the presently described PCPP enters cells through multiple cellular pathways.
  • the present inventors have observed the PCPP utilizing different cellular trafficking mechanisms of different velocities to travel into and throughout the cell.
  • the peptide may enter the cell through macropinocytosis, vesicular or endocyctic-like mechanisms.
  • the PCPP may travel through the plasma membrane in vesicles and may also travel laterally within the membrane.
  • the presently described PCPP may be trafficked inside the cell to different cellular regions and organelles through vesicular or endocytic pathways and may interact with cellular components including actin ruffles and the cytoskeleton.
  • the PCPP may localize around or enter the nucleus, including localizing in the perinuclear region of the cytoplasm.
  • PCPP may be used as a bioimaging agent, including, for example, to visualize cellular trafficking pathways in a cell.
  • Bioimaging refers to the detection and visualization of biological molecules, pathways and processes. Bioimaging can be used, for example, to detect interactions between molecules or movement of molecules within a cell.
  • cellular trafficking pathways refers the mechanisms and processes by which molecules are transported into and within a cell.
  • bioimaging requires that the molecule to be detected be coupled with a visually detectable label that can be detected by a visualization means, including, for example, a microscope.
  • a visualization means including, for example, a microscope.
  • Suitable visually detectable labels and visualization means for detecting such labels are well- known in the art and include, for example, those demonstrated in the Examples below.
  • the suitable label may be a fluorophore including, for example, fluorescein isothiocyanate (FITC).
  • the visualization means is a Total Internal Reflection Fluorescence microscope. Methods of coupling a detectable label to a molecule are well known in the art and labelled molecules can be conveniently commercially synthesized.
  • a method for visualizing a cellular trafficking pathway comprising coupling a peptide comprising an amino acid sequence of the presently described PCPP with a visually detectable label to form a labelled peptide, contacting a cell with the labelled peptide and detecting the labelled peptide.
  • the presently described PCPP exhibits antimicrobial activity, including, for example antiviral, antibacterial, antifungal or antiparasitic activity.
  • the PCPP may negatively regulate one or both of viral entry into a host cell and viral replication.
  • the PCPP may exhibit antimicrobial activity when delivered to a cell alone without any additional antimicrobial agent complexed thereto.
  • the PCPP may exhibit an. antiviral effect, either pre-infection or even in cells that have been infected with a virus, for example a Flavivirus such as West Nile virus or Dengue virus.
  • the peptide is the antimicrobial agent; that is, the antimicrobial agent is the free peptide delivered without any additional agent complexed thereto.
  • the peptide as antimicrobial agent exhibits an antiviral effect, an antibacterial effect, an antifungal effect or an antiparasitic effect, and thus the peptide as antimicrobial agent is an antiviral agent, an antibacterial agent, an antifungal agent or an antiparasitic agent.
  • the antimicrobial agent is an antiviral agent.
  • the peptide of me present method includes any peptide comprising, consisting essentially of or consisting of an amino acid sequence of PCPP as presently described, including any homologue, variant, derivative or fragment thereof.
  • delivering an antimicrobial agent to a cell refers to providing the antimicrobial agent in sufficiently close proximity to the cell such that the agent can exert its antimicrobial effects on the cell.
  • the peptide antimicrobial agent may be delivered to the cell by adding the peptide antimicrobial agent to the cell culture media.
  • the antimicrobial agent may be delivered by administering the antimicrobial agent to a subject as a pharmaceutical composition.
  • an "antimicrobial agent” refers to a compound or molecule that alters, reduces or inhibits the development, activity or replication of microbes, including for example viruses, bacteria, fungi and parasites, including altering, reducing or inhibiting the expression of microbial proteins, the function of microbial proteins or the ability of microbe particles to enter a host cell. As indicated above, even when not complexed with another molecule, the peptides as described herein may be the antimicrobial agent.
  • the antimicrobial activity of the peptide may be combined with the antimicrobial of an additional agent by formation of a peptide/agent complex as described above.
  • the peptide may be provided in a
  • one or more agents complexed with the peptide may be an antimicrobial agent such that two or more antimicrobial agents can be delivered to a cell at a time by contacting the cell with the peptide/agent complex.
  • the peptide is complexed with an antiviral siRNA, microRNA or shRNA.
  • the cell to which the antimicrobial agent is delivered may be, for example, a cell infected with a microbe, a cell requiring treatment of a microbial infection or a cell in which prevention of a microbial infection is desired.
  • a cell infected with a microbe a cell requiring treatment of a microbial infection or a cell in which prevention of a microbial infection is desired.
  • the microbe may be a bacterium, a fungus, a virus or a parasite.
  • the microbe is any virus that may have its development, activity or replication altered reduced or inhibited by the PCPP or any homologue, variant, derivative or fragment thereof.
  • a skilled person would be able to readily determine whether the PCPP alters, reduces or inhibits the development, activity or replication of a particular virus, using methods known in the art, including using techniques as described in the Examples set out herein.
  • the microbe is a Flavivirus, including, for example, a West Nile Virus or a Dengue Virus.
  • the cell is a cell infected with a Flavivirus, including, for example, a West Nile Virus or a Dengue Virus.
  • a Flavivirus including, for example, a West Nile Virus or a Dengue Virus.
  • the cell may be any type of cell to which a peptide/agent or peptide is to be delivered.
  • the cell may be a cell to which a peptide/nucleic acid complex is to be delivered.
  • the cell may be a cell type which is typically refractory to transfection using standard transfection techniques to deliver a nucleic acid.
  • the cell may be a cell of hemopoietic origin, such as a myeloid cell or a lymphoid cell.
  • the cell may be a monocyte, a macrophage, a neutrophil, a basophil, an eosinophil, an erythrocyte, a dendritic cell, a T-cell, a B-cell or an NK-cell.
  • the cell is a monocyte.
  • the cell is a dendritic cell.
  • the cell of the present method may also be within a subject with a microbial infection, a subject requiring treatment of a microbial infection, or a subject in which prevention of a microbial infection is desired.
  • the subject has a disease or disorder characterized or caused by a microbial infection.
  • the subject is a human subject.
  • the microbial infection may be a bacterial infection, a fungal infection or a viral infection.
  • the microbial infection is a viral infection, including a Flavivirus infection, including a West Nile Virus infection or a Dengue Virus infection.
  • an effective amount of the peptide may be delivered to a cell in a subject for the treatment of a microbial infection or a disease or disorder caused or characterized by a mircrobial infection.
  • an effective amount of the peptide is delivered to a cell in a subject for the treatment of a viral infection, including for treatment of a Flavivirus infection. This includes the peptide uncomplexed or complexed with an additional agent.
  • the term "effective amount” as used herein means an amount effective, at concentrations, dosages and/or periods of time necessary to achieve the desired result, for example to provide an antimicrobial effect or to treat a microbial infection or a disease or disorder caused or characterized by a microbial infection.
  • the total amount of peptide to be administered will vary, depending on several factors, including the severity and type of the microbial infection, disease or disorder, the mode of administration, and the age and health of the subject. Methods for determining an effective amount of peptide for treating a particular microbial infection or a disease or disorder caused or characterized by a microbial infection will be readily apparent to a person skilled in the art.
  • treating or “treatment of a microbial infection or a disease or disorder caused or characterized by a microbial infection or of cancer refers to an approach for obtaining beneficial or desired results, including clinical results.
  • Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of infection, disorder or disease, stabilization of the state of infection, disorder or disease, prevention of development of infection, disorder or disease, prevention of spread of infection, disorder or disease, delay or slowing of infection, disorder or disease progression, delay or slowing of infection, disorder or disease onset, amelioration or palliation of the infection, disorder or disease state, and remission, whether partial or total.
  • Treating can also mean prolonging survival of a subject beyond that expected in the absence of treatment.
  • Treating can also mean inhibiting the progression of the infection, disorder or disease, slowing the progression of the infection, disorder or disease temporarily, although in some instances, it involves halting the progression of the infection, disorder or disease permanently.
  • a "cell” as referred to herein may be any cell, including an in vitro cell, including a cell explanted from a subject, a cell in culture, or an in vivo cell within a subject.
  • the cell may be derived from any organism, for example an insect, a microorganism including a bacterium, or an animal including a mammal including a human.
  • cell refers to and includes a single cell, a plurality of cells or a population of cells where context permits, unless otherwise specified. Similarly, reference to “cells” also includes reference to a single cell where context permits, unless otherwise specified.
  • the peptide/agent complex or peptide may be formulated as an ingredient in a pharmaceutical composition.
  • the compositions may contain pharmaceutically acceptable concentrations of salt, buffering agents,
  • preservatives and various compatible carriers or diluents are preservatives and various compatible carriers or diluents.
  • the proportion and identity of the pharmaceutically acceptable carrier is dependant on a variety of factors including the chosen route of administration, compatibility with live cells and biologically active molecules such as peptides and nucleic acids, and standard pharmaceutical practice. Generally, the pharmaceutical composition will be fomiulated with components that will not significantly impair the biological properties of the peptide/agent complex or peptide.
  • Suitable vehicles and diluents are described, for example, in Remington's Pharmaceutical Sciences (Remington, The Science and Practice of Pharmacy, 21 st edition, Lippincott Williams & Wilkins, Philadelphia, PA., 2006).
  • the pharmaceutical composition presently provided may include, albeit not exclusively, a solution of the peptide/agent complex or peptide, in association with one of more pharmaceutically acceptable vehicles or diluents, and contained in buffer solutions with a suitable pH and iso-osmotic with physiological fluids.
  • Formulary (USP 24 NF19) published in 1999. Under ordinary conditions of storage and use, such pharmaceutical compositions may contain a preservative to prevent the growth of microorganisms. Alternatively, the composition may be formulated at a time sufficiently close to use, without the need for preservatives.
  • compositions may be administered to a subject in a variety of forms depending on the selected route of administration, as will be understood by those skilled in the art.
  • the composition of the invention may be administered for example, by topical application, oral administration, surgically or by injection to the desired site.
  • the composition is administered by injection (subcutaneously, intravenously, intramuscularly, etc.) directly at a desired site, for example in the vicinity of the cell into which the agent is to be delivered or in the vicinity of the microbial infection or disease or disorder caused or characterized by a microbial infection to be treated.
  • the dose of the pharmaceutical composition that is to be used depends on the particular microbial infection, disease or disorder being treated, the severity of the condition, individual patient parameters including age, physical condition, size and weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and other similar factors that are within the knowledge and expertise of the health practitioner. These factors are known to those of skill in the art and can be addressed with minimal routine experimentation.
  • compositions may be provided in a variety of dosage forms and thus, in different embodiments, the peptide/agent complexes or peptides may be administered in different dosage forms including for example pills, tablets, capsules, solutions, suspensions, creams, transdermal patches, powder and injections.
  • Conventional procedures and ingredients for preparing and administering the different dosage forms would be known to a skilled person and are described for example, in Remington's Pharmaceutical Sciences (Remington, The Science and Practice of Pharmacy, 21 st edition, Lippincott Williams & Wilkins,
  • a peptide/agent complex or peptide described herein may be administered with another compound as part of a combined therapy including a combined therapy for the treatment of an infection, disease or disorder.
  • a peptide of the present methods may be provided in combination with a known antimicrobial drug, for example a known antiviral, antibacterial, antifungal or antiparasitic drug currently in clinical use.
  • the peptide/agent complex may be provided in combination with another compound that has the same or a similar biological or therapeutic effect as the agent included in the peptide/agent complex.
  • Combined therapy may involve simultaneous or sequential administration of the compounds included in the therapy.
  • a peptide comprising an amino acid sequence of PCPP as a bioimaging agent for visualizing a cellular trafficking pathway.
  • the peptide comprising an amino acid sequence of PCPP may be used as a bioimaging agent to determine the effects of a drug on cellular trafficking pathways.
  • a peptide comprising an amino acid sequence of PCPP as an antimicrobial agent and in the manufacture of a medicament for use as a microbial agent, including for the treatment of a microbial infection or a disease characterized or caused by a microbial infection.
  • siRNA or Protein Delivery Fifty nanomolar of AlexaFluor-555- conjugated control siRNA (invitrogen) was incubated with 40 ⁇ of PCPP or
  • the cells were then rinsed once with HBSS and fixed using 4 % paraformaldehye (Merck) and stained with DAPI (Invitrogen) for 15 mins at RT.
  • the samples were mounted on glass slides using Prolong Gold (Invitrogen) and images were acquired using Nikon AlRsi confocal system and NIS Elements imaging software (Nikon). Live cell imaging was acquired using a Nikon Confocal microscope as described below.
  • Plaque Reduction-Neutralization Test For assessment of antiviral effect on virus entry, 100 plaque forming units (PFU) of WNV or DEN2 was co- incubated with 50 ⁇ or 100 ⁇ of the respective peptides at 37 °C for 1 hr before addition of the virus-peptide mixture to BHK cell grown onto 24-well plate. For assessment of antiviral effect on virus replication, 50 ⁇ or 100 ⁇ of different peptides were added to cells and incubated at 37 °C for 2 hr before addition of 100 PFU of WNV/ DEN2. The cells were infected at 37 °C for 1 hr before the mixture was removed and rinsed thrice with PBS to remove unbound viruses.
  • PFU plaque forming units
  • the RPMI medium containing 2 % FBS and 1 % carboxymethylcellulose (Sigma) was then added to each well and the cells were incubated at 37 °C for 48 hr (WNV) or 96 hr (DEN2) before staining with paraformaldehye/crystal violet solution.
  • Disk Diffusion Testing of Escherichia coli Stbl4 The nutrient agar plate was coated with a lawn of E.coli Stbl4 bacteria before placement of antibiotic disks, vancomycin , ampicillin and erythromycin. Droplets equivalent to 50 ⁇ of R9 (Positive control) and PCPP were applied. The plate was incubated overnight at 37 °C.
  • Time-lapse Confocal Live Cell Imaging Microscopy was performed on an inverted AlRsi confocal microscope (Nikon) using a Plan-Apochromat 100X 1.4 N.A, lens. All measurements of peptide uptake were performed with living, unfixed cells grown on 25 mm glass coverslips mounted onto holder. Cells were seeded at a density of 4 x 10 4 /well 1 day before the experiment and cultured in RPMI supplemented with 10 % fetal calf serum. For detection of fluorescein-labelled peptides, the 488-nm line of an argon ion laser was used as excitation light source and fluorescence was detected with a 525/50 band pass filter.
  • the 488-nm and 638-nm diode laser was used as excitation light source, respectively.
  • the fluorescence was detected respectively with a 525/50 and 700/75 band pass filter.
  • images were captured at 5 sees intervals at 30 frames per second (fps) for 15 to 20 mins.
  • Live cell bioimaging was performed at 37 °C in 5 % C0 2 microscope cage incubator system (OkoLab). The images were analyzed by NIS elements C software (64 bit, version 3, SP7/build 547) [Nikon].
  • FRAP experiments were performed with an inverted AlRsi confocal microscope (Nikon) using a Plan-Apochromat 100X 1.4 N.A. lens in 37 °C/ 5 % C0 2 microscope cage incubator system.
  • the FRAP experiment was acquired at the resolution of 512 x 512 pixels and zoom factor of 6.
  • the pinhole size was adjusted to 1 Airy unit.
  • the 488 nm laser line was used for FITC excitation and the emitted fluorescence was detected using a 525/50 nm bandpass filter.
  • FRAP experiment was started with 1 min image acquisition with 10 sees interval before the cells were subjected to photo-bleaching for 23.37 sees using 100 % 488 nm laser intensity.
  • TIRF Total Internal Reflection Fluorescence Imaging: TIRF live imaging was performed on Nikon eclipse Ti-E inverted microscope equipped with motorised TIRF illumination system and an Apo TIRF 100X Objective [NA 1.49] (Nikon). The environmental condition was maintained at 37 °C/ 5 % C0 2 in TIZ stage- top incubator system (Tokai Hit). The TIRF 488 nni and TIRF 561 nm excitation lasers were used to observe the cell entry process of PCPP in RFP (red fluorescence protein)- expressing BHK cells.
  • RFP red fluorescence protein
  • the Live cell imaging was acquired by a photometric CoolSnap HQ camera in a 2 X 2 binning mode at 400 milliseconds (ms) exposure at 10 MHz readout speed. Image analysis was performed with NIS Elements AR 3.1 software (Nikon).
  • CLUSTALW software (www.ebi.ac.uk/clustalw) was performed. As depicted in Figure 1, the positively charged region spanning from 76 th to 92 nd amino acids was highly conserved among the various strains of West Nile virus (New York, Sarafend, Wengler and Kunjin) and the closely related Japanese Encephalitis virus. The putative cell penetrating domain is also present in Dengue and other Flaviviruses, although they have fewer positively charged residues than West Nile virus.
  • WNV (Sarafend) prM gene is 501 bp ( Figure 2 A) in length and is a glycoprotein of approximately 19-21 kDa.
  • the amino acid sequence of WNV (Sarafend) pRM protein is outlined in Figure 2B.
  • the identified putative cell penetrating domain is about 51 bp in length and encodes for 17 amino acids (2.3 kDa) ( Figure 2C).
  • the cell penetrating domain was commercially synthesized as a 17 a.a. peptide (2.7 kDa) that was labelled with
  • PCPP is a novel cell penetrating biomolecule: The positive-charged nature of PCPP led to the hypothesis that this peptide from the prM protein can overcome the cellular barrier to mediate entry into the cells. To prove this postulation, time-lapse confocal microscopy was utilized to track the movement of FITC-PCPP in live BHK cells. Addition of FITC-PCPP imparted a green hue to the image while the cell remained grey as the optical sectioning demarcated the cell from the medium ( Figure 3 A).
  • PCPP is non-cytotoxic in mammalian cells: Flow cytometry of PCPP- treated BHK cells did not induce cell death as shown by the PI exclusion test ( Figure 8). When compared to oligoarginine or Petri (PCPP sequence with all the arginines substituted with alanines), PCPP shows an equivalent safety profile in cells ( ⁇ 1% PI positive cells). In contrast, cells treated with high concentration of chlorpromazine induced cell death (>90% PI positive cells). These results demonstrate that PCPP demonstrated no cytotoxicity in mammalian cells.
  • PCPP is a biomolecule that possesses the novel ability to transverse across the membranes of various cell types.
  • PCPP accumulates within the cells at a dose-dependent manner: Different concentrations of PCPP (5, 25, 50 or 100 ⁇ ) ( Figure 11) accumulated within the BH cells depending on the concentration used. At 100 ⁇ , intense peri-nuclear accumulation of PCPP was observed, thus demonstrating that higher concentrations of PCPP facilitated the accumulation of PCPP within the cells.
  • PCPP is an siRNA deliveiy tool: The cell penetrating and low cellular toxicity properties of PCPP rendered it as an attractive candidate for use in delivering biological molecules into cell.
  • AF555-labelled siRNA was co- incubated with either PCPP ( Figure 12A) or Lipofectamine 2000 ( Figure 12B) and transferred into BHK cells.
  • the strong positive charge will facilitate binding between the peptides and the negatively charged siRNA.
  • PCPP can successfully mediate the transfer of siRNA into the living cells with no visible toxicity.
  • the efficiency of transfection was relatively similar to that of the transfection of siRNA using liposome-based method (Lipofectamine 2000).
  • PCPP can deliver proteins into cells: The delivery property of PCPP can be further harnessed by co-incubation with protein molecules such as streptavidin- conjugated fluoronanogold ( ⁇ 50kDa) and fluorescent-labelled antibody ( ⁇ 250kDa). As depicted in Figure 14, PCPP can mediate entry of streptavidin (Figure 14B) and antibody molecules (Figure 14D) into the BHK cells albeit the entry efficiency of antibody is slower than streptavidin. Without being limited to any particular, theory, this may be due to molecular size or aggregation of antibodies. These experiments demonstrated that PCPP possesses intrinsic ability to bind and transfer proteins across cellular membranes. Control experiments conducted in the absence of PCPP were conducted ( Figure 14 A and 14C).
  • PCPP as a bioimaging tool: The course of studying PCPP unravelled the potential of using PCPP for visualizing trafficking pathways in a cellular environment and this potential was demonstrated in live imaging experiments captured on video. It was especially surprising to observe cellular locomotion in different velocities as tracked by resonant scanning of PCPP movement. Imaging of the locomotion of PCPP at the cell nucleus and periphery detected different movements of PCPP at different velocities. A slower speed for PCPP was observed around the nucleus as compared to the speed of PCPP travelling at the peripheral regions of the cell. Another amazing finding is the manipulation of actin ruffles for PCPP entry, a function that is yet to be known in cell- penetrating peptides.
  • PCPP movement is observed in close association with the actin network.
  • the unique function of PCPP exhibiting vesicles in different locomotion and velocities is tantalizing in cellular imaging as one can observe the whole cellular trafficking process in a multiple-directional process. This property can be further enhanced when combined with fluorescent proteins targeting organelles or cellular proteins (e.g. actin).
  • PCPP can be easily utilized as a cellular marker for trafficking during screening for drugs that induce abnormalities in cellular transport.
  • PCPP is an antiviral peptide: Several studies have previously reported the antimicrobial activity of CPPs (Nekhotiaeva et ai, 2003). To address if PCPP possesses similar bioactivity against pathogens, the PRNT assay was performed using WNV and DEN2. Two experimental designs were carried out. First experiment evaluated the effect of the PCPP on the entry of the virus by co-incubating the peptide with the virus before introduction to BHK cells. Second experiment aims to assess the antiviral effect of PCPP on virus replication by pretreating the cells with PCPP before the introduction of virus.
  • both PCPP and R9 nona-arginine [50 ⁇ and 100 ⁇ ] reduced virus plaque formation greater than 90 % when compare to the untreated virus-infected sample (positive control) and sample treated with another prM- derived peptide (Petri). This signified that PCPP has strong inhibitory effect on virus entry.
  • pretreatment of cells with PCPP exhibited a lower inhibitory effect by reducing 65 % of the plaques formed. Similar plaque reduction effect was also observed in R9-treated cells (60 %). Nonetheless, these experiments revealed that PCPP possesses antiviral activity against WNV and DEN2.
  • PCPP inhibits WNV and DEN2 through directing binding to the Flavivirus virions: Binding of PCPP to virions is demonstrated by transmission electron microscopy of immunogold-labeled PCPP and and virus-infected cells ( Figure 16).
  • PCPP is an inhibitor of Flavivirus NS3 protease: The WNV NS3 protease was used as a surrogate marker for Flavivirus protease activity (DEN2 NS3 protease is not commercially available). As depicted in Figure 17, PCPP inhibited WNV protease activity in a dose-dependent manner while Petri had no significant inhibitory activity. Both R9 and PCPP have similar IC 50 values of about 5 ⁇ , however PCPP exhibited stronger suppressive activity against NS3 protease activity at higher doses (10 ⁇ and 25 ⁇ ) than R9.
  • Figure 18 shows that NS3 protease of Dengue 2 virus (DEN2) and West Nile virus (WNV) co-localized in infected BH cells. This co-localization of NS3 protease and PCPP provides further support that PCPP can exert its inhibitory action against Flavivirus protease function.
  • DEN2 Dengue 2 virus
  • WNV West Nile virus
  • PCPP can also block DEN2 entry into BHK cells. This indicated that the antiviral properties of PCPP can be extended towards other Flaviviruses or other viruses recognised by PCPP.
  • PCPP is an antibacterial peptide: To investigate antibacterial activity, a preliminary disk diffusion test using gram negative ampicillin-resistant strain of E.coli was performed. The test indicated that PCPP has antibacterial activity towards the organism at 50 ⁇ concentration ( Figure 20).
  • PCPP was observed to be a cell penetrating peptide that can permeate BHK cell efficiently within 30 mins.
  • the entry process is a pronounced of a vesicular-endocytic pathway whereby the PCPP travelled across the membrane in vesicles and gravitated towards the nucleus.
  • surface entry of PCPP was gradual and first initiated at few spots on the plasma membrane before a more rapid uptake of the PCPP was observed across the entire membrane.
  • the fast movement of PCPP across the membrane suggested the possible involvement of lateral movement in the membrane.
  • FRAP experiments also showed that the PCPP is active and can travel into a new area within 2 mins. In most cells and at low.
  • PCPP tends to accentuate around the nucleus.
  • 3D volume rendering analysis of cell images indicated at least some PCPPs transversed across the nuclear boundary and nestled among the nuclear grooves. Such behaviour was not unexpected as nuclear localization of various CPPs has been reported (Melikov and Chernomordik, 2005). Moreover, the entry of PCPP in K562 cells was also detected in this study.
  • PCPP cell penetrating ability
  • PCPP cell type-specific. It showed the unique capability to enter various types of cells such as mammalian and insect cells without inducing cell death. These are desirable traits of PCPP which can be manipulated for delivery of biological cargoes into cells. Indeed, as demonstrated by this study, PCPP was capable of mediating the transfer of siRNA and proteins across the cellular membrane, highlighting its translational potential as a cellular delivery agent.
  • the membranes were washed in TBST buffer again for three times before immersion in enhanced chemiluminescent Supersignal West Dura Substrate working solution (Pierce Biotechnology) for 5 min. Membranes were then exposed to film (Pierce Biotechnology) for 5 min and developed by Medical X-Ray Processor 102 (Kodak, USA). For loading control, the blots above were stripped using stripping buffer (Pierce Biotechnology, USA) and reprobed using anti-actin monoclonal antibody (Millipore, USA) (1 : 1000).
  • Flow cytometry analysis For determination of the effect of post-treatment of PCPP on virus infection, BHK cells were infected with WNV and DEN2 at MOI of 1 and 25, 50 or 100 ⁇ of PCPP were added at 4 hr post- infection. The samples were fixed at 18 hr or 24 hr using 4% paraformaldehyde (Sigma) with 0.02 % Triton-X (Sigma). The virus envelope (E) protein was detected using anti-E monoclonal antibody (4G2, Millipore) and anti-mouse AlexaFluor-488 goat antibody (Invitrogen). In each case, the fluorescence of 25,000 events was analyzed.
  • E virus envelope
  • PCPP accumulates within the cells at a dose-dependent manner:
  • PCPP is a non-cytotoxic peptide that can penetrate dendritic-like or monocytic cells: This function highlights the potential to be used as a delivery agent for cells of haemopoeitic origin, which are widely known to be susceptible to lipid-based delivery and refractory to transfection.
  • PCPP is superior to commercial transfection reagent in siRNA delivery :
  • PCPP induced greater efficiency of gene knock-down compared to commercial siRNA reagent, Dharmafect. This further indicates that PCPP has the potential to be developed into an siRNA delivery platform.
  • PCPP is a novel antiviral cell penetrating peptide against Flaviviruses: These experiments provide further support to show that antiviral properties of PCPP can exert protective effect on cells after exposure to DEN2 and WNV infections. The ability of PCPP to inhibit NS3 protease is further supported by its ability to locate NS3 protease inside infected cells.
  • Herpes simplex virus type 1 tegument protein VP22 induces the stabilization and hyperacetylation of microtubules. J Virol 72, 6448- 6455.
  • Tyrosine 78 of premembrane protein is essential for assembly of West Nile virus. J Gen Virol 90, 1081-1092.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Genetics & Genomics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Public Health (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Virology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

There is presently provided a novel cell penetrating peptide consisting essentially of or consisting of an amino acid sequence of amino acids 76 to 92 of a Flavivirus premembrane protein or any homologue, derivative, variant, or fragment thereof that retains the ability to penetrate a cell. There is also provided methods comprising the novel cell penetrating peptide for delivering an agent into a cell, visualizing a cellular trafficking pathway and delivering an antimicrobial agent to a cell, as well as the use of the novel cell penetrating peptide as an antimicrobial agent.

Description

CELL PENETRATING PEPTIDE DERIVED FROM THE PREMEMBRANE PROTEIN OF FLAVIVIRUS
CROSS-REFERENCE TO RELATED APPLICATION
[0001] ' This application claims benefit of, and priority from, U.S. provisional patent application No. 61/326,119, filed on April 20, 2010, the contents of which are hereby incorporated herein by reference.
FIELD OF THE INVENTION
[0002] The present invention relates generally to a novel cell penetrating peptide, and methods comprising use of the novel peptide for delivering an agent into a cell, as a bioimaging agent, or as an antimicrobial agent.
BACKGROUND OF THE INVENTION
[0003] The cell plasma membrane is a semi-permeable phospholipid bilayer structure that regulates the entry and egress of biomolecules and chemicals into the cell. Although protein channels and carriers facilitate the trafficking of certain molecules through the hydrophobic cell membrane, such processes are highly selective and the plasma membrane constitutes an impermeable barrier against the entry of many exogenous or therapeutic molecules. In order to import such molecules into the cell, invasive techniques such as electrical pulsing and microinjection have been used to force the molecules through the cell plasma membrane (Fonseca et al, 2009). However, there are a number of problems associated with the use of such invasive methods, including cellular toxicity.
[0004] Over the years, there has.been intensive research directed to overcoming the cell plasma membrane barrier. The most prominent and promising group of compounds that have been identified are the cell penetrating peptides (CPPs). These peptides are a class of short peptides with amino acid sequences of 10 to 30 amino acids that possess the ability to traverse the cell membrane. A diverse range of CPPs have been identified ranging from positively-charged peptides to amphipathic and hydrophobic peptides. [0005] There are two main groups of identified CPPs. The first group is comprised of CPPs derived from naturally occurring proteins, including host proteins and viral proteins. Useful CPPs have been derived from the sequences of homeodomains of transcription factors and cell receptors as well as signal sequences (US 2008/0234183). Examples of naturally derived CPPs include penetratin from Antennapedia protein (DeRossi et al, 1994) and TAT from HIV (Vives et al, 1997). CPPs derived from Herpes Simplex virus (Elliot et al, 1998) and Pestivirus (Langedijk et al, 2002) have also been described.
[0006] The second group consists of peptides that are artificially synthesized or modified. This includes peptides like polyarginine (Mitchell et al, 2000, Futaki et al, 2001).
[0007] Although numerous studies have been published on the entry mechanism of CPPs, there is no consensus on the specific pathways the peptides utilize (Jones, 2008). This may be due to the differences in the experimental designs whereby different concentrations of peptides and cell types were used. Nonetheless, it has been postulated that at least some of the CPPs may manipulate multiple cellular pathways for entry into the cell (Nakase et al, 2008). Entry mechanisms may include, for example, energy- dependent endocytosis or direct translocation (Futaki et al, 2007). The use by CPPs of multiple cellular pathways to achieve cell entry is supported by the results of a recent study that focused on the cellular uptake of nona-arginine, TAT and penetratin peptides. The study showed that macropinocytosis, clathrin-mediated endocytosis and
caveolae/lipid raft-mediated endocytosis can occur concomitantly, depending on the nature of CPP and the concentration used (Duchardt, et al, 2007).
[0008] The unique ability of CPPs to transfer molecules and compounds across the plasma membrane has been widely exploited. CPPs have been used as delivery vehicles for transporting a wide variety of molecules including RNA, siRNA, DNA, antibodies, drugs and proteins into the cell (Fonseca et al, 2009, Heitz et al, 2009) and have been studied for potential therapeutic and bioimaging purposes (Kersemans et al, 2008, Fonseca et al, 2009). [0009] Several recent studies have highlighted the use of CPPs as delivery vehicles. Radiolabelled or fluorescent probes conjugated to CPPs have been found to efficiently enter cells to facilitate molecular imaging. For example, Gallazzi et al. (2003) used a fluorescent-labelled CPP-nucleic acid construct against bcl-2 for observation of over-expression of bcl-2 oncogene in tumors. Furthermore, CPPs have also been demonstrated to be useful in animal models (Heckl et al, 2003). Bioimaging of apoptosis in vivo was performed successfully in live animals using a capase-activatable form of a far-red fluorescent CPP (Maxwell et al, 2009).
[0010] Another intriguing trait of CPPs is the intrinsic antimicrobial nature found in some of these peptides. Monomeric penetratin was found to be bactericidal without causing cytotoxicity towards mammalian cells (Zhu and Shin, 2009). Another CPP, PAF26, has also been shown to exhibit fungicidal activity against Penicillium fungus (Munoz et al, 2006). In addition, the antiviral effects of polyarginine on gpl60 processing of HIV (Hallenberger et al, 1992) and of SUMO-1 heptapeptide protein transduction domain through antagonistic binding of HIV Rev protein (Roisin et al, 2003) have also been reported.
SUMMARY OF THE INVENTION
[0011] There is presently described a novel cell penetrating peptide derived from the amino acid sequence of a Flavivirus premembrane protein. The novel cell penetrating peptide described herein may be used to deliver an agent, including for example a biological molecule or therapeutic compound, into a cell and may be used as a bioimaging agent for visualizing cellular trafficking pathways. Furthermore, the novel cell penetrating peptide of the present invention exhibits antimicrobial activity and may be used for the treatment of a microbial infection or disease or disorder characterized or caused by a microbial infection.
[0012] Thus, in one aspect there is provided a cell penetrating peptide consisting essentially of or consisting of the amino acid sequence
XiX2YGX3X4X5X6X7X8X9 i0XiiR i2Xi3 [SEQ ID NO: 1] wherein:
Xi, X2 , X3, X5j Xt X Xs X Xio Xu Xn and X13j are each any amino acid;
X4 is cysteine or is absent; and
X7 is any amino acid or is absent.
[0013] In different embodiments, X] is an amino acid with a nonpolar side chain;
X2 is arginine, glutamine, asparagine, threonine, methionine or glutamic acid; X3 is an amino acid with a positively-charged polar side chain or an amino acid with an uncharged polar side chain; 4 is cysteine or is absent; X5 is histidine, an amino acid with an uncharged polar side chain or an amino acid with a nonpolar side chain; X6 is an amino acid with an uncharged polar side chain or an amino acid with a positively charged side chain; X7 is histidine, an amino acid with a non-polar side chain or an amino acid with an uncharged polar side chain, or is absent; X8 is arginine, glycine or glutamine; X9 is an amino acid with an electrically charged polar side chain; X10 is serine or glycine or an amino acid with a positively-charged polar side chain; Xu is an amino acid with a positively-charged polar side chain or an amino acid with an uncharged polar side chain; X12 is histidine, an amino acid with an uncharged polar side chain or an amino acid with a negatively-charged polar side chain; X13 is an amino acid with a positively-charged polar side chain.
[0014] In other embodiments, the cell penetrating peptide consists of seventeen amino acids, up to eighteen amino acids, up to nineteen amino acids, up to twenty amino acids, up to twenty-one amino acids, up to twenty-two amino acids, up to twenty-three amino acids, up to twenty-four amino acids, up to twenty- five amino acids, up to twenty- six amino acids, up to twenty-seven amino acids, up to twenty-eight amino acids, up to twenty nine amino acids, up to thirty amino acids, up to thirty-one amino acids, up to thirty-two amino acids, up to thirty-seven amino acids, up to forty-two amino acids, up to forty-seven amino acids, up to fifty-seven amino acids, up to sixty-seven amino acids, up to seventy-seven amino acids, up to eighty-seven amino acids, up to ninety-seven amino acids, up to one hundred and seven amino acids, up to one hundred and seventeen amino acids, up to two hundred and seventeen amino acids, up to two hundred and sixty-seven amino acids or up to five hundred and seventeen amino acids.
[0015] In one embodiment, the cell penetrating peptide consists essentially of or consists of an amino acid sequence of amino acids 76 to 92 of a Flavivirus premembrane protein. In different embodiments, the Flavivirus may be West Nile Virus, Japanese Encephalitis Virus, Murray Valley Encephalitis Virus, Dengue Virus, Tick Borne Encephalitis Virus or Langat Virus. In particular embodiments, the Flavivirus is West Nile Virus, Japanese Encephalitis Virus or Murray Valley Encephalitis Virus. I one embodiment, the Flavivirus is West Nile Virus.
[0016] In particular embodiments, the cell penetrating peptide consists essentially of or consists of a sequence set forth in any one of SEQ ID NOS: 2 to 13. In different embodiments, the cell penetrating peptide consists essentially of or consists of a sequence set forth in any one of SEQ ID NOS: 2 to 7. In particular, embodiments, the cell penetrating peptide consists essentially of or consists of a sequence set forth in any one of SEQ ID NOS: 2 to 5. In other embodiments, the cell penetrating peptide consists essentially of or consists of a sequence that shares at least 40% sequence identity with a sequence set forth in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13.
[0017] In different embodiments, the cell penetrating peptide consists essentially of or consists of an amino acid sequence comprising the amino acid sequence CG added to beginning of the amino acid sequence X1X2YGX3X4X5X6X7X8X9X1oX11RXi2 i3R [SEQ ID NO: 1] and the amino acid sequence GC added to the end of the amino acid sequence X1X2YGX3X4X5X6X7X8X9X10X11R 12X13 ' [SEQ ID NO: 1]. In particular embodiments, the cell penetrating peptide consists essentially of or consists of a sequence set forth in SEQ ID NO: 14 or SEQ ID NO: 15.
[0018] In another aspect, there is provided a cell penetrating peptide consisting essentially of or consisting of a fragment of the cell penetrating peptide described herein, the fragment consisting of at least eight amino acids. In particular embodiments, the cell penetrating peptide consists essentially of or consists of the sequence set forth in SEQ ID NO: 16.
[0019] In another aspect, there is provided a peptide/agent complex formed by complexing a peptide comprising an amino acid sequence of the cell penetrating peptide described herein with an agent.
[0020] In another aspect, there is provided a method for delivering an agent into a cell, the method comprising contacting the cell with the peptide/agent complex described herein so that the peptide/agent complex penetrates the cell.
[0021] In different embodiments, the agent may be, for example, an siRNA, a microRNA, an shRNA, a protein or a small molecule.
[0022] In another aspect, there is provided a method for visualizing a cellular trafficking pathway, the method comprising coupling a peptide comprising an amino acid sequence of the cell penetrating peptide described herein with a visually detectable label to form a labelled peptide; contacting a cell with the labelled peptide; detecting the labelled peptide.
[0023] In yet another aspect, there is provided a method for delivering an antimicrobial agent to a cell, the method comprising contacting a peptide comprising an amino acid sequence of the cell penetrating peptide described herein with the cell. In one embodiment, the method comprises administering an effective amount of the peptide for the treatment of a microbial infection or a disease or disorder caused or characterized by a microbial infection. In a particular embodiment, the antimicrobial agent is an antiviral agent.
[0024] In different embodiments, the cell of the methods described herein may be in vitro or in vivo.
[0025] In another aspect, there is provided use of a peptide comprising an amino acid sequence of the cell penetrating peptide described herein for delivering an agent into a cell. [0026] In yet another aspect, there is provided use of a peptide comprising an amino acid sequence of the cell penetrating peptide described herein in the manufacture of a medicament for delivering an agent into a cell.
[0027] In another aspect, there is provided a peptide comprising an amino acid sequence of the cell penetrating peptide described herein for delivering an agent into a cell.
[0028] In particular embodiments, the agent may be, for example, an siRNA, a microRNA, an shRNA, a protein or a small molecule. In different embodiments, the cell may be in vitro or in vivo.
[0029] In another aspect, there is provided use of a peptide comprising an amino acid sequence of the cell penetrating peptide described herein as a bioimaging agent for visualizing a cellular trafficking pathway.
[0030] In yet another aspect there is provided a peptide comprising an amino acid sequence of the cell penetrating peptide described herein for use as a bioimaging agent for visualizing a cellular trafficking pathway.
[0031 ] In another aspect, there is provided use of a peptide comprising an amino acid sequence of the cell penetrating peptide described herein as an antimicrobial agent. -<·■ <
[0032] In another aspect, there is provided use of a peptide comprising an amino acid sequence of the cell penetrating peptide described herein in the manufacture of a medicament for use as an antimicrobial agent.
[0033] In still another aspect, there is provided a peptide comprising an amino acid sequence of the cell penetrating peptide described herein for use as an antimicrobial agent.
[0034] In particular embodiments, the uses or peptide described herein are in an amount effective for the treatment of a microbial infection or a disease or disorder caused or characterized by a microbial infection. In one embodiment, the antimicrobial agent is an antiviral agent.
[0035] Other aspects and features of the present invention will become apparent to those of ordinary skill in the art upon review of the following description of specific embodiments of the invention in conjunction with the accompanying figures.
BRIEF DESCRIPTION OF THE DRAWINGS
[0036] In the figures, which illustrate, by way of example only, embodiments of the present invention:
[0037] Figure 1. Multiple sequence analysis of protein sequences of Flavivirus premembrane protein (prM). ClustalW sequence analysis of a West Nile Virus (WNV) Sarafend (Sarafend) amino acid sequence [Accession no: AY688948] [SEQ ID NO: 17]. prM protein is aligned against amino acid sequences from other Flaviviruses: WNV Wengler (Wengler) [Accession no: NC_001563] [SEQ ID NO: 18], WNV New York (New York) [Accession no: DQ211652] [SEQ ID NO: 19], Kunjin virus (Kunjin)
[Accession no: D00246] [SEQ ID NO: 20], Japanese Encephalitis virus (JEV) [Accession no: NC_001437] [SEQ ID NO: 21], Murray Valley Encephalitis virus (MVE) [Accession no: AF161266] [SEQ ID NO: 22], Dengue 1 virus (DEN 1) [Acession no: AD097104] [SEQ ID NO: 23], Dengue 2 virus (DEN2) [Accession no: NC_001474] [SEQ ID NO: 24], Dengue 3 virus (DEN3) [Accession no: NC_001475] [SEQ ID NO: 25], Dengue 4 virus (DEN4) [Accession no: NC_002640] [SEQ ID NO: 26], Langat virus (Langat) [Accession no: NC_003690] [SEQ ID NO: 27] and Tick-borne Encephalitis virus (TBE) [Accession no: NC_001672] [SEQ ID NO: 28]. The box indicates the domain from which the amino acid sequence of the presently described novel cell penetrating peptide is derived. The "*" and ":" represents highly conserved and semi-conserved amino acids respectively.
[0038] Figure 2. Nucleotide and amino acid sequence of a novel cell penetrating peptide (PCPP). (A) Complete nucleotide sequence of WNV (Sarafend) prM gene [SEQ ID NO : 29] and the nucleotide sequence of PCPP is underlined and in bold. (B) Amino acid sequence of WNV (Sarafend) prM protein [SEQ ID NO: 30] with the amino acid sequence of PCPP underlined and in bold. (C) Amino acid sequence of PCPP derived from WNV (Sarafend) [SEQ ID NO: 31] and its predicted molecular weight. (D) Design and amino acid sequence of fluorescein thiocyanate (FITC)-labelled PCPP [SEQ ID NO: 32] and its predicted molecular weight.
[0039] Figure 3. Time-lapse bioimaging of the entry of PCPP in live unfixed
BHK cells. (A) The baby hamster kidney (BHK) cells at 0 min upon addition of FITC- PCPP. (B) Entry of FITC-PCPP into BHK cells was detected at 30 mins after addition of FITC-PCPP. The entry mechanism of PCPP seemingly adopts a vesicular pattern as indicated by white arrows.
[0040] Figure 4. Single cell bioimaging of entry of PCPP in live BHK cells.
(A) The BHK cells at 0 min upon addition of FITC-PCPP. (B) Entry of FITC-PCPP into BHK cells is detected at 30 mins after addition of FITC-PCPP. The locations of PCPP are indicated by the white arrows.
[0041] Figure 5. Real-time 1 1 RF (Total Internal Reflection Fluorescence bioimaging of entry of PCPP in CeliularLight-PM (RFP)-infected BHK cells. (A)
The BHK cells expressed Red Fluorescence Protein at their plasma membranes (light grey areas in black and white image). The addition of FITC-PCPP into cells causing a green hue (bright areas in black and white image) in solution at 0 min. (B) The appearance of initiation points for PCPP entry on the surface membrane at 20 mins as indicated by white arrows. (C) Rapid entry of PCPP into the plasma membrane of cells at 30 mins resulting in change of red (light grey areas in black and white image) to yellow colouration (bright areas in black and white image), signifying colocalization of plasma membrane and PCPP.
[0042] Figure 6. 3-D volume rendering of PCPP at perinuclear region. (A) 3-
D volume rendering image of PCPP at the perinuclear region of BHK cell generated using binary algorithm from NIS Elements software. (B) Magnified view of nucleus coated with PCPP. 3-D volume rendering suggests that PCPP can enter nucleus and reside in the nuclear grooves (white arrow). [0043] Figure 7. Post-entry Fluorescence recovery after photo-bleaching
(FRAP) experiment on PCPP. FRAP was performed on BHK cells pretreated with FITC-PCPP and photobleached with laser before image acquisition. Image data is analyzed by NIS Elements software to generate the FRAP Table. The FRAP Table indicates that partial fluorescence recovery occurred approximately 2 mins after photobleaching.
[0044] Figure 8. Cellular cytotoxicity evaluation of PCPP using flow cytometry. In order to assess the level of cytotoxicity induced by PCPP, BHK cells were incubated with 100 μΜ of control alanine rich peptide [Petri] or R9 or PCPP overnight and subjected to PI exclusion sorting using flow cytometry. Cytotoxic level of chlorpromazine (100 μg/mL) was used as a positive indicator for PI staining (PI Ctrl) [>90% PI positive cells]. The PI fluorescence of 50,000 cells was acquired and no cytotoxic effect was observed for PCPP or any of the peptides (R9 and Petri) tested (<1% PI positive cells).
[0045] Figure 9. Entry of FITC-PCPP in different cell lines. (A) K562 cells,
(B) HeLa cells, (C) HEK293 cells, (D) BHK cells and (E) C6/36 cells. The FITC-labelled PCPP in treated cells except K562 cells exhibits a vesicular pattern in the cytoplasmic and perinuclear regions.
[0046] Figure 10. Entry of FITC-PCPP in human monocytic cell lines. The
K562, U937 and THP-1 cells were incubated with 5 μΜ of The FITC-PCPP (green fluorescence) at 37 °C for 30 min. The images of the live cells were acquired immediately after 30 mins using AlRsi Nikon confocal microscope. This demonstrates that PCPP can enter cell lines of monocytic origin.
[0047] Figure 11. Entry of PCPP in BHK cells at different concentration. The
BHK cells were incubated with 5, 25, 50 or 100 μΜ of The FITC-PCPP (green fluorescence) at 37°C for 30 min. The images of the live cells were acquired immediately after 30 min using AlRsi Nikon confocal microscope. This figure shows that intensity of intracellular PCPP increases as concentration increases. Accumulation of PCPP around peri-nuclear region becomes more prominent as concentration of PCPP increases. [0048] Figure 12. Delivery of AlexaFluor-555 (AF555)-siRNA usin PCPP.
(A) BHK cells were transfected with AF555-conjugated siRNA using 40 μΜ of PCPP or
(B) Lipofectamine 2000 or (C) Optimem (untreated) medium. The cells were imaged at 24 hrs post-transfection. (D-F) DIC overlay with DAPI and AF555. Experiment shows that siRNA can be delivered successfully into BHK cells using PCPP. PCPP-treated cells exhibit a punctuated vesicular distribution of siRNA as compared to Lipofectamine 2000, which displays aggregates at cytoplasmic and perinuclear regions. (G-H) Live cell imaging of BHK cells transfected with AF555-conjugated siRNA using PCPP shows efficient entry.
[0049] Figure 13. Gene knock-down of human GADPH using PCPP as delivery agent. Different PCPP concentration (Lane 1 - untreated cells, Lane 2 - 25 μΜ, Lane 3 - 50 μΜ, Lane 4 - 75 μΜ, Lane 5 - 100 μΜ and Lane 6 - Dharmafect 1 -treated cells) were used to deliver 100 nM of human GADPH siRNA in HeLa cells. The cell lysates were harvested at 72 hr post-transfection and subjected to Western
immunoblotting using anti-GADPH rabbit antibody. The blot was reprobed with anti- actin monoclonal antibody for loading control. The immunoblot shows that 75 μΜ of PCPP can induce higher level of GADPH knock-down than the commercial siRNA trasnfection reagent, Dharmfect.
[0050] Figure 14. Delivery of proteins using PCPP. BHK cells were treated with Streptavidin-conjugated AlexaFluor-488-fluoronanogold using (A) Optimem medium or (B) 50 μΜ of PCPP. BHK cells were treated with AlexaFluor-488 conjugated anti-rabbit goat antibody using Optimem medium (C) or (D) 50 μΜ of PCPP. The live cells were imaged at 4 hrs post-treatment. Experiments showed that protein molecules can be delivered successfully into BHK cells using PCPP.
[0051 ] Figure 15. Effect of PCPP on entry and replication of WNV and
DEN2. The antiviral effects of PCPP were evaluated by performing PRNT using 100 PFU of WNV or DEN2 and different concentrations (50 μΜ and 100 μΜ) of different peptides [control alanine rich peptide (Petri), R9 and PCPP]. Plaque from three independent experiments derived from untreated infected samples were normalized to 100 % and used as a comparison to treated samples. Mean ± SD was obtained from three independent experiments. Asterisk indicates p-value<0.05 calculated by Student t-test. Treatment with Petri does not have any significant antiviral effect while treatment with R9 and PCPP show significant reduction in virus plaques at both concentrations. PCPP exhibits potent activity (reduced plaques by 60-90 %) in suppressing both WNV and DEN2 entry and replication at both concentrations.
[0052] Figure 16. PCPP exerted its antiviral effect on Flavivirus entry through direct binding to Flavivirus virions. Immunogold labeling of PCPP (10 nni) of WNV and DEN2-infected BHK cells treated with 50 μΜ of FITC-PCPP indicated that FITC-PCPP can bind directly to the surface of virions. Black arrows represent FITC- PCPP that bind to virion(s) while black arrowheads indicate the unbound virions.
[0053] Figure 17. Effect of PCPP on WNV NS3 protease activity. The antiviral effect of PCPP on Flavivirus replication was assessed by measuring NS3 protease activity using in vitro fluorogenic assay. The assay was performed using serial dilutions of Petri, R9 and PCPP. The assay indicates that at 5 μΜ, R9 and PCPP reduced approximately 50 % of the WNV NS3 protease activity. Mean ± SD was obtained from three independent experiments. Asterisk indicates p-value<0.05 calculated by Student t- test.
[0054] Figure 18. Co-localization of Flavivirus NS3 protease and antiviral
PCPP. For co-localization of Flavivirus NS3 protease and PCPP, the BHK cells were infected with WNV and DEN2 at MOI of 1 and treated with 5 μΜ of FITC-PCPP (green fluorescence) at 18 hr and 24 hr post-infection, respectively. The samples were fixed and stained for NS3 protease (red fluorescence) using anti-NS3 rabbit antibody and anti- rabbit AlexaFluor-594 goat antibody. The cell nuclei were stained with DAPI (blue fluorescence). The images indicate that PCPP co-localized with NS3 protease in
/avivz us-infected BHK cells. White arrows (in black and white image) indicate the co- localization of NS3 protease and PCPP (yellow fluorescence).
[0055] Figure 19. Reduction of Flavivirus infectivity after treatment using PCPP at post-infection. To determine the antiviral effect of post-treatment of PCPP on virus infection, BH cells were infected with DEN2 (Figure 19A) and WNV (Figure 19B) at MOI of 1 and 25, 50 or 100 μΜ of PCPP were added at 4 hr post-infection. The samples were fixed at 18 hr (for WNV) or 24 hr (for DEN2), respectively and stained for E protein using anti-E 4G2 monoclonal antibody. In each case, the fluorescence of 25,000 events was analysed. Black line represents mock-infected cells, green line represents the untreated infected cells, blue line represents infected cells treated with 25 μΜ, pink line represents infected cells treated with 50 μΜ and red line represents infected cells treated with 100 μΜ. Addition of PCPP after infection reduces virus infectivity in a dose- dependent manner.
[0056] Figure 20. Antibacterial activity of PCPP. Disk Diffusion Testing of antibiotic-resistant Escherichia coli Stbl4. The nutrient agar plate was coated with a lawn of E.coli bacteria before placement of antibiotic disks, vancomycin (1), ampicillin (2) and erythromycin (3). Droplets equivalent to 50 μΜ of R9 (Positive control) (4) and PCPP (5 and 6). The plate was incubated overnight at 37 °C. As shown above, the clear halos (5-6) indicated that the PCPP prevented the growth of E.coli and henceforth, possesses antibacterial property.
DETAILED DESCRIPTION
[0057] Thus, there is presently provided a novel cell penetrating peptide derived from an amino acid sequence of a Flavivirus premembrane protein. This novel cell penetrating peptide can be used to deliver agents, such as biological molecules and therapeutic compounds, into a cell and can be used as a bioimaging agent to visualize cellular trafficking pathways. Furthermore, the novel cell penetrating peptide described herein can be used as an antimicrobial agent, for example an antiviral, antibacterial, antifungal or antiparasitic agent.
[0058] The present inventors have identified the first CPP derived from a
Flaviviridae virus. Flaviviridae is a family of viruses comprising three genera:
Flavivirus, Hepacirivirus and Pestivirus. The Flavivirus genus includes numerous viruses that cause or are associated with human disease including West Nile Virus, Japanese Encephalitis Virus, Tick Borne Encephalitis Virus, Yellow Fever Virus and Dengue Virus (EP 2 085 098).
[0059] The present inventors have surprisingly discovered that a peptide consisting of an amino acid sequence of amino acids 76 to 92 of a Flavivirus
premembrane protein is a cell penetrating peptide.
[0060] The Flavivirus premembrane protein (prM) is a structural protein involved in viral particle assembly. The amino acid sequence of the novel cell penetrating peptide described herein is derived from the furin recognition site of a Flavivirus prM protein which is cleaved by the host furin enzyme during the virus maturation process. Defective cleavage of the prM protein is associated with reduced virus infectivity (Stadler et al., 1997, Elshuber et al., 2003).
[0061] Thus, there is presently provided a novel cell penetrating peptide consisting essentially of or consisting of the amino acid sequence of amino acids 76 to 92 of a Flavivirus premembrane protein, hereinafter referred to as the premembrane cell penetrating peptide (PCPP).
[0062] Although the presently described PCPP does not share similar amino acid sequences with other known viral CPPs, it, like many CPPs, is rich in arginines and is positively charged (Kersemans et al., 2008, Fonseca et al., 2009). However, although positive residues have been shown to play an important role in mediating entry of CPPs into cells, it has been observed that non-positive residues may also play a key part in modulating the function of CPPs (Alves et al., 2008, Su et al, 2009). Without being limited to any particular theory, it appears the cell penetrating ability of the PCPP may be modulated, at least in part, by its non-positive residues. Removal of the first seven residues, VRYGRCT [SEQ ID NO: 33] of the PCPP derived from the Sarafend strain of West Nile Virus to yield a peptide with the amino acid sequence KTRHSRRSRR [SEQ ID NO: 16], resulted in drastically reduced antiviral properties even though the sequence retained one lysine and five arginine residues. It is noted that, although the antiviral properties were significantly reduced, the amino acid sequence KTRHSRRSRR [SEQ ID NO: 16] still demonstrated some antiviral activity. [0063] The amino acid sequence from amino acid 76 to amino acid 92 of the premembrane protein is highly conserved among West Nile Virus, Japanese Encephalitis Virus and Murray Valley Encephalitis Virus, and is conserved to a lesser extent, between these viruses and Dengue Virus, Tick Borne Encephalitis Virus and Langat Virus.
[0064] The premembrane protein of the Sarafend strain of the West Nile Virus (as described in NCBI accession no. AY688948) has the following amino acid sequence from amino acid 76 to amino acid 92:
VRYGRCTKTRHSRRSRR [SEQ ID NO: 2]
[0065] The premembrane protein of the Wengler strain of the West Nile Virus (as described in NCBI accession no. NC 001563) has the following amino acid sequence from amino acid 76 to amino acid 92:
VRYGRCTKTRHSRRSRR [SEQ ID NO: 3]
[0066] The premembrane protein of the New York strain of the West Nile Virus
(as described in NCBI accession no. DQ211652) has the following amino acid sequence from amino acid 76 to amino acid 92:
VRYGRCTKTRHSRRSRR [SEQ ID NO: 4]
[0067] The premembrane protein of the Kunjin strain of the West Nile Virus (as described in NCBI accession no. D00246) has the following amino acid sequence from amino acid 76 to amino acid 92:
VRYGRCTKTRHSRRSRR [SEQ ID NO: 5]
[0068] The premembrane protein of Japanese Encephalitis Virus (as described in
NCBI accession no. NC_001437) has the following amino acid sequence from amino acid 76 to amino acid 92:
VQYGRCTRTRHSKRSRR [SEQ ID NO: 6]
[0069] The premembrane protein of Murray Valley Encephalitis virus (as described in NCBI accession no. AF161266) has the following amino acid sequence from amino acid 76 to amino acid 92:
VNYGRCTRARHSKRSRR [SEQ ID NO: 7]
[0070] The premembrane protein of Dengue 1 Virus (as described in NCBI accession no. AD097104) has the following amino acid sequence from amino acid 76 to amino acid 92:
VTYGTCSQTGEHRRDKR [SEQ ID NO: 8]
[0071] The premembrane protein of Dengue 2 Virus (as described in NCBI accession no. NC_001474) has the following amino acid sequence from amino acid 76 to amino acid 92:
VTYGTCTTTGEHRREKR [SEQ ID NO: 9]
[0072] The premembrane protein of Dengue 3 Virus (as described in NCBI accession no. NC_001475) has the following amino acid sequence from amino acid 76 to amino acid 92:
VTYGTCNQAGEHRRDKR [SEQ ID NO: 10]
[0073] The premembrane protein of Dengue 4 Virus (as described in NCBI accession no. NC_002640) has the following amino acid sequence from amino acid 76 to amino acid 92:
VMYGTCTQ S GERRREKR [SEQ ID NO: 11]
[0074] The premembrane protein of Langat Virus (as described in NCBI accession no. NC_003690) has the following amino acid sequence from amino acid 76 to amino acid 92:
LEYGRCGRREGSRSRRS [SEQ ID NO: 12]
[0075] The premembrane protein of Tick-borne Encephalitis Virus (as described in NCBI accession no. NC_001672) has the following amino acid sequence from amino acid 76 to amino acid 92:
LEYGRCGRQEG SRTRRS [SEQ ID NO: 13]
[0076] Thus, the premembrane cell penetrating peptide, PCPP, described herein includes any peptide consisting essentially of or consisting of an amino acid sequence of amino acids 76 to 92 of a Flavivirus premembrane protein. It will be understood by persons skilled in the art that the PCPP presently described may encompass any homologue, derivative, variant, or fragment of the PCPP that is a cell penetrating peptide.
[0077] As used herein a "cell penetrating peptide" refers to a peptide with the ability to traverse the cell plasma membrane and enter into the interior of the cell from the exterior. Such peptides can traverse the cell plasma membrane without the use of techniques, such as electroporation or microinjection, or delivery agents, such as liposomes, to enter into the cell.
[0078] As used herein, "consists essentially of or "consisting essentially of means that the amino acid sequence includes one or more amino acids in addition to the amino acids of the described sequence, including at one or both ends of the described sequence, but that the additional amino acids do not materially affect the ability of the peptide to penetrate the cell. For example, the peptide consisting essentially of an amino acid sequence of amino acids 76 to 92 of a Flavivirus premembrane protein may alternatively have up to one, up to two, up to three, up to four, up to five, up to six, up to seven, up to eight, up to nine, up to ten , up to eleven, up to twelve, up to thirteen, up to fourteen, up to fifteen, up to twenty, up to twenty five, up to thirty, up to forty, up to fifty, up to sixty, up to seventy, up to eighty, up to ninety, up to one hundred, up to two hundred, up to two hundred and fifty, up to five hundred or more amino acids at one or both ends of the described sequence, provided that such a peptide still possesses the ability to penetrate a cell. In different embodiments, the peptide may alternatively consist of seventeen, up to eighteen, up to nineteen, up to twenty, up to twenty-one, up to twenty- two, up to twenty-three, up to twenty-four, up to twenty- five, up to twenty-six, up to twenty-seven, up to twenty-eight, up to twenty nine, up to thirty, up to thirty-one, up to thirty-two, up to thirty-seven, up to forty-two, up to forty-seven, up to fifty-seven, up to sixty-seven, up to seventy-seven, up to eighty-seven, up to ninety-seven, up to one hundred and seven, up to one hundred and seventeen, up to two hundred and seventeen, up to two hundred and sixty-seven, up to five hundred and seventeen or more amino acids.
[0079] In one embodiment, a peptide consisting essentially of an amino acid sequence of amino acids 76 to 92 of a Flavivirus premembrane protein may be a fusion proteiri comprising the PCPP. In particular embodiments, the fusion protein may comprise the PCPP and a peptide tag, including for example, tags for peptide purification such as a histidine tag, a tandem affinity purification tag or an epitope tag. In other embodiments, that fusion protein may comprise the PCPP and a fluorescent protein or bioluminescent protein.
[0080] As would be understood by a skilled person, the presently described peptide consisting essentially of an amino acid sequence of amino acids 76 to 92 of a Flavivirus premembrane protein excludes native full length Flavivirus premembrane protein.
[0081] A nucleotide sequence or peptide sequence is a "homologue" of, or is
"homologous" to, another sequence if the two sequences have substantial identity over a specified region and the functional activity of the sequences is conserved (as used herein, the term 'homologous' does not infer evolutionary relatedness). Two nucleotide sequences or peptide sequences are considered to have substantial identity if, when optimally aligned (with gaps permitted), they share at least about 40% sequence identity, or if the sequences share defined functional motifs. In alternative embodiments, optimally aligned sequences may be considered to be substantially identical (i.e. to have substantial identity) if they share at least 40 %, 41 %, 47 %, 50 %, 53 %, 55 %, 59%, 60 %, 65 %, 70 %, 75 %, 76 %, 80 %, 82 % 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99% identity over a specified region. An "unrelated" or "non-homologous" sequence shares less than 30 % identity, though preferably less than about 25 % identity, with a peptide or nucleotide of the invention over a specified region of homology. [0082] The terms "identity" and "identical" refer to sequence similarity between two peptides or two polynucleotide molecules. Identity can be determined by comparing each position in the aligned sequences. A degree of identity between amino acid sequences is a function of the number of identical or matching amino acids at positions shared by the sequences, i.e. over a specified region. Optimal alignment of sequences for comparisons of identity may be conducted using a variety of algorithms, as are known in the art, including the ClustalW program, available at clustalw.genome.ad.jp, the local homology algorithm of Smith and Waterman, 1981, Adv. Appl. Math 2: 482, the homology alignment algorithm of Needleman and Wunsch, 1970, J. Mol. Biol. 48:443, the search for similarity method of Pearson and Lipman, 1988, Proc. Natl. Acad. Set USA 85: 2444, and the computerised implementations of these algorithms (such as GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, Madison, WI, U.S.A.). Sequence identity may also be determined using the BLAST algorithm, described in Altschul et al, 1990, J. Mol. Biol. 215:403-10 (using the published default settings). Software for performing BLAST analysis may be available through the National Center for Biotechnology Information (through the internet at www.ncbi.nlm.nih.gov/).
[0083] A variant or derivative of the PCPP refers to a PCPP that has been altered or mutated at one or more amino acids, including point, insertion or deletion mutation, but still retains the ability to penetrate a cell, as well as non-peptides and peptide mimetics which possess the ability to mimic the biological activity of the PCPP.
[0084] A variant or derivative therefore includes deletions, insertions and additions, including tagged polypeptides and fusion proteins; substitutions, for example conservative substitutions, site-directed mutants and allelic variants; and modifications, including peptoids having one or more non-amino acyl groups (q.v., sugar, lipid, etc.) covalently linked to the peptide and post-translational modifications. As used herein, the term "conserved amino acid substitutions" or "conservative substitutions" refers to the substitution of one amino acid for another at a given location in the peptide, where the substitution can be made without substantial loss of the relevant function. Preferably, substitutions are made with conservative amino acid residues, i.e., residues having similar physical, biological or chemical properties. In making such changes, substitutions of like amino acid residues can be made on the basis of relative similarity of side-chain substituents, for example, their size, charge, hydrophobicity, hydrophilicity, and the like, and such substitutions may be assayed for their effect on the function of the peptide by routine testing. Conservative changes can also include the substitution of a chemically derivatised moiety for a non-derivatised residue, for example, by reaction of a functional side group of an amino acid.
[0085] As used herein "PCPP" encompasses such variants and derivatives as described herein.
[0086] Non-limiting representative PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence
Figure imgf000021_0001
wherein:
Xi represents any amino acid and is preferably an amino acid with a nonpolar side chain, such as valine or leucine;
X2 represents any amino acid and is preferably arginine, glutamine, asparagine, threonine, methionine, glutamic acid; -
X3 represents any amino acid and is preferably an amino acid with a positively- charged polar side chain, such as arginine, or an amino acid with an uncharged polar side chain, such as threonine;
Xt represents cysteine or is absent;
X5 represents any amino acid and is preferably histidine, an amino acid with an uncharged polar side chain, such as threonine or asparagine, or an amino acid with a nonpolar side chain such as glycine;
X6 represents any amino acid and is preferably an amino acid with an uncharged polar side chain, such as threonine and glutamine, or an amino acid with a positively charged side chain, such as lysine or arginine;
X7 represents any amino acid and is preferably bistidine, an amino acid with a non-polar side chain, such as alanine, or an amino acid with an uncharged polar side chain, such as serine or threonine, or is absent;
X8 represents any amino acid and is preferably arginine, glycine or glutamine;
X9 represents any amino acid and is preferably an amino acid with an electrically charged polar side chain, such as histidine or glutamic acid;
X10 represents any amino acid and is preferably serine, glycine or an amino acid with a positively-charged polar side chain, such as arginine or histidine;
X11 represents any represents any amino acid and is preferably an amino acid with a positively-charged polar side chain, such as arginine or lysine, or an amino acid with an uncharged polar side chain, such as serine;
X12 represents any amino acid and is preferably histidine, an amino acid with an uncharged polar side chain, such as serine or threonine, or an amino acid with a negatively-charged polar side chain, such as aspartic acid or glutamic acid;
Xi3 represents any amino acid and is preferably an amino acid with a positively- charged polar side chain, such as arginine or lysine.
[0088] Alternatively, PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence
X1X2YGX3X4X5X6X7X8X9X10X11RX12X13R [SEQ ID NO: 1] wherein Xi represents any amino acid and is preferably an amino acid with a nonpolar side chain, such as valine or leucine. Alternatively, PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence
X1X2YGX3X4X5X6X7X8X9X10X11RX12X13R [SEQ ID NO: 1] wherein X2 represents any amino acid and is preferably arginine, glutamine, asparagine, threonine, methionine, glutamic acid. Alternatively, PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence
X1X2YGX3X4X5X6X7X8X9XioXiiR i2Xi3R [SEQ ID NO: 1] wherein X3 represents any amino acid and is preferably an amino acid with a positively-charged polar side chain, such as arginine, or an amino acid with an uncharged polar side chain, such as threonine. Alternatively, PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence X1X2YGX3X4X5X6X7X8X9X10X11RX12X13R [SEQ ID NO: 1] wherein X represents cysteine or is absent. Alternatively, PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence XiX2YGX3X4X5X6X7X8X9XioXi1RX12Xi3R [SEQ ID NO: 1] wherein X5 represents any amino acid and is preferably histidine, an amino acid with an uncharged polar side chain, such as threonine or asparagine, or an amino acid with a nonpolar side chain such as glycine. Alternatively, PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence
X1X2YGX3X4X5X6X7X8X9XioXi iRXi2Xi3 [SEQ ID NO: 1] wherein X6 represents any amino acid and is preferably an amino acid with an uncharged polar side chain, such as threonine and glutamine, or an amino acid with a positively charged side chain, such as lysine or arginine. Alternatively, PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence
X1X2YGX3X4X5X6X7X8X9XioXiiRXi2Xi3R [SEQ ID NO: 1] wherein X7 represents any amino acid and is preferably histidine, an amino acid with a non-polar side chain, such as alanine, or an amino acid with an uncharged polar side chain, such as serine or threonine, or is absent. Alternatively, PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence
X1X2YGX3X4X5X6X7X8 9 ioXii Xi2Xi3 [SEQ ID NO: 1] wherein X8 represents any amino acid and is preferably arginine, glycine or glutamine. Alternatively, PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence XiX2YGX3X4X5X6X7X8X9XioXiiRXi2Xi3 [SEQ ID NO: 1] wherein X9 represents any amino acid and is preferably an amino acid with an electrically charged polar side chain, such as histidine or glutamic acid. Alternatively, X10 represents any amino acid and is preferably serine, glycine or an amino acid with a positively-charged polar side chain, such as arginine or histidine. Alternatively, PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence X1X2YGX3X4X5X6X7X8X9X10X1 iRXi2Xi3R [SEQ ID NO: 1 ] wherein Xn represents any amino acid and is preferably an amino acid with a positively-charged polar side chain, such as arginine or lysine, or an amino acid with an uncharged polar side chain, such as serine. Alternatively, PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence
XiX2YGX3X4X5X6X7X8X9XioXiiRXi2Xi3 [SEQ ID NO: 1] wherein Xi2 represents any amino acid and is preferably histidine, an amino acid with an uncharged polar side chain, such as serine or threonine, or an amino acid with a negatively- charged polar side chain, such as aspartic acid or glutamic acid. Alternatively, PCPP variants and derivatives include a peptide consisting essentially of or consisting of the amino acid sequence
X1X2YGX3X4X5X6X7X8X9Xi0X1iRXi2Xi3R [SEQ ID NO: 1] wherein X13 represents any amino acid and is preferably an amino acid with a positively-charged polar side chain, such as arginine or lysine.
[0089] The representative variant described above reflects consensus sequences based on sequence alignments between amino acids 76 to 92 of the premembrane protein of Flaviviruses such as West Nile Virus, Japanese Encephalitis Virus, Murray Valley Encephalitis Virus, Dengue Virus, Tick Borne Encephalitis Virus and Langat Virus.
[0090] Thus in one embodiment, the PCPP consists essentially of or consists of an amino acid sequence wherein the third amino acid in the amino acid sequence is tyrosine, the fourth amino acid in the amino acid sequence is glycine, the sixth amino acid in the amino acid sequence is cysteine, the thirteenth or the fourteenth amino acid in the amino acid sequence is arginine and the sixteenth or the seventeenth amino acid in the amino acid sequence is arginine.
[0091] In different embodiments, the peptide described herein may consist essentially of or consist of the amino acid sequence of amino acids 76 to 92 of the premembrane pro tein of Flaviviruses such as West Nile Virus, Japanese Encephalitis Virus, Murray Valley Encephalitis Virus, Dengue Virus, Tick Borne Encephalitis Virus or Langat Virus.
[0092] Thus, in various embodiments, the peptide described herein, consists essentially of or consists of one of the following amino acid sequences:
VRYGRCTKTRHSRRSRR [SEQ ID NO: 2], [SEQ ID NO: 3], [SEQ ID NO: 4], [SEQ ID NO: 5];
VQYGRCTRTRHSKRSRR [SEQ ID NO: 6]; VNYGRCTRARH SKRSRR [SEQ ID NO: 7]; VT YGTC S QTGEHRRDKR [SEQ ID NO: 8]; VTYGTCTTTGEHRREKR [SEQ ID NO: 9]; VTYGTCNQAGEHRRDKR [SEQ ID NO: 10]; VMYGTCTQSGERRREKR [SEQ ID NO: 11]; LEYGRCGRREGSRSRRS [SEQ ID NO: 12]; and LEYGRCGRQEGSRTRRS [SEQ ID NO: 13].
[0093] In particular embodiments, the peptide described herein may consist essentially of or consist of the amino acid sequence of amino acids 76 to 92 of the premembrane protein of West Nile Virus, Japanese Encephalitis Virus or Murray Valley Encephalitis Virus. Thus, in various embodiments, the peptide described herein, consists essentially of or consists of the amino acid sequence set forth in of any one of SEQ ID NOS: 2 to 7.
[0094] In one embodiment, the PCPP described herein consists essentially of or consists of an amino acid sequence of amino acids 76 to 92 from a premembrane protein of West Nile Virus including, for example, the Sarafend strain of West Nile Virus, the Wengler strain of West Nile Virus, the New York strain of West Nile Virus or the Kunjin strain of West Nile Virus. In a particular embodiment, the peptide described herein is derived from the Sarafend strain of West Nile Virus.
[0095] Thus in a particular embodiment, the PCPP described herein, consists essentially of or consists of the amino acid sequence set forth in SEQ ID NO : 2 to 5.
[0096] In one embodiment, the PCPP described herein consists of or consists essentially of a variant or derivative of an amino acid sequence of amino acids 76 to 92 of a Flavivirus premembrane protein. In different embodiments, the PCPP described herein consists of or consists essentially of a variant or derivative of an amino acid sequence of amino acids 76 to 92 of a premembrane protein of a West Nile Virus including, for example, the Sarafend strain of West Nile Virus, the Wengler strain of West Nile Virus, the New York strain of West Nile Virus or the Kunjin strain of West Nile Virus.
[0097] In other embodiments, the PCPP consists essentially of or consists of an amino acid sequence of amino acids 76 to 91 of Langat Virus or Tick Borne Encephalitis Virus.
[0098] In alternative embodiments, a variant or derivative of the PCPP may comprise substitution of up to one, up to two, up to three, up to four, up to five, up to six, up to seven, up to eight, up to nine or more of the amino acids in the PCPP amino acid sequence. In other alternative embodiments, a variant or derivative of the PCPP may comprise deletions of up to one, up to two, up to three, up to four, up to five, up to six, up to seven, up to eight, up to nine or more of the amino acids in the PCPP amino acid sequence. In other alterative embodiments, a variant or derivative of the PCPP may comprise addition of up to one, up to two, up to three or more amino acids to the PCPP amino acid sequence. Thus in different alternative embodiments, a variant or derivative of the PCPP may be a peptide consisting of eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, or twenty amino acids.
[0099] Thus in different embodiments, PCPP variants and derivatives consist essentially of or consist of an amino acid sequence wherein one or more amino acid substitutions, one or more amino acid deletions or one or more amino acid additions, or any combination thereof, has been made to the amino acid sequence
Figure imgf000027_0001
[SEQ ID NO: 1] as defined herein.
[00100] In one embodiment, PCPP variants and derivatives consist essentially of or consist of an amino acid sequence wherein one or more substitutions and one or more deletions has been made to the amino acid sequence
X1X2YGX3X4X5X6X7X8 i0Xi iR i2Xi3R [SEQ ID NO: 1] as defined herein.
[00101] In another embodiment, PCPP variants and derivatives consist essentially of or consist of an amino acid sequence wherein one or more substitutions and one or more additions has been made to the amino acid sequence
X1X2YGX3X4X5X6X7X8X XioXi1RXi2Xi3R [SEQ ID NO: 1] as defined herein.
[00102] In another embodiment, PCPP variants and derivatives consist essentially of or consist of an amino acid sequence wherein one or more additions and one or more deletions has been made to the amino acid sequence
X1X2YGX3X4X5X6X7X8X XioXiiRXi2Xi3R [SEQ ID NO: 1 ] as defined herein.
[00103] In yet another embodiment, PCPP variants and derivatives consist essentially of or consist of an amino acid sequence wherein on or more substitutions, one or more additions and one or more deletions has been made to the amino acid sequence X1X2YGX3X4X5X6X7X8X9XioXi iRX]2Xi3R [SEQ ID NO: 1 ] as defined herein.
[00104] It will be readily understood that in different embodiments, the PCPP variants and derivatives may comprise a combination of any of the substitutions, deletions or additions described herein.
[00105] In particular embodiments, the PCPP consists essentially of or consists of an amino acid sequence comprising the amino acid sequence CG added to beginning of the amino acid sequence X^YGXsXiXsXeXvXs ^ioXi.RXi^XnR [SEQ ID NO: 1] and the amino acid sequence GC added to the end of the amino acid sequence
XiX2YGX3X4X5X6X7X8X9XioXi iRXi2Xi3R [SEQ ID NO: 1].
[00106] Thus in a particular embodiment, the PCPP consists essentially of or consists of the amino acid sequence CGVRYGRTKTRHSRRSRRGC [SEQ ID NO: 14]. [00107] In another particular embodiment, the PCPP consists essentially of or consists of the amino acid sequence CGVRYGRHKHRHSRRHRRGC [SEQ ID NO: 15].
[00 08] As would be understood by a skilled person, the PCPP presently described also includes fragments thereof, either alone or contained in a fusion or chimeric protein, which retain the ability to penetrate a cell. The fragment may be a truncation of the PCPP that retains the ability to penetrate a cell. The fragment may be formed by truncating the amino acid sequence of the PCPP at the N-terminus or the C-terminus such that the one or more amino acid from the N-terminus or the C-terminus of the PCPP amino acid sequence is absent in the amino acid sequence of the fragment. In alternative particular embodiments, the fragment may consist of an amino acid sequence of amino acids 77 to 92, 78 to 92, 79 to 92, 80 to 92, 81 to 92, 82 to 92, 83 to 92, 84 to 92 or 85 to 92 of a Flavivirus premembrane protein. In other alternative embodiments, the fragment may consist of an amino acid sequence of amino acids 76 to 91, 76 to 90, 76 to 89, 76 to 88, 76 to 87, 76 to 86, 76 to 85, 76 to 84 or 76 to 83 of a Flavivirus premembrane protein. Alternatively the fragment may be comprised of an amino acid sequence of part of the PCPP peptide in which one or more amino acids from both the N-terminus and the C- terminus of the PCPP amino acid sequence are absent. In, different alternative embodiments, the fragment may be a peptide consisting of sixteen, fifteen, fourteen, thirteen, twelve, eleven, ten, nine or eight amino acids.
[00109] In one embodiment, the fragment may consist of an amino acid sequence wherein the first seven amino acids have been deleted from the amino acid sequence X1X2YGX3X4X5X6X7X8X9X10X11RX12X13 [SEQ ID NO: 1] as described herein. In particular embodiments, the fragment may consist of an amino acid sequence wherein the first seven amino acids have been deleted from an amino acid sequence of amino acids 76 to 92 of a Flavivirus premembrane protein, including the premembrane protein of Flaviviruses such as West Nile Virus, Japanese Encephalitis Virus, Murray Valley Encephalitis Virus, Dengue Virus, Tick Borne Encephalitis Virus or Langat Virus. In one embodiment, the fragment may consist of an amino acid wherein the first seven amino acids have been deleted from an amino acid sequence of amino acids 76 to 92 of the premembrane protein of West Nile virus. [00110] Thus, in one particular embodiment, the PCPP consists essentially of or consists of the amino acid sequence KTRHSRRSRR [SEQ ID NO: 16].
[00111] In another embodiment, the fragment has an amino acid sequence of amino acids 78 to 92 of a Flavivirus premembrane protein.
[00112] Variants, derivatives and fragments can be prepared, for example, by substituting, deleting or adding one or more amino acid residues in the amino acid sequence of PCPP, and screening for biological activity. A skilled person will understand how to make such derivatives, variants or fragments, using standard molecular biology techniques and methods, described for example in Sambrook et al. ((2001) Molecular Cloning: a Laboratory Manual, 3rd ed., Cold Spring Harbour
Laboratory Press), and how to test such derivatives or variants for their ability to penetrate a cell including using techniques as described in the Examples set out herein.
[00113] Methods of making the presently described PCPP will be readily apparent to a person skilled in the art. For example, the PCPP presently described may be synthesized synthetically using known peptide synthesis techniques, including chemical synthesis methods such as liquid- or solid-phase synthesis methods, including Fmoc and Boc synthesis methods.
[00114] In other embodiments, the PCPP may be expressed in and purified from a cell. For example, a nucleic acid sequence encoding the PCPP may be synthesized using known techniques, including for example polymerase chain reaction (PCR), and inserted into an expression vector. A suitable host cell is then transfected or transformed with the expression vector and cultured to produce the PCPP, which can then be isolated and purified from the cell, using known methods including but not limited to ion exchange chromatography, affinity chromatography, high pressure liquid chromatography, reversed phase high pressure liquid chromatography, gel electrophoresis and immunoprecipitation.
[00115] Appropriate expression vectors are commercially available or may be synthesized using known synthesis methods. As would be understood by a skilled person, selection of a host cell will depend upon the expression vector used and a suitable host cell may include, for example, a prokaryote cell, an insect cell or a mammalian cell, including a human cell. Suitable expression vectors, host cells, methods of cell culture and methods of isolating and purifying the PCPP would be readily apparent to a skilled person.
[00116] In another embodiment, the peptide is synthesized in and purified from a cell in a host animal that is transfected with a nucleic acid molecule encoding the PCPP and that expresses PCPP. Methods of transfecting a cell in a host animal are known in the art and include, for example, use of a gene gun.
[00117] In yet another embodiment, the PCPP is synthesized by in vitro translation methods. As would be appreciated by a person skilled in the art, depending on the cell- free expression system used, the in vitro translation method can be conducted using a DNA template or RNA template encoding the PCPP. Suitable cell-free expression systems include, for example, extracts from rabbit reticulocytes, wheat germ and
Escherichia coli.
[00118] The PCPP presently described may also be synthesized using a combination of synthesis methods, including the methods outlined above. As would be understood by a skilled person, two or more peptides, each encoding part of the PCPP amino acid sequence, can be synthesized using different synthesis methods and combined in an appropriate manner, using methods known in the art, to form the PCPP presently described.
[00119] The PCPP described herein may be modified to improve or alter its stability and activity. For example, the PCPP may be modified to increase resistance to peptidases, provide selective ligation of the PCPP to particular cell receptors or to target the PCPP to particular organelles within the cell. Modifications of the PCPP include for example, esterfication, glycosylation, acylation, amidation, phosphorylation,
biotinylation, PEGylation, lipidation, sulphonylation, insertion of cysteines, cyclization, methylation, dityrosine cross-linking, conjugation and succinylation. The PCPP may also be modified by addition of amino acid sequences or conjugates, including for example antibodies, protein binding domains, D-form amino acids, unnatural or unusual amino acids and amino acids mimetics, and fusion peptides that target the PCPP to penetrate particular cell types or localize to particular organelles within the cell. Modifications may be made at the N-terminus of the peptide, the C-terminus of the peptide or at any amino acid in the peptide and are described, for example in WO 2009/100934, US 2008/0234183 and EP 2 085 098.
[00120] The PCPP may also be modified by coupling to a detectable label, for example a fluorophore, including for example fluorescein isothiocyanate (FITC), to allow for detection of PCPP. A "detectable label" refers to any tag or label that can be detected by any means, directly or indirectly, for example by using visualizing methods, autoradiography methods, colour development methods or by affinity binding. It will be appreciated that the detectable label selected should not interfere with the ability of the PCPP to penetrate the cell. For example, the tag or label may comprise a fluorescent group, a chemiluminescent group, a radioactive group, a ligand (for example biotin), a photolabile fluorescent group, FRET substrates, a paramagnetic group, or a heavy metal complex or moiety. In certain embodiments, the PCPP is coupled to a detectable label to allow monitoring of PCPP movement into and within the cell, including through bioimaging. As would be understood by a skilled person, a single PCPP may have more then one type of modification. For example, in one embodiment, the PCPP may be modified by addition of a conjugate or amino acid sequence that targets binding of the PCPP to a particular organelle within the cell and may also be coupled with a detectable label such as a fluorophore, in order to allow organelle specific bioimaging.
[00121] There is also presently provided a nucleic acid molecule encoding an amino acid sequence of the presently described PCPP. As would be readily recognized by a skilled person, more than one nucleic acid codon can encode a particular amino acid and as such there are numerous nucleic acid sequences that can encode an amino acid sequence of the PCPP. As such the nucleic acid molecule provided herein can comprise any sequence of nucleotides which can be transcribed to form an RNA molecule with a nucleotide sequence that can be translated to provide an amino acid sequence of the presently described PCPP. [00122] In one embodiment, the nucleic acid molecule may comprise the nucleotide sequence of the West Nile virus prM encoding amino acids 76 to 92 of the West Nile virus prM protein, (as described in GENBank Accession no. AY688948) , as follows:
GTGCGCTATGGAAGATGCACAAAAACTCGGCATTCTCGCCGAAGTAGAAGG
[SEQ ID NO: 34]
[00123] Due to its cell penetrating ability, the presently described PCPP may be used to transport other molecules or compounds into a cell, including molecules and compounds that do not efficiently traverse or poorly traverse the cell plasma membrane on their own.
[00124] There is presently provided a peptide/agent complex formed by complexing a peptide comprising an amino acid sequence of the PCPP described herein with an agent and use of such a peptide-agent complex in a method for delivering the agent into a cell, the method comprising contacting the cell with the peptide/agent complex.
[00125] The peptide of the peptide/agent complex includes any peptide
comprising, consisting essentially of or consisting of an amino acid sequence of amino acids 76 to 92 of a Flavivirus premembrane protein or any homologue, variant, derivative or fragment thereof that retains the ability to penetrate a cell. Thus the peptide of the peptide/agent complex includes the presently described PCPP or any homologue, variant, derivative or fragment thereof and a peptide comprising an amino acid sequence of the presently described PCPP or any homologue, variant, derivative or fragment thereof.
[00126] The agent may be any agent that is desired to be delivered into a cell. For example, the agent may be any agent having a biological, diagnostic, therapeutic or preventative effect or which effects a desired biological or therapeutic result, that is to be delivered into a cell. The agent may comprise, for example, a nucleic acid molecule including DNA, RNA and DNA/RNA hybrids, an siRNA, a microRNA, an shRNA, a protein, a peptide, a polypeptide, a small molecule, a pharmaceutical compound, a drug, an antibiotic, an antibody, a radioactive isotope, a protease-activable molecule or compound, a photoactivable molecule or compound, a hormone or a cellular factor. In a particular embodiment, the agent is an siRNA molecule. In another, particular embodiment, the agent is a protein.
[00127] The PCPP has been demonstrated to allow delivery of nucleic acid molecules such as siRNA, microRNA or shRNA to cells, including cells that are typically difficult to transfect using standard transfection techniques, for example dendritic cells, monocytes and other cells of hematopoietic origin, including tumor cells or immortalized cell lines deriving from cells of hemopoietic origin. Thus, in one embodiment, the agent is a nucleic acid that is to be delivered into a cell. As indicated above, the nucleic acid molecule may be, for example, a DNA molecule, an RNA molecule, or a DNA/RNA hybrid molecule. In particular, the RNA molecule may be an siRNA molecule, a microRNA molecule or an shRNA molecule. As will be appreciated, an siRNA molecule is a double-stranded RNA molecule, typically 20-25 base pairs in length, that targets a specific gene and interferes with expression of that gene. In a specific embodiment, the agent is a nucleic acid, including an siRNA, microRNA, or shRNA molecule, and the cell is a cell of hematopoietic origin, including a monocyte or a dendritic cell.
[00128] In yet another embodiment, the agent is an anti-cancer drug. "Cancer" as used herein encompasses a class of diseases in which cells exhibit abnormal cell growth and the potential to invade nearby tissues. In some forms of cancer, the abnormal cells may also spread to other locations in the body. Different types of cancer include for example, breast cancer, colorectal cancer, brain cancer, prostate cancer, cervical cancer, ovarian cancer, bone cancer, skin cancer, lung cancer, pancreatic cancer, bladder cancer, gallbladder cancer, kidney cancer, esophageal cancer, Hodgkin lymphoma, non-Hodgkin lymphoma, laryngeal cancer, leukemia, multiple myeloma, oral cancer, pleural mesothelioma, small intestine cancer, testicular cancer, uterine cancer, thyroid cancer and stomach cancer.
[00129] As would be readily appreciated, different anti-cancer drugs may be used for the treatment of different types of cancer. The term drug is used to refer to any compound that can be administered to have a biological and/or pharmaceutical effect. An anti-cancer drug may be a small molecule, a pharmaceutical compound, a biological compound for example a protein, including an antibody such as a monoclonal antibody. As used herein an "anti-cancer drug" thus refers to any drug that has an anti-cancer effect on a cell, including an anti-tumour effect, such as a cytotoxic, apoptotic, anti-mitotic anti- angiogenesis or inhibition of metastasis effect. The anti-cancer effect is intended to include inhibition or reduction of tumour cell growth, inhibition or reduction of carcinogenesis, killing of tumour cells, or inhibition or reduction of carcinogenic or tumourogenic properties of a cell, including a tumour cell. Anti-cancer drugs are known in the art and, in different embodiments, the anti-cancer drug may be, for example, herceptin, TNP470, trastuzumab, bevacizumab, rituximab, erlotinib,daunorubicin, doxorubicin, etoposide, vinblastine, vincristine, pacitaxel, methotrexate, 5-fluorouracil, gemcitabine, arabinosylcytosine, altretamine, asparaginase, bleomycin, capecitabine, carboplatin, carmustine, BCNU, cladribine, cisplatin, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, actinomycin D, docetaxel, doxorubicin, doxorubicin, imatinib, doxorubicin liposomal, VP- 16, fludarabine, gemcitabine, hydroxyurea, idarubicin, ifosfamide, irinotecan, CPT-11, methotrexate, mitomycin, mitotane, mitoxantrone, topotecan, vinblastine, vincristine or vinorelbine.
[00130] Thus in one embodiment, a peptide comprising an amino acid sequence of the PCPP described herein may be complexed with an anti-cancer drug for delivery of the anti-cancer drug to a cell. In a particular embodiment, the peptide/agent complex comprising an amino acid sequence of the PCPP described herein complexed with an anti-cancer drug is delivered to a cell for the treatment of cancer.
[00131] References herein to a "peptide/agent complex" or references herein that the peptide and agent "are complexed" or form a "complex" refer to an interaction or association between the peptide and agent that is sufficiently stable to allow for the agent to associate with the peptide in order to be delivered into a cell. Thus, the agent to be delivered into the cell is capable of interacting with the peptide to form a complex. The agent may have a region or portion available to interact with the amino acid sequence of the peptide to form a complex. For example, the agent may form a complex with the peptide via a hydrophobic, electrostatic, hydrogen bonding, Van der Waals or covalent interaction between the agent and the amino acids of the peptide. In particular embodiments, the hydrophobic, electrostatic, hydrogen bonding, Van der Waals or covalent interaction may be between various functional groups available on the agent and complementary functional groups available on the peptide.
[00132] If the agent is a nucleic acid molecule, the negatively charged phosphates on the nucleic acid molecule backbone may interact with positive charges of the peptide, including the positive charges of the amino acids of the PCPP amino acid sequence present in the peptide, to form a peptide/nucleic acid complex. If the agent is a protein, the protein may contain a region on the surface of the protein that is negatively charged due to the spatial arrangement of negatively charged amino acids at the surface of the protein. The protein may be designed as a fusion protein having a stretch of amino acids containing negatively charged amino acids, for example at the C-terminus of a biologically active protein or protein domain. Alternatively, the protein may be modified with a negatively charged group or tag attached to the protein. Similarly, if the agent is a pharmaceutically active small molecule, the small molecule may have negatively charged functional groups or may also be modified with a negatively charged group or tag attached to the small molecule. It will be appreciated that any modification, including by insertion or fusion of additional amino acids or by attachment of .a negatively charged tag, should be done so as to avoid or minimize interference with any biological function of the protein or biological activity of the small molecule.
[00133] In other embodiments, the agent may be complexed to the peptide through the formation of a fusion molecule comprising the peptide coupled to the agent by a chemical bond, including for example, a peptide bond or a bond formed by chemical linkage. In the fusion molecule, the agent may be directly coupled to the peptide or the agent may be indirectly coupled to the peptide via an intervening molecule that is coupled to both the agent and the peptide. As used herein, an "intervening molecule" is a molecule that physically separates the agent and the peptide. In some embodiments, the intervening molecule may be provided to physically separate the peptide and agent in order to prevent or minimize interference with the biological effects and activities of the peptide, including the cell penetrating ability, and the biological effects and activities of the agent. The intervening molecule may be, for example, a peptide, an amino acid, small molecule or a chemical compound.
[00134] As will be readily appreciated by a skilled person, the method of forming the fusion molecule will depend on the agent to be coupled to the peptide. For example, if the agent is a small molecule, a pharmaceutical or a drug, the fusion molecule may be formed by chemical synthesis. If the agent is a peptide, the fusion molecule may be in the form of a fusion peptide comprising the peptide of the present method and the agent peptide may be expressed from a nucleic acid molecule encoding the fusion peptide. It will be appreciated that any fusion molecule should be synthesized or designed so as to avoid or minimize interference with the cell penetrating ability of the peptide of the present method and interference with any biological function or activity of the agent.
[00135] More than one agent at a time may be complexed with the peptide in the peptide/agent complex. The peptide may be complexed with more than one agent that are of the same or different type of agent. In one embodiment, each agent may be complexed to the peptide directly. In other embodiments, one or more agents may be complexed to the peptide via another agent or an intervening molecule. Furthermore, different agents may be complexed to the peptide by the same or different manner.
[00136] Thus the peptide/agent complex can be used to deliver more than one agent at time into a cell. Using a combination of agents complexed with the peptide may allow, for example, for specific targeting and/or a synergistic therapeutic effect in the cell.
[00137] References herein to "deliver into" "delivering into", "delivery into", or "delivered into" a cell, mean that the agent crosses the cell plasma membrane and enters into the interior of the cell from the exterior of the cell. In some embodiments, the agent becomes localised within the cell, including in the cytosol or within an organelle of the cell.
[00138] A skilled person can readily determine whether the agent has been delivered into the cell using known methods and techniques, including various detection methods, immunoassays and fluorescence labelling techniques. A skilled person can also readily determine whether the agent retains any biological, pharmaceutical or therapeutic function provided there exists a direct or indirect assay for that particular function within the cell.
[00139] Without being limited to any particular theory, it appears that the presently described PCPP enters cells through multiple cellular pathways. The present inventors have observed the PCPP utilizing different cellular trafficking mechanisms of different velocities to travel into and throughout the cell. For example, the peptide may enter the cell through macropinocytosis, vesicular or endocyctic-like mechanisms. The PCPP may travel through the plasma membrane in vesicles and may also travel laterally within the membrane. Furthermore, the presently described PCPP may be trafficked inside the cell to different cellular regions and organelles through vesicular or endocytic pathways and may interact with cellular components including actin ruffles and the cytoskeleton. In particular embodiments, the PCPP may localize around or enter the nucleus, including localizing in the perinuclear region of the cytoplasm.
[00140] Due to the involvement of the presently described PCPP in a variety of different cellular trafficking pathways, PCPP may be used as a bioimaging agent, including, for example, to visualize cellular trafficking pathways in a cell.
[00141] As used herein "bioimaging" refers to the detection and visualization of biological molecules, pathways and processes. Bioimaging can be used, for example, to detect interactions between molecules or movement of molecules within a cell.
[00142] As used herein "cellular trafficking pathways" refers the mechanisms and processes by which molecules are transported into and within a cell.
[00143] As would be readily apparent to a skilled person, bioimaging requires that the molecule to be detected be coupled with a visually detectable label that can be detected by a visualization means, including, for example, a microscope. Suitable visually detectable labels and visualization means for detecting such labels are well- known in the art and include, for example, those demonstrated in the Examples below. In one embodiment, the suitable label may be a fluorophore including, for example, fluorescein isothiocyanate (FITC). In another embodiment, the visualization means is a Total Internal Reflection Fluorescence microscope. Methods of coupling a detectable label to a molecule are well known in the art and labelled molecules can be conveniently commercially synthesized.
[00144] Thus there is presently provided a method for visualizing a cellular trafficking pathway, the method comprising coupling a peptide comprising an amino acid sequence of the presently described PCPP with a visually detectable label to form a labelled peptide, contacting a cell with the labelled peptide and detecting the labelled peptide.
[00145] It has also been discovered that the presently described PCPP exhibits antimicrobial activity, including, for example antiviral, antibacterial, antifungal or antiparasitic activity. For example, and without being limited to any particular theory, it appears the PCPP may negatively regulate one or both of viral entry into a host cell and viral replication. The PCPP may exhibit antimicrobial activity when delivered to a cell alone without any additional antimicrobial agent complexed thereto. For example, the PCPP may exhibit an. antiviral effect, either pre-infection or even in cells that have been infected with a virus, for example a Flavivirus such as West Nile virus or Dengue virus.
[00146] Thus there is presently provided a method for delivering an antimicrobial agent to a cell, the method comprising contacting a peptide comprising an amino acid sequence of PCPP with the cell.
[00147] Thus, in one embodiment, the peptide is the antimicrobial agent; that is, the antimicrobial agent is the free peptide delivered without any additional agent complexed thereto. In different embodiments, the peptide as antimicrobial agent exhibits an antiviral effect, an antibacterial effect, an antifungal effect or an antiparasitic effect, and thus the peptide as antimicrobial agent is an antiviral agent, an antibacterial agent, an antifungal agent or an antiparasitic agent. In a particular embodiment, the antimicrobial agent is an antiviral agent. [00148] The peptide of me present method includes any peptide comprising, consisting essentially of or consisting of an amino acid sequence of PCPP as presently described, including any homologue, variant, derivative or fragment thereof.
[00149] As used herein, "delivering an antimicrobial agent to a cell" refers to providing the antimicrobial agent in sufficiently close proximity to the cell such that the agent can exert its antimicrobial effects on the cell. In vitro, for example, the peptide antimicrobial agent may be delivered to the cell by adding the peptide antimicrobial agent to the cell culture media. In vivo, for example, the antimicrobial agent may be delivered by administering the antimicrobial agent to a subject as a pharmaceutical composition.
[00 50] As used herein an "antimicrobial agent" refers to a compound or molecule that alters, reduces or inhibits the development, activity or replication of microbes, including for example viruses, bacteria, fungi and parasites, including altering, reducing or inhibiting the expression of microbial proteins, the function of microbial proteins or the ability of microbe particles to enter a host cell. As indicated above, even when not complexed with another molecule, the peptides as described herein may be the antimicrobial agent.
[00151] In addition to the antimicrobial activity that may be exhibited by the peptide as described herein, the antimicrobial activity of the peptide may be combined with the antimicrobial of an additional agent by formation of a peptide/agent complex as described above. Thus, in one embodiment, the peptide may be provided in a
peptide/agent complex described above. In a particular embodiment, one or more agents complexed with the peptide may be an antimicrobial agent such that two or more antimicrobial agents can be delivered to a cell at a time by contacting the cell with the peptide/agent complex. In one embodiment, the peptide is complexed with an antiviral siRNA, microRNA or shRNA.
[00152] The cell to which the antimicrobial agent is delivered may be, for example, a cell infected with a microbe, a cell requiring treatment of a microbial infection or a cell in which prevention of a microbial infection is desired. In particular
embodiments, the microbe may be a bacterium, a fungus, a virus or a parasite. In one embodiment, the microbe is any virus that may have its development, activity or replication altered reduced or inhibited by the PCPP or any homologue, variant, derivative or fragment thereof. A skilled person would be able to readily determine whether the PCPP alters, reduces or inhibits the development, activity or replication of a particular virus, using methods known in the art, including using techniques as described in the Examples set out herein.
[00153] In a particular embodiment, the microbe is a Flavivirus, including, for example, a West Nile Virus or a Dengue Virus.
[00154] In a particular embodiment, the cell is a cell infected with a Flavivirus, including, for example, a West Nile Virus or a Dengue Virus.
[00155] The cell may be any type of cell to which a peptide/agent or peptide is to be delivered. In particular, the cell may be a cell to which a peptide/nucleic acid complex is to be delivered. The cell may be a cell type which is typically refractory to transfection using standard transfection techniques to deliver a nucleic acid. For example, the cell may be a cell of hemopoietic origin, such as a myeloid cell or a lymphoid cell. For example, the cell may be a monocyte, a macrophage, a neutrophil, a basophil, an eosinophil, an erythrocyte, a dendritic cell, a T-cell, a B-cell or an NK-cell. In one embodiment, the cell is a monocyte. In another embodiment, the cell is a dendritic cell.
[00156] The cell of the present method may also be within a subject with a microbial infection, a subject requiring treatment of a microbial infection, or a subject in which prevention of a microbial infection is desired. In some embodiments, the subject has a disease or disorder characterized or caused by a microbial infection. In particular embodiments, the subject is a human subject. In different embodiments, the microbial infection may be a bacterial infection, a fungal infection or a viral infection. In a particular embodiment, the microbial infection is a viral infection, including a Flavivirus infection, including a West Nile Virus infection or a Dengue Virus infection.
[00157] Thus, an effective amount of the peptide may be delivered to a cell in a subject for the treatment of a microbial infection or a disease or disorder caused or characterized by a mircrobial infection. In a particular embodiment, an effective amount of the peptide is delivered to a cell in a subject for the treatment of a viral infection, including for treatment of a Flavivirus infection. This includes the peptide uncomplexed or complexed with an additional agent.
[00158] The term "effective amount" as used herein means an amount effective, at concentrations, dosages and/or periods of time necessary to achieve the desired result, for example to provide an antimicrobial effect or to treat a microbial infection or a disease or disorder caused or characterized by a microbial infection. The total amount of peptide to be administered will vary, depending on several factors, including the severity and type of the microbial infection, disease or disorder, the mode of administration, and the age and health of the subject. Methods for determining an effective amount of peptide for treating a particular microbial infection or a disease or disorder caused or characterized by a microbial infection will be readily apparent to a person skilled in the art.
[00159] As used herein, "treating" or "treatment of a microbial infection or a disease or disorder caused or characterized by a microbial infection or of cancer refers to an approach for obtaining beneficial or desired results, including clinical results.
Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of infection, disorder or disease, stabilization of the state of infection, disorder or disease, prevention of development of infection, disorder or disease, prevention of spread of infection, disorder or disease, delay or slowing of infection, disorder or disease progression, delay or slowing of infection, disorder or disease onset, amelioration or palliation of the infection, disorder or disease state, and remission, whether partial or total. "Treating" can also mean prolonging survival of a subject beyond that expected in the absence of treatment. "Treating" can also mean inhibiting the progression of the infection, disorder or disease, slowing the progression of the infection, disorder or disease temporarily, although in some instances, it involves halting the progression of the infection, disorder or disease permanently.
[00160] A "cell" as referred to herein may be any cell, including an in vitro cell, including a cell explanted from a subject, a cell in culture, or an in vivo cell within a subject. The cell may be derived from any organism, for example an insect, a microorganism including a bacterium, or an animal including a mammal including a human.
[00161] The term "cell" as used herein refers to and includes a single cell, a plurality of cells or a population of cells where context permits, unless otherwise specified. Similarly, reference to "cells" also includes reference to a single cell where context permits, unless otherwise specified.
[00162] To aid in the administration of the peptide/agent complex or peptide of the methods described herein to a subject, the peptide/agent complex or peptide may be formulated as an ingredient in a pharmaceutical composition. The compositions may contain pharmaceutically acceptable concentrations of salt, buffering agents,
preservatives and various compatible carriers or diluents.
[00163] The proportion and identity of the pharmaceutically acceptable carrier is dependant on a variety of factors including the chosen route of administration, compatibility with live cells and biologically active molecules such as peptides and nucleic acids, and standard pharmaceutical practice. Generally, the pharmaceutical composition will be fomiulated with components that will not significantly impair the biological properties of the peptide/agent complex or peptide.
[00164] Suitable vehicles and diluents are described, for example, in Remington's Pharmaceutical Sciences (Remington, The Science and Practice of Pharmacy, 21st edition, Lippincott Williams & Wilkins, Philadelphia, PA., 2006). On this basis, the pharmaceutical composition presently provided may include, albeit not exclusively, a solution of the peptide/agent complex or peptide, in association with one of more pharmaceutically acceptable vehicles or diluents, and contained in buffer solutions with a suitable pH and iso-osmotic with physiological fluids.
[00165] It would be known to a person skilled in the art how to prepare a suitable phannaceutical- composition. Conventional procedures and ingredients for the selection and preparation of suitable formulations are described, for example, in Remington's Pharmaceutical Sciences and in The United States Pharmacopeia: The National
Formulary (USP 24 NF19) published in 1999. Under ordinary conditions of storage and use, such pharmaceutical compositions may contain a preservative to prevent the growth of microorganisms. Alternatively, the composition may be formulated at a time sufficiently close to use, without the need for preservatives.
[00166] The pharmaceutical composition may be administered to a subject in a variety of forms depending on the selected route of administration, as will be understood by those skilled in the art. The composition of the invention may be administered for example, by topical application, oral administration, surgically or by injection to the desired site.
[00167] In different embodiments, the composition is administered by injection (subcutaneously, intravenously, intramuscularly, etc.) directly at a desired site, for example in the vicinity of the cell into which the agent is to be delivered or in the vicinity of the microbial infection or disease or disorder caused or characterized by a microbial infection to be treated.
[00168] The dose of the pharmaceutical composition that is to be used depends on the particular microbial infection, disease or disorder being treated, the severity of the condition, individual patient parameters including age, physical condition, size and weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and other similar factors that are within the knowledge and expertise of the health practitioner. These factors are known to those of skill in the art and can be addressed with minimal routine experimentation.
[00169] It will be understood that pharmaceutical compositions may be provided in a variety of dosage forms and thus, in different embodiments, the peptide/agent complexes or peptides may be administered in different dosage forms including for example pills, tablets, capsules, solutions, suspensions, creams, transdermal patches, powder and injections. Conventional procedures and ingredients for preparing and administering the different dosage forms would be known to a skilled person and are described for example, in Remington's Pharmaceutical Sciences (Remington, The Science and Practice of Pharmacy, 21st edition, Lippincott Williams & Wilkins,
Philadelphia, PA., 2006).
[00170] A skilled person will understand that a peptide/agent complex or peptide described herein may be administered with another compound as part of a combined therapy including a combined therapy for the treatment of an infection, disease or disorder. For example, a peptide of the present methods may be provided in combination with a known antimicrobial drug, for example a known antiviral, antibacterial, antifungal or antiparasitic drug currently in clinical use. In another example, the peptide/agent complex may be provided in combination with another compound that has the same or a similar biological or therapeutic effect as the agent included in the peptide/agent complex. Combined therapy may involve simultaneous or sequential administration of the compounds included in the therapy.
[00171] Use of a peptide comprising an amino acid sequence of PCPP for delivering an agent into a cell and in the manufacture of medicament for delivering an agent into a cell is also contemplated. Use of a peptide comprising an amino acid sequence of PCPP as an antimicrobial agent is also contemplated.
[00172] There is also provided use of a peptide comprising an amino acid sequence of PCPP as a bioimaging agent for visualizing a cellular trafficking pathway. In particular embodiments, the peptide comprising an amino acid sequence of PCPP may be used as a bioimaging agent to determine the effects of a drug on cellular trafficking pathways.
[00173] In addition, there is also presently provided use of a peptide comprising an amino acid sequence of PCPP as an antimicrobial agent and in the manufacture of a medicament for use as a microbial agent, including for the treatment of a microbial infection or a disease characterized or caused by a microbial infection.
[00174] The present peptides, peptide/agent complexes and methods are further exemplified by way of the following non-limiting examples. EXAMPLES
[00175] EXAMPLE 1
[00176] Materials and Methods
[00177] Cells and Viruses: Baby hamster kidney (BHK)-21 [ATCC CCl-10], 293 human embryonic kidney (HEK293) [CRL-1573], K562 human leukemia (ATCC CCL- 243), HeLa human cervical carcinoma (ATCC CCL-2) cells and C6/36 Aedes albopictus (ATCC CRL- 1660) cells were grown in DMEM/F 12 (Invitrogen) or L 15 medium (Sigma) with 10 % Fetal Calf Serum (FCS). West Nile virus (Sarafend) [WNV] and Dengue 2 (New Guinea strain) were gifts from E.G. Westaway (Sir Albert Sakzewski Virus Research Centre, Australia).
[00178] Peptide Synthesis: FITC-labelled PCPP peptide was commercially synthesized by Sigma- Aldrich and purity of 95% was confirmed by high-performance liquid chromatography (HPLC). The peptide was dissolved in sterile nanopure water. Unlabelled PCPP, biotinylated PCPP, nonameric arginine (R9) (RRRRRRRRR) [SEQ ID NO: 35] and a control peptide (PCtrl) [KTRHSRRSRR] [SEQ ID NO: 16] were also commercially synthesized by Sigma.
[00179] siRNA or Protein Delivery: Fifty nanomolar of AlexaFluor-555- conjugated control siRNA (invitrogen) was incubated with 40 μΜ of PCPP or
Lipofectamine 2000 (invitrogen) in Optimem medium (Invitrogen) at room temperature (RT) for 1 hr. Control reagent was Optimem medium with siRNA only. The mixture was then transferred to BHK-21 cells seeded on 13 mm coverslips (Marienfeld GmbH) [80 % confluency] and incubated at 37 °C for 4 hrs before addition of DMEM/F 12 medium containing 10 % FCS. At 24 hrs post-transfection, the cells were rinsed twice with Hank's balanced salt solution (HBSS) and replaced with HBSS containing RNaseA (Qiagen)/Benzonase (Merck) before incubating the cells at 37 °C for 30 mins. The cells were then rinsed once with HBSS and fixed using 4 % paraformaldehye (Merck) and stained with DAPI (Invitrogen) for 15 mins at RT. The samples were mounted on glass slides using Prolong Gold (Invitrogen) and images were acquired using Nikon AlRsi confocal system and NIS Elements imaging software (Nikon). Live cell imaging was acquired using a Nikon Confocal microscope as described below.
[00180] For protein delivery, 4 micrograms of AlexaFluor-488 fluoronanogold- conjugated streptavidin (Invitrogen) or AlexaFluor-488-conjugated goat anti-rabbit antibody (Invitrogen) were incubated with 50 μΜ of biotinylated PCPP (Sigma) in 1 ml of Optimen solution at room temperature for 1 hr and transferred to the cell cultures for 4 hrs. The cells were rinsed thrice with medium and stained with Hoescht dye and/ or AlexaFluor594-conjugated wheat germ agglutinin (Invitrogen) for visualization of nuclei and plasma membrane respectively. The live cell images were acquired using Nikon confocal microscope as described below.
[00181] Baculovirus Infection: The BHK cells were seeded into 6- well plate (Nunc) to reach 80 % confluency on the next day. The cells were infected with 267 μΐ of OrganelleLight-plasma membrane, CellularLight-actin or CellularLight-tubulin
(Invitrogen) baculo viruses in 467 μΐ of PBS and incubated at RT for 4 hrs on a rocking platform (50 rpm). DMEM/F12 medium containing baculovirus enhancer was used to replace the infection solution and incubated at 37 °C for 2 hrs before replacement of fresh DMEM/F12 medium. The cells were then incubated at 37 °C for 24 hrs before seeding the infected cells onto 25 mm glass coverslips (Marienfeld GmbH). The coverslips were later transferred to live cell imaging chamber (Nikon) for live imaging experiments.
[00182] Plaque Reduction-Neutralization Test (P NT): For assessment of antiviral effect on virus entry, 100 plaque forming units (PFU) of WNV or DEN2 was co- incubated with 50 μΜ or 100 μΜ of the respective peptides at 37 °C for 1 hr before addition of the virus-peptide mixture to BHK cell grown onto 24-well plate. For assessment of antiviral effect on virus replication, 50 μΜ or 100 μΜ of different peptides were added to cells and incubated at 37 °C for 2 hr before addition of 100 PFU of WNV/ DEN2. The cells were infected at 37 °C for 1 hr before the mixture was removed and rinsed thrice with PBS to remove unbound viruses. The RPMI medium containing 2 % FBS and 1 % carboxymethylcellulose (Sigma) was then added to each well and the cells were incubated at 37 °C for 48 hr (WNV) or 96 hr (DEN2) before staining with paraformaldehye/crystal violet solution.
[00183] Disk Diffusion Testing of Escherichia coli Stbl4: The nutrient agar plate was coated with a lawn of E.coli Stbl4 bacteria before placement of antibiotic disks, vancomycin , ampicillin and erythromycin. Droplets equivalent to 50 μΜ of R9 (Positive control) and PCPP were applied. The plate was incubated overnight at 37 °C.
[00184] Time-lapse Confocal Live Cell Imaging: Microscopy was performed on an inverted AlRsi confocal microscope (Nikon) using a Plan-Apochromat 100X 1.4 N.A, lens. All measurements of peptide uptake were performed with living, unfixed cells grown on 25 mm glass coverslips mounted onto holder. Cells were seeded at a density of 4 x 104/well 1 day before the experiment and cultured in RPMI supplemented with 10 % fetal calf serum. For detection of fluorescein-labelled peptides, the 488-nm line of an argon ion laser was used as excitation light source and fluorescence was detected with a 525/50 band pass filter. For the simultaneous detection of fluorescein-labelled peptides and Alexa Fluor 555 or -594 conjugates, the 488-nm and 638-nm diode laser was used as excitation light source, respectively. The fluorescence was detected respectively with a 525/50 and 700/75 band pass filter. For resonant scanning, images were captured at 5 sees intervals at 30 frames per second (fps) for 15 to 20 mins. Live cell bioimaging was performed at 37 °C in 5 % C02 microscope cage incubator system (OkoLab). The images were analyzed by NIS elements C software (64 bit, version 3, SP7/build 547) [Nikon].
[00185] FRAP (Fluorescence recovery after photo-bleaching) experiment: The
FRAP experiments were performed with an inverted AlRsi confocal microscope (Nikon) using a Plan-Apochromat 100X 1.4 N.A. lens in 37 °C/ 5 % C02 microscope cage incubator system. The FRAP experiment was acquired at the resolution of 512 x 512 pixels and zoom factor of 6. The pinhole size was adjusted to 1 Airy unit. The 488 nm laser line was used for FITC excitation and the emitted fluorescence was detected using a 525/50 nm bandpass filter. FRAP experiment was started with 1 min image acquisition with 10 sees interval before the cells were subjected to photo-bleaching for 23.37 sees using 100 % 488 nm laser intensity. Subsequent image capturing was performed at 10 sees intervals for 20 mins at 1 fps. The bleaching region of interest, (ROI) was placed onto the largest cytoplasmic region of the cell and the data were acquired alongside with a control square ROI at close proximity to the cell to detect the basal fluorescence bleaching. Image data were analysed using NIS elements C software to generate relative molecule diffusion rate.
[00186] TIRF (Total Internal Reflection Fluorescence) Imaging: TIRF live imaging was performed on Nikon eclipse Ti-E inverted microscope equipped with motorised TIRF illumination system and an Apo TIRF 100X Objective [NA 1.49] (Nikon). The environmental condition was maintained at 37 °C/ 5 % C02 in TIZ stage- top incubator system (Tokai Hit). The TIRF 488 nni and TIRF 561 nm excitation lasers were used to observe the cell entry process of PCPP in RFP (red fluorescence protein)- expressing BHK cells. The Live cell imaging was acquired by a photometric CoolSnap HQ camera in a 2 X 2 binning mode at 400 milliseconds (ms) exposure at 10 MHz readout speed. Image analysis was performed with NIS Elements AR 3.1 software (Nikon).
[00187] Results
[00188] Discovery of prM-derived cell penetrating peptide: The PCPP was discovered based on a postulation about the unusually arginine rich sequence of its furin recognition site. The positively-charged nature of the region bears a resemblance to known peptides that permeate cell membranes known as cell penetrating peptides (CPP). Cell penetrating peptides such as nonameric arginine (R9) are known to transverse across the cellular barriers in a wide variety of cells and have been widely exploited as a delivery agent for nucleic acids and other biological cargoes (Morris et al., 2008, Veldhoen et al., 2008). To analyze the arginine-rich region of the prM protein, sequence comparison analysis of prM protein sequences from different Flaviviruses using
CLUSTALW software (www.ebi.ac.uk/clustalw) was performed. As depicted in Figure 1, the positively charged region spanning from 76th to 92nd amino acids was highly conserved among the various strains of West Nile virus (New York, Sarafend, Wengler and Kunjin) and the closely related Japanese Encephalitis virus. The putative cell penetrating domain is also present in Dengue and other Flaviviruses, although they have fewer positively charged residues than West Nile virus.
[00189] Design of PCPP domain for biological investigation: WNV (Sarafend) prM gene is 501 bp (Figure 2 A) in length and is a glycoprotein of approximately 19-21 kDa. The amino acid sequence of WNV (Sarafend) pRM protein is outlined in Figure 2B. The identified putative cell penetrating domain is about 51 bp in length and encodes for 17 amino acids (2.3 kDa) (Figure 2C). To further explore the possibility of the predicted cell penetrating domain of prM protein, the cell penetrating domain was commercially synthesized as a 17 a.a. peptide (2.7 kDa) that was labelled with
fluorescein at the N-terminus (Figure 2D). This construct (FITC-PCPP) was used in this study to prove the cell penetrating properties and applications of PCPP.
[00190] PCPP is a novel cell penetrating biomolecule: The positive-charged nature of PCPP led to the hypothesis that this peptide from the prM protein can overcome the cellular barrier to mediate entry into the cells. To prove this postulation, time-lapse confocal microscopy was utilized to track the movement of FITC-PCPP in live BHK cells. Addition of FITC-PCPP imparted a green hue to the image while the cell remained grey as the optical sectioning demarcated the cell from the medium (Figure 3 A). Over time, gradual entry of FITC-PCPP was observed and the trafficking of FITC-PCPP inside BHK cell closely resembled a vesicular or endocytic pathway (indicated by white arrows, Figure 3B). Such process took 30 mins.to achieve significant entry of the PCPP.
[00191] To further illustrate the internalization of PCPP, single cell time-lapse bioimaging was carried out in FITC-PCPP treated BHK cells. As displayed in Figure 4 A and Figure 4B, entry of PCPP adopted an endocytic-like mechanism to permeate the cell membrane and seemingly transverse across the cytosol to accumulate at the perinuclear region of the cell. The movement of FITC-PCPP from medium to perinuclear region was fast and readily achieved within 30 mins (Figure 4B). This confirmed that PCPP is a cell penetrating peptide.
[00192] Surface entry of PCPP: The above studies presented convincing evidence on the cell penetrating properties of PCPP. To visualize the entry process at the surface of the cell, TIRF microscopy was performed in BHK cells expressing RFP at the plasma membrane (Myristoylation/palmitoylation sequence from Lck tyrosine kinase). As presented in Figure 5A, addition of FITC-PCPP induced a green hue (bright areas in black and white image) over the medium as observed in time-lapse microscopy (Figure 3). Various points of contact between the plasma membrane and the peptide were detected at 20 mins, as indicated by the white arrows (Figure 5B). This step was followed by a rapid intake of the peptide at 30 mins, whereby the entire cell membrane was illuminated in yellow (bright areas in black and white image), signifying significant co-localization between the membrane and peptide (Figure 5C). Collectively, live imaging studies verified that the PCPP can ingress into cells in both surface and lateral directions in a highly efficient process.
[00193] Nuclear entry of PCPP: In some experiments, nuclear entry of PCPP was recorded albeit this phenomenon was more pronounced in cells treated with higher concentration of FITC-PCPP (>30 μΜ). To further clarify this observation, live cell imaging was repeated using cells pretreated with Hoescht 33342 (for nuclei staining). These experiments indicated that the peptides were aggregated at the periphery of the nuclei after entry and some peptides appeared to be inside the nucleus. However, co- localization between the peptide and nucleus was not obvious and thus, this propelled the use of computer modelling of the 3D volume image of the Z-stack images acquired from the live cell imaging using binary algorithm (Figure 6A). The generated image provided a high resolution image dissection of the nucleus and suggested that some of the peptides were indeed nestled within the grooves of the nucleus (indicated by the white arrow) (Figure 6B).
[00194] Dynamics of cellular movement of PCPP: To further explore the dynamics of PCPP movement in cells, FRAP experiments were carried out after BH cells were exposed to FITC-PCPP. The laser photobleaching was initiated at a specified region of interest (ROI) of the cell concurrently with another ROI in the medium. This was to normalize the data against background fluorescence loss due to spontaneous photobleaching. The return of fluorescence, representing the cellular ingression of FITC- PCPP from the vicinity into the bleach zone was measured by the NIS elements software and the obtained statistics were plotted to generate the Table provided in Figure 7. The FRAP experiments showed that recovery of PCPP took about only 2 minutes to occur although the recovery of fluorescence was partial.
[00195] PCPP is non-cytotoxic in mammalian cells: Flow cytometry of PCPP- treated BHK cells did not induce cell death as shown by the PI exclusion test (Figure 8). When compared to oligoarginine or Petri (PCPP sequence with all the arginines substituted with alanines), PCPP shows an equivalent safety profile in cells (<1% PI positive cells). In contrast, cells treated with high concentration of chlorpromazine induced cell death (>90% PI positive cells). These results demonstrate that PCPP demonstrated no cytotoxicity in mammalian cells.
[00196] Entry of PCPP in various cell types: In order to investigate if PCPP could permeate various cell types, human (Figure 9A-K562, Figure 9B-HeLa and Figure 9C- HEK293), animal (Figure 9D-BHK) and insect (Figure 9E-C6/36)] cell lines were treated with 10 μΜ of PCPP and imaged live using confocal microscopy. As shown in Figure 9, FITC-PCPP entered the cells and accentuated around the perinuclear region in a punctuated and vesicular distribution. In addition, nuclear localization of PCPP was also observed in K562 cells. The opaque cytoplasmic fluorescence was attributed to the focus deviation caused by the non-adherence nature of K562 suspension cells, which explained the "absence" of vesicular staining. Although nuclear entry of PCPP was detected in other cell types in some experiments, the factors influencing the nuclear localization of PCPP is poorly understood. This experiment demonstrated that PCPP is a biomolecule that possesses the novel ability to transverse across the membranes of various cell types.
[00197] Entry of PCPP in monocytic cells: Live cell imaging showed that FITC- PCPP entered K562 (Human erythromyeloblastoid leukemia cell line), U937 (Human leukemic monocyte lymphoma cell line) and THP-1 (Human acute monocytic leukemia cell line). From Figure 10, PCPP similarly penetrated cells of monocytic origins. Thus, these results indicate that PCPP can enter DC-like or monocytic cells, which are known to be refractory to transfection or delivery of biologies.
[00198] PCPP accumulates within the cells at a dose-dependent manner: Different concentrations of PCPP (5, 25, 50 or 100 μΜ) (Figure 11) accumulated within the BH cells depending on the concentration used. At 100 μΜ, intense peri-nuclear accumulation of PCPP was observed, thus demonstrating that higher concentrations of PCPP facilitated the accumulation of PCPP within the cells.
[00199] PCPP is an siRNA deliveiy tool: The cell penetrating and low cellular toxicity properties of PCPP rendered it as an attractive candidate for use in delivering biological molecules into cell. To exploit this potential, AF555-labelled siRNA was co- incubated with either PCPP (Figure 12A) or Lipofectamine 2000 (Figure 12B) and transferred into BHK cells. In principle, the strong positive charge will facilitate binding between the peptides and the negatively charged siRNA. As demonstrated in Figure 12A, PCPP can successfully mediate the transfer of siRNA into the living cells with no visible toxicity. The efficiency of transfection was relatively similar to that of the transfection of siRNA using liposome-based method (Lipofectamine 2000). Background fluorescence and surface adherence of siRNA were greatly eliminated by Benzonase/RNase A treatment (Figure 12C). To ensure the cell morphology was not altered by the treatment, DIC images were acquired and superimposed with the fluorescence images (Figure 12D, 12E, 12F). The DIC images indicated that the CPP-mediated delivery of siRNA did not alter the cell morphology, which further supported that CPP is a low cytotoxic delivery agent. In addition, there was a distinct difference in the distribution of siRNA in the PCPP and Lipofectamine methods. The PCPP method displayed siRNA in a vesicular and punctuated in the cells whereas the siRNA transfected using Lipofectamine 2000 formed aggregates inside the cells. Live cell imaging of BHK cells transfected with AF555-conjugated siRNA with and without PCPP (Figure 12G and 12H) was also conducted. This study demonstrated that PCPP can mediate entry of siRNA into living cells.
[00200] PCPP can deliver proteins into cells: The delivery property of PCPP can be further harnessed by co-incubation with protein molecules such as streptavidin- conjugated fluoronanogold (~50kDa) and fluorescent-labelled antibody (~250kDa). As depicted in Figure 14, PCPP can mediate entry of streptavidin (Figure 14B) and antibody molecules (Figure 14D) into the BHK cells albeit the entry efficiency of antibody is slower than streptavidin. Without being limited to any particular, theory, this may be due to molecular size or aggregation of antibodies. These experiments demonstrated that PCPP possesses intrinsic ability to bind and transfer proteins across cellular membranes. Control experiments conducted in the absence of PCPP were conducted (Figure 14 A and 14C).
[00201] PCPP as a bioimaging tool: The course of studying PCPP unravelled the potential of using PCPP for visualizing trafficking pathways in a cellular environment and this potential was demonstrated in live imaging experiments captured on video. It was especially surprising to observe cellular locomotion in different velocities as tracked by resonant scanning of PCPP movement. Imaging of the locomotion of PCPP at the cell nucleus and periphery detected different movements of PCPP at different velocities. A slower speed for PCPP was observed around the nucleus as compared to the speed of PCPP travelling at the peripheral regions of the cell. Another amazing finding is the manipulation of actin ruffles for PCPP entry, a function that is yet to be known in cell- penetrating peptides. Bioimaging of PCPP movement in BHK cells expressing actin-RFP demonstrated that PCPP movement is observed in close association with the actin network. The unique function of PCPP exhibiting vesicles in different locomotion and velocities is tantalizing in cellular imaging as one can observe the whole cellular trafficking process in a multiple-directional process. This property can be further enhanced when combined with fluorescent proteins targeting organelles or cellular proteins (e.g. actin). Furthermore, PCPP can be easily utilized as a cellular marker for trafficking during screening for drugs that induce abnormalities in cellular transport.
[00202] PCPP is an antiviral peptide: Several studies have previously reported the antimicrobial activity of CPPs (Nekhotiaeva et ai, 2003). To address if PCPP possesses similar bioactivity against pathogens, the PRNT assay was performed using WNV and DEN2. Two experimental designs were carried out. First experiment evaluated the effect of the PCPP on the entry of the virus by co-incubating the peptide with the virus before introduction to BHK cells. Second experiment aims to assess the antiviral effect of PCPP on virus replication by pretreating the cells with PCPP before the introduction of virus. As shown in Figure 15, in virus entry assessment, both PCPP and R9 (nona-arginine) [50 μΜ and 100 μΜ] reduced virus plaque formation greater than 90 % when compare to the untreated virus-infected sample (positive control) and sample treated with another prM- derived peptide (Petri). This signified that PCPP has strong inhibitory effect on virus entry. In comparison, pretreatment of cells with PCPP exhibited a lower inhibitory effect by reducing 65 % of the plaques formed. Similar plaque reduction effect was also observed in R9-treated cells (60 %). Nonetheless, these experiments revealed that PCPP possesses antiviral activity against WNV and DEN2.
[00203] PCPP inhibits WNV and DEN2 through directing binding to the Flavivirus virions: Binding of PCPP to virions is demonstrated by transmission electron microscopy of immunogold-labeled PCPP and and virus-infected cells (Figure 16).
[00204] PCPP is an inhibitor of Flavivirus NS3 protease: The WNV NS3 protease was used as a surrogate marker for Flavivirus protease activity (DEN2 NS3 protease is not commercially available). As depicted in Figure 17, PCPP inhibited WNV protease activity in a dose-dependent manner while Petri had no significant inhibitory activity. Both R9 and PCPP have similar IC50 values of about 5μΜ, however PCPP exhibited stronger suppressive activity against NS3 protease activity at higher doses (10μΜ and 25μΜ) than R9.
[00205] Co-localization of NS3 protease and PCPP: Confocal microscopy
(Figure 18) shows that NS3 protease of Dengue 2 virus (DEN2) and West Nile virus (WNV) co-localized in infected BH cells. This co-localization of NS3 protease and PCPP provides further support that PCPP can exert its inhibitory action against Flavivirus protease function.
[00206] Post-treatment of infected cells using PCPP reduced virus infectivity:
Flow cytometry analysis of DEN2- and WNV-infected BHK cells treated with different concentration of PCPP (25, 50 or 100 μΜ) revealed that the level of Flavivirus infectivity was reduced in a dose-dependent manner (Figure 19). Thus, PCPP retains its antiviral action against DEN2 and WNV even when used after infection.
[00207] To further investigate if the antiviral activity of PCPP is active against other related viruses, the entry inhibition study was performed using DEN2 virus as a candidate. As demonstrated in Figure 15, PCPP can also block DEN2 entry into BHK cells. This indicated that the antiviral properties of PCPP can be extended towards other Flaviviruses or other viruses recognised by PCPP.
[00208] PCPP is an antibacterial peptide: To investigate antibacterial activity, a preliminary disk diffusion test using gram negative ampicillin-resistant strain of E.coli was performed. The test indicated that PCPP has antibacterial activity towards the organism at 50 μΜ concentration (Figure 20).
[00209] Discussion
[00210] In this study PCPP was observed to be a cell penetrating peptide that can permeate BHK cell efficiently within 30 mins. The entry process is a reminiscent of a vesicular-endocytic pathway whereby the PCPP travelled across the membrane in vesicles and gravitated towards the nucleus. In comparison, surface entry of PCPP was gradual and first initiated at few spots on the plasma membrane before a more rapid uptake of the PCPP was observed across the entire membrane. The fast movement of PCPP across the membrane suggested the possible involvement of lateral movement in the membrane. Furthermore, FRAP experiments also showed that the PCPP is active and can travel into a new area within 2 mins. In most cells and at low. concentration (10 μΜ or less), PCPP tends to accentuate around the nucleus. 3D volume rendering analysis of cell images indicated at least some PCPPs transversed across the nuclear boundary and nestled among the nuclear grooves. Such behaviour was not unexpected as nuclear localization of various CPPs has been reported (Melikov and Chernomordik, 2005). Moreover, the entry of PCPP in K562 cells was also detected in this study.
[00211] The cell penetrating ability of PCPP is not cell type-specific. It showed the unique capability to enter various types of cells such as mammalian and insect cells without inducing cell death. These are desirable traits of PCPP which can be manipulated for delivery of biological cargoes into cells. Indeed, as demonstrated by this study, PCPP was capable of mediating the transfer of siRNA and proteins across the cellular membrane, highlighting its translational potential as a cellular delivery agent. [00212] Bioimaging studies of PCPP indicated that trafficking of PCPP adopted different cellular locomotion at different velocities. Although it remains debatable as to the specific pathway that CPPs utilise for cell entry, it is generally accepted that several mechanisms are probably implicated at the same time in different cells. Results from this study suggested that the actin ruffles may also play a role in CPP entry.
[00213] Another interesting aspect of this study is the unearthing of the intrinsic antimicrobial activity of PCPP. PRNT studies clearly indicated that the peptide has inhibitory impact on both virus entry and replication. Although the mechanism that underlies the antiviral property of PCPP is still unknown, it provides the prospect of creating a novel antiviral biomolecule against WNV or other Flavivirus infection
Currently, no antiviral agent has yet to be approved for treatment of Flavivirus infection. Since the PCPP can also bind to siRNA, it is promising to conjugate antiviral siRNA with PCPP to achieve a delivery agent that can exert dual antiviral effects.
[00214] EXAMPLE 2
[00215] Methods
[00216] Quantitative analysis of cellular cytotoxicity of PCPP using flow cytometry: BHK cells were incubated with 100 μΜ of control alanine rich peptide (Petri) or R9 or PCPP for 24 hr. The cells were then stained with propidium iodide (PI) (1 : 1000, 5mg/ml, Invitrogen) for 15 min before the cells were washed with PBS thrice. The cells were trypsinized, washed, suspended in PBS and measured immediately by flow cytometry (CyanADP LX538R, Beckman Coulter). In each case, the fluorescence of 50,000 viable cells was acquired. Viable cells were gated based on sideward and forward scatter. Dead cells were excluded by PI staining.
[00217] Evaluation of uptake of PCPP: BHK, K562, U937 or THP-1 cells were incubated with 5, 25, 50 or 100 μΜ of FITC-PCPP at 37°C for 30 min. The images of the live cells were acquired at 100X immediately after incubation using an AlRsi confocal microscope (Nikon) and NIS Elements software (Nikon).
[00218] Delivery of GADPH siRNA using PCPP: Different PCPP concentrations (25 μΜ, 50 μΜ, 75 μΜ and 100 μΜ) were used to deliver 100 nM of human GADPH siRNA (Dharmacon) into HeLa cells. Dharmafectl trasnfection reagent (Dharmacon) was used as a positive control. The peptide was co-incubated with the siRNA in 100 μΐ of Optimem medium (Invitrogen) at room temperature for 30 min. The mixture was transferred to the cells (six-well format) containing 400 μΐ of Optimem medium.
Transfection using Dharmafectl was performed as per manufacturer's instructions. The cells were kept at 37 °C for 4 hr before addition of DMEM containing 10 % fetal bovine serum (Sigma). At 72 hr post- transfection, cell lysates were harvested using M-Lysis buffer (Peirce Bioscience) containing protease inhibitor cocktail (Roche). The proteins separated by SDS-PAGE were transferred onto polyvinylidene fluoride (PVDF) iblot membranes (Invitrogen). Transfer was carried out using iblot dry blotting system
(Invitrogen) for 7 min. After transfer, each membrane was treated with 5 % skim milk blocking buffer (Anlene) for 1 hr at RT. The membrane was then incubated with anti- GADPH rabbit antibody (1 :1000, Peirce Biotechnology) and incubated overnight at 4 °C. Membranes were washed thrice with TBST buffer for 5 min each and were subsequently incubated at room temperature for 2 hr with goat anti-mouse or anti-rabbit horseradish peroxidase (HRP)-conjugated secondary antibodies (Pierce Biotechnology) (1 :5000). Following this, the membranes were washed in TBST buffer again for three times before immersion in enhanced chemiluminescent Supersignal West Dura Substrate working solution (Pierce Biotechnology) for 5 min. Membranes were then exposed to film (Pierce Biotechnology) for 5 min and developed by Medical X-Ray Processor 102 (Kodak, USA). For loading control, the blots above were stripped using stripping buffer (Pierce Biotechnology, USA) and reprobed using anti-actin monoclonal antibody (Millipore, USA) (1 : 1000).
[00219] Co-localization study ofFlavivirus NS3 protease and PCPP: The BHK cells were infected with WNV and DEN2 at MOI of 1 and treated with 5 μΜ of FITC- PCPP at 18 hr and 24 hr post-infection, respectively. The samples were fixed and stained for NS3 protein using anti-NS3 rabbit antibody (produced by Sigma) and anti-rabbit AlexaFluor-594 goat antibody (Invitrogen). The cell nuclei were then stained with DAPI (Invitrogen) and the images were acquired at 100X using AlRsi confocal microscope (Nikon). [00220] Flow cytometry analysis: For determination of the effect of post-treatment of PCPP on virus infection, BHK cells were infected with WNV and DEN2 at MOI of 1 and 25, 50 or 100 μΜ of PCPP were added at 4 hr post- infection. The samples were fixed at 18 hr or 24 hr using 4% paraformaldehyde (Sigma) with 0.02 % Triton-X (Sigma). The virus envelope (E) protein was detected using anti-E monoclonal antibody (4G2, Millipore) and anti-mouse AlexaFluor-488 goat antibody (Invitrogen). In each case, the fluorescence of 25,000 events was analyzed.
[00221] Results
[00222] PCPP accumulates within the cells at a dose-dependent manner:
Different concentrations of PCPP (5, 25, 50 or 100 μΜ) (Figure 11) accumulated within the BHK cells depending on the concentration used. At 100 μΜ, intense peri-nuclear accumulation of PCPP was observed, thus demonstrating that higher concentrations of PCPP facilitated the accumulation of PCPP within the cells.
[00223] Knock-down of human GADPH using PCPP: siRNA delivery using different concentrations of PCPP indicated that PCPP can deliver and mediate gene knock-down of GADPH in HeLa cells. Compared to Dharmafectl (Lane 6, Figure 13), delivery of siRNA using 75 μΜ of PCPP is superior in terms of gene knock-down efficiency (Lane 4, Figure 13). Thus, in this experiment, PCPP was seen to be more effective than commercial siRNA transfection reagent in knocking down gene expression.
[00224] Discussion
[00225] PCPP is a non-cytotoxic peptide that can penetrate dendritic-like or monocytic cells: This function highlights the potential to be used as a delivery agent for cells of haemopoeitic origin, which are widely known to be susceptible to lipid-based delivery and refractory to transfection.
[00226] PCPP is superior to commercial transfection reagent in siRNA delivery :
The gene knock-down experiment showed that PCPP induced greater efficiency of gene knock-down compared to commercial siRNA reagent, Dharmafect. This further indicates that PCPP has the potential to be developed into an siRNA delivery platform.
[00227] PCPP is a novel antiviral cell penetrating peptide against Flaviviruses: These experiments provide further support to show that antiviral properties of PCPP can exert protective effect on cells after exposure to DEN2 and WNV infections. The ability of PCPP to inhibit NS3 protease is further supported by its ability to locate NS3 protease inside infected cells.
[00228] All publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention.
[00229] Concentrations given in this specification, when given in terms of percentages, include weight/weight (w/w), weight/volume (w/v) and volume/volume (v/v) percentages.
[00230] As used in this specification and the appended claims, the singular forms "a", "an" and "the" include plural reference unless the context clearly dictates otherwise. As used in this specification and the appended claims, the terms "comprise",
"comprising", "comprises" and other forms of these terms are intended in the non- limiting inclusive sense, that is, to include particular recited elements or components without excluding any other element or component. As used in this specification and the appended claims, all ranges or lists as given are intended to convey any intermediate value or range or any sublist contained therein. Unless defined otherwise all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs.
[00231] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it is readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.
References
Alves, I.D., Goasdoue, N., Correia, I., Aubry, S., Galanth, C, Sagan, S., Lavielle, S. & Chassaiag, G. (2008). Membrane interaction and perturbation
mechanisms induced by two cationic cell penetrating peptides with distinct charge distribution. Biochim Biophys Acta 1780, 948-959.
Derossi, I)., Joliot, A.H., Chassaing, G. & Prochiantz, A. (1994). The third helix of the Antennapedia homeodomain translocates through biological membranes. J Biol Chem. 269, 10444- 10450.
Buchardt, F., Fotin-Mleczek, M., Scfawarz, H., Fischer, R. & Brock, R.
(2007). A comprehensive model for the cellular uptake of cationic cell-penetrating peptides. Traffic 8, 848-866.
Elliott, G. & O'Hare, P. (1998). Herpes simplex virus type 1 tegument protein VP22 induces the stabilization and hyperacetylation of microtubules. J Virol 72, 6448- 6455.
Elsfauber, S., Allison, S.L., Heinz, F.X. & Mandl, C.W. (2003). Cleavage of protein prM is necessary for infection of BHK-21 cells by tick-borne encephalitis virus. J Gen Virol 84, 183-191.
Fonseca, S.B., Pereira, M.P. & Kelley, S.O. (2009). Recent advances in the use of cell-penetrating peptides for medical and biological applications. Adv Drug Deliv Rev doi: 10.1016/j.addr.2009.06.001
Futaki, S., Suzuki, T., Ohashi, W., Yagami, T., Tanaka, S., Ueda, K. & Sugiura, Y. (2001). Arginine-rich peptides. An abundant source of membrane-permeable peptides having potential as carriers for intracellular protein delivery. J Biol Chem 276, 5836-5840.
Futaki, S., Nakase, I., Tadokoro, A., Takeuchi, T. & Jones, A.T. (2007).
Arginine-rich peptides and their internalization mechanisms. Biochem Soc Trans 35, 784- 787.
Gallazzi, F., Wang, Y., Jia, F., Shenoy, N., Landon, L.A., H aim ink, M.,
Lever, S.Z. & Lewis, M.R. (2003). Synthesis of radiometal-labeled and fluorescent cell- permeating peptide-PNA conjugates for targeting the bcl-2 proto-oncogene. Bioconjug Chem 14, 1083-1095. Hallenberger, S., Bosch, V., Angliker, H., Shaw, E., Klenk, H.D. & Garten,
W. (1992). Inhibition of furin-mediated cleavage activation of HIV- 1 glycoprotein gpl60. Nature 360, 358-361.
Heckl, S., Pipkorn, R., Waldeck, W., Spring, H., Jenne, J., von der Lieth, C.W., Corban-Wilhelm, H., Debus, J. & Braun, K. (2003). Intracellular visualization of prostate cancer using magnetic resonance imaging.Cancer Res 63, 4766-4772.
Heitz, .F, Morris, M.C. & Divita, G. (2009). Twenty years of cell-penetrating peptides: from molecular mechanisms to therapeutics. Br J Pharmacol 157, 195-206.
Jones, A.T. (2008). Gateways and tools for drug delivery: endocytic pathways and the cellular dynamics of cell penetrating peptides. Int J Pharm 354, 34-38.
Kersemans, V., ersemans, K. & Cornelissen, B.(2008). Cell penetrating peptides for in vivo molecular imaging applications. Curr Pharm Des 14, 2415-2447.
Langedijk, J.P. (2002). Translocation activity of C-terminal domain of pestivirus Erns and ribotoxin L3 loop. J Biol Chem 277, 5308-5314.
Maxwell, D., Chang, Q., Zhang, X., Barnett, E.M. & Piwnica- Worms, D. (2009). An improved cell-penetrating, caspase-activatable, near-infrared fluorescent peptide for apoptosis imaging. Bioconjug Chem. 20, 702-709.
Melikov, K. & Chernomordik, L.V. (2005). Arginine-rich cell penetrating peptides: from endosomal uptake to nuclear delivery. Cell Mol Life Sci 62, 2739-2749.
Mitchell, D.J., Kim, D.T., Steinman, L., Fathman, C.G. & Rothbard, J.B. (2000). Polyarginine enters cells more efficiently than other polycationic homopolymers. J Pept Res 56,318-325.
Morris, M.C, Deshayes, S., Heitz, F. & Divita, G. (2008). Cell-penetrating peptides: from molecular mechanisms to therapeutics. Biol Cell 100, 201-217.
Mufioz, A., Lopez-Garcia, B. & Marcos, J.F. (2006). Studies on the mode of action of the antifungal hexapeptide PAF26. Antimicrob Agents Chemother 50, 3847- 3855.
Nakase, I., Takeuchi, T., Tanaka, G. & Futaki, S. (2008). Methodological and cellular aspects that govern the internalization mechanisms of arginine-rich cell- penetrating peptides. Adv Drug Deliv Rev 60, 598-607.
Nekhotiaeva, N., Elmquist, A., Rajarao, G.K., Hallbrink, M., Langel, U. & Good, L. (2004). Cell entry and antimicrobial properties of eukaryotic cell-penetrating peptides. FASEB J 18, 394-396.' Roisin, A., Robin, J.P., Dereuddre-Bosquet, N., Vitte, A.L., Dormont, D., Clayette, P. & Jalinot,P. (2003). Inhibition of HIV- 1 replication by cell-penetrating peptides binding Rev. J Biol Chem 279, 9208-9214.
Stadler, K., Allison, S.L., Schalich, J. & Heinz, F.X. (1997). Proteolytic activation of tick-borne encephalitis virus by furin. J Virol 71, 8475-8481.
Su, Y., Dofaerty, T., Waring, A.J., Ruchala, P. & Hong, M. (2009). Roles of arginine and lysine residues in the translocation of a cell-penetrating peptide from (13)C, (31)P, and (19)F solid-state NMR. Biochemistry 48, 4587-4595.
Tan, T.T., Bfauvanakantham, R., Li, J., Howe, J. & Ng, MX. (2009). Tyrosine 78 of premembrane protein is essential for assembly of West Nile virus. J Gen Virol 90, 1081-1092.
Veldhoen, S., Laufer, S.D. & Restle, T. (2008). Recent developments in
Peptide-based nucleic Acid delivery. Int J Mol Sci 9, 1276-1320.
Vives, E., Brodin, P. & Lebleti, B. (1997). A truncated HIV-1 Tat protein basic domain rapidly translocates through the plasma membrane and accumulates in the cell nucleus. J Biol Chem 272, 16010-16017.
Zhu, W.L. & Shin, S.Y. (2009). Antimicrobial and cytolytic activities and plausible mode of bactericidal action of the cell penetrating peptide penetratin and its lys- linked two-stranded peptide. Chem Biol Drug Des. 73, 209-215.

Claims

WHAT IS CLAIMED IS:
1. A cell penetrating peptide consisting essentially of or consisting of the amino acid sequence X^YGX^XsXeX^sXgXioXiiRXnXnR [SEQ ID NO: 1] wherein:
Xi, X2 , X3; X5; X6j X7j X8j Xg X10; Xi t X12 and X13> are each any amino acid; X4 is cysteine or is absent; and X7 is any amino acid or is absent.
2. The cell penetrating peptide of claim 1 wherein: Xi is an amino acid with a nonpolar side chain;
X2 is arginine, glutamine, asparagine, threonine, methionine or glutamic acid;
X3 is an amino acid with a positively-charged polar side chain or an amino acid with an uncharged polar side chain;
X4 is cysteine or is absent;
X5 is histidine, an amino acid with an uncharged polar side chain or an amino acid with a nonpolar side chain;
X6 is an amino acid with an uncharged polar side chain or an amino acid with a positively charged side chain;
X7 is histidine, an amino acid with a non-polar side chain or an amino acid with an uncharged polar side chain, or is absent;
X8 is arginine, glycine or glutamine; X9 is an amino acid with an electrically charged polar side chain;
Xio is serine or glycine or an amino acid with a positively-charged polar side chain;
Xn is an amino acid with a positively-charged polar side chain or an amino acid with an uncharged polar side chain;
X12 is histidine, an amino acid with an uncharged polar side chain or an amino acid with a negatively-charged polar side chain; and
Xi3 is an amino acid with a positively-charged polar side chain.
3. The cell penetrating peptide of claim 1 or claim 2 wherein the cell penetrating peptide consists of seventeen amino acids, up to eighteen amino acids, up to nineteen amino acids, up to twenty amino acids, up to twenty-one amino acids, up to twenty-two amino acids, up to twenty-three amino acids, up to twenty-four amino acids, up to twenty-five amino acids, up to twenty-six amino acids, up to twenty-seven amino acids, up to twenty-eight amino acids, up to twenty nine amino acids, up to thirty amino acids, up to thirty-one amino acids, up to thirty-two amino acids, up to thirty-seven amino acids, up to forty-two amino acids, up to forty-seven amino acids, up to fifty-seven amino acids, up to sixty-seven amino acids, up to seventy-seven amino acids, up to eighty-seven amino acids, up to ninety-seven amino acids, up to one hundred and seven amino acids, up to one hundred and seventeen amino acids, up to two hundred and seventeen amino acids, up to two hundred and sixty-seven amino acids or up to five hundred and seventeen amino acids.
4. The cell penetrating peptide of any one of claims 1 to 3 consisting essentially of or consisting of an amino acid sequence of amino acids 76 to 92 of a Flavivirus premembrane protein.
5. The cell penetrating peptide of claim 4 wherein the Flavivirus is West Nile Virus, Japanese Encephalitis Virus, Murray Valley Encephalitis Virus, Dengue Virus, Tick Borne Encephalitis Virus or Langat Virus.
6. The cell penetrating peptide of claim 4 or claim 5 wherein the Flavivirus is West Nile Virus, Japanese Encephalitis Virus or Murray Valley Encephalitis Virus.
7. The cell penetrating peptide of any one of claims 4 to 6 wherein the Flavivirus is West Nile Virus.
8. The cell penetrating peptide of any one of claims 1 to 7 wherein the peptide consists essentially of or consists of a sequence set forth in any one of SEQ ID NOS: 2 to 13. .
9. The cell penetrating peptide of any one of claims 1 to 8 wherein the peptide consists essentially of or consists of a sequence set forth in any one of SEQ ID NOS: 2 to 7.
10. The cell penetrating peptide of any one of claims 1 to 9 wherein the peptide consists essentially of or consists of the sequence set forth in SEQ ID NOS: 2 to 5.
11. The cell penetrating peptide of any one of claims 1 to 7 wherein the peptide consists essentially of or consists of a sequence that shares at least 40 % sequence identity with a sequence set forth in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13.
12. The cell penetrating peptide of any one claims 1 to 11 wherein the peptide consists essentially of or consists of an amino acid sequence comprising the amino acid sequence CG added to beginning of the amino acid sequence
X1X2YGX3X4X5X6X7X8X9XioXi iRXi2Xi3R [SEQ ID NO: 1] and the amino acid sequence GC added to the end of the amino acid sequence
X1X2YGX3X4X5X6X7X8X9XioXi iRXi2Xi3R [SEQ ID NO: 1].
13. The cell penetrating peptide of claim 12 wherein the cell penetrating peptide consists essentially of or consists of a sequence set forth in SEQ ID NO: 14 or SEQ ID NO: 15.
A cell penetrating peptide consisting essentially of or consisting of a fragment of the cell penetrating peptide of any one of claims 1 to 13, the fragment consisting of at least eight amino acids.
15. The cell penetrating peptide of claim 14 wherein the cell penetrating peptide - consists essentially of or consists of the sequence set forth in SEQ ID NO: 16.
16. A peptide/agent complex formed by complexing a peptide comprising an amino acid sequence of the cell penetrating peptide of any one of claims 1 to 15 with an agent.
17. A method for delivering an agent into a cell, the method comprising contacting the cell with the peptide/agent complex of claim 16 so that the peptide/agent complex penetrates the cell.
18. The peptide/agent complex or method of claim 16 or claim 17 wherein the agent is an siRNA molecule, a microRNA molecule or an shRNA molecule.
19. The peptide/agent complex or method of claim 16 or claim 17 wherein the agent is a protein.
20. The peptide/agent complex or method of claim 16 or 17 wherein the agent is a small molecule drug.
21. The peptide/agent complex or method of claim 16 or 17 wherein the agent is an anti- cancer drug.
22. A method for visualizing a cellular trafficking pathway, the method comprising: i. coupling a peptide comprising an amino acid sequence of the cell penetrating peptide of any one of claims 1 to 15 with a visually detectable label to form a labelled peptide; ii. contacting a cell with the labelled peptide; iii. detecting the labelled peptide.
23. A method for delivering an antimicrobial agent to a cell, the method comprising contacting a peptide comprising an amino acid sequence of the cell penetrating peptide of any one of claims 1 to 15 with the cell.
24. The method of claim 23 comprising administering an effective amount of the peptide for the treatment of a microbial infection or a disease or disorder caused or characterized by a microbial infection.
25. The method of claim 23 or claim 24 wherein the antimicrobial agent is an antiviral agent, an antibacterial agent, an antifungal agent or an antiparasitic agent.
26. The method of any one of claims 17 to 25 wherein the cell is in vitro.
27. The method of any one of claims 17 to 25 wherein the cell is in vivo.
28. Use of a peptide comprising an amino acid sequence of the cell penetrating peptide of any one of claims 1 to 15 for delivering an agent into a cell.
29. Use of a peptide comprising an amino acid sequence of the cell penetrating peptide of any one of claims 1 to 15 in the manufacture of a medicament for delivering an agent into a cell.
30. A peptide comprising an amino acid sequence of the cell penetrating peptide of any one of claims 1 to 15 for delivering an agent into a cell.
31. The use or peptide of any one of claims 28 to 30 wherein the agent is an siRNA molecule, a microRNA molecule or an shRNA molecule.
32. The use or peptide of any of claims 28 to 30 wherein the agent is a protein.
33. The use or peptide of any one of claims 28 to 30 wherein the agent is a small molecule drug.
34. The use or peptide of any one of claims 28 to 30 wherein the agent is an anticancer drug.
35. The use or peptide of any one of claims 28 to 34 wherein the cell is in vitro.
36. The use or peptide of any one of claims 28 to 34 wherein the cell is in vivo.
37. Use of a peptide comprising an amino acid sequence of the cell penetrating peptide of any one of claims 1 to 15 as a bioimaging agent for visualizing a cellular trafficking pathway.
38. A peptide comprising an amino acid sequence of the cell penetrating peptide of any one of claims 1 to 15 for use as a bioimaging agent for visualizing a cellular trafficking pathway.
39. Use of a peptide comprising an amino acid sequence of the cell penetrating peptide of any one of claims 1 to 15 as an antimicrobial agent.
40. Use of a peptide comprising an amino acid sequence of the cell penetrating peptide of any one of claims 1 to 15 in the manufacture of a medicament for use as an antimicrobial agent.
41. A peptide comprising an amino acid sequence of the cell penetrating peptide of any one of claims 1 to 15 for use as an antimicrobial agent.
42. The use or peptide of any one of claims 39 to 41 in an amount effective for the treatment of a microbial infection or a disease or disorder caused or characterized by a microbial infection.
43. The use or peptide of any one of claims 39 to 42 wherein the antimicrobial agent is an antiviral agent, an antibacterial agent, an antifungal agent or an antiparasite agent.
44. A nucleic acid molecule encoding the cell penetrating peptide of any one of claims 1 to 15.
PCT/SG2011/000155 2010-04-20 2011-04-20 Cell penetrating peptide derived from the premembrane protein of flavivirus WO2011133112A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US32611910P 2010-04-20 2010-04-20
US61/326,119 2010-04-20

Publications (1)

Publication Number Publication Date
WO2011133112A1 true WO2011133112A1 (en) 2011-10-27

Family

ID=44834391

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SG2011/000155 WO2011133112A1 (en) 2010-04-20 2011-04-20 Cell penetrating peptide derived from the premembrane protein of flavivirus

Country Status (1)

Country Link
WO (1) WO2011133112A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106831957A (en) * 2017-04-17 2017-06-13 扬州大学 A kind of application for coming from the polypeptides of CAV VP1 aa 1 19 as high efficiency cell cell-penetrating peptide
CN106995487A (en) * 2017-04-17 2017-08-01 扬州大学 The polypeptides of CAV VP1 aa 23 43 are come from as the application of high efficiency cell cell-penetrating peptide
WO2021178350A1 (en) * 2020-03-03 2021-09-10 Innate Immunity LLC Antiviral chimeric peptides

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6383488B1 (en) * 1997-01-15 2002-05-07 Centro De Ingeniera Genetic Y Biotechnologies (Cigb) Pre-M/M epitopes of dengue virus, synthetic peptides, chimeric proteins and their use
WO2009024534A2 (en) * 2007-08-17 2009-02-26 Intercell Ag Japanese encephalitis virus (jev) and tick-borne encephalitis virus (tbev) peptides stimulating human t cell responses
WO2009069935A2 (en) * 2007-11-26 2009-06-04 Forhumantech Co. Ltd. Pharmaceutical compositions and methods for delivering nucleic acids into cells
EP2085098A2 (en) * 2006-10-30 2009-08-05 Centro De Ingenieria Genetica Y Biotecnologia Peptide chimeric molecules having antiviral properties against viruses of the flaviviridae family

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6383488B1 (en) * 1997-01-15 2002-05-07 Centro De Ingeniera Genetic Y Biotechnologies (Cigb) Pre-M/M epitopes of dengue virus, synthetic peptides, chimeric proteins and their use
EP2085098A2 (en) * 2006-10-30 2009-08-05 Centro De Ingenieria Genetica Y Biotecnologia Peptide chimeric molecules having antiviral properties against viruses of the flaviviridae family
WO2009024534A2 (en) * 2007-08-17 2009-02-26 Intercell Ag Japanese encephalitis virus (jev) and tick-borne encephalitis virus (tbev) peptides stimulating human t cell responses
WO2009069935A2 (en) * 2007-11-26 2009-06-04 Forhumantech Co. Ltd. Pharmaceutical compositions and methods for delivering nucleic acids into cells

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
FONSECA, S.B. ET AL.: "Recent advances in the use of cell-penetrating peptides for medical and biological applications", ADVANCED DRUG DELIVERY REVIEWS, vol. 61, 2009, pages 953 - 964 *
KERSEMANS, V. ET AL.: "Cell Penetrating Peptides forIn Vivo Molecular Imaging Applications", CURRENT PHARMACEUTICAL DESIGN, vol. 14, 2008, pages 2415 - 2427 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106831957A (en) * 2017-04-17 2017-06-13 扬州大学 A kind of application for coming from the polypeptides of CAV VP1 aa 1 19 as high efficiency cell cell-penetrating peptide
CN106995487A (en) * 2017-04-17 2017-08-01 扬州大学 The polypeptides of CAV VP1 aa 23 43 are come from as the application of high efficiency cell cell-penetrating peptide
CN106831957B (en) * 2017-04-17 2019-12-03 扬州大学 A kind of application derived from Chicken Infectious Anemia Virus VP1-aa 1-19 polypeptide as high efficiency cell cell-penetrating peptide
CN106995487B (en) * 2017-04-17 2019-12-03 扬州大学 Application derived from Chicken Infectious Anemia Virus VP1-aa 23-43 polypeptide as high efficiency cell cell-penetrating peptide
WO2021178350A1 (en) * 2020-03-03 2021-09-10 Innate Immunity LLC Antiviral chimeric peptides

Similar Documents

Publication Publication Date Title
US10688194B2 (en) Cell penetrating peptides for intracellular delivery of molecules
US10189876B2 (en) Cell penetrating peptides for intracellular delivery of molecules
EP2928907B1 (en) Cell penetrating peptides for intracellular delivery of molecules
Bahnsen et al. Antimicrobial and cell-penetrating properties of penetratin analogs: effect of sequence and secondary structure
CN105378084B (en) Method and composition for treating cancer
EP2698376B1 (en) Cancer-targeting peptides and uses thereof in cancer therapy
Ezzat et al. Peptide-based matrices as drug delivery vehicles
BRPI0620806B1 (en) A complex and composition comprising a peptide and a charge molecule, and use of said composition
Khemaissa et al. Tryptophan, more than just an interfacial amino acid in the membrane activity of cationic cell-penetrating and antimicrobial peptides
Gori et al. Cell penetrating peptides: classification, mechanisms, methods of study, and applications
WO2011133112A1 (en) Cell penetrating peptide derived from the premembrane protein of flavivirus
Shinga et al. L17ER4: A cell-permeable attenuated cationic amphiphilic lytic peptide
WO2013165262A1 (en) Peptides, constructs and uses therefor
Negi et al. Intrinsic cell permeability of the GAGA zinc finger protein into HeLa cells
Marchione et al. Study on the internalization mechanism of the ZEBRA cell-penetrating peptide
Salehi Amphiphilic Cell-Penetrating Peptides Containing Natural and Unnatural Amino Acids as Drug Delivery Tools and Antimicrobial Agents
CN109311962A (en) The inhibitor of BCL-2 L10/IP3 acceptor interaction
Vale 3.1 Amino Acids and Peptides in Medicine: Old or New Drugs?
Horn Model membrane systems, membrane-active peptides and application possibilities
Cirillo Short cationic peptides for gene delivery into cancer cells
Wu et al. Rational design of a new short anticancer peptide with good potential for cancer treatment
Kelly Delivery of Retinoic Acid Utilizing Cell Penetrating Peptides in Human Neuroblastoma Cells
CA3240978A1 (en) Therapeutical peptidomimetic
Wallbrecher The journey of cell-penetrating peptides into cells-Studies on interactions with components of the plasma membrane and their impact on internalization
KR20140126113A (en) Novel cell penetrating peptide comprising multiple motifs derived from RGD analogs and using thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11772334

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11772334

Country of ref document: EP

Kind code of ref document: A1